Isolation and characterization of target sequences of the chicken CdxA homeobox gene.
Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A
1993-01-01
The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943
APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies
NASA Astrophysics Data System (ADS)
Shlyakhtenko, Luda S.; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S.; Lyubchenko, Yuri L.
2015-10-01
APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA.
APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies.
Shlyakhtenko, Luda S; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S; Lyubchenko, Yuri L
2015-10-27
APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA.
APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies
Shlyakhtenko, Luda S.; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S.; Lyubchenko, Yuri L.
2015-01-01
APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA. PMID:26503602
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava
Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less
DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus
Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...
2014-08-23
Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less
Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A
1995-04-11
SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.
An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.
Lee, C K; Knipe, D M
1985-06-01
An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.
Context influences on TALE–DNA binding revealed by quantitative profiling
Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.
2015-01-01
Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805
Context influences on TALE-DNA binding revealed by quantitative profiling.
Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L
2015-06-11
Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.
Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko
2001-01-01
Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698
Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities
Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi
2005-01-01
Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118
Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.
2014-01-01
The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655
Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.
2003-01-01
Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006
Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H
1994-01-01
We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710
Cong, Le; Zhou, Ruhong; Kuo, Yu-chi; Cunniff, Margaret; Zhang, Feng
2012-01-01
Transcription activator-like effectors (TALE) are sequence-specific DNA binding proteins that harbor modular, repetitive DNA binding domains. TALEs have enabled the creation of customizable designer transcriptional factors and sequence-specific nucleases for genome engineering. Here we report two improvements of the TALE toolbox for achieving efficient activation and repression of endogenous gene expression in mammalian cells. We show that the naturally occurring repeat variable diresidue (RVD) Asn-His (NH) has high biological activity and specificity for guanine, a highly prevalent base in mammalian genomes. We also report an effective TALE transcriptional repressor architecture for targeted inhibition of transcription in mammalian cells. These findings will improve the precision and effectiveness of genome engineering that can be achieved using TALEs. PMID:22828628
p53 Specifically Binds Triplex DNA In Vitro and in Cells
Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej
2016-01-01
Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175
Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian
2015-01-01
The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765
Non-B-Form DNA Is Enriched at Centromeres
Henikoff, Steven
2018-01-01
Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169
Burger, C; Fanning, E
1983-04-15
Large tumor antigen (T antigen) occurs in at least three different oligomeric subclasses in cells infected or transformed by simian virus 40 (SV40): 5-7 S, 14-16 S, and 23-25 S. The 23-25 S form is complexed with a host phosphoprotein (p53). The DNA binding properties of these three subclasses of T antigen from nine different cell lines and free p53 protein were compared using an immunoprecipitation assay. All three subclasses of T antigen bound specifically to SV40 DNA sequences near the origin of replication. However, the DNA binding activity varied between different cell lines over a 40- to 50-fold range. The 23-25 S and 14-16 S forms from most of the cell lines tested bound much less SV40 origin DNA than 5-7 S T antigen. The free p53 phosphoprotein did not bind specifically to any SV40 DNA sequences.
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
Malhotra, Sony; Sowdhamini, Ramanathan
2013-08-01
The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.
Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.
Salter, Jason D; Smith, Harold C
2018-05-23
The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Watada, Hirotaka; Mirmira, Raghavendra G.; Kalamaras, Julie; German, Michael S.
2000-01-01
The developmentally important homeodomain transcription factors of the NK-2 class contain a highly conserved region, the NK2-specific domain (NK2-SD). The function of this domain, however, remains unknown. The primary structure of the NK2-SD suggests that it might function as an accessory DNA-binding domain or as a protein–protein interaction interface. To assess the possibility that the NK2-SD may contribute to DNA-binding specificity, we used a PCR-based approach to identify a consensus DNA-binding sequences for Nkx2.2, an NK-2 family member involved in pancreas and central nervous system development. The consensus sequence (TCTAAGTGAGCTT) is similar to the known binding sequences for other NK-2 homeodomain proteins, but we show that the NK2-SD does not contribute significantly to specific DNA binding to this sequence. To determine whether the NK2-SD contributes to transactivation, we used GAL4-Nkx2.2 fusion constructs to map a powerful transcriptional activation domain in the C-terminal region beyond the conserved NK2-SD. Interestingly, this C-terminal region functions as a transcriptional activator only in the absence of an intact NK2-SD. The NK2-SD also can mask transactivation from the paired homeodomain transcription factor Pax6, but it has no effect on transcription by itself. These results demonstrate that the NK2-SD functions as an intramolecular regulator of the C-terminal activation domain in Nkx2.2 and support a model in which interactions through the NK2-SD regulate the ability of NK-2-class proteins to activate specific genes during development. PMID:10944215
Tackett, Alan J.; Corey, David R.; Raney, Kevin D.
2002-01-01
Peptide nucleic acid (PNA) is a DNA mimic in which the nucleobases are linked by an N-(2-aminoethyl) glycine backbone. Here we report that PNA can interact with single-stranded DNA (ssDNA) in a non-sequence-specific fashion. We observed that a 15mer PNA inhibited the ssDNA-stimulated ATPase activity of a bacteriophage T4 helicase, Dda. Surprisingly, when a fluorescein-labeled 15mer PNA was used in binding studies no interaction was observed between PNA and Dda. However, fluorescence polarization did reveal non-sequence-specific interactions between PNA and ssDNA. Thus, the inhibition of ATPase activity of Dda appears to result from depletion of the available ssDNA due to non-Watson–Crick binding of PNA to ssDNA. Inhibition of the ssDNA-stimulated ATPase activity was observed for several PNAs of varying length and sequence. To study the basis for this phenomenon, we examined self-aggregation by PNAs. The 15mer PNA readily self-aggregates to the point of precipitation. Since PNAs are hydrophobic, they aggregate more than DNA or RNA, making the study of this phenomenon essential for understanding the properties of PNA. Non-sequence-specific interactions between PNA and ssDNA were observed at moderate concentrations of PNA, suggesting that such interactions should be considered for antisense and antigene applications. PMID:11842106
DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats
de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas
2015-01-01
Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. PMID:26481363
Arthur, A K; Höss, A; Fanning, E
1988-01-01
The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505
Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites
Prouse, Michael B.; Campbell, Malcolm M.
2013-01-01
Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471
Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin
2017-08-01
Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.
TFBSshape: a motif database for DNA shape features of transcription factor binding sites.
Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo
2014-01-01
Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.
TFBSshape: a motif database for DNA shape features of transcription factor binding sites
Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo
2014-01-01
Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955
Kamenova, Ivanka; Warfield, Linda
2014-01-01
Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972
Kamenova, Ivanka; Warfield, Linda; Hahn, Steven
2014-08-01
Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Parrilla-Doblas, Jara Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa
2017-01-01
ABSTRACT DNA methylation is a crucial epigenetic mark associated to gene silencing, and its targeted removal is a major goal of epigenetic editing. In animal cells, DNA demethylation involves iterative 5mC oxidation by TET enzymes followed by replication-dependent dilution and/or replication-independent DNA repair of its oxidized derivatives. In contrast, plants use specific DNA glycosylases that directly excise 5mC and initiate its substitution for unmethylated C in a base excision repair process. In this work, we have fused the catalytic domain of Arabidopsis ROS1 5mC DNA glycosylase (ROS1_CD) to the DNA binding domain of yeast GAL4 (GBD). We show that the resultant GBD-ROS1_CD fusion protein binds specifically a GBD-targeted DNA sequence in vitro. We also found that transient in vivo expression of GBD-ROS1_CD in human cells specifically reactivates transcription of a methylation-silenced reporter gene, and that such reactivation requires both ROS1_CD catalytic activity and GBD binding capacity. Finally, we show that reactivation induced by GBD-ROS1_CD is accompanied by decreased methylation levels at several CpG sites of the targeted promoter. All together, these results show that plant 5mC DNA glycosylases can be used for targeted active DNA demethylation in human cells. PMID:28277978
Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.
Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C
2017-03-21
A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.
Selective DNA demethylation by fusion of TDG with a sequence-specific DNA-binding domain
Gregory, David J.; Mikhaylova, Lyudmila; Fedulov, Alexey V.
2012-01-01
Our ability to selectively manipulate gene expression by epigenetic means is limited, as there is no approach for targeted reactivation of epigenetically silenced genes, in contrast to what is available for selective gene silencing. We aimed to develop a tool for selective transcriptional activation by DNA demethylation. Here we present evidence that direct targeting of thymine-DNA-glycosylase (TDG) to specific sequences in the DNA can result in local DNA demethylation at potential regulatory sequences and lead to enhanced gene induction. When TDG was fused to a well-characterized DNA-binding domain [the Rel-homology domain (RHD) of NFκB], we observed decreased DNA methylation and increased transcriptional response to unrelated stimulus of inducible nitric oxide synthase (NOS2). The effect was not seen for control genes lacking either RHD-binding sites or high levels of methylation, nor in control mock-transduced cells. Specific reactivation of epigenetically silenced genes may thus be achievable by this approach, which provides a broadly useful strategy to further our exploration of biological mechanisms and to improve control over the epigenome. PMID:22419066
Specific minor groove solvation is a crucial determinant of DNA binding site recognition
Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.
2014-01-01
The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976
A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.
Álvarez-Martos, Isabel; Ferapontova, Elena E
2017-08-05
A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.
He, Xin; Samee, Md. Abul Hassan; Blatti, Charles; Sinha, Saurabh
2010-01-01
Quantitative models of cis-regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled, or heuristic approximations of the underlying regulatory mechanisms. We have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence, as a function of transcription factor concentrations and their DNA-binding specificities. It uses statistical thermodynamics theory to model not only protein-DNA interaction, but also the effect of DNA-bound activators and repressors on gene expression. In addition, the model incorporates mechanistic features such as synergistic effect of multiple activators, short range repression, and cooperativity in transcription factor-DNA binding, allowing us to systematically evaluate the significance of these features in the context of available expression data. Using this model on segmentation-related enhancers in Drosophila, we find that transcriptional synergy due to simultaneous action of multiple activators helps explain the data beyond what can be explained by cooperative DNA-binding alone. We find clear support for the phenomenon of short-range repression, where repressors do not directly interact with the basal transcriptional machinery. We also find that the binding sites contributing to an enhancer's function may not be conserved during evolution, and a noticeable fraction of these undergo lineage-specific changes. Our implementation of the model, called GEMSTAT, is the first publicly available program for simultaneously modeling the regulatory activities of a given set of sequences. PMID:20862354
DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.
Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani
2018-01-01
Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.
de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas
2014-01-01
The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. PMID:24792163
Bonham, Andrew J.; Wenta, Nikola; Osslund, Leah M.; Prussin, Aaron J.; Vinkemeier, Uwe; Reich, Norbert O.
2013-01-01
The DNA-binding specificity and affinity of the dimeric human transcription factor (TF) STAT1, were assessed by total internal reflectance fluorescence protein-binding microarrays (TIRF-PBM) to evaluate the effects of protein phosphorylation, higher-order polymerization and small-molecule inhibition. Active, phosphorylated STAT1 showed binding preferences consistent with prior characterization, whereas unphosphorylated STAT1 showed a weak-binding preference for one-half of the GAS consensus site, consistent with recent models of STAT1 structure and function in response to phosphorylation. This altered-binding preference was further tested by use of the inhibitor LLL3, which we show to disrupt STAT1 binding in a sequence-dependent fashion. To determine if this sequence-dependence is specific to STAT1 and not a general feature of human TF biology, the TF Myc/Max was analysed and tested with the inhibitor Mycro3. Myc/Max inhibition by Mycro3 is sequence independent, suggesting that the sequence-dependent inhibition of STAT1 may be specific to this system and a useful target for future inhibitor design. PMID:23180800
DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.
de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas
2015-11-16
Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Suhkmann; Zhang, Ziming; Upchurch, Sean
2004-04-16
2 ARID is a homologous family of DNA-binding domains that occur in DNA binding proteins from a wide variety of species, ranging from yeast to nematodes, insects, mammals and plants. SWI1, a member of the SWI/SNF protein complex that is involved in chromatin remodeling during transcription, contains the ARID motif. The ARID domain of human SWI1 (also known as p270) does not select for a specific DNA sequence from a random sequence pool. The lack of sequence specificity shown by the SWI1 ARID domain stands in contrast to the other characterized ARID domains, which recognize specific AT-rich sequences. We havemore » solved the three-dimensional structure of human SWI1 ARID using solution NMR methods. In addition, we have characterized non-specific DNA-binding by the SWI1 ARID domain. Results from this study indicate that a flexible long internal loop in ARID motif is likely to be important for sequence specific DNA-recognition. The structure of human SWI1 ARID domain also represents a distinct structural subfamily. Studies of ARID indicate that boundary of the DNA binding structural and functional domains can extend beyond the sequence homologous region in a homologous family of proteins. Structural studies of homologous domains such as ARID family of DNA-binding domains should provide information to better predict the boundary of structural and functional domains in structural genomic studies. Key Words: ARID, SWI1, NMR, structural genomics, protein-DNA interaction.« less
2017-01-01
Abstract Target search as performed by DNA-binding proteins is a complex process, in which multiple factors contribute to both thermodynamic discrimination of the target sequence from overwhelmingly abundant off-target sites and kinetic acceleration of dynamic sequence interrogation. TRF1, the protein that binds to telomeric tandem repeats, faces an intriguing variant of the search problem where target sites are clustered within short fragments of chromosomal DNA. In this study, we use extensive (>0.5 ms in total) MD simulations to study the dynamical aspects of sequence-specific binding of TRF1 at both telomeric and non-cognate DNA. For the first time, we describe the spontaneous formation of a sequence-specific native protein–DNA complex in atomistic detail, and study the mechanism by which proteins avoid off-target binding while retaining high affinity for target sites. Our calculated free energy landscapes reproduce the thermodynamics of sequence-specific binding, while statistical approaches allow for a comprehensive description of intermediate stages of complex formation. PMID:28633355
Molecular determinants of origin discrimination by Orc1 initiators in archaea.
Dueber, Erin C; Costa, Alessandro; Corn, Jacob E; Bell, Stephen D; Berger, James M
2011-05-01
Unlike bacteria, many eukaryotes initiate DNA replication from genomic sites that lack apparent sequence conservation. These loci are identified and bound by the origin recognition complex (ORC), and subsequently activated by a cascade of events that includes recruitment of an additional factor, Cdc6. Archaeal organisms generally possess one or more Orc1/Cdc6 homologs, belonging to the Initiator clade of ATPases associated with various cellular activities (AAA(+)) superfamily; however, these proteins recognize specific sequences within replication origins. Atomic resolution studies have shown that archaeal Orc1 proteins contact double-stranded DNA through an N-terminal AAA(+) domain and a C-terminal winged-helix domain (WHD), but use remarkably few base-specific contacts. To investigate the biochemical effects of these associations, we mutated the DNA-interacting elements of the Orc1-1 and Orc1-3 paralogs from the archaeon Sulfolobus solfataricus, and tested their effect on origin binding and deformation. We find that the AAA(+) domain has an unpredicted role in controlling the sequence selectivity of DNA binding, despite an absence of base-specific contacts to this region. Our results show that both the WHD and ATPase region influence origin recognition by Orc1/Cdc6, and suggest that not only DNA sequence, but also local DNA structure help define archaeal initiator binding sites. © The Author(s) 2011. Published by Oxford University Press.
Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.
Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A
2018-05-14
The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.
Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B
1989-01-01
The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buchman, A.R.; Kimmerly, W.J.; Rine, J.
1988-01-01
Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less
Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A
1995-01-01
The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717
Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit
2003-01-01
Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563
Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou
2011-01-01
DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738
DNA binding specificity of the basic-helix-loop-helix protein MASH-1.
Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K
1995-09-05
Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.
Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun
1997-01-01
ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063
Zhang, Yun; Liu, Fang; Nie, Jinfang; Jiang, Fuyang; Zhou, Caibin; Yang, Jiani; Fan, Jinlong; Li, Jianping
2014-05-07
In this paper, we report for the first time an electrochemical biosensor for single-step, reagentless, and picomolar detection of a sequence-specific DNA-binding protein using a double-stranded, electrode-bound DNA probe terminally modified with a redox active label close to the electrode surface. This new methodology is based upon local repression of electrolyte diffusion associated with protein-DNA binding that leads to reduction of the electrochemical response of the label. In the proof-of-concept study, the resulting electrochemical biosensor was quantitatively sensitive to the concentrations of the TATA binding protein (TBP, a model analyte) ranging from 40 pM to 25.4 nM with an estimated detection limit of ∼10.6 pM (∼80 to 400-fold improvement on the detection limit over previous electrochemical analytical systems).
de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas
2014-06-01
The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J
2000-12-01
The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.
Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.
Mukherjee, Anirban; Vasquez, Karen M
2011-08-01
Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Characterization of the DNA binding properties of polyomavirus capsid protein
NASA Technical Reports Server (NTRS)
Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)
1993-01-01
The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.
Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori
2013-01-01
The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl+) and the polarized first hydration shell waters of divalent cations (Mg2+, Ca2+) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves. PMID:23940752
Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori
2013-01-01
The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl⁺) and the polarized first hydration shell waters of divalent cations (Mg²⁺, Ca²⁺) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves.
In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.
Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E
2018-01-01
DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benasutti, M.; Ejadi, S.; Whitlow, M.D.
The mutagenic and carcinogenic chemical aflatoxin B/sub 1/ (AFB/sub 1/) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB/sub 1/ oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB/sub 1/ oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB/sub 1/ oxide prefers to react with guanines inmore » some sequence contexts more than in others and has been referred to as sequence specificity of binding. Herein, data on the reaction of AFB/sub 1/ oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determine by high-pressure liquid chromatography. These results reveal that for AFB/sub 1/ oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. Methods are developed to determine the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. These rules in conjunction with molecular modeling studies were used to assess the binding sites that might be utilized by AFB/sub 1/ oxide in its reaction with DNA.« less
Zhao, A; Guo, A; Liu, Z; Pape, L
1997-01-01
The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645
Evers, R; Grummt, I
1995-01-01
Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036
Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.
Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George
2010-04-01
The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.
Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E
2008-09-01
WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.
Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing
Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2016-01-01
Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039
SivaRaman, L; Subramanian, S; Thimmappaya, B
1986-01-01
Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943
DNA sequence templates adjacent nucleosome and ORC sites at gene amplification origins in Drosophila
Liu, Jun; Zimmer, Kurt; Rusch, Douglas B.; Paranjape, Neha; Podicheti, Ram; Tang, Haixu; Calvi, Brian R.
2015-01-01
Eukaryotic origins of DNA replication are bound by the origin recognition complex (ORC), which scaffolds assembly of a pre-replicative complex (pre-RC) that is then activated to initiate replication. Both pre-RC assembly and activation are strongly influenced by developmental changes to the epigenome, but molecular mechanisms remain incompletely defined. We have been examining the activation of origins responsible for developmental gene amplification in Drosophila. At a specific time in oogenesis, somatic follicle cells transition from genomic replication to a locus-specific replication from six amplicon origins. Previous evidence indicated that these amplicon origins are activated by nucleosome acetylation, but how this affects origin chromatin is unknown. Here, we examine nucleosome position in follicle cells using micrococcal nuclease digestion with Ilumina sequencing. The results indicate that ORC binding sites and other essential origin sequences are nucleosome-depleted regions (NDRs). Nucleosome position at the amplicons was highly similar among developmental stages during which ORC is or is not bound, indicating that being an NDR is not sufficient to specify ORC binding. Importantly, the data suggest that nucleosomes and ORC have opposite preferences for DNA sequence and structure. We propose that nucleosome hyperacetylation promotes pre-RC assembly onto adjacent DNA sequences that are disfavored by nucleosomes but favored by ORC. PMID:26227968
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.
Engineering and Application of Zinc Finger Proteins and TALEs for Biomedical Research.
Kim, Moon-Soo; Kini, Anu Ganesh
2017-08-01
Engineered DNA-binding domains provide a powerful technology for numerous biomedical studies due to their ability to recognize specific DNA sequences. Zinc fingers (ZF) are one of the most common DNA-binding domains and have been extensively studied for a variety of applications, such as gene regulation, genome engineering and diagnostics. Another novel DNA-binding domain known as a transcriptional activator-like effector (TALE) has been more recently discovered, which has a previously undescribed DNA-binding mode. Due to their modular architecture and flexibility, TALEs have been rapidly developed into artificial gene targeting reagents. Here, we describe the methods used to design these DNA-binding proteins and their key applications in biomedical research.
2016-01-01
Metal ion cofactors can alter the energetics and specificity of sequence specific protein–DNA interactions, but it is unknown if the underlying effects on structure and dynamics are local or dispersed throughout the protein–DNA complex. This work uses EcoRV endonuclease as a model, and catalytically inactive lanthanide ions, which replace the Mg2+ cofactor. Nuclear magnetic resonance (NMR) titrations indicate that four Lu3+ or two La3+ cations bind, and two new crystal structures confirm that Lu3+ binding is confined to the active sites. NMR spectra show that the metal-free EcoRV complex with cognate (GATATC) DNA is structurally distinct from the nonspecific complex, and that metal ion binding sites are not assembled in the nonspecific complex. NMR chemical shift perturbations were determined for 1H–15N amide resonances, for 1H–13C Ile-δ-CH3 resonances, and for stereospecifically assigned Leu-δ-CH3 and Val-γ-CH3 resonances. Many chemical shifts throughout the cognate complex are unperturbed, so metal binding does not induce major conformational changes. However, some large perturbations of amide and side chain methyl resonances occur as far as 34 Å from the metal ions. Concerted changes in specific residues imply that local effects of metal binding are propagated via a β-sheet and an α-helix. Both amide and methyl resonance perturbations indicate changes in the interface between subunits of the EcoRV homodimer. Bound metal ions also affect amide hydrogen exchange rates for distant residues, including a distant subdomain that contacts DNA phosphates and promotes DNA bending, showing that metal ions in the active sites, which relieve electrostatic repulsion between protein and DNA, cause changes in slow dynamics throughout the complex. PMID:27786446
McCutchen-Maloney, Sandra L.
2002-01-01
Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.
Pastor, N; Pardo, L; Weinstein, H
1997-01-01
The binding of the TATA box-binding protein (TBP) to a TATA sequence in DNA is essential for eukaryotic basal transcription. TBP binds in the minor groove of DNA, causing a large distortion of the DNA helix. Given the apparent stereochemical equivalence of AT and TA basepairs in the minor groove, DNA deformability must play a significant role in binding site selection, because not all AT-rich sequences are bound effectively by TBP. To gain insight into the precise role that the properties of the TATA sequence have in determining the specificity of the DNA substrates of TBP, the solution structure and dynamics of seven DNA dodecamers have been studied by using molecular dynamics simulations. The analysis of the structural properties of basepair steps in these TATA sequences suggests a reason for the preference for alternating pyrimidine-purine (YR) sequences, but indicates that these properties cannot be the sole determinant of the sequence specificity of TBP. Rather, recognition depends on the interplay between the inherent deformability of the DNA and steric complementarity at the molecular interface. Images FIGURE 2 PMID:9251783
Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B
2017-09-01
DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.
Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C
1992-01-01
Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867
Sequence-specific DNA binding Pyrrole-imidazole polyamides and their applications.
Kawamoto, Yusuke; Bando, Toshikazu; Sugiyama, Hiroshi
2018-05-01
Pyrrole-imidazole polyamides (Py-Im polyamides) are cell-permeable compounds that bind to the minor groove of double-stranded DNA in a sequence-specific manner without causing denaturation of the DNA. These compounds can be used to control gene expression and to stain specific sequences in cells. Here, we review the history, structural variations, and functional investigations of Py-Im polyamides. Copyright © 2018 Elsevier Ltd. All rights reserved.
Functional specificity of a Hox protein mediated by the recognition of minor groove structure.
Joshi, Rohit; Passner, Jonathan M; Rohs, Remo; Jain, Rinku; Sosinsky, Alona; Crickmore, Michael A; Jacob, Vinitha; Aggarwal, Aneel K; Honig, Barry; Mann, Richard S
2007-11-02
The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.
Sequence specificity of single-stranded DNA-binding proteins: a novel DNA microarray approach
Morgan, Hugh P.; Estibeiro, Peter; Wear, Martin A.; Max, Klaas E.A.; Heinemann, Udo; Cubeddu, Liza; Gallagher, Maurice P.; Sadler, Peter J.; Walkinshaw, Malcolm D.
2007-01-01
We have developed a novel DNA microarray-based approach for identification of the sequence-specificity of single-stranded nucleic-acid-binding proteins (SNABPs). For verification, we have shown that the major cold shock protein (CspB) from Bacillus subtilis binds with high affinity to pyrimidine-rich sequences, with a binding preference for the consensus sequence, 5′-GTCTTTG/T-3′. The sequence was modelled onto the known structure of CspB and a cytosine-binding pocket was identified, which explains the strong preference for a cytosine base at position 3. This microarray method offers a rapid high-throughput approach for determining the specificity and strength of ss DNA–protein interactions. Further screening of this newly emerging family of transcription factors will help provide an insight into their cellular function. PMID:17488853
Bhat, Abhay Prasad; Shin, Minsang; Choy, Hyon E
2014-07-01
Histone-like nucleoid structuring protein (H-NS) is a small but abundant protein present in enteric bacteria and is involved in compaction of the DNA and regulation of the transcription. Recent reports have suggested that H-NS binds to a specific AT rich DNA sequence than to intrinsically curved DNA in sequence independent manner. We detected two high-specificity H-NS binding sites in LEE5 promoter of EPEC centered at -110 and -138, which were close to the proposed consensus H-NS binding motif. To identify H-NS binding sequence in LEE5 promoter, we took a random mutagenesis approach and found the mutations at around -138 were specifically defective in the regulation by H-NS. It was concluded that H-NS exerts maximum repression via the specific sequence at around -138 and subsequently contacts a subunit of RNAP through oligomerization.
Paull, T T; Cortez, D; Bowers, B; Elledge, S J; Gellert, M
2001-05-22
The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein-DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription.
Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N
2017-11-01
Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.
Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.
2010-01-01
The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069
Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation
Taylor, James A.; Pastrana, Cesar L.; Butterer, Annika; Pernstich, Christian; Gwynn, Emma J.; Sobott, Frank; Moreno-Herrero, Fernando; Dillingham, Mark S.
2015-01-01
The segregation of many bacterial chromosomes is dependent on the interactions of ParB proteins with centromere-like DNA sequences called parS that are located close to the origin of replication. In this work, we have investigated the binding of Bacillus subtilis ParB to DNA in vitro using a variety of biochemical and biophysical techniques. We observe tight and specific binding of a ParB homodimer to the parS sequence. Binding of ParB to non-specific DNA is more complex and displays apparent positive co-operativity that is associated with the formation of larger, poorly defined, nucleoprotein complexes. Experiments with magnetic tweezers demonstrate that non-specific binding leads to DNA condensation that is reversible by protein unbinding or force. The condensed DNA structure is not well ordered and we infer that it is formed by many looping interactions between neighbouring DNA segments. Consistent with this view, ParB is also able to stabilize writhe in single supercoiled DNA molecules and to bridge segments from two different DNA molecules in trans. The experiments provide no evidence for the promotion of non-specific DNA binding and/or condensation events by the presence of parS sequences. The implications of these observations for chromosome segregation are discussed. PMID:25572315
Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.
2015-01-01
CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421
Lin, Jiangguo; Countryman, Preston; Buncher, Noah; Kaur, Parminder; E, Longjiang; Zhang, Yiyun; Gibson, Greg; You, Changjiang; Watkins, Simon C; Piehler, Jacob; Opresko, Patricia L; Kad, Neil M; Wang, Hong
2014-02-01
Human telomeres are maintained by the shelterin protein complex in which TRF1 and TRF2 bind directly to duplex telomeric DNA. How these proteins find telomeric sequences among a genome of billions of base pairs and how they find protein partners to form the shelterin complex remains uncertain. Using single-molecule fluorescence imaging of quantum dot-labeled TRF1 and TRF2, we study how these proteins locate TTAGGG repeats on DNA tightropes. By virtue of its basic domain TRF2 performs an extensive 1D search on nontelomeric DNA, whereas TRF1's 1D search is limited. Unlike the stable and static associations observed for other proteins at specific binding sites, TRF proteins possess reduced binding stability marked by transient binding (∼ 9-17 s) and slow 1D diffusion on specific telomeric regions. These slow diffusion constants yield activation energy barriers to sliding ∼ 2.8-3.6 κ(B)T greater than those for nontelomeric DNA. We propose that the TRF proteins use 1D sliding to find protein partners and assemble the shelterin complex, which in turn stabilizes the interaction with specific telomeric DNA. This 'tag-team proofreading' represents a more general mechanism to ensure a specific set of proteins interact with each other on long repetitive specific DNA sequences without requiring external energy sources.
Walker, M D; Park, C W; Rosen, A; Aronheim, A
1990-01-01
Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401
Heyduk, E; Baichoo, N; Heyduk, T
2001-11-30
The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.
Molecular Dynamics Simulations of DNA-Free and DNA-Bound TAL Effectors
Wan, Hua; Hu, Jian-ping; Li, Kang-shun; Tian, Xu-hong; Chang, Shan
2013-01-01
TAL (transcriptional activator-like) effectors (TALEs) are DNA-binding proteins, containing a modular central domain that recognizes specific DNA sequences. Recently, the crystallographic studies of TALEs revealed the structure of DNA-recognition domain. In this article, molecular dynamics (MD) simulations are employed to study two crystal structures of an 11.5-repeat TALE, in the presence and absence of DNA, respectively. The simulated results indicate that the specific binding of RVDs (repeat-variable diresidues) with DNA leads to the markedly reduced fluctuations of tandem repeats, especially at the two ends. In the DNA-bound TALE system, the base-specific interaction is formed mainly by the residue at position 13 within a TAL repeat. Tandem repeats with weak RVDs are unfavorable for the TALE-DNA binding. These observations are consistent with experimental studies. By using principal component analysis (PCA), the dominant motions are open-close movements between the two ends of the superhelical structure in both DNA-free and DNA-bound TALE systems. The open-close movements are found to be critical for the recognition and binding of TALE-DNA based on the analysis of free energy landscape (FEL). The conformational analysis of DNA indicates that the 5′ end of DNA target sequence has more remarkable structural deformability than the other sites. Meanwhile, the conformational change of DNA is likely associated with the specific interaction of TALE-DNA. We further suggest that the arrangement of N-terminal repeats with strong RVDs may help in the design of efficient TALEs. This study provides some new insights into the understanding of the TALE-DNA recognition mechanism. PMID:24130757
Sauvé, Simon; Tremblay, Luc; Lavigne, Pierre
2004-09-17
Basic region-helix1-loop-helix2-leucine zipper (b/H(1)LH(2)/LZ) transcription factors bind specific DNA sequence in their target gene promoters as dimers. Max, a b/H(1)LH(2)/LZ transcription factor, is the obligate heterodimeric partner of the related b/H(1)LH(2)/LZ proteins of the Myc and Mad families. These heterodimers specifically bind E-box DNA sequence (CACGTG) to activate (e.g. c-Myc/Max) and repress (e.g. Mad1/Max) transcription. Max can also homodimerize and bind E-box sequences in c-Myc target gene promoters. While the X-ray structure of the Max b/H(1)LH(2)/LZ/DNA complex and that of others have been reported, the precise sequence of events leading to the reversible and specific binding of these important transcription factors is still largely unknown. In order to provide insights into the DNA binding mechanism, we have solved the NMR solution structure of a covalently homodimerized version of a Max b/H(1)LH(2)/LZ protein with two stabilizing mutations in the LZ, and characterized its backbone dynamics from (15)N spin-relaxation measurements in the absence of DNA. Apart from minor differences in the pitch of the LZ, possibly resulting from the mutations in the construct, we observe that the packing of the helices in the H(1)LH(2) domain is almost identical to that of the two crystal structures, indicating that no important conformational change in these helices occurs upon DNA binding. Conversely to the crystal structures of the DNA complexes, the first 14 residues of the basic region are found to be mostly unfolded while the loop is observed to be flexible. This indicates that these domains undergo conformational changes upon DNA binding. On the other hand, we find the last four residues of the basic region form a persistent helical turn contiguous to H(1). In addition, we provide evidence of the existence of internal motions in the backbone of H(1) that are of larger amplitude and longer time-scale (nanoseconds) than the ones in the H(2) and LZ domain. Most interestingly, we note that conformers in the ensemble of calculated structures have highly conserved basic residues (located in the persistent helical turn of the basic region and in the loop) known to be important for specific binding in a conformation that matches that of the DNA-bound state. These partially prefolded conformers can directly fit into the major groove of DNA and as such are proposed to lie on the pathway leading to the reversible and specific DNA binding. In these conformers, the conserved basic side-chains form a cluster that elevates the local electrostatic potential and could provide the necessary driving force for the generation of the internal motions localized in the H(1) and therefore link structural determinants with the DNA binding function. Overall, our results suggests that the Max homodimeric b/H(1)LH(2)/LZ can rapidly and preferentially bind DNA sequence through transient and partially prefolded states and subsequently, adopt the fully helical bound state in a DNA-assisted mechanism or induced-fit.
Sequence-specific binding of counterions to B-DNA
Denisov, Vladimir P.; Halle, Bertil
2000-01-01
Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo. To address this issue, we report here 23Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B-DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B-DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA. PMID:10639130
Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps
NASA Astrophysics Data System (ADS)
Niranjani, G.; Murugan, R.
2016-08-01
The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.
Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M
2002-12-01
There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.
2011-01-01
Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543
Rao, Harita; Damian, Mariana S; Alshiekh, Alak; Elmroth, Sofi K C; Diederichsen, Ulf
2015-12-28
Conjugation of metal complexes with peptide scaffolds possessing high DNA binding affinity has shown to modulate their biological activities and to enhance their interaction with DNA. In this work, a platinum complex/peptide chimera was synthesized based on a model of the Integration Host Factor (IHF), an architectural protein possessing sequence specific DNA binding and bending abilities through its interaction with a minor groove. The model peptide consists of a cyclic unit resembling the minor grove binding subdomain of IHF, a positively charged lysine dendrimer for electrostatic interactions with the DNA phosphate backbone and a flexible glycine linker tethering the two units. A norvaline derived artificial amino acid was designed to contain a dimethylethylenediamine as a bidentate platinum chelating unit, and introduced into the IHF mimicking peptides. The interaction of the chimeric peptides with various DNA sequences was studied by utilizing the following experiments: thermal melting studies, agarose gel electrophoresis for plasmid DNA unwinding experiments, and native and denaturing gel electrophoresis to visualize non-covalent and covalent peptide-DNA adducts, respectively. By incorporation of the platinum metal center within the model peptide mimicking IHF we have attempted to improve its specificity and DNA targeting ability, particularly towards those sequences containing adjacent guanine residues.
DNA-binding regulates site-specific ubiquitination of IRF-1.
Landré, Vivien; Pion, Emmanuelle; Narayan, Vikram; Xirodimas, Dimitris P; Ball, Kathryn L
2013-02-01
Understanding the determinants for site-specific ubiquitination by E3 ligase components of the ubiquitin machinery is proving to be a challenge. In the present study we investigate the role of an E3 ligase docking site (Mf2 domain) in an intrinsically disordered domain of IRF-1 [IFN (interferon) regulatory factor-1], a short-lived IFNγ-regulated transcription factor, in ubiquitination of the protein. Ubiquitin modification of full-length IRF-1 by E3 ligases such as CHIP [C-terminus of the Hsc (heat-shock cognate) 70-interacting protein] and MDM2 (murine double minute 2), which dock to the Mf2 domain, was specific for lysine residues found predominantly in loop structures that extend from the DNA-binding domain, whereas no modification was detected in the more conformationally flexible C-terminal half of the protein. The E3 docking site was not available when IRF-1 was in its DNA-bound conformation and cognate DNA-binding sequences strongly suppressed ubiquitination, highlighting a strict relationship between ligase binding and site-specific modification at residues in the DNA-binding domain. Hyperubiquitination of a non-DNA-binding mutant supports a mechanism where an active DNA-bound pool of IRF-1 is protected from polyubiquitination and degradation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.
2010-07-23
Research highlights: {yields} Successful fusion of GFP to M.EcoKI DNA methyltransferase. {yields} GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. {yields} FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerstermore » resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.« less
Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.
Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar
2018-05-22
Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.
Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David
2013-01-01
Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556
Subrahmanyam, S; Cronan, J E
1999-01-21
We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.
Baumann, G; Geisse, S; Sullivan, M
1991-03-01
The structurally unrelated immunosuppressive drugs cyclosporin A (Sandimmun) and FK-506 both interfere with the process of T-cell proliferation by blocking the transcription of the T-cell growth factor interleukin-2 (IL-2). Here we demonstrate that the transcriptional activation of this gene requires the binding of regulatory nuclear proteins to a promoter element with sequence similarity to the consensus binding site for NF-kappa B-related transcription factors. We present evidence that the binding by regulatory nuclear proteins to the kappa B element of the IL-2 promoter is affected negatively by cyclosporin A and FK-506 at concentrations paralleling their immunosuppressive activity in vivo. The decrease in DNA-protein complex formation induced by the immunosuppressive drugs correlates with a decrease in IL-2 production. FK-506 is 10 to 100 times more potent than cyclosporin A in its ability to inhibit sequence-specific DNA binding and IL-2 production. Our findings suggest that the actions of both drugs converge at the level of DNA-protein interaction.
Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron
2016-01-01
Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341
Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji
2015-11-10
Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.
Fedoreyeva, L I; Kireev, I I; Khavinson, V Kh; Vanyushin, B F
2011-11-01
Marked fluorescence in cytoplasm, nucleus, and nucleolus was observed in HeLa cells after incubation with each of several fluorescein isothiocyanate-labeled peptides (epithalon, Ala-Glu-Asp-Gly; pinealon, Glu-Asp-Arg; testagen, Lys-Glu-Asp-Gly). This means that short biologically active peptides are able to penetrate into an animal cell and its nucleus and, in principle they may interact with various components of cytoplasm and nucleus including DNA and RNA. It was established that various initial (intact) peptides differently affect the fluorescence of the 5,6-carboxyfluorescein-labeled deoxyribooligonucleotides and DNA-ethidium bromide complexes. The Stern-Volmer constants characterizing the degree of fluorescence quenching of various single- and double-stranded fluorescence-labeled deoxyribooligonucleotides with short peptides used were different depending on the peptide primary structures. This indicates the specific interaction between short biologically active peptides and nucleic acid structures. On binding to them, the peptides discriminate between different nucleotide sequences and recognize even their cytosine methylation status. Judging from corresponding constants of the fluorescence quenching, the epithalon, pinealon, and bronchogen (Ala-Glu-Asp-Leu) bind preferentially with deoxyribooligonucleotides containing CNG sequence (CNG sites are targets for cytosine DNA methylation in eukaryotes). Epithalon, testagen, and pinealon seem to preferentially bind with CAG- but bronchogen with CTG-containing sequences. The site-specific interactions of peptides with DNA can control epigenetically the cell genetic functions, and they seem to play an important role in regulation of gene activity even at the earliest stages of life origin and in evolution.
Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z
1994-01-01
The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.
2015-01-01
Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071
Robinson, Clifford R.; Sligar, Stephen G.
1998-01-01
Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860
NASA Astrophysics Data System (ADS)
Knight, Jonathan D.; Li, Rong; Botchan, Michael
1991-04-01
The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less
Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...
2016-03-09
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less
Ishii, N; Yamamoto, M; Lahm, H W; Iizumi, S; Yoshihara, F; Nakayama, H; Arisawa, M; Aoki, Y
1997-02-01
Electromobility shift assays with a DNA probe containing the Saccharomyces cerevisiae ENO1 RPG box identified a specific DNA-binding protein in total protein extracts of Candida albicans. The protein, named Rbf1p (RPG-box-binding protein 1), bound to other S. cerevisiae RPG boxes, although the nucleotide recognition profile was not completely the same as that of S. cerevisiae Rap 1p (repressor-activator protein 1), an RPG-box-binding protein. The repetitive sequence of the C. albicans chromosomal telomere also competed with RPG-box binding to Rbf1p. For further analysis, we purified Rbf1p 57,600-fold from C. albicans total protein extracts, raised mAbs against the purified protein and immunologically cloned the gene, whose ORF specified a protein of 527 aa. The bacterially expressed protein showed RPG-box-binding activity with the same profile as that of the purified one. The Rbf1p, containing two glutamine-rich regions that are found in many transcription factors, showed transcriptional activation capability in S. cerevisiae and was predominantly observed in nuclei. These results suggest that Rbf1p is a transcription factor with telomere-binding activity in C. albicans.
Specific Inhibition of the transcription factor Ci by a Cobalt(III)-Schiff base-DNA conjugate
Hurtado, Ryan R.; Harney, Allison S.; Heffern, Marie C.; Holbrook, Robert J.; Holmgren, Robert A.; Meade, Thomas J.
2012-01-01
We describe the use of Co(III) Schiff base-DNA conjugates, a versatile class of research tools that target C2H2 transcription factors, to inhibit the Hedgehog (Hh) pathway. In developing mammalian embryos, Hh signaling is critical for the formation and development of many tissues and organs. Inappropriate activation of the Hedgehog (Hh) pathway has been implicated in a variety of cancers including medulloblastomas and basal cell carcinomas. It is well known that Hh regulates the activity of the Gli family of C2H2 zinc finger transcription factors in mammals. In Drosophila the function of the Gli proteins is performed by a single transcription factor with an identical DNA binding consensus sequence, Cubitus Interruptus (Ci). We have demonstrated previously that conjugation of a specific 17 base-pair oligonucleotide to a Co(III) Schiff base complex results in a targeted inhibitor of the Snail family C2H2 zinc finger transcription factors. Modification of the oligonucleotide sequence in the Co(III) Schiff base-DNA conjugate to that of Ci’s consensus sequence (Co(III)-Ci) generates an equally selective inhibitor of Ci. Co(III)-Ci irreversibly binds the Ci zinc finger domain and prevents it from binding DNA in vitro. In a Ci responsive tissue culture reporter gene assay, Co(III)-Ci reduces the transcriptional activity of Ci in a concentration dependent manner. In addition, injection of wild-type Drosophila embryos with Co(III)-Ci phenocopies a Ci loss of function phenotype, demonstrating effectiveness in vivo. This study provides evidence that Co(III) Schiff base-DNA conjugates are a versatile class of specific and potent tools for studying zinc finger domain proteins and have potential applications as customizable anti-cancer therapeutics. PMID:22214326
Dummitt, Benjamin; Chang, Yie-Hwa
2006-06-01
Quantitation of the level or activity of specific proteins is one of the most commonly performed experiments in biomedical research. Protein detection has historically been difficult to adapt to high throughput platforms because of heavy reliance upon antibodies for protein detection. Molecular beacons for DNA binding proteins is a recently developed technology that attempts to overcome such limitations. Protein detection is accomplished using inexpensive, easy-to-synthesize oligonucleotides, accompanied by a fluorescence readout. Importantly, detection of the protein and reporting of the signal occur simultaneously, allowing for one-step protocols and increased potential for use in high throughput analysis. While the initial iteration of the technology allowed only for the detection of sequence-specific DNA binding proteins, more recent adaptations allow for the possibility of development of beacons for any protein, independent of native DNA binding activity. Here, we discuss the development of the technology, the mechanism of the reaction, and recent improvements and modifications made to improve the assay in terms of sensitivity, potential for multiplexing, and broad applicability.
Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.
Schreiber, T; Tissier, A
2016-01-01
The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.
Ozaki, Haruka; Iwasaki, Wataru
2016-08-01
As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Bosselut, R; Levin, J; Adjadj, E; Ghysdael, J
1993-11-11
Ets proteins form a family of sequence specific DNA binding proteins which bind DNA through a 85 aminoacids conserved domain, the Ets domain, whose sequence is unrelated to any other characterized DNA binding domain. Unlike all other known Ets proteins, which bind specific DNA sequences centered over either GGAA or GGAT core motifs, E74 and Elf1 selectively bind to GGAA corecontaining sites. Elf1 and E74 differ from other Ets proteins in three residues located in an otherwise highly conserved region of the Ets domain, referred to as conserved region III (CRIII). We show that a restricted selectivity for GGAA core-containing sites could be conferred to Ets1 upon changing a single lysine residue within CRIII to the threonine found in Elf1 and E74 at this position. Conversely, the reciprocal mutation in Elf1 confers to this protein the ability to bind to GGAT core containing EBS. This, together with the fact that mutation of two invariant arginine residues in CRIII abolishes DNA binding, indicates that CRIII plays a key role in Ets domain recognition of the GGAA/T core motif and lead us to discuss a model of Ets proteins--core motif interaction.
Rogers, Julia M; Bulyk, Martha L
2018-04-25
Sequence-specific transcription factors (TFs) bind short DNA sequences in the genome to regulate the expression of target genes. In the last decade, numerous technical advances have enabled the determination of the DNA-binding specificities of many of these factors. Large-scale screens of many TFs enabled the creation of databases of TF DNA-binding specificities, typically represented as position weight matrices (PWMs). Although great progress has been made in determining and predicting binding specificities systematically, there are still many surprises to be found when studying a particular TF's interactions with DNA in detail. Paralogous TFs' binding specificities can differ in subtle ways, in a manner that is not immediately apparent from looking at their PWMs. These differences affect gene regulatory outputs and enable TFs to rewire transcriptional networks over evolutionary time. This review discusses recent observations made in the study of TF-DNA interactions that highlight the importance of continued in-depth analysis of TF-DNA interactions and their inherent complexity. This article is categorized under: Biological Mechanisms > Regulatory Biology. © 2018 Wiley Periodicals, Inc.
Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal
2010-01-01
The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772
Mouw, M; Pintel, D J
1998-11-10
GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.
Pérez-Quintero, Alvaro L.; Rodriguez-R, Luis M.; Dereeper, Alexis; López, Camilo; Koebnik, Ralf; Szurek, Boris; Cunnac, Sebastien
2013-01-01
Transcription Activators-Like Effectors (TALEs) belong to a family of virulence proteins from the Xanthomonas genus of bacterial plant pathogens that are translocated into the plant cell. In the nucleus, TALEs act as transcription factors inducing the expression of susceptibility genes. A code for TALE-DNA binding specificity and high-resolution three-dimensional structures of TALE-DNA complexes were recently reported. Accurate prediction of TAL Effector Binding Elements (EBEs) is essential to elucidate the biological functions of the many sequenced TALEs as well as for robust design of artificial TALE DNA-binding domains in biotechnological applications. In this work a program with improved EBE prediction performances was developed using an updated specificity matrix and a position weight correction function to account for the matching pattern observed in a validation set of TALE-DNA interactions. To gain a systems perspective on the large TALE repertoires from X. oryzae strains, this program was used to predict rice gene targets for 99 sequenced family members. Integrating predictions and available expression data in a TALE-gene network revealed multiple candidate transcriptional targets for many TALEs as well as several possible instances of functional convergence among TALEs. PMID:23869221
Kachhap, Sangita; Singh, Balvinder
2015-01-01
In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.
Predicting the binding preference of transcription factors to individual DNA k-mers.
Alleyne, Trevis M; Peña-Castillo, Lourdes; Badis, Gwenael; Talukder, Shaheynoor; Berger, Michael F; Gehrke, Andrew R; Philippakis, Anthony A; Bulyk, Martha L; Morris, Quaid D; Hughes, Timothy R
2009-04-15
Recognition of specific DNA sequences is a central mechanism by which transcription factors (TFs) control gene expression. Many TF-binding preferences, however, are unknown or poorly characterized, in part due to the difficulty associated with determining their specificity experimentally, and an incomplete understanding of the mechanisms governing sequence specificity. New techniques that estimate the affinity of TFs to all possible k-mers provide a new opportunity to study DNA-protein interaction mechanisms, and may facilitate inference of binding preferences for members of a given TF family when such information is available for other family members. We employed a new dataset consisting of the relative preferences of mouse homeodomains for all eight-base DNA sequences in order to ask how well we can predict the binding profiles of homeodomains when only their protein sequences are given. We evaluated a panel of standard statistical inference techniques, as well as variations of the protein features considered. Nearest neighbour among functionally important residues emerged among the most effective methods. Our results underscore the complexity of TF-DNA recognition, and suggest a rational approach for future analyses of TF families.
Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor
2014-02-03
The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.
Morellet, Nelly; Li, Xianghong; Wieninger, Silke A; Taylor, Jennifer L; Bischerour, Julien; Moriau, Séverine; Lescop, Ewen; Bardiaux, Benjamin; Mathy, Nathalie; Assrir, Nadine; Bétermier, Mireille; Nilges, Michael; Hickman, Alison B; Dyda, Fred; Craig, Nancy L; Guittet, Eric
2018-01-01
Abstract The piggyBac transposase (PB) is distinguished by its activity and utility in genome engineering, especially in humans where it has highly promising therapeutic potential. Little is known, however, about the structure–function relationships of the different domains of PB. Here, we demonstrate in vitro and in vivo that its C-terminal Cysteine-Rich Domain (CRD) is essential for DNA breakage, joining and transposition and that it binds to specific DNA sequences in the left and right transposon ends, and to an additional unexpectedly internal site at the left end. Using NMR, we show that the CRD adopts the specific fold of the cross-brace zinc finger protein family. We determine the interaction interfaces between the CRD and its target, the 5′-TGCGT-3′/3′-ACGCA-5′ motifs found in the left, left internal and right transposon ends, and use NMR results to propose docking models for the complex, which are consistent with our site-directed mutagenesis data. Our results provide support for a model of the PB/DNA interactions in the context of the transpososome, which will be useful for the rational design of PB mutants with increased activity. PMID:29385532
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.
1987-11-01
The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription ofmore » RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.« less
Welch, M; Todd, D E; Whitehead, N A; McGowan, S J; Bycroft, B W; Salmond, G P
2000-02-15
Quorum sensing via an N-acyl homoserine lactone (HSL) pheromone controls the biosynthesis of a carbapenem antibiotic in Erwinia carotovora. Transcription of the carbapenem biosynthetic genes is dependent on the LuxR-type activator protein, CarR. Equilibrium binding of a range of HSL molecules, which are thought to activate CarR to bind to its DNA target sequence, was examined using fluorescence quenching, DNA bandshift analysis, limited proteolysis and reporter gene assays. CarR bound the most physiologically relevant ligand, N-(3-oxohexanoyl)-L-homoserine lactone, with a stoichiometry of two molecules of ligand per dimer of protein and a dissociation constant of 1.8 microM, in good agreement with the concentration of HSL required to activate carbapenem production in vivo. In the presence of HSL, CarR formed a very high molecular weight complex with its target DNA, indicating that the ligand causes the protein to multimerize. Chemical cross-linking analysis supported this interpretation. Our data show that the ability of a given HSL to facilitate CarR binding to its target DNA sequence is directly proportional to the affinity of the HSL for the protein.
McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
Replication of damaged DNA in vitro is blocked by p53
Zhou, Jianmin; Prives, Carol
2003-01-01
The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603
Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq
Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael
2016-01-01
Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249
Human HMG box transcription factor HBP1: a role in hCD2 LCR function.
Zhuma, T; Tyrrell, R; Sekkali, B; Skavdis, G; Saveliev, A; Tolaini, M; Roderick, K; Norton, T; Smerdon, S; Sedgwick, S; Festenstein, R; Kioussis, D
1999-01-01
The locus control region (LCR) of the human CD2 gene (hCD2) confers T cell-specific, copy-dependent and position-independent gene expression in transgenic mice. This LCR consists of a strong T cell-specific enhancer and an element without enhancer activity (designated HSS3), which is required for prevention of position effect variegation (PEV) in transgenic mice. Here, we identified the HMG box containing protein-1 (HBP1) as a factor binding to HSS3 of the hCD2 LCR. Within the LCR, HBP1 binds to a novel TTCATTCATTCA sequence that is higher in affinity than other recently reported HBP1-binding sites. Mice transgenic for a hCD2 LCR construct carrying a deletion of the HBP1-binding sequences show a propensity for PEV if the transgene integrates in a heterochromatic region of the chromosome such as the centromere or telomere. We propose that HBP1 plays an important role in chromatin opening and remodelling activities by binding to and bending the DNA, thus allowing DNA-protein and/or protein-protein interactions, which increase the probability of establishing an active locus. PMID:10562551
Lee, Susan D.; Surtees, Jennifer A.; Alani, Eric
2007-01-01
In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. In this study we showed that the msh2Δ1 mutation, containing a complete deletion of the conserved mismatch recognition Domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Δ1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of Domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that Domain I in MSH2 contributed a non-specific DNA binding activity while Domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA-binding. These observations reveal distinct requirements for the MSH2 DNA binding Domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding. PMID:17157869
Lee, Susan D; Surtees, Jennifer A; Alani, Eric
2007-02-09
In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. Here, we show that the msh2Delta1 mutation, containing a complete deletion of the conserved mismatch recognition domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Delta1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that domain I in MSH2 contributed a non-specific DNA binding activity while domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA binding. These observations reveal distinct requirements for the MSH2 DNA binding domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding.
Programmable RNA recognition and cleavage by CRISPR/Cas9.
O'Connell, Mitchell R; Oakes, Benjamin L; Sternberg, Samuel H; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A
2014-12-11
The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA-DNA complementarity to identify target sites for sequence-specific double-stranded DNA (dsDNA) cleavage. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, known as the protospacer adjacent motif (PAM), next to and on the strand opposite the twenty-nucleotide target site in dsDNA. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in a large range of prokaryotic and eukaryotic cell types, and in whole organisms, but it has been thought to be incapable of targeting RNA. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalysed DNA cleavage. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous messenger RNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable transcript recognition without the need for tags.
Programmable RNA recognition and cleavage by CRISPR/Cas9
O’Connell, Mitchell R.; Oakes, Benjamin L.; Sternberg, Samuel H.; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A.
2014-01-01
The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA:DNA complementarity to identify target sites for sequence-specific doublestranded DNA (dsDNA) cleavage1-5. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, the protospacer adjacent motif (PAM), next to and on the strand opposite the 20-nucleotide target site in dsDNA4-7. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in many cell types and organisms8, but it has been thought to be incapable of targeting RNA5. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalyzed DNA cleavage7. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous mRNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable and tagless transcript recognition. PMID:25274302
A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.
Clos, J; Buttgereit, D; Grummt, I
1986-01-01
A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157
Chimeric TALE recombinases with programmable DNA sequence specificity.
Mercer, Andrew C; Gaj, Thomas; Fuller, Roberta P; Barbas, Carlos F
2012-11-01
Site-specific recombinases are powerful tools for genome engineering. Hyperactivated variants of the resolvase/invertase family of serine recombinases function without accessory factors, and thus can be re-targeted to sequences of interest by replacing native DNA-binding domains (DBDs) with engineered zinc-finger proteins (ZFPs). However, imperfect modularity with particular domains, lack of high-affinity binding to all DNA triplets, and difficulty in construction has hindered the widespread adoption of ZFPs in unspecialized laboratories. The discovery of a novel type of DBD in transcription activator-like effector (TALE) proteins from Xanthomonas provides an alternative to ZFPs. Here we describe chimeric TALE recombinases (TALERs): engineered fusions between a hyperactivated catalytic domain from the DNA invertase Gin and an optimized TALE architecture. We use a library of incrementally truncated TALE variants to identify TALER fusions that modify DNA with efficiency and specificity comparable to zinc-finger recombinases in bacterial cells. We also show that TALERs recombine DNA in mammalian cells. The TALER architecture described herein provides a platform for insertion of customized TALE domains, thus significantly expanding the targeting capacity of engineered recombinases and their potential applications in biotechnology and medicine.
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj
2011-10-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S
2011-01-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373
Rivera-Cancel, Giomar; Motta-Mena, Laura B.; Gardner, Kevin H.
2012-01-01
Light-oxygen-voltage (LOV) domains serve as the photosensory modules for a wide range of plant and bacterial proteins, conferring blue light dependent regulation to effector activities as diverse as enzymes and DNA binding. LOV domains can also be engineered into a variety of exogenous targets, enabling similar regulation for new protein-based reagents. Common to these proteins is the ability for LOV domains to reversibly form a photochemical adduct between an internal flavin chromophore and the surrounding protein, using this to trigger conformational changes that affect output activity. Using the Erythrobacter litoralis protein EL222 model system which links LOV regulation to a helix-turn-helix (HTH) DNA binding domain, we demonstrated that the LOV domain binds and inhibits the HTH domain in the dark, releasing these interactions upon illumination [Nash et al. (2011) Proc. Natl. Acad. Sci. USA 108, 9449–9454]. Here we combine genomic and in vitro selection approaches to identify optimal DNA binding sites for EL222. Within the bacterial host, we observe binding several genomic sites using a 12 bp sequence consensus that is also found by in vitro selection methods. Sequence-specific alterations in the DNA consensus reduce EL222-binding affinity in a manner consistent with the expected binding mode: a protein dimer binding to two repeats. Finally, we demonstrate the light-dependent activation of transcription of two genes adjacent to an EL222 binding site. Taken together, these results shed light on the native function of EL222 and provide useful reagents for further basic and applications research of this versatile protein. PMID:23205774
Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*
Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.
2012-01-01
The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359
Lenzmeier, B A; Giebler, H A; Nyborg, J K
1998-02-01
Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.
Structure-based Analysis to Hu-DNA Binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Swinger,K.; Rice, P.
2007-01-01
HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently publishedmore » Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.« less
Binding site size limit of the 2:1 pyrrole-imidazole polyamide-DNA motif.
Kelly, J J; Baird, E E; Dervan, P B
1996-01-01
Polyamides containing N-methylimidazole (Im) and N-methylpyrrole (Py) amino acids can be combined in antiparallel side-by-side dimeric complexes for sequence-specific recognition in the minor groove of DNA. Six polyamides containing three to eight rings bind DNA sites 5-10 bp in length, respectively. Quantitative DNase I footprint titration experiments demonstrate that affinity maximizes and is similar at ring sizes of five, six, and seven. Sequence specificity decreases as the length of the polyamides increases beyond five rings. These results provide useful guidelines for the design of new polyamides that bind longer DNA sites with enhanced affinity and specificity. Images Fig. 4 PMID:8692930
Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.
1998-01-01
We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457
Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C
2000-06-01
Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.
TALE proteins search DNA using a rotationally decoupled mechanism.
Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M
2016-10-01
Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins used extensively for gene editing. Despite recent progress, however, little is known about their sequence search mechanism. Here, we use single-molecule experiments to study TALE search along DNA. Our results show that TALEs utilize a rotationally decoupled mechanism for nonspecific search, despite remaining associated with DNA templates during the search process. Our results suggest that the protein helical structure enables TALEs to adopt a loosely wrapped conformation around DNA templates during nonspecific search, facilitating rapid one-dimensional (1D) diffusion under a range of solution conditions. Furthermore, this model is consistent with a previously reported two-state mechanism for TALE search that allows these proteins to overcome the search speed-stability paradox. Taken together, our results suggest that TALE search is unique among the broad class of sequence-specific DNA-binding proteins and supports efficient 1D search along DNA.
Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu
2006-06-01
VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation.
Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu
2006-01-01
VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation. PMID:16757746
NMR studies of DNA oligomers and their interactions with minor groove binding ligands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fagan, Patricia A.
1996-05-01
The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less
RNA-programmed genome editing in human cells
Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer
2013-01-01
Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978
Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.
Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I
2001-08-01
DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.
USDA-ARS?s Scientific Manuscript database
Transcription activator-like (TAL) effectors found in Xanthomonas spp. promote bacterial growth and plant susceptibility by binding specific DNA sequences or, effector-binding elements (EBEs), and inducing host gene expression. In this study, we have found substantially different transcriptional pro...
Molecular dynamics studies on the DNA-binding process of ERG.
Beuerle, Matthias G; Dufton, Neil P; Randi, Anna M; Gould, Ian R
2016-11-15
The ETS family of transcription factors regulate gene targets by binding to a core GGAA DNA-sequence. The ETS factor ERG is required for homeostasis and lineage-specific functions in endothelial cells, some subset of haemopoietic cells and chondrocytes; its ectopic expression is linked to oncogenesis in multiple tissues. To date details of the DNA-binding process of ERG including DNA-sequence recognition outside the core GGAA-sequence are largely unknown. We combined available structural and experimental data to perform molecular dynamics simulations to study the DNA-binding process of ERG. In particular we were able to reproduce the ERG DNA-complex with a DNA-binding simulation starting in an unbound configuration with a final root-mean-square-deviation (RMSD) of 2.1 Å to the core ETS domain DNA-complex crystal structure. This allowed us to elucidate the relevance of amino acids involved in the formation of the ERG DNA-complex and to identify Arg385 as a novel key residue in the DNA-binding process. Moreover we were able to show that water-mediated hydrogen bonds are present between ERG and DNA in our simulations and that those interactions have the potential to achieve sequence recognition outside the GGAA core DNA-sequence. The methodology employed in this study shows the promising capabilities of modern molecular dynamics simulations in the field of protein DNA-interactions.
Cicconi, Alessandro; Micheli, Emanuela; Vernì, Fiammetta; Jackson, Alison; Gradilla, Ana Citlali; Cipressa, Francesca; Raimondo, Domenico; Bosso, Giuseppe; Wakefield, James G.; Ciapponi, Laura; Cenci, Giovanni; Gatti, Maurizio
2017-01-01
Abstract Drosophila telomeres are sequence-independent structures maintained by transposition to chromosome ends of three specialized retroelements rather than by telomerase activity. Fly telomeres are protected by the terminin complex that includes the HOAP, HipHop, Moi and Ver proteins. These are fast evolving, non-conserved proteins that localize and function exclusively at telomeres, protecting them from fusion events. We have previously suggested that terminin is the functional analogue of shelterin, the multi-protein complex that protects human telomeres. Here, we use electrophoretic mobility shift assay (EMSA) and atomic force microscopy (AFM) to show that Ver preferentially binds single-stranded DNA (ssDNA) with no sequence specificity. We also show that Moi and Ver form a complex in vivo. Although these two proteins are mutually dependent for their localization at telomeres, Moi neither binds ssDNA nor facilitates Ver binding to ssDNA. Consistent with these results, we found that Ver-depleted telomeres form RPA and γH2AX foci, like the human telomeres lacking the ssDNA-binding POT1 protein. Collectively, our findings suggest that Drosophila telomeres possess a ssDNA overhang like the other eukaryotes, and that the terminin complex is architecturally and functionally similar to shelterin. PMID:27940556
Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang
1998-01-01
Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860
Small molecule and peptide-mediated inhibition of Epstein-Barr virus nuclear antigen 1 dimerization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Sun Young; Song, Kyung-A; Samsung Biomedical Research Institute
Highlights: Black-Right-Pointing-Pointer Evidence that targeting EBNA1 dimer, an EBV onco-antigen, can be achievable. Black-Right-Pointing-Pointer A small molecule and a peptide as EBNA1 dimerization inhibitors identified. Black-Right-Pointing-Pointer Both inhibitors associated with EBNA1 and blocked EBNA1 DNA binding activity. Black-Right-Pointing-Pointer Also, prevented its dimerization, and repressed viral gene transcription. -- Abstract: Latent Epstein-Barr virus (EBV) infection is associated with human B cell lymphomas and certain carcinomas. EBV episome persistence, replication, and gene expression are dependent on EBV-encoded nuclear antigen 1 (EBNA1)'s DNA binding domain (DBD)/dimerization domain (DD)-mediated sequence-specific DNA binding activity. Homodimerization of EBNA1 is essential for EBNA1 DNA binding and transactivation.more » In this study, we characterized a novel small molecule EBNA1 inhibitor EiK1, screened from the previous high throughput screening (HTS). The EiK1 compound specifically inhibited the EBNA1-dependent, OriP-enhanced transcription, but not EBNA1-independent transcription. A Surface Plasmon Resonance Biacore assay revealed that EiK1 associates with EBNA1 amino acid 459-607 DBD/DD. Consistent with the SPR data, in vitro gel shift assays showed that EiK1 suppressed the activity of EBNA1 binding to the cognate familial repeats (FR) sequence, but not control RBP-J{kappa} binding to the J{kappa} site. Subsequently, a cross-linker-mediated in vitro multimerization assay and EBNA1 homodimerization-dependent yeast two-hybrid assay showed that EiK1 significantly inhibited EBNA1 dimerization. In an attempt to identify more highly specific peptide inhibitors, small peptides encompassing the EBNA1 DBD/DD were screened for inhibition of EBNA1 DBD-mediated DNA binding function. The small peptide P85, covering EBNA1 a.a. 560-574, significantly blocked EBNA1 DNA binding activity in vitro, prevented dimerization in vitro and in vivo, associated with EBNA1 in vitro, and repressed EBNA1-dependent transcription in vivo. Collectively, this study describes two novel inhibitors of EBNA1 dimerization. This study demonstrates that EBNA1 homodimerization can be effectively targeted by a small molecule or peptide.« less
Zandvakili, Arya; Campbell, Ian; Weirauch, Matthew T.
2018-01-01
Cells use thousands of regulatory sequences to recruit transcription factors (TFs) and produce specific transcriptional outcomes. Since TFs bind degenerate DNA sequences, discriminating functional TF binding sites (TFBSs) from background sequences represents a significant challenge. Here, we show that a Drosophila regulatory element that activates Epidermal Growth Factor signaling requires overlapping, low-affinity TFBSs for competing TFs (Pax2 and Senseless) to ensure cell- and segment-specific activity. Testing available TF binding models for Pax2 and Senseless, however, revealed variable accuracy in predicting such low-affinity TFBSs. To better define parameters that increase accuracy, we developed a method that systematically selects subsets of TFBSs based on predicted affinity to generate hundreds of position-weight matrices (PWMs). Counterintuitively, we found that degenerate PWMs produced from datasets depleted of high-affinity sequences were more accurate in identifying both low- and high-affinity TFBSs for the Pax2 and Senseless TFs. Taken together, these findings reveal how TFBS arrangement can be constrained by competition rather than cooperativity and that degenerate models of TF binding preferences can improve identification of biologically relevant low affinity TFBSs. PMID:29617378
He, Qiye; Johnston, Jeff; Zeitlinger, Julia
2014-01-01
Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057
Specificity determinants for the abscisic acid response element.
Sarkar, Aditya Kumar; Lahiri, Ansuman
2013-01-01
Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.
Effective DNA Inhibitors of Cathepsin G by In Vitro Selection
Gatto, Barbara; Vianini, Elena; Lucatello, Lorena; Sissi, Claudia; Moltrasio, Danilo; Pescador, Rodolfo; Porta, Roberto; Palumbo, Manlio
2008-01-01
Cathepsin G (CatG) is a chymotrypsin-like protease released upon degranulation of neutrophils. In several inflammatory and ischaemic diseases the impaired balance between CatG and its physiological inhibitors leads to tissue destruction and platelet aggregation. Inhibitors of CatG are suitable for the treatment of inflammatory diseases and procoagulant conditions. DNA released upon the death of neutrophils at injury sites binds CatG. Moreover, short DNA fragments are more inhibitory than genomic DNA. Defibrotide, a single stranded polydeoxyribonucleotide with antithrombotic effect is also a potent CatG inhibitor. Given the above experimental evidences we employed a selection protocol to assess whether DNA inhibition of CatG may be ascribed to specific sequences present in defibrotide DNA. A Selex protocol was applied to identify the single-stranded DNA sequences exhibiting the highest affinity for CatG, the diversity of a combinatorial pool of oligodeoxyribonucleotides being a good representation of the complexity found in defibrotide. Biophysical and biochemical studies confirmed that the selected sequences bind tightly to the target enzyme and also efficiently inhibit its catalytic activity. Sequence analysis carried out to unveil a motif responsible for CatG recognition showed a recurrence of alternating TG repeats in the selected CatG binders, adopting an extended conformation that grants maximal interaction with the highly charged protein surface. This unprecedented finding is validated by our results showing high affinity and inhibition of CatG by specific DNA sequences of variable length designed to maximally reduce pairing/folding interactions. PMID:19325843
Basu, A; Williams, K R; Modak, M J
1987-07-15
Treatment of Escherichia coli DNA polymerase-I with potassium ferrate (K2FeO4), a site-specific oxidizing agent for the phosphate group-binding sites of proteins, results in the irreversible inactivation of enzyme activity as judged by the loss of polymerization as well as 3'-5' exonuclease activity. A significant protection from ferrate-mediated inactivation is observed in the presence of DNA but not by substrate deoxynucleoside triphosphates. Furthermore, ferrate-treated enzyme also exhibits loss of template-primer binding activity, whereas its ability to bind substrate triphosphates is unaffected. In addition, comparative high pressure liquid chromatography tryptic peptide maps obtained before and after ferrate oxidation demonstrated that only five peptides of the more than 60 peptide peaks present in the tryptic digest underwent a major change in either peak position or intensity as a result of ferrate treatment. Amino acid analyses and/or sequencing identified four of these affected peaks as corresponding to peptides that span residues 324-340, 437-455, 456-464, and 512-518, respectively. However, only the last peptide, which has the sequence: Met-Trp-Pro-Asp-Leu-Gln-Lys, was significantly protected in the presence of DNA. This latter peptide was also the only peptide whose degree of oxidation correlated directly with the extent of inactivation of the enzyme. Amino acid analysis indicated that methionine 512 is the target site in this peptide for ferrate oxidation. Methionine 512, therefore, appears to be essential for the DNA-binding function of DNA polymerase-I from E. coli.
The evolutionary turnover of recombination hot spots contributes to speciation in mice.
Smagulova, Fatima; Brick, Kevin; Pu, Yongmei; Camerini-Otero, R Daniel; Petukhova, Galina V
2016-02-01
Meiotic recombination is required for the segregation of homologous chromosomes and is essential for fertility. In most mammals, the DNA double-strand breaks (DSBs) that initiate meiotic recombination are directed to a subset of genomic loci (hot spots) by sequence-specific binding of the PRDM9 protein. Rapid evolution of the DNA-binding specificity of PRDM9 and gradual erosion of PRDM9-binding sites by gene conversion will alter the recombination landscape over time. To better understand the evolutionary turnover of recombination hot spots and its consequences, we mapped DSB hot spots in four major subspecies of Mus musculus with different Prdm9 alleles and in their F1 hybrids. We found that hot spot erosion governs the preferential usage of some Prdm9 alleles over others in hybrid mice and increases sequence diversity specifically at hot spots that become active in the hybrids. As crossovers are disfavored at such hot spots, we propose that sequence divergence generated by hot spot turnover may create an impediment for recombination in hybrids, potentially leading to reduced fertility and, eventually, speciation. Published by Cold Spring Harbor Laboratory Press.
The evolutionary turnover of recombination hot spots contributes to speciation in mice
Smagulova, Fatima; Brick, Kevin; Pu, Yongmei; Camerini-Otero, R. Daniel; Petukhova, Galina V.
2016-01-01
Meiotic recombination is required for the segregation of homologous chromosomes and is essential for fertility. In most mammals, the DNA double-strand breaks (DSBs) that initiate meiotic recombination are directed to a subset of genomic loci (hot spots) by sequence-specific binding of the PRDM9 protein. Rapid evolution of the DNA-binding specificity of PRDM9 and gradual erosion of PRDM9-binding sites by gene conversion will alter the recombination landscape over time. To better understand the evolutionary turnover of recombination hot spots and its consequences, we mapped DSB hot spots in four major subspecies of Mus musculus with different Prdm9 alleles and in their F1 hybrids. We found that hot spot erosion governs the preferential usage of some Prdm9 alleles over others in hybrid mice and increases sequence diversity specifically at hot spots that become active in the hybrids. As crossovers are disfavored at such hot spots, we propose that sequence divergence generated by hot spot turnover may create an impediment for recombination in hybrids, potentially leading to reduced fertility and, eventually, speciation. PMID:26833728
Isalan, M; Klug, A; Choo, Y
2001-07-01
DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.
Liu, Ying; Matthews, Kathleen S.; Bondos, Sarah E.
2008-01-01
During animal development, distinct tissues, organs, and appendages are specified through differential gene transcription by Hox transcription factors. However, the conserved Hox homeodomains bind DNA with high affinity yet low specificity. We have therefore explored the structure of the Drosophila melanogaster Hox protein Ultrabithorax and the impact of its nonhomeodomain regions on DNA binding properties. Computational and experimental approaches identified several conserved, intrinsically disordered regions outside the homeodomain of Ultrabithorax that impact DNA binding by the homeodomain. Full-length Ultrabithorax bound to target DNA 2.5-fold weaker than its isolated homeodomain. Using N-terminal and C-terminal deletion mutants, we demonstrate that the YPWM region and the disordered microexons (termed the I1 region) inhibit DNA binding ∼2-fold, whereas the disordered I2 region inhibits homeodomain-DNA interaction a further ∼40-fold. Binding is restored almost to homeodomain affinity by the mostly disordered N-terminal 174 amino acids (R region) in a length-dependent manner. Both the I2 and R regions contain portions of the activation domain, functionally linking DNA binding and transcription regulation. Given that (i) the I1 region and a portion of the R region alter homeodomain-DNA binding as a function of pH and (ii) an internal deletion within I1 increases Ultrabithorax-DNA affinity, I1 must directly impact homeodomain-DNA interaction energetics. However, I2 appears to indirectly affect DNA binding in a manner countered by the N terminus. The amino acid sequences of I2 and much of the I1 and R regions vary significantly among Ultrabithorax orthologues, potentially diversifying Hox-DNA interactions. PMID:18508761
NASA Astrophysics Data System (ADS)
Smith, Jarrod Anson
2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.
Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J
2002-03-08
An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.
Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène
2008-06-01
The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.
McLaughlin, Paul J; Keegan, Liam P
2014-08-01
Nearly 150 different enzymatically modified forms of the four canonical residues in RNA have been identified. For instance, enzymes of the ADAR (adenosine deaminase acting on RNA) family convert adenosine residues into inosine in cellular dsRNAs. Recent findings show that DNA endonuclease V enzymes have undergone an evolutionary transition from cleaving 3' to deoxyinosine in DNA and ssDNA to cleaving 3' to inosine in dsRNA and ssRNA in humans. Recent work on dsRNA-binding domains of ADARs and other proteins also shows that a degree of sequence specificity is achieved by direct readout in the minor groove. However, the level of sequence specificity observed is much less than that of DNA major groove-binding helix-turn-helix proteins. We suggest that the evolution of DNA-binding proteins following the RNA to DNA genome transition represents the major advantage that DNA genomes have over RNA genomes. We propose that a hypothetical RNA modification, a RRAR (ribose reductase acting on genomic dsRNA) produced the first stretches of DNA in RNA genomes. We discuss why this is the most satisfactory explanation for the origin of DNA. The evolution of this RNA modification and later steps to DNA genomes are likely to have been driven by cellular genome co-evolution with viruses and intragenomic parasites. RNA modifications continue to be involved in host-virus conflicts; in vertebrates, edited cellular dsRNAs with inosine-uracil base pairs appear to be recognized as self RNA and to suppress activation of innate immune sensors that detect viral dsRNA.
Golovenko, Dmitrij; Manakova, Elena; Zakrys, Linas; Zaremba, Mindaugas; Sasnauskas, Giedrius; Gražulis, Saulius; Siksnys, Virginijus
2014-01-01
The B3 DNA-binding domains (DBDs) of plant transcription factors (TF) and DBDs of EcoRII and BfiI restriction endonucleases (EcoRII-N and BfiI-C) share a common structural fold, classified as the DNA-binding pseudobarrel. The B3 DBDs in the plant TFs recognize a diverse set of target sequences. The only available co-crystal structure of the B3-like DBD is that of EcoRII-N (recognition sequence 5′-CCTGG-3′). In order to understand the structural and molecular mechanisms of specificity of B3 DBDs, we have solved the crystal structure of BfiI-C (recognition sequence 5′-ACTGGG-3′) complexed with 12-bp cognate oligoduplex. Structural comparison of BfiI-C–DNA and EcoRII-N–DNA complexes reveals a conserved DNA-binding mode and a conserved pattern of interactions with the phosphodiester backbone. The determinants of the target specificity are located in the loops that emanate from the conserved structural core. The BfiI-C–DNA structure presented here expands a range of templates for modeling of the DNA-bound complexes of the B3 family of plant TFs. PMID:24423868
Jakubec, David; Laskowski, Roman A.; Vondrasek, Jiri
2016-01-01
Decades of intensive experimental studies of the recognition of DNA sequences by proteins have provided us with a view of a diverse and complicated world in which few to no features are shared between individual DNA-binding protein families. The originally conceived direct readout of DNA residue sequences by amino acid side chains offers very limited capacity for sequence recognition, while the effects of the dynamic properties of the interacting partners remain difficult to quantify and almost impossible to generalise. In this work we investigated the energetic characteristics of all DNA residue—amino acid side chain combinations in the conformations found at the interaction interface in a very large set of protein—DNA complexes by the means of empirical potential-based calculations. General specificity-defining criteria were derived and utilised to look beyond the binding motifs considered in previous studies. Linking energetic favourability to the observed geometrical preferences, our approach reveals several additional amino acid motifs which can distinguish between individual DNA bases. Our results remained valid in environments with various dielectric properties. PMID:27384774
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schormann, Norbert; Zhukovskaya, Natalia; Bedwell, Gregory
We report that uracil-DNA glycosylases are ubiquitous enzymes, which play a key role repairing damages in DNA and in maintaining genomic integrity by catalyzing the first step in the base excision repair pathway. Within the superfamily of uracil-DNA glycosylases family I enzymes or UNGs are specific for recognizing and removing uracil from DNA. These enzymes feature conserved structural folds, active site residues and use common motifs for DNA binding, uracil recognition and catalysis. Within this family the enzymes of poxviruses are unique and most remarkable in terms of amino acid sequences, characteristic motifs and more importantly for their novel non-enzymaticmore » function in DNA replication. UNG of vaccinia virus, also known as D4, is the most extensively characterized UNG of the poxvirus family. D4 forms an unusual heterodimeric processivity factor by attaching to a poxvirus-specific protein A20, which also binds to the DNA polymerase E9 and recruits other proteins necessary for replication. D4 is thus integrated in the DNA polymerase complex, and its DNA-binding and DNA scanning abilities couple DNA processivity and DNA base excision repair at the replication fork. In conclusion, the adaptations necessary for taking on the new function are reflected in the amino acid sequence and the three-dimensional structure of D4. We provide an overview of the current state of the knowledge on the structure-function relationship of D4.« less
Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.
2012-01-01
X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624
A Link between ORC-Origin Binding Mechanisms and Origin Activation Time Revealed in Budding Yeast
Hoggard, Timothy; Shor, Erika; Müller, Carolin A.; Nieduszynski, Conrad A.; Fox, Catherine A.
2013-01-01
Eukaryotic DNA replication origins are selected in G1-phase when the origin recognition complex (ORC) binds chromosomal positions and triggers molecular events culminating in the initiation of DNA replication (a.k.a. origin firing) during S-phase. Each chromosome uses multiple origins for its duplication, and each origin fires at a characteristic time during S-phase, creating a cell-type specific genome replication pattern relevant to differentiation and genome stability. It is unclear whether ORC-origin interactions are relevant to origin activation time. We applied a novel genome-wide strategy to classify origins in the model eukaryote Saccharomyces cerevisiae based on the types of molecular interactions used for ORC-origin binding. Specifically, origins were classified as DNA-dependent when the strength of ORC-origin binding in vivo could be explained by the affinity of ORC for origin DNA in vitro, and, conversely, as ‘chromatin-dependent’ when the ORC-DNA interaction in vitro was insufficient to explain the strength of ORC-origin binding in vivo. These two origin classes differed in terms of nucleosome architecture and dependence on origin-flanking sequences in plasmid replication assays, consistent with local features of chromatin promoting ORC binding at ‘chromatin-dependent’ origins. Finally, the ‘chromatin-dependent’ class was enriched for origins that fire early in S-phase, while the DNA-dependent class was enriched for later firing origins. Conversely, the latest firing origins showed a positive association with the ORC-origin DNA paradigm for normal levels of ORC binding, whereas the earliest firing origins did not. These data reveal a novel association between ORC-origin binding mechanisms and the regulation of origin activation time. PMID:24068963
MFP1 is a thylakoid-associated, nucleoid-binding protein with a coiled-coil structure
Jeong, Sun Yong; Rose, Annkatrin; Meier, Iris
2003-01-01
Plastid DNA, like bacterial and mitochondrial DNA, is organized into protein–DNA complexes called nucleoids. Plastid nucleoids are believed to be associated with the inner envelope in developing plastids and the thylakoid membranes in mature chloroplasts, but the mechanism for this re-localization is unknown. Here, we present the further characterization of the coiled-coil DNA-binding protein MFP1 as a protein associated with nucleoids and with the thylakoid membranes in mature chloroplasts. MFP1 is located in plastids in both suspension culture cells and leaves and is attached to the thylakoid membranes with its C-terminal DNA-binding domain oriented towards the stroma. It has a major DNA-binding activity in mature Arabidopsis chloroplasts and binds to all tested chloroplast DNA fragments without detectable sequence specificity. Its expression is tightly correlated with the accumulation of thylakoid membranes. Importantly, it is associated in vivo with nucleoids, suggesting a function for MFP1 at the interface between chloroplast nucleoids and the developing thylakoid membrane system. PMID:12930969
Moody, Colleen L; Tretyachenko-Ladokhina, Vira; Laue, Thomas M; Senear, Donald F; Cocco, Melanie J
2011-08-09
The cytidine repressor (CytR) is a member of the LacR family of bacterial repressors with distinct functional features. The Escherichia coli CytR regulon comprises nine operons whose palindromic operators vary in both sequence and, most significantly, spacing between the recognition half-sites. This suggests a strong likelihood that protein folding would be coupled to DNA binding as a mechanism to accommodate the variety of different operator architectures to which CytR is targeted. Such coupling is a common feature of sequence-specific DNA-binding proteins, including the LacR family repressors; however, there are no significant structural rearrangements upon DNA binding within the three-helix DNA-binding domains (DBDs) studied to date. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the CytR DBD free in solution and to determine the high-resolution structure of a CytR DBD monomer bound specifically to one DNA half-site of the uridine phosphorylase (udp) operator. We find that the free DBD populates multiple distinct conformations distinguished by up to four sets of NMR peaks per residue. This structural heterogeneity is previously unknown in the LacR family. These stable structures coalesce into a single, more stable udp-bound form that features a three-helix bundle containing a canonical helix-turn-helix motif. However, this structure differs from all other LacR family members whose structures are known with regard to the packing of the helices and consequently their relative orientations. Aspects of CytR activity are unique among repressors; we identify here structural properties that are also distinct and that might underlie the different functional properties. © 2011 American Chemical Society
DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.
Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford
2017-10-01
Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Yan, Qin; Gong, Lili; Deng, Mi; Zhang, Lan; Sun, Shuming; Liu, Jiao; Ma, Haili; Yuan, Dan; Chen, Pei-Chao; Hu, Xiaohui; Liu, Jinping; Qin, Jichao; Xiao, Ling; Huang, Xiao-Qin; Zhang, Jian; Wan-Cheng Li, David
2010-01-01
Pax-6 is an evolutionarily conserved transcription factor regulating brain and eye development. Four Pax-6 isoforms have been reported previously. Although the longer Pax-6 isoforms (p46 and p48) bear two DNA-binding domains, the paired domain (PD) and the homeodomain (HD), the shorter Pax-6 isoform p32 contains only the HD for DNA binding. Although a third domain, the proline-, serine- and threonine-enriched activation (PST) domain, in the C termini of all Pax-6 isoforms mediates their transcriptional modulation via phosphorylation, how p32 Pax-6 could regulate target genes remains to be elucidated. In the present study, we show that sumoylation at K91 is required for p32 Pax-6 to bind to a HD-specific site and regulate expression of target genes. First, in vitro-synthesized p32 Pax-6 alone cannot bind the P3 sequence, which contains the HD recognition site, unless it is preincubated with nuclear extracts precleared by anti–Pax-6 but not by anti-small ubiquitin-related modifier 1 (anti-SUMO1) antibody. Second, in vitro-synthesized p32 Pax-6 can be sumoylated by SUMO1, and the sumoylated p32 Pax-6 then can bind to the P3 sequence. Third, Pax-6 and SUMO1 are colocalized in the embryonic optic and lens vesicles and can be coimmunoprecipitated. Finally, SUMO1-conjugated p32 Pax-6 exists in both the nucleus and cytoplasm, and sumoylation significantly enhances the DNA-binding ability of p32 Pax-6 and positively regulates gene expression. Together, our results demonstrate that sumoylation activates p32 Pax-6 in both DNA-binding and transcriptional activities. In addition, our studies demonstrate that p32 and p46 Pax-6 possess differential DNA-binding and regulatory activities. PMID:21084637
Many human accelerated regions are developmental enhancers
Capra, John A.; Erwin, Genevieve D.; McKinsey, Gabriel; Rubenstein, John L. R.; Pollard, Katherine S.
2013-01-01
The genetic changes underlying the dramatic differences in form and function between humans and other primates are largely unknown, although it is clear that gene regulatory changes play an important role. To identify regulatory sequences with potentially human-specific functions, we and others used comparative genomics to find non-coding regions conserved across mammals that have acquired many sequence changes in humans since divergence from chimpanzees. These regions are good candidates for performing human-specific regulatory functions. Here, we analysed the DNA sequence, evolutionary history, histone modifications, chromatin state and transcription factor (TF) binding sites of a combined set of 2649 non-coding human accelerated regions (ncHARs) and predicted that at least 30% of them function as developmental enhancers. We prioritized the predicted ncHAR enhancers using analysis of TF binding site gain and loss, along with the functional annotations and expression patterns of nearby genes. We then tested both the human and chimpanzee sequence for 29 ncHARs in transgenic mice, and found 24 novel developmental enhancers active in both species, 17 of which had very consistent patterns of activity in specific embryonic tissues. Of these ncHAR enhancers, five drove expression patterns suggestive of different activity for the human and chimpanzee sequence at embryonic day 11.5. The changes to human non-coding DNA in these ncHAR enhancers may modify the complex patterns of gene expression necessary for proper development in a human-specific manner and are thus promising candidates for understanding the genetic basis of human-specific biology. PMID:24218637
Role of sequence encoded κB DNA geometry in gene regulation by Dorsal
Mrinal, Nirotpal; Tomar, Archana; Nagaraju, Javaregowda
2011-01-01
Many proteins of the Rel family can act as both transcriptional activators and repressors. However, mechanism that discerns the ‘activator/repressor’ functions of Rel-proteins such as Dorsal (Drosophila homologue of mammalian NFκB) is not understood. Using genomic, biophysical and biochemical approaches, we demonstrate that the underlying principle of this functional specificity lies in the ‘sequence-encoded structure’ of the κB-DNA. We show that Dorsal-binding motifs exist in distinct activator and repressor conformations. Molecular dynamics of DNA-Dorsal complexes revealed that repressor κB-motifs typically have A-tract and flexible conformation that facilitates interaction with co-repressors. Deformable structure of repressor motifs, is due to changes in the hydrogen bonding in A:T pair in the ‘A-tract’ core. The sixth nucleotide in the nonameric κB-motif, ‘A’ (A6) in the repressor motifs and ‘T’ (T6) in the activator motifs, is critical to confer this functional specificity as A6 → T6 mutation transformed flexible repressor conformation into a rigid activator conformation. These results highlight that ‘sequence encoded κB DNA-geometry’ regulates gene expression by exerting allosteric effect on binding of Rel proteins which in turn regulates interaction with co-regulators. Further, we identified and characterized putative repressor motifs in Dl-target genes, which can potentially aid in functional annotation of Dorsal gene regulatory network. PMID:21890896
Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S
2007-02-27
Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.
King, Justin J.; Amemiya, Chris T.; Hsu, Ellen
2017-01-01
ABSTRACT Activation-induced cytidine deaminase (AID) is a genome-mutating enzyme that initiates class switch recombination and somatic hypermutation of antibodies in jawed vertebrates. We previously described the biochemical properties of human AID and found that it is an unusual enzyme in that it exhibits binding affinities for its substrate DNA and catalytic rates several orders of magnitude higher and lower, respectively, than a typical enzyme. Recently, we solved the functional structure of AID and demonstrated that these properties are due to nonspecific DNA binding on its surface, along with a catalytic pocket that predominantly assumes a closed conformation. Here we investigated the biochemical properties of AID from a sea lamprey, nurse shark, tetraodon, and coelacanth: representative species chosen because their lineages diverged at the earliest critical junctures in evolution of adaptive immunity. We found that these earliest-diverged AID orthologs are active cytidine deaminases that exhibit unique substrate specificities and thermosensitivities. Significant amino acid sequence divergence among these AID orthologs is predicted to manifest as notable structural differences. However, despite major differences in sequence specificities, thermosensitivities, and structural features, all orthologs share the unusually high DNA binding affinities and low catalytic rates. This absolute conservation is evidence for biological significance of these unique biochemical properties. PMID:28716949
Song, Wei; Guo, Jun-Tao
2015-01-01
Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.
Presence of DNA methyltransferase activity and CpC methylation in Drosophila melanogaster.
Panikar, Chitra S; Rajpathak, Shriram N; Abhyankar, Varada; Deshmukh, Saniya; Deobagkar, Deepti D
2015-12-01
Drosophila melanogaster lacks DNMT1/DNMT3 based methylation machinery. Despite recent reports confirming the presence of low DNA methylation in Drosophila; little is known about the methyltransferase. Therefore, in this study, we have aimed to investigate the possible functioning of DNA methyltransferase in Drosophila. The 14 K oligo microarray slide was incubated with native cell extract from adult Drosophila to check the presence of the methyltransferase activity. After incubation under appropriate conditions, the methylated oligo sequences were identified by the binding of anti 5-methylcytosine monoclonal antibody. The antibody bound to the methylated oligos was detected using Cy3 labeled secondary antibody. Methylation sensitive restriction enzyme mediated PCR was used to assess the methylation at a few selected loci identified on the array. It could be seen that a few of the total oligos got methylated under the assay conditions. Analysis of methylated oligo sequences provides evidence for the presence of de novo methyltransferase activity and allows identification of its sequence specificity in adult Drosophila. With the help of methylation sensitive enzymes we could detect presence of CpC methylation in the selected genomic regions. This study reports presence of an active DNA methyltransferase in adult Drosophila, which exhibits sequence specificity confirmed by presence of asymmetric methylation at corresponding sites in the genomic DNA. It also provides an innovative approach to investigate methylation specificity of a native methyltransferase.
DNA binding of the p21 repressor ZBTB2 is inhibited by cytosine hydroxymethylation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lafaye, Céline; Barbier, Ewa; Miscioscia, Audrey
2014-03-28
Highlights: • 5-hmC epigenetic modification is measurable in HeLa, SH-SY5Y and UT7-MPL cell lines. • ZBTB2 binds to DNA probes containing 5-mC but not to sequences containing 5-hmC. • This differential binding is verified with DNA sequences involved in p21 regulation. - Abstract: Recent studies have demonstrated that the modified base 5-hydroxymethylcytosine (5-hmC) is detectable at various rates in DNA extracted from human tissues. This oxidative product of 5-methylcytosine (5-mC) constitutes a new and important actor of epigenetic mechanisms. We designed a DNA pull down assay to trap and identify nuclear proteins bound to 5-hmC and/or 5-mC. We applied thismore » strategy to three cancerous cell lines (HeLa, SH-SY5Y and UT7-MPL) in which we also measured 5-mC and 5-hmC levels by HPLC-MS/MS. We found that the putative oncoprotein Zinc finger and BTB domain-containing protein 2 (ZBTB2) is associated with methylated DNA sequences and that this interaction is inhibited by the presence of 5-hmC replacing 5-mC. As published data mention ZBTB2 recognition of p21 regulating sequences, we verified that this sequence specific binding was also alleviated by 5-hmC. ZBTB2 being considered as a multifunctional cell proliferation activator, notably through p21 repression, this work points out new epigenetic processes potentially involved in carcinogenesis.« less
Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.
2017-01-01
The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171
Accurate and sensitive quantification of protein-DNA binding affinity.
Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J
2018-04-17
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.
Accurate and sensitive quantification of protein-DNA binding affinity
Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.
2018-01-01
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332
Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.
2012-01-01
Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691
Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J
2012-06-01
Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.
Gabsalilow, Lilia; Schierling, Benno; Friedhoff, Peter; Pingoud, Alfred; Wende, Wolfgang
2013-04-01
Targeted genome engineering requires nucleases that introduce a highly specific double-strand break in the genome that is either processed by homology-directed repair in the presence of a homologous repair template or by non-homologous end-joining (NHEJ) that usually results in insertions or deletions. The error-prone NHEJ can be efficiently suppressed by 'nickases' that produce a single-strand break rather than a double-strand break. Highly specific nickases have been produced by engineering of homing endonucleases and more recently by modifying zinc finger nucleases (ZFNs) composed of a zinc finger array and the catalytic domain of the restriction endonuclease FokI. These ZF-nickases work as heterodimers in which one subunit has a catalytically inactive FokI domain. We present two different approaches to engineer highly specific nickases; both rely on the sequence-specific nicking activity of the DNA mismatch repair endonuclease MutH which we fused to a DNA-binding module, either a catalytically inactive variant of the homing endonuclease I-SceI or the DNA-binding domain of the TALE protein AvrBs4. The fusion proteins nick strand specifically a bipartite recognition sequence consisting of the MutH and the I-SceI or TALE recognition sequences, respectively, with a more than 1000-fold preference over a stand-alone MutH site. TALE-MutH is a programmable nickase.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Agarkar, Vinod B.; Babayeva, Nigar D.; Rizzino, Angie
2010-10-08
Ets proteins are transcription factors that activate or repress the expression of genes that are involved in various biological processes, including cellular proliferation, differentiation, development, transformation and apoptosis. Like other Ets-family members, Elf3 functions as a sequence-specific DNA-binding transcriptional factor. A mouse Elf3 C-terminal fragment (amino-acid residues 269-371) containing the DNA-binding domain has been crystallized in complex with mouse type II TGF-{beta} receptor promoter (TR-II) DNA. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 42.66, b = 52, c = 99.78 {angstrom}, and diffracted to a resolution of 2.2 {angstrom}.
Structure-Function Relationships in Human Testis-determining Factor SRY
Racca, Joseph D.; Chen, Yen-Shan; Maloy, James D.; Wickramasinghe, Nalinda; Phillips, Nelson B.; Weiss, Michael A.
2014-01-01
Human testis determination is initiated by SRY, a Y-encoded architectural transcription factor. Mutations in SRY cause 46 XY gonadal dysgenesis with female somatic phenotype (Swyer syndrome) and confer a high risk of malignancy (gonadoblastoma). Such mutations cluster in the SRY high mobility group (HMG) box, a conserved motif of specific DNA binding and bending. To explore structure-function relationships, we constructed all possible substitutions at a site of clinical mutation (W70L). Our studies thus focused on a core aromatic residue (position 15 of the consensus HMG box) that is invariant among SRY-related HMG box transcription factors (the SOX family) and conserved as aromatic (Phe or Tyr) among other sequence-specific boxes. In a yeast one-hybrid system sensitive to specific SRY-DNA binding, the variant domains exhibited reduced (Phe and Tyr) or absent activity (the remaining 17 substitutions). Representative nonpolar variants with partial or absent activity (Tyr, Phe, Leu, and Ala in order of decreasing side-chain volume) were chosen for study in vitro and in mammalian cell culture. The clinical mutation (Leu) was found to markedly impair multiple biochemical and cellular activities as respectively probed through the following: (i) in vitro assays of specific DNA binding and protein stability, and (ii) cell culture-based assays of proteosomal degradation, nuclear import, enhancer DNA occupancy, and SRY-dependent transcriptional activation. Surprisingly, however, DNA bending is robust to this or the related Ala substitution that profoundly impairs box stability. Together, our findings demonstrate that the folding, trafficking, and gene-regulatory function of SRY requires an invariant aromatic “buttress” beneath its specific DNA-bending surface. PMID:25258310
Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui
2017-06-01
The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.
The Epigenomic Landscape of Prokaryotes
Blow, Matthew J.; Clark, Tyson A.; Daum, Chris G.; ...
2016-02-12
DNA methylation acts in concert with restriction enzymes to protect the integrity of prokaryotic genomes. Studies in a limited number of organisms suggest that methylation also contributes to prokaryotic genome regulation, but the prevalence and properties of such non-restriction-associated methylation systems remain poorly understood. Here, we used single molecule, real-time sequencing to map DNA modifications including m6A, m4C, and m5C across the genomes of 230 diverse bacterial and archaeal species. We observed DNA methylation in nearly all (93%) organisms examined, and identified a total of 834 distinct reproducibly methylated motifs. This data enabled annotation of the DNA binding specificities ofmore » 620 DNA Methyltransferases (MTases), doubling known specificities for previously hard to study Type I, IIG and III MTases, and revealing their extraordinary diversity. Strikingly, 48% of organisms harbor active Type II MTases with no apparent cognate restriction enzyme. These active ‘orphan’ MTases are present in diverse bacterial and archaeal phyla and show motif specificities and methylation patterns consistent with functions in gene regulation and DNA replication. Our results reveal the pervasive presence of DNA methylation throughout the prokaryotic kingdoms, as well as the diversity of sequence specificities and potential functions of DNA methylation systems.« less
The Epigenomic Landscape of Prokaryotes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blow, Matthew J.; Clark, Tyson A.; Daum, Chris G.
DNA methylation acts in concert with restriction enzymes to protect the integrity of prokaryotic genomes. Studies in a limited number of organisms suggest that methylation also contributes to prokaryotic genome regulation, but the prevalence and properties of such non-restriction-associated methylation systems remain poorly understood. Here, we used single molecule, real-time sequencing to map DNA modifications including m6A, m4C, and m5C across the genomes of 230 diverse bacterial and archaeal species. We observed DNA methylation in nearly all (93%) organisms examined, and identified a total of 834 distinct reproducibly methylated motifs. This data enabled annotation of the DNA binding specificities ofmore » 620 DNA Methyltransferases (MTases), doubling known specificities for previously hard to study Type I, IIG and III MTases, and revealing their extraordinary diversity. Strikingly, 48% of organisms harbor active Type II MTases with no apparent cognate restriction enzyme. These active ‘orphan’ MTases are present in diverse bacterial and archaeal phyla and show motif specificities and methylation patterns consistent with functions in gene regulation and DNA replication. Our results reveal the pervasive presence of DNA methylation throughout the prokaryotic kingdoms, as well as the diversity of sequence specificities and potential functions of DNA methylation systems.« less
Terrados, Gloria; Finkernagel, Florian; Stielow, Bastian; Sadic, Dennis; Neubert, Juliane; Herdt, Olga; Krause, Michael; Scharfe, Maren; Jarek, Michael; Suske, Guntram
2012-01-01
The transcription factor Sp2 is essential for early mouse development and for proliferation of mouse embryonic fibroblasts in culture. Yet its mechanisms of action and its target genes are largely unknown. In this study, we have combined RNA interference, in vitro DNA binding, chromatin immunoprecipitation sequencing and global gene-expression profiling to investigate the role of Sp2 for cellular functions, to define target sites and to identify genes regulated by Sp2. We show that Sp2 is important for cellular proliferation that it binds to GC-boxes and occupies proximal promoters of genes essential for vital cellular processes including gene expression, replication, metabolism and signalling. Moreover, we identified important key target genes and cellular pathways that are directly regulated by Sp2. Most significantly, Sp2 binds and activates numerous sequence-specific transcription factor and co-activator genes, and represses the whole battery of cholesterol synthesis genes. Our results establish Sp2 as a sequence-specific regulator of vitally important genes. PMID:22684502
Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu
2007-03-01
Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.
Recognition of Local DNA Structures by p53 Protein
Brázda, Václav; Coufal, Jan
2017-01-01
p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646
Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.
Allevato, Michael; Bolotin, Eugene; Grossman, Mark; Mane-Padros, Daniel; Sladek, Frances M; Martinez, Ernest
2017-01-01
The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX) bind Enhancer box (E-box) DNA elements (CANNTG) and have the greatest affinity for the canonical MYC E-box (CME) CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87%) of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.
Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan
2016-04-20
DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .
In vitro fluorescence studies of transcription factor IIB-DNA interaction.
Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta
2015-01-01
General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.
Vipond, I B; Moon, B J; Halford, S E
1996-02-13
The EcoRV restriction endonuclease cleaves DNA at its recognition sequence more readily with Mg2+ as the cofactor than with Mn2+ but, at noncognate sequences that differ from the EcoRV site by one base pair, Mn2+ gives higher rates than Mg2+. A mutant of EcoRV, in which an isoleucine near the active site was replaced by leucine, showed the opposite behavior. It had low activity with Mg2+, but, in the presence of Mn2+ ions, it cleaved the recognition site faster than wild-type EcoRV with either Mn2+ or Mg2+. The mutant was also more specific for the recognition sequence than the native enzyme: the noncognate DNA cleavages by wild-type EcoRV and Mn2+ were not detected with the mutant. Further mutagenesis showed that the protein required the same acidic residues at its active site as wild-type EcoRV. The Ile-->Leu mutation seems to perturb the configuration of the metal-binding ligands at the active site so that the protein has virtually no affinity for Mg2+ yet it can still bind Mn2+ ions, though the latter only occurs when the protein is at the recognition site. This contrasts to wild-type EcoRV, where Mn2+ ions bind readily to complexes with either cognate and noncognate DNA and only Mg2+ shows the discrimination between the complexes. The structural perturbation is a specific consequence of leucine in place of isoleucine, since mutants with valine or alanine were similar to wild-type EcoRV.
A Feature-Based Approach to Modeling Protein–DNA Interactions
Segal, Eran
2008-01-01
Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950
Grove, A; Galeone, A; Mayol, L; Geiduschek, E P
1996-07-12
TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.
Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.
Sasaki, H; Yokoyama, E; Kuroiwa, A
1990-01-01
The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Transcription Factors Bind Thousands of Active and InactiveRegions in the Drosophila Blastoderm
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Xiao-Yong; MacArthur, Stewart; Bourgon, Richard
2008-01-10
Identifying the genomic regions bound by sequence-specific regulatory factors is central both to deciphering the complex DNA cis-regulatory code that controls transcription in metazoans and to determining the range of genes that shape animal morphogenesis. Here, we use whole-genome tiling arrays to map sequences bound in Drosophila melanogaster embryos by the six maternal and gap transcription factors that initiate anterior-posterior patterning. We find that these sequence-specific DNA binding proteins bind with quantitatively different specificities to highly overlapping sets of several thousand genomic regions in blastoderm embryos. Specific high- and moderate-affinity in vitro recognition sequences for each factor are enriched inmore » bound regions. This enrichment, however, is not sufficient to explain the pattern of binding in vivo and varies in a context-dependent manner, demonstrating that higher-order rules must govern targeting of transcription factors. The more highly bound regions include all of the over forty well-characterized enhancers known to respond to these factors as well as several hundred putative new cis-regulatory modules clustered near developmental regulators and other genes with patterned expression at this stage of embryogenesis. The new targets include most of the microRNAs (miRNAs) transcribed in the blastoderm, as well as all major zygotically transcribed dorsal-ventral patterning genes, whose expression we show to be quantitatively modulated by anterior-posterior factors. In addition to these highly bound regions, there are several thousand regions that are reproducibly bound at lower levels. However, these poorly bound regions are, collectively, far more distant from genes transcribed in the blastoderm than highly bound regions; are preferentially found in protein-coding sequences; and are less conserved than highly bound regions. Together these observations suggest that many of these poorly-bound regions are not involved in early-embryonic transcriptional regulation, and a significant proportion may be nonfunctional. Surprisingly, for five of the six factors, their recognition sites are not unambiguously more constrained evolutionarily than the immediate flanking DNA, even in more highly bound and presumably functional regions, indicating that comparative DNA sequence analysis is limited in its ability to identify functional transcription factor targets.« less
NASA Astrophysics Data System (ADS)
Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih
2017-04-01
Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.
Regulatory Phosphorylation of Ikaros by Bruton's Tyrosine Kinase
Zhang, Jian; Ishkhanian, Rita; Uckun, Fatih M.
2013-01-01
Diminished Ikaros function has been implicated in the pathogenesis of acute lymphoblastic leukemia (ALL), the most common form of childhood cancer. Therefore, a stringent regulation of Ikaros is of paramount importance for normal lymphocyte ontogeny. Here we provide genetic and biochemical evidence for a previously unknown function of Bruton's tyrosine kinase (BTK) as a partner and posttranslational regulator of Ikaros, a zinc finger-containing DNA-binding protein that plays a pivotal role in immune homeostasis. We demonstrate that BTK phosphorylates Ikaros at unique phosphorylation sites S214 and S215 in the close vicinity of its zinc finger 4 (ZF4) within the DNA binding domain, thereby augmenting its nuclear localization and sequence-specific DNA binding activity. Our results further demonstrate that BTK-induced activating phosphorylation is critical for the optimal transcription factor function of Ikaros. PMID:23977012
MorTAL Kombat: the story of defense against TAL effectors through loss-of-susceptibility
Hutin, Mathilde; Pérez-Quintero, Alvaro L.; Lopez, Camilo; Szurek, Boris
2015-01-01
Many plant-pathogenic xanthomonads rely on Transcription Activator-Like (TAL) effectors to colonize their host. This particular family of type III effectors functions as specific plant transcription factors via a programmable DNA-binding domain. Upon binding to the promoters of plant disease susceptibility genes in a sequence-specific manner, the expression of these host genes is induced. However, plants have evolved specific strategies to counter the action of TAL effectors and confer resistance. One mechanism is to avoid the binding of TAL effectors by mutations of their DNA binding sites, resulting in resistance by loss-of-susceptibility. This article reviews our current knowledge of the susceptibility hubs targeted by Xanthomonas TAL effectors, possible evolutionary scenarios for plants to combat the pathogen with loss-of-function alleles, and how this knowledge can be used overall to develop new pathogen-informed breeding strategies and improve crop resistance. PMID:26236326
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.
Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A
2014-03-06
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9
NASA Astrophysics Data System (ADS)
Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.
2014-03-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
RPA and POT1: friends or foes at telomeres?
Flynn, Rachel Litman; Chang, Sandy; Zou, Lee
2012-02-15
Telomere maintenance in cycling cells relies on both DNA replication and capping by the protein complex shelterin. Two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomere 1 (POT1) play critical roles in DNA replication and telomere capping, respectively. While RPA binds to ssDNA in a non-sequence-specific manner, POT1 specifically recognizes singlestranded TTAGGG telomeric repeats. Loss of POT1 leads to aberrant accumulation of RPA at telomeres and activation of the ataxia telangiectasia and Rad3-related kinase (ATR)-mediated checkpoint response, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. The requirement for both POT1 and RPA in telomere maintenance and the antagonism between the two proteins raises the important question of how they function in concert on telomeric ssDNA. Two interesting models were proposed by recent studies to explain the regulation of POT1 and RPA at telomeres. Here, we discuss how these models help unravel the coordination, and also the antagonism, between POT1 and RPA during the cell cycle.
Understanding the mechanisms of protein-DNA interactions
NASA Astrophysics Data System (ADS)
Lavery, Richard
2004-03-01
Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.
Quantitative determination of testosterone levels with biolayer interferometry.
Zhang, Hao; Li, Wei; Luo, Hong; Xiong, Guangming; Yu, Yuanhua
2017-10-01
Natural and synthetic steroid hormones are widely spread in the environment and are considered as pollutants due to their endocrine activities, even at low concentrations, which are harmful to human health. To detect steroid hormones in the environment, a novel biosensor system was developed based on the principle of biolayer interferometry. Detection is based on changes in the interference pattern of white light reflected from the surface of an optical fiber with bound biomolecules. Monitoring interactions between molecules does not require radioactive, enzymatic, or fluorescent labels. Here, 2 double-stranded DNA fragments of operator 1 (OP1) and OP2 containing 10-bp palindromic sequences in chromosomal Comamonas testosteroni DNA (ATCC11996) were surface-immobilized to streptavidin sensors. Interference changes were detected when repressor protein RepA bound the DNA sequences. DNA-protein interactions were characterized and kinetic parameters were obtained. The dissociation constants between the OP1 and OP2 DNA sequences and RepA were 9.865 × 10 -9 M and 2.750 × 10 -8 M, respectively. The reactions showed high specifically and affinity. Because binding of the 10-bp palindromic sequence and RepA was affected by RepA-testosterone binding, the steroid could be quantitatively determined rapidly using the biosensor system. The mechanism of the binding assay was as follows. RepA could bind both OP1 and testosterone. RepA binding to testosterone changed the protein conformation, which influenced the binding between RepA and OP1. The percentage of the signal detected negative correlation with the testosterone concentration. A standard curve was obtained, and the correlation coefficient value was approximately 0.97. We could quantitatively determine testosterone levels between 2.13 and 136.63 ng/ml. Each sample could be quantitatively detected in 17 min. These results suggested that the specific interaction between double-stranded OP1 DNA and the RepA protein could be used to rapidly and quantitatively determine environmental testosterone levels by the biolayer interferometry technique. Copyright © 2017 Elsevier B.V. All rights reserved.
Position specific variation in the rate of evolution in transcription factor binding sites
Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B
2003-01-01
Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282
Modulating the DNA affinity of Elk-1 with computationally selected mutations.
Park, Sheldon; Boder, Eric T; Saven, Jeffery G
2005-04-22
In order to regulate gene expression, transcription factors must first bind their target DNA sequences. The affinity of this binding is determined by both the network of interactions at the interface and the entropy change associated with the complex formation. To study the role of structural fluctuation in fine-tuning DNA affinity, we performed molecular dynamics simulations of two highly homologous proteins, Elk-1 and SAP-1, that exhibit different sequence specificity. Simulation studies show that several residues in Elk have significantly higher main-chain root-mean-square deviations than their counterparts in SAP. In particular, a single residue, D69, may contribute to Elk's lower DNA affinity for P(c-fos) by structurally destabilizing the carboxy terminus of the recognition helix. While D69 does not contact DNA directly, the increased mobility in the region may contribute to its weaker binding. We measured the ability of single point mutants of Elk to bind P(c-fos) in a reporter assay, in which D69 of wild-type Elk has been mutated to other residues with higher helix propensity in order to stabilize the local conformation. The gains in transcriptional activity and the free energy of binding suggested from these measurements correlate well with stability gains computed from helix propensity and charge-macrodipole interactions. The study suggests that residues that are distal to the binding interface may indirectly modulate the binding affinity by stabilizing the protein scaffold required for efficient DNA interaction.
Directed evolution of the TALE N-terminal domain for recognition of all 5' bases.
Lamb, Brian M; Mercer, Andrew C; Barbas, Carlos F
2013-11-01
Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5'-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5' T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5' T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes.
MotifMark: Finding regulatory motifs in DNA sequences.
Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L; Wang, May D
2017-07-01
The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity between proteins and DNA motifs. Despite their success, these technologies have their own limitations and fall short in precise characterization of motifs, and as a result, require further downstream analysis to extract useful and interpretable information from a haystack of noisy and inaccurate data. Here we propose MotifMark, a new algorithm based on graph theory and machine learning, that can find binding sites on candidate probes and rank their specificity in regard to the underlying transcription factor. We developed a pipeline to analyze experimental data derived from compact universal protein binding microarrays and benchmarked it against two of the most accurate motif search methods. Our results indicate that MotifMark can be a viable alternative technique for prediction of motif from protein binding microarrays and possibly other related high-throughput techniques.
NASA Astrophysics Data System (ADS)
Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim
2016-03-01
DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e
NASA Astrophysics Data System (ADS)
Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.
1984-08-01
A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.
Farasat, Iman; Salis, Howard M.
2016-01-01
The ability to precisely modify genomes and regulate specific genes will greatly accelerate several medical and engineering applications. The CRISPR/Cas9 (Type II) system binds and cuts DNA using guide RNAs, though the variables that control its on-target and off-target activity remain poorly characterized. Here, we develop and parameterize a system-wide biophysical model of Cas9-based genome editing and gene regulation to predict how changing guide RNA sequences, DNA superhelical densities, Cas9 and crRNA expression levels, organisms and growth conditions, and experimental conditions collectively control the dynamics of dCas9-based binding and Cas9-based cleavage at all DNA sites with both canonical and non-canonical PAMs. We combine statistical thermodynamics and kinetics to model Cas9:crRNA complex formation, diffusion, site selection, reversible R-loop formation, and cleavage, using large amounts of structural, biochemical, expression, and next-generation sequencing data to determine kinetic parameters and develop free energy models. Our results identify DNA supercoiling as a novel mechanism controlling Cas9 binding. Using the model, we predict Cas9 off-target binding frequencies across the lambdaphage and human genomes, and explain why Cas9’s off-target activity can be so high. With this improved understanding, we propose several rules for designing experiments for minimizing off-target activity. We also discuss the implications for engineering dCas9-based genetic circuits. PMID:26824432
Structure-affinity relationships for the binding of actinomycin D to DNA
NASA Astrophysics Data System (ADS)
Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico
1997-03-01
Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.
Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin
Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K.; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga
2015-01-01
Insulators are multiprotein–DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. PMID:25342723
Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun
2017-06-02
G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
The Replication Focus Targeting Sequence (RFTS) Domain Is a DNA-competitive Inhibitor of Dnmt1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Syeda, Farisa; Fagan, Rebecca L.; Wean, Matthew
Dnmt1 (DNA methyltransferase 1) is the principal enzyme responsible for maintenance of cytosine methylation at CpG dinucleotides in the mammalian genome. The N-terminal replication focus targeting sequence (RFTS) domain of Dnmt1 has been implicated in subcellular localization, protein association, and catalytic function. However, progress in understanding its function has been limited by the lack of assays for and a structure of this domain. Here, we show that the naked DNA- and polynucleosome-binding activities of Dnmt1 are inhibited by the RFTS domain, which functions by virtue of binding the catalytic domain to the exclusion of DNA. Kinetic analysis with a fluorogenicmore » DNA substrate established the RFTS domain as a 600-fold inhibitor of Dnmt1 enzymatic activity. The crystal structure of the RFTS domain reveals a novel fold and supports a mechanism in which an RFTS-targeted Dnmt1-binding protein, such as Uhrf1, may activate Dnmt1 for DNA binding.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akabayov, B.; Lee, S; Akabayov, S
2009-01-01
Synthesis of oligoribonucleotide primers for lagging-strand DNA synthesis in the DNA replication system of bacteriophage T7 is catalyzed by the primase domain of the gene 4 helicase-primase. The primase consists of a zinc-binding domain (ZBD) and an RNA polymerase (RPD) domain. The ZBD is responsible for recognition of a specific sequence in the ssDNA template whereas catalytic activity resides in the RPD. The ZBD contains a zinc ion coordinated with four cysteine residues. We have examined the ligation state of the zinc ion by X-ray absorption spectroscopy and biochemical analysis of genetically altered primases. The ZBD of primase engaged inmore » catalysis exhibits considerable asymmetry in coordination to zinc, as evidenced by a gradual increase in electron density of the zinc together with elongation of the zinc-sulfur bonds. Both wild-type primase and primase reconstituted from purified ZBD and RPD have a similar electronic change in the level of the zinc ion as well as the configuration of the ZBD. Single amino acid replacements in the ZBD (H33A and C36S) result in the loss of both zinc binding and its structural integrity. Thus the zinc in the ZBD may act as a charge modulation indicator for the surrounding sulfur atoms necessary for recognition of specific DNA sequences.« less
Ma, Xin; Guo, Jing; Sun, Xiao
2016-01-01
DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at http://www.cbi.seu.edu.cn/DNABP/.
Molecular sled sequences are common in mammalian proteins.
Xiong, Kan; Blainey, Paul C
2016-03-18
Recent work revealed a new class of molecular machines called molecular sleds, which are small basic molecules that bind and slide along DNA with the ability to carry cargo along DNA. Here, we performed biochemical and single-molecule flow stretching assays to investigate the basis of sliding activity in molecular sleds. In particular, we identified the functional core of pVIc, the first molecular sled characterized; peptide functional groups that control sliding activity; and propose a model for the sliding activity of molecular sleds. We also observed widespread DNA binding and sliding activity among basic polypeptide sequences that implicate mammalian nuclear localization sequences and many cell penetrating peptides as molecular sleds. These basic protein motifs exhibit weak but physiologically relevant sequence-nonspecific DNA affinity. Our findings indicate that many mammalian proteins contain molecular sled sequences and suggest the possibility that substantial undiscovered sliding activity exists among nuclear mammalian proteins. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela
To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less
Initial Characterization of the Pf-Int Recombinase from the Malaria Parasite Plasmodium falciparum
Ghorbal, Mehdi; Scheidig-Benatar, Christine; Bouizem, Salma; Thomas, Christophe; Paisley, Genevieve; Faltermeier, Claire; Liu, Melanie; Scherf, Artur; Lopez-Rubio, Jose-Juan; Gopaul, Deshmukh N.
2012-01-01
Background Genetic variation is an essential means of evolution and adaptation in many organisms in response to environmental change. Certain DNA alterations can be carried out by site-specific recombinases (SSRs) that fall into two families: the serine and the tyrosine recombinases. SSRs are seldom found in eukaryotes. A gene homologous to a tyrosine site-specific recombinase has been identified in the genome of Plasmodium falciparum. The sequence is highly conserved among five other members of Plasmodia. Methodology/Principal Findings The predicted open reading frame encodes for a ∼57 kDa protein containing a C-terminal domain including the putative tyrosine recombinase conserved active site residues R-H-R-(H/W)-Y. The N-terminus has the typical alpha-helical bundle and potentially a mixed alpha-beta domain resembling that of λ-Int. Pf-Int mRNA is expressed differentially during the P. falciparum erythrocytic life stages, peaking in the schizont stage. Recombinant Pf-Int and affinity chromatography of DNA from genomic or synthetic origin were used to identify potential DNA targets after sequencing or micro-array hybridization. Interestingly, the sequences captured also included highly variable subtelomeric genes such as var, rif, and stevor sequences. Electrophoretic mobility shift assays with DNA were carried out to verify Pf-Int/DNA binding. Finally, Pf-Int knock-out parasites were created in order to investigate the biological role of Pf-Int. Conclusions/Significance Our data identify for the first time a malaria parasite gene with structural and functional features of recombinases. Pf-Int may bind to and alter DNA, either in a sequence specific or in a non-specific fashion, and may contribute to programmed or random DNA rearrangements. Pf-Int is the first molecular player identified with a potential role in genome plasticity in this pathogen. Finally, Pf-Int knock-out parasite is viable showing no detectable impact on blood stage development, which is compatible with such function. PMID:23056326
Structure of apo-CAP reveals that large conformational changes are necessary for DNA binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Hitesh; Yu, Shaoning; Kong, Jilie
2009-10-21
The binding of cAMP to the Escherichia coli catabolite gene activator protein (CAP) produces a conformational change that enables it to bind specific DNA sequences and regulate transcription, which it cannot do in the absence of the nucleotide. The crystal structures of the unliganded CAP containing a D138L mutation and the unliganded WT CAP were determined at 2.3 and 3.6 {angstrom} resolution, respectively, and reveal that the two DNA binding domains have dimerized into one rigid body and their two DNA recognition helices become buried. The WT structure shows multiple orientations of this rigid body relative to the nucleotide bindingmore » domain supporting earlier biochemical data suggesting that the inactive form exists in an equilibrium among different conformations. Comparison of the structures of the liganded and unliganded CAP suggests that cAMP stabilizes the active DNA binding conformation of CAP through the interactions that the N{sup 6} of the adenosine makes with the C-helices. These interactions are associated with the reorientation and elongation of the C-helices that precludes the formation of the inactive structure.« less
Edwards, W. Barry
2013-01-01
The aim of this study was to identify potential ligands of PSMA suitable for further development as novel PSMA-targeted peptides using phage display technology. The human PSMA protein was immobilized as a target followed by incubation with a 15-mer phage display random peptide library. After one round of prescreening and two rounds of screening, high-stringency screening at the third round of panning was performed to identify the highest affinity binders. Phages which had a specific binding activity to PSMA in human prostate cancer cells were isolated and the DNA corresponding to the 15-mers were sequenced to provide three consensus sequences: GDHSPFT, SHFSVGS and EVPRLSLLAVFL as well as other sequences that did not display consensus. Two of the peptide sequences deduced from DNA sequencing of binding phages, SHSFSVGSGDHSPFT and GRFLTGGTGRLLRIS were labeled with 5-carboxyfluorescein and shown to bind and co-internalize with PSMA on human prostate cancer cells by fluorescence microscopy. The high stringency requirements yielded peptides with affinities KD∼1 µM or greater which are suitable starting points for affinity maturation. While these values were less than anticipated, the high stringency did yield peptide sequences that apparently bound to different surfaces on PSMA. These peptide sequences could be the basis for further development of peptides for prostate cancer tumor imaging and therapy. PMID:23935860
ERIC Educational Resources Information Center
Kugel, Jennifer F.
2008-01-01
An undergraduate biochemistry laboratory experiment that will teach the technique of fluorescence resonance energy transfer (FRET) while analyzing protein-induced DNA bending is described. The experiment uses the protein TATA binding protein (TBP), which is a general transcription factor that recognizes and binds specific DNA sequences known as…
The nucleoid protein Dps binds genomic DNA of Escherichia coli in a non-random manner
Kondrashov, F. A.; Toshchakov, S. V.; Dominova, I.; Shvyreva, U. S.; Vrublevskaya, V. V.; Morenkov, O. S.; Panyukov, V. V.
2017-01-01
Dps is a multifunctional homododecameric protein that oxidizes Fe2+ ions accumulating them in the form of Fe2O3 within its protein cavity, interacts with DNA tightly condensing bacterial nucleoid upon starvation and performs some other functions. During the last two decades from discovery of this protein, its ferroxidase activity became rather well studied, but the mechanism of Dps interaction with DNA still remains enigmatic. The crucial role of lysine residues in the unstructured N-terminal tails led to the conventional point of view that Dps binds DNA without sequence or structural specificity. However, deletion of dps changed the profile of proteins in starved cells, SELEX screen revealed genomic regions preferentially bound in vitro and certain affinity of Dps for artificial branched molecules was detected by atomic force microscopy. Here we report a non-random distribution of Dps binding sites across the bacterial chromosome in exponentially growing cells and show their enrichment with inverted repeats prone to form secondary structures. We found that the Dps-bound regions overlap with sites occupied by other nucleoid proteins, and contain overrepresented motifs typical for their consensus sequences. Of the two types of genomic domains with extensive protein occupancy, which can be highly expressed or transcriptionally silent only those that are enriched with RNA polymerase molecules were preferentially occupied by Dps. In the dps-null mutant we, therefore, observed a differentially altered expression of several targeted genes and found suppressed transcription from the dps promoter. In most cases this can be explained by the relieved interference with Dps for nucleoid proteins exploiting sequence-specific modes of DNA binding. Thus, protecting bacterial cells from different stresses during exponential growth, Dps can modulate transcriptional integrity of the bacterial chromosome hampering RNA biosynthesis from some genes via competition with RNA polymerase or, vice versa, competing with inhibitors to activate transcription. PMID:28800583
Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A
2018-01-09
Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kobayashi, Takehito; Yagi, Yusuke; Nakamura, Takahiro
2016-01-01
The pentatricopeptide repeat (PPR) motif is a sequence-specific RNA/DNA-binding module. Elucidation of the RNA/DNA recognition mechanism has enabled engineering of PPR motifs as new RNA/DNA manipulation tools in living cells, including for genome editing. However, the biochemical characteristics of PPR proteins remain unknown, mostly due to the instability and/or unfolding propensities of PPR proteins in heterologous expression systems such as bacteria and yeast. To overcome this issue, we constructed reporter systems using animal cultured cells. The cell-based system has highly attractive features for PPR engineering: robust eukaryotic gene expression; availability of various vectors, reagents, and antibodies; highly efficient DNA delivery ratio (>80 %); and rapid, high-throughput data production. In this chapter, we introduce an example of such reporter systems: a PPR-based sequence-specific translational activation system. The cell-based reporter system can be applied to characterize plant genes of interested and to PPR engineering.
The Agrobacterium tumefaciens Transcription Factor BlcR Is Regulated via Oligomerization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan, Yi; Fiscus, Valena; Meng, Wuyi
2012-02-08
The Agrobacterium tumefaciens BlcR is a member of the emerging isocitrate lyase transcription regulators that negatively regulates metabolism of {gamma}-butyrolactone, and its repressing function is relieved by succinate semialdehyde (SSA). Our crystal structure showed that BlcR folded into the DNA- and SSA-binding domains and dimerized via the DNA-binding domains. Mutational analysis identified residues, including Phe{sup 147}, that are important for SSA association; BlcR{sup F147A} existed as tetramer. Two BlcR dimers bound to target DNA and in a cooperative manner, and the distance between the two BlcR-binding sequences in DNA was critical for BlcR-DNA association. Tetrameric BlcR{sup F147A} retained DNA bindingmore » activity, and importantly, this activity was not affected by the distance separating the BlcR-binding sequences in DNA. SSA did not dissociate tetrameric BlcR{sup F147A} or BlcR{sup F147A}-DNA. As well as in the SSA-binding site, Phe{sup 147} is located in a structurally flexible loop that may be involved in BlcR oligomerization. We propose that SSA regulates BlcR DNA-binding function via oligomerization.« less
Toward rules relating zinc finger protein sequences and DNA binding site preferences.
Desjarlais, J R; Berg, J M
1992-08-15
Zinc finger proteins of the Cys2-His2 type consist of tandem arrays of domains, where each domain appears to contact three adjacent base pairs of DNA through three key residues. We have designed and prepared a series of variants of the central zinc finger within the DNA binding domain of Sp1 by using information from an analysis of a large data base of zinc finger protein sequences. Through systematic variations at two of the three contact positions (underlined), relatively specific recognition of sequences of the form 5'-GGGGN(G or T)GGG-3' has been achieved. These results provide the basis for rules that may develop into a code that will allow the design of zinc finger proteins with preselected DNA site specificity.
TALE-PvuII fusion proteins--novel tools for gene targeting.
Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang
2013-01-01
Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity.
Structure and Sequence Search on Aptamer-Protein Docking
NASA Astrophysics Data System (ADS)
Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie
2015-03-01
Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.
NKX3.1 Genotype and IGF-1 Interact in Prostate Cancer Risk
2009-05-01
Steadman DJ, Giuffrida D, Gelmann EP. DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1. Nucleic Acids Res 2000;28...Gelmann EP. DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1. Nucleic Acids Res 2000;28:2389–95. 20. Wu X, Senechal K...3212836 /UG=Hs.21765 fatty acid desaturase 3 204733_at 5.74 gb:NM_002774.1 /DEF=Homo sapiens kallikrein 6 (neurosin, zyme) (KLK6), mRNA. /FEA=mRNA /GEN
Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa
2016-01-01
Abstract The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200
Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald
2013-01-01
Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487
Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald
2013-08-01
Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.
Siede, W; Friedberg, E C
1992-03-01
In the yeast Saccharomyces cerevisiae the RAD2 gene is absolutely required for damage-specific incision of DNA during nucleotide excision repair and is inducible by DNA-damaging agents. In the present study we correlated sensitivity to killing by DNA-damaging agents with the deletion of previously defined specific promoter elements. Deletion of the element DRE2 increased the UV sensitivity of cells in both the G1/early S and S/G2 phases of the cell cycle as well as in stationary phase. On the other hand, increased UV sensitivity associated with deletion of the sequence-related element DRE1 was restricted to cells irradiated in G1/S. Specific binding of protein(s) to the promoter elements DRE1 and DRE2 was observed under non-inducing conditions using gel retardation assays. Exposure of cells to DNA-damaging agents resulted in increased protein binding that was dependent on de novo protein synthesis.
The zinc fingers of YY1 bind single-stranded RNA with low sequence specificity.
Wai, Dorothy C C; Shihab, Manar; Low, Jason K K; Mackay, Joel P
2016-11-02
Classical zinc fingers (ZFs) are traditionally considered to act as sequence-specific DNA-binding domains. More recently, classical ZFs have been recognised as potential RNA-binding modules, raising the intriguing possibility that classical-ZF transcription factors are involved in post-transcriptional gene regulation via direct RNA binding. To date, however, only one classical ZF-RNA complex, that involving TFIIIA, has been structurally characterised. Yin Yang-1 (YY1) is a multi-functional transcription factor involved in many regulatory processes, and binds DNA via four classical ZFs. Recent evidence suggests that YY1 also interacts with RNA, but the molecular nature of the interaction remains unknown. In the present work, we directly assess the ability of YY1 to bind RNA using in vitro assays. Systematic Evolution of Ligands by EXponential enrichment (SELEX) was used to identify preferred RNA sequences bound by the YY1 ZFs from a randomised library over multiple rounds of selection. However, a strong motif was not consistently recovered, suggesting that the RNA sequence selectivity of these domains is modest. YY1 ZF residues involved in binding to single-stranded RNA were identified by NMR spectroscopy and found to be largely distinct from the set of residues involved in DNA binding, suggesting that interactions between YY1 and ssRNA constitute a separate mode of nucleic acid binding. Our data are consistent with recent reports that YY1 can bind to RNA in a low-specificity, yet physiologically relevant manner. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Evolution of sequence-defined highly functionalized nucleic acid polymers
NASA Astrophysics Data System (ADS)
Chen, Zhen; Lichtor, Phillip A.; Berliner, Adrian P.; Chen, Jonathan C.; Liu, David R.
2018-03-01
The evolution of sequence-defined synthetic polymers made of building blocks beyond those compatible with polymerase enzymes or the ribosome has the potential to generate new classes of receptors, catalysts and materials. Here we describe a ligase-mediated DNA-templated polymerization and in vitro selection system to evolve highly functionalized nucleic acid polymers (HFNAPs) made from 32 building blocks that contain eight chemically diverse side chains on a DNA backbone. Through iterated cycles of polymer translation, selection and reverse translation, we discovered HFNAPs that bind proprotein convertase subtilisin/kexin type 9 (PCSK9) and interleukin-6, two protein targets implicated in human diseases. Mutation and reselection of an active PCSK9-binding polymer yielded evolved polymers with high affinity (KD = 3 nM). This evolved polymer potently inhibited the binding between PCSK9 and the low-density lipoprotein receptor. Structure-activity relationship studies revealed that specific side chains at defined positions in the polymers are required for binding to their respective targets. Our findings expand the chemical space of evolvable polymers to include densely functionalized nucleic acids with diverse, researcher-defined chemical repertoires.
Azhibek, Dulat; Skvortsov, Dmitry; Andreeva, Anna; Zatsepin, Timofei; Arutyunyan, Alexandr; Zvereva, Maria; Dontsova, Olga
2016-06-01
Telomerase is a key component of the telomere length maintenance system in the majority of eukaryotes. Telomerase displays maximal activity in stem and cancer cells with high proliferative potential. In humans, telomerase activity is regulated by various mechanisms, including the interaction with telomere ssDNA overhangs that contain a repetitive G-rich sequence, and with noncoding RNA, Telomeric repeat-containing RNA (TERRA), that contains the same sequence. So these nucleic acids can compete for telomerase RNA templates in the cell. In this study, we have investigated the ability of different model substrates mimicking telomere DNA overhangs and TERRA RNA to compete for telomerase in vitro through a previously developed telomerase inhibitor assay. We have shown in this study that RNA oligonucleotides are better competitors for telomerase that DNA ones as RNA also use an alternative binding site on telomerase, and the presence of 2'-OH groups is significant in these interactions. In contrast to DNA, the possibility of forming intramolecular G-quadruplex structures has a minor effect for RNA binding to telomerase. Taking together our data, we propose that TERRA RNA binds better to telomerase compared with its native substrate - the 3'-end of telomere DNA overhang. As a result, some specific factor may exist that participates in switching telomerase from TERRA to the 3'-end of DNA for telomere elongation at the distinct period of a cell cycle in vivo. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.
Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M
1989-10-05
We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.
Ozer, Zahide; Qazi, Sanjive; Ishkhanian, Rita; Hasty, Paul; Ma, Hong; Uckun, Fatih M.
2013-01-01
Ikaros (IK) malfunction has been implicated in the pathogenesis of acute lymphoblastic leukemia (ALL), the most common form of childhood cancer. Therefore, a stringent regulation of IK activity is very important. Here we provide unique genetic and biochemical evidence that the Ku protein components Ku70 and Ku80 act as positive regulators of IK function via formation of IK-Ku70 and IK-Ku80 heterodimers with augmented sequence-specific DNA binding activity. siRNA-mediated depletion of Ku70 or Ku80 reduced the sequence-specific DNA binding activity of IK in EMSA as well as the RT-PCR measured IK target gene expression levels in human cells. The interaction of Ku components with IK likely contributes to the anti-leukemic effects of IK as a tumor suppressor, because Ku70 as well as Ku80 haploinsuffiency in mice caused development of a lymphoproliferative disorder (LPD) involving CD2+CD4+CD8+CD1+IL7R+ thymic T-cell precursors with functional IK deficiency. PMID:24478815
Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi
2018-05-17
Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.
Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes
NASA Astrophysics Data System (ADS)
Roxbury, Daniel
It is known that single-stranded DNA adopts a helical wrap around a single-walled carbon nanotube (SWCNT), forming a water-dispersible hybrid molecule. The ability to sort mixtures of SWCNTs based on chirality (electronic species) has recently been demonstrated using special short DNA sequences that recognize certain matching SWCNTs of specific chirality. This thesis investigates the intricacies of DNA-SWCNT sequence-specific interactions through both experimental and molecular simulation studies. The DNA-SWCNT binding strengths were experimentally quantified by studying the kinetics of DNA replacement by a surfactant on the surface of particular SWCNTs. Recognition ability was found to correlate strongly with measured binding strength, e.g. DNA sequence (TAT)4 was found to bind 20 times stronger to the (6,5)-SWCNT than sequence (TAT)4T. Next, using replica exchange molecular dynamics (REMD) simulations, equilibrium structures formed by (a) single-strands and (b) multiple-strands of 12-mer oligonucleotides adsorbed on various SWCNTs were explored. A number of structural motifs were discovered in which the DNA strand wraps around the SWCNT and 'stitches' to itself via hydrogen bonding. Great variability among equilibrium structures was observed and shown to be directly influenced by DNA sequence and SWCNT type. For example, the (6,5)-SWCNT DNA recognition sequence, (TAT)4, was found to wrap in a tight single-stranded right-handed helical conformation. In contrast, DNA sequence T12 forms a beta-barrel left-handed structure on the same SWCNT. These are the first theoretical indications that DNA-based SWCNT selectivity can arise on a molecular level. In a biomedical collaboration with the Mayo Clinic, pathways for DNA-SWCNT internalization into healthy human endothelial cells were explored. Through absorbance spectroscopy, TEM imaging, and confocal fluorescence microscopy, we showed that intracellular concentrations of SWCNTs far exceeded those of the incubation solution, which suggested an energy-dependent pathway. Additionally, by means of pharmacological inhibition and vector-induced gene knockout studies, the DNA-SWCNTs were shown to enter the cells via Rac1-mediated macropinocytosis.
Engineering the DNA cytosine-5 methyltransferase reaction for sequence-specific labeling of DNA
Lukinavičius, Gražvydas; Lapinaitė, Audronė; Urbanavičiūtė, Giedrė; Gerasimaitė, Rūta; Klimašauskas, Saulius
2012-01-01
DNA methyltransferases catalyse the transfer of a methyl group from the ubiquitous cofactor S-adenosyl-L-methionine (AdoMet) onto specific target sites on DNA and play important roles in organisms from bacteria to humans. AdoMet analogs with extended propargylic side chains have been chemically produced for methyltransferase-directed transfer of activated groups (mTAG) onto DNA, although the efficiency of reactions with synthetic analogs remained low. We performed steric engineering of the cofactor pocket in a model DNA cytosine-5 methyltransferase (C5-MTase), M.HhaI, by systematic replacement of three non-essential positions, located in two conserved sequence motifs and in a variable region, with smaller residues. We found that double and triple replacements lead to a substantial improvement of the transalkylation activity, which manifests itself in a mild increase of cofactor binding affinity and a larger increase of the rate of alkyl transfer. These effects are accompanied with reduction of both the stability of the product DNA–M.HhaI–AdoHcy complex and the rate of methylation, permitting competitive mTAG labeling in the presence of AdoMet. Analogous replacements of two conserved residues in M.HpaII and M2.Eco31I also resulted in improved transalkylation activity attesting a general applicability of the homology-guided engineering to the C5-MTase family and expanding the repertoire of sequence-specific tools for covalent in vitro and ex vivo labeling of DNA. PMID:23042683
The mechanism and control of DNA transfer by the conjugative relaxase of resistance plasmid pCU1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nash, Rebekah Potts; Habibi, Sohrab; Cheng, Yuan
2010-11-15
Bacteria expand their genetic diversity, spread antibiotic resistance genes, and obtain virulence factors through the highly coordinated process of conjugative plasmid transfer (CPT). A plasmid-encoded relaxase enzyme initiates and terminates CPT by nicking and religating the transferred plasmid in a sequence-specific manner. We solved the 2.3 {angstrom} crystal structure of the relaxase responsible for the spread of the resistance plasmid pCU1 and determined its DNA binding and nicking capabilities. The overall fold of the pCU1 relaxase is similar to that of the F plasmid and plasmid R388 relaxases. However, in the pCU1 structure, the conserved tyrosine residues (Y18,19,26,27) that aremore » required for DNA nicking and religation were displaced up to 14 {angstrom} out of the relaxase active site, revealing a high degree of mobility in this region of the enzyme. In spite of this flexibility, the tyrosines still cleaved the nic site of the plasmid's origin of transfer, and did so in a sequence-specific, metal-dependent manner. Unexpectedly, the pCU1 relaxase lacked the sequence-specific DNA binding previously reported for the homologous F and R388 relaxase enzymes, despite its high sequence and structural similarity with both proteins. In summary, our work outlines novel structural and functional aspects of the relaxase-mediated conjugative transfer of plasmid pCU1.« less
DNA capture elements for rapid detection and identification of biological agents
NASA Astrophysics Data System (ADS)
Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva
2004-08-01
DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.
de Bruin, Donny; Bossert, Nelli; Aartsma-Rus, Annemieke; Bouwmeester, Dirk
2018-04-06
Short nucleic acid oligomers have found a wide range of applications in experimental physics, biology and medicine, and show potential for the treatment of acquired and genetic diseases. These applications rely heavily on the predictability of hybridization through Watson-Crick base pairing to allow positioning on a nanometer scale, as well as binding to the target transcripts, but also off-target binding to transcripts with partial homology. These effects are of particular importance in the development of therapeutic oligonucleotides, where off-target effects caused by the binding of mismatched sequences need to be avoided. We employ a novel method of probing DNA hybridization using optically active DNA-stabilized silver clusters (Ag-DNA) to measure binding efficiencies through a change in fluorescence intensity. In this way we can determine their location-specific sensitivity to individual mismatches in the sequence. The results reveal a strong dependence of the hybridization on the location of the mismatch, whereby mismatches close to the edges and center show a relatively minor impact. In parallel, we propose a simple model for calculating the annealing ratios of mismatched DNA sequences, which supports our experimental results. The primary result shown in this work is a demonstration of a novel technique to measure DNA hybridization using fluorescent Ag-DNA. With this technique, we investigated the effect of mismatches on the hybridization efficiency, and found a significant dependence on the location of individual mismatches. These effects are strongly influenced by the length of the used oligonucleotides. The novel probe method based on fluorescent Ag-DNA functions as a reliable tool in measuring this behavior. As a secondary result, we formulated a simple model that is consistent with the experimental data.
Chu, Chien-Hsin; Chang, Lung-Chun; Hsu, Hong-Ming; Wei, Shu-Yi; Liu, Hsing-Wei; Lee, Yu; Kuo, Chung-Chi; Indra, Dharmu; Chen, Chinpan; Ong, Shiou-Jeng; Tai, Jung-Hsiang
2011-01-01
Nuclear proteins usually contain specific peptide sequences, referred to as nuclear localization signals (NLSs), for nuclear import. These signals remain unexplored in the protozoan pathogen, Trichomonas vaginalis. The nuclear import of a Myb2 transcription factor was studied here using immunodetection of a hemagglutinin-tagged Myb2 overexpressed in the parasite. The tagged Myb2 was localized to the nucleus as punctate signals. With mutations of its polybasic sequences, 48KKQK51 and 61KR62, Myb2 was localized to the nucleus, but the signal was diffusive. When fused to a C-terminal non-nuclear protein, the Myb2 sequence spanning amino acid (aa) residues 48 to 143, which is embedded within the R2R3 DNA-binding domain (aa 40 to 156), was essential and sufficient for efficient nuclear import of a bacterial tetracycline repressor (TetR), and yet the transport efficiency was reduced with an additional fusion of a firefly luciferase to TetR, while classical NLSs from the simian virus 40 T-antigen had no function in this assay system. Myb2 nuclear import and DNA-binding activity were substantially perturbed with mutation of a conserved isoleucine (I74) in helix 2 to proline that altered secondary structure and ternary folding of the R2R3 domain. Disruption of DNA-binding activity alone by point mutation of a lysine residue, K51, preceding the structural domain had little effect on Myb2 nuclear localization, suggesting that nuclear translocation of Myb2, which requires an ordered structural domain, is independent of its DNA binding activity. These findings provide useful information for testing whether myriad Mybs in the parasite use a common module to regulate nuclear import. PMID:22021237
Adelman, K; Salmon, B; Baines, J D
2001-03-13
The product of the herpes simplex virus type 1 U(L)28 gene is essential for cleavage of concatemeric viral DNA into genome-length units and packaging of this DNA into viral procapsids. To address the role of U(L)28 in this process, purified U(L)28 protein was assayed for the ability to recognize conserved herpesvirus DNA packaging sequences. We report that DNA fragments containing the pac1 DNA packaging motif can be induced by heat treatment to adopt novel DNA conformations that migrate faster than the corresponding duplex in nondenaturing gels. Surprisingly, these novel DNA structures are high-affinity substrates for U(L)28 protein binding, whereas double-stranded DNA of identical sequence composition is not recognized by U(L)28 protein. We demonstrate that only one strand of the pac1 motif is responsible for the formation of novel DNA structures that are bound tightly and specifically by U(L)28 protein. To determine the relevance of the observed U(L)28 protein-pac1 interaction to the cleavage and packaging process, we have analyzed the binding affinity of U(L)28 protein for pac1 mutants previously shown to be deficient in cleavage and packaging in vivo. Each of the pac1 mutants exhibited a decrease in DNA binding by U(L)28 protein that correlated directly with the reported reduction in cleavage and packaging efficiency, thereby supporting a role for the U(L)28 protein-pac1 interaction in vivo. These data therefore suggest that the formation of novel DNA structures by the pac1 motif confers added specificity on recognition of DNA packaging sequences by the U(L)28-encoded component of the herpesvirus cleavage and packaging machinery.
Directed evolution of the TALE N-terminal domain for recognition of all 5′ bases
Lamb, Brian M.; Mercer, Andrew C.; Barbas, Carlos F.
2013-01-01
Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5′-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5′ T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5′ T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes. PMID:23980031
Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P
1995-01-01
A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result. PMID:7853501
Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P
1995-03-01
A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.
Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters
Wozniak, Christopher E.; Hughes, Kelly T.
2008-01-01
Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950
Dissecting the protein architecture of DNA-binding transcription factors in bacteria and archaea.
Rivera-Gómez, Nancy; Martínez-Núñez, Mario Alberto; Pastor, Nina; Rodriguez-Vazquez, Katya; Perez-Rueda, Ernesto
2017-08-01
Gene regulation at the transcriptional level is a central process in all organisms where DNA-binding transcription factors play a fundamental role. This class of proteins binds specifically at DNA sequences, activating or repressing gene expression as a function of the cell's metabolic status, operator context and ligand-binding status, among other factors, through the DNA-binding domain (DBD). In addition, TFs may contain partner domains (PaDos), which are involved in ligand binding and protein-protein interactions. In this work, we systematically evaluated the distribution, abundance and domain organization of DNA-binding TFs in 799 non-redundant bacterial and archaeal genomes. We found that the distributions of the DBDs and their corresponding PaDos correlated with the size of the genome. We also identified specific combinations between the DBDs and their corresponding PaDos. Within each class of DBDs there are differences in the actual angle formed at the dimerization interface, responding to the presence/absence of ligands and/or crystallization conditions, setting the orientation of the resulting helices and wings facing the DNA. Our results highlight the importance of PaDos as central elements that enhance the diversity of regulatory functions in all bacterial and archaeal organisms, and our results also demonstrate the role of PaDos in sensing diverse signal compounds. The highly specific interactions between DBDs and PaDos observed in this work, together with our structural analysis highlighting the difficulty in predicting both inter-domain geometry and quaternary structure, suggest that these systems appeared once and evolved with diverse duplication events in all the analysed organisms.
Functional Requirements for Fab-7 Boundary Activity in the Bithorax Complex
Wolle, Daniel; Cleard, Fabienne; Aoki, Tsutomu; Deshpande, Girish; Karch, Francois
2015-01-01
Chromatin boundaries are architectural elements that determine the three-dimensional folding of the chromatin fiber and organize the chromosome into independent units of genetic activity. The Fab-7 boundary from the Drosophila bithorax complex (BX-C) is required for the parasegment-specific expression of the Abd-B gene. We have used a replacement strategy to identify sequences that are necessary and sufficient for Fab-7 boundary function in the BX-C. Fab-7 boundary activity is known to depend on factors that are stage specific, and we describe a novel ∼700-kDa complex, the late boundary complex (LBC), that binds to Fab-7 sequences that have insulator functions in late embryos and adults. We show that the LBC is enriched in nuclear extracts from late, but not early, embryos and that it contains three insulator proteins, GAF, Mod(mdg4), and E(y)2. Its DNA binding properties are unusual in that it requires a minimal sequence of >65 bp; however, other than a GAGA motif, the three Fab-7 LBC recognition elements display few sequence similarities. Finally, we show that mutations which abrogate LBC binding in vitro inactivate the Fab-7 boundary in the BX-C. PMID:26303531
Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.
Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K
2016-10-24
DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
The multi-zinc finger protein ZNF217 contacts DNA through a two-finger domain.
Nunez, Noelia; Clifton, Molly M K; Funnell, Alister P W; Artuz, Crisbel; Hallal, Samantha; Quinlan, Kate G R; Font, Josep; Vandevenne, Marylène; Setiyaputra, Surya; Pearson, Richard C M; Mackay, Joel P; Crossley, Merlin
2011-11-04
Classical C2H2 zinc finger proteins are among the most abundant transcription factors found in eukaryotes, and the mechanisms through which they recognize their target genes have been extensively investigated. In general, a tandem array of three fingers separated by characteristic TGERP links is required for sequence-specific DNA recognition. Nevertheless, a significant number of zinc finger proteins do not contain a hallmark three-finger array of this type, raising the question of whether and how they contact DNA. We have examined the multi-finger protein ZNF217, which contains eight classical zinc fingers. ZNF217 is implicated as an oncogene and in repressing the E-cadherin gene. We show that two of its zinc fingers, 6 and 7, can mediate contacts with DNA. We examine its putative recognition site in the E-cadherin promoter and demonstrate that this is a suboptimal site. NMR analysis and mutagenesis is used to define the DNA binding surface of ZNF217, and we examine the specificity of the DNA binding activity using fluorescence anisotropy titrations. Finally, sequence analysis reveals that a variety of multi-finger proteins also contain two-finger units, and our data support the idea that these may constitute a distinct subclass of DNA recognition motif.
The Multi-zinc Finger Protein ZNF217 Contacts DNA through a Two-finger Domain*
Nunez, Noelia; Clifton, Molly M. K.; Funnell, Alister P. W.; Artuz, Crisbel; Hallal, Samantha; Quinlan, Kate G. R.; Font, Josep; Vandevenne, Marylène; Setiyaputra, Surya; Pearson, Richard C. M.; Mackay, Joel P.; Crossley, Merlin
2011-01-01
Classical C2H2 zinc finger proteins are among the most abundant transcription factors found in eukaryotes, and the mechanisms through which they recognize their target genes have been extensively investigated. In general, a tandem array of three fingers separated by characteristic TGERP links is required for sequence-specific DNA recognition. Nevertheless, a significant number of zinc finger proteins do not contain a hallmark three-finger array of this type, raising the question of whether and how they contact DNA. We have examined the multi-finger protein ZNF217, which contains eight classical zinc fingers. ZNF217 is implicated as an oncogene and in repressing the E-cadherin gene. We show that two of its zinc fingers, 6 and 7, can mediate contacts with DNA. We examine its putative recognition site in the E-cadherin promoter and demonstrate that this is a suboptimal site. NMR analysis and mutagenesis is used to define the DNA binding surface of ZNF217, and we examine the specificity of the DNA binding activity using fluorescence anisotropy titrations. Finally, sequence analysis reveals that a variety of multi-finger proteins also contain two-finger units, and our data support the idea that these may constitute a distinct subclass of DNA recognition motif. PMID:21908891
Glinsky, Gennadi V.
2015-01-01
Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794
Recombinant antibody mediated delivery of organelle-specific DNA pH sensors along endocytic pathways
NASA Astrophysics Data System (ADS)
Modi, Souvik; Halder, Saheli; Nizak, Clément; Krishnan, Yamuna
2013-12-01
DNA has been used to build nanomachines with potential in cellulo and in vivo applications. However their different in cellulo applications are limited by the lack of generalizable strategies to deliver them to precise intracellular locations. Here we describe a new molecular design of DNA pH sensors with response times that are nearly 20 fold faster. Further, by changing the sequence of the pH sensitive domain of the DNA sensor, we have been able to tune their pH sensitive regimes and create a family of DNA sensors spanning ranges from pH 4 to 7.6. To enable a generalizable targeting methodology, this new sensor design also incorporates a `handle' domain. We have identified, using a phage display screen, a set of three recombinant antibodies (scFv) that bind sequence specifically to the handle domain. Sequence analysis of these antibodies revealed several conserved residues that mediate specific interactions with the cognate DNA duplex. We also found that all three scFvs clustered into different branches indicating that their specificity arises from mutations in key residues. When one of these scFvs is fused to a membrane protein (furin) that traffics via the cell surface, the scFv-furin chimera binds the `handle' and ferries a family of DNA pH sensors along the furin endocytic pathway. Post endocytosis, all DNA nanodevices retain their functionality in cellulo and provide spatiotemporal pH maps of retrogradely trafficking furin inside living cells. This new molecular technology of DNA-scFv-protein chimeras can be used to site-specifically complex DNA nanostructures for bioanalytical applications.DNA has been used to build nanomachines with potential in cellulo and in vivo applications. However their different in cellulo applications are limited by the lack of generalizable strategies to deliver them to precise intracellular locations. Here we describe a new molecular design of DNA pH sensors with response times that are nearly 20 fold faster. Further, by changing the sequence of the pH sensitive domain of the DNA sensor, we have been able to tune their pH sensitive regimes and create a family of DNA sensors spanning ranges from pH 4 to 7.6. To enable a generalizable targeting methodology, this new sensor design also incorporates a `handle' domain. We have identified, using a phage display screen, a set of three recombinant antibodies (scFv) that bind sequence specifically to the handle domain. Sequence analysis of these antibodies revealed several conserved residues that mediate specific interactions with the cognate DNA duplex. We also found that all three scFvs clustered into different branches indicating that their specificity arises from mutations in key residues. When one of these scFvs is fused to a membrane protein (furin) that traffics via the cell surface, the scFv-furin chimera binds the `handle' and ferries a family of DNA pH sensors along the furin endocytic pathway. Post endocytosis, all DNA nanodevices retain their functionality in cellulo and provide spatiotemporal pH maps of retrogradely trafficking furin inside living cells. This new molecular technology of DNA-scFv-protein chimeras can be used to site-specifically complex DNA nanostructures for bioanalytical applications. Electronic supplementary information (ESI) available: Detailed description of all oligonucleotide sequences used in this study; list of figures that support claims from the main text. Mainly these show sensor sequences, phage display results, scFv purification and binding data, cell images clamped at different pH and co-localization studies with endocytic tracers. See DOI: 10.1039/c3nr03769j
Engineering a Cell-surface Aptamer Circuit for Targeted and Amplified Photodynamic Cancer Therapy
Han, Da; Zhu, Guizhi; Wu, Cuichen; Zhu, Zhi; Chen, Tao; Zhang, Xiaobing
2013-01-01
Photodynamic therapy (PDT) is one of the most promising and noninvasive methods for clinical treatment of different malignant diseases. Here, we present a novel strategy of designing an aptamer-based DNA nanocircuit capable of the selective recognition of cancer cells, controllable activation of photosensitizer and amplification of photodynamic therapeutic effect. The aptamers can selectively recognize target cancer cells and bind to the specific proteins on cell membranes. Then the overhanging catalyst sequence on aptamer can trigger a toehold-mediated catalytic strand displacement to activate photosensitizer and achieve amplified therapeutic effect. The specific binding-induced activation allows the DNA circuit to distinguish diseased cells from healthy cells, reducing damage to nearby healthy cells. Moreover, the catalytic amplification reaction will only take place close to the target cancer cells, resulting in a high local concentration of singlet oxygen to selectively kill the target cells. The principle employed in this study demonstrated the feasibility of assembling a DNA circuit on cell membranes and could further broaden the utility of DNA circuits for applications in biology, biotechnology, and biomedicine. PMID:23397942
Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.
Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M
2001-11-01
Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.
A conserved mechanism for replication origin recognition and binding in archaea.
Majerník, Alan I; Chong, James P J
2008-01-15
To date, methanogens are the only group within the archaea where firing DNA replication origins have not been demonstrated in vivo. In the present study we show that a previously identified cluster of ORB (origin recognition box) sequences do indeed function as an origin of replication in vivo in the archaeon Methanothermobacter thermautotrophicus. Although the consensus sequence of ORBs in M. thermautotrophicus is somewhat conserved when compared with ORB sequences in other archaea, the Cdc6-1 protein from M. thermautotrophicus (termed MthCdc6-1) displays sequence-specific binding that is selective for the MthORB sequence and does not recognize ORBs from other archaeal species. Stabilization of in vitro MthORB DNA binding by MthCdc6-1 requires additional conserved sequences 3' to those originally described for M. thermautotrophicus. By testing synthetic sequences bearing mutations in the MthORB consensus sequence, we show that Cdc6/ORB binding is critically dependent on the presence of an invariant guanine found in all archaeal ORB sequences. Mutation of a universally conserved arginine residue in the recognition helix of the winged helix domain of archaeal Cdc6-1 shows that specific origin sequence recognition is dependent on the interaction of this arginine residue with the invariant guanine. Recognition of a mutated origin sequence can be achieved by mutation of the conserved arginine residue to a lysine or glutamine residue. Thus despite a number of differences in protein and DNA sequences between species, the mechanism of origin recognition and binding appears to be conserved throughout the archaea.
TIA-1 RRM23 binding and recognition of target oligonucleotides
Waris, Saboora; García-Mauriño, Sofía M.; Sivakumaran, Andrew; Beckham, Simone A.; Loughlin, Fionna E.; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C.J.
2017-01-01
Abstract TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. PMID:28184449
TIA-1 RRM23 binding and recognition of target oligonucleotides.
Waris, Saboora; García-Mauriño, Sofía M; Sivakumaran, Andrew; Beckham, Simone A; Loughlin, Fionna E; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C J; Wilce, Jacqueline A
2017-05-05
TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Dai, Hanjun; Umarov, Ramzan; Kuwahara, Hiroyuki; Li, Yu; Song, Le; Gao, Xin
2017-11-15
An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have brought the opportunity for building binding affinity prediction methods, the accurate characterization of TF-DNA binding affinity landscape still remains a challenging problem. Here we propose a novel sequence embedding approach for modeling the transcription factor binding affinity landscape. Our method represents DNA binding sequences as a hidden Markov model which captures both position specific information and long-range dependency in the sequence. A cornerstone of our method is a novel message passing-like embedding algorithm, called Sequence2Vec, which maps these hidden Markov models into a common nonlinear feature space and uses these embedded features to build a predictive model. Our method is a novel combination of the strength of probabilistic graphical models, feature space embedding and deep learning. We conducted comprehensive experiments on over 90 large-scale TF-DNA datasets which were measured by different high-throughput experimental technologies. Sequence2Vec outperforms alternative machine learning methods as well as the state-of-the-art binding affinity prediction methods. Our program is freely available at https://github.com/ramzan1990/sequence2vec. xin.gao@kaust.edu.sa or lsong@cc.gatech.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-03-20
A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Briegel, K; Hentsch, B; Pfeuffer, I; Serfling, E
1991-01-01
The inducible, T cell-specific enhancers of murine and human Interleukin 2 (Il-2) genes contain the kB-like sequence GGGATTTCACC as an essential cis-acting enhancer motif. When cloned in multiple copies this so-called TCEd (distal T cell element) acts as an inducible proto-enhancer element in E14 T lymphoma cells, but not in HeLa cells. In extracts of induced, Il-2 secreting El4 cells three individual protein factors bind to TCEd DNA. The binding of the most prominent factor, named TCF-1 (T cell factor 1), is correlated with the proto-enhancer activity of TCEd. TCF-1 consists of two polypeptides of about 50 kD and 105 kD; the former seems to be related to the 50 kD polypeptide of NF-kB. Purified NF-kB is also able to bind to the TCEd, but TCF-1 binds stronger than NF-kB to TCEd DNA. The conversion of the TCEd to a 'perfect' NF-kB binding site leads to a tighter binding of NF-kB to TCEd DNA and, as a functional consequence, to the activity of the 'converted' TCEd motifs in HeLa cells. Thus, the substitution of the underlined A residue to a C within the GGGATTTCACC motif abolishes its T cell-restricted activity and leads to its functioning in both El4 cells and HeLa cells. These results indicate that lymphocyte-specific factors binding to the TCEd are involved in the control of T cell specific-transcription of the Il-2 gene. Images PMID:1945879
Yu, Bing; Ni, Ming; Li, Wen-Han; Lei, Ping; Xing, Wei; Xiao, Dai-Wen; Huang, Yu; Tang, Zhen-Jie; Zhu, Hui-Fen; Shen, Guan-Xin
2005-07-14
To identify the scFv antibody fragments specific for hepatocellular carcinoma by biopanning from a large human naive scFv phage display library. A large human naive scFv phage library was used to search for the specific targets by biopanning with the hepatocellular carcinoma cell line HepG2 for the positive-selecting and the normal liver cell line L02 for the counter-selecting. After three rounds of biopanning, individual scFv phages binding selectively to HepG2 cells were picked out. PCR was carried out for identification of the clones containing scFv gene sequence. The specific scFv phages were selected by ELISA and flow cytometry. DNA sequences of positive clones were analyzed by using Applied Biosystem Automated DNA sequencers 3 730. The expression proteins of the specific scFv antibody fragments in E.coli HB2151 were purified by the affinity chromatography and detected by SDS-PAGE, Western blot and ELISA. The biological effect of the soluble antibody fragments on the HepG2 cells was investigated by observing the cell proliferation. Two different positive clones were obtained and the functional variable sequences were identified. Their DNA sequences of the scFv antibody fragments were submitted to GenBank (accession nos: AY686498 and AY686499). The soluble scFv antibody fragments were successfully expressed in E.coli HB2151. The relative molecular mass of the expression products was about 36 ku, according to its predicted M(r) value. The two soluble scFv antibody fragments also had specific binding activity and obvious growth inhibition properties to HepG2 cells. The phage library biopanning permits identification of specific antibody fragments for hepatocellular carcinoma and affords experiment evidence for its immunotherapy study.
GBshape: a genome browser database for DNA shape annotations
Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J.; Parker, Stephen C.J.; Nuzhdin, Sergey V.; Tullius, Thomas D.; Rohs, Remo
2015-01-01
Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. PMID:25326329
Sun, Han; Zeng, Jun; Cao, Zhendong; Li, Yan; Qian, Weiqiang
2015-01-01
Active DNA demethylation plays crucial roles in the regulation of gene expression in both plants and animals. In Arabidopsis thaliana, active DNA demethylation is initiated by the ROS1 subfamily of 5-methylcytosine-specific DNA glycosylases via a base excision repair mechanism. Recently, IDM1 and IDM2 were shown to be required for the recruitment of ROS1 to some of its target loci. However, the mechanism(s) by which IDM1 is targeted to specific genomic loci remains to be determined. Affinity purification of IDM1- and IDM2- associating proteins demonstrated that IDM1 and IDM2 copurify together with two novel components, methyl-CpG-binding domain protein 7 (MBD7) and IDM2-like protein 1 (IDL1). IDL1 encodes an α-crystallin domain protein that shows high sequence similarity with IDM2. MBD7 interacts with IDM2 and IDL1 in vitro and in vivo and they form a protein complex associating with IDM1 in vivo. MBD7 directly binds to the target loci and is required for the H3K18 and H3K23 acetylation in planta. MBD7 dysfunction causes DNA hypermethylation and silencing of reporter genes and a subset of endogenous genes. Our results suggest that a histone acetyltransferase complex functions in active DNA demethylation and in suppression of gene silencing at some loci in Arabidopsis. PMID:25933434
Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J
1994-07-08
The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.
Yousaf, Nasim; Gould, David
2017-01-01
Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.
Generalized theory on the mechanism of site-specific DNA-protein interactions
NASA Astrophysics Data System (ADS)
Niranjani, G.; Murugan, R.
2016-05-01
We develop a generalized theoretical framework on the binding of transcription factor proteins (TFs) with specific sites on DNA that takes into account the interplay of various factors regarding overall electrostatic potential at the DNA-protein interface, occurrence of kinetic traps along the DNA sequence, presence of other roadblock protein molecules along DNA and crowded environment, conformational fluctuations in the DNA binding domains (DBDs) of TFs, and the conformational state of the DNA. Starting from a Smolochowski type theoretical framework on site-specific binding of TFs we logically build our model by adding the effects of these factors one by one. Our generalized two-step model suggests that the electrostatic attractive forces present inbetween the positively charged DBDs of TFs and the negatively charged phosphate backbone of DNA, along with the counteracting shielding effects of solvent ions, is the core factor that creates a fluidic type environment at the DNA-protein interface. This in turn facilitates various one-dimensional diffusion (1Dd) processes such as sliding, hopping and intersegmental transfers. These facilitating processes as well as flipping dynamics of conformational states of DBDs of TFs between stationary and mobile states can enhance the 1Dd coefficient on a par with three-dimensional diffusion (3Dd). The random coil conformation of DNA also plays critical roles in enhancing the site-specific association rate. The extent of enhancement over the 3Dd controlled rate seems to be directly proportional to the maximum possible 1Dd length. We show that the overall site-specific binding rate scales with the length of DNA in an asymptotic way. For relaxed DNA, the specific binding rate will be independent of the length of DNA as length increases towards infinity. For condensed DNA as in in vivo conditions, the specific binding rate depends on the length of DNA in a turnover way with a maximum. This maximum rate seems to scale with the maximum possible 1Dd length of TFs in a square root manner. Results suggest that 1Dd processes contribute much less to the enhancement of specific binding rate under in vivo conditions for condensed DNA. There exists a critical length of binding stretch of TFs beyond which the probability associated with the random occurrence of similar specific binding sites will be close to zero. TFs in natural systems from prokaryotes to eukaryotes seem to handle sequence-mediated kinetic traps via increasing the length of their recognition stretch or combinatorial binding. TFs overcome the hurdles of roadblocks via switching efficiently between sliding, hopping and intersegmental transfer modes. The site-specific binding rate as well as the maximum possible 1Dd length seem to be directly proportional to the square root of the probability (p R) of finding a nonspecific binding site to be free from dynamic roadblocks. Here p R seems to be a function of the number of nsbs available per DNA binding protein (ϕ) inside the living cell. It seems that p R > 0.8 when ϕ > 10 which is true for the Escherichia coli cell system.
Method for nucleic acid hybridization using single-stranded DNA binding protein
Tabor, Stanley; Richardson, Charles C.
1996-01-01
Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.
Kshirsagar, Rucha; Khan, Krishnendu; Joshi, Mamata V; Hosur, Ramakrishna V; Muniyappa, K
2017-05-23
A plethora of evidence suggests that different types of DNA quadruplexes are widely present in the genome of all organisms. The existence of a growing number of proteins that selectively bind and/or process these structures underscores their biological relevance. Moreover, G-quadruplex DNA has been implicated in the alignment of four sister chromatids by forming parallel guanine quadruplexes during meiosis; however, the underlying mechanism is not well defined. Here we show that a G/C-rich motif associated with a meiosis-specific DNA double-strand break (DSB) in Saccharomyces cerevisiae folds into G-quadruplex, and the C-rich sequence complementary to the G-rich sequence forms an i-motif. The presence of G-quadruplex or i-motif structures upstream of the green fluorescent protein-coding sequence markedly reduces the levels of gfp mRNA expression in S. cerevisiae cells, with a concomitant decrease in green fluorescent protein abundance, and blocks primer extension by DNA polymerase, thereby demonstrating the functional significance of these structures. Surprisingly, although S. cerevisiae Hop1, a component of synaptonemal complex axial/lateral elements, exhibits strong affinity to G-quadruplex DNA, it displays a much weaker affinity for the i-motif structure. However, the Hop1 C-terminal but not the N-terminal domain possesses strong i-motif binding activity, implying that the C-terminal domain has a distinct substrate specificity. Additionally, we found that Hop1 promotes intermolecular pairing between G/C-rich DNA segments associated with a meiosis-specific DSB site. Our results support the idea that the G/C-rich motifs associated with meiosis-specific DSBs fold into intramolecular G-quadruplex and i-motif structures, both in vitro and in vivo, thus revealing an important link between non-B form DNA structures and Hop1 in meiotic chromosome synapsis and recombination. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Crystal Structure of the Minimalist Max-E47 Protein Chimera
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahmadpour, Faraz; Ghirlando, Rodolfo; De Jong, Antonia T.
Max-E47 is a protein chimera generated from the fusion of the DNA-binding basic region of Max and the dimerization region of E47, both members of the basic region/helix-loop-helix (bHLH) superfamily of transcription factors. Like native Max, Max-E47 binds with high affinity and specificity to the E-box site, 5'-CACGTG, both in vivo and in vitro. We have determined the crystal structure of Max-E47 at 1.7 Å resolution, and found that it associates to form a well-structured dimer even in the absence of its cognate DNA. Analytical ultracentrifugation confirms that Max-E47 is dimeric even at low micromolar concentrations, indicating that the Max-E47more » dimer is stable in the absence of DNA. Circular dichroism analysis demonstrates that both non-specific DNA and the E-box site induce similar levels of helical secondary structure in Max-E47. These results suggest that Max-E47 may bind to the E-box following the two-step mechanism proposed for other bHLH proteins. In this mechanism, a rapid step where protein binds to DNA without sequence specificity is followed by a slow step where specific protein:DNA interactions are fine-tuned, leading to sequence-specific recognition. Collectively, these results show that the designed Max-E47 protein chimera behaves both structurally and functionally like its native counterparts.« less
2015-01-01
The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757
Common fold in helix–hairpin–helix proteins
Shao, Xuguang; Grishin, Nick V.
2000-01-01
Helix–hairpin–helix (HhH) is a widespread motif involved in non-sequence-specific DNA binding. The majority of HhH motifs function as DNA-binding modules, however, some of them are used to mediate protein–protein interactions or have acquired enzymatic activity by incorporating catalytic residues (DNA glycosylases). From sequence and structural analysis of HhH-containing proteins we conclude that most HhH motifs are integrated as a part of a five-helical domain, termed (HhH)2 domain here. It typically consists of two consecutive HhH motifs that are linked by a connector helix and displays pseudo-2-fold symmetry. (HhH)2 domains show clear structural integrity and a conserved hydrophobic core composed of seven residues, one residue from each α-helix and each hairpin, and deserves recognition as a distinct protein fold. In addition to known HhH in the structures of RuvA, RadA, MutY and DNA-polymerases, we have detected new HhH motifs in sterile alpha motif and barrier-to-autointegration factor domains, the α-subunit of Escherichia coli RNA-polymerase, DNA-helicase PcrA and DNA glycosylases. Statistically significant sequence similarity of HhH motifs and pronounced structural conservation argue for homology between (HhH)2 domains in different protein families. Our analysis helps to clarify how non-symmetric protein motifs bind to the double helix of DNA through the formation of a pseudo-2-fold symmetric (HhH)2 functional unit. PMID:10908318
Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases
Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik
2014-01-01
Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840
Noor, Nudrat; Bitoun, Emmanuelle; Tumian, Afidalina; Imbeault, Michael; Chapman, J Ross; Aricescu, A Radu
2017-01-01
PRDM9 binding localizes almost all meiotic recombination sites in humans and mice. However, most PRDM9-bound loci do not become recombination hotspots. To explore factors that affect binding and subsequent recombination outcomes, we mapped human PRDM9 binding sites in a transfected human cell line and measured PRDM9-induced histone modifications. These data reveal varied DNA-binding modalities of PRDM9. We also find that human PRDM9 frequently binds promoters, despite their low recombination rates, and it can activate expression of a small number of genes including CTCFL and VCX. Furthermore, we identify specific sequence motifs that predict consistent, localized meiotic recombination suppression around a subset of PRDM9 binding sites. These motifs strongly associate with KRAB-ZNF protein binding, TRIM28 recruitment, and specific histone modifications. Finally, we demonstrate that, in addition to binding DNA, PRDM9's zinc fingers also mediate its multimerization, and we show that a pair of highly diverged alleles preferentially form homo-multimers. PMID:29072575
Chromatin immunoprecipitation of mouse embryos.
Voss, Anne K; Dixon, Mathew P; McLennan, Tamara; Kueh, Andrew J; Thomas, Tim
2012-01-01
During prenatal development, a large number of different cell types are formed, the vast majority of which contain identical genetic material. The basis of the great variety in cell phenotype and function is the differential expression of the approximately 25,000 genes in the mammalian genome. Transcriptional activity is regulated at many levels by proteins, including members of the basal transcriptional apparatus, DNA-binding transcription factors, and chromatin-binding proteins. Importantly, chromatin structure dictates the availability of a specific genomic locus for transcriptional activation as well as the efficiency, with which transcription can occur. Chromatin immunoprecipitation (ChIP) is a method to assess if chromatin modifications or proteins are present at a specific locus. ChIP involves the cross linking of DNA and associated proteins and immunoprecipitation using specific antibodies to DNA-associated proteins followed by examination of the co-precipitated DNA sequences or proteins. In the last few years, ChIP has become an essential technique for scientists studying transcriptional regulation and chromatin structure. Using ChIP on mouse embryos, we can document the presence or absence of specific proteins and chromatin modifications at genomic loci in vivo during mammalian development. Here, we describe a ChIP technique adapted for mouse embryos.
Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.
Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R
2017-11-01
DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.
Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa
2016-03-21
Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.
2014-01-01
Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182
Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H
2018-05-23
Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.
Bigler, J; Eisenman, R N
1994-01-01
Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476
Nanjunda, Rupesh; Wilson, W. David
2012-01-01
Compounds that bind in the DNA minor groove have provided critical information on DNA molecular recognition, they have found extensive uses in biotechnology and they are providing clinically useful drugs against diseases as diverse as cancer and sleeping sickness. This review focuses on the development of clinically useful heterocyclic diamidine minor groove binders. These compounds have shown us that the classical model for minor groove binding in AT DNA sequences must be expanded in several ways: compounds with nonstandard shapes can bind strongly to the groove, water can be directly incorporated into the minor groove complex in an interfacial interaction, and the compounds can form cooperative stacked dimers to recognize GC and mixed AT/GC base pair sequences. PMID:23255206
Reading of the non-template DNA by transcription elongation factors.
Svetlov, Vladimir; Nudler, Evgeny
2018-05-14
Unlike transcription initiation and termination, which have easily discernable signals such as promoters and terminators, elongation is regulated through a dynamic network involving RNA/DNA pause signals and states- rather than sequence-specific protein interactions. A report by Nedialkov et al. (in press) provides experimental evidence for sequence-specific recruitment of elongation factor RfaH to transcribing RNA polymerase (RNAP) and outlines the mechanism of gene expression regulation by restraint ("locking") of the DNA non-template strand. According to this model, the elongation complex pauses at the so called "operon polarity sequence" (found in some long bacterial operons coding for virulence genes), when the usually flexible non-template DNA strand adopts a distinct hairpin-loop conformation on the surface of transcribing RNAP. Sequence-specific binding of RfaH to this DNA segment facilitates conversion of RfaH from its inactive closed to its active open conformation. The interaction network formed between RfaH, non-template DNA, and RNAP locks DNA in a conformation that renders the elongation complex resistant to pausing and termination. The effects of such locking on transcript elongation can be mimicked by restraint of the non-template strand due to its shortening. This work advances our understanding of regulation of transcript elongation and has important implications for the action of general transcription factors, such as NusG, which lack apparent sequence-specificity, as well as for the mechanisms of other processes linked to transcription such as transcription-coupled DNA repair. This article is protected by copyright. All rights reserved. © 2018 John Wiley & Sons Ltd.
Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin.
Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga; Renkawitz, Rainer; Georgiev, Pavel
2015-01-01
Insulators are multiprotein-DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. © 2015 Maksimenko et al.; Published by Cold Spring Harbor Laboratory Press.
Viola, Ivana L; Uberti Manassero, Nora G; Ripoll, Rodrigo; Gonzalez, Daniel H
2011-04-01
The TCP domain is a DNA-binding domain present in plant transcription factors that modulate different processes. In the present study, we show that Arabidopsis class I TCP proteins are able to interact with a dyad-symmetric sequence composed of two GTGGG half-sites. TCP20 establishes symmetric interactions with the 5' half of each strand, whereas TCP11 interacts mainly with the 3' half. SELEX (systematic evolution of ligands by exponential enrichment) experiments with TCP15 and TCP20 indicated that these proteins have similar, although not identical, DNA-binding preferences and are able to interact with non-palindromic binding sites of the type GTGGGNCCNN. TCP11 shows a different DNA-binding specificity, with a preference for the sequence GTGGGCCNNN. The distinct DNA-binding properties of TCP11 are due to the presence of a threonine residue at position 15 of the TCP domain, a position that is occupied by an arginine residue in most TCP proteins. TCP11 also forms heterodimers with TCP15 that have increased DNA-binding efficiency. The expression in plants of a repressor form of TCP11 demonstrated that this protein is a developmental regulator that influences the growth of leaves, stems and petioles, and pollen development. The results suggest that changes in DNA-binding preferences may be one of the mechanisms through which class I TCP proteins achieve functional specificity.
Generation of TALE-Based Designer Epigenome Modifiers.
Nitsch, Sandra; Mussolino, Claudio
2018-01-01
Manipulation of gene expression can be facilitated by editing the genome or the epigenome. Precise genome editing is traditionally achieved by using designer nucleases which are generally exploited to eliminate a specific gene product. Upon the introduction of a site-specific DNA double-strand break (DSB) by the nuclease, endogenous DSB repair mechanisms are in turn harnessed to induce DNA sequence changes that can result in target gene inactivation. Minimal off-target effects can be obtained by endowing designer nucleases with the highly specific DNA-binding domain (DBD) derived from transcription activator-like effectors (TALEs). In contrast, epigenome editing allows gene expression control without inducing changes in the DNA sequence by specifically altering epigenetic marks, as histone tails modifications or DNA methylation patterns within promoter or enhancer regions. Importantly, this approach allows both up- and downregulation of the target gene expression, and the effect is generally reversible. TALE-based designer epigenome modifiers combine the high specificity of TALE-derived DBDs with the power of epigenetic modifier domains to induce fast and long-lasting changes in the epigenetic landscape of a target gene and control its expression. Here we provide a detailed description for the generation of TALE-based designer epigenome modifiers and of a suitable reporter cell line to easily monitor their activity.
Lednicky, J; Folk, W R
1992-01-01
The 21-bp repeat region of simian virus 40 (SV40) activates viral transcription and DNA replication and contains binding sites for many cellular proteins, including Sp1, LSF, ETF, Ap2, Ap4, GT-1B, H16, and p53, and for the SV40 large tumor antigen. We have attempted to reduce the complexity of this region while maintaining its growth-promoting capacity. Deletion of the 21-bp repeat region from the SV40 genome delays the expression of viral early proteins and DNA replication and reduces virus production in CV-1 cells. Replacement of the 21-bp repeat region with two copies of DNA sequence motifs bound with high affinities by Sp1 promotes SV40 growth in CV-1 cells to nearly wild-type levels, but substitution by motifs bound less avidly by Sp1 or bound by other activator proteins does not restore growth. This indicates that Sp1 or a protein with similar sequence specificity is primarily responsible for the function of the 21-bp repeat region. We speculate about how Sp1 activates both SV40 transcription and DNA replication. Images PMID:1328672
Ji, Yuhang; Zhang, Lei; Zhu, Longyi; Lei, Jianping; Wu, Jie; Ju, Huangxian
2017-10-15
A binding-induced DNA walker-assisted signal amplification was developed for highly selective electrochemical detection of protein. Firstly, the track of DNA walker was constructed by self-assembly of the high density ferrocene (Fc)-labeled anchor DNA and aptamer 1 on the gold electrode surface. Sequentially, a long swing-arm chain containing aptamer 2 and walking strand DNA was introduced onto gold electrode through aptamers-target specific recognition, and thus initiated walker strand sequences to hybridize with anchor DNA. Then, the DNA walker was activated by the stepwise cleavage of the hybridized anchor DNA by nicking endonuclease to release multiple Fc molecules for signal amplification. Taking thrombin as the model target, the Fc-generated electrochemical signal decreased linearly with logarithm value of thrombin concentration ranging from 10pM to 100nM with a detection limit of 2.5pM under the optimal conditions. By integrating the specific recognition of aptamers to target with the enzymatic cleavage of nicking endonuclease, the aptasensor showed the high selectivity. The binding-induced DNA walker provides a promising strategy for signal amplification in electrochemical biosensor, and has the extensive applications in sensitive and selective detection of the various targets. Copyright © 2017 Elsevier B.V. All rights reserved.
TALE-PvuII Fusion Proteins – Novel Tools for Gene Targeting
Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang
2013-01-01
Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity. PMID:24349308
Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.
Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N
2013-04-16
In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA (EC50 is the concentration of fluorescently labeled DNA at which half of the maximum fluorescence signal from DNA-bound cells is reached). We also obtained expressions for signals from bound DNA (measured by flow cytometry) in terms of N, K(nsL), and K(nsM). These expressions can be used for the verification of N, K(nsL), and K(nsM) values found from EC50 measurements. The developed procedure was applied to MCF-7 breast cancer cells, and corresponding values of N, K(nsL), and K(nsM) were established for the first time. The concentration of masking DNA required for AptaBiD with MCF-7 breast cancer cells was also estimated.
The GAGA protein of Drosophila is phosphorylated by CK2.
Bonet, Carles; Fernández, Irene; Aran, Xavier; Bernués, Jordi; Giralt, Ernest; Azorín, Fernando
2005-08-19
The GAGA factor of Drosophila is a sequence-specific DNA-binding protein that contributes to multiple processes from the regulation of gene expression to the structural organisation of heterochromatin and chromatin remodelling. GAGA is known to interact with various other proteins (tramtrack, pipsqueak, batman and dSAP18) and protein complexes (PRC1, NURF and FACT). GAGA functions are likely regulated at the level of post-translational modifications. Little is known, however, about its actual pattern of modification. It was proposed that GAGA can be O-glycosylated. Here, we report that GAGA519 isoform is a phosphoprotein that is phosphorylated by CK2 at the region of the DNA-binding domain. Our results indicate that phosphorylation occurs at S388 and, to a lesser extent, at S378. These two residues are located in a region of the DNA-binding domain that makes no direct contact with DNA, being dispensable for sequence-specific recognition. Phosphorylation at these sites does not abolish DNA binding but reduces the affinity of the interaction. These results are discussed in the context of the various functions and interactions that GAGA supports.
DNA mimic proteins: functions, structures, and bioinformatic analysis.
Wang, Hao-Ching; Ho, Chun-Han; Hsu, Kai-Cheng; Yang, Jinn-Moon; Wang, Andrew H-J
2014-05-13
DNA mimic proteins have DNA-like negative surface charge distributions, and they function by occupying the DNA binding sites of DNA binding proteins to prevent these sites from being accessed by DNA. DNA mimic proteins control the activities of a variety of DNA binding proteins and are involved in a wide range of cellular mechanisms such as chromatin assembly, DNA repair, transcription regulation, and gene recombination. However, the sequences and structures of DNA mimic proteins are diverse, making them difficult to predict by bioinformatic search. To date, only a few DNA mimic proteins have been reported. These DNA mimics were not found by searching for functional motifs in their sequences but were revealed only by structural analysis of their charge distribution. This review highlights the biological roles and structures of 16 reported DNA mimic proteins. We also discuss approaches that might be used to discover new DNA mimic proteins.
Shkolnik, Doron; Bar-Zvi, Dudy
2008-05-01
The manipulation of transacting factors is commonly used to achieve a wide change in the expression of a large number of genes in transgenic plants as a result of a change in the expression of a single gene product. This is mostly achieved by the overexpression of transactivator or repressor proteins. In this study, it is demonstrated that the overexpression of an exogenous DNA-binding protein can be used to compete with the expression of an endogenous transcription factor sharing the same DNA-binding sequence. Arabidopsis was transformed with cDNA encoding tomato abscisic acid stress ripening 1 (ASR1), a sequence-specific DNA protein that has no orthologues in the Arabidopsis genome. ASR1-overexpressing (ASR1-OE) plants display an abscisic acid-insensitive 4 (abi4) phenotype: seed germination is not sensitive to inhibition by abscisic acid (ABA), glucose, NaCl and paclobutrazol. ASR1 binds coupling element 1 (CE1), a cis-acting element bound by the ABI4 transcription factor, located in the ABI4-regulated promoters, including that of the ABI4 gene. Chromatin immunoprecipitation demonstrates that ASR1 is bound in vivo to the promoter of the ABI4 gene in ASR1-OE plants, but not to promoters of genes known to be regulated by the transcription factors ABI3 or ABI5. Real-time polymerase chain reaction (PCR) analysis confirmed that the expression of ABI4 and ABI4-regulated genes is markedly reduced in ASR1-OE plants. Therefore, it is concluded that the abi4 phenotype of ASR1-OE plants is the result of competition between the foreign ASR1 and the endogenous ABI4 on specific promoter DNA sequences. The biotechnological advantage of using this approach in crop plants from the Brassicaceae family to reduce the transactivation activity of ABI4 is discussed.
Oliviero, S; Cortese, R
1989-01-01
Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Drosophila cell cycle under arrest: uncapped telomeres plead guilty.
Cenci, Giovanni
2009-04-01
Telomeres are specialized structures that protect chromosome ends from degradation and fusion events. In most organisms, telomeres consist of short, repetitive G-rich sequences added to chromosome ends by a reverse transcriptase with an internal RNA template, called telomerase. Specific DNA-binding protein complexes associate with telomeric sequences preventing chromosome ends from being recognized as DNA double strand breaks (DSBs). Telomeres that lose their cap activate the DNA damage response (DDR) likewise DSBs and, if inappropriately repaired, generate telomeric fusions, which eventually lead to genome instability. In Drosophila there is not telomerase, and telomere length is maintained by transposition of three specialized retroelements. However, fly telomeres are protected by multi protein complexes like their yeast and vertebrate counterparts; these complexes bind chromosome ends in a sequence-independent fashion and are required to prevent checkpoint activation and end-to-end fusion. Uncapped Drosophila telomeres elicit a DDR just as dysfunctional human telomeres. Most interestingly, uncapped Drosophila telomeres also activate the spindle assembly checkpoint (SAC) by recruiting the SAC kinase BubR1. BubR1 accumulations at chromosome ends trigger the SAC that inhibits the metaphase-to-anaphase transition. These findings, reviewed here, highlight an intriguing and unsuspected connection between telomeres and cell cycle regulation, providing a clue to understand human telomere function.
Cooper, Lauren A.; Stringer, Anne M.
2018-01-01
ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291
Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya
2018-03-01
LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.
Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.
2016-01-01
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769
Structural basis of DNA target recognition by the B3 domain of Arabidopsis epigenome reader VAL1
Sasnauskas, Giedrius; Kauneckaitė, Kotryna; Siksnys, Virginijus
2018-01-01
Abstract Arabidopsis thaliana requires a prolonged period of cold exposure during winter to initiate flowering in a process termed vernalization. Exposure to cold induces epigenetic silencing of the FLOWERING LOCUS C (FLC) gene by Polycomb group (PcG) proteins. A key role in this epigenetic switch is played by transcriptional repressors VAL1 and VAL2, which specifically recognize Sph/RY DNA sequences within FLC via B3 DNA binding domains, and mediate recruitment of PcG silencing machinery. To understand the structural mechanism of site-specific DNA recognition by VAL1, we have solved the crystal structure of VAL1 B3 domain (VAL1-B3) bound to a 12 bp oligoduplex containing the canonical Sph/RY DNA sequence 5′-CATGCA-3′/5′-TGCATG-3′. We find that VAL1-B3 makes H-bonds and van der Waals contacts to DNA bases of all six positions of the canonical Sph/RY element. In agreement with the structure, in vitro DNA binding studies show that VAL1-B3 does not tolerate substitutions at any position of the 5′-TGCATG-3′ sequence. The VAL1-B3–DNA structure presented here provides a structural model for understanding the specificity of plant B3 domains interacting with the Sph/RY and other DNA sequences. PMID:29660015
Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian
2009-07-13
Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.
Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.
2013-01-01
To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679
Wang, Qianqian; Li, Lanlan; Wang, Xiaoting; Liu, Huanxiang; Yao, Xiaojun
2014-11-01
The Z-DNA-binding domain of human double-stranded RNA adenosine deaminase I (hZαADAR1) can specifically recognize the left-handed Z-DNA which preferentially occurs at alternating purine-pyrimidine repeats, especially the CG-repeats. The interactions of hZαADAR1 and Z-DNAs in different sequence contexts can affect many important biological functions including gene regulation and chromatin remodeling. Therefore it is of great necessity to fully understand their recognition mechanisms. However, most existing studies are aimed at the standard CG-repeat Z-DNA rather than the non-CG-repeats, and whether the molecular basis of hZαADAR1 binding to various Z-DNAs are identical or not is still unclear on the atomic level. Here, based on the recently determined crystal structures of three representative non-CG-repeat Z-DNAs (d(CACGTG)2, d(CGTACG)2 and d(CGGCCG)2) in complex with hZαADAR1, 40 ns molecular dynamics simulation together with binding free energy calculation were performed for each system. For comparison, the standard CG-repeat Z-DNA (d(CGCGCG)2) complexed with hZαADAR1 was also simulated. The consistent results demonstrate that nonpolar interaction is the driving force during the protein-DNA binding process, and that polar interaction mainly from helix α3 also provides important contributions. Five common hot-spot residues were identified, namely Lys169, Lys170, Asn173, Arg174 and Tyr177. Hydrogen bond analysis coupled with surface charge distribution further reveal the interfacial information between hZαADAR1 and Z-DNA in detail. All of the analysis illustrate that four complexes share the common key features and the similar binding modes irrespective of Z-DNA sequences, suggesting that Z-DNA recognition by hZαADAR1 is conformation-specific rather than sequence-specific. Additionally, by analyzing the conformational changes of hZαADAR1, we found that the binding of Z-DNA could effectively stabilize hZαADAR1 protein. Our study can provide some valuable information for better understanding the binding mechanism between hZαADAR1 or even other Z-DNA-binding protein and Z-DNA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Xun; Guanga, Gerald P; Wan, Cheng
2012-11-13
MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less
Prediction of TF target sites based on atomistic models of protein-DNA complexes
Angarica, Vladimir Espinosa; Pérez, Abel González; Vasconcelos, Ana T; Collado-Vides, Julio; Contreras-Moreira, Bruno
2008-01-01
Background The specific recognition of genomic cis-regulatory elements by transcription factors (TFs) plays an essential role in the regulation of coordinated gene expression. Studying the mechanisms determining binding specificity in protein-DNA interactions is thus an important goal. Most current approaches for modeling TF specific recognition rely on the knowledge of large sets of cognate target sites and consider only the information contained in their primary sequence. Results Here we describe a structure-based methodology for predicting sequence motifs starting from the coordinates of a TF-DNA complex. Our algorithm combines information regarding the direct and indirect readout of DNA into an atomistic statistical model, which is used to estimate the interaction potential. We first measure the ability of our method to correctly estimate the binding specificities of eight prokaryotic and eukaryotic TFs that belong to different structural superfamilies. Secondly, the method is applied to two homology models, finding that sampling of interface side-chain rotamers remarkably improves the results. Thirdly, the algorithm is compared with a reference structural method based on contact counts, obtaining comparable predictions for the experimental complexes and more accurate sequence motifs for the homology models. Conclusion Our results demonstrate that atomic-detail structural information can be feasibly used to predict TF binding sites. The computational method presented here is universal and might be applied to other systems involving protein-DNA recognition. PMID:18922190
Wang, Xiaofeng; Zhang, Aiqun; Ren, Weizheng; Chen, Caiyu; Dong, Jiahong
2012-11-01
The cell growth, development, and regeneration of tissue and organ are associated with a large number of gene regulation events, which are mediated in part by transcription factors (TFs) binding to cis-regulatory elements involved in the genome. Predicting the binding affinity and inferring the binding specificity of TF-DNA interactions at the genomic level would be fundamentally helpful for our understanding of the molecular mechanism and biological implication underlying sequence-specific TF-DNA recognition. In this study, we report the development of a combination method to characterize the interaction behavior of a 11-mer oligonucleotide segment and its mutations with the Gcn4p protein, a homodimeric, basic leucine zipper TF, and to predict the binding affinity and specificity of potential Gcn4p binders in the genome-wide scale. In this procedure, a position-mutated energy matrix is created based on molecular modeling analysis of native and mutated Gcn4p-DNA complex structures to describe the position-independent interaction energy profile of Gcn4p with different nucleotide types at each position of the oligonucleotide, and the energy terms extracted from the matrix and their interactives are then correlated with experimentally measured affinities of 19268 distinct oligonucleotides using statistical modeling methodology. Subsequently, the best one of built regression models is successfully applied to screen those of potential high-affinity Gcn4p binders from the complete genome. The findings arising from this study are briefly listed below: (i) The 11 positions of oligonucleotides are highly interactive and non-additive in contribution to Gcn4p-DNA binding affinity; (ii) Indirect conformational effects upon nucleotide mutations as well as associated subtle changes in interfacial atomic contacts, but not the direct nonbonded interactions, are primarily responsible for the sequence-specific recognition; (iii) The intrinsic synergistic effects among the sequence positions of oligonucleotides determine Gcn4p-DNA binding affinity and specificity; (iv) Linear regression models in conjunction with variable selection seem to perform fairly well in capturing the internal dependences hidden in the Gcn4p-DNA system, albeit ignoring nonlinear factors may lead the models to systematically underestimate and overestimate high- and low-affinity samples, respectively. © 2012 John Wiley & Sons A/S.
Paugh, Steven W.; Coss, David R.; Bao, Ju; ...
2016-02-04
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paugh, Steven W.; Coss, David R.; Bao, Ju
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less
Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T
2018-04-17
In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.
Titration of DnaA protein by oriC DnaA-boxes increases dnaA gene expression in Escherichia coli.
Hansen, F G; Koefoed, S; Sørensen, L; Atlung, T
1987-01-01
Binding of the DnaA protein to its binding sites, the DnaA-boxes (TTATCCACA), was measured by a simple physiological approach. The presence of extra DnaA-boxes in growing cells leads to a derepression of dnaA gene expression, measured as beta-galactosidase activity of a dnaA-lacZ fusion polypeptide. Different DnaA-boxes caused different degrees of derepression indicating that the DnaA protein requires sequences in addition to the DnaA-box for efficient binding. The DnaA-boxes in oriC might act cooperatively in binding of the DnaA protein. The derepressed levels of DnaA protein obtained in a strain carrying an oriC+-pBR322 chimera were very high and sufficient to activate oriC on the chimeric plasmid, which was maintained at a copy number more than three times that of pBR322. PMID:3034578
Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.
Grange, T; de Sa, C M; Oddos, J; Pictet, R
1987-01-01
We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805
Lan, Susan; Kamel, Wael; Punga, Tanel; Akusjärvi, Göran
2017-02-28
The adenovirus L4-22K protein both activates and suppresses transcription from the adenovirus major late promoter (MLP) by binding to DNA elements located downstream of the MLP transcriptional start site: the so-called DE element (positive) and the R1 region (negative). Here we show that L4-22K preferentially binds to the RNA form of the R1 region, both to the double-stranded RNA and the single-stranded RNA of the same polarity as the nascent MLP transcript. Further, L4-22K binds to a 5΄-CAAA-3΄ motif in the single-stranded RNA, which is identical to the sequence motif characterized for L4-22K DNA binding. L4-22K binding to single-stranded RNA results in an enhancement of U1 snRNA recruitment to the major late first leader 5΄ splice site. This increase in U1 snRNA binding results in a suppression of MLP transcription and a concurrent stimulation of major late first intron splicing. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing
2016-04-15
In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.
Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R
2018-05-22
Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4 M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.
Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I
1990-03-25
The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.
Contacts between the factor TUF and RPG sequences.
Vignais, M L; Huet, J; Buhler, J M; Sentenac, A
1990-08-25
The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.
Foggetti, Giorgia; Raimondi, Ivan; Campomenosi, Paola; Menichini, Paola
2014-01-01
TP63 is a member of the TP53 gene family that encodes for up to ten different TA and ΔN isoforms through alternative promoter usage and alternative splicing. Besides being a master regulator of gene expression for squamous epithelial proliferation, differentiation and maintenance, P63, through differential expression of its isoforms, plays important roles in tumorigenesis. All P63 isoforms share an immunoglobulin-like folded DNA binding domain responsible for binding to sequence-specific response elements (REs), whose overall consensus sequence is similar to that of the canonical p53 RE. Using a defined assay in yeast, where P63 isoforms and RE sequences are the only variables, and gene expression assays in human cell lines, we demonstrated that human TA- and ΔN-P63α proteins exhibited differences in transactivation specificity not observed with the corresponding P73 or P53 protein isoforms. These differences 1) were dependent on specific features of the RE sequence, 2) could be related to intrinsic differences in their oligomeric state and cooperative DNA binding, and 3) appeared to be conserved in evolution. Since genotoxic stress can change relative ratio of TA- and ΔN-P63α protein levels, the different transactivation specificity of each P63 isoform could potentially influence cellular responses to specific stresses. PMID:24926492
GBshape: a genome browser database for DNA shape annotations.
Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J; Parker, Stephen C J; Nuzhdin, Sergey V; Tullius, Thomas D; Rohs, Remo
2015-01-01
Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Cai, Sheng; Cao, Zhijuan; Lau, Choiwan; Lu, Jianzhong
2014-11-21
By using the allosteric hairpin DNA switch, a novel assay for the detection of microRNA (miRNA) let-7a via a hybridization chain reaction (HCR) was introduced. Briefly, the hairpin DNA switch probe is a single-stranded DNA consisting of a streptavidin (SA) aptamer sequence, a target binding sequence and a certain sequence that acts as a trigger of the HCR. In the presence of target let-7a, the hairpin DNA switch would open and expose the stem region sequences, where a part of this sequence acts as initiator sequence strands for the HCR and triggers a cascade of hybridization events that yields nicked double helices analogous to alternating copolymers, another part is the SA aptamer sequence which activates its binding affinity to SA on SA-coated magnetic particles. The hybridization event could be sensitively detected via an instantaneous derivatization reaction between a special chemiluminescence (CL) reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG) and the guanine nucleotides within the target, the hairpin DNA switch probe, and HCR helices to form an unstable CL intermediate for the generation of light. Our results show that the coupling of the hairpin DNA switch probe and the HCR for the amplified detection of let-7a achieves a better performance (e.g. wide linear response range: 0.1-1000 fmol, low detection limit: 0.1 fmol, and high specificity). Furthermore, this approach could be easily applied to the detection of let-7a in human lung cells, and extended to detect other types of miRNA and proteins such as PDGF based on aptamers. We believe such advancements will represent a significant step towards improved diagnostics and more personalized medical treatment.
Brucoli, Federico; Guzman, Juan D; Basher, Mohammad A; Evangelopoulos, Dimitrios; McMahon, Eleanor; Munshi, Tulika; McHugh, Timothy D; Fox, Keith R; Bhakta, Sanjib
2016-12-01
New chemotherapeutic agents with novel mechanisms of action are in urgent need to combat the tuberculosis pandemic. A library of 12 C8-linked pyrrolo[2,1-c][1,4]benzodiazepine (PBD)-heterocyclic polyamide conjugates (1-12) was evaluated for anti-tubercular activity and DNA sequence selectivity. The PBD conjugates were screened against slow-growing Mycobacterium bovis Bacillus Calmette-Guérin and M. tuberculosis H 37 Rv, and fast-growing Escherichia coli, Pseudomonas putida and Rhodococcus sp. RHA1 bacteria. DNase I footprinting and DNA thermal denaturation experiments were used to determine the molecules' DNA recognition properties. The PBD conjugates were highly selective for the mycobacterial strains and exhibited significant growth inhibitory activity against the pathogenic M. tuberculosis H 37 Rv, with compound 4 showing MIC values (MIC=0.08 mg l -1 ) similar to those of rifampin and isoniazid. DNase I footprinting results showed that the PBD conjugates with three heterocyclic moieties had enhanced sequence selectivity and produced larger footprints, with distinct cleavage patterns compared with the two-heterocyclic chain PBD conjugates. DNA melting experiments indicated a covalent binding of the PBD conjugates to two AT-rich DNA-duplexes containing either a central GGATCC or GTATAC sequence, and showed that the polyamide chains affect the interactions of the molecules with DNA. The PBD-C8 conjugates tested in this study have a remarkable anti-mycobacterial activity and can be further developed as DNA-targeted anti-tubercular drugs.
Inhibition of HMGA2 binding to DNA by netropsin
Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David
2008-01-01
The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407
Functional Requirements for Fab-7 Boundary Activity in the Bithorax Complex.
Wolle, Daniel; Cleard, Fabienne; Aoki, Tsutomu; Deshpande, Girish; Schedl, Paul; Karch, Francois
2015-11-01
Chromatin boundaries are architectural elements that determine the three-dimensional folding of the chromatin fiber and organize the chromosome into independent units of genetic activity. The Fab-7 boundary from the Drosophila bithorax complex (BX-C) is required for the parasegment-specific expression of the Abd-B gene. We have used a replacement strategy to identify sequences that are necessary and sufficient for Fab-7 boundary function in the BX-C. Fab-7 boundary activity is known to depend on factors that are stage specific, and we describe a novel ∼700-kDa complex, the late boundary complex (LBC), that binds to Fab-7 sequences that have insulator functions in late embryos and adults. We show that the LBC is enriched in nuclear extracts from late, but not early, embryos and that it contains three insulator proteins, GAF, Mod(mdg4), and E(y)2. Its DNA binding properties are unusual in that it requires a minimal sequence of >65 bp; however, other than a GAGA motif, the three Fab-7 LBC recognition elements display few sequence similarities. Finally, we show that mutations which abrogate LBC binding in vitro inactivate the Fab-7 boundary in the BX-C. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Multiple structure-intrinsic disorder interactions regulate and coordinate Hox protein function
NASA Astrophysics Data System (ADS)
Bondos, Sarah
During animal development, Hox transcription factors determine fate of developing tissues to generate diverse organs and appendages. Hox proteins are famous for their bizarre mutant phenotypes, such as replacing antennae with legs. Clearly, the functions of individual Hox proteins must be distinct and reliable in vivo, or the organism risks malformation or death. However, within the Hox protein family, the DNA-binding homeodomains are highly conserved and the amino acids that contact DNA are nearly invariant. These observations raise the question: How do different Hox proteins correctly identify their distinct target genes using a common DNA binding domain? One possible means to modulate DNA binding is through the influence of the non-homeodomain protein regions, which differ significantly among Hox proteins. However genetic approaches never detected intra-protein interactions, and early biochemical attempts were hindered because the special features of ``intrinsically disordered'' sequences were not appreciated. We propose the first-ever structural model of a Hox protein to explain how specific contacts between distant, intrinsically disordered regions of the protein and the homeodomain regulate DNA binding and coordinate this activity with other Hox molecular functions.
Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H
2006-11-21
Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.
Cook, W B; Walker, J C
1992-01-01
A cDNA encoding a nuclear-encoded chloroplast nucleic acid-binding protein (NBP) has been isolated from maize. Identified as an in vitro DNA-binding activity, NBP belongs to a family of nuclear-encoded chloroplast proteins which share a common domain structure and are thought to be involved in posttranscriptional regulation of chloroplast gene expression. NBP contains an N-terminal chloroplast transit peptide, a highly acidic domain and a pair of ribonucleoprotein consensus sequence domains. NBP is expressed in a light-dependent, organ-specific manner which is consistent with its involvement in chloroplast biogenesis. The relationship of NBP to the other members of this protein family and their possible regulatory functions are discussed. Images PMID:1346929
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Hurst, H C; Masson, N; Jones, N C; Lee, K A
1990-12-01
Promoter elements containing the sequence motif CGTCA are important for a variety of inducible responses at the transcriptional level. Multiple cellular factors specifically bind to these elements and are encoded by a multigene family. Among these factors, polypeptides termed activating transcription factor 43 (ATF-43) and ATF-47 have been purified from HeLa cells and a factor referred to as cyclic AMP response element-binding protein (CREB) has been isolated from PC12 cells and rat brain. We demonstrated that CREB and ATF-47 are identical and that CREB and ATF-43 form protein-protein complexes. We also found that the cis requirements for stable DNA binding by ATF-43 and CREB are different. Using antibodies to ATF-43 we have identified a group of polypeptides (ATF-43) in the size range from 40 to 43 kDa. ATF-43 polypeptides are related by their reactivity with anti-ATF-43, DNA-binding specificity, complex formation with CREB, heat stability, and phosphorylation by protein kinase A. Certain cell types vary in their ATF-43 complement, suggesting that CREB activity is modulated in a cell-type-specific manner through interaction with ATF-43. ATF-43 polypeptides do not appear simply to correspond to the gene products of the ATF multigene family, suggesting that the size of the ATF family at the protein level is even larger than predicted from cDNA-cloning studies.
Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.
2016-01-01
Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825
Evolutionary and biophysical relationships among the papillomavirus E2 proteins.
Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael
2009-01-01
Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.
Buchmueller, Karen L; Staples, Andrew M; Howard, Cameron M; Horick, Sarah M; Uthe, Peter B; Le, N Minh; Cox, Kari K; Nguyen, Binh; Pacheco, Kimberly A O; Wilson, W David; Lee, Moses
2005-01-19
Pyrrole (Py) and imidazole (Im) polyamides can be designed to target specific DNA sequences. The effect that the pyrrole and imidazole arrangement, plus DNA sequence, have on sequence specificity and binding affinity has been investigated using DNA melting (DeltaT(M)), circular dichroism (CD), and surface plasmon resonance (SPR) studies. SPR results obtained from a complete set of triheterocyclic polyamides show a dramatic difference in the affinity of f-ImPyIm for its cognate DNA (K(eq) = 1.9 x 10(8) M(-1)) and f-PyPyIm for its cognate DNA (K(eq) = 5.9 x 10(5) M(-1)), which could not have been anticipated prior to characterization of these compounds. Moreover, f-ImPyIm has a 10-fold greater affinity for CGCG than distamycin A has for its cognate, AATT. To understand this difference, the triamide dimers are divided into two structural groupings: central and terminal pairings. The four possible central pairings show decreasing selectivity and affinity for their respective cognate sequences: -ImPy > -PyPy- > -PyIm- approximately -ImIm-. These results extend the language of current design motifs for polyamide sequence recognition to include the use of "words" for recognizing two adjacent base pairs, rather than "letters" for binding to single base pairs. Thus, polyamides designed to target Watson-Crick base pairs should utilize the strength of -ImPy- and -PyPy- central pairings. The f/Im and f/Py terminal groups yielded no advantage for their respective C/G or T/A base pairs. The exception is with the -ImPy- central pairing, for which f/Im has a 10-fold greater affinity for C/G than f/Py has for T/A.
Switching bonds in a DNA gel: an all-DNA vitrimer.
Romano, Flavio; Sciortino, Francesco
2015-02-20
We design an all-DNA system that behaves like vitrimers, innovative plastics with self-healing and stress-releasing properties. The DNA sequences are engineered to self-assemble first into tetra- and bifunctional units which, upon further cooling, bind to each other forming a fully bonded network gel. An innovative design of the binding regions of the DNA sequences, exploiting a double toehold-mediated strand displacement, generates a network gel which is able to reshuffle its bonds, retaining at all times full bonding. As in vitrimers, the rate of bond switching can be controlled via a thermally activated catalyst, which in the present design is very short DNA strands.
A DNA sequence element that advances replication origin activation time in Saccharomyces cerevisiae.
Pohl, Thomas J; Kolor, Katherine; Fangman, Walton L; Brewer, Bonita J; Raghuraman, M K
2013-11-06
Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time.
Modification-dependent restriction endonuclease, MspJI, flips 5-methylcytosine out of the DNA helix
Horton, J. R.; Wang, H.; Mabuchi, M. Y.; ...
2014-09-27
MspJI belongs to a family of restriction enzymes that cleave DNA containing 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC). MspJI is specific for the sequence 5(h)mC-N-N-G or A and cleaves with some variability 9/13 nucleotides downstream. Earlier, we reported the crystal structure of MspJI without DNA and proposed how it might recognize this sequence and catalyze cleavage. Here we report its co-crystal structure with a 27-base pair oligonucleotide containing 5mC. This structure confirms that MspJI acts as a homotetramer and that the modified cytosine is flipped from the DNA helix into an SRA-like-binding pocket. We expected the structure to reveal two DNAmore » molecules bound specifically to the tetramer and engaged with the enzyme's two DNA-cleavage sites. A coincidence of crystal packing precluded this organization, however. We found that each DNA molecule interacted with two adjacent tetramers, binding one specifically and the other non-specifically. The latter interaction, which prevented cleavage-site engagement, also involved base flipping and might represent the sequence-interrogation phase that precedes specific recognition. MspJI is unusual in that DNA molecules are recognized and cleaved by different subunits. Such interchange of function might explain how other complex multimeric restriction enzymes act.« less
Ping, Gang; Lv, Gang; Gutmann, Sebastian; Chen, Chen; Zhang, Renyun; Wang, Xuemei
2006-01-01
The interaction between procaine hydrochloride and DNA/DNA bases in the absence and presence of cadmium sulfide (CdS) nanoparticles has been explored in this study by using differential pulse voltammetry, atomic force microscopy (AFM) and so on, which illustrates the different binding behaviors of procaine hydrochloride with different DNA bases. The results clearly indicate that the binding of purines to procaine hydrochloride is stronger than that of pyrimidines and the binding affinity is in the order of G > A > T > C. In addition, it was observed that the presence of CdS nanoparticles could remarkably enhance the probing sensitivity for the interaction between procaine hydrochloride and DNA/DNA bases. Furthermore, AFM study illustrates that procaine hydrochloride can bind to some specific sites of DNA chains, which indicates that procaine hydrochloride may interact with some special sequences of DNA.
The consequences of sequence erosion in the evolution of recombination hotspots.
Tiemann-Boege, Irene; Schwarz, Theresa; Striedner, Yasmin; Heissl, Angelika
2017-12-19
Meiosis is initiated by a double-strand break (DSB) introduced in the DNA by a highly controlled process that is repaired by recombination. In many organisms, recombination occurs at specific and narrow regions of the genome, known as recombination hotspots, which overlap with regions enriched for DSBs. In recent years, it has been demonstrated that conversions and mutations resulting from the repair of DSBs lead to a rapid sequence evolution at recombination hotspots eroding target sites for DSBs. We still do not fully understand the effect of this erosion in the recombination activity, but evidence has shown that the binding of trans -acting factors like PRDM9 is affected. PRDM9 is a meiosis-specific, multi-domain protein that recognizes DNA target motifs by its zinc finger domain and directs DSBs to these target sites. Here we discuss the changes in affinity of PRDM9 to eroded recognition sequences, and explain how these changes in affinity of PRDM9 can affect recombination, leading sometimes to sterility in the context of hybrid crosses. We also present experimental data showing that DNA methylation reduces PRDM9 binding in vitro Finally, we discuss PRDM9-independent hotspots, posing the question how these hotspots evolve and change with sequence erosion.This article is part of the themed issue 'Evolutionary causes and consequences of recombination rate variation in sexual organisms'. © 2017 The Authors.
The consequences of sequence erosion in the evolution of recombination hotspots
Schwarz, Theresa; Heissl, Angelika
2017-01-01
Meiosis is initiated by a double-strand break (DSB) introduced in the DNA by a highly controlled process that is repaired by recombination. In many organisms, recombination occurs at specific and narrow regions of the genome, known as recombination hotspots, which overlap with regions enriched for DSBs. In recent years, it has been demonstrated that conversions and mutations resulting from the repair of DSBs lead to a rapid sequence evolution at recombination hotspots eroding target sites for DSBs. We still do not fully understand the effect of this erosion in the recombination activity, but evidence has shown that the binding of trans-acting factors like PRDM9 is affected. PRDM9 is a meiosis-specific, multi-domain protein that recognizes DNA target motifs by its zinc finger domain and directs DSBs to these target sites. Here we discuss the changes in affinity of PRDM9 to eroded recognition sequences, and explain how these changes in affinity of PRDM9 can affect recombination, leading sometimes to sterility in the context of hybrid crosses. We also present experimental data showing that DNA methylation reduces PRDM9 binding in vitro. Finally, we discuss PRDM9-independent hotspots, posing the question how these hotspots evolve and change with sequence erosion. This article is part of the themed issue ‘Evolutionary causes and consequences of recombination rate variation in sexual organisms’. PMID:29109225
Measurements of nonlinear Hall-driven reconnection in the reversed field pinch
NASA Astrophysics Data System (ADS)
Tharp, Timothy D.
Complex organisms are able to develop because of the complex regulatory systems that control their gene expression. The first step in this regulation, transcription initiation, is controlled by transcription factors. Transcription factors are modular proteins composed of two distinct domains, the DNA binding domain and the regulatory domain. These molecules are involved in a plethora of important biological processes including embryogenesis, development, cell health, and cancer. Tissue enriched transcription factors Nkx-2.5 and Gata4 are involved in cardiac development and cardiac health. In this thesis the DNA binding specificity of Nkx-2.5 will be analyzed using a high throughput double stranded DNA platform called Cognate Site Identifier (CSI) arrays (Chapter 2). The full DNA binding specificity of Nkx-2.5 and Nkx-2.5 mutants will be visualized using Sequence Specificity Landscapes (SSLs). In Chapter 3, the definition of binding specificity will be investigated by evaluating a number of different DNA binding folds by CSI and SSLs. CSI and SSLs will also be used to evaluate different pyrrole/imidazole hairpin polyamides in order to better characterize these small molecule DNA binding domains. CSI and SSL data will be applied to the genome in order to explain the biological function an artificial transcription factor. Chapter 4 will discuss the mechanism of nonspecific DNA binding. The historical means of predicting DNA binding will be challenged by utilizing high throughput experiments. The effect of salt concentration on both specific and nonspecific binding will also be investigated. Finally, in Chapter 5, a generation of Protein DNA Dimerizer will be discussed. A PDD that regulates transcription on genomic DNA by binding cooperatively with the heart IF Gata4 will be characterized. These studies provide understanding of, and a means to control, how transcription factors sample the endless sea of DNA in the genome in order to regulate gene expression with such wonderful specificity.
Structure of 5-hydroxymethylcytosine-specific restriction enzyme, AbaSI, in complex with DNA.
Horton, John R; Borgaro, Janine G; Griggs, Rose M; Quimby, Aine; Guan, Shengxi; Zhang, Xing; Wilson, Geoffrey G; Zheng, Yu; Zhu, Zhenyu; Cheng, Xiaodong
2014-07-01
AbaSI, a member of the PvuRts1I-family of modification-dependent restriction endonucleases, cleaves deoxyribonucleic acid (DNA) containing 5-hydroxymethylctosine (5hmC) and glucosylated 5hmC (g5hmC), but not DNA containing unmodified cytosine. AbaSI has been used as a tool for mapping the genomic locations of 5hmC, an important epigenetic modification in the DNA of higher organisms. Here we report the crystal structures of AbaSI in the presence and absence of DNA. These structures provide considerable, although incomplete, insight into how this enzyme acts. AbaSI appears to be mainly a homodimer in solution, but interacts with DNA in our structures as a homotetramer. Each AbaSI subunit comprises an N-terminal, Vsr-like, cleavage domain containing a single catalytic site, and a C-terminal, SRA-like, 5hmC-binding domain. Two N-terminal helices mediate most of the homodimer interface. Dimerization brings together the two catalytic sites required for double-strand cleavage, and separates the 5hmC binding-domains by ∼70 Å, consistent with the known activity of AbaSI which cleaves DNA optimally between symmetrically modified cytosines ∼22 bp apart. The eukaryotic SET and RING-associated (SRA) domains bind to DNA containing 5-methylcytosine (5mC) in the hemi-methylated CpG sequence. They make contacts in both the major and minor DNA grooves, and flip the modified cytosine out of the helix into a conserved binding pocket. In contrast, the SRA-like domain of AbaSI, which has no sequence specificity, contacts only the minor DNA groove, and in our current structures the 5hmC remains intra-helical. A conserved, binding pocket is nevertheless present in this domain, suitable for accommodating 5hmC and g5hmC. We consider it likely, therefore, that base-flipping is part of the recognition and cleavage mechanism of AbaSI, but that our structures represent an earlier, pre-flipped stage, prior to actual recognition. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Structure of 5-hydroxymethylcytosine-specific restriction enzyme, AbaSI, in complex with DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Horton, John R.; Borgaro, Janine G.; Griggs, Rose M.
2014-07-03
AbaSI, a member of the PvuRts1I-family of modification-dependent restriction endonucleases, cleaves DNA containing 5-hydroxymethylctosine (5hmC) and glucosylated 5hmC (g5hmC), but not DNA containing unmodified cytosine. AbaSI has been used as a tool for mapping the genomic locations of 5hmC, an important epigenetic modification in the DNA of higher organisms. Here we report the crystal structures of AbaSI in the presence and absence of DNA. These structures provide considerable, although incomplete, insight into how this enzyme acts. AbaSI appears to be mainly a homodimer in solution, but interacts with DNA in our structures as a homotetramer. Each AbaSI subunit comprises anmore » N-terminal, Vsr-like, cleavage domain containing a single catalytic site, and a C-terminal, SRA-like, 5hmC-binding domain. Two N-terminal helices mediate most of the homodimer interface. Dimerization brings together the two catalytic sites required for double-strand cleavage, and separates the 5hmC binding-domains by ~ 70 Å, consistent with the known activity of AbaSI which cleaves DNA optimally between symmetrically modified cytosines ~ 22 bp apart. The eukaryotic SET and RING-associated (SRA) domains bind to DNA containing 5-methylcytosine (5mC) in the hemi-methylated CpG sequence. They make contacts in both the major and minor DNA grooves, and flip the modified cytosine out of the helix into a conserved binding pocket. In contrast, the SRA-like domain of AbaSI, which has no sequence specificity, contacts only the minor DNA groove, and in our current structures the 5hmC remains intra-helical. A conserved, binding pocket is nevertheless present in this domain, suitable for accommodating 5hmC and g5hmC. We consider it likely, therefore, that base-flipping is part of the recognition and cleavage mechanism of AbaSI, but that our structures represent an earlier, pre-flipped stage, prior to actual recognition.« less
Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level
NASA Astrophysics Data System (ADS)
Ray, Sujay
Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Finally, we studied another protein-GQ system where a protein complex works synergistically with a GQ to suppress DNA damage signals by preventing RPA to bind to telomeric DNA. Human telomeres that terminate with a single-stranded 3' G-overhang can be recognized as a DNA damage site by RPA. The protection of telomere-1 (POT1) and POT1-interacting protein (TPP1) heterodimer, binds specifically to telomeric DNA and protects it against RPA binding. Using model telomeric DNA, we studied the competition between POT1/TPP1 and RPA to access telomeric GQs in vitro. Under physiological salt and pH conditions, POT1/TPP1 stably load to a minimal DNA sequence adjacent to a folded GQ and unfolds the anti-parallel GQ as the parallel conformation remains folded. We showed that GQ formation of telomeres enhances the ability of POT1/TPP1 to block RPA's access to telomeres by two orders of magnitude and contributes to suppress DNA damage signals.
Kirchner, Jasmin; Vissi, Emese; Gross, Sascha; Szoor, Balazs; Rudenko, Andrey; Alphey, Luke; White-Cooper, Helen
2008-01-01
Background Protein phosphatase 1 (PP1) is involved in diverse cellular processes, and is targeted to substrates via interaction with many different protein binding partners. PP1 catalytic subunits (PP1c) fall into PP1α and PP1β subfamilies based on sequence analysis, however very few PP1c binding proteins have been demonstrated to discriminate between PP1α and PP1β. Results URI (unconventional prefoldin RPB5 interactor) is a conserved molecular chaperone implicated in a variety of cellular processes, including the transcriptional response to nutrient signalling and maintenance of DNA integrity. We show that Drosophila Uri binds PP1α with much higher affinity than PP1β, and that this ability to discriminate between PP1c forms is conserved to humans. Most Uri is cytoplasmic, however we found some protein associated with active RNAPII on chromatin. We generated a uri loss of function allele, and show that uri is essential for viability in Drosophila. uri mutants have transcriptional defects, reduced cell viability and differentiation in the germline, and accumulate DNA damage in their nuclei. Conclusion Uri is the first PP1α specific binding protein to be described in Drosophila. Uri protein plays a role in transcriptional regulation. Activity of uri is required to maintain DNA integrity and cell survival in normal development. PMID:18412953
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E
2010-06-01
A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.
Enantiospecific recognition of DNA sequences by a proflavine Tröger base.
Bailly, C; Laine, W; Demeunynck, M; Lhomme, J
2000-07-05
The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.
QueTAL: a suite of tools to classify and compare TAL effectors functionally and phylogenetically
Pérez-Quintero, Alvaro L.; Lamy, Léo; Gordon, Jonathan L.; Escalon, Aline; Cunnac, Sébastien; Szurek, Boris; Gagnevin, Lionel
2015-01-01
Transcription Activator-Like (TAL) effectors from Xanthomonas plant pathogenic bacteria can bind to the promoter region of plant genes and induce their expression. DNA-binding specificity is governed by a central domain made of nearly identical repeats, each determining the recognition of one base pair via two amino acid residues (a.k.a. Repeat Variable Di-residue, or RVD). Knowing how TAL effectors differ from each other within and between strains would be useful to infer functional and evolutionary relationships, but their repetitive nature precludes reliable use of traditional alignment methods. The suite QueTAL was therefore developed to offer tailored tools for comparison of TAL effector genes. The program DisTAL considers each repeat as a unit, transforms a TAL effector sequence into a sequence of coded repeats and makes pair-wise alignments between these coded sequences to construct trees. The program FuncTAL is aimed at finding TAL effectors with similar DNA-binding capabilities. It calculates correlations between position weight matrices of potential target DNA sequence predicted from the RVD sequence, and builds trees based on these correlations. The programs accurately represented phylogenetic and functional relationships between TAL effectors using either simulated or literature-curated data. When using the programs on a large set of TAL effector sequences, the DisTAL tree largely reflected the expected species phylogeny. In contrast, FuncTAL showed that TAL effectors with similar binding capabilities can be found between phylogenetically distant taxa. This suite will help users to rapidly analyse any TAL effector genes of interest and compare them to other available TAL genes and should improve our understanding of TAL effectors evolution. It is available at http://bioinfo-web.mpl.ird.fr/cgi-bin2/quetal/quetal.cgi. PMID:26284082
Kanai, Akio; Oida, Hanako; Matsuura, Nana; Doi, Hirofumi
2003-01-01
We systematically screened a genomic DNA library to identify proteins of the hyperthermophilic archaeon Pyrococcus furiosus using an expression cloning method. One gene product, which we named FAU-1 (P. furiosus AU-binding), demonstrated the strongest binding activity of all the genomic library-derived proteins tested against an AU-rich RNA sequence. The protein was purified to near homogeneity as a 54 kDa single polypeptide, and the gene locus corresponding to this FAU-1 activity was also sequenced. The FAU-1 gene encoded a 472-amino-acid protein that was characterized by highly charged domains consisting of both acidic and basic amino acids. The N-terminal half of the gene had a degree of similarity (25%) with RNase E from Escherichia coli. Five rounds of RNA-binding-site selection and footprinting analysis showed that the FAU-1 protein binds specifically to the AU-rich sequence in a loop region of a possible RNA ligand. Moreover, we demonstrated that the FAU-1 protein acts as an oligomer, and mainly as a trimer. These results showed that the FAU-1 protein is a novel heat-stable protein with an RNA loop-binding characteristic. PMID:12614195
Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A; Schroeder, Charles M
2012-09-19
Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays, and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry.
Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A.
2012-01-01
Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry. PMID:22871171
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shi, Yuqian; Hellinga, Homme W.; Beese, Lorena S.
Human exonuclease 1 (hExo1) is a member of the RAD2/XPG structure-specific 5'-nuclease superfamily. Its dominant, processive 5'–3' exonuclease and secondary 5'-flap endonuclease activities participate in various DNA repair, recombination, and replication processes. A single active site processes both recessed ends and 5'-flap substrates. By initiating enzyme reactions in crystals, we have trapped hExo1 reaction intermediates that reveal structures of these substrates before and after their exo- and endonucleolytic cleavage, as well as structures of uncleaved, unthreaded, and partially threaded 5' flaps. Their distinctive 5' ends are accommodated by a small, mobile arch in the active site that binds recessed endsmore » at its base and threads 5' flaps through a narrow aperture within its interior. A sequence of successive, interlocking conformational changes guides the two substrate types into a shared reaction mechanism that catalyzes their cleavage by an elaborated variant of the two-metal, in-line hydrolysis mechanism. Coupling of substrate-dependent arch motions to transition-state stabilization suppresses inappropriate or premature cleavage, enhancing processing fidelity. The striking reduction in flap conformational entropy is catalyzed, in part, by arch motions and transient binding interactions between the flap and unprocessed DNA strand. At the end of the observed reaction sequence, hExo1 resets without relinquishing DNA binding, suggesting a structural basis for its processivity.« less
Shi, Yuqian; Hellinga, Homme W; Beese, Lorena S
2017-06-06
Human exonuclease 1 (hExo1) is a member of the RAD2/XPG structure-specific 5'-nuclease superfamily. Its dominant, processive 5'-3' exonuclease and secondary 5'-flap endonuclease activities participate in various DNA repair, recombination, and replication processes. A single active site processes both recessed ends and 5'-flap substrates. By initiating enzyme reactions in crystals, we have trapped hExo1 reaction intermediates that reveal structures of these substrates before and after their exo- and endonucleolytic cleavage, as well as structures of uncleaved, unthreaded, and partially threaded 5' flaps. Their distinctive 5' ends are accommodated by a small, mobile arch in the active site that binds recessed ends at its base and threads 5' flaps through a narrow aperture within its interior. A sequence of successive, interlocking conformational changes guides the two substrate types into a shared reaction mechanism that catalyzes their cleavage by an elaborated variant of the two-metal, in-line hydrolysis mechanism. Coupling of substrate-dependent arch motions to transition-state stabilization suppresses inappropriate or premature cleavage, enhancing processing fidelity. The striking reduction in flap conformational entropy is catalyzed, in part, by arch motions and transient binding interactions between the flap and unprocessed DNA strand. At the end of the observed reaction sequence, hExo1 resets without relinquishing DNA binding, suggesting a structural basis for its processivity.
Epigenetic regulatory mechanisms in vertebrate eye development and disease
Cvekl, A; Mitton, KP
2014-01-01
Eukaryotic DNA is organized as a nucleoprotein polymer termed chromatin with nucleosomes serving as its repetitive architectural units. Cellular differentiation is a dynamic process driven by activation and repression of specific sets of genes, partitioning the genome into transcriptionally active and inactive chromatin domains. Chromatin architecture at individual genes/loci may remain stable through cell divisions, from a single mother cell to its progeny during mitosis, and represents an example of epigenetic phenomena. Epigenetics refers to heritable changes caused by mechanisms distinct from the primary DNA sequence. Recent studies have shown a number of links between chromatin structure, gene expression, extracellular signaling, and cellular differentiation during eye development. This review summarizes recent advances in this field, and the relationship between sequence-specific DNA-binding transcription factors and their roles in recruitment of chromatin remodeling enzymes. In addition, lens and retinal differentiation is accompanied by specific changes in the nucleolar organization, expression of non-coding RNAs, and DNA methylation. Epigenetic regulatory mechanisms in ocular tissues represent exciting areas of research that have opened new avenues for understanding normal eye development, inherited eye diseases and eye diseases related to aging and the environment. PMID:20179734
Concerted formation of macromolecular Suppressor–mutator transposition complexes
Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina
1998-01-01
Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711
Mapping and analysis of Caenorhabditis elegans transcription factor sequence specificities
Narasimhan, Kamesh; Lambert, Samuel A; Yang, Ally WH; Riddell, Jeremy; Mnaimneh, Sanie; Zheng, Hong; Albu, Mihai; Najafabadi, Hamed S; Reece-Hoyes, John S; Fuxman Bass, Juan I; Walhout, Albertha JM; Weirauch, Matthew T; Hughes, Timothy R
2015-01-01
Caenorhabditis elegans is a powerful model for studying gene regulation, as it has a compact genome and a wealth of genomic tools. However, identification of regulatory elements has been limited, as DNA-binding motifs are known for only 71 of the estimated 763 sequence-specific transcription factors (TFs). To address this problem, we performed protein binding microarray experiments on representatives of canonical TF families in C. elegans, obtaining motifs for 129 TFs. Additionally, we predict motifs for many TFs that have DNA-binding domains similar to those already characterized, increasing coverage of binding specificities to 292 C. elegans TFs (∼40%). These data highlight the diversification of binding motifs for the nuclear hormone receptor and C2H2 zinc finger families and reveal unexpected diversity of motifs for T-box and DM families. Motif enrichment in promoters of functionally related genes is consistent with known biology and also identifies putative regulatory roles for unstudied TFs. DOI: http://dx.doi.org/10.7554/eLife.06967.001 PMID:25905672
Direct observation of transcription activator-like effector (TALE) protein dynamics
NASA Astrophysics Data System (ADS)
Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.
2014-03-01
In this work, we describe a single molecule assay to probe the site-search dynamics of transcription activator-like effector (TALE) proteins along DNA. In modern genetics, the ability to selectively edit the human genome is an unprecedented development, driven by recent advances in targeted nuclease proteins. Specific gene editing can be accomplished using TALE proteins, which are programmable DNA-binding proteins that can be fused to a nuclease domain. In this way, TALENs are a leading technology that has shown great success in the genomic editing of pluripotent stem cells. A major hurdle facing clinical implementation, however, is the potential for deleterious off-target binding events. For these reasons, a molecular-level understanding of TALE binding and target sequence search on DNA is essential. To this end, we developed a single-molecule fluorescence imaging assay that provides a first-of-its-kind view of the 1-D diffusion of TALE proteins along stretched DNA. Taken together with co-crystal structures of DNA-bound TALEs, our results suggest a rotationally-coupled, major groove tracking model for diffusion. We further report diffusion constants for TALE proteins as a function of salt concentration, consistent with previously described models of 1-D protein diffusion.
Active Site Sharing and Subterminal Hairpin Recognition in a New Class of DNA Transposases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ronning, Donald R.; Guynet, Catherine; Ton-Hoang, Bao
2010-07-20
Many bacteria harbor simple transposable elements termed insertion sequences (IS). In Helicobacter pylori, the chimeric IS605 family elements are particularly interesting due to their proximity to genes encoding gastric epithelial invasion factors. Protein sequences of IS605 transposases do not bear the hallmarks of other well-characterized transposases. We have solved the crystal structure of full-length transposase (TnpA) of a representative member, ISHp608. Structurally, TnpA does not resemble any characterized transposase; rather, it is related to rolling circle replication (RCR) proteins. Consistent with RCR, Mg{sup 2+} and a conserved tyrosine, Tyr127, are essential for DNA nicking and the formation of a covalentmore » intermediate between TnpA and DNA. TnpA is dimeric, contains two shared active sites, and binds two DNA stem loops representing the conserved inverted repeats near each end of ISHp608. The cocrystal structure with stem-loop DNA illustrates how this family of transposases specifically recognizes and pairs ends, necessary steps during transposition.« less
A close relative of the nuclear, chromosomal high-mobility group protein HMG1 in yeast mitochondria.
Diffley, J F; Stillman, B
1991-01-01
ABF2 (ARS-binding factor 2), a small, basic DNA-binding protein that binds specifically to the autonomously replicating sequence ARS1, is located primarily in the mitochondria of the yeast Saccharomyces cerevisiae. The abundance of ABF2 and the phenotype of abf2- null mutants argue that this protein plays a key role in the structure, maintenance, and expression of the yeast mitochondrial genome. The predicted amino acid sequence of ABF2 is closely related to the high-mobility group proteins HMG1 and HMG2 from vertebrate cell nuclei and to several other DNA-binding proteins. Additionally, ABF2 and the other HMG-related proteins are related to a globular domain from the heat shock protein hsp70 family. ABF2 interacts with DNA both nonspecifically and in a specific manner within regulatory regions, suggesting a mechanism whereby it may aid in compacting the mitochondrial genome without interfering with expression. Images PMID:1881919
Evers, R; Smid, A; Rudloff, U; Lottspeich, F; Grummt, I
1995-03-15
Termination of mouse ribosomal gene transcription by RNA polymerase I (Pol I) requires the specific interaction of a DNA binding protein, mTTF-I, with an 18 bp sequence element located downstream of the rRNA coding region. Here we describe the molecular cloning and functional characterization of the cDNA encoding this transcription termination factor. Recombinant mTTF-I binds specifically to the murine terminator elements and terminates Pol I transcription in a reconstituted in vitro system. Deletion analysis has defined a modular structure of mTTF-I comprising a dispensable N-terminal half, a large C-terminal DNA binding region and an internal domain which is required for transcription termination. Significantly, the C-terminal region of mTTF-I reveals striking homology to the DNA binding domains of the proto-oncogene c-Myb and the yeast transcription factor Reb1p. Site-directed mutagenesis of one of the tryptophan residues that is conserved in the homology region of c-Myb, Reb1p and mTTF-I abolishes specific DNA binding, a finding which underscores the functional relevance of these residues in DNA-protein interactions.
Evers, R; Smid, A; Rudloff, U; Lottspeich, F; Grummt, I
1995-01-01
Termination of mouse ribosomal gene transcription by RNA polymerase I (Pol I) requires the specific interaction of a DNA binding protein, mTTF-I, with an 18 bp sequence element located downstream of the rRNA coding region. Here we describe the molecular cloning and functional characterization of the cDNA encoding this transcription termination factor. Recombinant mTTF-I binds specifically to the murine terminator elements and terminates Pol I transcription in a reconstituted in vitro system. Deletion analysis has defined a modular structure of mTTF-I comprising a dispensable N-terminal half, a large C-terminal DNA binding region and an internal domain which is required for transcription termination. Significantly, the C-terminal region of mTTF-I reveals striking homology to the DNA binding domains of the proto-oncogene c-Myb and the yeast transcription factor Reb1p. Site-directed mutagenesis of one of the tryptophan residues that is conserved in the homology region of c-Myb, Reb1p and mTTF-I abolishes specific DNA binding, a finding which underscores the functional relevance of these residues in DNA-protein interactions. Images PMID:7720715
Zhou, Jia; Sears, Renee L; Xing, Xiaoyun; Zhang, Bo; Li, Daofeng; Rockweiler, Nicole B; Jang, Hyo Sik; Choudhary, Mayank N K; Lee, Hyung Joo; Lowdon, Rebecca F; Arand, Jason; Tabers, Brianne; Gu, C Charles; Cicero, Theodore J; Wang, Ting
2017-09-12
Uncovering mechanisms of epigenome evolution is an essential step towards understanding the evolution of different cellular phenotypes. While studies have confirmed DNA methylation as a conserved epigenetic mechanism in mammalian development, little is known about the conservation of tissue-specific genome-wide DNA methylation patterns. Using a comparative epigenomics approach, we identified and compared the tissue-specific DNA methylation patterns of rat against those of mouse and human across three shared tissue types. We confirmed that tissue-specific differentially methylated regions are strongly associated with tissue-specific regulatory elements. Comparisons between species revealed that at a minimum 11-37% of tissue-specific DNA methylation patterns are conserved, a phenomenon that we define as epigenetic conservation. Conserved DNA methylation is accompanied by conservation of other epigenetic marks including histone modifications. Although a significant amount of locus-specific methylation is epigenetically conserved, the majority of tissue-specific DNA methylation is not conserved across the species and tissue types that we investigated. Examination of the genetic underpinning of epigenetic conservation suggests that primary sequence conservation is a driving force behind epigenetic conservation. In contrast, evolutionary dynamics of tissue-specific DNA methylation are best explained by the maintenance or turnover of binding sites for important transcription factors. Our study extends the limited literature of comparative epigenomics and suggests a new paradigm for epigenetic conservation without genetic conservation through analysis of transcription factor binding sites.
Liu, Qiang; Su, Shifeng; Blackwelder, Amanda J.; Minges, John T.; Wilson, Elizabeth M.
2011-01-01
Male sex development and growth occur in response to high affinity androgen binding to the androgen receptor (AR). In contrast to complete amino acid sequence conservation in the AR DNA and ligand binding domains among mammals, a primate-specific difference in the AR NH2-terminal region that regulates the NH2- and carboxyl-terminal (N/C) interaction enables direct binding to melanoma antigen-A11 (MAGE-11), an AR coregulator that is also primate-specific. Human, mouse, and rat AR share the same NH2-terminal 23FQNLF27 sequence that mediates the androgen-dependent N/C interaction. However, the mouse and rat AR FXXLF motif is flanked by Ala33 that evolved to Val33 in primates. Human AR Val33 was required to interact directly with MAGE-11 and for the inhibitory effect of the AR N/C interaction on activation function 2 that was relieved by MAGE-11. The functional importance of MAGE-11 was indicated by decreased human AR regulation of an androgen-dependent endogenous gene using lentivirus short hairpin RNAs and by the greater transcriptional strength of human compared with mouse AR. MAGE-11 increased progesterone and glucocorticoid receptor activity independently of binding an FXXLF motif by interacting with p300 and p160 coactivators. We conclude that the coevolution of the AR NH2-terminal sequence and MAGE-11 expression among primates provides increased regulatory control over activation domain dominance. Primate-specific expression of MAGE-11 results in greater steroid receptor transcriptional activity through direct interactions with the human AR FXXLF motif region and indirectly through steroid receptor-associated p300 and p160 coactivators. PMID:21730049
Hamula, Camille L A; Peng, Hanyong; Wang, Zhixin; Tyrrell, Gregory J; Li, Xing-Fang; Le, X Chris
2016-03-15
Streptococcus pyogenes is a clinically important pathogen consisting of various serotypes determined by different M proteins expressed on the cell surface. The M type is therefore a useful marker to monitor the spread of invasive S. pyogenes in a population. Serotyping and nucleic acid amplification/sequencing methods for the identification of M types are laborious, inconsistent, and usually confined to reference laboratories. The primary objective of this work is to develop a technique that enables generation of aptamers binding to specific M-types of S. pyogenes. We describe here an in vitro technique that directly used live bacterial cells and the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) strategy. Live S. pyogenes cells were incubated with DNA libraries consisting of 40-nucleotides randomized sequences. Those sequences that bound to the cells were separated, amplified using polymerase chain reaction (PCR), purified using gel electrophoresis, and served as the input DNA pool for the next round of SELEX selection. A specially designed forward primer containing extended polyA20/5Sp9 facilitated gel electrophoresis purification of ssDNA after PCR amplification. A counter-selection step using non-target cells was introduced to improve selectivity. DNA libraries of different starting sequence diversity (10(16) and 10(14)) were compared. Aptamer pools from each round of selection were tested for their binding to the target and non-target cells using flow cytometry. Selected aptamer pools were then cloned and sequenced. Individual aptamer sequences were screened on the basis of their binding to the 10 M-types that were used as targets. Aptamer pools obtained from SELEX rounds 5-8 showed high affinity to the target S. pyogenes cells. Tests against non-target Streptococcus bovis, Streptococcus pneumoniae, and Enterococcus species demonstrated selectivity of these aptamers for binding to S. pyogenes. Several aptamer sequences were found to bind preferentially to the M11 M-type of S. pyogenes. Estimated binding dissociation constants (Kd) were in the low nanomolar range for the M11 specific sequences; for example, sequence E-CA20 had a Kd of 7±1 nM. These affinities are comparable to those of a monoclonal antibody. The improved bacterial cell-SELEX technique is successful in generating aptamers selective for S. pyogenes and some of its M-types. These aptamers are potentially useful for detecting S. pyogenes, achieving binding profiles of the various M-types, and developing new M-typing technologies for non-specialized laboratories or point-of-care testing. Copyright © 2015 Elsevier Inc. All rights reserved.
The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.
Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves
2017-08-21
Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein
Gupta, Gagan Deep; Kumar, Vinay
2012-01-01
Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937
Dodson, M; Echols, H; Wickner, S; Alfano, C; Mensa-Wilmot, K; Gomes, B; LeBowitz, J; Roberts, J D; McMacken, R
1986-01-01
The O protein of bacteriophage lambda localizes the initiation of DNA replication to a unique site on the lambda genome, ori lambda. By means of electron microscopy, we infer that the binding of O to ori lambda initiates a series of protein addition and transfer reactions that culminate in localized unwinding of the origin DNA, generating a prepriming structure for the initiation of DNA replication. We can define three stages of this prepriming reaction, the first two of which we have characterized previously. First, dimeric O protein binds to multiple DNA binding sites and self-associates to form a nucleoprotein structure, the O-some. Second, lambda P and host DnaB proteins interact with the O-some to generate a larger complex that includes additional DNA from an A + T-rich region adjacent to the O binding sites. Third, the addition of the DnaJ, DnaK, and Ssb proteins and ATP results in an origin-specific unwinding reaction, probably catalyzed by the helicase activity of DnaB. The unwinding reaction is unidirectional, proceeding "rightward" from the origin. The minimal DNA sequence competent for unwinding consists of two O binding sites and the adjacent A + T-rich region to the right of the binding sites. We conclude that the lambda O protein localizes and initiates a six-protein sequential reaction responsible for but preceding the precise initiation of DNA replication. Specialized nucleoprotein structures similar to the O-some may be a general feature of DNA transactions requiring extraordinary precision in localization and control. Images PMID:3020552
Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA
Mori, Tetsuya; Saveliev, Sergei V.; Xu, Yao; Stafford, Walter F.; Cox, Michael M.; Inman, Ross B.; Johnson, Carl H.
2002-01-01
KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecA/DnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecA/DnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns. PMID:12477935
In vitro selection of high temperature Zn(2+)-dependent DNAzymes.
Nelson, Kevin E; Bruesehoff, Peter J; Lu, Yi
2005-08-01
In vitro selection of Zn(2+)-dependent RNA-cleaving DNAzymes with activity at 90 degrees C has yielded a diverse spool of selected sequences. The RNA cleavage efficiency was found in all cases to be specific for Zn(2+) over Pb(2+), Ca(2+), Cd(2+), Co(2+), Hg(2+), and Mg(2+). The Zn(2+)-dependent activity assay of the most active sequence showed that the DNAzyme possesses an apparent Zn(2+)-binding dissociation constant of 234 muM and that its activity increases with increasing temperatures from 50-90 degrees C. A fit of the Arrhenius plot data gave E(a) = 15.3 kcal mol(-1). Surprisingly, the selected Zn(2+)-dependent DNAzymes showed only a modest (approximately 3-fold) activity enhancement over the background rate of cleavage of random sequences containing a single embedded ribonucleotide within an otherwise DNA oligonucleotide. The result is attributable to the ability of DNA to sustain cleavage activity at high temperature with minimal secondary structure when Zn(2+) is present. Since this effect is highly specific for Zn(2+), this metal ion may play a special role in molecular evolution of nucleic acids at high temperature.
Fisher, R P; Topper, J N; Clayton, D A
1987-07-17
Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.
Ramachandrakurup, Sreelakshmi; Ramakrishnan, Vigneshwar
2017-09-01
Protein-DNA interactions are an important class of biomolecular interactions inside the cell. Delineating the mechanisms of protein-DNA interactions and more specifically, how proteins search and bind to their specific cognate sequences has been the quest of many in the scientific community. Restriction enzymes have served as useful model systems to this end. In this work, we have investigated using molecular dynamics simulations the effect of L43K mutation on NaeI, a type IIE restriction enzyme. NaeI has two domains, the Topo and the Endo domains, each binding to identical strands of DNA sequences (GCCGGC) 2 . The binding of the DNA to the Topo domain is thought to enhance the binding and cleavage of DNA at the Endo domain. Interestingly, it has been found that the mutation of an amino acid that is distantly-located from the DNA cleavage site (L43K) converts the restriction endonuclease to a topoisomerase. Our investigations reveal that the L43K mutation not only induces local structural changes (as evidenced by changes in hydrogen bond propensities and differences in the percentage of secondary structure assignments of the residues in the ligase-like domain) but also alters the overall protein dynamics and DNA conformation which probably leads to the loss of specific cleavage of the recognition site. In a larger context, our study underscores the importance of considering the role of distantly-located amino acids in understanding protein-DNA interactions. Copyright © 2017 Elsevier Inc. All rights reserved.
Oda, Masako; Kanoh, Yutaka; Watanabe, Yoshihisa; Masai, Hisao
2012-01-01
Background Replication timing of metazoan DNA during S-phase may be determined by many factors including chromosome structures, nuclear positioning, patterns of histone modifications, and transcriptional activity. It may be determined by Mb-domain structures, termed as “replication domains”, and recent findings indicate that replication timing is under developmental and cell type-specific regulation. Methodology/Principal Findings We examined replication timing on the human 5q23/31 3.5-Mb segment in T cells and non-T cells. We used two independent methods to determine replication timing. One is quantification of nascent replicating DNA in cell cycle-fractionated stage-specific S phase populations. The other is FISH analyses of replication foci. Although the locations of early- and late-replicating domains were common between the two cell lines, the timing transition region (TTR) between early and late domains were offset by 200-kb. We show that Special AT-rich sequence Binding protein 1 (SATB1), specifically expressed in T-cells, binds to the early domain immediately adjacent to TTR and delays the replication timing of the TTR. Measurement of the chromosome copy number along the TTR during synchronized S phase suggests that the fork movement may be slowed down by SATB1. Conclusions Our results reveal a novel role of SATB1 in cell type-specific regulation of replication timing along the chromosome. PMID:22879953
Oda, Masako; Kanoh, Yutaka; Watanabe, Yoshihisa; Masai, Hisao
2012-01-01
Replication timing of metazoan DNA during S-phase may be determined by many factors including chromosome structures, nuclear positioning, patterns of histone modifications, and transcriptional activity. It may be determined by Mb-domain structures, termed as "replication domains", and recent findings indicate that replication timing is under developmental and cell type-specific regulation. We examined replication timing on the human 5q23/31 3.5-Mb segment in T cells and non-T cells. We used two independent methods to determine replication timing. One is quantification of nascent replicating DNA in cell cycle-fractionated stage-specific S phase populations. The other is FISH analyses of replication foci. Although the locations of early- and late-replicating domains were common between the two cell lines, the timing transition region (TTR) between early and late domains were offset by 200-kb. We show that Special AT-rich sequence Binding protein 1 (SATB1), specifically expressed in T-cells, binds to the early domain immediately adjacent to TTR and delays the replication timing of the TTR. Measurement of the chromosome copy number along the TTR during synchronized S phase suggests that the fork movement may be slowed down by SATB1. Our results reveal a novel role of SATB1 in cell type-specific regulation of replication timing along the chromosome.
A DNA Sequence Element That Advances Replication Origin Activation Time in Saccharomyces cerevisiae
Pohl, Thomas J.; Kolor, Katherine; Fangman, Walton L.; Brewer, Bonita J.; Raghuraman, M. K.
2013-01-01
Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time. PMID:24022751
Crystal structure of MboIIA methyltransferase.
Osipiuk, Jerzy; Walsh, Martin A; Joachimiak, Andrzej
2003-09-15
DNA methyltransferases (MTases) are sequence-specific enzymes which transfer a methyl group from S-adenosyl-L-methionine (AdoMet) to the amino group of either cytosine or adenine within a recognized DNA sequence. Methylation of a base in a specific DNA sequence protects DNA from nucleolytic cleavage by restriction enzymes recognizing the same DNA sequence. We have determined at 1.74 A resolution the crystal structure of a beta-class DNA MTase MboIIA (M.MboIIA) from the bacterium Moraxella bovis, the smallest DNA MTase determined to date. M.MboIIA methylates the 3' adenine of the pentanucleotide sequence 5'-GAAGA-3'. The protein crystallizes with two molecules in the asymmetric unit which we propose to resemble the dimer when M.MboIIA is not bound to DNA. The overall structure of the enzyme closely resembles that of M.RsrI. However, the cofactor-binding pocket in M.MboIIA forms a closed structure which is in contrast to the open-form structures of other known MTases.
Presynaptic Filament Dynamics in Homologous Recombination and DNA Repair
Liu, Jie; Ehmsen, Kirk T.; Heyer, Wolf-Dietrich; Morrical, Scott W.
2014-01-01
Homologous Recombination (HR) is an essential genome stability mechanism used for high-fidelity repair of DNA double-strand breaks and for the recovery of stalled or collapsed DNA replication forks. The crucial homology search and DNA strand exchange steps of HR are catalyzed by presynaptic filaments—helical filaments of a recombinase enzyme bound to single-stranded DNA. Presynaptic filaments are fundamentally dynamic structures, the assembly, catalytic turnover, and disassembly of which must be closely coordinated with other elements of the DNA recombination, repair, and replication machinery in order for genome maintenance functions to be effective. Here, we review the major dynamic elements controlling the assembly, activity, and disassembly of presynaptic filaments: some intrinsic such as recombinase ATP binding and hydrolytic activities, others extrinsic such as ssDNA-binding proteins, mediator proteins, and DNA motor proteins. We examine dynamic behavior on multiple levels, including atomic- and filament-level structural changes associated with ATP binding and hydrolysis as evidenced in crystal structures, as well as subunit binding and dissociation events driven by intrinsic and extrinsic factors. We examine the biochemical properties of recombination proteins from four model systems (T4 phage, E. coli, S. cerevisiae, and H. sapiens), demonstrating how their properties are tailored for the context-specific requirements in these diverse species. We propose that the presynaptic filament has evolved to rely on multiple external factors for increased multi-level regulation of HR processes in genomes with greater structural and sequence complexity. PMID:21599536
Engineering synthetic TAL effectors with orthogonal target sites
Garg, Abhishek; Lohmueller, Jason J.; Silver, Pamela A.; Armel, Thomas Z.
2012-01-01
The ability to engineer biological circuits that process and respond to complex cellular signals has the potential to impact many areas of biology and medicine. Transcriptional activator-like effectors (TALEs) have emerged as an attractive component for engineering these circuits, as TALEs can be designed de novo to target a given DNA sequence. Currently, however, the use of TALEs is limited by degeneracy in the site-specific manner by which they recognize DNA. Here, we propose an algorithm to computationally address this problem. We apply our algorithm to design 180 TALEs targeting 20 bp cognate binding sites that are at least 3 nt mismatches away from all 20 bp sequences in putative 2 kb human promoter regions. We generated eight of these synthetic TALE activators and showed that each is able to activate transcription from a targeted reporter. Importantly, we show that these proteins do not activate synthetic reporters containing mismatches similar to those present in the genome nor a set of endogenous genes predicted to be the most likely targets in vivo. Finally, we generated and characterized TALE repressors comprised of our orthogonal DNA binding domains and further combined them with shRNAs to accomplish near complete repression of target gene expression. PMID:22581776
Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L
2013-07-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.
Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.
2013-01-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967
DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue
NASA Astrophysics Data System (ADS)
Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul
2013-03-01
We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.
Extended HSR/CARD domain mediates AIRE binding to DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid
Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less
Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B
2018-04-01
Human papillomaviruses (HPVs) encompass a large family of viruses that range from benign to highly carcinogenic. The crucial differences between benign and carcinogenic types of HPV remain unknown, except that the two HPV types differ in the frequency of DNA replication. We have systematically analyzed the mechanism of HPV DNA replication initiation in low-risk and high-risk HPVs. Our results demonstrate that HPV-encoded E2 initiator protein and its four binding sites in the replication origin play pivotal roles in determining the destiny of the HPV-infected cell. We have identified strain-specific single nucleotide variations in E2 binding sites found only in the high-risk HPVs. We have demonstrated that these variations result in attenuated formation of the E2-DNA complex. E2 binding to these sites is linked to the activation of the DNA replication origin as well as initiation of DNA replication. Both electrophoretic mobility shift assay and atomic force microscopy studies demonstrated that binding of E2 from either low- or high-risk HPVs with variant binding sequences lacked multimeric E2-DNA complex formation in vitro. These results provided a molecular basis of differential DNA replication in the two types of HPVs and pointed to a correlation with the development of cancer. Copyright © 2017. Published by Elsevier B.V.
Wnt-Mediated Repression via Bipartite DNA Recognition by TCF in the Drosophila Hematopoietic System
Zhang, Chen U.; Blauwkamp, Timothy A.; Burby, Peter E.; Cadigan, Ken M.
2014-01-01
The Wnt/β-catenin signaling pathway plays many important roles in animal development, tissue homeostasis and human disease. Transcription factors of the TCF family mediate many Wnt transcriptional responses, promoting signal-dependent activation or repression of target gene expression. The mechanism of this specificity is poorly understood. Previously, we demonstrated that for activated targets in Drosophila, TCF/Pangolin (the fly TCF) recognizes regulatory DNA through two DNA binding domains, with the High Mobility Group (HMG) domain binding HMG sites and the adjacent C-clamp domain binding Helper sites. Here, we report that TCF/Pangolin utilizes a similar bipartite mechanism to recognize and regulate several Wnt-repressed targets, but through HMG and Helper sites whose sequences are distinct from those found in activated targets. The type of HMG and Helper sites is sufficient to direct activation or repression of Wnt regulated cis-regulatory modules, and protease digestion studies suggest that TCF/Pangolin adopts distinct conformations when bound to either HMG-Helper site pair. This repressive mechanism occurs in the fly lymph gland, the larval hematopoietic organ, where Wnt/β-catenin signaling controls prohemocytic differentiation. Our study provides a paradigm for direct repression of target gene expression by Wnt/β-catenin signaling and allosteric regulation of a transcription factor by DNA. PMID:25144371
Interaction of antitumor drug Sn(CH 3) 2Cl 2 with DNA and RNA
NASA Astrophysics Data System (ADS)
Nafisi, Shohreh; Sobhanmanesh, Amir; Esm-Hosseini, Majid; Alimoghaddam, Kamran; Tajmir-Riahi, Heidar Ali
2005-08-01
Sn(CH3)2Cl2 exerts its antitumor activity in a specific way. Unlike anticancer cis-Pt(NH3)2Cl2 drug which binds strongly to the nitrogen atoms of DNA bases, Sn(CH3)2Cl2 shows no major affinity towards base binding. Thus, the mechanism of action by which tinorganometallic compounds exert antitumor activity would be different from that of the cisplatin drug. The aim of this study was to examine the binding of Sn(CH3)2Cl2 with calf thymus DNA and yeast RNA in aqueous solutions at pH 7.1-6.6 with constant concentrations of DNA and RNA and various molar ratios of Sn(CH3)2Cl2/DNA (phosphate) and Sn(CH3)2Cl2/RNA of 1/40, 1/20, 1/10, 1/5. Fourier transform infrared (FTIR) and UV-visible difference spectroscopic methods were used to determine the Sn(CH3)2Cl2 binding mode, binding constant, sequence selectivity and structural variations of Sn(CH3)2Cl2/DNA and Sn(CH3)2Cl2/RNA complexes in aqueous solution. Sn(CH3)2Cl2 hydrolyzes in water to give Sn(CH3)2(OH)2 and [Sn(CH3)2(OH)(H2O)n]+ species. Spectroscopic evidence showed that interaction occurred mainly through (CH3)2Sn(IV) hydroxide and polynucleotide backbone phosphate group with overall binding constant of K(Sn(CH3)2Cl2-DNA)=1.47×105 M-1 and K(Sn(CH3)2Cl2-RNA)=7.33×105 M-1. Sn(CH3)2Cl2 induced no biopolymer conformational changes with DNA remaining in the B-family structure and RNA in A-conformation upon drug complexation.
Martínez de Alba, Angel Emilio; Sägesser, Rudolf; Tabler, Martin; Tsagris, Mina
2003-01-01
For the identification of RNA-binding proteins that specifically interact with potato spindle tuber viroid (PSTVd), we subjected a tomato cDNA expression library prepared from viroid-infected leaves to an RNA ligand screening procedure. We repeatedly identified cDNA clones that expressed a protein of 602 amino acids. The protein contains a bromodomain and was termed viroid RNA-binding protein 1 (VIRP1). The specificity of interaction of VIRP1 with viroid RNA was studied by different methodologies, which included Northwestern blotting, plaque lift, and electrophoretic mobility shift assays. VIRP1 interacted strongly and specifically with monomeric and oligomeric PSTVd positive-strand RNA transcripts. Other RNAs, for example, U1 RNA, did not bind to VIRP1. Further, we could immunoprecipitate complexes from infected tomato leaves that contained VIRP1 and viroid RNA in vivo. Analysis of the protein sequence revealed that VIRP1 is a member of a newly identified family of transcriptional regulators associated with chromatin remodeling. VIRP1 is the first member of this family of proteins, for which a specific RNA-binding activity is shown. A possible role of VIRP1 in viroid replication and in RNA mediated chromatin remodeling is discussed. PMID:12915580
Iwasaki, H; Shiba, T; Makino, K; Nakata, A; Shinagawa, H
1989-01-01
The ruvA and ruvB genes of Escherichia coli constitute an operon which belongs to the SOS regulon. Genetic evidence suggests that the products of the ruv operon are involved in DNA repair and recombination. To begin biochemical characterization of these proteins, we developed a plasmid system that overproduced RuvB protein to 20% of total cell protein. Starting from the overproducing system, we purified RuvB protein. The purified RuvB protein behaved like a monomer in gel filtration chromatography and had an apparent relative molecular mass of 38 kilodaltons in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, which agrees with the value predicted from the DNA sequence. The amino acid sequence of the amino-terminal region of the purified protein was analyzed, and the sequence agreed with the one deduced from the DNA sequence. Since the deduced sequence of RuvB protein contained the consensus sequence for ATP-binding proteins, we examined the ATP-binding and ATPase activities of the purified RuvB protein. RuvB protein had a stronger affinity to ADP than to ATP and weak ATPase activity. The results suggest that the weak ATPase activity of RuvB protein is at least partly due to end product inhibition by ADP. Images PMID:2529252
Liu, Xingfen; Ouyang, Lan; Cai, Xiaohui; Huang, Yanqin; Feng, Xiaomiao; Fan, Quli; Huang, Wei
2013-03-15
Sensitive, reliable, and simple detection of sequence-specific DNA-binding proteins (DBP) is of paramount importance in the area of proteomics, genomics, and biomedicine. We describe herein a novel fluorescent-amplified strategy for ultrasensitive, visual, quantitative, and "turn-on" detection of DBP. A Förster resonance energy transfer (FRET) assay utilizing a cationic conjugated polymer (CCP) and an intercalating dye was designed to detect a key transcription factor, nuclear factor-kappa B (NF-κB), the model target. A series of label-free DNA probes bearing one or two protein-binding sites (PBS) were used to identify the target protein specifically. The binding DBP protects the probe from digestion by exonuclease III, resulting in high efficient FRET due to the high affinity between the intercalating dye and duplex DNA, as well as strong electrostatic interactions between the CCP and DNA probe. By using label-free hairpin DNA or double-stranded DNA containing two PBS as probe, we could detect as low as 1 pg/μL of NF-κB in HeLa nuclear extracts, which is 10000-fold more sensitive than the previously reported methods. The approach also allows naked-eye detection by observing fluorescent color of solutions with the assistance of a hand-held UV lamp. Additionally, a less than 10% relative standard deviation was obtained, which offers a new platform for superior precision, low-cost, and simple detection of DBP. The features of our optical biosensor shows promising potential for early diagnosis of many diseases and high-throughput screening of new drugs targeted to DNA-binding proteins. Copyright © 2012 Elsevier B.V. All rights reserved.
Velmurugu, Yogambigai; Vivas, Paula; Connolly, Mitchell; Kuznetsov, Serguei V; Rice, Phoebe A; Ansari, Anjum
2018-02-28
The dynamics and mechanism of how site-specific DNA-bending proteins initially interrogate potential binding sites prior to recognition have remained elusive for most systems. Here we present these dynamics for Integration Host factor (IHF), a nucleoid-associated architectural protein, using a μs-resolved T-jump approach. Our studies show two distinct DNA-bending steps during site recognition by IHF. While the faster (∼100 μs) step is unaffected by changes in DNA or protein sequence that alter affinity by >100-fold, the slower (1-10 ms) step is accelerated ∼5-fold when mismatches are introduced at DNA sites that are sharply kinked in the specific complex. The amplitudes of the fast phase increase when the specific complex is destabilized and decrease with increasing [salt], which increases specificity. Taken together, these results indicate that the fast phase is non-specific DNA bending while the slow phase, which responds only to changes in DNA flexibility at the kink sites, is specific DNA kinking during site recognition. Notably, the timescales for the fast phase overlap with one-dimensional diffusion times measured for several proteins on DNA, suggesting that these dynamics reflect partial DNA bending during interrogation of potential binding sites by IHF as it scans DNA.
Hume, Maxwell A; Barrera, Luis A; Gisselbrecht, Stephen S; Bulyk, Martha L
2015-01-01
The Universal PBM Resource for Oligonucleotide Binding Evaluation (UniPROBE) serves as a convenient source of information on published data generated using universal protein-binding microarray (PBM) technology, which provides in vitro data about the relative DNA-binding preferences of transcription factors for all possible sequence variants of a length k ('k-mers'). The database displays important information about the proteins and displays their DNA-binding specificity data in terms of k-mers, position weight matrices and graphical sequence logos. This update to the database documents the growth of UniPROBE since the last update 4 years ago, and introduces a variety of new features and tools, including a new streamlined pipeline that facilitates data deposition by universal PBM data generators in the research community, a tool that generates putative nonbinding (i.e. negative control) DNA sequences for one or more proteins and novel motifs obtained by analyzing the PBM data using the BEEML-PBM algorithm for motif inference. The UniPROBE database is available at http://uniprobe.org. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru
2017-11-15
Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.
Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R; McQueen, Philip G; Yang, Andrew X; Mizuguchi, Takeshi; Grewal, Shiv I S; Levin, Henry L
2015-11-01
Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and -9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. Copyright © 2015 by the Genetics Society of America.
Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R.; McQueen, Philip G.; Yang, Andrew X.; Mizuguchi, Takeshi; Grewal, Shiv I. S.; Levin, Henry L.
2015-01-01
Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and −9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. PMID:26358720
Ha, Sung Chul; Choi, Jongkeun; Hwang, Hye-Yeon; Rich, Alexander; Kim, Yang-Gyun; Kim, Kyeong Kyu
2009-02-01
The Z-DNA conformation preferentially occurs at alternating purine-pyrimidine repeats, and is specifically recognized by Z alpha domains identified in several Z-DNA-binding proteins. The binding of Z alpha to foreign or chromosomal DNA in various sequence contexts is known to influence various biological functions, including the DNA-mediated innate immune response and transcriptional modulation of gene expression. For these reasons, understanding its binding mode and the conformational diversity of Z alpha bound Z-DNAs is of considerable importance. However, structural studies of Z alpha bound Z-DNA have been mostly limited to standard CG-repeat DNAs. Here, we have solved the crystal structures of three representative non-CG repeat DNAs, d(CACGTG)(2), d(CGTACG)(2) and d(CGGCCG)(2) complexed to hZ alpha(ADAR1) and compared those structures with that of hZ alpha(ADAR1)/d(CGCGCG)(2) and the Z alpha-free Z-DNAs. hZ alpha(ADAR1) bound to each of the three Z-DNAs showed a well conserved binding mode with very limited structural deviation irrespective of the DNA sequence, although varying numbers of residues were in contact with Z-DNA. Z-DNAs display less structural alterations in the Z alpha-bound state than in their free form, thereby suggesting that conformational diversities of Z-DNAs are restrained by the binding pocket of Z alpha. These data suggest that Z-DNAs are recognized by Z alpha through common conformational features regardless of the sequence and structural alterations.
Han, Le; Pandian, Ganesh N; Chandran, Anandhakumar; Sato, Shinsuke; Taniguchi, Junichi; Kashiwazaki, Gengo; Sawatani, Yoshito; Hashiya, Kaori; Bando, Toshikazu; Xu, Yufang; Qian, Xuhong; Sugiyama, Hiroshi
2015-07-20
Synthetic dual-function ligands targeting specific DNA sequences and histone-modifying enzymes were applied to achieve regulatory control over multi-gene networks in living cells. Unlike the broad array of targeting small molecules for histone deacetylases (HDACs), few modulators are known for histone acetyltransferases (HATs), which play a central role in transcriptional control. As a novel chemical approach to induce selective HAT-regulated genes, we conjugated a DNA-binding domain (DBD) "I" to N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-benzamide (CTB), an artificial HAT activator. In vitro enzyme activity assays and microarray studies were used to demonstrate that distinct functional small molecules could be transformed to have identical bioactivity when conjugated with a targeting DBD. This proof-of-concept synthetic strategy validates the switchable functions of HDACs and HATs in gene regulation and provides a molecular basis for developing versatile bioactive ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Carvalho, Alexandra T P; Gouveia, Leonor; Kanna, Charan Raju; Wärmländer, Sebastian K T S; Platts, Jamie A; Kamerlin, Shina Caroline Lynn
2014-01-01
We report a series of molecular dynamics (MD) simulations of up to a microsecond combined simulation time designed to probe epigenetically modified DNA sequences. More specifically, by monitoring the effects of methylation and hydroxymethylation of cytosine in different DNA sequences, we show, for the first time, that DNA epigenetic modifications change the molecule's dynamical landscape, increasing the propensity of DNA toward different values of twist and/or roll/tilt angles (in relation to the unmodified DNA) at the modification sites. Moreover, both the extent and position of different modifications have significant effects on the amount of structural variation observed. We propose that these conformational differences, which are dependent on the sequence environment, can provide specificity for protein binding. PMID:25625845
Phosphorylation of serine-515 activates the Mammalian maintenance methyltransferase Dnmt1.
Goyal, Rachna; Rathert, Philipp; Laser, Heike; Gowher, Humaira; Jeltsch, Albert
2007-09-01
DNA methyltransferase 1 methylates hemi-methylated CG sites generated during DNA replication. Serine 515 of this enzyme has been shown to be phosphorylated. To explore the importance of S515 phosphorylation, we generated mutants of Dnmt1 which removed the phosphorylation potential (S515A) or mimic phosphoserine (S515E), purified the proteins from insect cells and analyzed their DNA methylation activity in vitro. The S515E mutant was found to be active, while S515A mutant had severe loss in activity when compared to the wild type protein. The loss of activity of the S515A variant was not due to loss of DNA binding capacity. Furthermore, we show that a phosphorylated peptide whose sequence mimics the surrounding of Ser515 (EKIYIS(P)KIVVE) inhibited the activity of wild type Dnmt1 ten-fold more than the non-phosphorylated peptide. The inhibition was specific for Dnmt1 and for the particular peptide sequence. Our data suggest that phosphorylation of Ser515 is important for an interaction between the N-terminal domain of Dnmt1 and its catalytic domain that is necessary for activity and that this interaction is specifically disrupted by the phosphorylated peptide. We conclude that phosphorylation of Dnmt1 at Ser515 could be an important regulator of Dnmt1 activity during cell cycle and after proliferative stimuli.
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh
2013-01-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh
2013-09-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.
Molecular mechanisms of floral organ specification by MADS domain proteins.
Yan, Wenhao; Chen, Dijun; Kaufmann, Kerstin
2016-02-01
Flower development is a model system to understand organ specification in plants. The identities of different types of floral organs are specified by homeotic MADS transcription factors that interact in a combinatorial fashion. Systematic identification of DNA-binding sites and target genes of these key regulators show that they have shared and unique sets of target genes. DNA binding by MADS proteins is not based on 'simple' recognition of a specific DNA sequence, but depends on DNA structure and combinatorial interactions. Homeotic MADS proteins regulate gene expression via alternative mechanisms, one of which may be to modulate chromatin structure and accessibility in their target gene promoters. Copyright © 2015 Elsevier Ltd. All rights reserved.
The region of CQQQKPQRRP of PGC-1{alpha} interacts with the DNA-binding complex of FXR/RXR{alpha}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanaya, Eiko; Jingami, Hisato
2006-04-14
PGC-1{alpha} co-activates transcription by several nuclear receptors. To study the interaction among PGC-1{alpha}, RXR{alpha}/FXR, and DNA, we performed electrophoresis mobility shift assays. The RXR{alpha}/FXR proteins specifically bound to DNA containing the IR-1 sequence in the absence of ligand. When the fusion protein of GST-PGC-1{alpha} was added to the mixture of RXR{alpha}/FXR/DNA, the ligand-influenced retardation of the mobility was observed. The ligand for RXR{alpha} (9-cis-retinoic acid) was necessary for this retardation, whereas, the ligand for FXR, chenodeoxycholic acid, barely had an effect. The results obtained using truncated PGC-1{alpha} proteins suggested that two regions are necessary for PGC-1{alpha} to interact with themore » DNA-binding complex of RXR{alpha}/FXR. One is the region of the second leucine-rich motif, and the other is that of the amino acid sequence CQQQKPQRRP, present between the second and third leucine-rich motifs. The results obtained with the SPQSS mutation for KPQRR suggested that the basic amino acids are important for the interaction.« less
Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes
Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.
2015-01-01
Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076
In vitro selection of zinc fingers with altered DNA-binding specificity.
Jamieson, A C; Kim, S H; Wells, J A
1994-05-17
We have used random mutagenesis and phage display to alter the DNA-binding specificity of Zif268, a transcription factor that contains three zinc finger domains. Four residues in the helix of finger 1 of Zif268 that potentially mediate DNA binding were identified from an X-ray structure of the Zif268-DNA complex. A library was constructed in which these residues were randomly mutated and the Zif268 variants were fused to a truncated version of the gene III coat protein on the surface of M13 filamentous phage particles. The phage displayed the mutant proteins in a monovalent fashion and were sorted by repeated binding and elution from affinity matrices containing different DNA sequences. When the matrix contained the natural nine base pair operator sequence 5'-GCG-TGG-GCG-3', native-like zinc fingers were isolated. New finger 1 variants were found by sorting with two different operators in which the singly modified triplets, GTG and TCG, replaced the native finger 1 triplet, GCG. Overall, the selected finger 1 variants contained a preponderance of polar residues at the four sites. Interestingly, the net charge of the four residues in any selected finger never derived more that one unit from neutrality despite the fact that about half the variants contained three or four charged residues over the four sites. Measurements of the dissociation constants for two of these purified finger 1 variants by gel-shift assay showed their specificities to vary over a 10-fold range, with the greatest affinity being for the DNA binding site for which they were sorted.(ABSTRACT TRUNCATED AT 250 WORDS)
Elder, Robert M; Jayaraman, Arthi
2013-10-10
Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.
Zhang, Lu; Xu, Jinhao; Ma, Jinbiao
2016-07-25
RNA-binding protein exerts important biological function by specifically recognizing RNA motif. SELEX (Systematic evolution of ligands by exponential enrichment), an in vitro selection method, can obtain consensus motif with high-affinity and specificity for many target molecules from DNA or RNA libraries. Here, we combined SELEX with next-generation sequencing to study the protein-RNA interaction in vitro. A pool of RNAs with 20 bp random sequences were transcribed by T7 promoter, and target protein was inserted into plasmid containing SBP-tag, which can be captured by streptavidin beads. Through only one cycle, the specific RNA motif can be obtained, which dramatically improved the selection efficiency. Using this method, we found that human hnRNP A1 RRMs domain (UP1 domain) bound RNA motifs containing AGG and AG sequences. The EMSA experiment indicated that hnRNP A1 RRMs could bind the obtained RNA motif. Taken together, this method provides a rapid and effective method to study the RNA binding specificity of proteins.
G-Quadruplex Induction by the Hairpin Pyrrole-Imidazole Polyamide Dimer.
Obata, Shunsuke; Asamitsu, Sefan; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-02-06
The G-quadruplex (G4) is one type of higher-order structure of nucleic acids and is thought to play important roles in various biological events such as regulation of transcription and inhibition of DNA replication. Pyrrole-imidazole polyamides (PIPs) are programmable small molecules that can sequence-specifically bind with high affinity to the minor groove of double-stranded DNA (dsDNA). Herein, we designed head-to-head hairpin PIP dimers and their target dsDNA in a model G4-forming sequence. Using an electrophoresis mobility shift assay and transcription arrest assay, we found that PIP dimers could induce the structural change to G4 DNA from dsDNA through the recognition by one PIP dimer molecule of two duplex-binding sites flanking both ends of the G4-forming sequence. This induction ability was dependent on linker length. This is the first study to induce G4 formation using PIPs, which are known to be dsDNA binders. The results reported here suggest that selective G4 induction in native sequences may be achieved with PIP dimers by applying the same design strategy.
Computational Design of DNA-Binding Proteins.
Thyme, Summer; Song, Yifan
2016-01-01
Predicting the outcome of engineered and naturally occurring sequence perturbations to protein-DNA interfaces requires accurate computational modeling technologies. It has been well established that computational design to accommodate small numbers of DNA target site substitutions is possible. This chapter details the basic method of design used in the Rosetta macromolecular modeling program that has been successfully used to modulate the specificity of DNA-binding proteins. More recently, combining computational design and directed evolution has become a common approach for increasing the success rate of protein engineering projects. The power of such high-throughput screening depends on computational methods producing multiple potential solutions. Therefore, this chapter describes several protocols for increasing the diversity of designed output. Lastly, we describe an approach for building comparative models of protein-DNA complexes in order to utilize information from homologous sequences. These models can be used to explore how nature modulates specificity of protein-DNA interfaces and potentially can even be used as starting templates for further engineering.
Wang, Yupeng; Khan, Iram F.; Boissel, Sandrine; Jarjour, Jordan; Pangallo, Joseph; Thyme, Summer; Baker, David; Scharenberg, Andrew M.; Rawlings, David J.
2014-01-01
LAGLIDADG homing endonucleases (LHEs) are compact endonucleases with 20–22 bp recognition sites, and thus are ideal scaffolds for engineering site-specific DNA cleavage enzymes for genome editing applications. Here, we describe a general approach to LHE engineering that combines rational design with directed evolution, using a yeast surface display high-throughput cleavage selection. This approach was employed to alter the binding and cleavage specificity of the I-Anil LHE to recognize a mutation in the mouse Bruton tyrosine kinase (Btk) gene causative for mouse X-linked immunodeficiency (XID)—a model of human X-linked agammaglobulinemia (XLA). The required re-targeting of I-AniI involved progressive resculpting of the DNA contact interface to accommodate nine base differences from the native cleavage sequence. The enzyme emerging from the progressive engineering process was specific for the XID mutant allele versus the wild-type (WT) allele, and exhibited activity equivalent to WT I-AniI in vitro and in cellulo reporter assays. Fusion of the enzyme to a site-specific DNA binding domain of transcription activator-like effector (TALE) resulted in a further enhancement of gene editing efficiency. These results illustrate the potential of LHE enzymes as specific and efficient tools for therapeutic genome engineering. PMID:24682825
Sequence Discrimination by Alternatively Spliced Isoforms of a DNA Binding Zinc Finger Domain
NASA Astrophysics Data System (ADS)
Gogos, Joseph A.; Hsu, Tien; Bolton, Jesse; Kafatos, Fotis C.
1992-09-01
Two major developmentally regulated isoforms of the Drosophila chorion transcription factor CF2 differ by an extra zinc finger within the DNA binding domain. The preferred DNA binding sites were determined and are distinguished by an internal duplication of TAT in the site recognized by the isoform with the extra finger. The results are consistent with modular interactions between zinc fingers and trinucleotides and also suggest rules for recognition of AT-rich DNA sites by zinc finger proteins. The results show how modular finger interactions with trinucleotides can be used, in conjunction with alternative splicing, to alter the binding specificity and increase the spectrum of sites recognized by a DNA binding domain. Thus, CF2 may potentially regulate distinct sets of target genes during development.
Newer Gene Editing Technologies toward HIV Gene Therapy
Manjunath, N.; Yi, Guohua; Dang, Ying; Shankar, Premlata
2013-01-01
Despite the great success of highly active antiretroviral therapy (HAART) in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy. PMID:24284874
Mariani, Luca; Weinand, Kathryn; Vedenko, Anastasia; Barrera, Luis A; Bulyk, Martha L
2017-09-27
Transcription factors (TFs) control cellular processes by binding specific DNA motifs to modulate gene expression. Motif enrichment analysis of regulatory regions can identify direct and indirect TF binding sites. Here, we created a glossary of 108 non-redundant TF-8mer "modules" of shared specificity for 671 metazoan TFs from publicly available and new universal protein binding microarray data. Analysis of 239 ENCODE TF chromatin immunoprecipitation sequencing datasets and associated RNA sequencing profiles suggest the 8mer modules are more precise than position weight matrices in identifying indirect binding motifs and their associated tethering TFs. We also developed GENRE (genomically equivalent negative regions), a tunable tool for construction of matched genomic background sequences for analysis of regulatory regions. GENRE outperformed four state-of-the-art approaches to background sequence construction. We used our TF-8mer glossary and GENRE in the analysis of the indirect binding motifs for the co-occurrence of tethering factors, suggesting novel TF-TF interactions. We anticipate that these tools will aid in elucidating tissue-specific gene-regulatory programs. Copyright © 2017 Elsevier Inc. All rights reserved.
Kouno, Takahide; Silvas, Tania V; Hilbert, Brendan J; Shandilya, Shivender M D; Bohn, Markus F; Kelch, Brian A; Royer, William E; Somasundaran, Mohan; Kurt Yilmaz, Nese; Matsuo, Hiroshi; Schiffer, Celia A
2017-04-28
Nucleic acid editing enzymes are essential components of the immune system that lethally mutate viral pathogens and somatically mutate immunoglobulins, and contribute to the diversification and lethality of cancers. Among these enzymes are the seven human APOBEC3 deoxycytidine deaminases, each with unique target sequence specificity and subcellular localization. While the enzymology and biological consequences have been extensively studied, the mechanism by which APOBEC3s recognize and edit DNA remains elusive. Here we present the crystal structure of a complex of a cytidine deaminase with ssDNA bound in the active site at 2.2 Å. This structure not only visualizes the active site poised for catalysis of APOBEC3A, but pinpoints the residues that confer specificity towards CC/TC motifs. The APOBEC3A-ssDNA complex defines the 5'-3' directionality and subtle conformational changes that clench the ssDNA within the binding groove, revealing the architecture and mechanism of ssDNA recognition that is likely conserved among all polynucleotide deaminases, thereby opening the door for the design of mechanistic-based therapeutics.
Jalili, Seifollah; Karami, Leila; Schofield, Jeremy
2013-06-01
Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.
SRY, like HMG1, recognizes sharp angles in DNA.
Ferrari, S; Harley, V R; Pontiggia, A; Goodfellow, P N; Lovell-Badge, R; Bianchi, M E
1992-01-01
HMG boxes are DNA binding domains present in chromatin proteins, general transcription factors for nucleolar and mitochondrial RNA polymerases, and gene- and tissue-specific transcriptional regulators. The HMG boxes of HMG1, an abundant component of chromatin, interact specifically with four-way junctions, DNA structures that are cross-shaped and contain angles of approximately 60 and 120 degrees between their arms. We show here also that the HMG box of SRY, the protein that determines the expression of male-specific genes in humans, recognizes four-way junction DNAs irrespective of their sequence. In addition, when SRY binds to linear duplex DNA containing its specific target AACAAAG, it produces a sharp bend. Therefore, the interaction between HMG boxes and DNA appears to be predominantly structure-specific. The production of the recognition of a kink in DNA can serve several distinct functions, such as the repair of DNA lesions, the folding of DNA segments with bound transcriptional factors into productive complexes or the wrapping of DNA in chromatin. Images PMID:1425584
Tumorigenic Potential of Transit Amplifying Prostate Cells
2012-06-01
by ChIP-Seq showed that in both the human prostate cell line LNCaP and in mouse prostate, NKX3.1 bound DNA fragments are significantly enriched in...progression. Cancer Cell. 2010;17(5):443–454. 29. Steadman DJ, Giuffrida D, Gelmann EP. DNA - binding sequence of the human prostate-specific...bind nucleosomal DNA and destabilize nucleosomes thereby allowing other transcription factors to access their sites (7),(8). BODY Aim 1: To
Replication Protein A-1 Has a Preference for the Telomeric G-rich Sequence in Trypanosoma cruzi.
Pavani, Raphael Souza; Vitarelli, Marcela O; Fernandes, Carlos A H; Mattioli, Fabio F; Morone, Mariana; Menezes, Milene C; Fontes, Marcos R M; Cano, Maria Isabel N; Elias, Maria Carolina
2018-05-01
Replication protein A (RPA), the major eukaryotic single-stranded binding protein, is a heterotrimeric complex formed by RPA-1, RPA-2, and RPA-3. RPA is a fundamental player in replication, repair, recombination, and checkpoint signaling. In addition, increasing evidences have been adding functions to RPA in telomere maintenance, such as interaction with telomerase to facilitate its activity and also involvement in telomere capping in some conditions. Trypanosoma cruzi, the etiological agent of Chagas disease is a protozoa parasite that appears early in the evolution of eukaryotes. Recently, we have showed that T. cruziRPA presents canonical functions being involved with DNA replication and DNA damage response. Here, we found by FISH/IF assays that T. cruziRPA localizes at telomeres even outside replication (S) phase. In vitro analysis showed that one telomeric repeat is sufficient to bind RPA-1. Telomeric DNA induces different secondary structural modifications on RPA-1 in comparison with other types of DNA. In addition, RPA-1 presents a higher affinity for telomeric sequence compared to randomic sequence, suggesting that RPA may play specific roles in T. cruzi telomeric region. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.
Follett, Shelby E; Ingersoll, Azure D; Murray, Sally A; Reilly, Teresa M; Lehmann, Teresa E
2017-10-01
Bleomycins are a group of glycopeptide antibiotics synthesized by Streptomyces verticillus that are widely used for the treatment of various neoplastic diseases. These antibiotics have the ability to chelate a metal center, mainly Fe(II), and cause site-specific DNA cleavage. Bleomycins are differentiated by their C-terminal regions. Although this antibiotic family is a successful course of treatment for some types of cancers, it is known to cause pulmonary fibrosis. Previous studies have identified that bleomycin-related pulmonary toxicity is linked to the C-terminal region of these drugs. This region has been shown to closely interact with DNA. We examined the binding of Zn(II)peplomycin and Zn(II)bleomycin-A 2 to a DNA hairpin of sequence 5'-CCAGTATTTTTACTGG-3', containing the binding site 5'-GT-3', and compared the results with those obtained from our studies of the same MBLMs bound to a DNA hairpin containing the binding site 5'-GC-3'. We provide evidence that the DNA base sequence has a strong impact in the final structure of the drug-target complex.
Wu, Xiao-nan; Shi, Tao-tao; He, Yao-hui; Wang, Fei-fei; Sang, Rui; Ding, Jian-cheng; Zhang, Wen-juan; Shu, Xing-yi; Shen, Hai-feng; Yi, Jia; Gao, Xiang; Liu, Wen
2017-01-01
Yin Yang 1 (YY1) is a multifunctional DNA-binding transcription factor shown to be critical in a variety of biological processes, and its activity and function have been shown to be regulated by multitude of mechanisms, which include but are not limited to post-translational modifications (PTMs), its associated proteins and cellular localization. YY2, the paralog of YY1 in mouse and human, has been proposed to function redundantly or oppositely in a context-specific manner compared with YY1. Despite its functional importance, how YY2’s DNA-binding activity and function are regulated, particularly by PTMs, remains completely unknown. Here we report the first PTM with functional characterization on YY2, namely lysine 247 monomethylation (K247me1), which was found to be dynamically regulated by SET7/9 and LSD1 both in vitro and in cultured cells. Functional study revealed that SET7/9-mediated YY2 methylation regulated its DNA-binding activity in vitro and in association with chromatin examined by chromatin immunoprecipitation coupled with sequencing (ChIP-seq) in cultured cells. Knockout of YY2, SET7/9 or LSD1 by CRISPR (clustered, regularly interspaced, short palindromic repeats)/Cas9-mediated gene editing followed by RNA sequencing (RNA-seq) revealed that a subset of genes was positively regulated by YY2 and SET7/9, but negatively regulated by LSD1, which were enriched with genes involved in cell proliferation regulation. Importantly, YY2-regulated gene transcription, cell proliferation and tumor growth were dependent, at least partially, on YY2 K247 methylation. Finally, somatic mutations on YY2 found in cancer, which are in close proximity to K247, altered its methylation, DNA-binding activity and gene transcription it controls. Our findings revealed the first PTM with functional implications imposed on YY2 protein, and linked YY2 methylation with its biological functions. PMID:29098080
IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.
Hároníková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva B; Fojta, Miroslav; Dvořáková, Petra; Muller, Petr; Vojtesek, Borivoj; Brázda, Václav
2016-01-01
Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.
Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pröpper, Kevin; Instituto de Biologia Molecular de Barcelona; Meindl, Kathrin
2014-06-01
The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite themore » fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.« less
TALE: a tale of genome editing.
Zhang, Mingjie; Wang, Feng; Li, Shifei; Wang, Yan; Bai, Yun; Xu, Xueqing
2014-01-01
Transcription activator-like effectors (TALEs), first identified in Xanthomonas bacteria, are naturally occurring or artificially designed proteins that modulate gene transcription. These proteins recognize and bind DNA sequences based on a variable numbers of tandem repeats. Each repeat is comprised of a set of ∼ 34 conserved amino acids; within this conserved domain, there are usually two amino acids that distinguish one TALE from another. Interestingly, TALEs have revealed a simple cipher for the one-to-one recognition of proteins for DNA bases. Synthetic TALEs have been used to successfully target genes in a variety of species, including humans. Depending on the type of functional domain that is fused to the TALE of interest, these proteins can have diverse biological effects. For example, after binding DNA, TALEs fused to transcriptional activation domains can function as robust transcription factors (TALE-TFs), while fused to restriction endonucleases (TALENs) can cut DNA. Targeted genome editing, in theory, is capable of modifying any endogenous gene sequence of interest; this can be performed in cells or organisms, and may be applied to clinical gene-based therapies in the future. With current technologies, highly accurate, specific, and reliable gene editing cannot be achieved. Thus, recognition and binding mechanisms governing TALE biology are currently hot research areas. In this review, we summarize the major advances in TALE technology over the past several years with a focus on the interaction between TALEs and DNA, TALE design and construction, potential applications for this technology, and unique characteristics that make TALEs superior to zinc finger endonucleases. Copyright © 2013 Elsevier Ltd. All rights reserved.
Marshall, Owen J; Southall, Tony D; Cheetham, Seth W; Brand, Andrea H
2016-09-01
This protocol is an extension to: Nat. Protoc. 2, 1467-1478 (2007); doi:10.1038/nprot.2007.148; published online 7 June 2007The ability to profile transcription and chromatin binding in a cell-type-specific manner is a powerful aid to understanding cell-fate specification and cellular function in multicellular organisms. We recently developed targeted DamID (TaDa) to enable genome-wide, cell-type-specific profiling of DNA- and chromatin-binding proteins in vivo without cell isolation. As a protocol extension, this article describes substantial modifications to an existing protocol, and it offers additional applications. TaDa builds upon DamID, a technique for detecting genome-wide DNA-binding profiles of proteins, by coupling it with the GAL4 system in Drosophila to enable both temporal and spatial resolution. TaDa ensures that Dam-fusion proteins are expressed at very low levels, thus avoiding toxicity and potential artifacts from overexpression. The modifications to the core DamID technique presented here also increase the speed of sample processing and throughput, and adapt the method to next-generation sequencing technology. TaDa is robust, reproducible and highly sensitive. Compared with other methods for cell-type-specific profiling, the technique requires no cell-sorting, cross-linking or antisera, and binding profiles can be generated from as few as 10,000 total induced cells. By profiling the genome-wide binding of RNA polymerase II (Pol II), TaDa can also identify transcribed genes in a cell-type-specific manner. Here we describe a detailed protocol for carrying out TaDa experiments and preparing the material for next-generation sequencing. Although we developed TaDa in Drosophila, it should be easily adapted to other organisms with an inducible expression system. Once transgenic animals are obtained, the entire experimental procedure-from collecting tissue samples to generating sequencing libraries-can be accomplished within 5 d.
Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.
Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong
2006-07-07
We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.
Wang, Shuo; Aston, Karl; Koeller, Kevin J.; Harris, G. Davis; Rath, Nigam P.
2014-01-01
Hairpin polyamides (PAs) are an important class of sequence-specific DNA minor groove binders, and frequently employ a flexible motif, β-alanine (β), to reduce the molecular rigidity to maintain the DNA recognition register. To better understand the diverse effects β can have on DNA-PA binding affinity, selectivity, and especially kinetics, which have rarely been reported, we have initiated a detailed study for an eight-heterocyclic hairpin PA and its β derivatives with their cognate and mutant sequences. With these derivatives, all internal pyrroles of the parent PA are systematically substituted with single or double βs. A set of complementary experiments have been conducted to evaluate the molecular interactions in detail: UV-melting, biosensor-surface plasmon resonance, circular dichroism and isothermal titration calorimetry. The β substitutions generally weaken the binding affinities of these PAs with cognate DNA, and have large and diverse influences on PA binding kinetics in a position- and number-dependent manner. The DNA base mutations have also shown positional effects on binding of a single PA. Besides the β substitutions, the monocationic Dp group [3-(dimethylamino) propylamine] in parent PA has been modified into a dicationic Ta group (3, 3'-Diamino-N-methyldipropylamine) to minimize the frequently observed PA aggregation with ITC experiments. The results clearly show that the Ta modification not only maintains the DNA binding mode and affinity of PA, but also significantly reduces PA aggregation and allows the complete thermodynamic signature of eight-ring hairpin PA to be determined for the first time. This combined set of results significantly extends our understanding of the energetic basis of specific DNA recognition by PAs. PMID:25141096
TAF(II)250: a transcription toolbox.
Wassarman, D A; Sauer, F
2001-08-01
Activation of RNA-polymerase-II-dependent transcription involves conversion of signals provided by gene-specific activator proteins into the synthesis of messenger RNA. This conversion requires dynamic structural changes in chromatin and assembly of general transcription factors (GTFs) and RNA polymerase II at core promoter sequence elements surrounding the transcription start site of genes. One hallmark of transcriptional activation is the interaction of DNA-bound activators with coactivators such as the TATA-box binding protein (TBP)-associated factors (TAF(II)s) within the GTF TFIID. TAF(II)250 possesses a variety of activities that are likely to contribute to the initial steps of RNA polymerase II transcription. TAF(II)250 is a scaffold for assembly of other TAF(II)s and TBP into TFIID, TAF(II)250 binds activators to recruit TFIID to particular promoters, TAF(II)250 regulates binding of TBP to DNA, TAF(II)250 binds core promoter initiator elements, TAF(II)250 binds acetylated lysine residues in core histones, and TAF(II)250 possesses protein kinase, ubiquitin-activating/conjugating and acetylase activities that modify histones and GTFs. We speculate that these activities achieve two goals--(1) they aid in positioning and stabilizing TFIID at particular promoters, and (2) they alter chromatin structure at the promoter to allow assembly of GTFs--and we propose a model for how TAF(II)250 converts activation signals into active transcription.
Melkina, Olga E; Koval, Vasilii S; Ivanov, Alexander A; Zhuze, Alexei L; Zavilgelsky, Gennadii B
2018-03-01
DNA sequence-specific fluorescent dimeric bisbenzimidazoles DBP(n) and DBPA(n), noncovalently interacting with A-T pairs in the minor groove of double-stranded DNA were used for studying and monitoring the expression of histone-like H-NS-dependent promoters. Histone-like H-NS selectively binds to AT-rich segments of DNA and silences a large number of genes in bacterial chromosomes. The H-NS-dependent promoters of Quorum Sensing (QS)-regulated lux operons of the marine bacteria mesophilic Aliivibrio fischeri, psychrophilic Aliivibrio logei were used. Escherichia coli lux biosensors were constructed by cloning fragments bearing QS-regulated promoters into the vector, thereby placing each fragment upstream of the promoterless Photorhabdus luminescens luxCDABE genes. It was shown that the dimeric bisbenzimidazoles DBP(n) and DBPA(n) counteract the H-NS silencing activity. Thus, the presence of DBP(n) or DBPA(n) in the medium leads to an approximately 10-100-fold increase in the level of transcription of QS promoters in E. coli hns + . The largest decrease in the level of H-NS repression was observed using ligands containing a linker with a length of ca. 18Å, such as DBP(2) and DBPA(2). Ligands containing linkers with n=1 and 3 are an order of magnitude less active; ligands with n=4 are inactive. DBPA(2) exhibits activity starting with a concentration of 0.5μM; the minimum concentration of DBP(2) is 5-7 times higher. It is suggested that A-T pairs located at five nucleotide pair intervals, which correspond to the linker length in highly active ligands with n=2, play a key role in the structure of H-NS-binding sites in QS-regulated promoters. Copyright © 2017 Elsevier GmbH. All rights reserved.
Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus.
Duan, Nuo; Wu, Shijia; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping
2012-04-25
A whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX) method was applied to a combinatorial library of FAM-labeled single-stranded DNA molecules to identify DNA aptamers demonstrating specific binding to Vibrio parahemolyticus . FAM-labeled aptamer sequences with high binding affinity to V. parahemolyticus were identified by flow cytometric analysis. Aptamer A3P, which showed a particularly high binding affinity in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K(d)) of 16.88 ± 1.92 nM. Binding assays to assess the specificity of aptamer A3P showed a high binding affinity (76%) for V. parahemolyticus and a low apparent binding affinity (4%) for other bacteria. Whole-bacterium SELEX is a promising technique for the design of aptamer-based molecular probes for microbial pathogens that does not require the labor-intensive steps of isolating and purifying complex markers or targets.
Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon
2018-02-07
We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I
2013-03-29
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.
2013-01-01
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bach, Christian; Sherman, William; Pallis, Jani
Zinc finger nucleases (ZFNs) are associated with cell death and apoptosis by binding at countless undesired locations. This cytotoxicity is associated with the binding ability of engineered zinc finger domains to bind dissimilar DNA sequences with high affinity. In general, binding preferences of transcription factors are associated with significant degenerated diversity and complexity which convolutes the design and engineering of precise DNA binding domains. Evolutionary success of natural zinc finger proteins, however, evinces that nature created specific evolutionary traits and strategies, such as modularity and rank-specific recognition to cope with binding complexity that are critical for creating clinical viable toolsmore » to precisely modify the human genome. Our findings indicate preservation of general modularity and significant alteration of the rank-specific binding preferences of the three-finger binding domain of transcription factor SP1 when exchanging amino acids in the 2nd finger.« less
Bach, Christian; Sherman, William; Pallis, Jani; ...
2014-01-01
Zinc finger nucleases (ZFNs) are associated with cell death and apoptosis by binding at countless undesired locations. This cytotoxicity is associated with the binding ability of engineered zinc finger domains to bind dissimilar DNA sequences with high affinity. In general, binding preferences of transcription factors are associated with significant degenerated diversity and complexity which convolutes the design and engineering of precise DNA binding domains. Evolutionary success of natural zinc finger proteins, however, evinces that nature created specific evolutionary traits and strategies, such as modularity and rank-specific recognition to cope with binding complexity that are critical for creating clinical viable toolsmore » to precisely modify the human genome. Our findings indicate preservation of general modularity and significant alteration of the rank-specific binding preferences of the three-finger binding domain of transcription factor SP1 when exchanging amino acids in the 2nd finger.« less
Uckun, Fatih M.; Ma, Hong; Zhang, Jian; Ozer, Zahide; Dovat, Sinisa; Mao, Cheney; Ishkhanian, Rita; Goodman, Patricia; Qazi, Sanjive
2012-01-01
Ikaros is a zinc finger-containing DNA-binding protein that plays a pivotal role in immune homeostasis through transcriptional regulation of the earliest stages of lymphocyte ontogeny and differentiation. Functional deficiency of Ikaros has been implicated in the pathogenesis of acute lymphoblastic leukemia, the most common form of childhood cancer. Therefore, a stringent regulation of Ikaros activity is considered of paramount importance, but the operative molecular mechanisms responsible for its regulation remain largely unknown. Here we provide multifaceted genetic and biochemical evidence for a previously unknown function of spleen tyrosine kinase (SYK) as a partner and posttranslational regulator of Ikaros. We demonstrate that SYK phoshorylates Ikaros at unique C-terminal serine phosphorylation sites S358 and S361, thereby augmenting its nuclear localization and sequence-specific DNA binding activity. Mechanistically, we establish that SYK-induced Ikaros activation is essential for its nuclear localization and optimal transcription factor function. PMID:23071339
Systematic Evaluation of the Dependence of Deoxyribozyme Catalysis on Random Region Length
Velez, Tania E.; Singh, Jaydeep; Xiao, Ying; Allen, Emily C.; Wong, On Yi; Chandra, Madhavaiah; Kwon, Sarah C.; Silverman, Scott K.
2012-01-01
Functional nucleic acids are DNA and RNA aptamers that bind targets, or they are deoxyribozymes and ribozymes that have catalytic activity. These functional DNA and RNA sequences can be identified from random-sequence pools by in vitro selection, which requires choosing the length of the random region. Shorter random regions allow more complete coverage of sequence space but may not permit the structural complexity necessary for binding or catalysis. In contrast, longer random regions are sampled incompletely but may allow adoption of more complicated structures that enable function. In this study, we systematically examined random region length (N20 through N60) for two particular deoxyribozyme catalytic activities, DNA cleavage and tyrosine-RNA nucleopeptide linkage formation. For both activities, we previously identified deoxyribozymes using only N40 regions. In the case of DNA cleavage, here we found that shorter N20 and N30 regions allowed robust catalytic function, either by DNA hydrolysis or by DNA deglycosylation and strand scission via β-elimination, whereas longer N50 and N60 regions did not lead to catalytically active DNA sequences. Follow-up selections with N20, N30, and N40 regions revealed an interesting interplay of metal ion cofactors and random region length. Separately, for Tyr-RNA linkage formation, N30 and N60 regions provided catalytically active sequences, whereas N20 was unsuccessful, and the N40 deoxyribozymes were functionally superior (in terms of rate and yield) to N30 and N60. Collectively, the results indicate that with future in vitro selection experiments for DNA and RNA catalysts, and by extension for aptamers, random region length should be an important experimental variable. PMID:23088677
NASA Astrophysics Data System (ADS)
Samuelsen, Simone V.; Solov'Yov, Ilia A.; Balboni, Imelda M.; Mellins, Elizabeth; Nielsen, Christoffer Tandrup; Heegaard, Niels H. H.; Astakhova, Kira
2016-10-01
New techniques to detect and quantify antibodies to nucleic acids would provide a significant advance over current methods, which often lack specificity. We investigate the potential of novel antigens containing locked nucleic acids (LNAs) as targets for antibodies. Particularly, employing molecular dynamics we predict optimal nucleotide composition for targeting DNA-binding antibodies. As a proof of concept, we address a problem of detecting anti-DNA antibodies that are characteristic of systemic lupus erythematosus, a chronic autoimmune disease with multiple manifestations. We test the best oligonucleotide binders in surface plasmon resonance studies to analyze binding and kinetic aspects of interactions between antigens and target DNA. These DNA and LNA/DNA sequences showed improved binding in enzyme-linked immunosorbent assay using human samples of pediatric lupus patients. Our results suggest that the novel method is a promising tool to create antigens for research and point-of-care monitoring of anti-DNA antibodies.
DNA sequencing using polymerase substrate-binding kinetics
Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min
2015-01-01
Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848
Selection of homeotic proteins for binding to a human DNA replication origin.
de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G
2000-06-09
We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.
The tall letters represent the highly conserved bases in DNA binding sites of several prokaryotic repressors and activators. Conservation is strongest where major grooves of the double helical DNA (represented by crests of a cosine wave) face the protein. This shows that conservation analysis alone can be used to predict the face of DNA that contacts the proteins.
Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.
Sweet, D H; Jang, Y K; Sancar, G B
1997-11-01
In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.
footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.
Sebastian, Alvaro; Contreras-Moreira, Bruno
2014-01-15
Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.
Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V
1996-01-19
Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.
Shi, Yuqian; Hellinga, Homme W.; Beese, Lorena S.
2017-01-01
Human exonuclease 1 (hExo1) is a member of the RAD2/XPG structure-specific 5′-nuclease superfamily. Its dominant, processive 5′–3′ exonuclease and secondary 5′-flap endonuclease activities participate in various DNA repair, recombination, and replication processes. A single active site processes both recessed ends and 5′-flap substrates. By initiating enzyme reactions in crystals, we have trapped hExo1 reaction intermediates that reveal structures of these substrates before and after their exo- and endonucleolytic cleavage, as well as structures of uncleaved, unthreaded, and partially threaded 5′ flaps. Their distinctive 5′ ends are accommodated by a small, mobile arch in the active site that binds recessed ends at its base and threads 5′ flaps through a narrow aperture within its interior. A sequence of successive, interlocking conformational changes guides the two substrate types into a shared reaction mechanism that catalyzes their cleavage by an elaborated variant of the two-metal, in-line hydrolysis mechanism. Coupling of substrate-dependent arch motions to transition-state stabilization suppresses inappropriate or premature cleavage, enhancing processing fidelity. The striking reduction in flap conformational entropy is catalyzed, in part, by arch motions and transient binding interactions between the flap and unprocessed DNA strand. At the end of the observed reaction sequence, hExo1 resets without relinquishing DNA binding, suggesting a structural basis for its processivity. PMID:28533382
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tully, D.B.; Hillman, D.; Herbert, E.
1986-05-01
Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less
Weber, Axel; Borghouts, Corina; Brendel, Christian; Moriggl, Richard; Delis, Natalia; Brill, Boris; Vafaizadeh, Vida; Groner, Bernd
2013-01-01
The signal transducer and activator of transcription Stat5 is transiently activated by growth factor and cytokine signals in normal cells, but its persistent activation has been observed in a wide range of human tumors. Aberrant Stat5 activity was initially observed in leukemias, but subsequently also found in carcinomas. We investigated the importance of Stat5 in human tumor cell lines. shRNA mediated downregulation of Stat5 revealed the dependence of prostate and breast cancer cells on the expression of this transcription factor. We extended these inhibition studies and derived a peptide aptamer (PA) ligand, which directly interacts with the DNA-binding domain of Stat5 in a yeast-two-hybrid screen. The Stat5 specific PA sequence is embedded in a thioredoxin (hTRX) scaffold protein. The resulting recombinant protein S5-DBD-PA was expressed in bacteria, purified and introduced into tumor cells by protein transduction. Alternatively, S5-DBD-PA was expressed in the tumor cells after infection with a S5-DBD-PA encoding gene transfer vector. Both strategies impaired the DNA-binding ability of Stat5, suppressed Stat5 dependent transactivation and caused its intracellular degradation. Our experiments describe a peptide based inhibitor of Stat5 protein activity which can serve as a lead for the development of a clinically useful compound for cancer treatment. PMID:24276378
Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsodikov, Oleg V.; Biswas, Tapan
An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less
May the Best Molecule Win: Competition ESI Mass Spectrometry
Laughlin, Sarah; Wilson, W. David
2015-01-01
Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. PMID:26501262
Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P
2007-08-01
To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.
Duquesnoy, P; Sobrier, M L; Amselem, S; Goossens, M
1991-01-01
Mutations in the growth hormone receptor (GHR) gene can cause growth hormone (GH) resistance. Given the sequence homology between the extracellular domain of the GHR and a soluble GH-binding protein (GH-BP), it is remarkable that GH-BP binding activity is absent from the serum of patients with Laron-type GH insensitivity, a hereditary form of severe dwarfism. We have previously identified a mutation within the extracellular domain of this receptor, replacing phenylalanine by serine at position 96 of the mature protein, in a patient with Laron syndrome. We have now investigated the effect of this Phe----Ser substitution on hormone binding activity by expressing the total human GHR cDNA and mutant form in eukaryotic cells. The wild-type protein expressed was able to bind GH but no plasma membrane binding was detectable on cells transfected with the mutant cDNA; this was also the case of cells transfected with a Phe96----Ala mutant cDNA, suggesting that the lack of binding activity is not due to a posttranslational modification of serine. Examination of the variant proteins in subcellular fractions revealed the presence of specific GH binding activity in the lysosomal fraction, whereas immunofluorescence studies located mutant proteins in the cytosol. Our findings suggest that these mutant GHRs fail to follow the correct intracellular transport pathway and underline the potential importance of this phenylalanine residue, which is conserved among the GH, prolactin, and erythropoietin receptors that belong to the same cytokine receptor superfamily. Images PMID:1719554
Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA.
Mori, Tetsuya; Saveliev, Sergei V; Xu, Yao; Stafford, Walter F; Cox, Michael M; Inman, Ross B; Johnson, Carl H
2002-12-24
KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecADnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecADnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns.
Molecular cytogenetics using fluorescence in situ hybridization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gray, J.W.; Kuo, Wen-Lin; Lucas, J.
1990-12-07
Fluorescence in situ hybridization (FISH) with chromosome-specific probes enables several new areas of cytogenetic investigation by allowing visual determination of the presence and normality of specific genetic sequences in single metaphase or interphase cells. in this approach, termed molecular cytogenetics, the genetic loci to be analyzed are made microscopically visible in single cells using in situ hybridization with nucleic acid probes specific to these loci. To accomplish this, the DNA in the target cells is made single stranded by thermal denaturation and incubated with single-stranded, chemically modified probe under conditions where the probe will anneal only with DNA sequences tomore » which it has high DNA sequence homology. The bound probe is then made visible by treatment with a fluorescent reagent such as fluorescein that binds to the chemical modification carried by the probe. The DNA to which the probe does not bind is made visible by staining with a dye such as propidium iodide that fluoresces at a wavelength different from that of the reagent used for probe visualization. We show in this report that probes are now available that make this technique useful for biological dosimetry, prenatal diagnosis and cancer biology. 31 refs., 3 figs.« less
Crystal structure of MboIIA methyltransferase.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Osipiuk, J.; Walsh, M. A.; Joachimiak, A.
2003-09-15
DNA methyltransferases (MTases) are sequence-specific enzymes which transfer a methyl group from S-adenosyl-L-methionine (AdoMet) to the amino group of either cytosine or adenine within a recognized DNA sequence. Methylation of a base in a specific DNA sequence protects DNA from nucleolytic cleavage by restriction enzymes recognizing the same DNA sequence. We have determined at 1.74 {angstrom} resolution the crystal structure of a {beta}-class DNA MTase MboIIA (M {center_dot} MboIIA) from the bacterium Moraxella bovis, the smallest DNA MTase determined to date. M {center_dot} MboIIA methylates the 3' adenine of the pentanucleotide sequence 5'-GAAGA-3'. The protein crystallizes with two molecules inmore » the asymmetric unit which we propose to resemble the dimer when M {center_dot} MboIIA is not bound to DNA. The overall structure of the enzyme closely resembles that of M {center_dot} RsrI. However, the cofactor-binding pocket in M {center_dot} MboIIA forms a closed structure which is in contrast to the open-form structures of other known MTases.« less
Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford
2006-01-01
The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069
Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford
2006-01-01
The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.
Aranovich, Alexander; Braier-Marcovitz, Shani; Ansbacher, Esti; Granek, Rony; Parola, Abraham H; Fishov, Itzhak
2015-08-13
DnaA, the initiator of chromosome replication in most known eubacteria species, is activated once per cell division cycle. Its overall activity cycle is driven by ATP hydrolysis and ADP-ATP exchange. The latter can be promoted by binding to specific sequences on the chromosome and/or to acidic phospholipids in the membrane. We have previously shown that the transition into an active form (rejuvenation) is strongly co-operative with respect to DnaA membrane occupancy. Only at low membrane occupancy is DnaA reactivation efficiently catalysed by the acidic phospholipids. The present study was aimed at unravelling the molecular mechanism underlying the occupancy-dependent DnaA rejuvenation. We found that truncation of the DnaA N-terminal completely abolishes the co-operative transformation between the high and low occupancy states (I and II respectively) without affecting the membrane binding. The environmentally sensitive fluorophore specifically attached to the N-terminal cysteines of DnaA reported on occupancy-correlated changes in its vicinity. Cross-linking of DnaA with a short homobifunctional reagent revealed that state II of the protein on the membrane corresponds to a distinct oligomeric form of DnaA. The kinetic transition of DnaA on the membrane surface is described in the present study by a generalized 2D condensation phase transition model, confirming the existence of two states of DnaA on the membrane and pointing to the possibility that membrane protein density serves as an on-off switch in vivo. We conclude that the DnaA conformation attained at low surface density drives its N-terminal-mediated oligomerization, which is presumably a pre-requisite for facilitated nt exchange. © 2015 Authors.
Polstein, Lauren R.; Perez-Pinera, Pablo; Kocak, D. Dewran; Vockley, Christopher M.; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Reddy, Timothy E.; Gersbach, Charles A.
2015-01-01
Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. PMID:26025803
Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.
1998-01-01
Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480
A search for specificity in DNA-drug interactions.
Cruciani, G; Goodford, P J
1994-06-01
The GRID force field and a principal component analysis have been used in order to predict the interactions of small chemical groups with all 64 different triplet sequences of B-DNA. Factors that favor binding to guanine-cytosine base pairs have been identified, and a dictionary of ligand groups and their locations is presented as a guide to the design of specific DNA ligands.
Fortin, Connor H; Schulze, Katharina V; Babbitt, Gregory A
2015-01-01
It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence logos plots are severely limited in that they convey no explicit information regarding the structural dynamics of DNA backbone, a feature often critical to binding specificity. We present TRX-LOGOS, an R software package and Perl wrapper code that interfaces the JASPAR database for computational regulatory genomics. TRX-LOGOS extends the traditional sequence logo plot to include Shannon information content calculated with regard to the dinucleotide-based BI-BII conformation shifts in phosphate linkages on the DNA backbone, thereby adding a visual measure of intrinsic DNA flexibility that can be critical for many DNA-protein interactions. TRX-LOGOS is available as an R graphics module offered at both SourceForge and as a download supplement at this journal. To demonstrate the general utility of TRX logo plots, we first calculated the information content for 416 Saccharomyces cerevisiae transcription factor binding sites functionally confirmed in the Yeastract database and matched to previously published yeast genomic alignments. We discovered that flanking regions contain significantly elevated information content at phosphate linkages than can be observed at nucleobases. We also examined broader transcription factor classifications defined by the JASPAR database, and discovered that many general signatures of transcription factor binding are locally more information rich at the level of DNA backbone dynamics than nucleobase sequence. We used TRX-logos in combination with MEGA 6.0 software for molecular evolutionary genetics analysis to visually compare the human Forkhead box/FOX protein evolution to its binding site evolution. We also compared the DNA binding signatures of human TP53 tumor suppressor determined by two different laboratory methods (SELEX and ChIP-seq). Further analysis of the entire yeast genome, center aligned at the start codon, also revealed a distinct sequence-independent 3 bp periodic pattern in information content, present only in coding region, and perhaps indicative of the non-random organization of the genetic code. TRX-LOGOS is useful in any situation in which important information content in DNA can be better visualized at the positions of phosphate linkages (i.e. dinucleotides) where the dynamic properties of the DNA backbone functions to facilitate DNA-protein interaction.
Hüntelmann, Bettina; Staab, Julia; Herrmann-Lingen, Christoph; Meyer, Thomas
2014-01-01
Binding to specific palindromic sequences termed gamma-activated sites (GAS) is a hallmark of gene activation by members of the STAT (signal transducer and activator of transcription) family of cytokine-inducible transcription factors. However, the precise molecular mechanisms involved in the signal-dependent finding of target genes by STAT dimers have not yet been very well studied. In this study, we have characterized a sequence motif in the STAT1 linker domain which is highly conserved among the seven human STAT proteins and includes surface-exposed residues in close proximity to the bound DNA. Using site-directed mutagenesis, we have demonstrated that a lysine residue in position 567 of the full-length molecule is required for GAS recognition. The substitution of alanine for this residue completely abolished both binding to high-affinity GAS elements and transcriptional activation of endogenous target genes in cells stimulated with interferon-γ (IFNγ), while the time course of transient nuclear accumulation and tyrosine phosphorylation were virtually unchanged. In contrast, two glutamic acid residues (E559 and E563) on each monomer are important for the dissociation of dimeric STAT1 from DNA and, when mutated to alanine, result in elevated levels of tyrosine-phosphorylated STAT1 as well as prolonged IFNγ-stimulated nuclear accumulation. In conclusion, our data indicate that the kinetics of signal-dependent GAS binding is determined by an array of glutamic acid residues located at the interior surface of the STAT1 dimer. These negatively charged residues appear to align the long axis of the STAT1 dimer in a position perpendicular to the DNA, thereby facilitating the interaction between lysine 567 and the phosphodiester backbone of a bound GAS element, which is a prerequisite for transient gene induction.
High-resolution mapping of transcription factor binding sites on native chromatin
Kasinathan, Sivakanthan; Orsi, Guillermo A.; Zentner, Gabriel E.; Ahmad, Kami; Henikoff, Steven
2014-01-01
Sequence-specific DNA-binding proteins including transcription factors (TFs) are key determinants of gene regulation and chromatin architecture. Formaldehyde cross-linking and sonication followed by Chromatin ImmunoPrecipitation (X-ChIP) is widely used for profiling of TF binding, but is limited by low resolution and poor specificity and sensitivity. We present a simple protocol that starts with micrococcal nuclease-digested uncross-linked chromatin and is followed by affinity purification of TFs and paired-end sequencing. The resulting ORGANIC (Occupied Regions of Genomes from Affinity-purified Naturally Isolated Chromatin) profiles of Saccharomyces cerevisiae Abf1 and Reb1 provide highly accurate base-pair resolution maps that are not biased toward accessible chromatin, and do not require input normalization. We also demonstrate the high specificity of our method when applied to larger genomes by profiling Drosophila melanogaster GAGA Factor and Pipsqueak. Our results suggest that ORGANIC profiling is a widely applicable high-resolution method for sensitive and specific profiling of direct protein-DNA interactions. PMID:24336359
Discrimination against RNA Backbones by a ssDNA Binding Protein.
Lloyd, Neil R; Wuttke, Deborah S
2018-05-01
Pot1 is the shelterin component responsible for the protection of the single-stranded DNA (ssDNA) overhang at telomeres in nearly all eukaryotic organisms. The C-terminal domain of the DNA-binding domain, Pot1pC, exhibits non-specific ssDNA recognition, achieved through thermodynamically equivalent alternative binding conformations. Given this flexibility, it is unclear how specificity for ssDNA over RNA, an activity required for biological function, is achieved. Examination of the ribose-position specificity of Pot1pC shows that ssDNA specificity is additive but not uniformly distributed across the ligand. High-resolution structures of several Pot1pC complexes with RNA-DNA chimeric ligands reveal Pot1pC discriminates against RNA by utilizing non-compensatory binding modes that feature significant rearrangement of the binding interface. These alternative conformations, accessed through both ligand and protein flexibility, recover much, but not all, of the binding energy, leading to the observed reduction in affinities. These findings suggest that intermolecular interfaces are remarkably sophisticated in their tuning of specificity toward flexible ligands. Copyright © 2018 Elsevier Ltd. All rights reserved.
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-01-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-11-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.
Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming
2012-01-01
The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Small terminase couples viral DNA-binding to genome-packaging ATPase activity
Roy, Ankoor; Bhardwaj, Anshul; Datta, Pinaki; Lander, Gabriel C.; Cingolani, Gino
2012-01-01
SUMMARY Packaging of viral genomes into empty procapsids is powered by a large DNA-packaging motor. In most viruses, this machine is composed of a large (L) and a small (S) terminase subunit complexed with a dodecamer of portal protein. Here, we describe the 1.75 Å crystal structure of the bacteriophage P22 S-terminase in a nonameric conformation. The structure presents a central channel ~23 Å in diameter, sufficiently large to accommodate hydrated B-DNA. The last 23 residues of S-terminase are essential for binding to DNA and assembly to L-terminase. Upon binding to its own DNA, S-terminase functions as a specific activator of L-terminase ATPase activity. The DNA-dependent stimulation of ATPase activity thus rationalizes the exclusive specificity of genome-packaging motors for viral DNA in the crowd of host DNA, ensuring fidelity of packaging and avoiding wasteful ATP hydrolysis. This posits a model for DNA-dependent activation of genome-packaging motors of general interest in virology. PMID:22771211
Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.
Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P
2001-08-17
Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.
Survey of protein–DNA interactions in Aspergillus oryzae on a genomic scale
Wang, Chao; Lv, Yangyong; Wang, Bin; Yin, Chao; Lin, Ying; Pan, Li
2015-01-01
The genome-scale delineation of in vivo protein–DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein–DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein–DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences. PMID:25883143
Giresi, Paul G.; Lieb, Jason D.
2009-01-01
The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047
Gauthier-Rouvière, C; Cavadore, J C; Blanchard, J M; Lamb, N J; Fernandez, A
1991-01-01
Indirect immunofluorescence analysis, using antibodies directed against peptide sequences outside the DNA-binding domain of the 67-kDa serum response factor (p67SRF), revealed a punctuated nuclear staining, constant throughout the cell cycle and in all different cell lines tested. p67SRF was also tightly associated with chromatin through all stages of mitosis. Inhibition of p67SRF activity in vivo, through microinjection of anti-p67SRF antibodies, specifically suppressed DNA synthesis induced after serum addition or ras microinjection, suggesting that these antibodies were effective in preventing expression of serum response element (SRE)-regulated genes. A similar inhibition was also obtained in cells injected with oligonucleotides corresponding to the DNA binding sequence for p67SRF protein, SRE. Moreover, this inhibition of DNA synthesis by anti-p67SRF or SRE injection was still observed in cells injected during late G1, well after c-fos induction. These data imply that genes regulated by p67SRF are continuously involved in the proliferation pathway throughout G1 and that p67SRF forms an integral component of mammalian cell transcriptional control. Images PMID:1782216
DNA residence time is a regulatory factor of transcription repression
Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette
2017-01-01
Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492
Schneider, T D
2001-12-01
The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.
Custom-Designed Molecular Scissors for Site-Specific Manipulation of the Plant and Mammalian Genomes
NASA Astrophysics Data System (ADS)
Kandavelou, Karthikeyan; Chandrasegaran, Srinivasan
Zinc finger nucleases (ZFNs) are custom-designed molecular scissors, engineered to cut at specific DNA sequences. ZFNs combine the zinc finger proteins (ZFPs) with the nonspecific cleavage domain of the FokI restriction enzyme. The DNA-binding specificity of ZFNs can be easily altered experimentally. This easy manipulation of the ZFN recognition specificity enables one to deliver a targeted double-strand break (DSB) to a genome. The targeted DSB stimulates local gene targeting by several orders of magnitude at that specific cut site via homologous recombination (HR). Thus, ZFNs have become an important experimental tool to make site-specific and permanent alterations to genomes of not only plants and mammals but also of many other organisms. Engineering of custom ZFNs involves many steps. The first step is to identify a ZFN site at or near the chosen chromosomal target within the genome to which ZFNs will bind and cut. The second step is to design and/or select various ZFP combinations that will bind to the chosen target site with high specificity and affinity. The DNA coding sequence for the designed ZFPs are then assembled by polymerase chain reaction (PCR) using oligonucleotides. The third step is to fuse the ZFP constructs to the FokI cleavage domain. The ZFNs are then expressed as proteins by using the rabbit reticulocyte in vitro transcription/translation system and the protein products assayed for their DNA cleavage specificity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cairns, S.S.
1987-01-01
In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less
The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.
Sengupta, P K; Lavelle, D E; DeSimone, J
1994-03-01
Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.
Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran
2015-02-06
Gaining access to sequence and structure information of telomere binding proteins helps in understanding the essential biological processes involve in conserved sequence specific interaction between DNA and the proteins. Rice telomere binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix turn helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain but till now there is very less communication on the in silico studies of these complete proteins.Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK web server.Digging up all the facts about the proteins it was reveled that around 120 amino acids in the tail part was showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicates the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and Energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.
Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran
2015-09-01
Gaining access to sequence and structure information of telomere-binding proteins helps in understanding the essential biological processes involve in conserved sequence-specific interaction between DNA and the proteins. Rice telomere-binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix-turn-helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain, but till now there is very less communication on the in silico studies of these complete proteins. Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK Web server. By digging up all the facts about the proteins, it was revealed that around 120 amino acids in the tail part were showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicate the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA-binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.
Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana
2012-09-03
Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.
Arocena, Gastón M.; Sieira, Rodrigo; Comerci, Diego J.; Ugalde, Rodolfo A.
2010-01-01
VjbR is a LuxR-type quorum-sensing (QS) regulator that plays an essential role in the virulence of the intracellular facultative pathogen Brucella, the causative agent of brucellosis. It was previously described that VjbR regulates a diverse group of genes, including the virB operon. The latter codes for a type IV secretion system (T4SS) that is central for the pathogenesis of Brucella. Although the regulatory role of VjbR on the virB promoter (PvirB) was extensively studied by different groups, the VjbR-binding site had not been identified so far. Here, we identified the target DNA sequence of VjbR in PvirB by DNase I footprinting analyses. Surprisingly, we observed that VjbR specifically recognizes a sequence that is identical to a half-binding site of the QS-related regulator MrtR of Mesorhizobium tianshanense. As shown by DNase I footprinting and electrophoretic mobility shift assays, generation of a palindromic MrtR-like-binding site in PvirB increased both the affinity and the stability of the VjbR-DNA complex, which confirmed that the QS regulator of Brucella is highly related to that of M. tianshanense. The addition of N-dodecanoyl homoserine lactone dissociated VjbR from the promoter, which confirmed previous reports that indicated a negative effect of this signal on the VjbR-mediated activation of PvirB. Our results provide new molecular evidence for the structure of the virB promoter and reveal unusual features of the QS target DNA sequence of the main regulator of virulence in Brucella. PMID:20400542
Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong
2017-12-21
An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.
Nair, Maya S; D'Mello, Samar; Pant, Rashmi; Poluri, Krishna Mohan
2017-05-01
Interactions of a natural stilbene compound, resveratrol with two DNA sequences containing AATT/TTAA segments have been studied. Resveratrol is found to interact with both the sequences. The mode of interaction has been studied using absorption, steady state fluorescence and circular dichroism spectroscopic techniques. UV-visible absorption and fluorescence studies provided the information regarding the binding constants and the stoichiometry of binding, whereas circular dichroism studies depicted the structural changes in DNA upon resveratrol binding. Our results evidenced that, though resveratrol showed similar affinity to both the sequences, the mode of interactions was different. The binding constants of resveratrol to AATT/TTAA sequences were found to be 7.55×10 5 M -1 and 5.42×10 5 M -1 respectively. Spectroscopic data evidenced for a groove binding interaction. Melting studies showed that the binding of resveratrol induces differential stability to the DNA sequences d(CGTTAACG) 2 and d(CGAATTCG) 2 . Fluorescence data showed a stoichiometry of 1:1 for d(CGAATTCG) 2 -resveratrol complex and 1:4 for d(CGTTAACG) 2 -resveratrol complex. Molecular docking studies demonstrated that resveratrol binds to the minor groove region of both the sequences to form stable complexes with varied atomic contacts to the DNA bases or backbone. Both the complexes are stabilized by hydrogen bond formation. Our results evidenced that modulation of DNA sequence within the same bases can greatly alter the binding geometry and stability of the complex upon binding to small molecule inhibitor compounds like resveratrol. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
MacArthur, Stewart; Li, Xiao-Yong; Li, Jingyi
2009-05-15
BACKGROUND: We previously established that six sequence-specific transcription factors that initiate anterior/posterior patterning in Drosophila bind to overlapping sets of thousands of genomic regions in blastoderm embryos. While regions bound at high levels include known and probable functional targets, more poorly bound regions are preferentially associated with housekeeping genes and/or genes not transcribed in the blastoderm, and are frequently found in protein coding sequences or in less conserved non-coding DNA, suggesting that many are likely non-functional. RESULTS: Here we show that an additional 15 transcription factors that regulate other aspects of embryo patterning show a similar quantitative continuum of functionmore » and binding to thousands of genomic regions in vivo. Collectively, the 21 regulators show a surprisingly high overlap in the regions they bind given that they belong to 11 DNA binding domain families, specify distinct developmental fates, and can act via different cis-regulatory modules. We demonstrate, however, that quantitative differences in relative levels of binding to shared targets correlate with the known biological and transcriptional regulatory specificities of these factors. CONCLUSIONS: It is likely that the overlap in binding of biochemically and functionally unrelated transcription factors arises from the high concentrations of these proteins in nuclei, which, coupled with their broad DNA binding specificities, directs them to regions of open chromatin. We suggest that most animal transcription factors will be found to show a similar broad overlapping pattern of binding in vivo, with specificity achieved by modulating the amount, rather than the identity, of bound factor.« less
Flexible DNA binding of the BTB/POZ-domain protein FBI-1.
Pessler, Frank; Hernandez, Nouria
2003-08-01
POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.
Dissociation free-energy profiles of specific and nonspecific DNA-protein complexes.
Yonetani, Yoshiteru; Kono, Hidetoshi
2013-06-27
DNA-binding proteins recognize DNA sequences with at least two different binding modes: specific and nonspecific. Experimental structures of such complexes provide us a static view of the bindings. However, it is difficult to reveal further mechanisms of their target-site search and recognition only from static information because the transition process between the bound and unbound states is not clarified by static information. What is the difference between specific and nonspecific bindings? Here we performed adaptive biasing force molecular dynamics simulations with the specific and nonspecific structures of DNA-Lac repressor complexes to investigate the dissociation process. The resultant free-energy profiles showed that the specific complex has a sharp, deep well consistent with tight binding, whereas the nonspecific complex has a broad, shallow well consistent with loose binding. The difference in the well depth, ~5 kcal/mol, was in fair agreement with the experimentally obtained value and was found to mainly come from the protein conformational difference, particularly in the C-terminal tail. Also, the free-energy profiles were found to be correlated with changes in the number of protein-DNA contacts and that of surface water molecules. The derived protein spatial distributions around the DNA indicate that any large dissociation occurs rarely, regardless of the specific and nonspecific sites. Comparison of the free-energy barrier for sliding [~8.7 kcal/mol; Furini J. Phys. Chem. B 2010, 114, 2238] and that for dissociation (at least ~16 kcal/mol) calculated in this study suggests that sliding is much preferred to dissociation.
Klug, Aaron
2010-02-01
A long-standing goal of molecular biologists has been to construct DNA-binding proteins for the control of gene expression. The classical Cys2His2 (C2H2) zinc finger design is ideally suited for such purposes. Discriminating between closely related DNA sequences both in vitro and in vivo, this naturally occurring design was adopted for engineering zinc finger proteins (ZFPs) to target genes specifically. Zinc fingers were discovered in 1985, arising from the interpretation of our biochemical studies on the interaction of the Xenopus protein transcription factor IIIA (TFIIIA) with 5S RNA. Subsequent structural studies revealed its three-dimensional structure and its interaction with DNA. Each finger constitutes a self-contained domain stabilized by a zinc (Zn) ion ligated to a pair of cysteines and a pair of histidines and also by an inner structural hydrophobic core. This discovery showed not only a new protein fold but also a novel principle of DNA recognition. Whereas other DNA-binding proteins generally make use of the 2-fold symmetry of the double helix, functioning as homo- or heterodimers, zinc fingers can be linked linearly in tandem to recognize nucleic acid sequences of varying lengths. This modular design offers a large number of combinatorial possibilities for the specific recognition of DNA (or RNA). It is therefore not surprising that the zinc finger is found widespread in nature, including 3% of the genes of the human genome. The zinc finger design can be used to construct DNA-binding proteins for specific intervention in gene expression. By fusing selected zinc finger peptides to repression or activation domains, genes can be selectively switched off or on by targeting the peptide to the desired gene target. It was also suggested that by combining an appropriate zinc finger peptide with other effector or functional domains, e.g. from nucleases or integrases to form chimaeric proteins, genomes could be modified or manipulated. The first example of the power of the method was published in 1994 when a three-finger protein was constructed to block the expression of a human oncogene transformed into a mouse cell line. The same paper also described how a reporter gene was activated by targeting an inserted 9-base pair (bp) sequence, which acts as the promoter. Thus, by fusing zinc finger peptides to repression or activation domains, genes can be selectively switched off or on. It was also suggested that, by combining zinc fingers with other effector or functional domains, e.g. from nucleases or integrases, to form chimaeric proteins, genomes could be manipulated or modified. Several applications of such engineered ZFPs are described here, including some of therapeutic importance, and also their adaptation for breeding improved crop plants.