Sample records for sequenced coding regions

  1. Correlation approach to identify coding regions in DNA sequences

    NASA Technical Reports Server (NTRS)

    Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1994-01-01

    Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

  2. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

    1995-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  3. Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

    PubMed Central

    Hall, L; Laird, J E; Craig, R K

    1984-01-01

    Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

  4. Phylogenetic Network for European mtDNA

    PubMed Central

    Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari

    2001-01-01

    The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229

  5. Quantized phase coding and connected region labeling for absolute phase retrieval.

    PubMed

    Chen, Xiangcheng; Wang, Yuwei; Wang, Yajun; Ma, Mengchao; Zeng, Chunnian

    2016-12-12

    This paper proposes an absolute phase retrieval method for complex object measurement based on quantized phase-coding and connected region labeling. A specific code sequence is embedded into quantized phase of three coded fringes. Connected regions of different codes are labeled and assigned with 3-digit-codes combining the current period and its neighbors. Wrapped phase, more than 36 periods, can be restored with reference to the code sequence. Experimental results verify the capability of the proposed method to measure multiple isolated objects.

  6. Second-generation sequencing of entire mitochondrial coding-regions (∼15.4 kb) holds promise for study of the phylogeny and taxonomy of human body lice and head lice.

    PubMed

    Xiong, H; Campelo, D; Pollack, R J; Raoult, D; Shao, R; Alem, M; Ali, J; Bilcha, K; Barker, S C

    2014-08-01

    The Illumina Hiseq platform was used to sequence the entire mitochondrial coding-regions of 20 body lice, Pediculus humanus Linnaeus, and head lice, P. capitis De Geer (Phthiraptera: Pediculidae), from eight towns and cities in five countries: Ethiopia, France, China, Australia and the U.S.A. These data (∼310 kb) were used to see how much more informative entire mitochondrial coding-region sequences were than partial mitochondrial coding-region sequences, and thus to guide the design of future studies of the phylogeny, origin, evolution and taxonomy of body lice and head lice. Phylogenies were compared from entire coding-region sequences (∼15.4 kb), entire cox1 (∼1.5 kb), partial cox1 (∼700 bp) and partial cytb (∼600 bp) sequences. On the one hand, phylogenies from entire mitochondrial coding-region sequences (∼15.4 kb) were much more informative than phylogenies from entire cox1 sequences (∼1.5 kb) and partial gene sequences (∼600 to ∼700 bp). For example, 19 branches had > 95% bootstrap support in our maximum likelihood tree from the entire mitochondrial coding-regions (∼15.4 kb) whereas the tree from 700 bp cox1 had only two branches with bootstrap support > 95%. Yet, by contrast, partial cytb (∼600 bp) and partial cox1 (∼486 bp) sequences were sufficient to genotype lice to Clade A, B or C. The sequences of the mitochondrial genomes of the P. humanus, P. capitis and P. schaeffi Fahrenholz studied are in NCBI GenBank under the accession numbers KC660761-800, KC685631-6330, KC241882-97, EU219988-95, HM241895-8 and JX080388-407. © 2014 The Royal Entomological Society.

  7. A common class of transcripts with 5'-intron depletion, distinct early coding sequence features, and N1-methyladenosine modification.

    PubMed

    Cenik, Can; Chua, Hon Nian; Singh, Guramrit; Akef, Abdalla; Snyder, Michael P; Palazzo, Alexander F; Moore, Melissa J; Roth, Frederick P

    2017-03-01

    Introns are found in 5' untranslated regions (5'UTRs) for 35% of all human transcripts. These 5'UTR introns are not randomly distributed: Genes that encode secreted, membrane-bound and mitochondrial proteins are less likely to have them. Curiously, transcripts lacking 5'UTR introns tend to harbor specific RNA sequence elements in their early coding regions. To model and understand the connection between coding-region sequence and 5'UTR intron status, we developed a classifier that can predict 5'UTR intron status with >80% accuracy using only sequence features in the early coding region. Thus, the classifier identifies transcripts with 5 ' proximal- i ntron- m inus-like-coding regions ("5IM" transcripts). Unexpectedly, we found that the early coding sequence features defining 5IM transcripts are widespread, appearing in 21% of all human RefSeq transcripts. The 5IM class of transcripts is enriched for non-AUG start codons, more extensive secondary structure both preceding the start codon and near the 5' cap, greater dependence on eIF4E for translation, and association with ER-proximal ribosomes. 5IM transcripts are bound by the exon junction complex (EJC) at noncanonical 5' proximal positions. Finally, N 1 -methyladenosines are specifically enriched in the early coding regions of 5IM transcripts. Taken together, our analyses point to the existence of a distinct 5IM class comprising ∼20% of human transcripts. This class is defined by depletion of 5' proximal introns, presence of specific RNA sequence features associated with low translation efficiency, N 1 -methyladenosines in the early coding region, and enrichment for noncanonical binding by the EJC. © 2017 Cenik et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  8. Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

    PubMed

    Suyama, Mikita; Lathe, Warren C; Bork, Peer

    2005-10-10

    We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

  9. The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea

    PubMed Central

    Oh, Chang Seok; Lee, Soong Deok; Kim, Yi-Suk; Shin, Dong Hoon

    2015-01-01

    Previous study showed that East Asian mtDNA haplogroups, especially those of Koreans, could be successfully assigned by the coupled use of analyses on coding region SNP markers and control region mutation motifs. In this study, we tried to see if the same triple multiplex analysis for coding regions SNPs could be also applicable to ancient samples from East Asia as the complementation for sequence analysis of mtDNA control region. By the study on Joseon skeleton samples, we know that mtDNA haplogroup determined by coding region SNP markers successfully falls within the same haplogroup that sequence analysis on control region can assign. Considering that ancient samples in previous studies make no small number of errors in control region mtDNA sequencing, coding region SNP analysis can be used as good complimentary to the conventional haplogroup determination, especially of archaeological human bone samples buried underground over long periods. PMID:26345190

  10. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    NASA Technical Reports Server (NTRS)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  11. Variability and transmission by Aphis glycines of North American and Asian Soybean mosaic virus isolates.

    PubMed

    Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L

    2003-10-01

    The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.

  12. A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

    PubMed

    Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

    2015-01-01

    The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

  13. Outbreak of poliomyelitis in Finland in 1984-85 - Re-analysis of viral sequences using the current standard approach.

    PubMed

    Simonen, Marja-Leena; Roivainen, Merja; Iber, Jane; Burns, Cara; Hovi, Tapani

    2010-01-01

    In 1984, a wild type 3 poliovirus (PV3/FIN84) spread all over Finland causing nine cases of paralytic poliomyelitis and one case of aseptic meningitis. The outbreak was ended in 1985 with an intensive vaccination campaign. By limited sequence comparison with previously isolated PV3 strains, closest relatives of PV3/FIN84 were found among strains circulating in the Mediterranean region. Now we wanted to reanalyse the relationships using approaches currently exploited in poliovirus surveillance. Cell lysates of 22 strains isolated during the outbreak and stored frozen were subjected to RT-PCR amplification in three genomic regions without prior subculture. Sequences of the entire VP1 coding region, 150 nucleotides in the VP1-2A junction, most of the 5' non-coding region, partial sequences of the 3D RNA polymerase coding region and partial 3' non-coding region were compared within the outbreak and with sequences available in data banks. In addition, complete nucleotide sequences were obtained for 2 strains isolated from two different cases of disease during the outbreak. The results confirmed the previously described wide intraepidemic variation of the strains, including amino acid substitutions in antigenic sites, as well as the likely Mediterranean region origin of the strains. Simplot and bootscanning analyses of the complete genomes indicated complicated evolutionary history of the non-capsid coding regions of the genome suggesting several recombinations with different HEV-C viruses in the past.

  14. Scaling features of noncoding DNA

    NASA Technical Reports Server (NTRS)

    Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.

    1999-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

  15. CRITICA: coding region identification tool invoking comparative analysis

    NASA Technical Reports Server (NTRS)

    Badger, J. H.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

    1999-01-01

    Gene recognition is essential to understanding existing and future DNA sequence data. CRITICA (Coding Region Identification Tool Invoking Comparative Analysis) is a suite of programs for identifying likely protein-coding sequences in DNA by combining comparative analysis of DNA sequences with more common noncomparative methods. In the comparative component of the analysis, regions of DNA are aligned with related sequences from the DNA databases; if the translation of the aligned sequences has greater amino acid identity than expected for the observed percentage nucleotide identity, this is interpreted as evidence for coding. CRITICA also incorporates noncomparative information derived from the relative frequencies of hexanucleotides in coding frames versus other contexts (i.e., dicodon bias). The dicodon usage information is derived by iterative analysis of the data, such that CRITICA is not dependent on the existence or accuracy of coding sequence annotations in the databases. This independence makes the method particularly well suited for the analysis of novel genomes. CRITICA was tested by analyzing the available Salmonella typhimurium DNA sequences. Its predictions were compared with the DNA sequence annotations and with the predictions of GenMark. CRITICA proved to be more accurate than GenMark, and moreover, many of its predictions that would seem to be errors instead reflect problems in the sequence databases. The source code of CRITICA is freely available by anonymous FTP (rdp.life.uiuc.edu in/pub/critica) and on the World Wide Web (http:/(/)rdpwww.life.uiuc.edu).

  16. Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

    PubMed

    Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

    2016-03-01

    Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

  17. Detecting the borders between coding and non-coding DNA regions in prokaryotes based on recursive segmentation and nucleotide doublets statistics

    PubMed Central

    2012-01-01

    Background Detecting the borders between coding and non-coding regions is an essential step in the genome annotation. And information entropy measures are useful for describing the signals in genome sequence. However, the accuracies of previous methods of finding borders based on entropy segmentation method still need to be improved. Methods In this study, we first applied a new recursive entropic segmentation method on DNA sequences to get preliminary significant cuts. A 22-symbol alphabet is used to capture the differential composition of nucleotide doublets and stop codon patterns along three phases in both DNA strands. This process requires no prior training datasets. Results Comparing with the previous segmentation methods, the experimental results on three bacteria genomes, Rickettsia prowazekii, Borrelia burgdorferi and E.coli, show that our approach improves the accuracy for finding the borders between coding and non-coding regions in DNA sequences. Conclusions This paper presents a new segmentation method in prokaryotes based on Jensen-Rényi divergence with a 22-symbol alphabet. For three bacteria genomes, comparing to A12_JR method, our method raised the accuracy of finding the borders between protein coding and non-coding regions in DNA sequences. PMID:23282225

  18. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

    PubMed Central

    Pietan, Lucas L.; Spradling, Theresa A.

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  19. Functional interrogation of non-coding DNA through CRISPR genome editing

    PubMed Central

    Canver, Matthew C.; Bauer, Daniel E.; Orkin, Stuart H.

    2017-01-01

    Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. PMID:28288828

  20. Genomic Sequence around Butterfly Wing Development Genes: Annotation and Comparative Analysis

    PubMed Central

    Conceição, Inês C.; Long, Anthony D.; Gruber, Jonathan D.; Beldade, Patrícia

    2011-01-01

    Background Analysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available despite the unique genetic and biological properties of this group, such as diversified wing color patterns. The evolution and development of these patterns is being studied in a few target species, including Bicyclus anynana, where a whole-genome BAC library allows targeted access to large genomic regions. Methodology/Principal Findings We characterize ∼1.3 Mb of genomic sequence around 11 selected genes expressed in B. anynana developing wings. Extensive manual curation of in silico predictions, also making use of a large dataset of expressed genes for this species, identified repetitive elements and protein coding sequence, and highlighted an expansion of Alcohol dehydrogenase genes. Comparative analysis with orthologous regions of the lepidopteran reference genome allowed assessment of conservation of fine-scale synteny (with detection of new inversions and translocations) and of DNA sequence (with detection of high levels of conservation of non-coding regions around some, but not all, developmental genes). Conclusions The general properties and organization of the available B. anynana genomic sequence are similar to the lepidopteran reference, despite the more than 140 MY divergence. Our results lay the groundwork for further studies of new interesting findings in relation to both coding and non-coding sequence: 1) the Alcohol dehydrogenase expansion with higher similarity between the five tandemly-repeated B. anynana paralogs than with the corresponding B. mori orthologs, and 2) the high conservation of non-coding sequence around the genes wingless and Ecdysone receptor, both involved in multiple developmental processes including wing pattern formation. PMID:21909358

  1. Different evolutionary patterns of SNPs between domains and unassigned regions in human protein-coding sequences.

    PubMed

    Pang, Erli; Wu, Xiaomei; Lin, Kui

    2016-06-01

    Protein evolution plays an important role in the evolution of each genome. Because of their functional nature, in general, most of their parts or sites are differently constrained selectively, particularly by purifying selection. Most previous studies on protein evolution considered individual proteins in their entirety or compared protein-coding sequences with non-coding sequences. Less attention has been paid to the evolution of different parts within each protein of a given genome. To this end, based on PfamA annotation of all human proteins, each protein sequence can be split into two parts: domains or unassigned regions. Using this rationale, single nucleotide polymorphisms (SNPs) in protein-coding sequences from the 1000 Genomes Project were mapped according to two classifications: SNPs occurring within protein domains and those within unassigned regions. With these classifications, we found: the density of synonymous SNPs within domains is significantly greater than that of synonymous SNPs within unassigned regions; however, the density of non-synonymous SNPs shows the opposite pattern. We also found there are signatures of purifying selection on both the domain and unassigned regions. Furthermore, the selective strength on domains is significantly greater than that on unassigned regions. In addition, among all of the human protein sequences, there are 117 PfamA domains in which no SNPs are found. Our results highlight an important aspect of protein domains and may contribute to our understanding of protein evolution.

  2. Functional interrogation of non-coding DNA through CRISPR genome editing.

    PubMed

    Canver, Matthew C; Bauer, Daniel E; Orkin, Stuart H

    2017-05-15

    Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. CombAlign: a code for generating a one-to-many sequence alignment from a set of pairwise structure-based sequence alignments.

    PubMed

    Zhou, Carol L Ecale

    2015-01-01

    In order to better define regions of similarity among related protein structures, it is useful to identify the residue-residue correspondences among proteins. Few codes exist for constructing a one-to-many multiple sequence alignment derived from a set of structure or sequence alignments, and a need was evident for creating such a tool for combining pairwise structure alignments that would allow for insertion of gaps in the reference structure. This report describes a new Python code, CombAlign, which takes as input a set of pairwise sequence alignments (which may be structure based) and generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA). The use and utility of CombAlign was demonstrated by generating gapped MSSAs using sets of pairwise structure-based sequence alignments between structure models of the matrix protein (VP40) and pre-small/secreted glycoprotein (sGP) of Reston Ebolavirus and the corresponding proteins of several other filoviruses. The gapped MSSAs revealed structure-based residue-residue correspondences, which enabled identification of structurally similar versus differing regions in the Reston proteins compared to each of the other corresponding proteins. CombAlign is a new Python code that generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA) given a set of pairwise sequence alignments (which may be structure based). CombAlign has utility in assisting the user in distinguishing structurally conserved versus divergent regions on a reference protein structure relative to other closely related proteins. CombAlign was developed in Python 2.6, and the source code is available for download from the GitHub code repository.

  4. Complete mitochondrial genome of the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae).

    PubMed

    Kim, Min Jee; Im, Hyun Hwak; Lee, Kwang Youll; Han, Yeon Soo; Kim, Iksoo

    2014-06-01

    Abstract The complete nucleotide sequences of the mitochondrial genome from the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae), was determined. The 20,319-bp long circular genome is the longest among completely sequenced Coleoptera. As is typical in animals, the P. brevitarsis genome consisted of two ribosomal RNAs, 22 transfer RNAs, 13 protein-coding genes and one A + T-rich region. Although the size of the coding genes was typical, the non-coding A + T-rich region was 5654 bp, which is the longest in insects. The extraordinary length of this region was composed of 28,117-bp tandem repeats and 782-bp tandem repeats. These repeat sequences were encompassed by three non-repeat sequences constituting 1804 bp.

  5. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region.

    PubMed

    Kress, W John; Erickson, David L

    2007-06-06

    A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination.

  6. RAMICS: trainable, high-speed and biologically relevant alignment of high-throughput sequencing reads to coding DNA

    PubMed Central

    Wright, Imogen A.; Travers, Simon A.

    2014-01-01

    The challenge presented by high-throughput sequencing necessitates the development of novel tools for accurate alignment of reads to reference sequences. Current approaches focus on using heuristics to map reads quickly to large genomes, rather than generating highly accurate alignments in coding regions. Such approaches are, thus, unsuited for applications such as amplicon-based analysis and the realignment phase of exome sequencing and RNA-seq, where accurate and biologically relevant alignment of coding regions is critical. To facilitate such analyses, we have developed a novel tool, RAMICS, that is tailored to mapping large numbers of sequence reads to short lengths (<10 000 bp) of coding DNA. RAMICS utilizes profile hidden Markov models to discover the open reading frame of each sequence and aligns to the reference sequence in a biologically relevant manner, distinguishing between genuine codon-sized indels and frameshift mutations. This approach facilitates the generation of highly accurate alignments, accounting for the error biases of the sequencing machine used to generate reads, particularly at homopolymer regions. Performance improvements are gained through the use of graphics processing units, which increase the speed of mapping through parallelization. RAMICS substantially outperforms all other mapping approaches tested in terms of alignment quality while maintaining highly competitive speed performance. PMID:24861618

  7. RNAcode: Robust discrimination of coding and noncoding regions in comparative sequence data

    PubMed Central

    Washietl, Stefan; Findeiß, Sven; Müller, Stephan A.; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L.; Stadler, Peter F.; Goldman, Nick

    2011-01-01

    With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied “out of the box,” without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as “noncoding.” RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode. PMID:21357752

  8. RNAcode: robust discrimination of coding and noncoding regions in comparative sequence data.

    PubMed

    Washietl, Stefan; Findeiss, Sven; Müller, Stephan A; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L; Stadler, Peter F; Goldman, Nick

    2011-04-01

    With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied "out of the box," without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as "noncoding." RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode.

  9. Expressed gene sequence of the IFN-gamma-response chemokine CXCL9 of cattle, horses, and swine

    USDA-ARS?s Scientific Manuscript database

    This report describes the cloning and characterization of expressed gene sequences of bovine, equine, and swine CXCL9 from RNA obtained from peripheral blood mononuclear cell (PBMC) or other tissues. The bovine coding region was 378 nucleotides in length, while the equine and swine coding regions w...

  10. Statistical and linguistic features of DNA sequences

    NASA Technical Reports Server (NTRS)

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  11. Intact coding region of the serotonin transporter gene in obsessive-compulsive disorder

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Altemus, M.; Murphy, D.L.; Greenberg, B.

    1996-07-26

    Epidemiologic studies indicate that obsessive-compulsive disorder is genetically transmitted in some families, although no genetic abnormalities have been identified in individuals with this disorder. The selective response of obsessive-compulsive disorder to treatment with agents which block serotonin reuptake suggests the gene coding for the serotonin transporter as a candidate gene. The primary structure of the serotonin-transporter coding region was sequenced in 22 patients with obsessive-compulsive disorder, using direct PCR sequencing of cDNA synthesized from platelet serotonin-transporter mRNA. No variations in amino acid sequence were found among the obsessive-compulsive disorder patients or healthy controls. These results do not support a rolemore » for alteration in the primary structure of the coding region of the serotonin-transporter gene in the pathogenesis of obsessive-compulsive disorder. 27 refs.« less

  12. Novel variants of the 5S rRNA genes in Eruca sativa.

    PubMed

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. RRE: a tool for the extraction of non-coding regions surrounding annotated genes from genomic datasets.

    PubMed

    Lazzarato, F; Franceschinis, G; Botta, M; Cordero, F; Calogero, R A

    2004-11-01

    RRE allows the extraction of non-coding regions surrounding a coding sequence [i.e. gene upstream region, 5'-untranslated region (5'-UTR), introns, 3'-UTR, downstream region] from annotated genomic datasets available at NCBI. RRE parser and web-based interface are accessible at http://www.bioinformatica.unito.it/bioinformatics/rre/rre.html

  14. Identification of coding and non-coding mutational hotspots in cancer genomes.

    PubMed

    Piraino, Scott W; Furney, Simon J

    2017-01-05

    The identification of mutations that play a causal role in tumour development, so called "driver" mutations, is of critical importance for understanding how cancers form and how they might be treated. Several large cancer sequencing projects have identified genes that are recurrently mutated in cancer patients, suggesting a role in tumourigenesis. While the landscape of coding drivers has been extensively studied and many of the most prominent driver genes are well characterised, comparatively less is known about the role of mutations in the non-coding regions of the genome in cancer development. The continuing fall in genome sequencing costs has resulted in a concomitant increase in the number of cancer whole genome sequences being produced, facilitating systematic interrogation of both the coding and non-coding regions of cancer genomes. To examine the mutational landscapes of tumour genomes we have developed a novel method to identify mutational hotspots in tumour genomes using both mutational data and information on evolutionary conservation. We have applied our methodology to over 1300 whole cancer genomes and show that it identifies prominent coding and non-coding regions that are known or highly suspected to play a role in cancer. Importantly, we applied our method to the entire genome, rather than relying on predefined annotations (e.g. promoter regions) and we highlight recurrently mutated regions that may have resulted from increased exposure to mutational processes rather than selection, some of which have been identified previously as targets of selection. Finally, we implicate several pan-cancer and cancer-specific candidate non-coding regions, which could be involved in tumourigenesis. We have developed a framework to identify mutational hotspots in cancer genomes, which is applicable to the entire genome. This framework identifies known and novel coding and non-coding mutional hotspots and can be used to differentiate candidate driver regions from likely passenger regions susceptible to somatic mutation.

  15. A Two-Locus Global DNA Barcode for Land Plants: The Coding rbcL Gene Complements the Non-Coding trnH-psbA Spacer Region

    PubMed Central

    Kress, W. John; Erickson, David L.

    2007-01-01

    Background A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Methodology/Principal Findings Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. Conclusions/Significance A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination. PMID:17551588

  16. Two-terminal video coding.

    PubMed

    Yang, Yang; Stanković, Vladimir; Xiong, Zixiang; Zhao, Wei

    2009-03-01

    Following recent works on the rate region of the quadratic Gaussian two-terminal source coding problem and limit-approaching code designs, this paper examines multiterminal source coding of two correlated, i.e., stereo, video sequences to save the sum rate over independent coding of both sequences. Two multiterminal video coding schemes are proposed. In the first scheme, the left sequence of the stereo pair is coded by H.264/AVC and used at the joint decoder to facilitate Wyner-Ziv coding of the right video sequence. The first I-frame of the right sequence is successively coded by H.264/AVC Intracoding and Wyner-Ziv coding. An efficient stereo matching algorithm based on loopy belief propagation is then adopted at the decoder to produce pixel-level disparity maps between the corresponding frames of the two decoded video sequences on the fly. Based on the disparity maps, side information for both motion vectors and motion-compensated residual frames of the right sequence are generated at the decoder before Wyner-Ziv encoding. In the second scheme, source splitting is employed on top of classic and Wyner-Ziv coding for compression of both I-frames to allow flexible rate allocation between the two sequences. Experiments with both schemes on stereo video sequences using H.264/AVC, LDPC codes for Slepian-Wolf coding of the motion vectors, and scalar quantization in conjunction with LDPC codes for Wyner-Ziv coding of the residual coefficients give a slightly lower sum rate than separate H.264/AVC coding of both sequences at the same video quality.

  17. Comparative analysis of complete chloroplast genome sequence and inversion variation in Lasthenia burkei (Madieae, Asteraceae).

    PubMed

    Walker, Joseph F; Zanis, Michael J; Emery, Nancy C

    2014-04-01

    Complete chloroplast genome studies can help resolve relationships among large, complex plant lineages such as Asteraceae. We present the first whole plastome from the Madieae tribe and compare its sequence variation to other chloroplast genomes in Asteraceae. We used high throughput sequencing to obtain the Lasthenia burkei chloroplast genome. We compared sequence structure and rates of molecular evolution in the small single copy (SSC), large single copy (LSC), and inverted repeat (IR) regions to those for eight Asteraceae accessions and one Solanaceae accession. The chloroplast sequence of L. burkei is 150 746 bp and contains 81 unique protein coding genes and 4 coding ribosomal RNA sequences. We identified three major inversions in the L. burkei chloroplast, all of which have been found in other Asteraceae lineages, and a previously unreported inversion in Lactuca sativa. Regions flanking inversions contained tRNA sequences, but did not have particularly high G + C content. Substitution rates varied among the SSC, LSC, and IR regions, and rates of evolution within each region varied among species. Some observed differences in rates of molecular evolution may be explained by the relative proportion of coding to noncoding sequence within regions. Rates of molecular evolution vary substantially within and among chloroplast genomes, and major inversion events may be promoted by the presence of tRNAs. Collectively, these results provide insight into different mechanisms that may promote intramolecular recombination and the inversion of large genomic regions in the plastome.

  18. Discrete Ramanujan transform for distinguishing the protein coding regions from other regions.

    PubMed

    Hua, Wei; Wang, Jiasong; Zhao, Jian

    2014-01-01

    Based on the study of Ramanujan sum and Ramanujan coefficient, this paper suggests the concepts of discrete Ramanujan transform and spectrum. Using Voss numerical representation, one maps a symbolic DNA strand as a numerical DNA sequence, and deduces the discrete Ramanujan spectrum of the numerical DNA sequence. It is well known that of discrete Fourier power spectrum of protein coding sequence has an important feature of 3-base periodicity, which is widely used for DNA sequence analysis by the technique of discrete Fourier transform. It is performed by testing the signal-to-noise ratio at frequency N/3 as a criterion for the analysis, where N is the length of the sequence. The results presented in this paper show that the property of 3-base periodicity can be only identified as a prominent spike of the discrete Ramanujan spectrum at period 3 for the protein coding regions. The signal-to-noise ratio for discrete Ramanujan spectrum is defined for numerical measurement. Therefore, the discrete Ramanujan spectrum and the signal-to-noise ratio of a DNA sequence can be used for distinguishing the protein coding regions from the noncoding regions. All the exon and intron sequences in whole chromosomes 1, 2, 3 and 4 of Caenorhabditis elegans have been tested and the histograms and tables from the computational results illustrate the reliability of our method. In addition, we have analyzed theoretically and gotten the conclusion that the algorithm for calculating discrete Ramanujan spectrum owns the lower computational complexity and higher computational accuracy. The computational experiments show that the technique by using discrete Ramanujan spectrum for classifying different DNA sequences is a fast and effective method. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. RAMICS: trainable, high-speed and biologically relevant alignment of high-throughput sequencing reads to coding DNA.

    PubMed

    Wright, Imogen A; Travers, Simon A

    2014-07-01

    The challenge presented by high-throughput sequencing necessitates the development of novel tools for accurate alignment of reads to reference sequences. Current approaches focus on using heuristics to map reads quickly to large genomes, rather than generating highly accurate alignments in coding regions. Such approaches are, thus, unsuited for applications such as amplicon-based analysis and the realignment phase of exome sequencing and RNA-seq, where accurate and biologically relevant alignment of coding regions is critical. To facilitate such analyses, we have developed a novel tool, RAMICS, that is tailored to mapping large numbers of sequence reads to short lengths (<10 000 bp) of coding DNA. RAMICS utilizes profile hidden Markov models to discover the open reading frame of each sequence and aligns to the reference sequence in a biologically relevant manner, distinguishing between genuine codon-sized indels and frameshift mutations. This approach facilitates the generation of highly accurate alignments, accounting for the error biases of the sequencing machine used to generate reads, particularly at homopolymer regions. Performance improvements are gained through the use of graphics processing units, which increase the speed of mapping through parallelization. RAMICS substantially outperforms all other mapping approaches tested in terms of alignment quality while maintaining highly competitive speed performance. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

    PubMed Central

    Gustafson, G; Armour, S L

    1986-01-01

    The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

  1. Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

    PubMed Central

    Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

    2006-01-01

    Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

  2. The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes.

    PubMed Central

    Fletcher, Simon P; Ali, Iraj K; Kaminski, Ann; Digard, Paul; Jackson, Richard J

    2002-01-01

    Classical swine fever virus (CSFV) is a member of the pestivirus family, which shares many features in common with hepatitis C virus (HCV). It is shown here that CSFV has an exceptionally efficient cis-acting internal ribosome entry segment (IRES), which, like that of HCV, is strongly influenced by the sequences immediately downstream of the initiation codon, and is optimal with viral coding sequences in this position. Constructs that retained 17 or more codons of viral coding sequence exhibited full IRES activity, but with only 12 codons, activity was approximately 66% of maximum in vitro (though close to maximum in transfected BHK cells), whereas with just 3 codons or fewer, the activity was only approximately 15% of maximum. The minimal coding region elements required for high activity were exchanged between HCV and CSFV. Although maximum activity was observed in each case with the homologous combination of coding region and 5' UTR, the heterologous combinations were sufficiently active to rule out a highly specific functional interplay between the 5' UTR and coding sequences. On the other hand, inversion of the coding sequences resulted in low IRES activity, particularly with the HCV coding sequences. RNA structure probing showed that the efficiency of internal initiation of these chimeric constructs correlated most closely with the degree of single-strandedness of the region around and immediately downstream of the initiation codon. The low activity IRESs could not be rescued by addition of supplementary eIF4A (the initiation factor with ATP-dependent RNA helicase activity). The extreme sensitivity to secondary structure around the initiation codon is likely to be due to the fact that the eIF4F complex (which has eIF4A as one of its subunits) is not required for and does not participate in initiation on these IRESs. PMID:12515388

  3. Next-generation sequencing of the Trichinella murrelli mitochondrial genome allows comprehensive comparison of its divergence from the principal agent of human trichinellosis, Trichinella spiralis.

    PubMed

    Webb, Kristen M; Rosenthal, Benjamin M

    2011-01-01

    The mitochondrial genome's non-recombinant mode of inheritance and relatively rapid rate of evolution has promoted its use as a marker for studying the biogeographic history and evolutionary interrelationships among many metazoan species. A modest portion of the mitochondrial genome has been defined for 12 species and genotypes of parasites in the genus Trichinella, but its adequacy in representing the mitochondrial genome as a whole remains unclear, as the complete coding sequence has been characterized only for Trichinella spiralis. Here, we sought to comprehensively describe the extent and nature of divergence between the mitochondrial genomes of T. spiralis (which poses the most appreciable zoonotic risk owing to its capacity to establish persistent infections in domestic pigs) and Trichinella murrelli (which is the most prevalent species in North American wildlife hosts, but which poses relatively little risk to the safety of pork). Next generation sequencing methodologies and scaffold and de novo assembly strategies were employed. The entire protein-coding region was sequenced (13,917 bp), along with a portion of the highly repetitive non-coding region (1524 bp) of the mitochondrial genome of T. murrelli with a combined average read depth of 250 reads. The accuracy of base calling, estimated from coding region sequence was found to exceed 99.3%. Genome content and gene order was not found to be significantly different from that of T. spiralis. An overall inter-species sequence divergence of 9.5% was estimated. Significant variation was identified when the amount of variation between species at each gene is compared to the average amount of variation between species across the coding region. Next generation sequencing is a highly effective means to obtain previously unknown mitochondrial genome sequence. Particular to parasites, the extremely deep coverage achieved through this method allows for the detection of sequence heterogeneity between the multiple individuals that necessarily comprise such templates. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Sequences of 95 human MHC haplotypes reveal extreme coding variation in genes other than highly polymorphic HLA class I and II

    PubMed Central

    Norman, Paul J.; Norberg, Steven J.; Guethlein, Lisbeth A.; Nemat-Gorgani, Neda; Royce, Thomas; Wroblewski, Emily E.; Dunn, Tamsen; Mann, Tobias; Alicata, Claudia; Hollenbach, Jill A.; Chang, Weihua; Shults Won, Melissa; Gunderson, Kevin L.; Abi-Rached, Laurent; Ronaghi, Mostafa; Parham, Peter

    2017-01-01

    The most polymorphic part of the human genome, the MHC, encodes over 160 proteins of diverse function. Half of them, including the HLA class I and II genes, are directly involved in immune responses. Consequently, the MHC region strongly associates with numerous diseases and clinical therapies. Notoriously, the MHC region has been intractable to high-throughput analysis at complete sequence resolution, and current reference haplotypes are inadequate for large-scale studies. To address these challenges, we developed a method that specifically captures and sequences the 4.8-Mbp MHC region from genomic DNA. For 95 MHC homozygous cell lines we assembled, de novo, a set of high-fidelity contigs and a sequence scaffold, representing a mean 98% of the target region. Included are six alternative MHC reference sequences of the human genome that we completed and refined. Characterization of the sequence and structural diversity of the MHC region shows the approach accurately determines the sequences of the highly polymorphic HLA class I and HLA class II genes and the complex structural diversity of complement factor C4A/C4B. It has also uncovered extensive and unexpected diversity in other MHC genes; an example is MUC22, which encodes a lung mucin and exhibits more coding sequence alleles than any HLA class I or II gene studied here. More than 60% of the coding sequence alleles analyzed were previously uncharacterized. We have created a substantial database of robust reference MHC haplotype sequences that will enable future population scale studies of this complicated and clinically important region of the human genome. PMID:28360230

  5. The complete chloroplast genome of Cinnamomum camphora and its comparison with related Lauraceae species.

    PubMed

    Chen, Caihui; Zheng, Yongjie; Liu, Sian; Zhong, Yongda; Wu, Yanfang; Li, Jiang; Xu, Li-An; Xu, Meng

    2017-01-01

    Cinnamomum camphora , a member of the Lauraceae family, is a valuable aromatic and timber tree that is indigenous to the south of China and Japan. All parts of Cinnamomum camphora have secretory cells containing different volatile chemical compounds that are utilized as herbal medicines and essential oils. Here, we reported the complete sequencing of the chloroplast genome of Cinnamomum camphora using illumina technology. The chloroplast genome of Cinnamomum camphora is 152,570 bp in length and characterized by a relatively conserved quadripartite structure containing a large single copy region of 93,705 bp, a small single copy region of 19,093 bp and two inverted repeat (IR) regions of 19,886 bp. Overall, the genome contained 123 coding regions, of which 15 were repeated in the IR regions. An analysis of chloroplast sequence divergence revealed that the small single copy region was highly variable among the different genera in the Lauraceae family. A total of 40 repeat structures and 83 simple sequence repeats were detected in both the coding and non-coding regions. A phylogenetic analysis indicated that Calycanthus is most closely related to Lauraceae , both being members of Laurales , which forms a sister group to Magnoliids . The complete sequence of the chloroplast of Cinnamomum camphora will aid in in-depth taxonomical studies of the Lauraceae family in the future. The genetic sequence information will also have valuable applications for chloroplast genetic engineering.

  6. The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

    PubMed

    Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

    2018-05-17

    Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Tenebrio molitor antifreeze protein gene identification and regulation.

    PubMed

    Qin, Wensheng; Walker, Virginia K

    2006-02-15

    The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

  8. A Sabin 2-related poliovirus recombinant contains a homologous sequence of human enterovirus species C in the viral polymerase coding region.

    PubMed

    Zhang, Yong; Zhang, Fan; Zhu, Shuangli; Chen, Li; Yan, Dongmei; Wang, Dongyan; Tang, Ruiyan; Zhu, Hui; Hou, Xiaohui; An, Hongqiu; Zhang, Hong; Xu, Wenbo

    2010-02-01

    A type 2 vaccine-related poliovirus (strain CHN3024), differing from the Sabin 2 strain by 0.44% in the VP1 coding region was isolated from a patient with vaccine-associated paralytic poliomyelitis. Sequences downstream of nucleotide position 6735 (3D(pol) coding region) were derived from an unidentified sequence; no close match for a potential parent was found, but it could be classified into a non-polio human enteroviruses species C (HEV-C) phylogeny. The virus differed antigenically from the parental Sabin strain, having an amino acid substitution in the neutralizing antigenic site 1. The similarity between CHN3024 and Sabin 2 sequences suggests that the recombination was recent; this is supported by the estimation that the initiating OPV dose was given only 36-75 days before sampling. The patient's clinical manifestations, intratypic differentiation examination, and whole-genome sequencing showed that this recombinant exhibited characteristics of neurovirulent vaccine-derived polioviruses (VDPV), which may, thus, pose a potential threat to a polio-free world.

  9. A candidate gene for choanal atresia in alpaca.

    PubMed

    Reed, Kent M; Bauer, Miranda M; Mendoza, Kristelle M; Armién, Aníbal G

    2010-03-01

    Choanal atresia (CA) is a common nasal craniofacial malformation in New World domestic camelids (alpaca and llama). CA results from abnormal development of the nasal passages and is especially debilitating to newborn crias. CA in camelids shares many of the clinical manifestations of a similar condition in humans (CHARGE syndrome). Herein we report on the regulatory gene CHD7 of alpaca, whose homologue in humans is most frequently associated with CHARGE. Sequence of the CHD7 coding region was obtained from a non-affected cria. The complete coding region was 9003 bp, corresponding to a translated amino acid sequence of 3000 aa. Additional genomic sequences corresponding to a significant portion of the CHD7 gene were identified and assembled from the 2x alpaca whole genome sequence, providing confirmatory sequence for much of the CHD7 coding region. The alpaca CHD7 mRNA sequence was 97.9% similar to the human sequence, with the greatest sequence difference being an insertion in exon 38 that results in a polyalanine repeat (A12). Polymorphism in this repeat was tested for association with CA in alpaca by cloning and sequencing the repeat from both affected and non-affected individuals. Variation in length of the poly-A repeat was not associated with CA. Complete sequencing of the CHD7 gene will be necessary to determine whether other mutations in CHD7 are the cause of CA in camelids.

  10. Complete chloroplast genome sequence of MD-2 pineapple and its comparative analysis among nine other plants from the subclass Commelinidae.

    PubMed

    Redwan, R M; Saidin, A; Kumar, S V

    2015-08-12

    Pineapple (Ananas comosus var. comosus) is known as the king of fruits for its crown and is the third most important tropical fruit after banana and citrus. The plant, which is indigenous to South America, is the most important species in the Bromeliaceae family and is largely traded for fresh fruit consumption. Here, we report the complete chloroplast sequence of the MD-2 pineapple that was sequenced using the PacBio sequencing technology. In this study, the high error rate of PacBio long sequence reads of A. comosus's total genomic DNA were improved by leveraging on the high accuracy but short Illumina reads for error-correction via the latest error correction module from Novocraft. Error corrected long PacBio reads were assembled by using a single tool to produce a contig representing the pineapple chloroplast genome. The genome of 159,636 bp in length is featured with the conserved quadripartite structure of chloroplast containing a large single copy region (LSC) with a size of 87,482 bp, a small single copy region (SSC) with a size of 18,622 bp and two inverted repeat regions (IRA and IRB) each with the size of 26,766 bp. Overall, the genome contained 117 unique coding regions and 30 were repeated in the IR region with its genes contents, structure and arrangement similar to its sister taxon, Typha latifolia. A total of 35 repeats structure were detected in both the coding and non-coding regions with a majority being tandem repeats. In addition, 205 SSRs were detected in the genome with six protein-coding genes contained more than two SSRs. Comparative chloroplast genomes from the subclass Commelinidae revealed a conservative protein coding gene albeit located in a highly divergence region. Analysis of selection pressure on protein-coding genes using Ka/Ks ratio showed significant positive selection exerted on the rps7 gene of the pineapple chloroplast with P less than 0.05. Phylogenetic analysis confirmed the recent taxonomical relation among the member of commelinids which support the monophyly relationship between Arecales and Dasypogonaceae and between Zingiberales to the Poales, which includes the A. comosus. The complete sequence of the chloroplast of pineapple provides insights to the divergence of genic chloroplast sequences from the members of the subclass Commelinidae. The complete pineapple chloroplast will serve as a reference for in-depth taxonomical studies in the Bromeliaceae family when more species under the family are sequenced in the future. The genetic sequence information will also make feasible other molecular applications of the pineapple chloroplast for plant genetic improvement.

  11. Complex alternative splicing of acetylcholinesterase transcripts in Torpedo electric organ; primary structure of the precursor of the glycolipid-anchored dimeric form.

    PubMed Central

    Sikorav, J L; Duval, N; Anselmet, A; Bon, S; Krejci, E; Legay, C; Osterlund, M; Reimund, B; Massoulié, J

    1988-01-01

    In this paper, we show the existence of alternative splicing in the 3' region of the coding sequence of Torpedo acetylcholinesterase (AChE). We describe two cDNA structures which both diverge from the previously described coding sequence of the catalytic subunit of asymmetric (A) forms (Schumacher et al., 1986; Sikorav et al., 1987). They both contain a coding sequence followed by a non-coding sequence and a poly(A) stretch. Both of these structures were shown to exist in poly(A)+ RNAs, by S1 mapping experiments. The divergent region encoded by the first sequence corresponds to the precursor of the globular dimeric form (G2a), since it contains the expected C-terminal amino acids, Ala-Cys. These amino acids are followed by a 29 amino acid extension which contains a hydrophobic segment and must be replaced by a glycolipid in the mature protein. Analyses of intact G2a AChE showed that the common domain of the protein contains intersubunit disulphide bonds. The divergent region of the second type of cDNA consists of an adjacent genomic sequence, which is removed as an intron in A and Ga mRNAs, but may encode a distinct, less abundant catalytic subunit. The structures of the cDNA clones indicate that they are derived from minor mRNAs, shorter than the three major transcripts which have been described previously (14.5, 10.5 and 5.5 kb). Oligonucleotide probes specific for the asymmetric and globular terminal regions hybridize with the three major transcripts, indicating that their size is determined by 3'-untranslated regions which are not related to the differential splicing leading to A and Ga forms. Images PMID:3181125

  12. Complete mitochondrial genome sequence of the heart failure model of cardiomyopathic Syrian hamster (Mesocricetus auratus).

    PubMed

    Hu, Bo; Liu, Dong-Xing; Zhang, Yu-Qing; Song, Jian-Tao; Ji, Xian-Fei; Hou, Zhi-Qiang; Zhang, Zhen-Hai

    2016-05-01

    In this study we sequenced the complete mitochondrial genome sequencing of a heart failure model of cardiomyopathic Syrian hamster (Mesocricetus auratus) for the first time. The total length of the mitogenome was 16,267 bp. It harbored 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and 1 non-coding control region.

  13. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  14. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed Central

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

  15. Molecular cloning and evolutionary analysis of the calcium-modulated contractile protein, centrin, in green algae and land plants.

    PubMed

    Bhattacharya, D; Steinkötter, J; Melkonian, M

    1993-12-01

    Centrin (= caltractin) is a ubiquitous, cytoskeletal protein which is a member of the EF-hand superfamily of calcium-binding proteins. A centrin-coding cDNA was isolated and characterized from the prasinophyte green alga Scherffelia dubia. Centrin PCR amplification primers were used to isolate partial, homologous cDNA sequences from the green algae Tetraselmis striata and Spermatozopsis similis. Annealing analyses suggested that centrin is a single-copy-coding region in T. striata and S. similis and other green algae studied. Centrin-coding regions from S. dubia, S. similis and T. striata encode four colinear EF-hand domains which putatively bind calcium. Phylogenetic analyses, including homologous sequences from Chlamydomonas reinhardtii and the land plant Atriplex nummularia, demonstrate that the domains of centrins are congruent and arose from the two-fold duplication of an ancestral EF hand with Domains 1+3 and Domains 2+4 clustering. The domains of centrins are also congruent with those of calmodulins demonstrating that, like calmodulin, centrin is an ancient protein which arose within the ancestor of all eukaryotes via gene duplication. Phylogenetic relationships inferred from centrin-coding region comparisons mirror results of small subunit ribosomal RNA sequence analyses suggesting that centrin-coding regions are useful evolutionary markers within the green algae.

  16. Recurrent and functional regulatory mutations in breast cancer.

    PubMed

    Rheinbay, Esther; Parasuraman, Prasanna; Grimsby, Jonna; Tiao, Grace; Engreitz, Jesse M; Kim, Jaegil; Lawrence, Michael S; Taylor-Weiner, Amaro; Rodriguez-Cuevas, Sergio; Rosenberg, Mara; Hess, Julian; Stewart, Chip; Maruvka, Yosef E; Stojanov, Petar; Cortes, Maria L; Seepo, Sara; Cibulskis, Carrie; Tracy, Adam; Pugh, Trevor J; Lee, Jesse; Zheng, Zongli; Ellisen, Leif W; Iafrate, A John; Boehm, Jesse S; Gabriel, Stacey B; Meyerson, Matthew; Golub, Todd R; Baselga, Jose; Hidalgo-Miranda, Alfredo; Shioda, Toshi; Bernards, Andre; Lander, Eric S; Getz, Gad

    2017-07-06

    Genomic analysis of tumours has led to the identification of hundreds of cancer genes on the basis of the presence of mutations in protein-coding regions. By contrast, much less is known about cancer-causing mutations in non-coding regions. Here we perform deep sequencing in 360 primary breast cancers and develop computational methods to identify significantly mutated promoters. Clear signals are found in the promoters of three genes. FOXA1, a known driver of hormone-receptor positive breast cancer, harbours a mutational hotspot in its promoter leading to overexpression through increased E2F binding. RMRP and NEAT1, two non-coding RNA genes, carry mutations that affect protein binding to their promoters and alter expression levels. Our study shows that promoter regions harbour recurrent mutations in cancer with functional consequences and that the mutations occur at similar frequencies as in coding regions. Power analyses indicate that more such regions remain to be discovered through deep sequencing of adequately sized cohorts of patients.

  17. The complete mitochondrial genome of Pholis nebulosus (Perciformes: Pholidae).

    PubMed

    Wang, Zhongquan; Qin, Kaili; Liu, Jingxi; Song, Na; Han, Zhiqiang; Gao, Tianxiang

    2016-11-01

    In this study, the complete mitochondrial genome (mitogenome) sequence of Pholis nebulosus has been determined by long polymerase chain reaction and primer-walking methods. The mitogenome is a circular molecule of 16 524 bp in length, including the typical structure of 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and 2 non-coding regions (L-strand replication origin and control region), the gene contents of which are identical to those observed in most bony fishes. Within the control region, we identified the termination-associated sequence domain (TAS), and the conserved sequence block domain (CSB-F, CSB-E, CSB-D, CSB-C, CSB-B, CSB-A, CSB-1, CSB-2, CSB-3).

  18. Human somatostatin I: sequence of the cDNA.

    PubMed Central

    Shen, L P; Pictet, R L; Rutter, W J

    1982-01-01

    RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

  19. Nucleotide sequencing analysis of a LEU gene of Candida maltosa which complements leuB mutation of Escherichia coli and leu2 mutation of Saccharomyces cerevisiae.

    PubMed

    Takagi, M; Kobayashi, N; Sugimoto, M; Fujii, T; Watari, J; Yano, K

    1987-01-01

    The expression of a LEU gene from Candida maltosa (designated as C-LEU2) isolated previously (Kawamura et al. 1983) was shown to be regulated, when transferred into Saccharomyces cerevisiae, by leucine and threonine in the medium, as in the case of LEU2 gene of S. cerevisiae. The coding region together with the regulatory region was subcloned and the nucleotide sequence was determined. When the sequence of the coding region was compared with that of LEU2, the homology was 72% for base pairs and 76% for deduced amino acids. Comparison of the regulatory region of C-LEU2 with those of LEU1 and LEU2 suggested a few short consensus sequences which are involved in regulation of gene expression by leucine and threonine in the medium.

  20. New encoded single-indicator sequences based on physico-chemical parameters for efficient exon identification.

    PubMed

    Meher, J K; Meher, P K; Dash, G N; Raval, M K

    2012-01-01

    The first step in gene identification problem based on genomic signal processing is to convert character strings into numerical sequences. These numerical sequences are then analysed spectrally or using digital filtering techniques for the period-3 peaks, which are present in exons (coding areas) and absent in introns (non-coding areas). In this paper, we have shown that single-indicator sequences can be generated by encoding schemes based on physico-chemical properties. Two new methods are proposed for generating single-indicator sequences based on hydration energy and dipole moments. The proposed methods produce high peak at exon locations and effectively suppress false exons (intron regions having greater peak than exon regions) resulting in high discriminating factor, sensitivity and specificity.

  1. Complete mitochondrial genome of the larch hawk moth, Sphinx morio (Lepidoptera: Sphingidae).

    PubMed

    Kim, Min Jee; Choi, Sei-Woong; Kim, Iksoo

    2013-12-01

    The larch hawk moth, Sphinx morio, belongs to the lepidopteran family Sphingidae that has long been studied as a family of model insects in a diverse field. In this study, we describe the complete mitochondrial genome (mitogenome) sequences of the species in terms of general genomic features and characteristic short repetitive sequences found in the A + T-rich region. The 15,299-bp-long genome consisted of a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes) and one major non-coding A + T-rich region, with the typical arrangement found in Lepidoptera. The 316-bp-long A + T-rich region located between srRNA and tRNA(Met) harbored the conserved sequence blocks that are typically found in lepidopteran insects. Additionally, the A + T-rich region of S. morio contained three characteristic repeat sequences that are rarely found in Lepidoptera: two identical 12-bp repeat, three identical 5-bp-long tandem repeat, and six nearly identical 5-6 bp long repeat sequences.

  2. The complete chloroplast genome sequence of strawberry (Fragaria  × ananassa Duch.) and comparison with related species of Rosaceae

    PubMed Central

    Cheng, Hui; Li, Jinfeng; Zhang, Hong; Cai, Binhua; Gao, Zhihong

    2017-01-01

    Compared with other members of the family Rosaceae, the chloroplast genomes of Fragaria species exhibit low variation, and this situation has limited phylogenetic analyses; thus, complete chloroplast genome sequencing of Fragaria species is needed. In this study, we sequenced the complete chloroplast genome of F. × ananassa ‘Benihoppe’ using the Illumina HiSeq 2500-PE150 platform and then performed a combination of de novo assembly and reference-guided mapping of contigs to generate complete chloroplast genome sequences. The chloroplast genome exhibits a typical quadripartite structure with a pair of inverted repeats (IRs, 25,936 bp) separated by large (LSC, 85,531 bp) and small (SSC, 18,146 bp) single-copy (SC) regions. The length of the F. × ananassa ‘Benihoppe’ chloroplast genome is 155,549 bp, representing the smallest Fragaria chloroplast genome observed to date. The genome encodes 112 unique genes, comprising 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Comparative analysis of the overall nucleotide sequence identity among ten complete chloroplast genomes confirmed that for both coding and non-coding regions in Rosaceae, SC regions exhibit higher sequence variation than IRs. The Ka/Ks ratio of most genes was less than 1, suggesting that most genes are under purifying selection. Moreover, the mVISTA results also showed a high degree of conservation in genome structure, gene order and gene content in Fragaria, particularly among three octoploid strawberries which were F. × ananassa ‘Benihoppe’, F. chiloensis (GP33) and F. virginiana (O477). However, when the sequences of the coding and non-coding regions of F. × ananassa ‘Benihoppe’ were compared in detail with those of F. chiloensis (GP33) and F. virginiana (O477), a number of SNPs and InDels were revealed by MEGA 7. Six non-coding regions (trnK-matK, trnS-trnG, atpF-atpH, trnC-petN, trnT-psbD and trnP-psaJ) with a percentage of variable sites greater than 1% and no less than five parsimony-informative sites were identified and may be useful for phylogenetic analysis of the genus Fragaria. PMID:29038765

  3. Chimeric mitochondrial minichromosomes of the human body louse, Pediculus humanus: evidence for homologous and non-homologous recombination.

    PubMed

    Shao, Renfu; Barker, Stephen C

    2011-02-15

    The mitochondrial (mt) genome of the human body louse, Pediculus humanus, consists of 18 minichromosomes. Each minichromosome is 3 to 4 kb long and has 1 to 3 genes. There is unequivocal evidence for recombination between different mt minichromosomes in P. humanus. It is not known, however, how these minichromosomes recombine. Here, we report the discovery of eight chimeric mt minichromosomes in P. humanus. We classify these chimeric mt minichromosomes into two groups: Group I and Group II. Group I chimeric minichromosomes contain parts of two different protein-coding genes that are from different minichromosomes. The two parts of protein-coding genes in each Group I chimeric minichromosome are joined at a microhomologous nucleotide sequence; microhomologous nucleotide sequences are hallmarks of non-homologous recombination. Group II chimeric minichromosomes contain all of the genes and the non-coding regions of two different minichromosomes. The conserved sequence blocks in the non-coding regions of Group II chimeric minichromosomes resemble the "recombination repeats" in the non-coding regions of the mt genomes of higher plants. These repeats are essential to homologous recombination in higher plants. Our analyses of the nucleotide sequences of chimeric mt minichromosomes indicate both homologous and non-homologous recombination between minichromosomes in the mitochondria of the human body louse. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Kangaroo – A pattern-matching program for biological sequences

    PubMed Central

    2002-01-01

    Background Biologists are often interested in performing a simple database search to identify proteins or genes that contain a well-defined sequence pattern. Many databases do not provide straightforward or readily available query tools to perform simple searches, such as identifying transcription binding sites, protein motifs, or repetitive DNA sequences. However, in many cases simple pattern-matching searches can reveal a wealth of information. We present in this paper a regular expression pattern-matching tool that was used to identify short repetitive DNA sequences in human coding regions for the purpose of identifying potential mutation sites in mismatch repair deficient cells. Results Kangaroo is a web-based regular expression pattern-matching program that can search for patterns in DNA, protein, or coding region sequences in ten different organisms. The program is implemented to facilitate a wide range of queries with no restriction on the length or complexity of the query expression. The program is accessible on the web at http://bioinfo.mshri.on.ca/kangaroo/ and the source code is freely distributed at http://sourceforge.net/projects/slritools/. Conclusion A low-level simple pattern-matching application can prove to be a useful tool in many research settings. For example, Kangaroo was used to identify potential genetic targets in a human colorectal cancer variant that is characterized by a high frequency of mutations in coding regions containing mononucleotide repeats. PMID:12150718

  5. Identification of Putative Nuclear Receptors and Steroidogenic Enzymes in Murray-Darling Rainbowfish (Melanotaenia fluviatilis) Using RNA-Seq and De Novo Transcriptome Assembly.

    PubMed

    Bain, Peter A; Papanicolaou, Alexie; Kumar, Anupama

    2015-01-01

    Murray-Darling rainbowfish (Melanotaenia fluviatilis [Castelnau, 1878]; Atheriniformes: Melanotaeniidae) is a small-bodied teleost currently under development in Australasia as a test species for aquatic toxicological studies. To date, efforts towards the development of molecular biomarkers of contaminant exposure have been hindered by the lack of available sequence data. To address this, we sequenced messenger RNA from brain, liver and gonads of mature male and female fish and generated a high-quality draft transcriptome using a de novo assembly approach. 149,742 clusters of putative transcripts were obtained, encompassing 43,841 non-redundant protein-coding regions. Deduced amino acid sequences were annotated by functional inference based on similarity with sequences from manually curated protein sequence databases. The draft assembly contained protein-coding regions homologous to 95.7% of the complete cohort of predicted proteins from the taxonomically related species, Oryzias latipes (Japanese medaka). The mean length of rainbowfish protein-coding sequences relative to their medaka homologues was 92.1%, indicating that despite the limited number of tissues sampled a large proportion of the total expected number of protein-coding genes was captured in the study. Because of our interest in the effects of environmental contaminants on endocrine pathways, we manually curated subsets of coding regions for putative nuclear receptors and steroidogenic enzymes in the rainbowfish transcriptome, revealing 61 candidate nuclear receptors encompassing all known subfamilies, and 41 putative steroidogenic enzymes representing all major steroidogenic enzymes occurring in teleosts. The transcriptome presented here will be a valuable resource for researchers interested in biomarker development, protein structure and function, and contaminant-response genomics in Murray-Darling rainbowfish.

  6. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    PubMed

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  7. Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

    PubMed

    Kanai, T H; Ueda, S; Nakamura, T

    2000-01-31

    Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

  8. DNA barcode goes two-dimensions: DNA QR code web server.

    PubMed

    Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

    2012-01-01

    The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

  9. Identification of G-quadruplex forming sequences in three manatee papillomaviruses

    PubMed Central

    Zahin, Maryam; Dean, William L.; Ghim, Shin-je; Joh, Joongho; Gray, Robert D.; Khanal, Sujita; Bossart, Gregory D.; Mignucci-Giannoni, Antonio A.; Rouchka, Eric C.; Jenson, Alfred B.; Trent, John O.; Chaires, Jonathan B.

    2018-01-01

    The Florida manatee (Trichechus manatus latirotris) is a threatened aquatic mammal in United States coastal waters. Over the past decade, the appearance of papillomavirus-induced lesions and viral papillomatosis in manatees has been a concern for those involved in the management and rehabilitation of this species. To date, three manatee papillomaviruses (TmPVs) have been identified in Florida manatees, one forming cutaneous lesions (TmPV1) and two forming genital lesions (TmPV3 and TmPV4). We identified DNA sequences with the potential to form G-quadruplex structures (G4) across the three genomes. G4 were located on both DNA strands and across coding and non-coding regions on all TmPVs, offering multiple targets for viral control. Although G4 have been identified in several viral genomes, including human PVs, most research has focused on canonical structures comprised of three G-tetrads. In contrast, the vast majority of sequences we identified would allow the formation of non-canonical structures with only two G-tetrads. Our biophysical analysis confirmed the formation of G4 with parallel topology in three such sequences from the E2 region. Two of the structures appear comprised of multiple stacked two G-tetrad structures, perhaps serving to increase structural stability. Computational analysis demonstrated enrichment of G4 sequences on all TmPVs on the reverse strand in the E2/E4 region and on both strands in the L2 region. Several G4 sequences occurred at similar regional locations on all PVs, most notably on the reverse strand in the E2 region. In other cases, G4 were identified at similar regional locations only on PVs forming genital lesions. On all TmPVs, G4 sequences were located in the non-coding region near putative E2 binding sites. Together, these findings suggest that G4 are possible regulatory elements in TmPVs. PMID:29630682

  10. Identification of common, unique and polymorphic microsatellites among 73 cyanobacterial genomes.

    PubMed

    Kabra, Ritika; Kapil, Aditi; Attarwala, Kherunnisa; Rai, Piyush Kant; Shanker, Asheesh

    2016-04-01

    Microsatellites also known as Simple Sequence Repeats are short tandem repeats of 1-6 nucleotides. These repeats are found in coding as well as non-coding regions of both prokaryotic and eukaryotic genomes and play a significant role in the study of gene regulation, genetic mapping, DNA fingerprinting and evolutionary studies. The availability of 73 complete genome sequences of cyanobacteria enabled us to mine and statistically analyze microsatellites in these genomes. The cyanobacterial microsatellites identified through bioinformatics analysis were stored in a user-friendly database named CyanoSat, which is an efficient data representation and query system designed using ASP.net. The information in CyanoSat comprises of perfect, imperfect and compound microsatellites found in coding, non-coding and coding-non-coding regions. Moreover, it contains PCR primers with 200 nucleotides long flanking region. The mined cyanobacterial microsatellites can be freely accessed at www.compubio.in/CyanoSat/home.aspx. In addition to this 82 polymorphic, 13,866 unique and 2390 common microsatellites were also detected. These microsatellites will be useful in strain identification and genetic diversity studies of cyanobacteria.

  11. Complete mitochondrial genome of Eagle Owl (Bubo bubo, Strigiformes; Strigidae) from China.

    PubMed

    Hengjiu, Tian; Jianwei, Ji; Shi, Yang; Zhiming, Zhang; Laghari, Muhammad Younis; Narejo, Naeem Tariq; Lashari, Punhal

    2016-01-01

    In the present study, the complete mitochondrial genome sequence of Bubo bubo using PCR amplification, sequencing and assembling has been obtained for the first time. The total length of the mitochondrial genome was 16,250  bp, with the base composition of 29.88% A, 34.16% C, 14.35% G, and 21.58% T. It contained 37 genes (2 ribosomal RNA genes, 13 protein-coding genes and 22 transfer RNA genes) and a major non-coding control region (D-loop region). The complete mitochondrial genome sequence of Bubo bubo provides an important data set for further investigation on the phylogenetic relationships within Strigiformes.

  12. Next generation sequencing yields the complete mitochondrial genome of the Endangered Chilean silverside Basilichthys microlepidotus (Jenyns, 1841) (Teleostei, Atherinopsidae), validated with RNA-seq.

    PubMed

    Véliz, David; Vega-Retter, Caren; Quezada-Romegialli, Claudio

    2016-01-01

    The complete sequence of the mitochondrial genome for the Chilean silverside Basilichthys microlepidotus is reported for the first time. The entire mitochondrial genome was 16,544 bp in length (GenBank accession no. KM245937); gene composition and arrangement was conformed to that reported for most fishes and contained the typical structure of 2 rRNAs, 13 protein-coding genes, 22 tRNAs and a non-coding region. The assembled mitogenome was validated against sequences of COI and Control Region previously sequenced in our lab, functional genes from RNA-Seq data for the same species and the mitogenome of two other atherinopsid species available in Genbank.

  13. Reduced-median-network analysis of complete mitochondrial DNA coding-region sequences for the major African, Asian, and European haplogroups.

    PubMed

    Herrnstadt, Corinna; Elson, Joanna L; Fahy, Eoin; Preston, Gwen; Turnbull, Douglass M; Anderson, Christen; Ghosh, Soumitra S; Olefsky, Jerrold M; Beal, M Flint; Davis, Robert E; Howell, Neil

    2002-05-01

    The evolution of the human mitochondrial genome is characterized by the emergence of ethnically distinct lineages or haplogroups. Nine European, seven Asian (including Native American), and three African mitochondrial DNA (mtDNA) haplogroups have been identified previously on the basis of the presence or absence of a relatively small number of restriction-enzyme recognition sites or on the basis of nucleotide sequences of the D-loop region. We have used reduced-median-network approaches to analyze 560 complete European, Asian, and African mtDNA coding-region sequences from unrelated individuals to develop a more complete understanding of sequence diversity both within and between haplogroups. A total of 497 haplogroup-associated polymorphisms were identified, 323 (65%) of which were associated with one haplogroup and 174 (35%) of which were associated with two or more haplogroups. Approximately one-half of these polymorphisms are reported for the first time here. Our results confirm and substantially extend the phylogenetic relationships among mitochondrial genomes described elsewhere from the major human ethnic groups. Another important result is that there were numerous instances both of parallel mutations at the same site and of reversion (i.e., homoplasy). It is likely that homoplasy in the coding region will confound evolutionary analysis of small sequence sets. By a linkage-disequilibrium approach, additional evidence for the absence of human mtDNA recombination is presented here.

  14. An exploration of the sequence of a 2.9-Mb region of the genome of Drosophila melanogaster: the Adh region.

    PubMed Central

    Ashburner, M; Misra, S; Roote, J; Lewis, S E; Blazej, R; Davis, T; Doyle, C; Galle, R; George, R; Harris, N; Hartzell, G; Harvey, D; Hong, L; Houston, K; Hoskins, R; Johnson, G; Martin, C; Moshrefi, A; Palazzolo, M; Reese, M G; Spradling, A; Tsang, G; Wan, K; Whitelaw, K; Celniker, S

    1999-01-01

    A contiguous sequence of nearly 3 Mb from the genome of Drosophila melanogaster has been sequenced from a series of overlapping P1 and BAC clones. This region covers 69 chromosome polytene bands on chromosome arm 2L, including the genetically well-characterized "Adh region." A computational analysis of the sequence predicts 218 protein-coding genes, 11 tRNAs, and 17 transposable element sequences. At least 38 of the protein-coding genes are arranged in clusters of from 2 to 6 closely related genes, suggesting extensive tandem duplication. The gene density is one protein-coding gene every 13 kb; the transposable element density is one element every 171 kb. Of 73 genes in this region identified by genetic analysis, 49 have been located on the sequence; P-element insertions have been mapped to 43 genes. Ninety-five (44%) of the known and predicted genes match a Drosophila EST, and 144 (66%) have clear similarities to proteins in other organisms. Genes known to have mutant phenotypes are more likely to be represented in cDNA libraries, and far more likely to have products similar to proteins of other organisms, than are genes with no known mutant phenotype. Over 650 chromosome aberration breakpoints map to this chromosome region, and their nonrandom distribution on the genetic map reflects variation in gene spacing on the DNA. This is the first large-scale analysis of the genome of D. melanogaster at the sequence level. In addition to the direct results obtained, this analysis has allowed us to develop and test methods that will be needed to interpret the complete sequence of the genome of this species.Before beginning a Hunt, it is wise to ask someone what you are looking for before you begin looking for it. Milne 1926 PMID:10471707

  15. Lessons learned from the initial sequencing of the pig genome: comparative analysis of an 8 Mb region of pig chromosome 17

    PubMed Central

    Hart, Elizabeth A; Caccamo, Mario; Harrow, Jennifer L; Humphray, Sean J; Gilbert, James GR; Trevanion, Steve; Hubbard, Tim; Rogers, Jane; Rothschild, Max F

    2007-01-01

    Background We describe here the sequencing, annotation and comparative analysis of an 8 Mb region of pig chromosome 17, which provides a useful test region to assess coverage and quality for the pig genome sequencing project. We report our findings comparing the annotation of draft sequence assembled at different depths of coverage. Results Within this region we annotated 71 loci, of which 53 are orthologous to human known coding genes. When compared to the syntenic regions in human (20q13.13-q13.33) and mouse (chromosome 2, 167.5 Mb-178.3 Mb), this region was found to be highly conserved with respect to gene order. The most notable difference between the three species is the presence of a large expansion of zinc finger coding genes and pseudogenes on mouse chromosome 2 between Edn3 and Phactr3 that is absent from pig and human. All of our annotation has been made publicly available in the Vertebrate Genome Annotation browser, VEGA. We assessed the impact of coverage on sequence assembly across this region and found, as expected, that increased sequence depth resulted in fewer, longer contigs. One-third of our annotated loci could not be fully re-aligned back to the low coverage version of the sequence, principally because the transcripts are fragmented over several contigs. Conclusion We have demonstrated the considerable advantages of sequencing at increased read depths and discuss the implications that lower coverage sequence may have on subsequent comparative and functional studies, particularly those involving complex loci such as GNAS. PMID:17705864

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leong, JoAnn Ching

    The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

  17. VaDiR: an integrated approach to Variant Detection in RNA.

    PubMed

    Neums, Lisa; Suenaga, Seiji; Beyerlein, Peter; Anders, Sara; Koestler, Devin; Mariani, Andrea; Chien, Jeremy

    2018-02-01

    Advances in next-generation DNA sequencing technologies are now enabling detailed characterization of sequence variations in cancer genomes. With whole-genome sequencing, variations in coding and non-coding sequences can be discovered. But the cost associated with it is currently limiting its general use in research. Whole-exome sequencing is used to characterize sequence variations in coding regions, but the cost associated with capture reagents and biases in capture rate limit its full use in research. Additional limitations include uncertainty in assigning the functional significance of the mutations when these mutations are observed in the non-coding region or in genes that are not expressed in cancer tissue. We investigated the feasibility of uncovering mutations from expressed genes using RNA sequencing datasets with a method called Variant Detection in RNA(VaDiR) that integrates 3 variant callers, namely: SNPiR, RVBoost, and MuTect2. The combination of all 3 methods, which we called Tier 1 variants, produced the highest precision with true positive mutations from RNA-seq that could be validated at the DNA level. We also found that the integration of Tier 1 variants with those called by MuTect2 and SNPiR produced the highest recall with acceptable precision. Finally, we observed a higher rate of mutation discovery in genes that are expressed at higher levels. Our method, VaDiR, provides a possibility of uncovering mutations from RNA sequencing datasets that could be useful in further functional analysis. In addition, our approach allows orthogonal validation of DNA-based mutation discovery by providing complementary sequence variation analysis from paired RNA/DNA sequencing datasets.

  18. Detection of non-coding RNA in bacteria and archaea using the DETR'PROK Galaxy pipeline.

    PubMed

    Toffano-Nioche, Claire; Luo, Yufei; Kuchly, Claire; Wallon, Claire; Steinbach, Delphine; Zytnicki, Matthias; Jacq, Annick; Gautheret, Daniel

    2013-09-01

    RNA-seq experiments are now routinely used for the large scale sequencing of transcripts. In bacteria or archaea, such deep sequencing experiments typically produce 10-50 million fragments that cover most of the genome, including intergenic regions. In this context, the precise delineation of the non-coding elements is challenging. Non-coding elements include untranslated regions (UTRs) of mRNAs, independent small RNA genes (sRNAs) and transcripts produced from the antisense strand of genes (asRNA). Here we present a computational pipeline (DETR'PROK: detection of ncRNAs in prokaryotes) based on the Galaxy framework that takes as input a mapping of deep sequencing reads and performs successive steps of clustering, comparison with existing annotation and identification of transcribed non-coding fragments classified into putative 5' UTRs, sRNAs and asRNAs. We provide a step-by-step description of the protocol using real-life example data sets from Vibrio splendidus and Escherichia coli. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  20. HIV1 V3 loop hypermutability is enhanced by the guanine usage bias in the part of env gene coding for it.

    PubMed

    Khrustalev, Vladislav Victorovich

    2009-01-01

    Guanine is the most mutable nucleotide in HIV genes because of frequently occurring G to A transitions, which are caused by cytosine deamination in viral DNA minus strands catalyzed by APOBEC enzymes. Distribution of guanine between three codon positions should influence the probability for G to A mutation to be nonsynonymous (to occur in first or second codon position). We discovered that nucleotide sequences of env genes coding for third variable regions (V3 loops) of gp120 from HIV1 and HIV2 have different kinds of guanine usage biases. In the HIV1 reference strain and 100 additionally analyzed HIV1 strains the guanine usage bias in V3 loop coding regions (2G>1G>3G) should lead to elevated nonsynonymous G to A transitions occurrence rates. In the HIV2 reference strain and 100 other HIV2 strains guanine usage bias in V3 loop coding regions (3G>2G>1G) should protect V3 loops from hypermutability. According to the HIV1 and HIV2 V3 alignment, insertion of the sequence enriched with 2G (21 codons in length) occurred during the evolution of HIV1 predecessor, while insertion of the different sequence enriched with 3G (19 codons in length) occurred during the evolution of HIV2 predecessor. The higher is the level of 3G in the V3 coding region, the lower should be the immune escaping mutation occurrence rates. This hypothesis was tested in this study by comparing the guanine usage in V3 loop coding regions from HIV1 fast and slow progressors. All calculations have been performed by our algorithms "VVK In length", "VVK Dinucleotides" and "VVK Consensus" (www.barkovsky.hotmail.ru).

  1. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana).

    PubMed

    Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila

    2010-07-16

    Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A large RGA08 gene cluster identified in wild banana corresponds to a highly variable genomic region between haplotypes surrounded by conserved flanking regions. High level of sequence identity (70 to 99%) of the genic and intergenic regions suggests a recent and rapid evolution of this cluster in M. balbisiana.

  2. Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

    PubMed Central

    Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

    1995-01-01

    The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

  3. DNA Barcode Goes Two-Dimensions: DNA QR Code Web Server

    PubMed Central

    Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

    2012-01-01

    The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, “DNA barcode” actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications. PMID:22574113

  4. Detection of hyper-conserved regions in hepatitis B virus X gene potentially useful for gene therapy.

    PubMed

    González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

    2018-05-21

    To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.

  5. The mitochondrial genome of the multicolored Asian lady beetle Harmonia axyridis (Pallas) and a phylogenetic analysis of the Polyphaga (Insecta: Coleoptera).

    PubMed

    Niu, Fang-Fang; Zhu, Liang; Wang, Su; Wei, Shu-Jun

    2016-07-01

    Here, we report the mitochondrial genome sequence of the multicolored Asian lady beetle Harmonia axyridis (Pallas, 1773) (Coleoptera: Coccinellidae) (GenBank accession No. KR108208). This is the first species with sequenced mitochondrial genome from the genus Harmonia. The current length with partitial A + T-rich region of this mitochondrial genome is 16,387 bp. All the typical genes were sequenced except the trnI and trnQ. As in most other sequenced mitochondrial genomes of Coleoptera, there is no re-arrangement in the sequenced region compared with the pupative ancestral arrangement of insects. All protein-coding genes start with ATN codons. Five, five and three protein-coding genes stop with termination codon TAA, TA and T, respectively. Phylogenetic analysis using Bayesian method based on the first and second codon positions of the protein-coding genes supported that the Scirtidae is a basal lineage of Polyphaga. The Harmonia and the Coccinella form a sister lineage. The monophyly of Staphyliniformia, Scarabaeiformia and Cucujiformia was supported. The Buprestidae was found to be a sister group to the Bostrichiformia.

  6. Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

    PubMed Central

    Dasgupta, R; Kaesberg, P

    1982-01-01

    The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

  7. A specific indel marker for the Philippines Schistosoma japonicum revealed by analysis of mitochondrial genome sequences.

    PubMed

    Li, Juan; Chen, Fen; Sugiyama, Hiromu; Blair, David; Lin, Rui-Qing; Zhu, Xing-Quan

    2015-07-01

    In the present study, near-complete mitochondrial (mt) genome sequences for Schistosoma japonicum from different regions in the Philippines and Japan were amplified and sequenced. Comparisons among S. japonicum from the Philippines, Japan, and China revealed a geographically based length difference in mt genomes, but the mt genomic organization and gene arrangement were the same. Sequence differences among samples from the Philippines and all samples from the three endemic areas were 0.57-2.12 and 0.76-3.85 %, respectively. The most variable part of the mt genome was the non-coding region. In the coding portion of the genome, protein-coding genes varied more than rRNA genes and tRNAs. The near-complete mt genome sequences for Philippine specimens were identical in length (14,091 bp) which was 4 bp longer than those of S. japonicum samples from Japan and China. This indel provides a unique genetic marker for S. japonicum samples from the Philippines. Phylogenetic analyses based on the concatenated amino acids of 12 protein-coding genes showed that samples of S. japonicum clustered according to their geographical origins. The identified mitochondrial indel marker will be useful for tracing the source of S. japonicum infection in humans and animals in Southeast Asia.

  8. Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

    PubMed

    Cao, Yinhe; Tung, Wen-Wen; Gao, J B

    2004-01-01

    With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

  9. Differentiated evolutionary conservatism and lack of polymorphism of crucial sex determination genes (SRY and SOX9) in four species of the family Canidae.

    PubMed

    Nowacka-Woszuk, Joanna; Switonski, Marek

    2009-01-01

    The sex determination process is under the control of several genes of which two (SRY and SOX9), encoding transcription factors, play a crucial role. It is well-known that mutations at these genes may cause the development of an intersexual phenotype. The aim of this study was to conduct a comparative analysis of the coding sequence and 5'-flanking regions of both genes in four species of the family Canidae (the dog, red fox, arctic fox and Chinese raccoon dog). Similarity of the coding sequence of the SOX9 gene among the studied species was higher (99.7-99.9%) than in the case of the SRY gene (96.7-97.3%). Only single nucleotide changes were found in the compared coding sequences, whereas in the 5'-flanking region of both genes nucleotide substitutions, as well as insertions and deletions were observed. None of the changes detected in the 5'-flanking region occurred within the potential consensus sequences for transcription factors. No polymorphism was found for either of these genes in any of the analyzed species.

  10. The mitochondrial genome of Polistes jokahamae and a phylogenetic analysis of the Vespoidea (Insecta: Hymenoptera).

    PubMed

    Song, Sheng-Nan; Chen, Peng-Yan; Wei, Shu-Jun; Chen, Xue-Xin

    2016-07-01

    The mitochondrial genome sequence of Polistes jokahamae (Radoszkowski, 1887) (Hymenoptera: Vespidae) (GenBank accession no. KR052468) was sequenced. The current length with partial A + T-rich region of this mitochondrial genome is 16,616 bp. All the typical mitochondrial genes were sequenced except for three tRNAs (trnI, trnQ, and trnY) located between the A + T-rich region and nad2. At least three rearrangement events occurred in the sequenced region compared with the pupative ancestral arrangement of insects, corresponding to the shuffling of trnK and trnD, translocation or remote inversion of tnnY and translocation of trnL1. All protein-coding genes start with ATN codons. Eleven, one, and another one protein-coding genes stop with termination codon TAA, TA, and T, respectively. Phylogenetic analysis using the Bayesian method based on all codon positions of the 13 protein-coding genes supports the monophyly of Vespidae and Formicidae. Within the Formicidae, the Myrmicinae and Formicinae form a sister lineage and then sister to the Dolichoderinae, while within the Vespidae, the Eumeninae is sister to the lineage of Vespinae + Polistinae.

  11. Self-organizing approach for meta-genomes.

    PubMed

    Zhu, Jianfeng; Zheng, Wei-Mou

    2014-12-01

    We extend the self-organizing approach for annotation of a bacterial genome to analyze the raw sequencing data of the human gut metagenome without sequence assembling. The original approach divides the genomic sequence of a bacterium into non-overlapping segments of equal length and assigns to each segment one of seven 'phases', among which one is for the noncoding regions, three for the direct coding regions to indicate the three possible codon positions of the segment starting site, and three for the reverse coding regions. The noncoding phase and the six coding phases are described by two frequency tables of the 64 triplet types or 'codon usages'. A set of codon usages can be used to update the phase assignment and vice versa. An iteration after an initialization leads to a convergent phase assignment to give an annotation of the genome. In the extension of the approach to a metagenome, we consider a mixture model of a number of categories described by different codon usages. The Illumina Genome Analyzer sequencing data of the total DNA from faecal samples are then examined to understand the diversity of the human gut microbiome. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.

    PubMed

    2004-12-09

    We present here a draft genome sequence of the red jungle fowl, Gallus gallus. Because the chicken is a modern descendant of the dinosaurs and the first non-mammalian amniote to have its genome sequenced, the draft sequence of its genome--composed of approximately one billion base pairs of sequence and an estimated 20,000-23,000 genes--provides a new perspective on vertebrate genome evolution, while also improving the annotation of mammalian genomes. For example, the evolutionary distance between chicken and human provides high specificity in detecting functional elements, both non-coding and coding. Notably, many conserved non-coding sequences are far from genes and cannot be assigned to defined functional classes. In coding regions the evolutionary dynamics of protein domains and orthologous groups illustrate processes that distinguish the lineages leading to birds and mammals. The distinctive properties of avian microchromosomes, together with the inferred patterns of conserved synteny, provide additional insights into vertebrate chromosome architecture.

  13. Compositional correlations in the chicken genome.

    PubMed

    Musto, H; Romero, H; Zavala, A; Bernardi, G

    1999-09-01

    This paper analyses the compositional correlations that hold in the chicken genome. Significant linear correlations were found among the regions studied-coding sequences (and their first, second, and third codon positions), flanking regions (5' and 3'), and introns-as is the case in the human genome. We found that these compositional correlations are not limited to global GC levels but even extend to individual bases. Furthermore, an analysis of 1037 coding sequences has confirmed a correlation among GC(3), GC(2), and GC(1). The implications of these results are discussed.

  14. The complete validated mitochondrial genome of the silver gemfish Rexea solandri (Cuvier, 1832) (Perciformes, Gempylidae).

    PubMed

    Bustamante, Carlos; Ovenden, Jennifer R

    2016-01-01

    The silver gemfish Rexea solandri is an important economic resource but Vulnerable to overfishing in Australian waters. The complete mitochondrial genome sequence is described from 1.6 million reads obtained via next generation sequencing. The total length of the mitogenome is 16,350 bp comprising 2 rRNA, 13 protein-coding genes, 22 tRNA and 2 non-coding regions. The mitogenome sequence was validated against sequences of PCR fragments and BLAST queries of Genbank. Gene order was equivalent to that found in marine fishes.

  15. Automated conserved non-coding sequence (CNS) discovery reveals differences in gene content and promoter evolution among grasses

    PubMed Central

    Turco, Gina; Schnable, James C.; Pedersen, Brent; Freeling, Michael

    2013-01-01

    Conserved non-coding sequences (CNS) are islands of non-coding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searches for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 kb of non-coding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions, and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium, and maize. PMID:23874343

  16. Whole mitochondrial genome sequence for an osteoarthritis model of Guinea pig (Caviidae; Cavia).

    PubMed

    Cui, Xin-Gang; Liu, Cheng-Yao; Wei, Bo; Zhao, Wen-Jian; Zhang, Wen-Feng

    2016-11-01

    Animal models played an important role in osteoarthritis studies. Here, the complete mitochondrial genome sequence of the Guinea pig was reported for the first time. The total length of the mitogenome was 16,797 bp. It contained the typical structure, including two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one non-coding control region (D-loop region). The overall composition of the mitogenome was estimated to be 34.9% for A, 26.1% for T, 26.0% for C and 13.0% for G showing an A-T (61.0%)-rich feature. This mitochondrial genome sequence will provide new genetic resource into osteoarthritis disease.

  17. Draft Genome Sequence of Staphylococcus cohnii subsp. urealyticus Isolated from a Healthy Dog

    PubMed Central

    Wigmore, Sarah M.; Wareham, David W.

    2017-01-01

    ABSTRACT   Staphylococcus cohnii subsp. urealyticus strain SW120 was isolated from the ear swab of a healthy dog. The isolate is resistant to methicillin and fusidic acid. The SW120 draft genome is 2,805,064 bp and contains 2,667 coding sequences, including 58 tRNAs and nine complete rRNA coding regions. PMID:28209829

  18. Draft Genome Sequence of a Canine Isolate of Methicillin-Resistant Staphylococcus haemolyticus

    PubMed Central

    Wigmore, Sarah M.; Wareham, David W.

    2017-01-01

    ABSTRACT Staphylococcus haemolyticus strain SW007 was isolated from a nasal swab taken from a healthy dog. The isolate is resistant to methicillin, mupirocin, macrolides, and sulfonamides. The SW007 draft genome is 2,325,410 bp and contains 2,277 coding sequences, including 60 tRNAs and nine complete rRNA-coding regions. PMID:28385855

  19. Complete coding regions of the prototypes enterovirus B93 and C95: phylogenetic analyses of the P1 and P3 regions of EV-B and EV-C strains.

    PubMed

    Junttila, N; Lévêque, N; Magnius, L O; Kabue, J P; Muyembe-Tamfum, J J; Maslin, J; Lina, B; Norder, H

    2015-03-01

    Complete coding regions were sequenced for two new enterovirus genomes: EV-B93 previously identified by VP1 sequencing, derived from a child with acute flaccid paralysis in the Democratic Republic of Congo; and EV-C95 from a French soldier with acute gastroenteritis in Djibouti. The EV-B93 P1 had more than 30% nucleotide divergence from other EV-B types, with highest similarity to E-15 and EV-B80. The P1 nucleotide sequence of EV-C95 was most similar, 71%, to CV-A21. Complete coding regions for the new enteroviruses were compared with those of 135 EV-B and 176 EV-C strains representing all types available in GenBank. When strains from the same outbreak or strains isolated during the same year in the same geographical region were excluded, 27 of the 58 EV-B, and 16 of the 23 EV-C types were represented by more than one sequence. However, for EV-B the P3 sequences formed three clades mainly according to origin or time of isolation, irrespective of type, while for EV-C the P3 sequences segregated mainly according to disease manifestation, with most strains causing paralysis, including polioviruses, forming one clade, and strains causing respiratory illness forming another. There was no intermixing of types between these two clades, apart from two EV-C96 strains. The EV-B P3 sequences had lower inter-clade and higher intra-clade variability as compared to the EV-C sequences, which may explain why inter-clade recombinations are more frequent in EV-B. Further analysis of more isolates may shed light on the role of recombinations in the evolution of EV-B in geographical context. © 2014 Wiley Periodicals, Inc.

  20. Using hidden Markov models and observed evolution to annotate viral genomes.

    PubMed

    McCauley, Stephen; Hein, Jotun

    2006-06-01

    ssRNA (single stranded) viral genomes are generally constrained in length and utilize overlapping reading frames to maximally exploit the coding potential within the genome length restrictions. This overlapping coding phenomenon leads to complex evolutionary constraints operating on the genome. In regions which code for more than one protein, silent mutations in one reading frame generally have a protein coding effect in another. To maximize coding flexibility in all reading frames, overlapping regions are often compositionally biased towards amino acids which are 6-fold degenerate with respect to the 64 codon alphabet. Previous methodologies have used this fact in an ad hoc manner to look for overlapping genes by motif matching. In this paper differentiated nucleotide compositional patterns in overlapping regions are incorporated into a probabilistic hidden Markov model (HMM) framework which is used to annotate ssRNA viral genomes. This work focuses on single sequence annotation and applies an HMM framework to ssRNA viral annotation. A description of how the HMM is parameterized, whilst annotating within a missing data framework is given. A Phylogenetic HMM (Phylo-HMM) extension, as applied to 14 aligned HIV2 sequences is also presented. This evolutionary extension serves as an illustration of the potential of the Phylo-HMM framework for ssRNA viral genomic annotation. The single sequence annotation procedure (SSA) is applied to 14 different strains of the HIV2 virus. Further results on alternative ssRNA viral genomes are presented to illustrate more generally the performance of the method. The results of the SSA method are encouraging however there is still room for improvement, and since there is overwhelming evidence to indicate that comparative methods can improve coding sequence (CDS) annotation, the SSA method is extended to a Phylo-HMM to incorporate evolutionary information. The Phylo-HMM extension is applied to the same set of 14 HIV2 sequences which are pre-aligned. The performance improvement that results from including the evolutionary information in the analysis is illustrated.

  1. Many human accelerated regions are developmental enhancers

    PubMed Central

    Capra, John A.; Erwin, Genevieve D.; McKinsey, Gabriel; Rubenstein, John L. R.; Pollard, Katherine S.

    2013-01-01

    The genetic changes underlying the dramatic differences in form and function between humans and other primates are largely unknown, although it is clear that gene regulatory changes play an important role. To identify regulatory sequences with potentially human-specific functions, we and others used comparative genomics to find non-coding regions conserved across mammals that have acquired many sequence changes in humans since divergence from chimpanzees. These regions are good candidates for performing human-specific regulatory functions. Here, we analysed the DNA sequence, evolutionary history, histone modifications, chromatin state and transcription factor (TF) binding sites of a combined set of 2649 non-coding human accelerated regions (ncHARs) and predicted that at least 30% of them function as developmental enhancers. We prioritized the predicted ncHAR enhancers using analysis of TF binding site gain and loss, along with the functional annotations and expression patterns of nearby genes. We then tested both the human and chimpanzee sequence for 29 ncHARs in transgenic mice, and found 24 novel developmental enhancers active in both species, 17 of which had very consistent patterns of activity in specific embryonic tissues. Of these ncHAR enhancers, five drove expression patterns suggestive of different activity for the human and chimpanzee sequence at embryonic day 11.5. The changes to human non-coding DNA in these ncHAR enhancers may modify the complex patterns of gene expression necessary for proper development in a human-specific manner and are thus promising candidates for understanding the genetic basis of human-specific biology. PMID:24218637

  2. Polyomavirus BK non-coding control region rearrangements in health and disease.

    PubMed

    Sharma, Preety M; Gupta, Gaurav; Vats, Abhay; Shapiro, Ron; Randhawa, Parmjeet S

    2007-08-01

    BK virus is an increasingly recognized pathogen in transplanted patients. DNA sequencing of this virus shows considerable genomic variability. To understand the clinical significance of rearrangements in the non-coding control region (NCCR) of BK virus (BKV), we report a meta-analysis of 507 sequences, including 40 sequences generated in our own laboratory, for associations between rearrangements and disease, tissue tropism, geographic origin, and viral genotype. NCCR rearrangements were less frequent in (a) asymptomatic BKV viruria compared to patients viral nephropathy (1.7% vs. 22.5%), and (b) viral genotype 1 compared to other genotypes (2.4% vs. 11.2%). Rearrangements were commoner in malignancy (78.6%), and Norwegians (45.7%), and less common in East Indians (0%), and Japanese (4.3%). A surprising number of rearranged sequences were reported from mononuclear cells of healthy subjects, whereas most plasma sequences were archetypal. This difference could not be related to potential recombinase activity in lymphocytes, as consensus recombination signal sequences could not be found in the NCCR region. NCCR rearrangements are neither required nor a sufficient condition to produce clinical disease. BKV nephropathy and hemorrhagic cystitis are not associated with any unique NCCR configuration or nucleotide sequence.

  3. Combined sequence and sequence-structure-based methods for analyzing RAAS gene SNPs: a computational approach.

    PubMed

    Singh, Kh Dhanachandra; Karthikeyan, Muthusamy

    2014-12-01

    The renin-angiotensin-aldosterone system (RAAS) plays a key role in the regulation of blood pressure (BP). Mutations on the genes that encode components of the RAAS have played a significant role in genetic susceptibility to hypertension and have been intensively scrutinized. The identification of such probably causal mutations not only provides insight into the RAAS but may also serve as antihypertensive therapeutic targets and diagnostic markers. The methods for analyzing the SNPs from the huge dataset of SNPs, containing both functional and neutral SNPs is challenging by the experimental approach on every SNPs to determine their biological significance. To explore the functional significance of genetic mutation (SNPs), we adopted combined sequence and sequence-structure-based SNP analysis algorithm. Out of 3864 SNPs reported in dbSNP, we found 108 missense SNPs in the coding region and remaining in the non-coding region. In this study, we are reporting only those SNPs in coding region to be deleterious when three or more tools are predicted to be deleterious and which have high RMSD from the native structure. Based on these analyses, we have identified two SNPs of REN gene, eight SNPs of AGT gene, three SNPs of ACE gene, two SNPs of AT1R gene, three SNPs of CYP11B2 gene and three SNPs of CMA1 gene in the coding region were found to be deleterious. Further this type of study will be helpful in reducing the cost and time for identification of potential SNP and also helpful in selecting potential SNP for experimental study out of SNP pool.

  4. A family of long intergenic non-coding RNA genes in human chromosomal region 22q11.2 carry a DNA translocation breakpoint/AT-rich sequence

    PubMed Central

    2018-01-01

    FAM230C, a long intergenic non-coding RNA (lincRNA) gene in human chromosome 13 (chr13) is a member of lincRNA genes termed family with sequence similarity 230. An analysis using bioinformatics search tools and alignment programs was undertaken to determine properties of FAM230C and its related genes. Results reveal that the DNA translocation element, the Translocation Breakpoint Type A (TBTA) sequence, which consists of satellite DNA, Alu elements, and AT-rich sequences is embedded in the FAM230C gene. Eight lincRNA genes related to FAM230C also carry the TBTA sequences. These genes were formed from a large segment of the 3’ half of the FAM230C sequence duplicated in chr22, and are specifically in regions of low copy repeats (LCR22)s, in or close to the 22q.11.2 region. 22q11.2 is a chromosomal segment that undergoes a high rate of DNA translocation and is prone to genetic deletions. FAM230C-related genes present in other chromosomes do not carry the TBTA motif and were formed from the 5’ half region of the FAM230C sequence. These findings identify a high specificity in lincRNA gene formation by gene sequence duplication in different chromosomes. PMID:29668722

  5. Representation of DNA sequences with virtual potentials and their processing by (SEQREP) Kohonen self-organizing maps.

    PubMed

    Aires-de-Sousa, João; Aires-de-Sousa, Luisa

    2003-01-01

    We propose representing individual positions in DNA sequences by virtual potentials generated by other bases of the same sequence. This is a compact representation of the neighbourhood of a base. The distribution of the virtual potentials over the whole sequence can be used as a representation of the entire sequence (SEQREP code). It is a flexible code, with a length independent of the sequence size, does not require previous alignment, and is convenient for processing by neural networks or statistical techniques. To evaluate its biological significance, the SEQREP code was used for training Kohonen self-organizing maps (SOMs) in two applications: (a) detection of Alu sequences, and (b) classification of sequences encoding for HIV-1 envelope glycoprotein (env) into subtypes A-G. It was demonstrated that SOMs clustered sequences belonging to different classes into distinct regions. For independent test sets, very high rates of correct predictions were obtained (97% in the first application, 91% in the second). Possible areas of application of SEQREP codes include functional genomics, phylogenetic analysis, detection of repetitions, database retrieval, and automatic alignment. Software for representing sequences by SEQREP code, and for training Kohonen SOMs is made freely available from http://www.dq.fct.unl.pt/qoa/jas/seqrep. Supplementary material is available at http://www.dq.fct.unl.pt/qoa/jas/seqrep/bioinf2002

  6. Multiplexed direct genomic selection (MDiGS): a pooled BAC capture approach for highly accurate CNV and SNP/INDEL detection.

    PubMed

    Alvarado, David M; Yang, Ping; Druley, Todd E; Lovett, Michael; Gurnett, Christina A

    2014-06-01

    Despite declining sequencing costs, few methods are available for cost-effective single-nucleotide polymorphism (SNP), insertion/deletion (INDEL) and copy number variation (CNV) discovery in a single assay. Commercially available methods require a high investment to a specific region and are only cost-effective for large samples. Here, we introduce a novel, flexible approach for multiplexed targeted sequencing and CNV analysis of large genomic regions called multiplexed direct genomic selection (MDiGS). MDiGS combines biotinylated bacterial artificial chromosome (BAC) capture and multiplexed pooled capture for SNP/INDEL and CNV detection of 96 multiplexed samples on a single MiSeq run. MDiGS is advantageous over other methods for CNV detection because pooled sample capture and hybridization to large contiguous BAC baits reduces sample and probe hybridization variability inherent in other methods. We performed MDiGS capture for three chromosomal regions consisting of ∼ 550 kb of coding and non-coding sequence with DNA from 253 patients with congenital lower limb disorders. PITX1 nonsense and HOXC11 S191F missense mutations were identified that segregate in clubfoot families. Using a novel pooled-capture reference strategy, we identified recurrent chromosome chr17q23.1q23.2 duplications and small HOXC 5' cluster deletions (51 kb and 12 kb). Given the current interest in coding and non-coding variants in human disease, MDiGS fulfills a niche for comprehensive and low-cost evaluation of CNVs, coding, and non-coding variants across candidate regions of interest. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Draft Genome Sequence of a Canine Isolate of Methicillin-Resistant Staphylococcus haemolyticus.

    PubMed

    Bean, David C; Wigmore, Sarah M; Wareham, David W

    2017-04-06

    Staphylococcus haemolyticus strain SW007 was isolated from a nasal swab taken from a healthy dog. The isolate is resistant to methicillin, mupirocin, macrolides, and sulfonamides. The SW007 draft genome is 2,325,410 bp and contains 2,277 coding sequences, including 60 tRNAs and nine complete rRNA-coding regions. Copyright © 2017 Bean et al.

  8. The complete chloroplast genome sequence of the medicinal plant Salvia miltiorrhiza.

    PubMed

    Qian, Jun; Song, Jingyuan; Gao, Huanhuan; Zhu, Yingjie; Xu, Jiang; Pang, Xiaohui; Yao, Hui; Sun, Chao; Li, Xian'en; Li, Chuyuan; Liu, Juyan; Xu, Haibin; Chen, Shilin

    2013-01-01

    Salvia miltiorrhiza is an important medicinal plant with great economic and medicinal value. The complete chloroplast (cp) genome sequence of Salvia miltiorrhiza, the first sequenced member of the Lamiaceae family, is reported here. The genome is 151,328 bp in length and exhibits a typical quadripartite structure of the large (LSC, 82,695 bp) and small (SSC, 17,555 bp) single-copy regions, separated by a pair of inverted repeats (IRs, 25,539 bp). It contains 114 unique genes, including 80 protein-coding genes, 30 tRNAs and four rRNAs. The genome structure, gene order, GC content and codon usage are similar to the typical angiosperm cp genomes. Four forward, three inverted and seven tandem repeats were detected in the Salvia miltiorrhiza cp genome. Simple sequence repeat (SSR) analysis among the 30 asterid cp genomes revealed that most SSRs are AT-rich, which contribute to the overall AT richness of these cp genomes. Additionally, fewer SSRs are distributed in the protein-coding sequences compared to the non-coding regions, indicating an uneven distribution of SSRs within the cp genomes. Entire cp genome comparison of Salvia miltiorrhiza and three other Lamiales cp genomes showed a high degree of sequence similarity and a relatively high divergence of intergenic spacers. Sequence divergence analysis discovered the ten most divergent and ten most conserved genes as well as their length variation, which will be helpful for phylogenetic studies in asterids. Our analysis also supports that both regional and functional constraints affect gene sequence evolution. Further, phylogenetic analysis demonstrated a sister relationship between Salvia miltiorrhiza and Sesamum indicum. The complete cp genome sequence of Salvia miltiorrhiza reported in this paper will facilitate population, phylogenetic and cp genetic engineering studies of this medicinal plant.

  9. Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing

    PubMed Central

    Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin

    2012-01-01

    Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633

  10. Differential recognition of the ORF2 region in a complete genome sequence of porcine circovirus type 2 (PCV2) isolated from boar bone marrow in Korea.

    PubMed

    Kweon, Chang-Hee; Nguyen, Lien Thi Kim; Yoo, Mi-Sun; Kang, Seung-Won

    2015-09-15

    Porcine circovirus type 2 (PCV2) is the causative agent of post-weaning multisystemic wasting syndrome (PMWS) in swine. Here, a phylogenetic tree was constructed using PCV2 nucleotide sequences derived from the bone marrow of Korean boar and previously reported PCV2 sequences isolated from various countries. PCV2 from Korean boar bone marrow (KC188796) was classified into the group containing PCV2a-Canada and other PCV2 strain from Korea. While the ORF1 region of the PCV2 genome was highly conserved, ORF2 (the capsid protein coding region) was relatively variable. The nucleotide sequences for bone marrow-derived PCV2 were 93.4-99.0% homologous to the other reference sequences. The deduced amino acid sequences for the ORF1 and ORF2 coding regions were 97.4-99.3% and 84.5-97.4% homologous with the other reference strains, respectively, indicating that KC188796 did not differ markedly from the other PCV2 strains. Phylogenetic analysis demonstrated that bone marrow-derived PCV2 was highly similar to PCV2a from Canada and may be related to persistent PCV2 infections in swine. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Nucleotide sequence of the L1 ribosomal protein gene of Xenopus laevis: remarkable sequence homology among introns.

    PubMed Central

    Loreni, F; Ruberti, I; Bozzoni, I; Pierandrei-Amaldi, P; Amaldi, F

    1985-01-01

    Ribosomal protein L1 is encoded by two genes in Xenopus laevis. The comparison of two cDNA sequences shows that the two L1 gene copies (L1a and L1b) have diverged in many silent sites and very few substitution sites; moreover a small duplication occurred at the very end of the coding region of the L1b gene which thus codes for a product five amino acids longer than that coded by L1a. Quantitatively the divergence between the two L1 genes confirms that a whole genome duplication took place in Xenopus laevis approximately 30 million years ago. A genomic fragment containing one of the two L1 gene copies (L1a), with its nine introns and flanking regions, has been completely sequenced. The 5' end of this gene has been mapped within a 20-pyridimine stretch as already found for other vertebrate ribosomal protein genes. Four of the nine introns have a 60-nucleotide sequence with 80% homology; within this region some boxes, one of which is 16 nucleotides long, are 100% homologous among the four introns. This feature of L1a gene introns is interesting since we have previously shown that the activity of this gene is regulated at a post-transcriptional level and it involves the block of the normal splicing of some intron sequences. Images Fig. 3. Fig. 5. PMID:3841512

  12. Sequence differences in the diagnostic region of the cysteine protease 8 gene of Tritrichomonas foetus parasites of cats and cattle.

    PubMed

    Sun, Zichen; Stack, Colin; Šlapeta, Jan

    2012-05-25

    In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. The complete mitochondrial genome sequence of the Datong yak (Bos grunniens).

    PubMed

    Wu, Xiaoyun; Chu, Min; Liang, Chunnian; Ding, Xuezhi; Guo, Xian; Bao, Pengjia; Yan, Ping

    2016-01-01

    Datong yak is a famous artificially cultivated breed in China. In the present work, we report the complete mitochondrial genome sequence of Datong yak for the first time. The total length of the mitogenome is 16,323 bp long, containing 13 protein-coding genes, 22 tRNA genes, two rRNA genes and one non-coding region (D-loop region). The gene order of Datong yak mitogenome is identical to that observed in most other vertebrates. The overall base composition is 33.71% A, 25.8.0% C, 13.21% G and 27.27% T, with an A + T content of 60.98%. The complete mitogenome sequence information of Datong yak can provide useful data for further studies on molecular breeding and taxonomic status.

  14. Characterization of the complete mitochondrial genome sequence of Gannan yak (Bos grunniens).

    PubMed

    Wu, Xiaoyun; Ding, Xuezhi; Chu, Min; Guo, Xian; Bao, Pengjia; Liang, Chunnian; Yan, Ping

    2016-01-01

    Gannan yak is the native breed of Gansu province in China. In this work, the complete mitochondrial genome sequence of Gannan yak was determined for the first time. The total length of the mitogenome is 16,322 bp long, with the base composition of 33.74% A, 25.84% T, 13.18% C, and 27.24% G. It contained 13 protein-coding genes, 22 tRNA genes, two rRNA genes and one non-coding region (D-loop region). The gene order of Gannan yak mitogenome is identical to that observed in most other vertebrates. The complete mitogenome sequence information of Gannan yak can provide useful data for further studies on protection of genetic resources and phylogenetic relationships within Bos grunniens.

  15. The Complete Sequence of a Human Parainfluenzavirus 4 Genome

    PubMed Central

    Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond

    2009-01-01

    Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536

  16. The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

    PubMed

    Neuhaus, H; Link, G

    1987-01-01

    The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

  17. Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

    PubMed Central

    LaPolla, R J; Mayne, K M; Davidson, N

    1984-01-01

    A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

  18. Next generation sequencing and analysis of a conserved transcriptome of New Zealand's kiwi.

    PubMed

    Subramanian, Sankar; Huynen, Leon; Millar, Craig D; Lambert, David M

    2010-12-15

    Kiwi is a highly distinctive, flightless and endangered ratite bird endemic to New Zealand. To understand the patterns of molecular evolution of the nuclear protein-coding genes in brown kiwi (Apteryx australis mantelli) and to determine the timescale of avian history we sequenced a transcriptome obtained from a kiwi embryo using next generation sequencing methods. We then assembled the conserved protein-coding regions using the chicken proteome as a scaffold. Using 1,543 conserved protein coding genes we estimated the neutral evolutionary divergence between the kiwi and chicken to be ~45%, which is approximately equal to the divergence computed for the human-mouse pair using the same set of genes. A large fraction of genes was found to be under high selective constraint, as most of the expressed genes appeared to be involved in developmental gene regulation. Our study suggests a significant relationship between gene expression levels and protein evolution. Using sequences from over 700 nuclear genes we estimated the divergence between the two basal avian groups, Palaeognathae and Neognathae to be 132 million years, which is consistent with previous studies using mitochondrial genes. The results of this investigation revealed patterns of mutation and purifying selection in conserved protein coding regions in birds. Furthermore this study suggests a relatively cost-effective way of obtaining a glimpse into the fundamental molecular evolutionary attributes of a genome, particularly when no closely related genomic sequence is available.

  19. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana)

    PubMed Central

    2010-01-01

    Background Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Results Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. Conclusions A large RGA08 gene cluster identified in wild banana corresponds to a highly variable genomic region between haplotypes surrounded by conserved flanking regions. High level of sequence identity (70 to 99%) of the genic and intergenic regions suggests a recent and rapid evolution of this cluster in M. balbisiana. PMID:20637079

  20. Combined actions of multiple hairpin loop structures and sites of rate-limiting endonucleolytic cleavage determine differential degradation rates of individual segments within polycistronic puf operon mRNA.

    PubMed Central

    Klug, G; Cohen, S N

    1990-01-01

    Differential expression of the genes within the puf operon of Rhodobacter capsulatus is accomplished in part by differences in the rate of degradation of different segments of the puf transcript. We report here that decay of puf mRNA sequences specifying the light-harvesting I (LHI) and reaction center (RC) photosynthetic membrane peptides is initiated endoribonucleolytically within a discrete 1.4-kilobase segment of the RC-coding region. Deletion of this segment increased the half-life of the RC-coding region from 8 to 20 min while not affecting decay of LHI-coding sequences upstream from an intercistronic hairpin loop structure shown previously to impede 3'-to-5' degradation. Prolongation of RC segment half-life was dependent on the presence of other hairpin structures 3' to the RC region. Inserting the endonuclease-sensitive sites into the LHI-coding segment markedly accelerated its degradation. Our results suggest that differential degradation of the RC- and LHI-coding segments of puf mRNA is accomplished at least in part by the combined actions of RC region-specific endonuclease(s), one or more exonucleases, and several strategically located exonuclease-impeding hairpins. Images PMID:2394682

  1. Comparison of simple sequence repeats in 19 Archaea.

    PubMed

    Trivedi, S

    2006-12-05

    All organisms that have been studied until now have been found to have differential distribution of simple sequence repeats (SSRs), with more SSRs in intergenic than in coding sequences. SSR distribution was investigated in Archaea genomes where complete chromosome sequences of 19 Archaea were analyzed with the program SPUTNIK to find di- to penta-nucleotide repeats. The number of repeats was determined for the complete chromosome sequences and for the coding and non-coding sequences. Different from what has been found for other groups of organisms, there is an abundance of SSRs in coding regions of the genome of some Archaea. Dinucleotide repeats were rare and CG repeats were found in only two Archaea. In general, trinucleotide repeats are the most abundant SSR motifs; however, pentanucleotide repeats are abundant in some Archaea. Some of the tetranucleotide and pentanucleotide repeat motifs are organism specific. In general, repeats are short and CG-rich repeats are present in Archaea having a CG-rich genome. Among the 19 Archaea, SSR density was not correlated with genome size or with optimum growth temperature. Pentanucleotide density had an inverse correlation with the CG content of the genome.

  2. Analysis of CHRNA7 rare variants in autism spectrum disorder susceptibility.

    PubMed

    Bacchelli, Elena; Battaglia, Agatino; Cameli, Cinzia; Lomartire, Silvia; Tancredi, Raffaella; Thomson, Susanne; Sutcliffe, James S; Maestrini, Elena

    2015-04-01

    Chromosome 15q13.3 recurrent microdeletions are causally associated with a wide range of phenotypes, including autism spectrum disorder (ASD), seizures, intellectual disability, and other psychiatric conditions. Whether the reciprocal microduplication is pathogenic is less certain. CHRNA7, encoding for the alpha7 subunit of the neuronal nicotinic acetylcholine receptor, is considered the likely culprit gene in mediating neurological phenotypes in 15q13.3 deletion cases. To assess if CHRNA7 rare variants confer risk to ASD, we performed copy number variant analysis and Sanger sequencing of the CHRNA7 coding sequence in a sample of 135 ASD cases. Sequence variation in this gene remains largely unexplored, given the existence of a fusion gene, CHRFAM7A, which includes a nearly identical partial duplication of CHRNA7. Hence, attempts to sequence coding exons must distinguish between CHRNA7 and CHRFAM7A, making next-generation sequencing approaches unreliable for this purpose. A CHRNA7 microduplication was detected in a patient with autism and moderate cognitive impairment; while no rare damaging variants were identified in the coding region, we detected rare variants in the promoter region, previously described to functionally reduce transcription. This study represents the first sequence variant analysis of CHRNA7 in a sample of idiopathic autism. © 2015 Wiley Periodicals, Inc.

  3. Sounds of silence: synonymous nucleotides as a key to biological regulation and complexity

    PubMed Central

    Shabalina, Svetlana A.; Spiridonov, Nikolay A.; Kashina, Anna

    2013-01-01

    Messenger RNA is a key component of an intricate regulatory network of its own. It accommodates numerous nucleotide signals that overlap protein coding sequences and are responsible for multiple levels of regulation and generation of biological complexity. A wealth of structural and regulatory information, which mRNA carries in addition to the encoded amino acid sequence, raises the question of how these signals and overlapping codes are delineated along non-synonymous and synonymous positions in protein coding regions, especially in eukaryotes. Silent or synonymous codon positions, which do not determine amino acid sequences of the encoded proteins, define mRNA secondary structure and stability and affect the rate of translation, folding and post-translational modifications of nascent polypeptides. The RNA level selection is acting on synonymous sites in both prokaryotes and eukaryotes and is more common than previously thought. Selection pressure on the coding gene regions follows three-nucleotide periodic pattern of nucleotide base-pairing in mRNA, which is imposed by the genetic code. Synonymous positions of the coding regions have a higher level of hybridization potential relative to non-synonymous positions, and are multifunctional in their regulatory and structural roles. Recent experimental evidence and analysis of mRNA structure and interspecies conservation suggest that there is an evolutionary tradeoff between selective pressure acting at the RNA and protein levels. Here we provide a comprehensive overview of the studies that define the role of silent positions in regulating RNA structure and processing that exert downstream effects on proteins and their functions. PMID:23293005

  4. Mitochondrial genomes of the jungle crow Corvus macrorhynchos (Passeriformes: Corvidae) from shed feathers and a phylogenetic analysis of genus Corvus using mitochondrial protein-coding genes.

    PubMed

    Krzeminska, Urszula; Wilson, Robyn; Rahman, Sadequr; Song, Beng Kah; Seneviratne, Sampath; Gan, Han Ming; Austin, Christopher M

    2016-07-01

    The complete mitochondrial genomes of two jungle crows (Corvus macrorhynchos) were sequenced. DNA was extracted from tissue samples obtained from shed feathers collected in the field in Sri Lanka and sequenced using the Illumina MiSeq Personal Sequencer. Jungle crow mitogenomes have a structural organization typical of the genus Corvus and are 16,927 bp and 17,066 bp in length, both comprising 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal subunit genes, and a non-coding control region. In addition, we complement already available house crow (Corvus spelendens) mitogenome resources by sequencing an individual from Singapore. A phylogenetic tree constructed from Corvidae family mitogenome sequences available on GenBank is presented. We confirm the monophyly of the genus Corvus and propose to use complete mitogenome resources for further intra- and interspecies genetic studies.

  5. Complete chloroplast DNA sequence from a Korean endemic genus, Megaleranthis saniculifolia, and its evolutionary implications.

    PubMed

    Kim, Young-Kyu; Park, Chong-wook; Kim, Ki-Joong

    2009-03-31

    The chloroplast DNA sequences of Megaleranthis saniculifolia, an endemic and monotypic endangered plant species, were completed in this study (GenBank FJ597983). The genome is 159,924 bp in length. It harbors a pair of IR regions consisting of 26,608 bp each. The lengths of the LSC and SSC regions are 88,326 bp and 18,382 bp, respectively. The structural organizations, gene and intron contents, gene orders, AT contents, codon usages, and transcription units of the Megaleranthis chloroplast genome are similar to those of typical land plant cp DNAs. However, the detailed features of Megaleranthis chloroplast genomes are substantially different from that of Ranunculus, which belongs to the same family, the Ranunculaceae. First, the Megaleranthis cp DNA was 4,797 bp longer than that of Ranunculus due to an expanded IR region into the SSC region and duplicated sequence elements in several spacer regions of the Megaleranthis cp genome. Second, the chloroplast genomes of Megaleranthis and Ranunculus evidence 5.6% sequence divergence in the coding regions, 8.9% sequence divergence in the intron regions, and 18.7% sequence divergence in the intergenic spacer regions, respectively. In both the coding and noncoding regions, average nucleotide substitution rates differed markedly, depending on the genome position. Our data strongly implicate the positional effects of the evolutionary modes of chloroplast genes. The genes evidencing higher levels of base substitutions also have higher incidences of indel mutations and low Ka/Ks ratios. A total of 54 simple sequence repeat loci were identified from the Megaleranthis cp genome. The existence of rich cp SSR loci in the Megaleranthis cp genome provides a rare opportunity to study the population genetic structures of this endangered species. Our phylogenetic trees based on the two independent markers, the nuclear ITS and chloroplast matK sequences, strongly support the inclusion of the Megaleranthis to the Trollius. Therefore, our molecular trees support Ohwi's original treatment of Megaleranthis saniculiforia to Trollius chosenensis Ohwi.

  6. Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

    PubMed

    Chun, J; Huq, A; Colwell, R R

    1999-05-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

  7. Comparison and correlation of Simple Sequence Repeats distribution in genomes of Brucella species

    PubMed Central

    Kiran, Jangampalli Adi Pradeep; Chakravarthi, Veeraraghavulu Praveen; Kumar, Yellapu Nanda; Rekha, Somesula Swapna; Kruti, Srinivasan Shanthi; Bhaskar, Matcha

    2011-01-01

    Computational genomics is one of the important tools to understand the distribution of closely related genomes including simple sequence repeats (SSRs) in an organism, which gives valuable information regarding genetic variations. The central objective of the present study was to screen the SSRs distributed in coding and non-coding regions among different human Brucella species which are involved in a range of pathological disorders. Computational analysis of the SSRs in the Brucella indicates few deviations from expected random models. Statistical analysis also reveals that tri-nucleotide SSRs are overrepresented and tetranucleotide SSRs underrepresented in Brucella genomes. From the data, it can be suggested that over expressed tri-nucleotide SSRs in genomic and coding regions might be responsible in the generation of functional variation of proteins expressed which in turn may lead to different pathogenicity, virulence determinants, stress response genes, transcription regulators and host adaptation proteins of Brucella genomes. Abbreviations SSRs - Simple Sequence Repeats, ORFs - Open Reading Frames. PMID:21738309

  8. Molecular cloning and sequence analysis of the gene coding for the 57kDa soluble antigen of the salmonid fish pathogen Renibacterium salmoninarum

    USGS Publications Warehouse

    Chien, Maw-Sheng; Gilbert , Teresa L.; Huang, Chienjin; Landolt, Marsha L.; O'Hara, Patrick J.; Winton, James R.

    1992-01-01

    The complete sequence coding for the 57-kDa major soluble antigen of the salmonid fish pathogen, Renibacterium salmoninarum, was determined. The gene contained an opening reading frame of 1671 nucleotides coding for a protein of 557 amino acids with a calculated Mr value of 57190. The first 26 amino acids constituted a signal peptide. The deduced sequence for amino acid residues 27–61 was in agreement with the 35 N-terminal amino acid residues determined by microsequencing, suggesting the protein in synthesized as a 557-amino acid precursor and processed to produce a mature protein of Mr 54505. Two regions of the protein contained imperfect direct repeats. The first region contained two copies of an 81-residue repeat, the second contained five copies of an unrelated 25-residue repeat. Also, a perfect inverted repeat (including three in-frame UAA stop codons) was observed at the carboxyl-terminus of the gene.

  9. Reduced TCOF1 mRNA level in a rhesus macaque with Treacher Collins-like syndrome: further evidence for haploinsufficiency of treacle as the cause of disease.

    PubMed

    Shows, Kathryn H; Ward, Christy; Summers, Laura; Li, Lin; Ziegler, Gregory R; Hendrickx, Andrew G; Shiang, Rita

    2006-02-01

    Mutations in the human gene TCOF1 cause a mandibulofacial dysostosis known as Treacher Collins syndrome (TCS). An infant rhesus macaque (Macaca mulatta) that displayed the TCS phenotype was identified at the California National Primate Research Center. The TCOF1 coding region was cloned from a normal rhesus macaque and sequenced. The rhesus macaque homolog of TCOF1 is 91.6% identical in cDNA sequence and 93.8% identical in translated protein sequence compared to human TCOF1. Sequencing of TCOF1 in the TCS-affected rhesus macaque showed no mutations within the coding region or splice sites; however, real-time quantitative PCR showed an 87% reduction of spleen TCOF1 mRNA level in the TCS affected macaque when compared with normal macaque spleen.

  10. The complete chloroplast DNA sequence of Eleutherococcus senticosus (Araliaceae); comparative evolutionary analyses with other three asterids.

    PubMed

    Yi, Dong-Keun; Lee, Hae-Lim; Sun, Byung-Yun; Chung, Mi Yoon; Kim, Ki-Joong

    2012-05-01

    This study reports the complete chloroplast (cp) DNA sequence of Eleutherococcus senticosus (GenBank: JN 637765), an endangered endemic species. The genome is 156,768 bp in length, and contains a pair of inverted repeat (IR) regions of 25,930 bp each, a large single copy (LSC) region of 86,755 bp and a small single copy (SSC) region of 18,153 bp. The structural organization, gene and intron contents, gene order, AT content, codon usage, and transcription units of the E. senticosus chloroplast genome are similar to that of typical land plant cp DNA. We aligned and analyzed the sequences of 86 coding genes, 19 introns and 113 intergenic spacers (IGS) in three different taxonomic hierarchies; Eleutherococcus vs. Panax, Eleutherococcus vs. Daucus, and Eleutherococcus vs. Nicotiana. The distribution of indels, the number of polymorphic sites and nucleotide diversity indicate that positional constraint is more important than functional constraint for the evolution of cp genome sequences in Asterids. For example, the intron sequences in the LSC region exhibited base substitution rates 5-11-times higher than that of the IR regions, while the intron sequences in the SSC region evolved 7-14-times faster than those in the IR region. Furthermore, the Ka/Ks ratio of the gene coding sequences supports a stronger evolutionary constraint in the IR region than in the LSC or SSC regions. Therefore, our data suggest that selective sweeps by base collection mechanisms more frequently eliminate polymorphisms in the IR region than in other regions. Chloroplast genome regions that have high levels of base substitutions also show higher incidences of indels. Thirty-five simple sequence repeat (SSR) loci were identified in the Eleutherococcus chloroplast genome. Of these, 27 are homopolymers, while six are di-polymers and two are tri-polymers. In addition to the SSR loci, we also identified 18 medium size repeat units ranging from 22 to 79 bp, 11 of which are distributed in the IGS or intron regions. These medium size repeats may contribute to developing a cp genome-specific gene introduction vector because the region may use for specific recombination sites.

  11. Genome Analysis Reveals Interplay between 5′UTR Introns and Nuclear mRNA Export for Secretory and Mitochondrial Genes

    PubMed Central

    Cenik, Can; Chua, Hon Nian; Zhang, Hui; Tarnawsky, Stefan P.; Akef, Abdalla; Derti, Adnan; Tasan, Murat; Moore, Melissa J.; Palazzo, Alexander F.; Roth, Frederick P.

    2011-01-01

    In higher eukaryotes, messenger RNAs (mRNAs) are exported from the nucleus to the cytoplasm via factors deposited near the 5′ end of the transcript during splicing. The signal sequence coding region (SSCR) can support an alternative mRNA export (ALREX) pathway that does not require splicing. However, most SSCR–containing genes also have introns, so the interplay between these export mechanisms remains unclear. Here we support a model in which the furthest upstream element in a given transcript, be it an intron or an ALREX–promoting SSCR, dictates the mRNA export pathway used. We also experimentally demonstrate that nuclear-encoded mitochondrial genes can use the ALREX pathway. Thus, ALREX can also be supported by nucleotide signals within mitochondrial-targeting sequence coding regions (MSCRs). Finally, we identified and experimentally verified novel motifs associated with the ALREX pathway that are shared by both SSCRs and MSCRs. Our results show strong correlation between 5′ untranslated region (5′UTR) intron presence/absence and sequence features at the beginning of the coding region. They also suggest that genes encoding secretory and mitochondrial proteins share a common regulatory mechanism at the level of mRNA export. PMID:21533221

  12. Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

    PubMed

    Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

    1991-03-01

    We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

  13. Representations of Pitch and Timbre Variation in Human Auditory Cortex

    PubMed Central

    2017-01-01

    Pitch and timbre are two primary dimensions of auditory perception, but how they are represented in the human brain remains a matter of contention. Some animal studies of auditory cortical processing have suggested modular processing, with different brain regions preferentially coding for pitch or timbre, whereas other studies have suggested a distributed code for different attributes across the same population of neurons. This study tested whether variations in pitch and timbre elicit activity in distinct regions of the human temporal lobes. Listeners were presented with sequences of sounds that varied in either fundamental frequency (eliciting changes in pitch) or spectral centroid (eliciting changes in brightness, an important attribute of timbre), with the degree of pitch or timbre variation in each sequence parametrically manipulated. The BOLD responses from auditory cortex increased with increasing sequence variance along each perceptual dimension. The spatial extent, region, and laterality of the cortical regions most responsive to variations in pitch or timbre at the univariate level of analysis were largely overlapping. However, patterns of activation in response to pitch or timbre variations were discriminable in most subjects at an individual level using multivoxel pattern analysis, suggesting a distributed coding of the two dimensions bilaterally in human auditory cortex. SIGNIFICANCE STATEMENT Pitch and timbre are two crucial aspects of auditory perception. Pitch governs our perception of musical melodies and harmonies, and conveys both prosodic and (in tone languages) lexical information in speech. Brightness—an aspect of timbre or sound quality—allows us to distinguish different musical instruments and speech sounds. Frequency-mapping studies have revealed tonotopic organization in primary auditory cortex, but the use of pure tones or noise bands has precluded the possibility of dissociating pitch from brightness. Our results suggest a distributed code, with no clear anatomical distinctions between auditory cortical regions responsive to changes in either pitch or timbre, but also reveal a population code that can differentiate between changes in either dimension within the same cortical regions. PMID:28025255

  14. Complete sequence of two tick-borne flaviviruses isolated from Siberia and the UK: analysis and significance of the 5' and 3'-UTRs.

    PubMed

    Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A

    1997-05-01

    The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.

  15. Recombined sequences between the non-coding control regions of JC and BK viruses found in the urine of a renal transplantation patient.

    PubMed

    Liaw, Yu-Ching; Chen, Cheng-Hsu; Shu, Kuo-Hsiung; Fang, Chiung-Yao; Ou, Wei-Chih; Chen, Pei-Lain; Shen, Cheng-Huang; Lin, Mien-Chun; Chang, Deching; Wang, Meilin

    2012-12-01

    Kidney cells are the common host for JC virus (JCV) and BK virus (BKV). Reactivation of JCV and/or BKV in patients after organ transplantation, such as renal transplantation, may cause hemorrhagic cystitis and polyomavirus-associated nephropathy. Furthermore, JCV and BKV may be shed in the urine after reactivation in the kidney. Rearranged as well as archetypal non-coding control regions (NCCRs) of JCV and BKV have been frequently identified in human samples. In this study, three JC/BK recombined NCCR sequences were identified in the urine of a patient who had undergone renal transplantation. They were designated as JC-BK hybrids 1, 2, and 3. The three JC/BK recombinant NCCRs contain up-stream JCV as well as down-stream BKV sequences. Deletions of both JCV and BKV sequences were found in these recombined NCCRs. Recombination of DNA sequences between JCV and BKV may occur during co-infection due to the relatively high homology of the two viral genomes.

  16. The GENCODE exome: sequencing the complete human exome

    PubMed Central

    Coffey, Alison J; Kokocinski, Felix; Calafato, Maria S; Scott, Carol E; Palta, Priit; Drury, Eleanor; Joyce, Christopher J; LeProust, Emily M; Harrow, Jen; Hunt, Sarah; Lehesjoki, Anna-Elina; Turner, Daniel J; Hubbard, Tim J; Palotie, Aarno

    2011-01-01

    Sequencing the coding regions, the exome, of the human genome is one of the major current strategies to identify low frequency and rare variants associated with human disease traits. So far, the most widely used commercial exome capture reagents have mainly targeted the consensus coding sequence (CCDS) database. We report the design of an extended set of targets for capturing the complete human exome, based on annotation from the GENCODE consortium. The extended set covers an additional 5594 genes and 10.3 Mb compared with the current CCDS-based sets. The additional regions include potential disease genes previously inaccessible to exome resequencing studies, such as 43 genes linked to ion channel activity and 70 genes linked to protein kinase activity. In total, the new GENCODE exome set developed here covers 47.9 Mb and performed well in sequence capture experiments. In the sample set used in this study, we identified over 5000 SNP variants more in the GENCODE exome target (24%) than in the CCDS-based exome sequencing. PMID:21364695

  17. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  18. Forensic strategy to ensure the quality of sequencing data of mitochondrial DNA in highly degraded samples.

    PubMed

    Adachi, Noboru; Umetsu, Kazuo; Shojo, Hideki

    2014-01-01

    Mitochondrial DNA (mtDNA) is widely used for DNA analysis of highly degraded samples because of its polymorphic nature and high number of copies in a cell. However, as endogenous mtDNA in deteriorated samples is scarce and highly fragmented, it is not easy to obtain reliable data. In the current study, we report the risks of direct sequencing mtDNA in highly degraded material, and suggest a strategy to ensure the quality of sequencing data. It was observed that direct sequencing data of the hypervariable segment (HVS) 1 by using primer sets that generate an amplicon of 407 bp (long-primer sets) was different from results obtained by using newly designed primer sets that produce an amplicon of 120-139 bp (mini-primer sets). The data aligned with the results of mini-primer sets analysis in an amplicon length-dependent manner; the shorter the amplicon, the more evident the endogenous sequence became. Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA. Although the sequencing data obtained using long-primer sets turned out to be erroneous, it was unambiguous and reproducible. These findings suggest that PCR primers that produce amplicons shorter than those currently recognized should be used for mtDNA analysis in highly degraded samples. Haplogroup motif analysis of the coding region and HVS should also be performed to improve the reliability of forensic mtDNA data. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  19. On fuzzy semantic similarity measure for DNA coding.

    PubMed

    Ahmad, Muneer; Jung, Low Tang; Bhuiyan, Md Al-Amin

    2016-02-01

    A coding measure scheme numerically translates the DNA sequence to a time domain signal for protein coding regions identification. A number of coding measure schemes based on numerology, geometry, fixed mapping, statistical characteristics and chemical attributes of nucleotides have been proposed in recent decades. Such coding measure schemes lack the biologically meaningful aspects of nucleotide data and hence do not significantly discriminate coding regions from non-coding regions. This paper presents a novel fuzzy semantic similarity measure (FSSM) coding scheme centering on FSSM codons׳ clustering and genetic code context of nucleotides. Certain natural characteristics of nucleotides i.e. appearance as a unique combination of triplets, preserving special structure and occurrence, and ability to own and share density distributions in codons have been exploited in FSSM. The nucleotides׳ fuzzy behaviors, semantic similarities and defuzzification based on the center of gravity of nucleotides revealed a strong correlation between nucleotides in codons. The proposed FSSM coding scheme attains a significant enhancement in coding regions identification i.e. 36-133% as compared to other existing coding measure schemes tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. The complete sequence of mitochondrial genome of polled yak (Bos grunniens).

    PubMed

    Chu, Min; Wu, Xiaoyun; Liang, Chunnian; Pei, Jie; Ding, Xuezhi; Guo, Xian; Bao, Pengjia; Yan, Ping

    2016-05-01

    Generally speaking, the hornless trait is also known as polled. Although the POLL locus could be assigned to a 1.36-Mb interval in the centromeric region of BTA1 (Georges et al., 1993; Drögemüller et al., 2005)), and (Liu et al., 2014) reported a 147-kb segment that included three protein-coding genes was the most likely location of the POLL mutation in domestic yaks, the underlying genetic basis for the polled trait is still unknown. In this work, the complete mitochondrial genome sequence of polled yak was determined for the first time. The total length of the mitogenome is 16,324 bp long, with the base composition of 33.72% A, 27.25% T, 25.83% C, and 13.20% G. It contained 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and 1 non-coding region (D-loop region). The gene order of polled yak mitogenome is identical to that observed in most other vertebrates. The complete mitogenome sequence information of polled yak will provide useful data for further studies on protection of genetic resources and phylogenetic relationships within Bos grunniens.

  1. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S.

    1995-10-09

    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains amore » functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.« less

  2. East Asian mtDNA haplogroup determination in Koreans: haplogroup-level coding region SNP analysis and subhaplogroup-level control region sequence analysis.

    PubMed

    Lee, Hwan Young; Yoo, Ji-Eun; Park, Myung Jin; Chung, Ukhee; Kim, Chong-Youl; Shin, Kyoung-Jin

    2006-11-01

    The present study analyzed 21 coding region SNP markers and one deletion motif for the determination of East Asian mitochondrial DNA (mtDNA) haplogroups by designing three multiplex systems which apply single base extension methods. Using two multiplex systems, all 593 Korean mtDNAs were allocated into 15 haplogroups: M, D, D4, D5, G, M7, M8, M9, M10, M11, R, R9, B, A, and N9. As the D4 haplotypes occurred most frequently in Koreans, the third multiplex system was used to further define D4 subhaplogroups: D4a, D4b, D4e, D4g, D4h, and D4j. This method allowed the complementation of coding region information with control region mutation motifs and the resultant findings also suggest reliable control region mutation motifs for the assignment of East Asian mtDNA haplogroups. These three multiplex systems produce good results in degraded samples as they contain small PCR products (101-154 bp) for single base extension reactions. SNP scoring was performed in 101 old skeletal remains using these three systems to prove their utility in degraded samples. The sequence analysis of mtDNA control region with high incidence of haplogroup-specific mutations and the selective scoring of highly informative coding region SNPs using the three multiplex systems are useful tools for most applications involving East Asian mtDNA haplogroup determination and haplogroup-directed stringent quality control.

  3. Lineage-Specific Biology Revealed by a Finished Genome Assembly of the Mouse

    PubMed Central

    Hillier, LaDeana W.; Zody, Michael C.; Goldstein, Steve; She, Xinwe; Bult, Carol J.; Agarwala, Richa; Cherry, Joshua L.; DiCuccio, Michael; Hlavina, Wratko; Kapustin, Yuri; Meric, Peter; Maglott, Donna; Birtle, Zoë; Marques, Ana C.; Graves, Tina; Zhou, Shiguo; Teague, Brian; Potamousis, Konstantinos; Churas, Christopher; Place, Michael; Herschleb, Jill; Runnheim, Ron; Forrest, Daniel; Amos-Landgraf, James; Schwartz, David C.; Cheng, Ze; Lindblad-Toh, Kerstin; Eichler, Evan E.; Ponting, Chris P.

    2009-01-01

    The mouse (Mus musculus) is the premier animal model for understanding human disease and development. Here we show that a comprehensive understanding of mouse biology is only possible with the availability of a finished, high-quality genome assembly. The finished clone-based assembly of the mouse strain C57BL/6J reported here has over 175,000 fewer gaps and over 139 Mb more of novel sequence, compared with the earlier MGSCv3 draft genome assembly. In a comprehensive analysis of this revised genome sequence, we are now able to define 20,210 protein-coding genes, over a thousand more than predicted in the human genome (19,042 genes). In addition, we identified 439 long, non–protein-coding RNAs with evidence for transcribed orthologs in human. We analyzed the complex and repetitive landscape of 267 Mb of sequence that was missing or misassembled in the previously published assembly, and we provide insights into the reasons for its resistance to sequencing and assembly by whole-genome shotgun approaches. Duplicated regions within newly assembled sequence tend to be of more recent ancestry than duplicates in the published draft, correcting our initial understanding of recent evolution on the mouse lineage. These duplicates appear to be largely composed of sequence regions containing transposable elements and duplicated protein-coding genes; of these, some may be fixed in the mouse population, but at least 40% of segmentally duplicated sequences are copy number variable even among laboratory mouse strains. Mouse lineage-specific regions contain 3,767 genes drawn mainly from rapidly-changing gene families associated with reproductive functions. The finished mouse genome assembly, therefore, greatly improves our understanding of rodent-specific biology and allows the delineation of ancestral biological functions that are shared with human from derived functions that are not. PMID:19468303

  4. Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae).

    PubMed

    Liu, Ze-Xuan; Zhang, Yan; Liu, Yu-Ting; Chang, Qiao-Cheng; Su, Xin; Fu, Xue; Yue, Dong-Mei; Gao, Yuan; Wang, Chun-Ren

    2016-04-01

    Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans.

  5. Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)

    PubMed Central

    Liu, Ze-Xuan; Zhang, Yan; Liu, Yu-Ting; Chang, Qiao-Cheng; Su, Xin; Fu, Xue; Yue, Dong-Mei; Gao, Yuan; Wang, Chun-Ren

    2016-01-01

    Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans. PMID:27180575

  6. The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

    1994-12-31

    Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

  7. Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

    PubMed Central

    Hobbs, A A; Rosen, J M

    1982-01-01

    The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

  8. The complete mitochondrial genome of Chrysopa pallens (Insecta, Neuroptera, Chrysopidae).

    PubMed

    He, Kun; Chen, Zhe; Yu, Dan-Na; Zhang, Jia-Yong

    2012-10-01

    The complete mitochondrial genome of Chrysopa pallens (Neuroptera, Chrysopidae) was sequenced. It consists of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA (rRNA) genes, and a control region (AT-rich region). The total length of C. pallens mitogenome is 16,723 bp with 79.5% AT content, and the length of control region is 1905 bp with 89.1% AT content. The non-coding regions of C. pallens include control region between 12S rRNA and trnI genes, and a 75-bp space region between trnI and trnQ genes.

  9. Multiple copies of a bile acid-inducible gene in Eubacterium sp. strain VPI 12708.

    PubMed Central

    Gopal-Srivastava, R; Mallonee, D H; White, W B; Hylemon, P B

    1990-01-01

    Eubacterium sp. strain VPI 12708 is an anaerobic intestinal bacterium which possesses inducible bile acid 7-dehydroxylation activity. Several new polypeptides are produced in this strain following induction with cholic acid. Genes coding for two copies of a bile acid-inducible 27,000-dalton polypeptide (baiA1 and baiA2) have been previously cloned and sequenced. We now report on a gene coding for a third copy of this 27,000-dalton polypeptide (baiA3). The baiA3 gene has been cloned in lambda DASH on an 11.2-kilobase DNA fragment from a partial Sau3A digest of the Eubacterium DNA. DNA sequence analysis of the baiA3 gene revealed 100% homology with the baiA1 gene within the coding region of the 27,000-dalton polypeptides. The baiA2 gene shares 81% sequence identity with the other two genes at the nucleotide level. The flanking nucleotide sequences associated with the baiA1 and baiA3 genes are identical for 930 bases in the 5' direction from the initiation codon and for at least 325 bases in the 3' direction from the stop codon, including the putative promoter regions for the genes. An additional open reading frame (occupying from 621 to 648 bases, depending on the correct start codon) was found in the identical 5' regions associated with the baiA1 and baiA3 clones. The 5' sequence 930 bases upstream from the baiA1 and baiA3 genes was totally divergent. The baiA2 gene, which is part of a large bile acid-inducible operon, showed no homology with the other two genes either in the 5' or 3' direction from the polypeptide coding region, except for a 15-base-pair presumed ribosome-binding site in the 5' region. These studies strongly suggest that a gene duplication (baiA1 and baiA3) has occurred and is stably maintained in this bacterium. Images PMID:2376563

  10. Comparative Analysis of the Complete Plastomes of Apostasia wallichii and Neuwiedia singapureana (Apostasioideae) Reveals Different Evolutionary Dynamics of IR/SSC Boundary among Photosynthetic Orchids.

    PubMed

    Niu, Zhitao; Pan, Jiajia; Zhu, Shuying; Li, Ludan; Xue, Qingyun; Liu, Wei; Ding, Xiaoyu

    2017-01-01

    Apostasioideae, consists of only two genera, Apostasia and Neuwiedia , which are mainly distributed in Southeast Asia and northern Australia. The floral structure, taxonomy, biogeography, and genome variation of Apostasioideae have been intensively studied. However, detailed analyses of plastome composition and structure and comparisons with those of other orchid subfamilies have not yet been conducted. Here, the complete plastome sequences of Apostasia wallichii and Neuwiedia singapureana were sequenced and compared with 43 previously published photosynthetic orchid plastomes to characterize the plastome structure and evolution in the orchids. Unlike many orchid plastomes (e.g., Paphiopedilum and Vanilla ), the plastomes of Apostasioideae contain a full set of 11 functional NADH dehydrogenase ( ndh ) genes. The distribution of repeat sequences and simple sequence repeat elements enhanced the view that the mutation rate of non-coding regions was higher than that of coding regions. The 10 loci- ndhA intron, matK-5'trnK , clpP-psbB , rps8-rpl14 , trnT-trnL , 3'trnK-matK , clpP intron , psbK-trnK , trnS-psbC , and ndhF-rpl32 -that had the highest degrees of sequence variability were identified as mutational hotspots for the Apostasia plastome. Furthermore, our results revealed that plastid genes exhibited a variable evolution rate within and among different orchid genus. Considering the diversified evolution of both coding and non-coding regions, we suggested that the plastome-wide evolution of orchid species was disproportional. Additionally, the sequences flanking the inverted repeat/small single copy (IR/SSC) junctions of photosynthetic orchid plastomes were categorized into three types according to the presence/absence of ndh genes. Different evolutionary dynamics for each of the three IR/SSC types of photosynthetic orchid plastomes were also proposed.

  11. Comparative Analysis of the Complete Plastomes of Apostasia wallichii and Neuwiedia singapureana (Apostasioideae) Reveals Different Evolutionary Dynamics of IR/SSC Boundary among Photosynthetic Orchids

    PubMed Central

    Niu, Zhitao; Pan, Jiajia; Zhu, Shuying; Li, Ludan; Xue, Qingyun; Liu, Wei; Ding, Xiaoyu

    2017-01-01

    Apostasioideae, consists of only two genera, Apostasia and Neuwiedia, which are mainly distributed in Southeast Asia and northern Australia. The floral structure, taxonomy, biogeography, and genome variation of Apostasioideae have been intensively studied. However, detailed analyses of plastome composition and structure and comparisons with those of other orchid subfamilies have not yet been conducted. Here, the complete plastome sequences of Apostasia wallichii and Neuwiedia singapureana were sequenced and compared with 43 previously published photosynthetic orchid plastomes to characterize the plastome structure and evolution in the orchids. Unlike many orchid plastomes (e.g., Paphiopedilum and Vanilla), the plastomes of Apostasioideae contain a full set of 11 functional NADH dehydrogenase (ndh) genes. The distribution of repeat sequences and simple sequence repeat elements enhanced the view that the mutation rate of non-coding regions was higher than that of coding regions. The 10 loci—ndhA intron, matK-5′trnK, clpP-psbB, rps8-rpl14, trnT-trnL, 3′trnK-matK, clpP intron, psbK-trnK, trnS-psbC, and ndhF-rpl32—that had the highest degrees of sequence variability were identified as mutational hotspots for the Apostasia plastome. Furthermore, our results revealed that plastid genes exhibited a variable evolution rate within and among different orchid genus. Considering the diversified evolution of both coding and non-coding regions, we suggested that the plastome-wide evolution of orchid species was disproportional. Additionally, the sequences flanking the inverted repeat/small single copy (IR/SSC) junctions of photosynthetic orchid plastomes were categorized into three types according to the presence/absence of ndh genes. Different evolutionary dynamics for each of the three IR/SSC types of photosynthetic orchid plastomes were also proposed. PMID:29046685

  12. Tau mRNA 3'UTR-to-CDS ratio is increased in Alzheimer disease.

    PubMed

    García-Escudero, Vega; Gargini, Ricardo; Martín-Maestro, Patricia; García, Esther; García-Escudero, Ramón; Avila, Jesús

    2017-08-10

    Neurons frequently show an imbalance in expression of the 3' untranslated region (3'UTR) relative to the coding DNA sequence (CDS) region of mature messenger RNAs (mRNA). The ratio varies among different cells or parts of the brain. The Map2 protein levels per cell depend on the 3'UTR-to-CDS ratio rather than the total mRNA amount, which suggests powerful regulation of protein expression by 3'UTR sequences. Here we found that MAPT (the microtubule-associated protein tau gene) 3'UTR levels are particularly high with respect to other genes; indeed, the 3'UTR-to-CDS ratio of MAPT is balanced in healthy brain in mouse and human. The tau protein accumulates in Alzheimer diseased brain. We nonetheless observed that the levels of RNA encoding MAPT/tau were diminished in these patients' brains. To explain this apparently contradictory result, we studied MAPT mRNA stoichiometry in coding and non-coding regions, and found that the 3'UTR-to-CDS ratio was higher in the hippocampus of Alzheimer disease patients, with higher tau protein but lower total mRNA levels. Our data indicate that changes in the 3'UTR-to-CDS ratio have a regulatory role in the disease. Future research should thus consider not only mRNA levels, but also the ratios between coding and non-coding regions. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Molecular characterization of amino acid deletion in VP1 (1D) protein and novel amino acid substitutions in 3D polymerase protein of foot and mouth disease virus subtype A/Iran87.

    PubMed

    Esmaelizad, Majid; Jelokhani-Niaraki, Saber; Hashemnejad, Khadije; Kamalzadeh, Morteza; Lotfi, Mohsen

    2011-12-01

    The nucleotide sequence of the VP1 (1D) and partial 3D polymerase (3D(pol)) coding regions of the foot and mouth disease virus (FMDV) vaccine strain A/Iran87, a highly passaged isolate (~150 passages), was determined and aligned with previously published FMDV serotype A sequences. Overall analysis of the amino acid substitutions revealed that the partial 3D(pol) coding region contained four amino acid alterations. Amino acid sequence comparison of the VP1 coding region of the field isolates revealed deletions in the highly passaged Iranian isolate (A/Iran87). The prominent G-H loop of the FMDV VP1 protein contains the conserved arginine-glycine-aspartic acid (RGD) tripeptide, which is a well-known ligand for a specific cell surface integrin. Despite losing the RGD sequence of the VP1 protein and an Asp(26)→Glu substitution in a beta sheet located within a small groove of the 3D(pol) protein, the virus grew in BHK 21 suspension cell cultures. Since this strain has been used as a vaccine strain, it may be inferred that the RGD deletion has no critical role in virus attachment to the cell during the initiation of infection. It is probable that this FMDV subtype can utilize other pathways for cell attachment.

  14. End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

    PubMed

    Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

    2015-12-01

    Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

  15. Semiconductor Whole Exome Sequencing for the Identification of Genetic Variants in Colombian Patients Clinically Diagnosed with Long QT Syndrome.

    PubMed

    Burgos, Mariana; Arenas, Alvaro; Cabrera, Rodrigo

    2016-08-01

    Inherited long QT syndrome (LQTS) is a cardiac channelopathy characterized by a prolongation of QT interval and the risk of syncope, cardiac arrest, and sudden cardiac death. Genetic diagnosis of LQTS is critical in medical practice as results can guide adequate management of patients and distinguish phenocopies such as catecholaminergic polymorphic ventricular tachycardia (CPVT). However, extensive screening of large genomic regions is required in order to reliably identify genetic causes. Semiconductor whole exome sequencing (WES) is a promising approach for the identification of variants in the coding regions of most human genes. DNA samples from 21 Colombian patients clinically diagnosed with LQTS were enriched for coding regions using multiplex polymerase chain reaction (PCR) and subjected to WES using a semiconductor sequencer. Semiconductor WES showed mean coverage of 93.6 % for all coding regions relevant to LQTS at >10× depth with high intra- and inter-assay depth heterogeneity. Fifteen variants were detected in 12 patients in genes associated with LQTS. Three variants were identified in three patients in genes associated with CPVT. Co-segregation analysis was performed when possible. All variants were analyzed with two pathogenicity prediction algorithms. The overall prevalence of LQTS and CPVT variants in our cohort was 71.4 %. All LQTS variants previously identified through commercial genetic testing were identified. Standardized WES assays can be easily implemented, often at a lower cost than sequencing panels. Our results show that WES can identify LQTS-causing mutations and permits differential diagnosis of related conditions in a real-world clinical setting. However, high heterogeneity in sequencing depth and low coverage in the most relevant genes is expected to be associated with reduced analytical sensitivity.

  16. Exome sequencing and arrayCGH detection of gene sequence and copy number variation between ILS and ISS mouse strains.

    PubMed

    Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M

    2014-06-01

    It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.

  17. The complete mitogenome of the river blackfish, Gadopsis marmoratus (Richardson, 1848) (Teleostei: Percichthyidae).

    PubMed

    Gan, Han Ming; Tan, Mun Hua; Lee, Yin Peng; Austin, Christopher M

    2016-05-01

    The mitogenome of the Australian freshwater blackfish, Gadopsis marmoratus was recovered coverage by genome skimming using the MiSeq sequencer (GenBank Accession Number: NC_024436). The blackfish mitogenome has 16,407 base pairs made up of 13 protein-coding genes, 2 ribosomal subunit genes, 22 transfer RNAs, and a 819 bp non-coding AT-rich region. This is the 5th mitogenome sequence to be reported for the family Percichthyidae.

  18. A deep learning method for lincRNA detection using auto-encoder algorithm.

    PubMed

    Yu, Ning; Yu, Zeng; Pan, Yi

    2017-12-06

    RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly annotated lincRNA data, deep learning methods based on auto-encoder algorithm can exert their capability in knowledge learning in order to capture the useful features and the information correlation along DNA genome sequences for lincRNA detection. As our knowledge, this is the first application to adopt the deep learning techniques for identifying lincRNA transcription sequences.

  19. Mitochondrial genome sequence of Egyptian swift Rock Pigeon (Columba livia breed Egyptian swift).

    PubMed

    Li, Chun-Hong; Shi, Wei; Shi, Wan-Yu

    2015-06-01

    The Egyptian swift Rock Pigeon is a breed of fancy pigeon developed over many years of selective breeding. In this work, we report the complete mitochondrial genome sequence of Egyptian swift Rock Pigeon. The total length of the mitogenome was 17,239 bp and its overall base composition was estimated to be 30.2% for A, 24.0% for T, 31.9% for C and 13.9% for G, indicating an A-T (54.2%)-rich feature in the mitogenome. It contained the typical structure of 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and a non-coding control region (D-loop region). The complete mitochondrial genome sequence of Egyptian swift Rock Pigeon would serve as an important data set of the germplasm resources for further study.

  20. Correlations of nucleotide substitution rates and base composition of mammalian coding sequences with protein structure.

    PubMed

    Chiusano, M L; D'Onofrio, G; Alvarez-Valin, F; Jabbari, K; Colonna, G; Bernardi, G

    1999-09-30

    We investigated the relationships between the nucleotide substitution rates and the predicted secondary structures in the three states representation (alpha-helix, beta-sheet, and coil). The analysis was carried out on 34 alignments, each of which comprised sequences belonging to at least four different mammalian orders. The rates of synonymous substitution were found to be significantly different in regions predicted to be alpha-helix, beta-sheet, or coil. Likewise, the nonsynonymous rates also differ, although expectedly at a lower extent, in the three types of secondary structure, suggesting that different selective constraints associated with the different structures are affecting in a similar way the synonymous and nonsynonymous rates. Moreover, the base composition of the third codon positions is different in coding sequence regions corresponding to different secondary structures of proteins.

  1. A Sabin 3-Derived Poliovirus Recombinant Contained a Sequence Homologous with Indigenous Human Enterovirus Species C in the Viral Polymerase Coding Region†

    PubMed Central

    Arita, Minetaro; Zhu, Shuang-Li; Yoshida, Hiromu; Yoneyama, Tetsuo; Miyamura, Tatsuo; Shimizu, Hiroyuki

    2005-01-01

    Outbreaks of poliomyelitis caused by circulating vaccine-derived polioviruses (cVDPVs) have been reported in areas where indigenous wild polioviruses (PVs) were eliminated by vaccination. Most of these cVDPVs contained unidentified sequences in the nonstructural protein coding region which were considered to be derived from human enterovirus species C (HEV-C) by recombination. In this study, we report isolation of a Sabin 3-derived PV recombinant (Cambodia-02) from an acute flaccid paralysis (AFP) case in Cambodia in 2002. We attempted to identify the putative recombination counterpart of Cambodia-02 by sequence analysis of nonpolio enterovirus isolates from AFP cases in Cambodia from 1999 to 2003. Based on the previously estimated evolution rates of PVs, the recombination event resulting in Cambodia-02 was estimated to have occurred within 6 months after the administration of oral PV vaccine (99.3% nucleotide identity in VP1 region). The 2BC and the 3Dpol coding regions of Cambodia-02 were grouped into the genetic cluster of indigenous coxsackie A virus type 17 (CAV17) (the highest [87.1%] nucleotide identity) and the cluster of indigenous CAV13-CAV18 (the highest [94.9%] nucleotide identity) by the phylogenic analysis of the HEV-C isolates in 2002, respectively. CAV13-CAV18 and CAV17 were the dominant HEV-C serotypes in 2002 but not in 2001 and in 2003. We found a putative recombination between CAV13-CAV18 and CAV17 in the 3CDpro coding region of a CAV17 isolate. These results suggested that a part of the 3Dpol coding region of PV3(Cambodia-02) was derived from a HEV-C strain genetically related to indigenous CAV13-CAV18 strains in 2002 in Cambodia. PMID:16188967

  2. Consensus coding sequence (CCDS) database: a standardized set of human and mouse protein-coding regions supported by expert curation

    PubMed Central

    Pujar, Shashikant; O’Leary, Nuala A; Farrell, Catherine M; Mudge, Jonathan M; Wallin, Craig; Diekhans, Mark; Barnes, If; Bennett, Ruth; Berry, Andrew E; Cox, Eric; Davidson, Claire; Goldfarb, Tamara; Gonzalez, Jose M; Hunt, Toby; Jackson, John; Joardar, Vinita; Kay, Mike P; Kodali, Vamsi K; McAndrews, Monica; McGarvey, Kelly M; Murphy, Michael; Rajput, Bhanu; Rangwala, Sanjida H; Riddick, Lillian D; Seal, Ruth L; Webb, David; Zhu, Sophia; Aken, Bronwen L; Bult, Carol J; Frankish, Adam; Pruitt, Kim D

    2018-01-01

    Abstract The Consensus Coding Sequence (CCDS) project provides a dataset of protein-coding regions that are identically annotated on the human and mouse reference genome assembly in genome annotations produced independently by NCBI and the Ensembl group at EMBL-EBI. This dataset is the product of an international collaboration that includes NCBI, Ensembl, HUGO Gene Nomenclature Committee, Mouse Genome Informatics and University of California, Santa Cruz. Identically annotated coding regions, which are generated using an automated pipeline and pass multiple quality assurance checks, are assigned a stable and tracked identifier (CCDS ID). Additionally, coordinated manual review by expert curators from the CCDS collaboration helps in maintaining the integrity and high quality of the dataset. The CCDS data are available through an interactive web page (https://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi) and an FTP site (ftp://ftp.ncbi.nlm.nih.gov/pub/CCDS/). In this paper, we outline the ongoing work, growth and stability of the CCDS dataset and provide updates on new collaboration members and new features added to the CCDS user interface. We also present expert curation scenarios, with specific examples highlighting the importance of an accurate reference genome assembly and the crucial role played by input from the research community. PMID:29126148

  3. Parametric modulation of reward sequences during a reversal task in ACC and VMPFC but not amygdala and striatum.

    PubMed

    Becker, Michael P I; Nitsch, Alexander M; Hewig, Johannes; Miltner, Wolfgang H R; Straube, Thomas

    2016-12-01

    Several regions of the frontal cortex interact with striatal and amygdala regions to mediate the evaluation of reward-related information and subsequent adjustment of response choices. Recent theories discuss the particular relevance of dorsal anterior cingulate cortex (dACC) for switching behavior; consecutively, ventromedial prefrontal cortex (VMPFC) is involved in mediating exploitative behaviors by tracking reward values unfolding after the behavioral switch. Amygdala, on the other hand, has been implied in coding the valence of stimulus-outcome associations and the ventral striatum (VS) has consistently been shown to code a reward prediction error (RPE). Here, we used fMRI data acquired in humans during a reversal task to parametrically model different sequences of positive feedback in order to unravel differential contributions of these brain regions to the tracking and exploitation of rewards. Parameters from an Optimal Bayesian Learner accurately predicted the divergent involvement of dACC and VMPFC during feedback processing: dACC signaled the first, but not later, presentations of positive feedback, while VMPFC coded trial-by-trial accumulations in reward value. Our results confirm that dACC carries a prominent confirmatory signal during processing of first positive feedback. Amygdala coded positive feedbacks more uniformly, while striatal regions were associated with RPE. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. microRNA-122 target sites in the hepatitis C virus RNA NS5B coding region and 3' untranslated region: function in replication and influence of RNA secondary structure.

    PubMed

    Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael

    2017-02-01

    We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.

  5. Characterization and phylogenetic analysis of the swine leukocyte antigen 3 gene from Korean native pigs.

    PubMed

    Chung, H Y; Choi, Y C; Park, H N

    2015-05-18

    We investigated the phylogenetic relationships between pig breeds, compared the genetic similarity between humans and pigs, and provided basic genetic information on Korean native pigs (KNPs), using genetic variants of the swine leukocyte antigen 3 (SLA-3) gene. Primers were based on sequences from GenBank (accession Nos. AF464010 and AF464009). Polymerase chain reaction analysis amplified approximately 1727 bp of segments, which contained 1086 bp of coding regions and 641 bp of the 3'- and 5'-untranslated regions. Bacterial artificial chromosome clones of miniature pigs were used for sequencing the SLA-3 genomic region, which was 3114 bp in total length, including the coding (1086 bp) and non-coding (2028 bp) regions. Sequence analysis detected 53 single nucleotide polymorphisms (SNPs), based on a minor allele frequency greater than 0.01, which is low compared with other pig breeds, and the results suggest that there is low genetic variability in KNPs. Comparative analysis revealed that humans possess approximately three times more genetic variation than do pigs. Approximately 71% of SNPs in exons 2 and 3 were detected in KNPs, and exon 5 in humans is a highly polymorphic region. Newly identified sequences of SLA-3 using KNPs were submitted to GenBank (accession No. DQ992512-18). Cluster analysis revealed that KNPs were grouped according to three major alleles: SLA-3*0502 (DQ992518), SLA-3*0302 (DQ992513 and DQ992516), and SLA-3*0303 (DQ992512, DQ992514, DQ992515, and DQ992517). Alignments revealed that humans have a relatively close genetic relationship with pigs and chimpanzees. The information provided by this study may be useful in KNP management.

  6. Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

    PubMed Central

    Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

    1982-01-01

    We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

  7. A retroviral oncogene, akt, encoding a serine-threonine kinase containing an SH2-like region.

    PubMed

    Bellacosa, A; Testa, J R; Staal, S P; Tsichlis, P N

    1991-10-11

    The v-akt oncogene codes for a 105-kilodalton fusion phosphoprotein containing Gag sequences at its amino terminus. Sequence analysis of v-akt and biochemical characterization of its product revealed that it codes for a protein kinase C-related serine-threonine kinase whose cellular homolog is expressed in most tissues, with the highest amount found in thymus. Although Akt is a serine-threonine kinase, part of its regulatory region is similar to the Src homology-2 domain, a structural motif characteristic of cytoplasmic tyrosine kinases that functions in protein-protein interactions. This suggests that Akt may form a functional link between tyrosine and serine-threonine phosphorylation pathways.

  8. Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae.

    PubMed

    Gritz, L; Davies, J

    1983-11-01

    The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.

  9. A novel deletion/insertion mutation in the mRNA transcribed from one {alpha}1(I) collagen allele in a family with dominant type III OI and germline mosaicism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, O.; Masters, C.; Lewis, M.B.

    1994-09-01

    In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less

  10. Mechanisms of radiation-induced gene responses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woloschak, G.E.; Paunesku, T.

    1996-10-01

    In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

  11. Evolution and Diversity of the Human Hepatitis D Virus Genome

    PubMed Central

    Huang, Chi-Ruei; Lo, Szecheng J.

    2010-01-01

    Human hepatitis delta virus (HDV) is the smallest RNA virus in genome. HDV genome is divided into a viroid-like sequence and a protein-coding sequence which could have originated from different resources and the HDV genome was eventually constituted through RNA recombination. The genome subsequently diversified through accumulation of mutations selected by interactions between the mutated RNA and proteins with host factors to successfully form the infectious virions. Therefore, we propose that the conservation of HDV nucleotide sequence is highly related with its functionality. Genome analysis of known HDV isolates shows that the C-terminal coding sequences of large delta antigen (LDAg) are the highest diversity than other regions of protein-coding sequences but they still retain biological functionality to interact with the heavy chain of clathrin can be selected and maintained. Since viruses interact with many host factors, including escaping the host immune response, how to design a program to predict RNA genome evolution is a great challenging work. PMID:20204073

  12. Genomic Sequence of the WHO International Standard for Hepatitis A Virus RNA.

    PubMed

    Jenkins, Adrian; Minhas, Rehan; Morris, Clare; Berry, Neil

    2018-05-10

    The World Health Organization (WHO) international standard for hepatitis A virus (HAV) RNA nucleic acid assays was characterized by complete genome sequencing. The entire coding sequence and noncoding regions were assigned HAV genotype IB. This information will aid the design, development, and evaluation of HAV RNA amplification assays. Copyright © 2018 Jenkins et al.

  13. Comparative Mitogenomics of Plant Bugs (Hemiptera: Miridae): Identifying the AGG Codon Reassignments between Serine and Lysine

    PubMed Central

    Wang, Pei; Song, Fan; Cai, Wanzhi

    2014-01-01

    Insect mitochondrial genomes are very important to understand the molecular evolution as well as for phylogenetic and phylogeographic studies of the insects. The Miridae are the largest family of Heteroptera encompassing more than 11,000 described species and of great economic importance. For better understanding the diversity and the evolution of plant bugs, we sequence five new mitochondrial genomes and present the first comparative analysis of nine mitochondrial genomes of mirids available to date. Our result showed that gene content, gene arrangement, base composition and sequences of mitochondrial transcription termination factor were conserved in plant bugs. Intra-genus species shared more conserved genomic characteristics, such as nucleotide and amino acid composition of protein-coding genes, secondary structure and anticodon mutations of tRNAs, and non-coding sequences. Control region possessed several distinct characteristics, including: variable size, abundant tandem repetitions, and intra-genus conservation; and was useful in evolutionary and population genetic studies. The AGG codon reassignments were investigated between serine and lysine in the genera Adelphocoris and other cimicomorphans. Our analysis revealed correlated evolution between reassignments of the AGG codon and specific point mutations at the antidocons of tRNALys and tRNASer(AGN). Phylogenetic analysis indicated that mitochondrial genome sequences were useful in resolving family level relationship of Cimicomorpha. Comparative evolutionary analysis of plant bug mitochondrial genomes allowed the identification of previously neglected coding genes or non-coding regions as potential molecular markers. The finding of the AGG codon reassignments between serine and lysine indicated the parallel evolution of the genetic code in Hemiptera mitochondrial genomes. PMID:24988409

  14. Characterisation of ATM mutations in Slavic Ataxia telangiectasia patients.

    PubMed

    Soukupova, Jana; Pohlreich, Petr; Seemanova, Eva

    2011-09-01

    Ataxia telangiectasia (AT) is a genomic instability syndrome characterised, among others, by progressive cerebellar degeneration, oculocutaneous telangiectases, immunodeficiency, elevated serum alpha-phetoprotein level, chromosomal breakage, hypersensitivity to ionising radiation and increased cancer risk. This autosomal recessive disorder is caused by mutations in the ataxia telangiectasia mutated (ATM) gene coding for serine/threonine protein kinase with a crucial role in response to DNA double-strand breaks. We characterised genotype and phenotype of 12 Slavic AT patients from 11 families. Mutation analysis included sequencing of the entire coding sequence, adjacent intron regions, 3'UTR and 5'UTR of the ATM gene and multiplex ligation-dependent probe amplification (MLPA) for the detection of large deletions/duplications at the ATM locus. The high incidence of new and individual mutations demonstrates a marked mutational heterogeneity of AT in the Czech Republic. Our data indicate that sequence analysis of the entire coding region of ATM is sufficient for a high detection rate of mutations in ATM and that MLPA analysis for the detection of deletions/duplications seems to be redundant in the Slavic population.

  15. Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing.

    PubMed

    Kanda, Kojun; Pflug, James M; Sproul, John S; Dasenko, Mark A; Maddison, David R

    2015-01-01

    In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles being more successfully sequenced.

  16. Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing

    PubMed Central

    Dasenko, Mark A.

    2015-01-01

    In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles being more successfully sequenced. PMID:26716693

  17. Error and Error Mitigation in Low-Coverage Genome Assemblies

    PubMed Central

    Hubisz, Melissa J.; Lin, Michael F.; Kellis, Manolis; Siepel, Adam

    2011-01-01

    The recent release of twenty-two new genome sequences has dramatically increased the data available for mammalian comparative genomics, but twenty of these new sequences are currently limited to ∼2× coverage. Here we examine the extent of sequencing error in these 2× assemblies, and its potential impact in downstream analyses. By comparing 2× assemblies with high-quality sequences from the ENCODE regions, we estimate the rate of sequencing error to be 1–4 errors per kilobase. While this error rate is fairly modest, sequencing error can still have surprising effects. For example, an apparent lineage-specific insertion in a coding region is more likely to reflect sequencing error than a true biological event, and the length distribution of coding indels is strongly distorted by error. We find that most errors are contributed by a small fraction of bases with low quality scores, in particular, by the ends of reads in regions of single-read coverage in the assembly. We explore several approaches for automatic sequencing error mitigation (SEM), making use of the localized nature of sequencing error, the fact that it is well predicted by quality scores, and information about errors that comes from comparisons across species. Our automatic methods for error mitigation cannot replace the need for additional sequencing, but they do allow substantial fractions of errors to be masked or eliminated at the cost of modest amounts of over-correction, and they can reduce the impact of error in downstream phylogenomic analyses. Our error-mitigated alignments are available for download. PMID:21340033

  18. Sequence Polishing Library (SPL) v10.0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oberortner, Ernst

    The Sequence Polishing Library (SPL) is a suite of software tools in order to automate "Design for Synthesis and Assembly" workflows. Specifically: The SPL "Converter" tool converts files among the following sequence data exchange formats: CSV, FASTA, GenBank, and Synthetic Biology Open Language (SBOL); The SPL "Juggler" tool optimizes the codon usages of DNA coding sequences according to an optimization strategy, a user-specific codon usage table and genetic code. In addition, the SPL "Juggler" can translate amino acid sequences into DNA sequences.:The SPL "Polisher" verifies NA sequences against DNA synthesis constraints, such as GC content, repeating k-mers, and restriction sites.more » In case of violations, the "Polisher" reports the violations in a comprehensive manner. The "Polisher" tool can also modify the violating regions according to an optimization strategy, a user-specific codon usage table and genetic code;The SPL "Partitioner" decomposes large DNA sequences into smaller building blocks with partial overlaps that enable an efficient assembly. The "Partitioner" enables the user to configure the characteristics of the overlaps, which are mostly determined by the utilized assembly protocol, such as length, GC content, or melting temperature.« less

  19. The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

    PubMed

    Holland, M J; Holland, J P; Thill, G P; Jackson, K A

    1981-02-10

    Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.

  20. Hermes Transposon Distribution and Structure in Musca domestica

    PubMed Central

    Subramanian, Ramanand A.; Cathcart, Laura A.; Krafsur, Elliot S.; Atkinson, Peter W.

    2009-01-01

    Hermes are hAT transposons from Musca domestica that are very closely related to the hobo transposons from Drosophila melanogaster and are useful as gene vectors in a wide variety of organisms including insects, planaria, and yeast. hobo elements show distinct length variations in a rapidly evolving region of the transposase-coding region as a result of expansions and contractions of a simple repeat sequence encoding 3 amino acids threonine, proline, and glutamic acid (TPE). These variations in length may influence the function of the protein and the movement of hobo transposons in natural populations. Here, we determine the distribution of Hermes in populations of M. domestica as well as whether Hermes transposase has undergone similar sequence expansions and contractions during its evolution in this species. Hermes transposons were found in all M. domestica individuals sampled from 14 populations collected from 4 continents. All individuals with Hermes transposons had evidence for the presence of intact transposase open reading frames, and little sequence variation was observed among Hermes elements. A systematic analysis of the TPE-homologous region of the Hermes transposase-coding region revealed no evidence for length variation. The simple sequence repeat found in hobo elements is a feature of this transposon that evolved since the divergence of hobo and Hermes. PMID:19366812

  1. Negligible impact of rare autoimmune-locus coding-region variants on missing heritability.

    PubMed

    Hunt, Karen A; Mistry, Vanisha; Bockett, Nicholas A; Ahmad, Tariq; Ban, Maria; Barker, Jonathan N; Barrett, Jeffrey C; Blackburn, Hannah; Brand, Oliver; Burren, Oliver; Capon, Francesca; Compston, Alastair; Gough, Stephen C L; Jostins, Luke; Kong, Yong; Lee, James C; Lek, Monkol; MacArthur, Daniel G; Mansfield, John C; Mathew, Christopher G; Mein, Charles A; Mirza, Muddassar; Nutland, Sarah; Onengut-Gumuscu, Suna; Papouli, Efterpi; Parkes, Miles; Rich, Stephen S; Sawcer, Steven; Satsangi, Jack; Simmonds, Matthew J; Trembath, Richard C; Walker, Neil M; Wozniak, Eva; Todd, John A; Simpson, Michael A; Plagnol, Vincent; van Heel, David A

    2013-06-13

    Genome-wide association studies (GWAS) have identified common variants of modest-effect size at hundreds of loci for common autoimmune diseases; however, a substantial fraction of heritability remains unexplained, to which rare variants may contribute. To discover rare variants and test them for association with a phenotype, most studies re-sequence a small initial sample size and then genotype the discovered variants in a larger sample set. This approach fails to analyse a large fraction of the rare variants present in the entire sample set. Here we perform simultaneous amplicon-sequencing-based variant discovery and genotyping for coding exons of 25 GWAS risk genes in 41,911 UK residents of white European origin, comprising 24,892 subjects with six autoimmune disease phenotypes and 17,019 controls, and show that rare coding-region variants at known loci have a negligible role in common autoimmune disease susceptibility. These results do not support the rare-variant synthetic genome-wide-association hypothesis (in which unobserved rare causal variants lead to association detected at common tag variants). Many known autoimmune disease risk loci contain multiple, independently associated, common and low-frequency variants, and so genes at these loci are a priori stronger candidates for harbouring rare coding-region variants than other genes. Our data indicate that the missing heritability for common autoimmune diseases may not be attributable to the rare coding-region variant portion of the allelic spectrum, but perhaps, as others have proposed, may be a result of many common-variant loci of weak effect.

  2. A-to-I editing of coding and non-coding RNAs by ADARs

    PubMed Central

    Nishikura, Kazuko

    2016-01-01

    Adenosine deaminases acting on RNA (ADARs) convert adenosine to inosine in double-stranded RNA. This A-to-I editing occurs not only in protein-coding regions of mRNAs, but also frequently in non-coding regions that contain inverted Alu repeats. Editing of coding sequences can result in the expression of functionally altered proteins that are not encoded in the genome, whereas the significance of Alu editing remains largely unknown. Certain microRNA (miRNA) precursors are also edited, leading to reduced expression or altered function of mature miRNAs. Conversely, recent studies indicate that ADAR1 forms a complex with Dicer to promote miRNA processing, revealing a new function of ADAR1 in the regulation of RNA interference. PMID:26648264

  3. Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

    PubMed

    Feng, X; Happ, G M

    1996-11-14

    The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

  4. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

    PubMed

    Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

    1991-09-15

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerr, J.M.; Fisher, L.W.; Termine, J.D.

    The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

  6. Complete mitogenome sequencing and phylogenetic analysis of PaLi yak (Bos grunniens).

    PubMed

    Bao, Pengjia; Guo, Xian; Pei, Jie; Liang, Chunnian; Ding, Xuezhi; Min, Chu; Wang, Hongbo; Wu, Xiaoyun; Yan, Ping

    2016-11-01

    PaLi yak is a very important local breed in China; as a year-round grazing animal, it plays a very important role for the economic and native herdsmen. The PaLi yak complete mitochondrial DNA is sequenced in this study, the total length is 16,324 bp, containing 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and a non-coding control region (D-loop region). The order and composition are similar to most of the other vertebrates. The base contents are: 33.72% A, 25.80% C, 13.21% G and 27.27% T; A + T (60.99%) was higher than G + C (39.01%). The phylogenetic relationships were analyzed using the complete mitogenome sequence, results showed that the genetic relationship between yak and cattle is distinct. These information provides useful data for further study on protection of genetic resources and the taxonomy of Bovinae.

  7. Deep sequencing approaches for the analysis of prokaryotic transcriptional boundaries and dynamics.

    PubMed

    James, Katherine; Cockell, Simon J; Zenkin, Nikolay

    2017-05-01

    The identification of the protein-coding regions of a genome is straightforward due to the universality of start and stop codons. However, the boundaries of the transcribed regions, conditional operon structures, non-coding RNAs and the dynamics of transcription, such as pausing of elongation, are non-trivial to identify, even in the comparatively simple genomes of prokaryotes. Traditional methods for the study of these areas, such as tiling arrays, are noisy, labour-intensive and lack the resolution required for densely-packed bacterial genomes. Recently, deep sequencing has become increasingly popular for the study of the transcriptome due to its lower costs, higher accuracy and single nucleotide resolution. These methods have revolutionised our understanding of prokaryotic transcriptional dynamics. Here, we review the deep sequencing and data analysis techniques that are available for the study of transcription in prokaryotes, and discuss the bioinformatic considerations of these analyses. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Differences in the emergent coding properties of cortical and striatal ensembles

    PubMed Central

    Ma, L.; Hyman, J.M.; Lindsay, A.J.; Phillips, A.G.; Seamans, J.K.

    2016-01-01

    The function of a given brain region is often defined by the coding properties of its individual neurons, yet how this information is combined at the ensemble level is an equally important consideration. In the present study, multiple neurons from the anterior cingulate cortex (ACC) and the dorsal striatum (DS) were recorded simultaneously as rats performed different sequences of the same three actions. Sequence and lever decoding was remarkably similar on a per-neuron basis in the two regions. At the ensemble level, sequence-specific representations in the DS appeared synchronously but transiently along with the representation of lever location, while these two streams of information appeared independently and asynchronously in the ACC. As a result the ACC achieved superior ensemble decoding accuracy overall. Thus, the manner in which information was combined across neurons in an ensemble determined the functional separation of the ACC and DS on this task. PMID:24974796

  9. Comparisons between Arabidopsis thaliana and Drosophila melanogaster in relation to Coding and Noncoding Sequence Length and Gene Expression

    PubMed Central

    Caldwell, Rachel; Lin, Yan-Xia; Zhang, Ren

    2015-01-01

    There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript) length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs) between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length. PMID:26114098

  10. Organization and annotation of the Xcat critical region: elimination of seven positional candidate genes.

    PubMed

    Huang, Kristen M; Geunes-Boyer, Scarlett; Wu, Sufen; Dutra, Amalia; Favor, Jack; Stambolian, Dwight

    2004-05-01

    Xcat mice display X-linked congenital cataracts and are a mouse model for the human X-linked cataract disease Nance Horan syndrome (NHS). The genetic defect in Xcat mice and NHS patients is not known. We isolated and sequenced a BAC contig representing a portion of the Xcat critical region. We combined our sequencing data with the most recent mouse sequence assemblies from both Celera and public databases. The sequence of the 2.2-Mb Xcat critical region was then analyzed for potential Xcat candidate genes. The coding regions of the seven known genes within this area (Rai2, Rbbp7, Ctps2, Calb3, Grpr, Reps2, and Syap1) were sequenced in Xcat mice and no mutations were detected. The expression of Rai2 was quantitatively identical in wild-type and Xcat mutant eyes. These results indicate that the Xcat mutation is within a novel, undiscovered gene.

  11. Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

    PubMed Central

    Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

    2006-01-01

    The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

  12. Mitochondrial genome evolution in the Saccharomyces sensu stricto complex.

    PubMed

    Ruan, Jiangxing; Cheng, Jian; Zhang, Tongcun; Jiang, Huifeng

    2017-01-01

    Exploring the evolutionary patterns of mitochondrial genomes is important for our understanding of the Saccharomyces sensu stricto (SSS) group, which is a model system for genomic evolution and ecological analysis. In this study, we first obtained the complete mitochondrial sequences of two important species, Saccharomyces mikatae and Saccharomyces kudriavzevii. We then compared the mitochondrial genomes in the SSS group with those of close relatives, and found that the non-coding regions evolved rapidly, including dramatic expansion of intergenic regions, fast evolution of introns and almost 20-fold higher rearrangement rates than those of the nuclear genomes. However, the coding regions, and especially the protein-coding genes, are more conserved than those in the nuclear genomes of the SSS group. The different evolutionary patterns of coding and non-coding regions in the mitochondrial and nuclear genomes may be related to the origin of the aerobic fermentation lifestyle in this group. Our analysis thus provides novel insights into the evolution of mitochondrial genomes.

  13. Organizational heterogeneity of vertebrate genomes.

    PubMed

    Frenkel, Svetlana; Kirzhner, Valery; Korol, Abraham

    2012-01-01

    Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS) analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers) in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM) allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.

  14. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis.

    PubMed

    Buldyrev, S V; Goldberger, A L; Havlin, S; Mantegna, R N; Matsa, M E; Peng, C K; Simons, M; Stanley, H E

    1995-05-01

    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  15. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  16. The complete mitochondrial genome of the Feral Rock Pigeon (Columba livia breed feral).

    PubMed

    Li, Chun-Hong; Liu, Fang; Wang, Li

    2014-10-01

    Abstract In the present work, we report the complete mitochondrial genome sequence of feral rock pigeon for the first time. The total length of the mitogenome was 17,239 bp with the base composition of 30.3% for A, 24.0% for T, 31.9% for C, and 13.8% for G and an A-T (54.3 %)-rich feature was detected. It harbored 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and 1 non-coding control region (D-loop region). The arrangement of all genes was identical to the typical mitochondrial genomes of pigeon. The complete mitochondrial genome sequence of feral rock pigeon would serve as an important data set of the germplasm resources for further study.

  17. Consensus coding sequence (CCDS) database: a standardized set of human and mouse protein-coding regions supported by expert curation.

    PubMed

    Pujar, Shashikant; O'Leary, Nuala A; Farrell, Catherine M; Loveland, Jane E; Mudge, Jonathan M; Wallin, Craig; Girón, Carlos G; Diekhans, Mark; Barnes, If; Bennett, Ruth; Berry, Andrew E; Cox, Eric; Davidson, Claire; Goldfarb, Tamara; Gonzalez, Jose M; Hunt, Toby; Jackson, John; Joardar, Vinita; Kay, Mike P; Kodali, Vamsi K; Martin, Fergal J; McAndrews, Monica; McGarvey, Kelly M; Murphy, Michael; Rajput, Bhanu; Rangwala, Sanjida H; Riddick, Lillian D; Seal, Ruth L; Suner, Marie-Marthe; Webb, David; Zhu, Sophia; Aken, Bronwen L; Bruford, Elspeth A; Bult, Carol J; Frankish, Adam; Murphy, Terence; Pruitt, Kim D

    2018-01-04

    The Consensus Coding Sequence (CCDS) project provides a dataset of protein-coding regions that are identically annotated on the human and mouse reference genome assembly in genome annotations produced independently by NCBI and the Ensembl group at EMBL-EBI. This dataset is the product of an international collaboration that includes NCBI, Ensembl, HUGO Gene Nomenclature Committee, Mouse Genome Informatics and University of California, Santa Cruz. Identically annotated coding regions, which are generated using an automated pipeline and pass multiple quality assurance checks, are assigned a stable and tracked identifier (CCDS ID). Additionally, coordinated manual review by expert curators from the CCDS collaboration helps in maintaining the integrity and high quality of the dataset. The CCDS data are available through an interactive web page (https://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi) and an FTP site (ftp://ftp.ncbi.nlm.nih.gov/pub/CCDS/). In this paper, we outline the ongoing work, growth and stability of the CCDS dataset and provide updates on new collaboration members and new features added to the CCDS user interface. We also present expert curation scenarios, with specific examples highlighting the importance of an accurate reference genome assembly and the crucial role played by input from the research community. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  18. Transcription Factors Bind Thousands of Active and InactiveRegions in the Drosophila Blastoderm

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Xiao-Yong; MacArthur, Stewart; Bourgon, Richard

    2008-01-10

    Identifying the genomic regions bound by sequence-specific regulatory factors is central both to deciphering the complex DNA cis-regulatory code that controls transcription in metazoans and to determining the range of genes that shape animal morphogenesis. Here, we use whole-genome tiling arrays to map sequences bound in Drosophila melanogaster embryos by the six maternal and gap transcription factors that initiate anterior-posterior patterning. We find that these sequence-specific DNA binding proteins bind with quantitatively different specificities to highly overlapping sets of several thousand genomic regions in blastoderm embryos. Specific high- and moderate-affinity in vitro recognition sequences for each factor are enriched inmore » bound regions. This enrichment, however, is not sufficient to explain the pattern of binding in vivo and varies in a context-dependent manner, demonstrating that higher-order rules must govern targeting of transcription factors. The more highly bound regions include all of the over forty well-characterized enhancers known to respond to these factors as well as several hundred putative new cis-regulatory modules clustered near developmental regulators and other genes with patterned expression at this stage of embryogenesis. The new targets include most of the microRNAs (miRNAs) transcribed in the blastoderm, as well as all major zygotically transcribed dorsal-ventral patterning genes, whose expression we show to be quantitatively modulated by anterior-posterior factors. In addition to these highly bound regions, there are several thousand regions that are reproducibly bound at lower levels. However, these poorly bound regions are, collectively, far more distant from genes transcribed in the blastoderm than highly bound regions; are preferentially found in protein-coding sequences; and are less conserved than highly bound regions. Together these observations suggest that many of these poorly-bound regions are not involved in early-embryonic transcriptional regulation, and a significant proportion may be nonfunctional. Surprisingly, for five of the six factors, their recognition sites are not unambiguously more constrained evolutionarily than the immediate flanking DNA, even in more highly bound and presumably functional regions, indicating that comparative DNA sequence analysis is limited in its ability to identify functional transcription factor targets.« less

  19. The complete mitochondrial genome of the Giant Manta ray, Manta birostris.

    PubMed

    Hinojosa-Alvarez, Silvia; Díaz-Jaimes, Pindaro; Marcet-Houben, Marina; Gabaldón, Toni

    2015-01-01

    The complete mitochondrial genome of the giant manta ray (Manta birostris), consists of 18,075 bp with rich A + T and low G content. Gene organization and length is similar to other species of ray. It comprises of 13 protein-coding genes, 2 rRNAs genes, 23 tRNAs genes and 1 non-coding sequence, and the control region. We identified an AT tandem repeat region, similar to that reported in Mobula japanica.

  20. Can mutational GC-pressure create new linear B-cell epitopes in herpes simplex virus type 1 glycoprotein B?

    PubMed

    Khrustalev, Vladislav Victorovich

    2009-01-01

    We showed that GC-content of nucleotide sequences coding for linear B-cell epitopes of herpes simplex virus type 1 (HSV1) glycoprotein B (gB) is higher than GC-content of sequences coding for epitope-free regions of this glycoprotein (G + C = 73 and 64%, respectively). Linear B-cell epitopes have been predicted in HSV1 gB by BepiPred algorithm ( www.cbs.dtu.dk/services/BepiPred ). Proline is an acrophilic amino acid residue (it is usually situated on the surface of protein globules, and so included in linear B-cell epitopes). Indeed, the level of proline is much higher in predicted epitopes of gB than in epitope-free regions (17.8% versus 1.8%). This amino acid is coded by GC-rich codons (CCX) that can be produced due to nucleotide substitutions caused by mutational GC-pressure. GC-pressure will also lead to disappearance of acrophobic phenylalanine, isoleucine, methionine and tyrosine coded by GC-poor codons. Results of our "in-silico directed mutagenesis" showed that single nonsynonymous substitutions in AT to GC direction in two long epitope-free regions of gB will cause formation of new linear epitopes or elongation of previously existing epitopes flanking these regions in 25% of 539 possible cases. The calculations of GC-content and amino acid content have been performed by CodonChanges algorithm ( www.barkovsky.hotmail.ru ).

  1. The complete mitochondrial genome of Lota lota (Gadiformes: Gadidae) from the Burqin River in China.

    PubMed

    Lu, Zhichuang; Zhang, Nan; Song, Na; Gao, Tianxiang

    2016-05-01

    In this study, the complete mitochondrial genome (mitogenome) sequence of Lota lota has been determined by long polymerase chain reaction and primer walking methods. The mitogenome is a circular molecule of 16,519 bp in length and contains 37 mitochondrial genes including 13 protein-coding genes, 2 ribosomal RNA (rRNA), 22 transfer RNA (tRNA) and a control region as other bony fishes. Within the control region, we identified the termination-associated sequence domain (TAS), the central conserved sequence block domains (CSB-F and CSB-D), and the conserved sequence block domains (CSB-1, CSB-2 and CSB-3).

  2. Molecular characterization of Banana streak virus isolate from Musa Acuminata in China.

    PubMed

    Zhuang, Jun; Wang, Jian-Hua; Zhang, Xin; Liu, Zhi-Xin

    2011-12-01

    Banana streak virus (BSV), a member of genus Badnavirus, is a causal agent of banana streak disease throughout the world. The genetic diversity of BSVs from different regions of banana plantations has previously been investigated, but there are relatively few reports of the genetic characteristic of episomal (non-integrated) BSV genomes isolated from China. Here, the complete genome, a total of 7722bp (GenBank accession number DQ092436), of an isolate of Banana streak virus (BSV) on cultivar Cavendish (BSAcYNV) in Yunnan, China was determined. The genome organises in the typical manner of badnaviruses. The intergenic region of genomic DNA contains a large stem-loop, which may contribute to the ribosome shift into the following open reading frames (ORFs). The coding region of BSAcYNV consists of three overlapping ORFs, ORF1 with a non-AUG start codon and ORF2 encoding two small proteins are individually involved in viral movement and ORF3 encodes a polyprotein. Besides the complete genome, a defective genome lacking the whole RNA leader region and a majority of ORF1 and which encompasses 6525bp was also isolated and sequenced from this BSV DNA reservoir in infected banana plants. Sequence analyses showed that BSAcYNV has closest similarity in terms of genome organization and the coding assignments with an BSV isolate from Vietnam (BSAcVNV). The corresponding coding regions shared identities of 88% and -95% at nucleotide and amino acid levels, respectively. Phylogenetic analysis also indicated BSAcYNV shared the closest geographical evolutionary relationship to BSAcVNV among sequenced banana streak badnaviruses.

  3. Sequence-dependent modelling of local DNA bending phenomena: curvature prediction and vibrational analysis.

    PubMed

    Vlahovicek, K; Munteanu, M G; Pongor, S

    1999-01-01

    Bending is a local conformational micropolymorphism of DNA in which the original B-DNA structure is only distorted but not extensively modified. Bending can be predicted by simple static geometry models as well as by a recently developed elastic model that incorporate sequence dependent anisotropic bendability (SDAB). The SDAB model qualitatively explains phenomena including affinity of protein binding, kinking, as well as sequence-dependent vibrational properties of DNA. The vibrational properties of DNA segments can be studied by finite element analysis of a model subjected to an initial bending moment. The frequency spectrum is obtained by applying Fourier analysis to the displacement values in the time domain. This analysis shows that the spectrum of the bending vibrations quite sensitively depends on the sequence, for example the spectrum of a curved sequence is characteristically different from the spectrum of straight sequence motifs of identical basepair composition. Curvature distributions are genome-specific, and pronounced differences are found between protein-coding and regulatory regions, respectively, that is, sites of extreme curvature and/or bendability are less frequent in protein-coding regions. A WWW server is set up for the prediction of curvature and generation of 3D models from DNA sequences (http:@www.icgeb.trieste.it/dna).

  4. The full mitochondrial genome sequence of Raillietina tetragona from chicken (Cestoda: Davaineidae).

    PubMed

    Liang, Jian-Ying; Lin, Rui-Qing

    2016-11-01

    In the present study, the complete mitochondrial DNA (mtDNA) sequence of Raillietina tetragona was sequenced and its gene contents and genome organizations was compared with that of other tapeworm. The complete mt genome sequence of R. tetragona is 14,444 bp in length. It contains 12 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and two non-coding region. All genes are transcribed in the same direction and have a nucleotide composition high in A and T. The contents of A + T of the complete mt genome are 71.4% for R. tetragona. The R. tetragona mt genome sequence provides novel mtDNA marker for studying the molecular epidemiology and population genetics of Raillietina and has implications for the molecular diagnosis of chicken cestodosis caused by Raillietina.

  5. The 2012 Ferrara seismic sequence: Regional crustal structure, earthquake sources, and seismic hazard

    NASA Astrophysics Data System (ADS)

    Malagnini, Luca; Herrmann, Robert B.; Munafò, Irene; Buttinelli, Mauro; Anselmi, Mario; Akinci, Aybige; Boschi, E.

    2012-10-01

    Inadequate seismic design codes can be dangerous, particularly when they underestimate the true hazard. In this study we use data from a sequence of moderate-sized earthquakes in northeast Italy to validate and test a regional wave propagation model which, in turn, is used to understand some weaknesses of the current design spectra. Our velocity model, while regionalized and somewhat ad hoc, is consistent with geophysical observations and the local geology. In the 0.02-0.1 Hz band, this model is validated by using it to calculate moment tensor solutions of 20 earthquakes (5.6 ≥ MW ≥ 3.2) in the 2012 Ferrara, Italy, seismic sequence. The seismic spectra observed for the relatively small main shock significantly exceeded the design spectra to be used in the area for critical structures. Observations and synthetics reveal that the ground motions are dominated by long-duration surface waves, which, apparently, the design codes do not adequately anticipate. In light of our results, the present seismic hazard assessment in the entire Pianura Padana, including the city of Milan, needs to be re-evaluated.

  6. Widespread signatures of local mRNA folding structure selection in four Dengue virus serotypes

    PubMed Central

    2015-01-01

    Background It is known that mRNA folding can affect and regulate various gene expression steps both in living organisms and in viruses. Previous studies have recognized functional RNA structures in the genome of the Dengue virus. However, these studies usually focused either on the viral untranslated regions or on very specific and limited regions at the beginning of the coding sequences, in a limited number of strains, and without considering evolutionary selection. Results Here we performed the first large scale comprehensive genomics analysis of selection for local mRNA folding strength in the Dengue virus coding sequences, based on a total of 1,670 genomes and 4 serotypes. Our analysis identified clusters of positions along the coding regions that may undergo a conserved evolutionary selection for strong or weak local folding maintained across different viral variants. Specifically, 53-66 clusters for strong folding and 49-73 clusters for weak folding (depending on serotype) aggregated of positions with a significant conservation of folding energy signals (related to partially overlapping local genomic regions) were recognized. In addition, up to 7% of these positions were found to be conserved in more than 90% of the viral genomes. Although some of the identified positions undergo frequent synonymous / non-synonymous substitutions, the selection for folding strength therein is preserved, and thus cannot be trivially explained based on sequence conservation alone. Conclusions The fact that many of the positions with significant folding related signals are conserved among different Dengue variants suggests that a better understanding of the mRNA structures in the corresponding regions may promote the development of prospective anti- Dengue vaccination strategies. The comparative genomics approach described here can be employed in the future for detecting functional regions in other pathogens with very high mutations rates. PMID:26449467

  7. Complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera, and comparative analyses with other grass genomes

    PubMed Central

    Saski, Christopher; Lee, Seung-Bum; Fjellheim, Siri; Guda, Chittibabu; Jansen, Robert K.; Luo, Hong; Tomkins, Jeffrey; Rognli, Odd Arne; Clarke, Jihong Liu

    2009-01-01

    Comparisons of complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera to six published grass chloroplast genomes reveal that gene content and order are similar but two microstructural changes have occurred. First, the expansion of the IR at the SSC/IRa boundary that duplicates a portion of the 5′ end of ndhH is restricted to the three genera of the subfamily Pooideae (Agrostis, Hordeum and Triticum). Second, a 6 bp deletion in ndhK is shared by Agrostis, Hordeum, Oryza and Triticum, and this event supports the sister relationship between the subfamilies Erhartoideae and Pooideae. Repeat analysis identified 19–37 direct and inverted repeats 30 bp or longer with a sequence identity of at least 90%. Seventeen of the 26 shared repeats are found in all the grass chloroplast genomes examined and are located in the same genes or intergenic spacer (IGS) regions. Examination of simple sequence repeats (SSRs) identified 16–21 potential polymorphic SSRs. Five IGS regions have 100% sequence identity among Zea mays, Saccharum officinarum and Sorghum bicolor, whereas no spacer regions were identical among Oryza sativa, Triticum aestivum, H. vulgare and A. stolonifera despite their close phylogenetic relationship. Alignment of EST sequences and DNA coding sequences identified six C–U conversions in both Sorghum bicolor and H. vulgare but only one in A. stolonifera. Phylogenetic trees based on DNA sequences of 61 protein-coding genes of 38 taxa using both maximum parsimony and likelihood methods provide moderate support for a sister relationship between the subfamilies Erhartoideae and Pooideae. PMID:17534593

  8. Arc Length Coding by Interference of Theta Frequency Oscillations May Underlie Context-Dependent Hippocampal Unit Data and Episodic Memory Function

    ERIC Educational Resources Information Center

    Hasselmo, Michael E.

    2007-01-01

    Many memory models focus on encoding of sequences by excitatory recurrent synapses in region CA3 of the hippocampus. However, data and modeling suggest an alternate mechanism for encoding of sequences in which interference between theta frequency oscillations encodes the position within a sequence based on spatial arc length or time. Arc length…

  9. Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

    PubMed

    Spielmann, A; Stutz, E

    1983-10-25

    The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.

  10. Complete mitochondrial genome of Bactrocera arecae (Insecta: Tephritidae) by next-generation sequencing and molecular phylogeny of Dacini tribe

    PubMed Central

    Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Chan, Kok-Gan; Chow, Wan-Loo; Eamsobhana, Praphathip

    2015-01-01

    The whole mitochondrial genome of the pest fruit fly Bactrocera arecae was obtained from next-generation sequencing of genomic DNA. It had a total length of 15,900 bp, consisting of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a non-coding region (A + T-rich control region). The control region (952 bp) was flanked by rrnS and trnI genes. The start codons included 6 ATG, 3 ATT and 1 each of ATA, ATC, GTG and TCG. Eight TAA, two TAG, one incomplete TA and two incomplete T stop codons were represented in the protein-coding genes. The cloverleaf structure for trnS1 lacked the D-loop, and that of trnN and trnF lacked the TΨC-loop. Molecular phylogeny based on 13 protein-coding genes was concordant with 37 mitochondrial genes, with B. arecae having closest genetic affinity to B. tryoni. The subgenus Bactrocera of Dacini tribe and the Dacinae subfamily (Dacini and Ceratitidini tribes) were monophyletic. The whole mitogenome of B. arecae will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general. PMID:26472633

  11. Effective gene prediction by high resolution frequency estimator based on least-norm solution technique

    PubMed Central

    2014-01-01

    Linear algebraic concept of subspace plays a significant role in the recent techniques of spectrum estimation. In this article, the authors have utilized the noise subspace concept for finding hidden periodicities in DNA sequence. With the vast growth of genomic sequences, the demand to identify accurately the protein-coding regions in DNA is increasingly rising. Several techniques of DNA feature extraction which involves various cross fields have come up in the recent past, among which application of digital signal processing tools is of prime importance. It is known that coding segments have a 3-base periodicity, while non-coding regions do not have this unique feature. One of the most important spectrum analysis techniques based on the concept of subspace is the least-norm method. The least-norm estimator developed in this paper shows sharp period-3 peaks in coding regions completely eliminating background noise. Comparison of proposed method with existing sliding discrete Fourier transform (SDFT) method popularly known as modified periodogram method has been drawn on several genes from various organisms and the results show that the proposed method has better as well as an effective approach towards gene prediction. Resolution, quality factor, sensitivity, specificity, miss rate, and wrong rate are used to establish superiority of least-norm gene prediction method over existing method. PMID:24386895

  12. Improving the genome annotation of the acarbose producer Actinoplanes sp. SE50/110 by sequencing enriched 5'-ends of primary transcripts.

    PubMed

    Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred

    2014-11-20

    Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. JCoDA: a tool for detecting evolutionary selection.

    PubMed

    Steinway, Steven N; Dannenfelser, Ruth; Laucius, Christopher D; Hayes, James E; Nayak, Sudhir

    2010-05-27

    The incorporation of annotated sequence information from multiple related species in commonly used databases (Ensembl, Flybase, Saccharomyces Genome Database, Wormbase, etc.) has increased dramatically over the last few years. This influx of information has provided a considerable amount of raw material for evaluation of evolutionary relationships. To aid in the process, we have developed JCoDA (Java Codon Delimited Alignment) as a simple-to-use visualization tool for the detection of site specific and regional positive/negative evolutionary selection amongst homologous coding sequences. JCoDA accepts user-inputted unaligned or pre-aligned coding sequences, performs a codon-delimited alignment using ClustalW, and determines the dN/dS calculations using PAML (Phylogenetic Analysis Using Maximum Likelihood, yn00 and codeml) in order to identify regions and sites under evolutionary selection. The JCoDA package includes a graphical interface for Phylip (Phylogeny Inference Package) to generate phylogenetic trees, manages formatting of all required file types, and streamlines passage of information between underlying programs. The raw data are output to user configurable graphs with sliding window options for straightforward visualization of pairwise or gene family comparisons. Additionally, codon-delimited alignments are output in a variety of common formats and all dN/dS calculations can be output in comma-separated value (CSV) format for downstream analysis. To illustrate the types of analyses that are facilitated by JCoDA, we have taken advantage of the well studied sex determination pathway in nematodes as well as the extensive sequence information available to identify genes under positive selection, examples of regional positive selection, and differences in selection based on the role of genes in the sex determination pathway. JCoDA is a configurable, open source, user-friendly visualization tool for performing evolutionary analysis on homologous coding sequences. JCoDA can be used to rapidly screen for genes and regions of genes under selection using PAML. It can be freely downloaded at http://www.tcnj.edu/~nayaklab/jcoda.

  14. JCoDA: a tool for detecting evolutionary selection

    PubMed Central

    2010-01-01

    Background The incorporation of annotated sequence information from multiple related species in commonly used databases (Ensembl, Flybase, Saccharomyces Genome Database, Wormbase, etc.) has increased dramatically over the last few years. This influx of information has provided a considerable amount of raw material for evaluation of evolutionary relationships. To aid in the process, we have developed JCoDA (Java Codon Delimited Alignment) as a simple-to-use visualization tool for the detection of site specific and regional positive/negative evolutionary selection amongst homologous coding sequences. Results JCoDA accepts user-inputted unaligned or pre-aligned coding sequences, performs a codon-delimited alignment using ClustalW, and determines the dN/dS calculations using PAML (Phylogenetic Analysis Using Maximum Likelihood, yn00 and codeml) in order to identify regions and sites under evolutionary selection. The JCoDA package includes a graphical interface for Phylip (Phylogeny Inference Package) to generate phylogenetic trees, manages formatting of all required file types, and streamlines passage of information between underlying programs. The raw data are output to user configurable graphs with sliding window options for straightforward visualization of pairwise or gene family comparisons. Additionally, codon-delimited alignments are output in a variety of common formats and all dN/dS calculations can be output in comma-separated value (CSV) format for downstream analysis. To illustrate the types of analyses that are facilitated by JCoDA, we have taken advantage of the well studied sex determination pathway in nematodes as well as the extensive sequence information available to identify genes under positive selection, examples of regional positive selection, and differences in selection based on the role of genes in the sex determination pathway. Conclusions JCoDA is a configurable, open source, user-friendly visualization tool for performing evolutionary analysis on homologous coding sequences. JCoDA can be used to rapidly screen for genes and regions of genes under selection using PAML. It can be freely downloaded at http://www.tcnj.edu/~nayaklab/jcoda. PMID:20507581

  15. Evaluation of 10 genes encoding cardiac proteins in Doberman Pinschers with dilated cardiomyopathy.

    PubMed

    O'Sullivan, M Lynne; O'Grady, Michael R; Pyle, W Glen; Dawson, John F

    2011-07-01

    To identify a causative mutation for dilated cardiomyopathy (DCM) in Doberman Pinschers by sequencing the coding regions of 10 cardiac genes known to be associated with familial DCM in humans. 5 Doberman Pinschers with DCM and congestive heart failure and 5 control mixed-breed dogs that were euthanized or died. RNA was extracted from frozen ventricular myocardial samples from each dog, and first-strand cDNA was synthesized via reverse transcription, followed by PCR amplification with gene-specific primers. Ten cardiac genes were analyzed: cardiac actin, α-actinin, α-tropomyosin, β-myosin heavy chain, metavinculin, muscle LIM protein, myosinbinding protein C, tafazzin, titin-cap (telethonin), and troponin T. Sequences for DCM-affected and control dogs and the published canine genome were compared. None of the coding sequences yielded a common causative mutation among all Doberman Pinscher samples. However, 3 variants were identified in the α-actinin gene in the DCM-affected Doberman Pinschers. One of these variants, identified in 2 of the 5 Doberman Pinschers, resulted in an amino acid change in the rod-forming triple coiled-coil domain. Mutations in the coding regions of several genes associated with DCM in humans did not appear to consistently account for DCM in Doberman Pinschers. However, an α-actinin variant was detected in some Doberman Pinschers that may contribute to the development of DCM given its potential effect on the structure of this protein. Investigation of additional candidate gene coding and noncoding regions and further evaluation of the role of α-actinin in development of DCM in Doberman Pinschers are warranted.

  16. Parallel computation of genome-scale RNA secondary structure to detect structural constraints on human genome.

    PubMed

    Kawaguchi, Risa; Kiryu, Hisanori

    2016-05-06

    RNA secondary structure around splice sites is known to assist normal splicing by promoting spliceosome recognition. However, analyzing the structural properties of entire intronic regions or pre-mRNA sequences has been difficult hitherto, owing to serious experimental and computational limitations, such as low read coverage and numerical problems. Our novel software, "ParasoR", is designed to run on a computer cluster and enables the exact computation of various structural features of long RNA sequences under the constraint of maximal base-pairing distance. ParasoR divides dynamic programming (DP) matrices into smaller pieces, such that each piece can be computed by a separate computer node without losing the connectivity information between the pieces. ParasoR directly computes the ratios of DP variables to avoid the reduction of numerical precision caused by the cancellation of a large number of Boltzmann factors. The structural preferences of mRNAs computed by ParasoR shows a high concordance with those determined by high-throughput sequencing analyses. Using ParasoR, we investigated the global structural preferences of transcribed regions in the human genome. A genome-wide folding simulation indicated that transcribed regions are significantly more structural than intergenic regions after removing repeat sequences and k-mer frequency bias. In particular, we observed a highly significant preference for base pairing over entire intronic regions as compared to their antisense sequences, as well as to intergenic regions. A comparison between pre-mRNAs and mRNAs showed that coding regions become more accessible after splicing, indicating constraints for translational efficiency. Such changes are correlated with gene expression levels, as well as GC content, and are enriched among genes associated with cytoskeleton and kinase functions. We have shown that ParasoR is very useful for analyzing the structural properties of long RNA sequences such as mRNAs, pre-mRNAs, and long non-coding RNAs whose lengths can be more than a million bases in the human genome. In our analyses, transcribed regions including introns are indicated to be subject to various types of structural constraints that cannot be explained from simple sequence composition biases. ParasoR is freely available at https://github.com/carushi/ParasoR .

  17. Complete chloroplast genome sequence of green foxtail (Setaria viridis), a promising model system for C4 photosynthesis.

    PubMed

    Wang, Shuo; Gao, Li-Zhi

    2016-09-01

    The complete chloroplast genome of green foxtail (Setaria viridis), a promising model system for C4 photosynthesis, is first reported in this study. The genome harbors a large single copy (LSC) region of 81 016 bp and a small single copy (SSC) region of 12 456  bp separated by a pair of inverted repeat (IRa and IRb) regions of 22 315 bp. GC content is 38.92%. The proportion of coding sequence is 57.97%, comprising of 111 (19 duplicated in IR regions) unique genes, 71 of which are protein-coding genes, four are rRNA genes, and 36 are tRNA genes. Phylogenetic analysis indicated that S. viridis was clustered with its cultivated species S. italica in the tribe Paniceae of the family Poaceae. This newly determined chloroplast genome will provide valuable genetic resources to assist future studies on C4 photosynthesis in grasses.

  18. Characterization of a Theta-Type Plasmid from Lactobacillus sakei: a Potential Basis for Low-Copy-Number Vectors in Lactobacilli

    PubMed Central

    Alpert, Carl-Alfred; Crutz-Le Coq, Anne-Marie; Malleret, Christine; Zagorec, Monique

    2003-01-01

    The complete nucleotide sequence of the 13-kb plasmid pRV500, isolated from Lactobacillus sakei RV332, was determined. Sequence analysis enabled the identification of genes coding for a putative type I restriction-modification system, two genes coding for putative recombinases of the integrase family, and a region likely involved in replication. The structural features of this region, comprising a putative ori segment containing 11- and 22-bp repeats and a repA gene coding for a putative initiator protein, indicated that pRV500 belongs to the pUCL287 subfamily of theta-type replicons. A 3.7-kb fragment encompassing this region was fused to an Escherichia coli replicon to produce the shuttle vector pRV566 and was observed to be functional in L. sakei for plasmid replication. The L. sakei replicon alone could not support replication in E. coli. Plasmid pRV500 and its derivative pRV566 were determined to be at very low copy numbers in L. sakei. pRV566 was maintained at a reasonable rate over 20 generations in several lactobacilli, such as Lactobacillus curvatus, Lactobacillus casei, and Lactobacillus plantarum, in addition to L. sakei, making it an interesting basis for developing vectors. Sequence relationships with other plasmids are described and discussed. PMID:12957947

  19. Identification of Methanococcus Jannaschii Proteins in 2-D Gel Electrophoresis Patterns by Mass Spectrometry

    DOE R&D Accomplishments Database

    Liang, X.

    1998-06-10

    The genome of Methanococcus jannaschii has been sequenced completely and has been found to contain approximately 1,770 predicted protein-coding regions. When these coding regions are expressed and how their expression is regulated, however, remain open questions. In this work, mass spectrometry was combined with two-dimensional gel electrophoresis to identify which proteins the genes produce under different growth conditions, and thus investigate the regulation of genes responsible for functions characteristic of this thermophilic representative of the methanogenic Archaea.

  20. Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.

    PubMed

    Yin, Changchuan

    2015-04-01

    To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.

  1. Next generation sequencing yields the complete mitochondrial genome of the Hornlip mullet Plicomugil labiosus (Teleostei: Mugilidae).

    PubMed

    Shen, Kang-Ning; Chen, Ching-Hung; Hsiao, Chung-Der

    2016-05-01

    In this study, the complete mitogenome sequence of hornlip mullet Plicomugil labiosus (Teleostei: Mugilidae) has been sequenced by next-generation sequencing method. The assembled mitogenome, consisting of 16,829 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein coding genes, 22 transfer RNAs, 2 ribosomal RNAs genes and a non-coding control region of D-loop. D-loop contains 1057 bp length is located between tRNA-Pro and tRNA-Phe. The overall base composition of P. labiosus is 28.0% for A, 29.3% for C, 15.5% for G and 27.2% for T. The complete mitogenome may provide essential and important DNA molecular data for further population, phylogenetic and evolutionary analysis for Mugilidae.

  2. Next generation sequencing yields the complete mitochondrial genome of the largescale mullet, Liza macrolepis (Teleostei: Mugilidae).

    PubMed

    Shen, Kang-Ning; Tsai, Shiou-Yi; Chen, Ching-Hung; Hsiao, Chung-Der; Durand, Jean-Dominique

    2016-11-01

    In this study, the complete mitogenome sequence of largescale mullet (Teleostei: Mugilidae) has been sequenced by the next-generation sequencing method. The assembled mitogenome, consisting of 16,832 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 transfer RNAs, two ribosomal RNAs genes, and a non-coding control region of D-loop. D-loop which has a length of 1094 bp is located between tRNA-Pro and tRNA-Phe. The overall base composition of largescale mullet is 27.8% for A, 30.1% for C, 16.2% for G, and 25.9% for T. The complete mitogenome may provide essential and important DNA molecular data for further phylogenetic and evolutionary analysis for Mugilidae.

  3. Complete nucleotide sequence of pig (Sus scrofa) mitochondrial genome and dating evolutionary divergence within Artiodactyla.

    PubMed

    Lin, C S; Sun, Y L; Liu, C Y; Yang, P C; Chang, L C; Cheng, I C; Mao, S J; Huang, M C

    1999-08-05

    The complete nucleotide sequence of the pig (Sus scrofa) mitochondrial genome, containing 16613bp, is presented in this report. The genome is not a specific length because of the presence of the variable numbers of tandem repeats, 5'-CGTGCGTACA in the displacement loop (D-loop). Genes responsible for 12S and 16S rRNAs, 22 tRNAs, and 13 protein-coding regions are found. The genome carries very few intergenic nucleotides with several instances of overlap between protein-coding or tRNA genes, except in the D-loop region. For evaluating the possible evolutionary relationships between Artiodactyla and Cetacea, the nucleotide substitutions and amino acid sequences of 13 protein-coding genes were aligned by pairwise comparisons of the pig, cow, and fin whale. By comparing these sequences, we suggest that there is a closer relationship between the pig and cow than that between either of these species and fin whale. In addition, the accumulation of transversions and gaps in pig 12S and 16S rRNA genes was compared with that in other eutherian species, including cow, fin whale, human, horse, and harbor seal. The results also reveal a close phylogenetic relationship between pig and cow, as compared to fin whale and others. Thus, according to the sequence differences of mitochondrial rRNA genes in eutherian species, the evolutionary separation of pig and cow occurred about 53-60 million years ago.

  4. Comparative and Evolutionary Analyses of Meloidogyne spp. Based on Mitochondrial Genome Sequences

    PubMed Central

    García, Laura Evangelina; Sánchez-Puerta, M. Virginia

    2015-01-01

    Molecular taxonomy and evolution of nematodes have been recently the focus of several studies. Mitochondrial sequences were proposed as an alternative for precise identification of Meloidogyne species, to study intraspecific variability and to follow maternal lineages. We characterized the mitochondrial genomes (mtDNAs) of the root knot nematodes M. floridensis, M. hapla and M. incognita. These were AT rich (81–83%) and highly compact, encoding 12 proteins, 2 rRNAs, and 22 tRNAs. Comparisons with published mtDNAs of M. chitwoodi, M. incognita (another strain) and M. graminicola revealed that they share protein and rRNA gene order but differ in the order of tRNAs. The mtDNAs of M. floridensis and M. incognita were strikingly similar (97–100% identity for all coding regions). In contrast, M. floridensis, M. chitwoodi, M. hapla and M. graminicola showed 65–84% nucleotide identity for coding regions. Variable mitochondrial sequences are potentially useful for evolutionary and taxonomic studies. We developed a molecular taxonomic marker by sequencing a highly-variable ~2 kb mitochondrial region, nad5-cox1, from 36 populations of root-knot nematodes to elucidate relationships within the genus Meloidogyne. Isolates of five species formed monophyletic groups and showed little intraspecific variability. We also present a thorough analysis of the mitochondrial region cox2-rrnS. Phylogenies based on either mitochondrial region had good discrimination power but could not discriminate between M. arenaria, M. incognita and M. floridensis. PMID:25799071

  5. Nonspatial Sequence Coding in CA1 Neurons

    PubMed Central

    Allen, Timothy A.; Salz, Daniel M.; McKenzie, Sam

    2016-01-01

    The hippocampus is critical to the memory for sequences of events, a defining feature of episodic memory. However, the fundamental neuronal mechanisms underlying this capacity remain elusive. While considerable research indicates hippocampal neurons can represent sequences of locations, direct evidence of coding for the memory of sequential relationships among nonspatial events remains lacking. To address this important issue, we recorded neural activity in CA1 as rats performed a hippocampus-dependent sequence-memory task. Briefly, the task involves the presentation of repeated sequences of odors at a single port and requires rats to identify each item as “in sequence” or “out of sequence”. We report that, while the animals' location and behavior remained constant, hippocampal activity differed depending on the temporal context of items—in this case, whether they were presented in or out of sequence. Some neurons showed this effect across items or sequence positions (general sequence cells), while others exhibited selectivity for specific conjunctions of item and sequence position information (conjunctive sequence cells) or for specific probe types (probe-specific sequence cells). We also found that the temporal context of individual trials could be accurately decoded from the activity of neuronal ensembles, that sequence coding at the single-cell and ensemble level was linked to sequence memory performance, and that slow-gamma oscillations (20–40 Hz) were more strongly modulated by temporal context and performance than theta oscillations (4–12 Hz). These findings provide compelling evidence that sequence coding extends beyond the domain of spatial trajectories and is thus a fundamental function of the hippocampus. SIGNIFICANCE STATEMENT The ability to remember the order of life events depends on the hippocampus, but the underlying neural mechanisms remain poorly understood. Here we addressed this issue by recording neural activity in hippocampal region CA1 while rats performed a nonspatial sequence memory task. We found that hippocampal neurons code for the temporal context of items (whether odors were presented in the correct or incorrect sequential position) and that this activity is linked with memory performance. The discovery of this novel form of temporal coding in hippocampal neurons advances our fundamental understanding of the neurobiology of episodic memory and will serve as a foundation for our cross-species, multitechnique approach aimed at elucidating the neural mechanisms underlying memory impairments in aging and dementia. PMID:26843637

  6. Protein structure and the sequential structure of mRNA: alpha-helix and beta-sheet signals at the nucleotide level.

    PubMed

    Brunak, S; Engelbrecht, J

    1996-06-01

    A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed. We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting protein. The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain. A complete search for GenBank nucleotide sequences coding for structural entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment. By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets. These signals do not originate from the clustering of rare codons, but from the similarity of codons coding for very abundant amino acid residues at the N- and C-termini of helices and sheets. No correlation between the positioning of rare codons and the location of structural units was found. The mRNA signals were also compared with conserved nucleotide features of 16S-like ribosomal RNA sequences and related to mechanisms for maintaining the correct reading frame by the ribosome.

  7. ChloroSSRdb: a repository of perfect and imperfect chloroplastic simple sequence repeats (cpSSRs) of green plants

    PubMed Central

    Kapil, Aditi; Rai, Piyush Kant; Shanker, Asheesh

    2014-01-01

    Simple sequence repeats (SSRs) are regions in DNA sequence that contain repeating motifs of length 1–6 nucleotides. These repeats are ubiquitously present and are found in both coding and non-coding regions of genome. A total of 534 complete chloroplast genome sequences (as on 18 September 2014) of Viridiplantae are available at NCBI organelle genome resource. It provides opportunity to mine these genomes for the detection of SSRs and store them in the form of a database. In an attempt to properly manage and retrieve chloroplastic SSRs, we designed ChloroSSRdb which is a relational database developed using SQL server 2008 and accessed through ASP.NET. It provides information of all the three types (perfect, imperfect and compound) of SSRs. At present, ChloroSSRdb contains 124 430 mined SSRs, with majority lying in non-coding region. Out of these, PCR primers were designed for 118 249 SSRs. Tetranucleotide repeats (47 079) were found to be the most frequent repeat type, whereas hexanucleotide repeats (6414) being the least abundant. Additionally, in each species statistical analyses were performed to calculate relative frequency, correlation coefficient and chi-square statistics of perfect and imperfect SSRs. In accordance with the growing interest in SSR studies, ChloroSSRdb will prove to be a useful resource in developing genetic markers, phylogenetic analysis, genetic mapping, etc. Moreover, it will serve as a ready reference for mined SSRs in available chloroplast genomes of green plants. Database URL: www.compubio.in/chlorossrdb/ PMID:25380781

  8. ChloroSSRdb: a repository of perfect and imperfect chloroplastic simple sequence repeats (cpSSRs) of green plants.

    PubMed

    Kapil, Aditi; Rai, Piyush Kant; Shanker, Asheesh

    2014-01-01

    Simple sequence repeats (SSRs) are regions in DNA sequence that contain repeating motifs of length 1-6 nucleotides. These repeats are ubiquitously present and are found in both coding and non-coding regions of genome. A total of 534 complete chloroplast genome sequences (as on 18 September 2014) of Viridiplantae are available at NCBI organelle genome resource. It provides opportunity to mine these genomes for the detection of SSRs and store them in the form of a database. In an attempt to properly manage and retrieve chloroplastic SSRs, we designed ChloroSSRdb which is a relational database developed using SQL server 2008 and accessed through ASP.NET. It provides information of all the three types (perfect, imperfect and compound) of SSRs. At present, ChloroSSRdb contains 124 430 mined SSRs, with majority lying in non-coding region. Out of these, PCR primers were designed for 118 249 SSRs. Tetranucleotide repeats (47 079) were found to be the most frequent repeat type, whereas hexanucleotide repeats (6414) being the least abundant. Additionally, in each species statistical analyses were performed to calculate relative frequency, correlation coefficient and chi-square statistics of perfect and imperfect SSRs. In accordance with the growing interest in SSR studies, ChloroSSRdb will prove to be a useful resource in developing genetic markers, phylogenetic analysis, genetic mapping, etc. Moreover, it will serve as a ready reference for mined SSRs in available chloroplast genomes of green plants. Database URL: www.compubio.in/chlorossrdb/ © The Author(s) 2014. Published by Oxford University Press.

  9. New genetic variants of LATS1 detected in urinary bladder and colon cancer.

    PubMed

    Saadeldin, Mona K; Shawer, Heba; Mostafa, Ahmed; Kassem, Neemat M; Amleh, Asma; Siam, Rania

    2014-01-01

    LATS1, the large tumor suppressor 1 gene, encodes for a serine/threonine kinase protein and is implicated in cell cycle progression. LATS1 is down-regulated in various human cancers, such as breast cancer, and astrocytoma. Point mutations in LATS1 were reported in human sarcomas. Additionally, loss of heterozygosity of LATS1 chromosomal region predisposes to breast, ovarian, and cervical tumors. In the current study, we investigated LATS1 genetic variations including single nucleotide polymorphisms (SNPs), in 28 Egyptian patients with either urinary bladder or colon cancers. The LATS1 gene was amplified and sequenced and the expression of LATS1 at the RNA level was assessed in 12 urinary bladder cancer samples. We report, the identification of a total of 29 variants including previously identified SNPs within LATS1 coding and non-coding sequences. A total of 18 variants were novel. Majority of the novel variants, 13, were mapped to intronic sequences and un-translated regions of the gene. Four of the five novel variants located in the coding region of the gene, represented missense mutations within the serine/threonine kinase catalytic domain. Interestingly, LATS1 RNA steady state levels was lost in urinary bladder cancerous tissue harboring four specific SNPs (16045 + 41736 + 34614 + 56177) positioned in the 5'UTR, intron 6, and two silent mutations within exon 4 and exon 8, respectively. This study identifies novel single-base-sequence alterations in the LATS1 gene. These newly identified variants could potentially be used as novel diagnostic or prognostic tools in cancer.

  10. Long-term excretion of vaccine-derived poliovirus by a healthy child.

    PubMed

    Martín, Javier; Odoom, Kofi; Tuite, Gráinne; Dunn, Glynis; Hopewell, Nicola; Cooper, Gill; Fitzharris, Catherine; Butler, Karina; Hall, William W; Minor, Philip D

    2004-12-01

    A child was found to be excreting type 1 vaccine-derived poliovirus (VDPV) with a 1.1% sequence drift from Sabin type 1 vaccine strain in the VP1 coding region 6 months after he was immunized with oral live polio vaccine. Seventeen type 1 poliovirus isolates were recovered from stools taken from this child during the following 4 months. Contrary to expectation, the child was not deficient in humoral immunity and showed high levels of serum neutralization against poliovirus. Selected virus isolates were characterized in terms of their antigenic properties, virulence in transgenic mice, sensitivity for growth at high temperatures, and differences in nucleotide sequence from the Sabin type 1 strain. The VDPV isolates showed mutations at key nucleotide positions that correlated with the observed reversion to biological properties typical of wild polioviruses. A number of capsid mutations mapped at known antigenic sites leading to changes in the viral antigenic structure. Estimates of sequence evolution based on the accumulation of nucleotide changes in the VP1 coding region detected a "defective" molecular clock running at an apparent faster speed of 2.05% nucleotide changes per year versus 1% shown in previous studies. Remarkably, when compared to several type 1 VDPV strains of different origins, isolates from this child showed a much higher proportion of nonsynonymous versus synonymous nucleotide changes in the capsid coding region. This anomaly could explain the high VP1 sequence drift found and the ability of these virus strains to replicate in the gut for a longer period than expected.

  11. Internal control regions for transcription of eukaryotic tRNA genes.

    PubMed Central

    Sharp, S; DeFranco, D; Dingermann, T; Farrell, P; Söll, D

    1981-01-01

    We have identified the region within a eukaryotic tRNA gene required for initiation of transcription. These results were obtained by systematically constructing deletions extending from the 5' or the 3' flanking regions into a cloned Drosophila tRNAArg gene by using nuclease BAL 31. The ability of the newly generated deletion clones to direct the in vitro synthesis of tRNA precursors was measured in transcription systems from Xenopus laevis oocytes, Drosophila Kc cells, and HeLa cells. Two control regions within the coding sequence were identified. The first was essential for transcription and was contained between nucleotides 8 and 25 of the mature tRNA sequence. Genes devoid of the second control region, which was contained between nucleotides 50 and 58 of the mature tRNA sequence, could be transcribed but with reduced efficiency. Thus, the promoter regions within a tRNA gene encode the tRNA sequences of the D stem and D loop, the invariant uridine at position 8, and the semi-invariant G-T-psi-C sequence. Images PMID:6947245

  12. The complete mitochondrial genome and phylogenetic analysis of the giant panda (Ailuropoda melanoleuca).

    PubMed

    Peng, Rui; Zeng, Bo; Meng, Xiuxiang; Yue, Bisong; Zhang, Zhihe; Zou, Fangdong

    2007-08-01

    The complete mitochondrial genome sequence of the giant panda, Ailuropoda melanoleuca, was determined by the long and accurate polymerase chain reaction (LA-PCR) with conserved primers and primer walking sequence methods. The complete mitochondrial DNA is 16,805 nucleotides in length and contains two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one control region. The total length of the 13 protein-coding genes is longer than the American black bear, brown bear and polar bear by 3 amino acids at the end of ND5 gene. The codon usage also followed the typical vertebrate pattern except for an unusual ATT start codon, which initiates the NADH dehydrogenase subunit 5 (ND5) gene. The molecular phylogenetic analysis was performed on the sequences of 12 concatenated heavy-strand encoded protein-coding genes, and suggested that the giant panda is most closely related to bears.

  13. Determining coding CpG islands by identifying regions significant for pattern statistics on Markov chains.

    PubMed

    Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior

    2011-09-23

    Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.

  14. A comparison of complete mitochondrial genomes of silver carp hypophthalmichthys molitrix and bighead carp hypophthalmichthys nobilis: Implications for their taxonomic relationship and phylogeny

    USGS Publications Warehouse

    Li, S.-F.; Xu, J.-W.; Yang, Q.-L.; Wang, C.H.; Chen, Q.; Chapman, D.C.; Lu, G.

    2009-01-01

    Based upon morphological characters, Silver carp Hypophthalmichthys molitrix and bighead carp Hypophthalmichthys nobilis (or Aristichthys nobilis) have been classified into either the same genus or two distinct genera. Consequently, the taxonomic relationship of the two species at the generic level remains equivocal. This issue is addressed by sequencing complete mitochondrial genomes of H. molitrix and H. nobilis, comparing their mitogenome organization, structure and sequence similarity, and conducting a comprehensive phylogenetic analysis of cyprinid species. As with other cyprinid fishes, the mitogenomes of the two species were structurally conserved, containing 37 genes including 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA (tRNAs) genes and a putative control region (D-loop). Sequence similarity between the two mitogenomes varied in different genes or regions, being highest in the tRNA genes (98??8%), lowest in the control region (89??4%) and intermediate in the protein-coding genes (94??2%). Analyses of the sequence comparison and phylogeny using concatenated protein sequences support the view that the two species belong to the genus Hypophthalmichthys. Further studies using nuclear markers and involving more closely related species, and the systematic combination of traditional biology and molecular biology are needed in order to confirm this conclusion. ?? 2009 The Fisheries Society of the British Isles.

  15. Sequence-based analysis of pQBR103; a representative of a unique, transfer-proficient mega plasmid resident in the microbial community of sugar beet

    PubMed Central

    Tett, Adrian; Spiers, Andrew J; Crossman, Lisa C; Ager, Duane; Ciric, Lena; Dow, J Maxwell; Fry, John C; Harris, David; Lilley, Andrew; Oliver, Anna; Parkhill, Julian; Quail, Michael A; Rainey, Paul B; Saunders, Nigel J; Seeger, Kathy; Snyder, Lori AS; Squares, Rob; Thomas, Christopher M; Turner, Sarah L; Zhang, Xue-Xian; Field, Dawn; Bailey, Mark J

    2009-01-01

    The plasmid pQBR103 was found within Pseudomonas populations colonizing the leaf and root surfaces of sugar beet plants growing at Wytham, Oxfordshire, UK. At 425 kb it is the largest self-transmissible plasmid yet sequenced from the phytosphere. It is known to enhance the competitive fitness of its host, and parts of the plasmid are known to be actively transcribed in the plant environment. Analysis of the complete sequence of this plasmid predicts a coding sequence (CDS)-rich genome containing 478 CDSs and an exceptional degree of genetic novelty; 80% of predicted coding sequences cannot be ascribed a function and 60% are orphans. Of those to which function could be assigned, 40% bore greatest similarity to sequences from Pseudomonas spp, and the majority of the remainder showed similarity to other c-proteobacterial genera and plasmids. pQBR103 has identifiable regions presumed responsible for replication and partitioning, but despite being tra+ lacks the full complement of any previously described conjugal transfer functions. The DNA sequence provided few insights into the functional significance of plant-induced transcriptional regions, but suggests that 14% of CDSs may be expressed (11 CDSs with functional annotation and 54 without), further highlighting the ecological importance of these novel CDSs. Comparative analysis indicates that pQBR103 shares significant regions of sequence with other plasmids isolated from sugar beet plants grown at the same geographic location. These plasmid sequences indicate there is more novelty in the mobile DNA pool accessible to phytosphere pseudomonas than is currently appreciated or understood. PMID:18043644

  16. An analytical framework for whole-genome sequence association studies and its implications for autism spectrum disorder.

    PubMed

    Werling, Donna M; Brand, Harrison; An, Joon-Yong; Stone, Matthew R; Zhu, Lingxue; Glessner, Joseph T; Collins, Ryan L; Dong, Shan; Layer, Ryan M; Markenscoff-Papadimitriou, Eirene; Farrell, Andrew; Schwartz, Grace B; Wang, Harold Z; Currall, Benjamin B; Zhao, Xuefang; Dea, Jeanselle; Duhn, Clif; Erdman, Carolyn A; Gilson, Michael C; Yadav, Rachita; Handsaker, Robert E; Kashin, Seva; Klei, Lambertus; Mandell, Jeffrey D; Nowakowski, Tomasz J; Liu, Yuwen; Pochareddy, Sirisha; Smith, Louw; Walker, Michael F; Waterman, Matthew J; He, Xin; Kriegstein, Arnold R; Rubenstein, John L; Sestan, Nenad; McCarroll, Steven A; Neale, Benjamin M; Coon, Hilary; Willsey, A Jeremy; Buxbaum, Joseph D; Daly, Mark J; State, Matthew W; Quinlan, Aaron R; Marth, Gabor T; Roeder, Kathryn; Devlin, Bernie; Talkowski, Michael E; Sanders, Stephan J

    2018-05-01

    Genomic association studies of common or rare protein-coding variation have established robust statistical approaches to account for multiple testing. Here we present a comparable framework to evaluate rare and de novo noncoding single-nucleotide variants, insertion/deletions, and all classes of structural variation from whole-genome sequencing (WGS). Integrating genomic annotations at the level of nucleotides, genes, and regulatory regions, we define 51,801 annotation categories. Analyses of 519 autism spectrum disorder families did not identify association with any categories after correction for 4,123 effective tests. Without appropriate correction, biologically plausible associations are observed in both cases and controls. Despite excluding previously identified gene-disrupting mutations, coding regions still exhibited the strongest associations. Thus, in autism, the contribution of de novo noncoding variation is probably modest in comparison to that of de novo coding variants. Robust results from future WGS studies will require large cohorts and comprehensive analytical strategies that consider the substantial multiple-testing burden.

  17. Phylogeographic Differentiation of Mitochondrial DNA in Han Chinese

    PubMed Central

    Yao, Yong-Gang; Kong, Qing-Peng; Bandelt, Hans-Jürgen; Kivisild, Toomas; Zhang, Ya-Ping

    2002-01-01

    To characterize the mitochondrial DNA (mtDNA) variation in Han Chinese from several provinces of China, we have sequenced the two hypervariable segments of the control region and the segment spanning nucleotide positions 10171–10659 of the coding region, and we have identified a number of specific coding-region mutations by direct sequencing or restriction-fragment–length–polymorphism tests. This allows us to define new haplogroups (clades of the mtDNA phylogeny) and to dissect the Han mtDNA pool on a phylogenetic basis, which is a prerequisite for any fine-grained phylogeographic analysis, the interpretation of ancient mtDNA, or future complete mtDNA sequencing efforts. Some of the haplogroups under study differ considerably in frequencies across different provinces. The southernmost provinces show more pronounced contrasts in their regional Han mtDNA pools than the central and northern provinces. These and other features of the geographical distribution of the mtDNA haplogroups observed in the Han Chinese make an initial Paleolithic colonization from south to north plausible but would suggest subsequent migration events in China that mainly proceeded from north to south and east to west. Lumping together all regional Han mtDNA pools into one fictive general mtDNA pool or choosing one or two regional Han populations to represent all Han Chinese is inappropriate for prehistoric considerations as well as for forensic purposes or medical disease studies. PMID:11836649

  18. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

    PubMed

    Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

    2010-02-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

  19. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer

    PubMed Central

    Wojcik, Sylwia E.; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S.; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z.; Rai, Kanti R.; Kipps, Thomas J.; Keating, Michael J.

    2010-01-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas. PMID:19926640

  20. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    PubMed

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  1. Organization and transient expression of the gene for human U11 snRNA

    PubMed Central

    Clemens, Suter-Crazzolara; Walter, Keller

    1991-01-01

    The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

  2. Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller.

    PubMed

    Xu, Chang; Nezami Ranjbar, Mohammad R; Wu, Zhong; DiCarlo, John; Wang, Yexun

    2017-01-03

    Detection of DNA mutations at very low allele fractions with high accuracy will significantly improve the effectiveness of precision medicine for cancer patients. To achieve this goal through next generation sequencing, researchers need a detection method that 1) captures rare mutation-containing DNA fragments efficiently in the mix of abundant wild-type DNA; 2) sequences the DNA library extensively to deep coverage; and 3) distinguishes low level true variants from amplification and sequencing errors with high accuracy. Targeted enrichment using PCR primers provides researchers with a convenient way to achieve deep sequencing for a small, yet most relevant region using benchtop sequencers. Molecular barcoding (or indexing) provides a unique solution for reducing sequencing artifacts analytically. Although different molecular barcoding schemes have been reported in recent literature, most variant calling has been done on limited targets, using simple custom scripts. The analytical performance of barcode-aware variant calling can be significantly improved by incorporating advanced statistical models. We present here a highly efficient, simple and scalable enrichment protocol that integrates molecular barcodes in multiplex PCR amplification. In addition, we developed smCounter, an open source, generic, barcode-aware variant caller based on a Bayesian probabilistic model. smCounter was optimized and benchmarked on two independent read sets with SNVs and indels at 5 and 1% allele fractions. Variants were called with very good sensitivity and specificity within coding regions. We demonstrated that we can accurately detect somatic mutations with allele fractions as low as 1% in coding regions using our enrichment protocol and variant caller.

  3. Chromatin accessibility prediction via a hybrid deep convolutional neural network.

    PubMed

    Liu, Qiao; Xia, Fei; Yin, Qijin; Jiang, Rui

    2018-03-01

    A majority of known genetic variants associated with human-inherited diseases lie in non-coding regions that lack adequate interpretation, making it indispensable to systematically discover functional sites at the whole genome level and precisely decipher their implications in a comprehensive manner. Although computational approaches have been complementing high-throughput biological experiments towards the annotation of the human genome, it still remains a big challenge to accurately annotate regulatory elements in the context of a specific cell type via automatic learning of the DNA sequence code from large-scale sequencing data. Indeed, the development of an accurate and interpretable model to learn the DNA sequence signature and further enable the identification of causative genetic variants has become essential in both genomic and genetic studies. We proposed Deopen, a hybrid framework mainly based on a deep convolutional neural network, to automatically learn the regulatory code of DNA sequences and predict chromatin accessibility. In a series of comparison with existing methods, we show the superior performance of our model in not only the classification of accessible regions against background sequences sampled at random, but also the regression of DNase-seq signals. Besides, we further visualize the convolutional kernels and show the match of identified sequence signatures and known motifs. We finally demonstrate the sensitivity of our model in finding causative noncoding variants in the analysis of a breast cancer dataset. We expect to see wide applications of Deopen with either public or in-house chromatin accessibility data in the annotation of the human genome and the identification of non-coding variants associated with diseases. Deopen is freely available at https://github.com/kimmo1019/Deopen. ruijiang@tsinghua.edu.cn. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  4. Sequence and analysis of chromosome 4 of the plant Arabidopsis thaliana.

    PubMed

    Mayer, K; Schüller, C; Wambutt, R; Murphy, G; Volckaert, G; Pohl, T; Düsterhöft, A; Stiekema, W; Entian, K D; Terryn, N; Harris, B; Ansorge, W; Brandt, P; Grivell, L; Rieger, M; Weichselgartner, M; de Simone, V; Obermaier, B; Mache, R; Müller, M; Kreis, M; Delseny, M; Puigdomenech, P; Watson, M; Schmidtheini, T; Reichert, B; Portatelle, D; Perez-Alonso, M; Boutry, M; Bancroft, I; Vos, P; Hoheisel, J; Zimmermann, W; Wedler, H; Ridley, P; Langham, S A; McCullagh, B; Bilham, L; Robben, J; Van der Schueren, J; Grymonprez, B; Chuang, Y J; Vandenbussche, F; Braeken, M; Weltjens, I; Voet, M; Bastiaens, I; Aert, R; Defoor, E; Weitzenegger, T; Bothe, G; Ramsperger, U; Hilbert, H; Braun, M; Holzer, E; Brandt, A; Peters, S; van Staveren, M; Dirske, W; Mooijman, P; Klein Lankhorst, R; Rose, M; Hauf, J; Kötter, P; Berneiser, S; Hempel, S; Feldpausch, M; Lamberth, S; Van den Daele, H; De Keyser, A; Buysshaert, C; Gielen, J; Villarroel, R; De Clercq, R; Van Montagu, M; Rogers, J; Cronin, A; Quail, M; Bray-Allen, S; Clark, L; Doggett, J; Hall, S; Kay, M; Lennard, N; McLay, K; Mayes, R; Pettett, A; Rajandream, M A; Lyne, M; Benes, V; Rechmann, S; Borkova, D; Blöcker, H; Scharfe, M; Grimm, M; Löhnert, T H; Dose, S; de Haan, M; Maarse, A; Schäfer, M; Müller-Auer, S; Gabel, C; Fuchs, M; Fartmann, B; Granderath, K; Dauner, D; Herzl, A; Neumann, S; Argiriou, A; Vitale, D; Liguori, R; Piravandi, E; Massenet, O; Quigley, F; Clabauld, G; Mündlein, A; Felber, R; Schnabl, S; Hiller, R; Schmidt, W; Lecharny, A; Aubourg, S; Chefdor, F; Cooke, R; Berger, C; Montfort, A; Casacuberta, E; Gibbons, T; Weber, N; Vandenbol, M; Bargues, M; Terol, J; Torres, A; Perez-Perez, A; Purnelle, B; Bent, E; Johnson, S; Tacon, D; Jesse, T; Heijnen, L; Schwarz, S; Scholler, P; Heber, S; Francs, P; Bielke, C; Frishman, D; Haase, D; Lemcke, K; Mewes, H W; Stocker, S; Zaccaria, P; Bevan, M; Wilson, R K; de la Bastide, M; Habermann, K; Parnell, L; Dedhia, N; Gnoj, L; Schutz, K; Huang, E; Spiegel, L; Sehkon, M; Murray, J; Sheet, P; Cordes, M; Abu-Threideh, J; Stoneking, T; Kalicki, J; Graves, T; Harmon, G; Edwards, J; Latreille, P; Courtney, L; Cloud, J; Abbott, A; Scott, K; Johnson, D; Minx, P; Bentley, D; Fulton, B; Miller, N; Greco, T; Kemp, K; Kramer, J; Fulton, L; Mardis, E; Dante, M; Pepin, K; Hillier, L; Nelson, J; Spieth, J; Ryan, E; Andrews, S; Geisel, C; Layman, D; Du, H; Ali, J; Berghoff, A; Jones, K; Drone, K; Cotton, M; Joshu, C; Antonoiu, B; Zidanic, M; Strong, C; Sun, H; Lamar, B; Yordan, C; Ma, P; Zhong, J; Preston, R; Vil, D; Shekher, M; Matero, A; Shah, R; Swaby, I K; O'Shaughnessy, A; Rodriguez, M; Hoffmann, J; Till, S; Granat, S; Shohdy, N; Hasegawa, A; Hameed, A; Lodhi, M; Johnson, A; Chen, E; Marra, M; Martienssen, R; McCombie, W R

    1999-12-16

    The higher plant Arabidopsis thaliana (Arabidopsis) is an important model for identifying plant genes and determining their function. To assist biological investigations and to define chromosome structure, a coordinated effort to sequence the Arabidopsis genome was initiated in late 1996. Here we report one of the first milestones of this project, the sequence of chromosome 4. Analysis of 17.38 megabases of unique sequence, representing about 17% of the genome, reveals 3,744 protein coding genes, 81 transfer RNAs and numerous repeat elements. Heterochromatic regions surrounding the putative centromere, which has not yet been completely sequenced, are characterized by an increased frequency of a variety of repeats, new repeats, reduced recombination, lowered gene density and lowered gene expression. Roughly 60% of the predicted protein-coding genes have been functionally characterized on the basis of their homology to known genes. Many genes encode predicted proteins that are homologous to human and Caenorhabditis elegans proteins.

  5. SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

    PubMed Central

    Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

    2007-01-01

    Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

  6. An integrative approach to predicting the functional effects of small indels in non-coding regions of the human genome

    PubMed Central

    Ferlaino, Michael; Rogers, Mark F.; Shihab, Hashem A.; Mort, Matthew; Cooper, David N.; Gaunt, Tom R.; Campbell, Colin

    2018-01-01

    Background Small insertions and deletions (indels) have a significant influence in human disease and, in terms of frequency, they are second only to single nucleotide variants as pathogenic mutations. As the majority of mutations associated with complex traits are located outside the exome, it is crucial to investigate the potential pathogenic impact of indels in non-coding regions of the human genome. Results We present FATHMM-indel, an integrative approach to predict the functional effect, pathogenic or neutral, of indels in non-coding regions of the human genome. Our method exploits various genomic annotations in addition to sequence data. When validated on benchmark data, FATHMM-indel significantly outperforms CADD and GAVIN, state of the art models in assessing the pathogenic impact of non-coding variants. FATHMM-indel is available via a web server at indels.biocompute.org.uk. Conclusions FATHMM-indel can accurately predict the functional impact and prioritise small indels throughout the whole non-coding genome. PMID:28985712

  7. An integrative approach to predicting the functional effects of small indels in non-coding regions of the human genome.

    PubMed

    Ferlaino, Michael; Rogers, Mark F; Shihab, Hashem A; Mort, Matthew; Cooper, David N; Gaunt, Tom R; Campbell, Colin

    2017-10-06

    Small insertions and deletions (indels) have a significant influence in human disease and, in terms of frequency, they are second only to single nucleotide variants as pathogenic mutations. As the majority of mutations associated with complex traits are located outside the exome, it is crucial to investigate the potential pathogenic impact of indels in non-coding regions of the human genome. We present FATHMM-indel, an integrative approach to predict the functional effect, pathogenic or neutral, of indels in non-coding regions of the human genome. Our method exploits various genomic annotations in addition to sequence data. When validated on benchmark data, FATHMM-indel significantly outperforms CADD and GAVIN, state of the art models in assessing the pathogenic impact of non-coding variants. FATHMM-indel is available via a web server at indels.biocompute.org.uk. FATHMM-indel can accurately predict the functional impact and prioritise small indels throughout the whole non-coding genome.

  8. Complete Genome Analysis of an Enterovirus EV-B83 Isolated in China.

    PubMed

    Tang, Jingjing; Li, Qiongfen; Tian, Bingjun; Zhang, Jie; Li, Kai; Ding, Zhengrong; Lu, Lin

    2016-07-12

    Enterovirus B83 (EV-B83) is a recently identified member of enterovirus species B. It is a rarely reported serotype and up to date, only the complete genome sequence of the prototype strain from the United States is available. In this study, we describe the complete genomic characterization of an EV-B83 strain 246/YN/CHN/08HC isolated from a healthy child living in border region of Yunnan Province, China in 2008. Compared with the prototype strain, it had 79.6% similarity in the complete genome and 78.9% similarity in the VP1 coding region, reflecting the great genetic divergence among them. VP1-coding region alignment revealed it had 77.2-91.3% with other EV-B83 sequences available in GenBank. Similarity plot analysis revealed it had higher identity with several other EV-B serotypes than the EV-B83 prototype strain in the P2 and P3 coding region, suggesting multiple recombination events might have occurred. The great genetic divergence with previously isolated strains and the extremely rare isolation suggest this serotype has circulated at a low epidemic strength for many years. This is the first report of complete genome of EV-B83 in China.

  9. Complete Sequence of the mitochondrial genome of the tapeworm Hymenolepis diminuta: Gene arrangements indicate that platyhelminths are eutrochozoans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    von Nickisch-Rosenegk, Markus; Brown, Wesley M.; Boore, Jeffrey L.

    2001-01-01

    Using ''long-PCR'' we have amplified in overlapping fragments the complete mitochondrial genome of the tapeworm Hymenolepis diminuta (Platyhelminthes: Cestoda) and determined its 13,900 nucleotide sequence. The gene content is the same as that typically found for animal mitochondrial DNA (mtDNA) except that atp8 appears to be lacking, a condition found previously for several other animals. Despite the small size of this mtDNA, there are two large non-coding regions, one of which contains 13 repeats of a 31 nucleotide sequence and a potential stem-loop structure of 25 base pairs with an 11-member loop. Large potential secondary structures are identified also formore » the non-coding regions of two other cestode mtDNAs. Comparison of the mitochondrial gene arrangement of H. diminuta with those previously published supports a phylogenetic position of flatworms as members of the Eutrochozoa, rather than being basal to either a clade of protostomes or a clade of coelomates.« less

  10. The structure of the human interferon alpha/beta receptor gene.

    PubMed

    Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G

    1992-02-05

    Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.

  11. The complete mitochondrial genome of Liobagrus marginatus (Teleostei, Siluriformes: Amblycipitidae).

    PubMed

    Li, Qiang; Du, Jun; Liu, Ya; Zhou, Jian; Ke, Hongyu; Liu, Chao; Liu, Guangxun

    2014-04-01

    The Liobagrus marginatus is an economic fish which distribute in the upstream of Yangtze river and its distributary. For its taste fresh, environmental pollution and overfishing, its population declined drastically and body miniaturization in recent decades, so it is essential to protect its resource. In this study, the complete mitochondrial genome sequence of Liobagrus marginatus was sequenced, which contains 22 tRNA genes, 13 protein-coding genes, 2 rRNA genes, and a non-coding control region with the total length of 16,497 bp. The gene arrangement and composition are similar to most of other fish. Most of the genes are encoded on heavy-strand, except for eight tRNA and ND6 genes. Just like most other vertebrates, the bias of G and C has been found in statistics results of different genes/regions. The complete mitochondrial genome sequence of Liobagrus marginatus would contribute to better understand population genetics, evolution of this lineage, and will help administrative departments to make rules and laws to protect it.

  12. Sequence Analysis of Mitochondrial Genome of Toxascaris leonina from a South China Tiger.

    PubMed

    Li, Kangxin; Yang, Fang; Abdullahi, A Y; Song, Meiran; Shi, Xianli; Wang, Minwei; Fu, Yeqi; Pan, Weida; Shan, Fang; Chen, Wu; Li, Guoqing

    2016-12-01

    Toxascaris leonina is a common parasitic nematode of wild mammals and has significant impacts on the protection of rare wild animals. To analyze population genetic characteristics of T. leonina from South China tiger, its mitochondrial (mt) genome was sequenced. Its complete circular mt genome was 14,277 bp in length, including 12 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 2 non-coding regions. The nucleotide composition was biased toward A and T. The most common start codon and stop codon were TTG and TAG, and 4 genes ended with an incomplete stop codon. There were 13 intergenic regions ranging 1 to 10 bp in size. Phylogenetically, T. leonina from a South China tiger was close to canine T. leonina . This study reports for the first time a complete mt genome sequence of T. leonina from the South China tiger, and provides a scientific basis for studying the genetic diversity of nematodes between different hosts.

  13. Identification of a novel bovine enterovirus possessing highly divergent amino acid sequences in capsid protein.

    PubMed

    Tsuchiaka, Shinobu; Rahpaya, Sayed Samim; Otomaru, Konosuke; Aoki, Hiroshi; Kishimoto, Mai; Naoi, Yuki; Omatsu, Tsutomu; Sano, Kaori; Okazaki-Terashima, Sachiko; Katayama, Yukie; Oba, Mami; Nagai, Makoto; Mizutani, Tetsuya

    2017-01-17

    Bovine enterovirus (BEV) belongs to the species Enterovirus E or F, genus Enterovirus and family Picornaviridae. Although numerous studies have identified BEVs in the feces of cattle with diarrhea, the pathogenicity of BEVs remains unclear. Previously, we reported the detection of novel kobu-like virus in calf feces, by metagenomics analysis. In the present study, we identified a novel BEV in diarrheal feces collected for that survey. Complete genome sequences were determined by deep sequencing in feces. Secondary RNA structure analysis of the 5' untranslated region (UTR), phylogenetic tree construction and pairwise identity analysis were conducted. The complete genome sequences of BEV were genetically distant from other EVs and the VP1 coding region contained novel and unique amino acid sequences. We named this strain as BEV AN12/Bos taurus/JPN/2014 (referred to as BEV-AN12). According to genome analysis, the genome length of this virus is 7414 nucleotides excluding the poly (A) tail and its genome consists of a 5'UTR, open reading frame encoding a single polyprotein, and 3'UTR. The results of secondary RNA structure analysis showed that in the 5'UTR, BEV-AN12 had an additional clover leaf structure and small stem loop structure, similarly to other BEVs. In pairwise identity analysis, BEV-AN12 showed high amino acid (aa) identities to Enterovirus F in the polyprotein, P2 and P3 regions (aa identity ≥82.4%). Therefore, BEV-AN12 is closely related to Enterovirus F. However, aa sequences in the capsid protein regions, particularly the VP1 encoding region, showed significantly low aa identity to other viruses in genus Enterovirus (VP1 aa identity ≤58.6%). In addition, BEV-AN12 branched separately from Enterovirus E and F in phylogenetic trees based on the aa sequences of P1 and VP1, although it clustered with Enterovirus F in trees based on sequences in the P2 and P3 genome region. We identified novel BEV possessing highly divergent aa sequences in the VP1 coding region in Japan. According to species definition, we proposed naming this strain as "Enterovirus K", which is a novel species within genus Enterovirus. Further genomic studies are needed to understand the pathogenicity of BEVs.

  14. A new polymorphic and multicopy MHC gene family related to nonmammalian class I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leelayuwat, C.; Degli-Esposti, M.A.; Abraham, L.J.

    1994-12-31

    The authors have used genomic analysis to characterize a region of the central major histocompatibility complex (MHC) spanning {approximately} 300 kilobases (kb) between TNF and HLA-B. This region has been suggested to carry genetic factors relevant to the development of autoimmune diseases such as myasthenia gravis (MG) and insulin dependent diabetes mellitus (IDDM). Genomic sequence was analyzed for coding potential, using two neural network programs, GRAIL and GeneParser. A genomic probe, JAB, containing putative coding sequences (PERB11) located 60 kb centromeric of HLA-B, was used for northern analysis of human tissues. Multiple transcripts were detected. Southern analysis of genomic DNAmore » and overlapping YAC clones, covering the region from BAT1 to HLA-F, indicated that there are at least five copies of PERB11, four of which are located within this region of the MHC. The partial cDNA sequence of PERB11 was obtained from poly-A RNA derived from skeletal muscle. The putative amino acid sequence of PERB11 shares {approximately} 30% identity to MHC class I molecules from various species, including reptiles, chickens, and frogs, as well as to other MHC class I-like molecules, such as the IgG FcR of the mouse and rat and the human Zn-{alpha}2-glycoprotein. From direct comparison of amino acid sequences, it is concluded that PERB11 is a distinct molecule more closely related to nonmammalian than known mammalian MHC class I molecules. Genomic sequence analysis of PERB11 from five MHC ancestral haplotypes (AH) indicated that the gene is polymorphic at both DNA and protein level. The results suggest that the authors have identified a novel polymorphic gene family with multiple copies within the MHC. 48 refs., 10 figs., 2 tabs.« less

  15. Novel mutations of CHST6 in Iranian patients with macular corneal dystrophy

    PubMed Central

    Salehi, Zivar; Houshmand, Masoud; Mohamadi, Mohamad Javad; Promehr, Leila Azizade; Mozafarzadeh, Zahra

    2009-01-01

    Purpose To characterize mutations within the carbohydrate sulfotransferase 6 (CHST6) gene in Iranian subjects from 12 families with macular corneal dystrophy (MCD). Methods Genomic DNA was extracted from peripheral blood of 20 affected patients and 60 healthy volunteers followed by polymerase chain reaction (PCR) and direct sequencing of the CHST6 coding region. The observed nucleotide sequences were then compared with those found by investigators in other populations with MCD and in the controls. Results Analysis of CHST6 revealed 11 different mutations. These mutations were comprised of six novel missense mutations (p.F55L, p.P132L, p.S136G, p.C149Y, p.D203Y, and p.H249R), one novel nonsense mutation (p.S48X), one novel frame shift (after P297), and three previously reported missense mutations (p.P31L, p.C165Y, and p.R127C). The majority of the detected MCD mutations are located in the binding sites or the binding pocket, except the p.P31L and p.H249R mutations. Conclusions Nucleotide changes within the coding region of CHST6 are predicted to significantly alter the encoded sulfotransferase within the evolutionary conserved sequences. Our findings show that CHST6 mutations are responsible for the pathogenesis of MCD in Iranian patients. Moreover, the observation that some cases of MCD cannot be explained by mutations in the coding region of CHST6 suggests that MCD may result from possible upstream rearrangements in the CHST6 genomic region. PMID:19223992

  16. Novel mutations of CHST6 in Iranian patients with macular corneal dystrophy.

    PubMed

    Birgani, Shiva Akbari; Salehi, Zivar; Houshmand, Masoud; Mohamadi, Mohamad Javad; Promehr, Leila Azizade; Mozafarzadeh, Zahra

    2009-01-01

    To characterize mutations within the carbohydrate sulfotransferase 6 (CHST6) gene in Iranian subjects from 12 families with macular corneal dystrophy (MCD). Genomic DNA was extracted from peripheral blood of 20 affected patients and 60 healthy volunteers followed by polymerase chain reaction (PCR) and direct sequencing of the CHST6 coding region. The observed nucleotide sequences were then compared with those found by investigators in other populations with MCD and in the controls. Analysis of CHST6 revealed 11 different mutations. These mutations were comprised of six novel missense mutations (p.F55L, p.P132L, p.S136G, p.C149Y, p.D203Y, and p.H249R), one novel nonsense mutation (p.S48X), one novel frame shift (after P297), and three previously reported missense mutations (p.P31L, p.C165Y, and p.R127C). The majority of the detected MCD mutations are located in the binding sites or the binding pocket, except the p.P31L and p.H249R mutations. Nucleotide changes within the coding region of CHST6 are predicted to significantly alter the encoded sulfotransferase within the evolutionary conserved sequences. Our findings show that CHST6 mutations are responsible for the pathogenesis of MCD in Iranian patients. Moreover, the observation that some cases of MCD cannot be explained by mutations in the coding region of CHST6 suggests that MCD may result from possible upstream rearrangements in the CHST6 genomic region.

  17. Beta-keratins of differentiating epidermis of snake comprise glycine-proline-serine-rich proteins with an avian-like gene organization.

    PubMed

    Dalla Valle, Luisa; Nardi, Alessia; Belvedere, Paola; Toni, Mattia; Alibardi, Lorenzo

    2007-07-01

    Beta-keratins of reptilian scales have been recently cloned and characterized in some lizards. Here we report for the first time the sequence of some beta-keratins from the snake Elaphe guttata. Five different cDNAs were obtained using 5'- and 3'-RACE analyses. Four sequences differ by only few nucleotides in the coding region, whereas the last cDNA shows, in this region, only 84% of identity. The gene corresponding to one of the cDNA sequences has a single intron present in the 5'-untranslated region. This genomic organization is similar to that of birds' beta-keratins. Cloning and Southern blotting analysis suggest that snake beta-keratins belong to a family of high-related genes as for geckos. PCR analysis suggests a head-to-tail orientation of genes in the same chromosome. In situ hybridization detected beta-keratin transcripts almost exclusively in differentiating oberhautchen and beta-cells of the snake epidermis in renewal phase. This is confirmed by Northern blotting that showed, in this phase, a high expression of two different transcripts whereas only the longer transcript is expressed at a much lower level in resting skin. The cDNA coding sequences encoded putative glycine-proline-serine rich proteins containing 137-139 amino acids, with apparent isoelectric point at 7.5 and 8.2. A central region, rich in proline, shows over 50% homology with avian scale, claw, and feather keratins. The prediction of secondary structure shows mainly a random coil conformation and few beta-strand regions in the central region, likely involved in the formation of a fibrous framework of beta-keratins. This region was possibly present in basic reptiles that originated reptiles and birds. Copyright 2007 Wiley-Liss, Inc.

  18. GeneMachine: gene prediction and sequence annotation.

    PubMed

    Makalowska, I; Ryan, J F; Baxevanis, A D

    2001-09-01

    A number of free-standing programs have been developed in order to help researchers find potential coding regions and deduce gene structure for long stretches of what is essentially 'anonymous DNA'. As these programs apply inherently different criteria to the question of what is and is not a coding region, multiple algorithms should be used in the course of positional cloning and positional candidate projects to assure that all potential coding regions within a previously-identified critical region are identified. We have developed a gene identification tool called GeneMachine which allows users to query multiple exon and gene prediction programs in an automated fashion. BLAST searches are also performed in order to see whether a previously-characterized coding region corresponds to a region in the query sequence. A suite of Perl programs and modules are used to run MZEF, GENSCAN, GRAIL 2, FGENES, RepeatMasker, Sputnik, and BLAST. The results of these runs are then parsed and written into ASN.1 format. Output files can be opened using NCBI Sequin, in essence using Sequin as both a workbench and as a graphical viewer. The main feature of GeneMachine is that the process is fully automated; the user is only required to launch GeneMachine and then open the resulting file with Sequin. Annotations can then be made to these results prior to submission to GenBank, thereby increasing the intrinsic value of these data. GeneMachine is freely-available for download at http://genome.nhgri.nih.gov/genemachine. A public Web interface to the GeneMachine server for academic and not-for-profit users is available at http://genemachine.nhgri.nih.gov. The Web supplement to this paper may be found at http://genome.nhgri.nih.gov/genemachine/supplement/.

  19. The complete mitogenome of the whale shark parasitic copepod Pandarus rhincodonicus norman, Newbound & Knott (Crustacea; Siphonostomatoida; Pandaridae)--a new gene order for the copepoda.

    PubMed

    Austin, Christopher M; Tan, Mun Hua; Lee, Yin Peng; Croft, Laurence J; Meekan, Mark G; Pierce, Simon J; Gan, Han Ming

    2016-01-01

    The complete mitochondrial genome of the parasitic copepod Pandarus rhincodonicus was obtained from a partial genome scan using the HiSeq sequencing system. The Pandarus rhincodonicus mitogenome has 14,480 base pairs (62% A+T content) made up of 12 protein-coding genes, 2 ribosomal subunit genes, 22 transfer RNAs, and a putative 384 bp non-coding AT-rich region. This Pandarus mitogenome sequence is the first for the family Pandaridae, the second for the order Siphonostomatoida and the sixth for the Copepoda.

  20. Microsatellites in the Eukaryotic DNA Mismatch Repair Genes as Modulators of Evolutionary Mutation Rate

    NASA Technical Reports Server (NTRS)

    Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard

    2003-01-01

    All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.

  1. Complete mitochondrial genome of Taharana fasciana (Insecta, Hemiptera: Cicadellidae) and comparison with other Cicadellidae insects.

    PubMed

    Wang, Jiajia; Li, Hu; Dai, Renhuai

    2017-12-01

    Here, we describe the first complete mitochondrial genome (mitogenome) sequence of the leafhopper Taharana fasciana (Coelidiinae). The mitogenome sequence contains 15,161 bp with an A + T content of 77.9%. It includes 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and one non-coding (A + T-rich) region; in addition, a repeat region is also present (GenBank accession no. KY886913). These genes/regions are in the same order as in the inferred insect ancestral mitogenome. All protein-coding genes have ATN as the start codon, and TAA or single T as the stop codons, except the gene ND3, which ends with TAG. Furthermore, we predicted the secondary structures of the rRNAs in T. fasciana. Six domains (domain III is absent in arthropods) and 41 helices were predicted for 16S rRNA, and 12S rRNA comprised three structural domains and 24 helices. Phylogenetic tree analysis confirmed that T. fasciana and other members of the Cicadellidae are clustered into a clade, and it identified the relationships among the subfamilies Deltocephalinae, Coelidiinae, Idiocerinae, Cicadellinae, and Typhlocybinae.

  2. Gene Expression and Polymorphism of Myostatin Gene and its Association with Growth Traits in Chicken.

    PubMed

    Dushyanth, K; Bhattacharya, T K; Shukla, R; Chatterjee, R N; Sitaramamma, T; Paswan, C; Guru Vishnu, P

    2016-10-01

    Myostatin is a member of TGF-β super family and is directly involved in regulation of body growth through limiting muscular growth. A study was carried out in three chicken lines to identify the polymorphism in the coding region of the myostatin gene through SSCP and DNA sequencing. A total of 12 haplotypes were observed in myostatin coding region of chicken. Significant associations between haplogroups with body weight at day 1, 14, 28, and 42 days, and carcass traits at 42 days were observed across the lines. It is concluded that the coding region of myostatin gene was polymorphic, with varied levels of expression among lines and had significant effects on growth traits. The expression of MSTN gene varied during embryonic and post hatch development stage.

  3. Mu-Like Prophage in Serogroup B Neisseria meningitidis Coding for Surface-Exposed Antigens

    PubMed Central

    Masignani, Vega; Giuliani, Marzia Monica; Tettelin, Hervé; Comanducci, Maurizio; Rappuoli, Rino; Scarlato, Vincenzo

    2001-01-01

    Sequence analysis of the genome of Neisseria meningititdis serogroup B revealed the presence of an ∼35-kb region inserted within a putative gene coding for an ABC-type transporter. The region contains 46 open reading frames, 29 of which are colinear and homologous to the genes of Escherichia coli Mu phage. Two prophages with similar organizations were also found in serogroup A meningococcus, and one was found in Haemophilus influenzae. Early and late phage functions are well preserved in this family of Mu-like prophages. Several regions of atypical nucleotide content were identified. These likely represent genes acquired by horizontal transfer. Three of the acquired genes are shown to code for surface-associated antigens, and the encoded proteins are able to induce bactericidal antibodies. PMID:11254622

  4. Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples

    PubMed Central

    Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

    2008-01-01

    Background Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. Results We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12–17 bp), C. elegans (11–17 bp), A. thaliana (11–17 bp), S. cerevisiae (10–16 bp) and E. coli (9–15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Conclusion Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues. PMID:18973670

  5. Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples.

    PubMed

    Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

    2008-10-30

    Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12-17 bp), C. elegans (11-17 bp), A. thaliana (11-17 bp), S. cerevisiae (10-16 bp) and E. coli (9-15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues.

  6. Aquaporin 2 of Rhipicephalus (Boophilus) microplus as a potential target to control ticks and tick-borne parasites

    USDA-ARS?s Scientific Manuscript database

    In a collaboration with Washington State University and ARS-Pullman, WA researchers, we identified and sequenced a 1,059 base pair Rhipicephalus microplus transcript that contained the coding region for a water channel protein, Aquaporin 2 (RmAQP2). The clone sequencing resulted in the production of...

  7. Acetylcholinesterase 1 in populations of organophosphate resistant North American strains of the cattle tick, Rhipicephalus microplus (Acari: Ixodidae)

    USDA-ARS?s Scientific Manuscript database

    In a collaboration with Purdue University researchers, we sequenced a 143,606 base pair Rhipicephalus microplus BAC library clone that contained the coding region for acetylcholinesterase 1 (AChE1). Sequencing was by Sanger protocols and the final assembly resulted in 15 contigs of varying length, e...

  8. Length and nucleotide sequence polymorphism at the trnL and trnF non-coding regions of chloroplast genomes among Saccharum and Erianthus species

    USDA-ARS?s Scientific Manuscript database

    The aneupolyploidy genome of sugarcane (Saccharum hybrids spp.) and lack of a classical genetic linkage map make genetics research most difficult for sugarcane. Whole genome sequencing and genetic characterization of sugarcane and related taxa are far behind other crops. In this study, universal PCR...

  9. Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

    PubMed Central

    Spielmann, A; Stutz, E

    1983-01-01

    The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2. PMID:6314279

  10. Comparative architecture of silks, fibrous proteins and their encoding genes in insects and spiders.

    PubMed

    Craig, Catherine L; Riekel, Christian

    2002-12-01

    The known silk fibroins and fibrous glues are thought to be encoded by members of the same gene family. All silk fibroins sequenced to date contain regions of long-range order (crystalline regions) and/or short-range order (non-crystalline regions). All of the sequenced fibroin silks (Flag or silk from flagelliform gland in spiders; Fhc or heavy chain fibroin silks produced by Lepidoptera larvae) are made up of hierarchically organized, repetitive arrays of amino acids. Fhc fibroin genes are characterized by a similar molecular genetic architecture of two exons and one intron, but the organization and size of these units differs. The Flag, Ser (sericin gene) and BR (Balbiani ring genes; both fibrous proteins) genes are made up of multiple exons and introns. Sequences coding for crystalline and non-crystalline protein domains are integrated in the repetitive regions of Fhc and MA exons, but not in the protein glues Ser1 and BR-1. Genetic 'hot-spots' promote recombination errors in Fhc, MA, and Flag. Codon bias, structural constraint, point mutations, and shortened coding arrays may be alternative means of stabilizing precursor mRNA transcripts. Differential regulation of gene expression and selective splicing of the mRNA transcript may allow rapid adaptation of silk functional properties to different physical environments.

  11. Rare and Coding Region Genetic Variants Associated With Risk of Ischemic Stroke: The NHLBI Exome Sequence Project.

    PubMed

    Auer, Paul L; Nalls, Mike; Meschia, James F; Worrall, Bradford B; Longstreth, W T; Seshadri, Sudha; Kooperberg, Charles; Burger, Kathleen M; Carlson, Christopher S; Carty, Cara L; Chen, Wei-Min; Cupples, L Adrienne; DeStefano, Anita L; Fornage, Myriam; Hardy, John; Hsu, Li; Jackson, Rebecca D; Jarvik, Gail P; Kim, Daniel S; Lakshminarayan, Kamakshi; Lange, Leslie A; Manichaikul, Ani; Quinlan, Aaron R; Singleton, Andrew B; Thornton, Timothy A; Nickerson, Deborah A; Peters, Ulrike; Rich, Stephen S

    2015-07-01

    Stroke is the second leading cause of death and the third leading cause of years of life lost. Genetic factors contribute to stroke prevalence, and candidate gene and genome-wide association studies (GWAS) have identified variants associated with ischemic stroke risk. These variants often have small effects without obvious biological significance. Exome sequencing may discover predicted protein-altering variants with a potentially large effect on ischemic stroke risk. To investigate the contribution of rare and common genetic variants to ischemic stroke risk by targeting the protein-coding regions of the human genome. The National Heart, Lung, and Blood Institute (NHLBI) Exome Sequencing Project (ESP) analyzed approximately 6000 participants from numerous cohorts of European and African ancestry. For discovery, 365 cases of ischemic stroke (small-vessel and large-vessel subtypes) and 809 European ancestry controls were sequenced; for replication, 47 affected sibpairs concordant for stroke subtype and an African American case-control series were sequenced, with 1672 cases and 4509 European ancestry controls genotyped. The ESP's exome sequencing and genotyping started on January 1, 2010, and continued through June 30, 2012. Analyses were conducted on the full data set between July 12, 2012, and July 13, 2013. Discovery of new variants or genes contributing to ischemic stroke risk and subtype (primary analysis) and determination of support for protein-coding variants contributing to risk in previously published candidate genes (secondary analysis). We identified 2 novel genes associated with an increased risk of ischemic stroke: a protein-coding variant in PDE4DIP (rs1778155; odds ratio, 2.15; P = 2.63 × 10(-8)) with an intracellular signal transduction mechanism and in ACOT4 (rs35724886; odds ratio, 2.04; P = 1.24 × 10(-7)) with a fatty acid metabolism; confirmation of PDE4DIP was observed in affected sibpair families with large-vessel stroke subtype and in African Americans. Replication of protein-coding variants in candidate genes was observed for 2 previously reported GWAS associations: ZFHX3 (cardioembolic stroke) and ABCA1 (large-vessel stroke). Exome sequencing discovered 2 novel genes and mechanisms, PDE4DIP and ACOT4, associated with increased risk for ischemic stroke. In addition, ZFHX3 and ABCA1 were discovered to have protein-coding variants associated with ischemic stroke. These results suggest that genetic variation in novel pathways contributes to ischemic stroke risk and serves as a target for prediction, prevention, and therapy.

  12. Reconstitution of wild type viral DNA in simian cells transfected with early and late SV40 defective genomes.

    PubMed

    O'Neill, F J; Gao, Y; Xu, X

    1993-11-01

    The DNAs of polyomaviruses ordinarily exist as a single circular molecule of approximately 5000 base pairs. Variants of SV40, BKV and JCV have been described which contain two complementing defective DNA molecules. These defectives, which form a bipartite genome structure, contain either the viral early region or the late region. The defectives have the unique property of being able to tolerate variable sized reiterations of regulatory and terminus region sequences, and portions of the coding region. They can also exchange coding region sequences with other polyomaviruses. It has been suggested that the bipartite genome structure might be a stage in the evolution of polyomaviruses which can uniquely sustain genome and sequence diversity. However, it is not known if the regulatory and terminus region sequences are highly mutable. Also, it is not known if the bipartite genome structure is reversible and what the conditions might be which would favor restoration of the monomolecular genome structure. We addressed the first question by sequencing the reiterated regulatory and terminus regions of E- and L-SV40 DNAs. This revealed a large number of mutations in the regulatory regions of the defective genomes, including deletions, insertions, rearrangements and base substitutions. We also detected insertions and base substitutions in the T-antigen gene. We addressed the second question by introducing into permissive simian cells, E- and L-SV40 genomes which had been engineered to contain only a single regulatory region. Analysis of viral DNA from transfected cells demonstrated recombined genomes containing a wild type monomolecular DNA structure. However, the complete defectives, containing reiterated regulatory regions, could often compete away the wild type genomes. The recombinant monomolecular genomes were isolated, cloned and found to be infectious. All of the DNA alterations identified in one of the regulatory regions of E-SV40 DNA were present in the recombinant monomolecular genomes. These and other findings indicate that the bipartite genome state can sustain many mutations which wtSV40 cannot directly sustain. However, the mutations can later be introduced into the wild type genomes when the E- and L-SV40 DNAs recombine to generate a new monomolecular genome structure.

  13. Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

    PubMed

    Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

    1987-01-01

    The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

  14. Molecular detection of bovine Noroviruses in Argentinean dairy calves: Circulation of a tentative new genotype.

    PubMed

    Ferragut, Fátima; Vega, Celina G; Mauroy, Axel; Conceição-Neto, Nádia; Zeller, Mark; Heylen, Elisabeth; Uriarte, Enrique Louge; Bilbao, Gladys; Bok, Marina; Matthijnssens, Jelle; Thiry, Etienne; Badaracco, Alejandra; Parreño, Viviana

    2016-06-01

    Bovine noroviruses are enteric pathogens detected in fecal samples of both diarrheic and non-diarrheic calves from several countries worldwide. However, epidemiological information regarding bovine noroviruses is still lacking for many important cattle producing countries from South America. In this study, three bovine norovirus genogroup III sequences were determined by conventional RT-PCR and Sanger sequencing in feces from diarrheic dairy calves from Argentina (B4836, B4848, and B4881, all collected in 2012). Phylogenetic studies based on a partial coding region for the RNA-dependent RNA polymerase (RdRp, 503 nucleotides) of these three samples suggested that two of them (B4836 and B4881) belong to genotype 2 (GIII.2) while the third one (B4848) was more closely related to genotype 1 (GIII.1) strains. By deep sequencing, the capsid region from two of these strains could be determined. This confirmed the circulation of genotype 1 (B4848) together with the presence of another sequence (B4881) sharing its highest genetic relatedness with genotype 1, but sufficiently distant to constitute a new genotype. This latter strain was shown in silico to be a recombinant: phylogenetic divergence was detected between its RNA-dependent RNA polymerase coding sequence (genotype GIII.2) and its capsid protein coding sequence (genotype GIII.1 or a potential norovirus genotype). According to this data, this strain could be the second genotype GIII.2_GIII.1 bovine norovirus recombinant described in literature worldwide. Further analysis suggested that this strain could even be a potential norovirus GIII genotype, tentatively named GIII.4. The data provides important epidemiological and evolutionary information on bovine noroviruses circulating in South America. Copyright © 2016. Published by Elsevier B.V.

  15. Development of a set of SNP markers present in expressed genes of the apple.

    PubMed

    Chagné, David; Gasic, Ksenija; Crowhurst, Ross N; Han, Yuepeng; Bassett, Heather C; Bowatte, Deepa R; Lawrence, Timothy J; Rikkerink, Erik H A; Gardiner, Susan E; Korban, Schuyler S

    2008-11-01

    Molecular markers associated with gene coding regions are useful tools for bridging functional and structural genomics. Due to their high abundance in plant genomes, single nucleotide polymorphisms (SNPs) are present within virtually all genomic regions, including most coding sequences. The objective of this study was to develop a set of SNPs for the apple by taking advantage of the wealth of genomics resources available for the apple, including a large collection of expressed sequenced tags (ESTs). Using bioinformatics tools, a search for SNPs within an EST database of approximately 350,000 sequences developed from a variety of apple accessions was conducted. This resulted in the identification of a total of 71,482 putative SNPs. As the apple genome is reported to be an ancient polyploid, attempts were made to verify whether those SNPs detected in silico were attributable either to allelic polymorphisms or to gene duplication or paralogous or homeologous sequence variations. To this end, a set of 464 PCR primer pairs was designed, PCR was amplified using two subsets of plants, and the PCR products were sequenced. The SNPs retrieved from these sequences were then mapped onto apple genetic maps, including a newly constructed map of a Royal Gala x A689-24 cross and a Malling 9 x Robusta 5, map using a bin mapping strategy. The SNP genotyping was performed using the high-resolution melting (HRM) technique. A total of 93 new markers containing 210 coding SNPs were successfully mapped. This new set of SNP markers for the apple offers new opportunities for understanding the genetic control of important horticultural traits using quantitative trait loci (QTL) or linkage disequilibrium analysis. These also serve as useful markers for aligning physical and genetic maps, and as potential transferable markers across the Rosaceae family.

  16. Recombinant lactoferrin (Lf) of Vechur cow, the critical breed of Bos indicus and the Lf gene variants.

    PubMed

    Anisha, Shashidharan; Bhasker, Salini; Mohankumar, Chinnamma

    2012-03-01

    Vechur cow, categorized as a critically maintained breed by the FAO, is a unique breed of Bos indicus due to its extremely small size, less fodder intake, adaptability, easy domestication and traditional medicinal property of the milk. Lactoferrin (Lf) is an iron-binding glycoprotein that is found predominantly in the milk of mammals. The full coding region of Lf gene of Vechur cow was cloned, sequenced and expressed in a prokaryotic system. Antibacterial activity of the recombinant Lf showed suppression of bacterial growth. To the best of our knowledge this is the first time that the full coding region of Lf gene of B. indicus Vechur breed is sequenced, successfully expressed in a prokaryotic system and characterized. Comparative analysis of Lf gene sequence of five Vechur cows with B. taurus revealed 15 SNPs in the exon region associated with 11 amino acid substitutions. The amino acid arginine was noticed as a pronounced substitution and the tertiary structure analysis of the BLfV protein confirmed the positions of arginine in the β sheet region, random coil and helix region 1. Based on the recent reports on the nutritional therapies of arginine supplementation for wound healing and for cardiovascular diseases, the higher level of arginine in the lactoferrin protein of Vechur cow milk provides enormous scope for further therapeutic studies. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. Determination of the melon chloroplast and mitochondrial genome sequences reveals that the largest reported mitochondrial genome in plants contains a significant amount of DNA having a nuclear origin

    PubMed Central

    2011-01-01

    Background The melon belongs to the Cucurbitaceae family, whose economic importance among vegetable crops is second only to Solanaceae. The melon has a small genome size (454 Mb), which makes it suitable for molecular and genetic studies. Despite similar nuclear and chloroplast genome sizes, cucurbits show great variation when their mitochondrial genomes are compared. The melon possesses the largest plant mitochondrial genome, as much as eight times larger than that of other cucurbits. Results The nucleotide sequences of the melon chloroplast and mitochondrial genomes were determined. The chloroplast genome (156,017 bp) included 132 genes, with 98 single-copy genes dispersed between the small (SSC) and large (LSC) single-copy regions and 17 duplicated genes in the inverted repeat regions (IRa and IRb). A comparison of the cucumber and melon chloroplast genomes showed differences in only approximately 5% of nucleotides, mainly due to short indels and SNPs. Additionally, 2.74 Mb of mitochondrial sequence, accounting for 95% of the estimated mitochondrial genome size, were assembled into five scaffolds and four additional unscaffolded contigs. An 84% of the mitochondrial genome is contained in a single scaffold. The gene-coding region accounted for 1.7% (45,926 bp) of the total sequence, including 51 protein-coding genes, 4 conserved ORFs, 3 rRNA genes and 24 tRNA genes. Despite the differences observed in the mitochondrial genome sizes of cucurbit species, Citrullus lanatus (379 kb), Cucurbita pepo (983 kb) and Cucumis melo (2,740 kb) share 120 kb of sequence, including the predicted protein-coding regions. Nevertheless, melon contained a high number of repetitive sequences and a high content of DNA of nuclear origin, which represented 42% and 47% of the total sequence, respectively. Conclusions Whereas the size and gene organisation of chloroplast genomes are similar among the cucurbit species, mitochondrial genomes show a wide variety of sizes, with a non-conserved structure both in gene number and organisation, as well as in the features of the noncoding DNA. The transfer of nuclear DNA to the melon mitochondrial genome and the high proportion of repetitive DNA appear to explain the size of the largest mitochondrial genome reported so far. PMID:21854637

  18. Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.

    PubMed Central

    Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F

    1984-01-01

    The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019

  19. Genomic structure of two ras family genes in the slime mold Physarum polycephalum.

    PubMed

    Trzcińska-Danielewicz, Joanna; Kozlowski, Piotr; Gierdal, Katarzyna; Wiejak, Jolanta; Jagielski, Adam; Toczko, Kazimierz; Fronk, Jan

    2002-08-01

    Genomic structure of two Physarum polycephalum ras family genes, Ppras2 and Pprap1, has been determined, including the upstream region of the latter. The genes are interrupted by three and four introns, respectively. The first intron of Ppras2 has the same location within the coding sequence as the first intron in another ras homolog from this organism, Ppras1 [Trzcińska-Danielewicz, J., Kozlowski, P., and Toczko, K. (1996). "Cloning and genomic sequence of the Physarum polycephalum Ppras1 gene, a homologue of the ras protooncogene", Gene 169, pp. 143-144]. All introns, ranging from 53 to ca. 460 base pairs, have the canonical 5' and 3' ends, are greatly enriched in pyrimidines in the coding strand and have frequent pyrimidines-only tracts. These latter features seem to be responsible for the difficulties in cloning and sequencing of parts of these genes. Short sequences shared with P. polycephalum transposon-like repeats are common in the introns, indicating a possible role of transposition in intron evolution. In all three ras family genes phase zero introns are located mostly between sequences coding for regular protein secondary structure elements.

  20. Glutamate cysteine ligase (GCL) in the freshwater bivalve Unio tumidus: impact of storage conditions and seasons on activity and identification of partial coding sequence of the catalytic subunit.

    PubMed

    Coffinet, Stéphanie; Cossu-Leguille, Carole; Rodius, François; Vasseur, Paule

    2008-09-01

    Glutamate cysteine ligase (GCL; EC 6.3.2.2) is the first enzyme involved in the synthesis of glutathione. A HPLC method with fluorimetric detection was used to measure GCL activity in the gills and the digestive gland of the freshwater bivalve, Unio tumidus. Storage conditions were optimized in order to prevent decrease of GCL activity and consisted in freezing the cytosolic fraction in the presence of protease (1 mM phenylmethylsulfonic fluoric acid) and gamma-glutamyltranspeptidase (1 mM L-serine borate mixture and 0.5 mM acivicin) inhibitors. Seasonal variations of activity in the digestive gland and to a lesser extent in the gills were found with activity increasing in spring compared to winter. No sex differences were revealed. The GCL coding sequence was identified using degenerated primers designed in the highly conserved regions of the catalytic subunit of GCL. The partial sequence identified encoded for 121 amino acids. The comparison of the identified partial coding sequence of U. tumidus with those available from vertebrates and invertebrates indicated that GCL sequence was highly conserved.

  1. A single base substitution in the coding region for neurophysin II associated with familial central diabetes insipidus.

    PubMed Central

    Ito, M; Mori, Y; Oiso, Y; Saito, H

    1991-01-01

    To elucidate the molecular mechanism of familial central diabetes insipidus (FDI), we sequenced the arginine vasopressin-neurophysin II (AVP-NPII) gene in 2 patients belonging to a pedigree that is consistent with an autosomal dominant mode of inheritance. 10 patients with idiopathic central diabetes insipidus (IDI) and 5 normals were also studied. The AVP-NPII gene, locating on chromosome 20, consists of three exons that encode putative signal peptide, AVP, NPII, and glycoprotein. Using polymerase chain reaction, fragments including the promoter region and all coding regions were amplified from genomic DNA and subjected to direct sequencing. Sequences of 10 patients with IDI were identical with those of normals, while in 2 patients with FDI, a single base substitution was detected in one of two alleles of the AVP-NPII gene, indicating they were heterozygotes for this mutation. It was a G----A transition at nucleotide position 1859 in the second exon, resulting in a substitution of Gly for Ser at amino acid position 57 in the NPII moiety. It was speculated that the mutated AVP-NPII precursor or the mutated NPII molecule, through their conformational changes, might be responsible for AVP deficiency. Images PMID:1840604

  2. Complete mitochondrial genome sequence of northeastern sika deer (Cervus nippon hortulorum).

    PubMed

    Shao, Yuanchen; Zha, Daiming; Xing, Xiumei; Su, Weilin; Liu, Huamiao; Zhang, Ranran

    2016-01-01

    The complete mitochondrial genome of the northeastern sika deer, Cervus nippon hortulorum, was determined by accurate polymerase chain reaction. The entire genome is 16,434 bp in length and contains 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region, all of which are arranged in a typical vertebrate manner. The overall base composition of the northeastern sika deer's mitochondrial genome is 33.3% of A, 24.5% of C, 28.7% of T and 13.5% of G. A termination associated sequence and several conserved central sequence block domains were discovered within the control region.

  3. The complete mitochondrial genome of the ice pigeon (Columba livia breed ice).

    PubMed

    Zhang, Rui-Hua; He, Wen-Xiao

    2015-02-01

    The ice pigeon is a breed of fancy pigeon developed over many years of selective breeding. In the present work, we report the complete mitochondrial genome sequence of ice pigeon for the first time. The total length of the mitogenome was 17,236 bp with the base composition of 30.2% for A, 24.0% for T, 31.9% for C, and 13.9% for G and an A-T (54.2 %)-rich feature was detected. It harbored 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and 1 non-coding control region (D-loop region). The arrangement of all genes was identical to the typical mitochondrial genomes of pigeon. The complete mitochondrial genome sequence of ice pigeon would serve as an important data set of the germplasm resources for further study.

  4. The complete mitochondrial genome of the Fancy Pigeon, Columba livia (Columbiformes: Columbidae).

    PubMed

    Zhang, Rui-Hua; Xu, Ming-Ju; Wang, Cun-Lian; Xu, Tong; Wei, Dong; Liu, Bao-Jian; Wang, Guo-Hua

    2015-02-01

    The fancy pigeons are domesticated varieties of the rock pigeon developed over many years of selective breeding. In the present work, we report the complete mitochondrial genome sequence of fancy pigeon for the first time. The total length of the mitogenome was 17,233 bp with the base composition of 30.1% for A, 24.0% for T, 31.9% for C, and 14.0% for G and an A-T (54.2 %)-rich feature was detected. It harbored 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and 1 non-coding control region (D-loop region). The arrangement of all genes was identical to the typical mitochondrial genomes of pigeon. The complete mitochondrial genome sequence of fancy pigeon would serve as an important data set of the germplasm resources for further study.

  5. Complete mitochondrial genome of Xingguo red carp (Cyprinus carpio var. singuonensis) and purse red carp (Cyprinus carpio var. wuyuanensis).

    PubMed

    Hu, Guang-Fu; Liu, Xiang-Jiang; Li, Zhong; Liang, Hong-Wei; Hu, Shao-Na; Zou, Gui-Wei

    2016-01-01

    The complete mitochondrial genomes of Xingguo red carp (Cyprinus carpio var. singuonensis) and purse red carp (Cyprinus carpio var. wuyuanensis) were sequenced. Comparison of these two mitochondrial genomes revealed that the mtDNAs of these two common carp varieties were remarkably similar in genome length, gene order and content, and AT content. However, size variation between these two mitochondrial genomes presented here showed 39 site differences in overall length. About 2 site differences were located in rRNAs, 3 in tRNAs, 3 in the control region, 31 in protein-coding genes. Thirty-one variable bases in the protein-coding regions between the two varieties mitochondrial sequences led to three variable amino acids, which were mainly located in the protein ND5 and ND4.

  6. WES homozygosity mapping in a recessive form of Charcot-Marie-Tooth neuropathy reveals intronic GDAP1 variant leading to a premature stop codon.

    PubMed

    Masingue, Marion; Perrot, Jimmy; Carlier, Robert-Yves; Piguet-Lacroix, Guenaelle; Latour, Philippe; Stojkovic, Tanya

    2018-05-01

    Charcot-Marie-Tooth disease (CMT) refers to a group of clinically and genetically heterogeneous inherited neuropathies. Ganglioside-induced differentiation-associated protein 1 GDAP1-related CMT has been reported in an autosomal dominant or recessive form in patients presenting either axonal or demyelinating neuropathy. We report two Sri Lankan sisters born to consanguineous parents and presenting with a severe axonal sensorimotor neuropathy. The early onset of the disease, the distal and proximal weakness and atrophy leading to major disability, along with areflexia, and, most notably, vocal cord and diaphragm paralysis were highly evocative of a GDAP1-related CMT. However, sequencing of the coding regions of the gene was normal. Whole-exome sequencing (WES) was performed and revealed that the largest region of homozygosity was around GDAP1 with several variants, mostly in non-coding regions. In view of the high clinical suspicion of GDAP1 gene involvement, we examined the variants in this gene and this, along with functional studies, allowed us to identify an alternative splicing site revealing a cryptic in-frame stop codon in intron 4 responsible for a severe loss of wild-type GDAP1. This work is the first to describe a deleterious mutation in GDAP1 gene outside of coding sequences or intronic junctions and emphasizes the importance of interpreting molecular analysis, and in particular WES results, in light of the clinical and electrophysiological phenotype.

  7. Low Diversity in the Mitogenome of Sperm Whales Revealed by Next-Generation Sequencing

    PubMed Central

    Alexander, Alana; Steel, Debbie; Slikas, Beth; Hoekzema, Kendra; Carraher, Colm; Parks, Matthew; Cronn, Richard; Baker, C. Scott

    2013-01-01

    Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20 mitogenomes from 17 sperm whales representative of worldwide diversity using Next Generation Sequencing (NGS) technologies (Illumina GAIIx, Roche 454 GS Junior). Resequencing of three individuals with both NGS platforms and partial Sanger sequencing showed low discrepancy rates (454-Illumina: 0.0071%; Sanger-Illumina: 0.0034%; and Sanger-454: 0.0023%) confirming suitability of both NGS platforms for investigating low mitogenomic diversity. Using the 17 sperm whale mitogenomes in a phylogenetic reconstruction with 41 other species, including 11 new dolphin mitogenomes, we tested two hypotheses for the low CR diversity. First, the hypothesis that CR-specific constraints have reduced diversity solely in the CR was rejected as diversity was low throughout the mitogenome, not just in the CR (overall diversity π = 0.096%; protein-coding 3rd codon = 0.22%; CR = 0.35%), and CR phylogenetic signal was congruent with protein-coding regions. Second, the hypothesis that slow substitution rates reduced diversity throughout the sperm whale mitogenome was rejected as sperm whales had significantly higher rates of CR evolution and no evidence of slow coding region evolution relative to other cetaceans. The estimated time to most recent common ancestor for sperm whale mitogenomes was 72,800 to 137,400 years ago (95% highest probability density interval), consistent with previous hypotheses of a bottleneck or selective sweep as likely causes of low mitogenome diversity. PMID:23254394

  8. GeneBuilder: interactive in silico prediction of gene structure.

    PubMed

    Milanesi, L; D'Angelo, D; Rogozin, I B

    1999-01-01

    Prediction of gene structure in newly sequenced DNA becomes very important in large genome sequencing projects. This problem is complicated due to the exon-intron structure of eukaryotic genes and because gene expression is regulated by many different short nucleotide domains. In order to be able to analyse the full gene structure in different organisms, it is necessary to combine information about potential functional signals (promoter region, splice sites, start and stop codons, 3' untranslated region) together with the statistical properties of coding sequences (coding potential), information about homologous proteins, ESTs and repeated elements. We have developed the GeneBuilder system which is based on prediction of functional signals and coding regions by different approaches in combination with similarity searches in proteins and EST databases. The potential gene structure models are obtained by using a dynamic programming method. The program permits the use of several parameters for gene structure prediction and refinement. During gene model construction, selecting different exon homology levels with a protein sequence selected from a list of homologous proteins can improve the accuracy of the gene structure prediction. In the case of low homology, GeneBuilder is still able to predict the gene structure. The GeneBuilder system has been tested by using the standard set (Burset and Guigo, Genomics, 34, 353-367, 1996) and the performances are: 0.89 sensitivity and 0.91 specificity at the nucleotide level. The total correlation coefficient is 0.88. The GeneBuilder system is implemented as a part of the WebGene a the URL: http://www.itba.mi. cnr.it/webgene and TRADAT (TRAncription Database and Analysis Tools) launcher URL: http://www.itba.mi.cnr.it/tradat.

  9. Low diversity in the mitogenome of sperm whales revealed by next-generation sequencing.

    PubMed

    Alexander, Alana; Steel, Debbie; Slikas, Beth; Hoekzema, Kendra; Carraher, Colm; Parks, Matthew; Cronn, Richard; Baker, C Scott

    2013-01-01

    Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20 mitogenomes from 17 sperm whales representative of worldwide diversity using Next Generation Sequencing (NGS) technologies (Illumina GAIIx, Roche 454 GS Junior). Resequencing of three individuals with both NGS platforms and partial Sanger sequencing showed low discrepancy rates (454-Illumina: 0.0071%; Sanger-Illumina: 0.0034%; and Sanger-454: 0.0023%) confirming suitability of both NGS platforms for investigating low mitogenomic diversity. Using the 17 sperm whale mitogenomes in a phylogenetic reconstruction with 41 other species, including 11 new dolphin mitogenomes, we tested two hypotheses for the low CR diversity. First, the hypothesis that CR-specific constraints have reduced diversity solely in the CR was rejected as diversity was low throughout the mitogenome, not just in the CR (overall diversity π = 0.096%; protein-coding 3rd codon = 0.22%; CR = 0.35%), and CR phylogenetic signal was congruent with protein-coding regions. Second, the hypothesis that slow substitution rates reduced diversity throughout the sperm whale mitogenome was rejected as sperm whales had significantly higher rates of CR evolution and no evidence of slow coding region evolution relative to other cetaceans. The estimated time to most recent common ancestor for sperm whale mitogenomes was 72,800 to 137,400 years ago (95% highest probability density interval), consistent with previous hypotheses of a bottleneck or selective sweep as likely causes of low mitogenome diversity.

  10. Regulatory versus coding signatures of natural selection in a candidate gene involved in the adaptive divergence of whitefish species pairs (Coregonus spp.)

    PubMed Central

    Jeukens, Julie; Bernatchez, Louis

    2012-01-01

    While gene expression divergence is known to be involved in adaptive phenotypic divergence and speciation, the relative importance of regulatory and structural evolution of genes is poorly understood. A recent next-generation sequencing experiment allowed identifying candidate genes potentially involved in the ongoing speciation of sympatric dwarf and normal lake whitefish (Coregonus clupeaformis), such as cytosolic malate dehydrogenase (MDH1), which showed both significant expression and sequence divergence. The main goal of this study was to investigate into more details the signatures of natural selection in the regulatory and coding sequences of MDH1 in lake whitefish and test for parallelism of these signatures with other coregonine species. Sequencing of the two regions in 118 fish from four sympatric pairs of whitefish and two cisco species revealed a total of 35 single nucleotide polymorphisms (SNPs), with more genetic diversity in European compared to North American coregonine species. While the coding region was found to be under purifying selection, an SNP in the proximal promoter exhibited significant allele frequency divergence in a parallel manner among independent sympatric pairs of North American lake whitefish and European whitefish (C. lavaretus). According to transcription factor binding simulation for 22 regulatory haplotypes of MDH1, putative binding profiles were fairly conserved among species, except for the region around this SNP. Moreover, we found evidence for the role of this SNP in the regulation of MDH1 expression level. Overall, these results provide further evidence for the role of natural selection in gene regulation evolution among whitefish species pairs and suggest its possible link with patterns of phenotypic diversity observed in coregonine species. PMID:22408741

  11. Regulatory versus coding signatures of natural selection in a candidate gene involved in the adaptive divergence of whitefish species pairs (Coregonus spp.).

    PubMed

    Jeukens, Julie; Bernatchez, Louis

    2012-01-01

    While gene expression divergence is known to be involved in adaptive phenotypic divergence and speciation, the relative importance of regulatory and structural evolution of genes is poorly understood. A recent next-generation sequencing experiment allowed identifying candidate genes potentially involved in the ongoing speciation of sympatric dwarf and normal lake whitefish (Coregonus clupeaformis), such as cytosolic malate dehydrogenase (MDH1), which showed both significant expression and sequence divergence. The main goal of this study was to investigate into more details the signatures of natural selection in the regulatory and coding sequences of MDH1 in lake whitefish and test for parallelism of these signatures with other coregonine species. Sequencing of the two regions in 118 fish from four sympatric pairs of whitefish and two cisco species revealed a total of 35 single nucleotide polymorphisms (SNPs), with more genetic diversity in European compared to North American coregonine species. While the coding region was found to be under purifying selection, an SNP in the proximal promoter exhibited significant allele frequency divergence in a parallel manner among independent sympatric pairs of North American lake whitefish and European whitefish (C. lavaretus). According to transcription factor binding simulation for 22 regulatory haplotypes of MDH1, putative binding profiles were fairly conserved among species, except for the region around this SNP. Moreover, we found evidence for the role of this SNP in the regulation of MDH1 expression level. Overall, these results provide further evidence for the role of natural selection in gene regulation evolution among whitefish species pairs and suggest its possible link with patterns of phenotypic diversity observed in coregonine species.

  12. Sequence analysis of tau 3'untranslated region and saitohin gene in sporadic progressive supranuclear palsy

    PubMed Central

    Ezquerra, M; Campdelacreu, J; Munoz, E; Oliva, R; Tolosa, E

    2004-01-01

    Objectives: To search for genetic changes in the 3'untranslated region (3'UTR) of tau and adjacent sequence LOC147077, and in the coding region of STH in PSP patients. Methods: The study included 57 PSP patients and 83 healthy controls. The genetic analysis of each region was performed through sequencing. The Q7R polymorphism was studied through restriction enzyme and electrophoresis analysis. Results: No mutations were found in the regions analysed. The QQ genotype of the STH polymorphism was over-represented in participants with PSP (91.5%) compared with control subjects (47%) (p⩽0.00001). This genotype co-segregated with the H1/H1 haplotype in our PSP cases. Conclusions: Our results do not support a major role for the tau 3'UTR in PSP genetics. The QQ genotype of STH confers susceptibility for PSP and is in linkage disequilibrium with the H1/H1 haplotype. PMID:14707330

  13. Sequence of interleukin-2 isolated from human placental poly A+ RNA: possible role in maintenance of fetal allograft.

    PubMed

    Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J

    1996-02-01

    There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.

  14. Major Breeding Plumage Color Differences of Male Ruffs (Philomachus pugnax) Are Not Associated With Coding Sequence Variation in the MC1R Gene

    PubMed Central

    Küpper, Clemens; Burke, Terry; Lank, David B.

    2015-01-01

    Sequence variation in the melanocortin-1 receptor (MC1R) gene explains color morph variation in several species of birds and mammals. Ruffs (Philomachus pugnax) exhibit major dark/light color differences in melanin-based male breeding plumage which is closely associated with alternative reproductive behavior. A previous study identified a microsatellite marker (Ppu020) near the MC1R locus associated with the presence/absence of ornamental plumage. We investigated whether coding sequence variation in the MC1R gene explains major dark/light plumage color variation and/or the presence/absence of ornamental plumage in ruffs. Among 821bp of the MC1R coding region from 44 male ruffs we found 3 single nucleotide polymorphisms, representing 1 nonsynonymous and 2 synonymous amino acid substitutions. None were associated with major dark/light color differences or the presence/absence of ornamental plumage. At all amino acid sites known to be functionally important in other avian species with dark/light plumage color variation, ruffs were either monomorphic or the shared polymorphism did not coincide with color morph. Neither ornamental plumage color differences nor the presence/absence of ornamental plumage in ruffs are likely to be caused entirely by amino acid variation within the coding regions of the MC1R locus. Regulatory elements and structural variation at other loci may be involved in melanin expression and contribute to the extreme plumage polymorphism observed in this species. PMID:25534935

  15. Evaluation of non-coding variation in GLUT1 deficiency.

    PubMed

    Liu, Yu-Chi; Lee, Jia Wei Audrey; Bellows, Susannah T; Damiano, John A; Mullen, Saul A; Berkovic, Samuel F; Bahlo, Melanie; Scheffer, Ingrid E; Hildebrand, Michael S

    2016-12-01

    Loss-of-function mutations in SLC2A1, encoding glucose transporter-1 (GLUT-1), lead to dysfunction of glucose transport across the blood-brain barrier. Ten percent of cases with hypoglycorrhachia (fasting cerebrospinal fluid [CSF] glucose <2.2mmol/L) do not have mutations. We hypothesized that GLUT1 deficiency could be due to non-coding SLC2A1 variants. We performed whole exome sequencing of one proband with a GLUT1 phenotype and hypoglycorrhachia negative for SLC2A1 sequencing and copy number variants. We studied a further 55 patients with different epilepsies and low CSF glucose who did not have exonic mutations or copy number variants. We sequenced non-coding promoter and intronic regions. We performed mRNA studies for the recurrent intronic variant. The proband had a de novo splice site mutation five base pairs from the intron-exon boundary. Three of 55 patients had deep intronic SLC2A1 variants, including a recurrent variant in two. The recurrent variant produced less SLC2A1 mRNA transcript. Fasting CSF glucose levels show an age-dependent correlation, which makes the definition of hypoglycorrhachia challenging. Low CSF glucose levels may be associated with pathogenic SLC2A1 mutations including deep intronic SLC2A1 variants. Extending genetic screening to non-coding regions will enable diagnosis of more patients with GLUT1 deficiency, allowing implementation of the ketogenic diet to improve outcomes. © 2016 Mac Keith Press.

  16. Comparative genomics approach to detecting split-coding regions in a low-coverage genome: lessons from the chimaera Callorhinchus milii (Holocephali, Chondrichthyes).

    PubMed

    Dessimoz, Christophe; Zoller, Stefan; Manousaki, Tereza; Qiu, Huan; Meyer, Axel; Kuraku, Shigehiro

    2011-09-01

    Recent development of deep sequencing technologies has facilitated de novo genome sequencing projects, now conducted even by individual laboratories. However, this will yield more and more genome sequences that are not well assembled, and will hinder thorough annotation when no closely related reference genome is available. One of the challenging issues is the identification of protein-coding sequences split into multiple unassembled genomic segments, which can confound orthology assignment and various laboratory experiments requiring the identification of individual genes. In this study, using the genome of a cartilaginous fish, Callorhinchus milii, as test case, we performed gene prediction using a model specifically trained for this genome. We implemented an algorithm, designated ESPRIT, to identify possible linkages between multiple protein-coding portions derived from a single genomic locus split into multiple unassembled genomic segments. We developed a validation framework based on an artificially fragmented human genome, improvements between early and recent mouse genome assemblies, comparison with experimentally validated sequences from GenBank, and phylogenetic analyses. Our strategy provided insights into practical solutions for efficient annotation of only partially sequenced (low-coverage) genomes. To our knowledge, our study is the first formulation of a method to link unassembled genomic segments based on proteomes of relatively distantly related species as references.

  17. Comparative genomics approach to detecting split-coding regions in a low-coverage genome: lessons from the chimaera Callorhinchus milii (Holocephali, Chondrichthyes)

    PubMed Central

    Zoller, Stefan; Manousaki, Tereza; Qiu, Huan; Meyer, Axel; Kuraku, Shigehiro

    2011-01-01

    Recent development of deep sequencing technologies has facilitated de novo genome sequencing projects, now conducted even by individual laboratories. However, this will yield more and more genome sequences that are not well assembled, and will hinder thorough annotation when no closely related reference genome is available. One of the challenging issues is the identification of protein-coding sequences split into multiple unassembled genomic segments, which can confound orthology assignment and various laboratory experiments requiring the identification of individual genes. In this study, using the genome of a cartilaginous fish, Callorhinchus milii, as test case, we performed gene prediction using a model specifically trained for this genome. We implemented an algorithm, designated ESPRIT, to identify possible linkages between multiple protein-coding portions derived from a single genomic locus split into multiple unassembled genomic segments. We developed a validation framework based on an artificially fragmented human genome, improvements between early and recent mouse genome assemblies, comparison with experimentally validated sequences from GenBank, and phylogenetic analyses. Our strategy provided insights into practical solutions for efficient annotation of only partially sequenced (low-coverage) genomes. To our knowledge, our study is the first formulation of a method to link unassembled genomic segments based on proteomes of relatively distantly related species as references. PMID:21712341

  18. Applications of statistical physics and information theory to the analysis of DNA sequences

    NASA Astrophysics Data System (ADS)

    Grosse, Ivo

    2000-10-01

    DNA carries the genetic information of most living organisms, and the of genome projects is to uncover that genetic information. One basic task in the analysis of DNA sequences is the recognition of protein coding genes. Powerful computer programs for gene recognition have been developed, but most of them are based on statistical patterns that vary from species to species. In this thesis I address the question if there exist universal statistical patterns that are different in coding and noncoding DNA of all living species, regardless of their phylogenetic origin. In search for such species-independent patterns I study the mutual information function of genomic DNA sequences, and find that it shows persistent period-three oscillations. To understand the biological origin of the observed period-three oscillations, I compare the mutual information function of genomic DNA sequences to the mutual information function of stochastic model sequences. I find that the pseudo-exon model is able to reproduce the mutual information function of genomic DNA sequences. Moreover, I find that a generalization of the pseudo-exon model can connect the existence and the functional form of long-range correlations to the presence and the length distributions of coding and noncoding regions. Based on these theoretical studies I am able to find an information-theoretical quantity, the average mutual information (AMI), whose probability distributions are significantly different in coding and noncoding DNA, while they are almost identical in all studied species. These findings show that there exist universal statistical patterns that are different in coding and noncoding DNA of all studied species, and they suggest that the AMI may be used to identify genes in different living species, irrespective of their taxonomic origin.

  19. Characterization of mitochondrial genome of sea cucumber Stichopus horrens: a novel gene arrangement in Holothuroidea.

    PubMed

    Fan, SiGang; Hu, ChaoQun; Wen, Jing; Zhang, LvPing

    2011-05-01

    The complete mitochondrial DNA sequence contains useful information for phylogenetic analyses of metazoa. In this study, the complete mitochondrial DNA sequence of sea cucumber Stichopus horrens (Holothuroidea: Stichopodidae: Stichopus) is presented. The complete sequence was determined using normal and long PCRs. The mitochondrial genome of Stichopus horrens is a circular molecule 16257 bps long, composed of 13 protein-coding genes, two ribosomal RNA genes and 22 transfer RNA genes. Most of these genes are coded on the heavy strand except for one protein-coding gene (nad6) and five tRNA genes (tRNA ( Ser(UCN) ), tRNA ( Gln ), tRNA ( Ala ), tRNA ( Val ), tRNA ( Asp )) which are coded on the light strand. The composition of the heavy strand is 30.8% A, 23.7% C, 16.2% G, and 29.3% T bases (AT skew=0.025; GC skew=-0.188). A non-coding region of 675 bp was identified as a putative control region because of its location and AT richness. The intergenic spacers range from 1 to 50 bp in size, totaling 227 bp. A total of 25 overlapping nucleotides, ranging from 1 to 10 bp in size, exist among 11 genes. All 13 protein-coding genes are initiated with an ATG. The TAA codon is used as the stop codon in all the protein coding genes except nad3 and nad4 that use TAG as their termination codon. The most frequently used amino acids are Leu (16.29%), Ser (10.34%) and Phe (8.37%). All of the tRNA genes have the potential to fold into typical cloverleaf secondary structures. We also compared the order of the genes in the mitochondrial DNA from the five holothurians that are now available and found a novel gene arrangement in the mitochondrial DNA of Stichopus horrens.

  20. The first complete mitochondrial genome of Bactrocera tsuneonis (Miyake) (Diptera: Tephritidae) by next-generation sequencing and its phylogenetic implications.

    PubMed

    Zhang, Yue; Feng, Shiqian; Zeng, Yiying; Ning, Hong; Liu, Lijun; Zhao, Zihua; Jiang, Fan; Li, Zhihong

    2018-06-23

    Bactrocera tsuneonis (Miyake), generally known as the Japanese orange fly, is considered to be a major pest of commercial citrus crops. It has a limited distribution in China, Japan and Vietnam, but it has the potential to invade areas outside of Asia. More genetic information of B. tsuneonis should be obtained in order to develop effective methodologies for rapid and accurate molecular identification due to the difficulty of distinguishing it from Bactrocera minax based on morphological features. We report here the whole mitochondrial genome of B. tsuneonis sequenced by next-generation sequencing. This mitogenome sequence had a total length of 15,865 bp, a typical circular molecule comprising 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a non-coding region (A + T-rich control region). The structure and organization of the molecule were typical and similar compared with the published homologous sequences of other fruit flies in Tephritidae. The phylogenetic analyses based on the mitochondrial genome data presented a close genetic relationship between B. tsuneonis and B. minax. This is the first report of the complete mitochondrial genome of B. tsuneonis, and it can be used in further studies of species diagnosis, evolutionary biology, prevention and control. Copyright © 2018. Published by Elsevier B.V.

  1. Polymorphism of BMP4 gene in Indian goat breeds differing in prolificacy.

    PubMed

    Sharma, Rekha; Ahlawat, Sonika; Maitra, A; Roy, Manoranjan; Mandakmale, S; Tantia, M S

    2013-12-10

    Bone morphogenetic proteins (BMPs) are members of the TGF-β (transforming growth factor-beta) superfamily, of which BMP4 is the most important due to its crucial role in follicular growth and differentiation, cumulus expansion and ovulation. Reproduction is a crucial trait in goat breeding and based on the important role of BMP4 gene in reproduction it was considered as a possible candidate gene for the prolificacy of goats. The objective of the present study was to detect polymorphism in intronic, exonic and 3' un-translated regions of BMP4 gene in Indian goats. Nine different goat breeds (Barbari, Beetal, Black Bengal, Malabari, Jakhrana (Twinning>40%), Osmanabadi, Sangamneri (Twinning 20-30%), Sirohi and Ganjam (Twinning<10%)) differing in prolificacy and geographic distribution were employed for polymorphism scanning. Cattle sequence (AC_000167.1) was used to design primers for the amplification of a targeted region followed by direct DNA sequencing to identify the genetic variations. Single nucleotide polymorphisms (SNPs) were not detected in exon 3, the intronic region and the 3' flanking region. A SNP (G1534A) was identified in exon 2. It was a non-synonymous mutation resulting in an arginine to lysine change in a corresponding protein sequence. G to A transition at the 1534 locus revealed two genotypes GG and GA in the nine investigated goat breeds. The GG genotype was predominant with a genotype frequency of 0.98. The GA genotype was present in the Black Bengal as well as Jakhrana breed with a genotype frequency of 0.02. A microsatellite was identified in the 3' flanking region, only 20 nucleotides downstream from the termination site of the coding region, as a short sequence with more than nineteen continuous and repeated CA dinucleotides. Since the gene is highly evolutionarily conserved, identification of a non-synonymous SNP (G1534A) in the coding region gains further importance. To our knowledge, this is the first report of a mutation in the coding region of the caprine BMP4 gene. But whether the reproduction trait of goat is associated with the BMP4 polymorphism, needs to be further defined by association studies in more populations so as to delineate an effect on it. © 2013 Elsevier B.V. All rights reserved.

  2. The complete coding region sequence of river buffalo (Bubalus bubalis) SRY gene.

    PubMed

    Parma, Pietro; Feligini, Maria; Greppi, Gianfranco; Enne, Giuseppe

    2004-02-01

    The Y-linked SRY gene is responsible for testis determination in mammals. Mutations in this gene can lead to XY Gonadal Dysgenesis, an abnormal sexual phenotype described in humans, cattle, horses and river buffalo. We report here the complete river buffalo SRY sequence in order to enable the genetic diagnosis of this disease. The SRY sequence was also used to confirm the evolutionary divergence time between cattle and river buffalo 10 million years ago.

  3. Mind the gap! The mitochondrial control region and its power as a phylogenetic marker in echinoids.

    PubMed

    Bronstein, Omri; Kroh, Andreas; Haring, Elisabeth

    2018-05-30

    In Metazoa, mitochondrial markers are the most commonly used targets for inferring species-level molecular phylogenies due to their extremely low rate of recombination, maternal inheritance, ease of use and fast substitution rate in comparison to nuclear DNA. The mitochondrial control region (CR) is the main non-coding area of the mitochondrial genome and contains the mitochondrial origin of replication and transcription. While sequences of the cytochrome oxidase subunit 1 (COI) and 16S rRNA genes are the prime mitochondrial markers in phylogenetic studies, the highly variable CR is typically ignored and not targeted in such analyses. However, the higher substitution rate of the CR can be harnessed to infer the phylogeny of closely related species, and the use of a non-coding region alleviates biases resulting from both directional and purifying selection. Additionally, complete mitochondrial genome assemblies utilizing next generation sequencing (NGS) data often show exceptionally low coverage at specific regions, including the CR. This can only be resolved by targeted sequencing of this region. Here we provide novel sequence data for the echinoid mitochondrial control region in over 40 species across the echinoid phylogenetic tree. We demonstrate the advantages of directly targeting the CR and adjacent tRNAs to facilitate complementing low coverage NGS data from complete mitochondrial genome assemblies. Finally, we test the performance of this region as a phylogenetic marker both in the lab and in phylogenetic analyses, and demonstrate its superior performance over the other available mitochondrial markers in echinoids. Our target region of the mitochondrial CR (1) facilitates the first thorough investigation of this region across a wide range of echinoid taxa, (2) provides a tool for complementing missing data in NGS experiments, and (3) identifies the CR as a powerful, novel marker for phylogenetic inference in echinoids due to its high variability, lack of selection, and high compatibility across the entire class, outperforming conventional mitochondrial markers.

  4. Genomewide analysis of Drosophila circular RNAs reveals their structural and sequence properties and age-dependent neural accumulation

    PubMed Central

    Westholm, Jakub O.; Miura, Pedro; Olson, Sara; Shenker, Sol; Joseph, Brian; Sanfilippo, Piero; Celniker, Susan E.; Graveley, Brenton R.; Lai, Eric C.

    2014-01-01

    Circularization was recently recognized to broadly expand transcriptome complexity. Here, we exploit massive Drosophila total RNA-sequencing data, >5 billion paired-end reads from >100 libraries covering diverse developmental stages, tissues and cultured cells, to rigorously annotate >2500 fruitfly circular RNAs. These mostly derive from back-splicing of protein-coding genes and lack poly(A) tails, and circularization of hundreds of genes is conserved across multiple Drosophila species. We elucidate structural and sequence properties of Drosophila circular RNAs, which exhibit commonalities and distinctions from mammalian circles. Notably, Drosophila circular RNAs harbor >1000 well-conserved canonical miRNA seed matches, especially within coding regions, and coding conserved miRNA sites reside preferentially within circularized exons. Finally, we analyze the developmental and tissue specificity of circular RNAs, and note their preferred derivation from neural genes and enhanced accumulation in neural tissues. Interestingly, circular isoforms increase dramatically relative to linear isoforms during CNS aging, and constitute a novel aging biomarker. PMID:25544350

  5. Analysis of protein-coding genetic variation in 60,706 humans.

    PubMed

    Lek, Monkol; Karczewski, Konrad J; Minikel, Eric V; Samocha, Kaitlin E; Banks, Eric; Fennell, Timothy; O'Donnell-Luria, Anne H; Ware, James S; Hill, Andrew J; Cummings, Beryl B; Tukiainen, Taru; Birnbaum, Daniel P; Kosmicki, Jack A; Duncan, Laramie E; Estrada, Karol; Zhao, Fengmei; Zou, James; Pierce-Hoffman, Emma; Berghout, Joanne; Cooper, David N; Deflaux, Nicole; DePristo, Mark; Do, Ron; Flannick, Jason; Fromer, Menachem; Gauthier, Laura; Goldstein, Jackie; Gupta, Namrata; Howrigan, Daniel; Kiezun, Adam; Kurki, Mitja I; Moonshine, Ami Levy; Natarajan, Pradeep; Orozco, Lorena; Peloso, Gina M; Poplin, Ryan; Rivas, Manuel A; Ruano-Rubio, Valentin; Rose, Samuel A; Ruderfer, Douglas M; Shakir, Khalid; Stenson, Peter D; Stevens, Christine; Thomas, Brett P; Tiao, Grace; Tusie-Luna, Maria T; Weisburd, Ben; Won, Hong-Hee; Yu, Dongmei; Altshuler, David M; Ardissino, Diego; Boehnke, Michael; Danesh, John; Donnelly, Stacey; Elosua, Roberto; Florez, Jose C; Gabriel, Stacey B; Getz, Gad; Glatt, Stephen J; Hultman, Christina M; Kathiresan, Sekar; Laakso, Markku; McCarroll, Steven; McCarthy, Mark I; McGovern, Dermot; McPherson, Ruth; Neale, Benjamin M; Palotie, Aarno; Purcell, Shaun M; Saleheen, Danish; Scharf, Jeremiah M; Sklar, Pamela; Sullivan, Patrick F; Tuomilehto, Jaakko; Tsuang, Ming T; Watkins, Hugh C; Wilson, James G; Daly, Mark J; MacArthur, Daniel G

    2016-08-18

    Large-scale reference data sets of human genetic variation are critical for the medical and functional interpretation of DNA sequence changes. Here we describe the aggregation and analysis of high-quality exome (protein-coding region) DNA sequence data for 60,706 individuals of diverse ancestries generated as part of the Exome Aggregation Consortium (ExAC). This catalogue of human genetic diversity contains an average of one variant every eight bases of the exome, and provides direct evidence for the presence of widespread mutational recurrence. We have used this catalogue to calculate objective metrics of pathogenicity for sequence variants, and to identify genes subject to strong selection against various classes of mutation; identifying 3,230 genes with near-complete depletion of predicted protein-truncating variants, with 72% of these genes having no currently established human disease phenotype. Finally, we demonstrate that these data can be used for the efficient filtering of candidate disease-causing variants, and for the discovery of human 'knockout' variants in protein-coding genes.

  6. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda) mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    PubMed

    Brewer, Michael S; Swafford, Lynn; Spruill, Chad L; Bond, Jason E

    2013-01-01

    Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the resulting tree topologies as suspect. As such, these data are likely inappropriate for investigating such ancient relationships.

  7. Next-generation sequencing yields the complete mitochondrial genome of the flathead mullet, Mugil cephalus cryptic species in East Australia (Teleostei: Mugilidae).

    PubMed

    Shen, Kang-Ning; Chen, Ching-Hung; Hsiao, Chung-Der; Durand, Jean-Dominique

    2016-09-01

    In this study, the complete mitogenome sequence of a cryptic species from East Australia (Mugil sp. H) belonging to the worldwide Mugil cephalus species complex (Teleostei: Mugilidae) has been sequenced by next-generation sequencing method. The assembled mitogenome, consisting of 16,845 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 transfer RNAs, 2 ribosomal RNAs genes and a non-coding control region of D-loop. D-loop consists of 1067 bp length, and is located between tRNA-Pro and tRNA-Phe. The overall base composition of East Australia M. cephalus is 28.4% for A, 29.3% for C, 15.4% for G and 26.9% for T. The complete mitogenome may provide essential and important DNA molecular data for further phylogenetic and evolutionary analysis for flathead mullet species complex.

  8. Next generation sequencing yields the complete mitochondrial genome of the flathead mullet, Mugil cephalus cryptic species NWP2 (Teleostei: Mugilidae).

    PubMed

    Shen, Kang-Ning; Yen, Ta-Chi; Chen, Ching-Hung; Li, Huei-Ying; Chen, Pei-Lung; Hsiao, Chung-Der

    2016-05-01

    In this study, the complete mitogenome sequence of Northwestern Pacific 2 (NWP2) cryptic species of flathead mullet, Mugil cephalus (Teleostei: Mugilidae) has been amplified by long-range PCR and sequenced by next-generation sequencing method. The assembled mitogenome, consisting of 16,686 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 transfer RNAs, 2 ribosomal RNAs genes and a non-coding control region of D-loop. D-loop was 909 bp length and was located between tRNA-Pro and tRNA-Phe. The overall base composition of NWP2 M. cephalus was 28.4% for A, 29.8% for C, 26.5% for T and 15.3% for G. The complete mitogenome may provide essential and important DNA molecular data for further phylogenetic and evolutionary analysis for flathead mullet species complex.

  9. A new method for species identification via protein-coding and non-coding DNA barcodes by combining machine learning with bioinformatic methods.

    PubMed

    Zhang, Ai-bing; Feng, Jie; Ward, Robert D; Wan, Ping; Gao, Qiang; Wu, Jun; Zhao, Wei-zhong

    2012-01-01

    Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI) region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS) genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF) to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish) and two representing non-coding ITS barcodes (rust fungi and brown algae). Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ) and Maximum likelihood (ML) methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI) of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40%) for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37%) for 1094 brown algae queries, both using ITS barcodes.

  10. Identification of significantly mutated regions across cancer types highlights a rich landscape of functional molecular alterations

    PubMed Central

    Araya, Carlos L.; Cenik, Can; Reuter, Jason A.; Kiss, Gert; Pande, Vijay S.; Snyder, Michael P.; Greenleaf, William J.

    2015-01-01

    Cancer sequencing studies have primarily identified cancer-driver genes by the accumulation of protein-altering mutations. An improved method would be annotation-independent, sensitive to unknown distributions of functions within proteins, and inclusive of non-coding drivers. We employed density-based clustering methods in 21 tumor types to detect variably-sized significantly mutated regions (SMRs). SMRs reveal recurrent alterations across a spectrum of coding and non-coding elements, including transcription factor binding sites and untranslated regions mutated in up to ∼15% of specific tumor types. SMRs reveal spatial clustering of mutations at molecular domains and interfaces, often with associated changes in signaling. Mutation frequencies in SMRs demonstrate that distinct protein regions are differentially mutated among tumor types, as exemplified by a linker region of PIK3CA in which biophysical simulations suggest mutations affect regulatory interactions. The functional diversity of SMRs underscores both the varied mechanisms of oncogenic misregulation and the advantage of functionally-agnostic driver identification. PMID:26691984

  11. The complete chloroplast genome sequence of Dendrobium officinale.

    PubMed

    Yang, Pei; Zhou, Hong; Qian, Jun; Xu, Haibin; Shao, Qingsong; Li, Yonghua; Yao, Hui

    2016-01-01

    The complete chloroplast sequence of Dendrobium officinale, an endangered and economically important traditional Chinese medicine, was reported and characterized. The genome size is 152,018 bp, with 37.5% GC content. A pair of inverted repeats (IRs) of 26,284 bp are separated by a large single-copy region (LSC, 84,944 bp) and a small single-copy region (SSC, 14,506 bp). The complete cp DNA contains 83 protein-coding genes, 39 tRNA genes and 8 rRNA genes. Fourteen genes contained one or two introns.

  12. The coding region of the UFGT gene is a source of diagnostic SNP markers that allow single-locus DNA genotyping for the assessment of cultivar identity and ancestry in grapevine (Vitis vinifera L.)

    PubMed Central

    2013-01-01

    Background Vitis vinifera L. is one of society’s most important agricultural crops with a broad genetic variability. The difficulty in recognizing grapevine genotypes based on ampelographic traits and secondary metabolites prompted the development of molecular markers suitable for achieving variety genetic identification. Findings Here, we propose a comparison between a multi-locus barcoding approach based on six chloroplast markers and a single-copy nuclear gene sequencing method using five coding regions combined with a character-based system with the aim of reconstructing cultivar-specific haplotypes and genotypes to be exploited for the molecular characterization of 157 V. vinifera accessions. The analysis of the chloroplast target regions proved the inadequacy of the DNA barcoding approach at the subspecies level, and hence further DNA genotyping analyses were targeted on the sequences of five nuclear single-copy genes amplified across all of the accessions. The sequencing of the coding region of the UFGT nuclear gene (UDP-glucose: flavonoid 3-0-glucosyltransferase, the key enzyme for the accumulation of anthocyanins in berry skins) enabled the discovery of discriminant SNPs (1/34 bp) and the reconstruction of 130 V. vinifera distinct genotypes. Most of the genotypes proved to be cultivar-specific, and only few genotypes were shared by more, although strictly related, cultivars. Conclusion On the whole, this technique was successful for inferring SNP-based genotypes of grapevine accessions suitable for assessing the genetic identity and ancestry of international cultivars and also useful for corroborating some hypotheses regarding the origin of local varieties, suggesting several issues of misidentification (synonymy/homonymy). PMID:24298902

  13. Long-PCR based next generation sequencing of the whole mitochondrial genome of the peacock skate Pavoraja nitida (Elasmobranchii: Arhynchobatidae).

    PubMed

    Yang, Lei; Naylor, Gavin J P

    2016-01-01

    We determined the complete mitochondrial genome sequence (16,760 bp) of the peacock skate Pavoraja nitida using a long-PCR based next generation sequencing method. It has 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 control region in the typical vertebrate arrangement. Primers, protocols, and procedures used to obtain this mitogenome are provided. We anticipate that this approach will facilitate rapid collection of mitogenome sequences for studies on phylogenetic relationships, population genetics, and conservation of cartilaginous fishes.

  14. The complete chloroplast genome sequence of Euonymus japonicus (Celastraceae).

    PubMed

    Choi, Kyoung Su; Park, SeonJoo

    2016-09-01

    The complete chloroplast (cp) genome sequence of the Euonymus japonicus, the first sequenced of the genus Euonymus, was reported in this study. The total length was 157 637 bp, containing a pair of 26 678 bp inverted repeat region (IR), which were separated by small single copy (SSC) region and large single copy (LSC) region of 18 340 bp and 85 941 bp, respectively. This genome contains 107 unique genes, including 74 coding genes, four rRNA genes, and 29 tRNA genes. Seventeen genes contain intron of E. japonicus, of which three genes (clpP, ycf3, and rps12) include two introns. The maximum likelihood (ML) phylogenetic analysis revealed that E. japonicus was closely related to Manihot and Populus.

  15. Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

    PubMed Central

    Murthy, S C; Bhat, G P; Thimmappaya, B

    1985-01-01

    A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

  16. Network perturbation by recurrent regulatory variants in cancer

    PubMed Central

    Cho, Ara; Lee, Insuk; Choi, Jung Kyoon

    2017-01-01

    Cancer driving genes have been identified as recurrently affected by variants that alter protein-coding sequences. However, a majority of cancer variants arise in noncoding regions, and some of them are thought to play a critical role through transcriptional perturbation. Here we identified putative transcriptional driver genes based on combinatorial variant recurrence in cis-regulatory regions. The identified genes showed high connectivity in the cancer type-specific transcription regulatory network, with high outdegree and many downstream genes, highlighting their causative role during tumorigenesis. In the protein interactome, the identified transcriptional drivers were not as highly connected as coding driver genes but appeared to form a network module centered on the coding drivers. The coding and regulatory variants associated via these interactions between the coding and transcriptional drivers showed exclusive and complementary occurrence patterns across tumor samples. Transcriptional cancer drivers may act through an extensive perturbation of the regulatory network and by altering protein network modules through interactions with coding driver genes. PMID:28333928

  17. Evolutionary Dynamics of Microsatellite Distribution in Plants: Insight from the Comparison of Sequenced Brassica, Arabidopsis and Other Angiosperm Species

    PubMed Central

    Shi, Jiaqin; Huang, Shunmou; Fu, Donghui; Yu, Jinyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

    2013-01-01

    Despite their ubiquity and functional importance, microsatellites have been largely ignored in comparative genomics, mostly due to the lack of genomic information. In the current study, microsatellite distribution was characterized and compared in the whole genomes and both the coding and non-coding DNA sequences of the sequenced Brassica, Arabidopsis and other angiosperm species to investigate their evolutionary dynamics in plants. The variation in the microsatellite frequencies of these angiosperm species was much smaller than those for their microsatellite numbers and genome sizes, suggesting that microsatellite frequency may be relatively stable in plants. The microsatellite frequencies of these angiosperm species were significantly negatively correlated with both their genome sizes and transposable elements contents. The pattern of microsatellite distribution may differ according to the different genomic regions (such as coding and non-coding sequences). The observed differences in many important microsatellite characteristics (especially the distribution with respect to motif length, type and repeat number) of these angiosperm species were generally accordant with their phylogenetic distance, which suggested that the evolutionary dynamics of microsatellite distribution may be generally consistent with plant divergence/evolution. Importantly, by comparing these microsatellite characteristics (especially the distribution with respect to motif type) the angiosperm species (aside from a few species) all clustered into two obviously different groups that were largely represented by monocots and dicots, suggesting a complex and generally dichotomous evolutionary pattern of microsatellite distribution in angiosperms. Polyploidy may lead to a slight increase in microsatellite frequency in the coding sequences and a significant decrease in microsatellite frequency in the whole genome/non-coding sequences, but have little effect on the microsatellite distribution with respect to motif length, type and repeat number. Interestingly, several microsatellite characteristics seemed to be constant in plant evolution, which can be well explained by the general biological rules. PMID:23555856

  18. The complete chloroplast genome sequence of Dendrobium nobile.

    PubMed

    Yan, Wenjin; Niu, Zhitao; Zhu, Shuying; Ye, Meirong; Ding, Xiaoyu

    2016-11-01

    The complete chloroplast (cp) genome sequence of Dendrobium nobile, an endangered and traditional Chinese medicine with important economic value, is presented in this article. The total genome size is 150,793 bp, containing a large single copy (LSC) region (84,939 bp) and a small single copy region (SSC) (13,310 bp) which were separated by two inverted repeat (IRs) regions (26,272 bp). The overall GC contents of the plastid genome were 38.8%. In total, 130 unique genes were annotated and they were consisted of 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. Fourteen genes contained one or two introns.

  19. RPS8—a New Informative DNA Marker for Phylogeny of Babesia and Theileria Parasites in China

    PubMed Central

    Tian, Zhan-Cheng; Liu, Guang-Yuan; Yin, Hong; Luo, Jian-Xun; Guan, Gui-Quan; Luo, Jin; Xie, Jun-Ren; Shen, Hui; Tian, Mei-Yuan; Zheng, Jin-feng; Yuan, Xiao-song; Wang, Fang-fang

    2013-01-01

    Piroplasmosis is a serious debilitating and sometimes fatal disease. Phylogenetic relationships within piroplasmida are complex and remain unclear. We compared the intron–exon structure and DNA sequences of the RPS8 gene from Babesia and Theileria spp. isolates in China. Similar to 18S rDNA, the 40S ribosomal protein S8 gene, RPS8, including both coding and non-coding regions is a useful and novel genetic marker for defining species boundaries and for inferring phylogenies because it tends to have little intra-specific variation but considerable inter-specific difference. However, more samples are needed to verify the usefulness of the RPS8 (coding and non-coding regions) gene as a marker for the phylogenetic position and detection of most Babesia and Theileria species, particularly for some closely related species. PMID:24244571

  20. Complete mitochondrial genome of endangered Yellow-shouldered Amazon (Amazona barbadensis): two control region copies in parrot species of the Amazona genus.

    PubMed

    Urantowka, Adam Dawid; Hajduk, Kacper; Kosowska, Barbara

    2013-08-01

    Amazona barbadensis is an endangered species of parrot living in northern coastal Venezuela and in several Caribbean islands. In this study, we sequenced full mitochondrial genome of the considered species. The total length of the mitogenome was 18,983 bp and contained 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, duplicated control region, and degenerate copies of ND6 and tRNA (Glu) genes. High degree of identity between two copies of control region suggests their coincident evolution and functionality. Comparative analysis of both the control region sequences from four Amazona species revealed their 89.1% identity over a region of 1300 bp and indicates the presence of distinctive parts of two control region copies.

  1. H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes

    PubMed Central

    Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

    2016-01-01

    Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches. PMID:26789284

  2. Genome-wide prediction of cis-regulatory regions using supervised deep learning methods.

    PubMed

    Li, Yifeng; Shi, Wenqiang; Wasserman, Wyeth W

    2018-05-31

    In the human genome, 98% of DNA sequences are non-protein-coding regions that were previously disregarded as junk DNA. In fact, non-coding regions host a variety of cis-regulatory regions which precisely control the expression of genes. Thus, Identifying active cis-regulatory regions in the human genome is critical for understanding gene regulation and assessing the impact of genetic variation on phenotype. The developments of high-throughput sequencing and machine learning technologies make it possible to predict cis-regulatory regions genome wide. Based on rich data resources such as the Encyclopedia of DNA Elements (ENCODE) and the Functional Annotation of the Mammalian Genome (FANTOM) projects, we introduce DECRES based on supervised deep learning approaches for the identification of enhancer and promoter regions in the human genome. Due to their ability to discover patterns in large and complex data, the introduction of deep learning methods enables a significant advance in our knowledge of the genomic locations of cis-regulatory regions. Using models for well-characterized cell lines, we identify key experimental features that contribute to the predictive performance. Applying DECRES, we delineate locations of 300,000 candidate enhancers genome wide (6.8% of the genome, of which 40,000 are supported by bidirectional transcription data), and 26,000 candidate promoters (0.6% of the genome). The predicted annotations of cis-regulatory regions will provide broad utility for genome interpretation from functional genomics to clinical applications. The DECRES model demonstrates potentials of deep learning technologies when combined with high-throughput sequencing data, and inspires the development of other advanced neural network models for further improvement of genome annotations.

  3. H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes.

    PubMed

    Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

    2016-01-01

    Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches.

  4. Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.

    PubMed

    Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul

    2012-11-20

    Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable resources for marker development, comparative genomic studies and candidate gene approaches. Next generation sequencing of leaf transcriptome is very effective; however, deeper sequencing and using more tissues and stages is advisable for extended comparative studies.

  5. Ancient DNA sequence revealed by error-correcting codes.

    PubMed

    Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo

    2015-07-10

    A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.

  6. Ancient DNA sequence revealed by error-correcting codes

    PubMed Central

    Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo

    2015-01-01

    A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228

  7. Characterization of the complete mitochondrial genome of the king pigeon (Columba livia breed king).

    PubMed

    Zhang, Rui-Hua; He, Wen-Xiao; Xu, Tong

    2015-06-01

    The king pigeon is a breed of pigeon developed over many years of selective breeding primarily as a utility breed. In the present work, we report the complete mitochondrial genome sequence of king pigeon for the first time. The total length of the mitogenome was 17,221 bp with the base composition of 30.14% for A, 24.05% for T, 31.82% for C, and 13.99% for G and an A-T (54.22 %)-rich feature was detected. It harbored 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and one non-coding control region (D-loop region). The arrangement of all genes was identical to the typical mitochondrial genomes of pigeon. The complete mitochondrial genome sequence of king pigeon would serve as an important data set of the germplasm resources for further study.

  8. Characterization of the complete mitochondrial genome sequence of wild yak (Bos mutus).

    PubMed

    Chunnian, Liang; Wu, Xiaoyun; Ding, Xuezhi; Wang, Hongbo; Guo, Xian; Chu, Min; Bao, Pengjia; Yan, Ping

    2016-11-01

    Wild yak is a special breed in China and it is regarded as an important genetic resource for sustainably developing the animal husbandry in Tibetan area and enriching region's biodiversity. The complete mitochondrial genome of wild yak (16,322 bp in length) displayed 37 typical animal mitochondrial genes and A + T-rich (61.01%), with an overall G + C content of only 38.99%. It contained a non-coding control region (D-loop), 13 protein-coding genes, two rRNA genes, and 22 tRNA genes. Most of the genes have ATG initiation codons, whereas ND2, ND3, and ND5 genes start with ATA and were encoded on H-strand. The gene order of wild yak mitogenome is identical to that observed in most other vertebrates. The complete mitochondrial genome sequence of wild yak reported here could provide valuable information for developing genetic markers and phylogenetic analysis in yak.

  9. The complete chloroplast genome of an irreplaceable dietary and model crop, foxtail millet (Setaria italica).

    PubMed

    Wang, Shuo; Gao, Li-Zhi

    2016-11-01

    The complete chloroplast genome sequence of foxtail millet (Setaria italica), an important food and fodder crop in the family Poaceae, is first reported in this study. The genome consists of 1 35 516 bp containing a pair of inverted repeats (IRs) of 21 804 bp separated by a large single-copy (LSC) region and a small single-copy (SSC) region of 79 896 bp and 12 012 bp, respectively. Coding sequences constitute 58.8% of the genome harboring 111 unique genes, 71 of which are protein-coding genes, 4 are rRNA genes, and 36 are tRNA genes. Phylogenetic analysis indicated foxtail millet clustered with Panicum virgatum and Echinochloa crus-galli belonging to the tribe Paniceae of the subfamily Panicoideae. This newly determined chloroplast genome will provide valuable information for the future breeding programs of valuable cereal crops in the family Poaceae.

  10. Sequence variations of the bovine prion protein gene (PRNP) in native Korean Hanwoo cattle

    PubMed Central

    Choi, Sangho

    2012-01-01

    Bovine spongiform encephalopathy (BSE) is one of the fatal neurodegenerative diseases known as transmissible spongiform encephalopathies (TSEs) caused by infectious prion proteins. Genetic variations correlated with susceptibility or resistance to TSE in humans and sheep have not been reported for bovine strains including those from Holstein, Jersey, and Japanese Black cattle. Here, we investigated bovine prion protein gene (PRNP) variations in Hanwoo cattle [Bos (B.) taurus coreanae], a native breed in Korea. We identified mutations and polymorphisms in the coding region of PRNP, determined their frequency, and evaluated their significance. We identified four synonymous polymorphisms and two non-synonymous mutations in PRNP, but found no novel polymorphisms. The sequence and number of octapeptide repeats were completely conserved, and the haplotype frequency of the coding region was similar to that of other B. taurus strains. When we examined the 23-bp and 12-bp insertion/deletion (indel) polymorphisms in the non-coding region of PRNP, Hanwoo cattle had a lower deletion allele and 23-bp del/12-bp del haplotype frequency than healthy and BSE-affected animals of other strains. Thus, Hanwoo are seemingly less susceptible to BSE than other strains due to the 23-bp and 12-bp indel polymorphisms. PMID:22705734

  11. Comparison of the complete mitochondrial genome of the stonefly Sweltsa longistyla (Plecoptera: Chloroperlidae) with mitogenomes of three other stoneflies.

    PubMed

    Chen, Zhi-Teng; Du, Yu-Zhou

    2015-03-01

    The complete mitochondrial genome of the stonefly, Sweltsa longistyla Wu (Plecoptera: Chloroperlidae), was sequenced in this study. The mitogenome of S. longistyla is 16,151bp and contains 37 genes including 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes, and a large non-coding region. S. longistyla, Pteronarcys princeps Banks, Kamimuria wangi Du and Cryptoperla stilifera Sivec belong to the Plecoptera, and the gene order and orientation of their mitogenomes were similar. The overall AT content for the four stoneflies was below 72%, and the AT content of tRNA genes was above 69%. The four genomes were compact and contained only 65-127bp of non-coding intergenic DNAs. Overlapping nucleotides existed in all four genomes and ranged from 24 (P. princeps) to 178bp (K. wangi). There was a 7-bp motif ('ATGATAA') of overlapping DNA and an 8-bp motif (AAGCCTTA) conserved in three stonefly species (P. princeps, K. wangi and C. stilifera). The control regions of four stoneflies contained a stem-loop structure. Four conserved sequence blocks (CSBs) were present in the A+T-rich regions of all four stoneflies. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Isolation and molecular identification of Sunshine virus, a novel paramyxovirus found in Australian snakes.

    PubMed

    Hyndman, Timothy H; Marschang, Rachel E; Wellehan, James F X; Nicholls, Philip K

    2012-10-01

    This paper describes the isolation and molecular identification of a novel paramyxovirus found during an investigation of an outbreak of neurorespiratory disease in a collection of Australian pythons. Using Illumina® high-throughput sequencing, a 17,187 nucleotide sequence was assembled from RNA extracts from infected viper heart cells (VH2) displaying widespread cytopathic effects in the form of multinucleate giant cells. The sequence appears to contain all the coding regions of the genome, including the following predicted paramyxoviral open reading frames (ORFs): 3'--Nucleocapsid (N)--putative Phosphoprotein (P)--Matrix (M)--Fusion (F)--putative attachment protein--Polymerase (L)--5'. There is also a 540 nucleotide ORF between the N and putative P genes that may be an additional coding region. Phylogenetic analyses of the complete N, M, F and L genes support the clustering of this virus within the family Paramyxoviridae but outside both of the current subfamilies: Paramyxovirinae and Pneumovirinae. We propose to name this new virus, Sunshine virus, after the geographic origin of the first isolate--the Sunshine Coast of Queensland, Australia. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Xuhuai goat H-FABP gene clone, subcellular localization of expression products and the preparation of transgenic mice.

    PubMed

    Yin, Yan-hui; Li, Bi-chun; Wei, Guang-hui; Zhu, Cai-ye; Li, Wei; Zhang, Ya-ni; Du, Li-xin; Cao, Wen-guang

    2012-05-01

    The aim of this study was to clone the heart-type fatty acid binding protein (H-FABP) gene of Xuhuai goat, to explore it bioinformatically, and analyze the subcellular localization using enhanced green fluorescent protein (EGFP). The results showed that the coding sequence (CDS) length of Xuhuai goat H-FABP gene was 402 bp, encoding 133 amino acids (GenBank accession number AY466498.1). The H-FABP cDNA coding sequence was compared with the corresponding region of human, chicken, brown rat, cow, wild boar, donkey, and zebrafish. The similarity were 89%, 76%, 85%, 84%, 93%, 91%, 70%, respectively. For the corresponding amino acid sequences, the similarity were 90%, 79%, 88%, 97%, 95%, 94%, 72%, respectively. This study did not find the signal peptide region in the H-FABP protein; it revealed that H-FABP protein might be a nonsecreted protein. H-FABP expression was detected in vitro by reverse transcription-polymerase chain reaction (RT-PCR), and the EGFP-H-FABP fusion protein was localized to the cytoplasm. The gene could also be transiently and permanently expressed in mice.

  14. Genetic variation of the Borrelia burgdorferi gene vlsE involves cassette-specific, segmental gene conversion.

    PubMed

    Zhang, J R; Norris, S J

    1998-08-01

    The Lyme disease spirochete Borrelia burgdorferi possesses 15 silent vls cassettes and a vls expression site (vlsE) encoding a surface-exposed lipoprotein. Segments of the silent vls cassettes have been shown to recombine with the vlsE cassette region in the mammalian host, resulting in combinatorial antigenic variation. Despite promiscuous recombination within the vlsE cassette region, the 5' and 3' coding sequences of vlsE that flank the cassette region are not subject to sequence variation during these recombination events. The segments of the silent vls cassettes recombine in the vlsE cassette region through a unidirectional process such that the sequence and organization of the silent vls loci are not affected. As a result of recombination, the previously expressed segments are replaced by incoming segments and apparently degraded. These results provide evidence for a gene conversion mechanism in VlsE antigenic variation.

  15. The complete mitochondrial genome sequence of the maned wolf (Chrysocyon brachyurus).

    PubMed

    Zhao, Chao; Yang, Xiufeng; Zhang, Honghai; Zhang, Jin; Chen, Lei; Sha, Weilai; Liu, Guangshuai

    2016-01-01

    In this study, the complete mitochondrial genome of the maned wolf (Chrysocyon brachyurus), the unique species in Chrysocyon, was sequenced and reported for the first time using blood samples obtained from a female individual in Shanghai Zoo, China. Sequence analysis showed that the genome structure was in accordance with other Canidae species and it contained 12 S rRNA gene, 16 S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region.

  16. Ovine mitochondrial DNA sequence variation and its association with production and reproduction traits within an Afec-Assaf flock.

    PubMed

    Reicher, S; Seroussi, E; Weller, J I; Rosov, A; Gootwine, E

    2012-07-01

    Polymorphisms in mitochondrial DNA (mtDNA) protein- and tRNA-coding genes were shown to be associated with various diseases in humans as well as with production and reproduction traits in livestock. Alignment of full length mitochondria sequences from the 5 known ovine haplogroups: HA (n = 3), HB (n = 5), HC (n = 3), HD (n = 2), and HE (n = 2; GenBank accession nos. HE577847-50 and 11 published complete ovine mitochondria sequences) revealed sequence variation in 10 out of the 13 protein coding mtDNA sequences. Twenty-six of the 245 variable sites found in the protein coding sequences represent non-synonymous mutations. Sequence variation was observed also in 8 out of the 22 tRNA mtDNA sequences. On the basis of the mtDNA control region and cytochrome b partial sequences along with information on maternal lineages within an Afec-Assaf flock, 1,126 Afec-Assaf ewes were assigned to mitochondrial haplogroups HA, HB, and HC, with frequencies of 0.43, 0.43, and 0.14, respectively. Analysis of birth weight and growth rate records of lamb (n = 1286) and productivity from 4,993 lambing records revealed no association between mitochondrial haplogroup affiliation and female longevity, lambs perinatal survival rate, birth weight, and daily growth rate of lambs up to 150 d that averaged 1,664 d, 88.3%, 4.5 kg, and 320 g/d, respectively. However, significant (P < 0.0001) differences among the haplogroups were found for prolificacy of ewes, with prolificacies (mean ± SE) of 2.14 ± 0.04, 2.25 ± 0.04, and 2.30 ± 0.06 lamb born/ewe lambing for the HA, HB, and the HC haplogroups, respectively. Our results highlight the ovine mitogenome genetic variation in protein- and tRNA coding genes and suggest that sequence variation in ovine mtDNA is associated with variation in ewe prolificacy.

  17. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    PubMed

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  18. RNAP-II transcribes two small RNAs at the promoter and terminator regions of the RNAP-I gene in Saccharomyces cerevisiae.

    PubMed

    Mayán, Maria D

    2013-01-01

    Three RNA polymerases coexist in the ribosomal DNA of Saccharomyces cerevisiae. RNAP-I transcribes the 35S rRNA, RNAP-III transcribes the 5S rRNA and RNAP-II is found in both intergenic non-coding regions. Previously, we demonstrated that RNAP-II molecules bound to the intergenic non-coding regions (IGS) of the ribosomal locus are mainly found in a stalled conformation, and the stalled polymerase mediates chromatin interactions, which isolate RNAP-I from the RNAP-III transcriptional domain. Besides, RNAP-II transcribes both IGS regions at low levels, using different cryptic promoters. This report demonstrates that RNAP-II also transcribes two sequences located in the 5'- and 3'-ends of the 35S rRNA gene that overlap with the sequences of the 35S rRNA precursor transcribed by RNAP-I. The sequence located at the promoter region of RNAP-I, called the p-RNA transcript, binds to the transcription termination-related protein, Reb1p, while the T-RNA sequence, located in the termination sites of RNAP-I gene, contains the stem-loop recognized by Rtn1p, which is necessary for proper termination of RNAP-I. Because of their location, these small RNAs may play a key role in the initiation and termination of RNAP-I transcription. To correctly synthesize proteins, eukaryotic cells may retain a mechanism that connects the three main polymerases. This report suggests that cryptic transcription by RNAP-II may be required for normal transcription by RNAP-I in the ribosomal locus of S. cerevisiae. Copyright © 2012 John Wiley & Sons, Ltd.

  19. Both coding exons of the c-myc gene contribute to its posttranscriptional regulation in the quiescent liver and regenerating liver and after protein synthesis inhibition.

    PubMed Central

    Lavenu, A; Pistoi, S; Pournin, S; Babinet, C; Morello, D

    1995-01-01

    In vivo, the steady-state level of c-myc mRNA is mainly controlled by posttranscriptional mechanisms. Using a panel of transgenic mice in which various versions of the human c-myc proto-oncogene were under the control of major histocompatibility complex H-2Kb class I regulatory sequences, we have shown that the 5' and the 3' noncoding sequences are dispensable for obtaining a regulated expression of the transgene in adult quiescent tissues, at the start of liver regeneration, and after inhibition of protein synthesis. These results indicated that the coding sequences were sufficient to ensure a regulated c-myc expression. In the present study, we have pursued this analysis with transgenes containing one or the other of the two c-myc coding exons either alone or in association with the c-myc 3' untranslated region. We demonstrate that each of the exons contains determinants which control c-myc mRNA expression. Moreover, we show that in the liver, c-myc exon 2 sequences are able to down-regulate an otherwise stable H-2K mRNA when embedded within it and to induce its transient accumulation after cycloheximide treatment and soon after liver ablation. Finally, the use of transgenes with different coding capacities has allowed us to postulate that the primary mRNA sequence itself and not c-Myc peptides is an important component of c-myc posttranscriptional regulation. PMID:7623834

  20. Comparative sequence analysis of acid sensitive/resistance proteins in Escherichia coli and Shigella flexneri

    PubMed Central

    Manikandan, Selvaraj; Balaji, Seetharaaman; Kumar, Anil; Kumar, Rita

    2007-01-01

    The molecular basis for the survival of bacteria under extreme conditions in which growth is inhibited is a question of great current interest. A preliminary study was carried out to determine residue pattern conservation among the antiporters of enteric bacteria, responsible for extreme acid sensitivity especially in Escherichia coli and Shigella flexneri. Here we found the molecular evidence that proved the relationship between E. coli and S. flexneri. Multiple sequence alignment of the gadC coded acid sensitive antiporter showed many conserved residue patterns at regular intervals at the N-terminal region. It was observed that as the alignment approaches towards the C-terminal, the number of conserved residues decreases, indicating that the N-terminal region of this protein has much active role when compared to the carboxyl terminal. The motif, FHLVFFLLLGG, is well conserved within the entire gadC coded protein at the amino terminal. The motif is also partially conserved among other antiporters (which are not coded by gadC) but involved in acid sensitive/resistance mechanism. Phylogenetic cluster analysis proves the relationship of Escherichia coli and Shigella flexneri. The gadC coded proteins are converged as a clade and diverged from other antiporters belongs to the amino acid-polyamine-organocation (APC) superfamily. PMID:21670792

  1. Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

    PubMed Central

    Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

    2008-01-01

    Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

  2. Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

    PubMed

    Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

    2008-04-28

    In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

  3. Highly conserved intragenic HSV-2 sequences: Results from next-generation sequencing of HSV-2 UL and US regions from genital swabs collected from 3 continents.

    PubMed

    Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M

    2017-10-01

    Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Control of total GFP expression by alterations to the 3′ region nucleotide sequence

    PubMed Central

    2013-01-01

    Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

  5. Five Complete Chloroplast Genome Sequences from Diospyros: Genome Organization and Comparative Analysis.

    PubMed

    Fu, Jianmin; Liu, Huimin; Hu, Jingjing; Liang, Yuqin; Liang, Jinjun; Wuyun, Tana; Tan, Xiaofeng

    2016-01-01

    Diospyros is the largest genus in Ebenaceae, comprising more than 500 species with remarkable economic value, especially Diospyros kaki Thunb., which has traditionally been an important food resource in China, Korea, and Japan. Complete chloroplast (cp) genomes from D. kaki, D. lotus L., D. oleifera Cheng., D. glaucifolia Metc., and Diospyros 'Jinzaoshi' were sequenced using Illumina sequencing technology. This is the first cp genome reported in Ebenaceae. The cp genome sequences of Diospyros ranged from 157,300 to 157,784 bp in length, presenting a typical quadripartite structure with two inverted repeats each separated by one large and one small single-copy region. For each cp genome, 134 genes were annotated, including 80 protein-coding, 31 tRNA, and 4 rRNA unique genes. In all, 179 repeats and 283 single sequence repeats were identified. Four hypervariable regions, namely, intergenic region of trnQ_rps16, trnV_ndhC, and psbD_trnT, and intron of ndhA, were identified in the Diospyros genomes. Phylogenetic analyses based on the whole cp genome, protein-coding, and intergenic and intron sequences indicated that D. oleifera is closely related to D. kaki and could be used as a model plant for future research on D. kaki; to our knowledge, this is proposed for the first time. Further, these analyses together with two large deletions (301 and 140 bp) in the cp genome of D. 'Jinzaoshi', support its placement as a new species in Diospyros. Both maximum parsimony and likelihood analyses for 19 taxa indicated the basal position of Ericales in asterids and suggested that Ebenaceae is monophyletic in Ericales.

  6. Five Complete Chloroplast Genome Sequences from Diospyros: Genome Organization and Comparative Analysis

    PubMed Central

    Hu, Jingjing; Liang, Yuqin; Liang, Jinjun; Wuyun, Tana; Tan, Xiaofeng

    2016-01-01

    Diospyros is the largest genus in Ebenaceae, comprising more than 500 species with remarkable economic value, especially Diospyros kaki Thunb., which has traditionally been an important food resource in China, Korea, and Japan. Complete chloroplast (cp) genomes from D. kaki, D. lotus L., D. oleifera Cheng., D. glaucifolia Metc., and Diospyros ‘Jinzaoshi’ were sequenced using Illumina sequencing technology. This is the first cp genome reported in Ebenaceae. The cp genome sequences of Diospyros ranged from 157,300 to 157,784 bp in length, presenting a typical quadripartite structure with two inverted repeats each separated by one large and one small single-copy region. For each cp genome, 134 genes were annotated, including 80 protein-coding, 31 tRNA, and 4 rRNA unique genes. In all, 179 repeats and 283 single sequence repeats were identified. Four hypervariable regions, namely, intergenic region of trnQ_rps16, trnV_ndhC, and psbD_trnT, and intron of ndhA, were identified in the Diospyros genomes. Phylogenetic analyses based on the whole cp genome, protein-coding, and intergenic and intron sequences indicated that D. oleifera is closely related to D. kaki and could be used as a model plant for future research on D. kaki; to our knowledge, this is proposed for the first time. Further, these analyses together with two large deletions (301 and 140 bp) in the cp genome of D. ‘Jinzaoshi’, support its placement as a new species in Diospyros. Both maximum parsimony and likelihood analyses for 19 taxa indicated the basal position of Ericales in asterids and suggested that Ebenaceae is monophyletic in Ericales. PMID:27442423

  7. Complete mitochondrial genome of Camponotus atrox (Hymenoptera: Formicidae): a new tRNA arrangement in Hymenoptera.

    PubMed

    Kim, Min Jee; Hong, Eui Jeong; Kim, Iksoo

    2016-01-01

    We sequenced the complete mitochondrial (mt) genome of Camponotus atrox (Hymenoptera: Formicidae), which is only distributed in Korea. The genome was 16 540 bp in size and contained typical sets of genes (13 protein-coding genes, 22 tRNAs, and 2 rRNAs). The C. atrox A+T-rich region, at 1402 bp, was the longest of all sequenced ant genomes and was composed of an identical tandem repeat consisting of six 100-bp copies and one 96-bp copy. A total of 315 bp of intergenic spacer sequence was spread over 23 regions. An alignment of the spacer sequences in ants was largely feasible among congeneric species, and there was substantial sequence divergence, indicating their potential use as molecular markers for congeneric species. The A/T contents at the first and second codon positions of protein-coding genes (PCGs) were similar for ant species, including C. atrox (73.9% vs. 72.3%, on average). With increased taxon sampling among hymenopteran superfamilies, differences in the divergence rates (i.e., the non-synonymous substitution rates) between the suborders Symphyta and Apocrita were detected, consistent with previous results. The C. atrox mt genome had a unique gene arrangement, trnI-trnM-trnQ, at the A+T-rich region and ND2 junction (underline indicates inverted gene). This may have originated from a tandem duplication of trnM-trnI, resulting in trnM-trnI-trnM-trnI-trnQ, and the subsequent loss of the first trnM and second trnI, resulting in trnI-trnM-trnQ.

  8. Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

    PubMed Central

    Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

    2015-01-01

    Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

  9. Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence.

    PubMed

    Lotos, Leonidas; Efthimiou, Konstantinos; Maliogka, Varvara I; Katis, Nikolaos I

    2014-03-01

    In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers' target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Region-Based Prediction for Image Compression in the Cloud.

    PubMed

    Begaint, Jean; Thoreau, Dominique; Guillotel, Philippe; Guillemot, Christine

    2018-04-01

    Thanks to the increasing number of images stored in the cloud, external image similarities can be leveraged to efficiently compress images by exploiting inter-images correlations. In this paper, we propose a novel image prediction scheme for cloud storage. Unlike current state-of-the-art methods, we use a semi-local approach to exploit inter-image correlation. The reference image is first segmented into multiple planar regions determined from matched local features and super-pixels. The geometric and photometric disparities between the matched regions of the reference image and the current image are then compensated. Finally, multiple references are generated from the estimated compensation models and organized in a pseudo-sequence to differentially encode the input image using classical video coding tools. Experimental results demonstrate that the proposed approach yields significant rate-distortion performance improvements compared with the current image inter-coding solutions such as high efficiency video coding.

  11. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) – Definition of a Distinct Class of Begomovirus-Associated Satellites

    PubMed Central

    Lozano, Gloria; Trenado, Helena P.; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W.; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem–loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem–loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  12. Exploration of sequence space as the basis of viral RNA genome segmentation.

    PubMed

    Moreno, Elena; Ojosnegros, Samuel; García-Arriaza, Juan; Escarmís, Cristina; Domingo, Esteban; Perales, Celia

    2014-05-06

    The mechanisms of viral RNA genome segmentation are unknown. On extensive passage of foot-and-mouth disease virus in baby hamster kidney-21 cells, the virus accumulated multiple point mutations and underwent a transition akin to genome segmentation. The standard single RNA genome molecule was replaced by genomes harboring internal in-frame deletions affecting the L- or capsid-coding region. These genomes were infectious and killed cells by complementation. Here we show that the point mutations in the nonstructural protein-coding region (P2, P3) that accumulated in the standard genome before segmentation increased the relative fitness of the segmented version relative to the standard genome. Fitness increase was documented by intracellular expression of virus-coded proteins and infectious progeny production by RNAs with the internal deletions placed in the sequence context of the parental and evolved genome. The complementation activity involved several viral proteins, one of them being the leader proteinase L. Thus, a history of genetic drift with accumulation of point mutations was needed to allow a major variation in the structure of a viral genome. Thus, exploration of sequence space by a viral genome (in this case an unsegmented RNA) can reach a point of the space in which a totally different genome structure (in this case, a segmented RNA) is favored over the form that performed the exploration.

  13. ScaffoldSeq: Software for characterization of directed evolution populations.

    PubMed

    Woldring, Daniel R; Holec, Patrick V; Hackel, Benjamin J

    2016-07-01

    ScaffoldSeq is software designed for the numerous applications-including directed evolution analysis-in which a user generates a population of DNA sequences encoding for partially diverse proteins with related functions and would like to characterize the single site and pairwise amino acid frequencies across the population. A common scenario for enzyme maturation, antibody screening, and alternative scaffold engineering involves naïve and evolved populations that contain diversified regions, varying in both sequence and length, within a conserved framework. Analyzing the diversified regions of such populations is facilitated by high-throughput sequencing platforms; however, length variability within these regions (e.g., antibody CDRs) encumbers the alignment process. To overcome this challenge, the ScaffoldSeq algorithm takes advantage of conserved framework sequences to quickly identify diverse regions. Beyond this, unintended biases in sequence frequency are generated throughout the experimental workflow required to evolve and isolate clones of interest prior to DNA sequencing. ScaffoldSeq software uniquely handles this issue by providing tools to quantify and remove background sequences, cluster similar protein families, and dampen the impact of dominant clones. The software produces graphical and tabular summaries for each region of interest, allowing users to evaluate diversity in a site-specific manner as well as identify epistatic pairwise interactions. The code and detailed information are freely available at http://research.cems.umn.edu/hackel. Proteins 2016; 84:869-874. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. The complete chloroplast genome of a medicinal plant Epimedium koreanum Nakai (Berberidaceae).

    PubMed

    Lee, Jung-Hoon; Kim, Kyunghee; Kim, Na-Rae; Lee, Sang-Choon; Yang, Tae-Jin; Kim, Young-Dong

    2016-11-01

    Epimedium koreanum is a perennial medicinal plant distributed in Eastern Asia. The complete chloroplast genome sequences of E. koreanum was obtained by de novo assembly using whole genome next-generation sequences. The chloroplast genome of E. koreanum was 157 218 bp in length and separated into four distinct regions such as large single copy region (89 600 bp), small single copy region (17 222 bp) and a pair of inverted repeat regions (25 198 bp). The genome contained a total of 112 genes including 78 protein-coding genes, 30 tRNA genes, and 4 rRNA genes. Phylogenetic analysis with the reported chloroplast genomes revealed that E. koreanum is most closely related to Berberis bealei, a traditional medicinal plant in the Berberidaceae family.

  15. Phylogeny of flowering plants by the chloroplast genome sequences: in search of a "lucky gene".

    PubMed

    Logacheva, M D; Penin, A A; Samigullin, T H; Vallejo-Roman, C M; Antonov, A S

    2007-12-01

    One of the most complicated remaining problems of molecular-phylogenetic analysis is choosing an appropriate genome region. In an ideal case, such a region should have two specific properties: (i) results of analysis using this region should be similar to the results of multigene analysis using the maximal number of regions; (ii) this region should be arranged compactly and be significantly shorter than the multigene set. The second condition is necessary to facilitate sequencing and extension of taxons under analysis, the number of which is also crucial for molecular phylogenetic analysis. Such regions have been revealed for some groups of animals and have been designated as "lucky genes". We have carried out a computational experiment on analysis of 41 complete chloroplast genomes of flowering plants aimed at searching for a "lucky gene" for reconstruction of their phylogeny. It is shown that the phylogenetic tree inferred from a combination of translated nucleotide sequences of genes encoding subunits of plastid RNA polymerase is closest to the tree constructed using all protein coding sites of the chloroplast genome. The only node for which a contradiction is observed is unstable according to the different type analyses. For all the other genes or their combinations, the coincidence is significantly worse. The RNA polymerase genes are compactly arranged in the genome and are fourfold shorter than the total length of protein coding genes used for phylogenetic analysis. The combination of all necessary features makes this group of genes main candidates for the role of "lucky gene" in studying phylogeny of flowering plants.

  16. Regions of extreme synonymous codon selection in mammalian genes

    PubMed Central

    Schattner, Peter; Diekhans, Mark

    2006-01-01

    Recently there has been increasing evidence that purifying selection occurs among synonymous codons in mammalian genes. This selection appears to be a consequence of either cis-regulatory motifs, such as exonic splicing enhancers (ESEs), or mRNA secondary structures, being superimposed on the coding sequence of the gene. We have developed a program to identify regions likely to be enriched for such motifs by searching for extended regions of extreme codon conservation between homologous genes of related species. Here we present the results of applying this approach to five mammalian species (human, chimpanzee, mouse, rat and dog). Even with very conservative selection criteria, we find over 200 regions of extreme codon conservation, ranging in length from 60 to 178 codons. The regions are often found within genes involved in DNA-binding, RNA-binding or zinc-ion-binding. They are highly depleted for synonymous single nucleotide polymorphisms (SNPs) but not for non-synonymous SNPs, further indicating that the observed codon conservation is being driven by negative selection. Forty-three percent of the regions overlap conserved alternative transcript isoforms and are enriched for known ESEs. Other regions are enriched for TpA dinucleotides and may contain conserved motifs/structures relating to mRNA stability and/or degradation. We anticipate that this tool will be useful for detecting regions enriched in other classes of coding-sequence motifs and structures as well. PMID:16556911

  17. Divergent evolution of part of the involucrin gene in the hominoids: Unique intragenic duplications in the gorilla and human

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Teumer, J.; Green, H.

    1989-02-01

    The gene for involucrin, an epidermal protein, has been remodeled in the higher primates. Most of the coding region of the human gene consists of a modern segment of repeats derived from a 10-codon sequence present in the ancestral segment of the gene. The modern segment can be divided into early, middle, and late regions. The authors report here the nucleotide sequence of three alleles of the gorilla involucrin gene. Each possesses a modern segment homologous to that of the human and consisting of 10-codon repeats. The early and middle regions are similar to the corresponding regions of the humanmore » allele and are nearly identical among the different gorilla alleles. The late region consists of recent duplications whose pattern is unique in each of the gorilla alleles and in the human allele. The early region is located in what is now the 3{prime} third of the modern segment, and the late, polymorphic region is located in what is now the 5{prime} third. Therefore, as the modern segment expanded during evolution, its 3{prime} end became stabilized, and continuing duplications became confined to its 5{prime} end. The expansion of the involucrin coding region, which began long before the separation of the gorilla and human, has continued in both species after their separation.« less

  18. The mitochondrial genomes of the human hookworms, Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea).

    PubMed

    Hu, Min; Chilton, Neil B; Gasser, Robin B

    2002-02-01

    The complete mitochondrial genome sequences were determined for two species of human hookworms, Ancylostoma duodenale (13,721 bp) and Necator americanus (13,604 bp). The circular hookworm genomes are amongst the smallest reported to date for any metazoan organism. Their relatively small size relates mainly to a reduced length in the AT-rich region. Both hookworm genomes encode 12 protein, two ribosomal RNA and 22 transfer RNA genes, but lack the ATP synthetase subunit 8 gene, which is consistent with three other species of Secernentea studied to date. All genes are transcribed in the same direction and have a nucleotide composition high in A and T, but low in G and C. The AT bias had a significant effect on both the codon usage pattern and amino acid composition of proteins. For both hookworm species, genes were arranged in the same order as for Caenorhabditis elegans, except for the presence of a non-coding region between genes nad3 and nad5. In A. duodenale, this non-coding region is predicted to form a stem-and-loop structure which is not present in N. americanus. The mitochondrial genome structure for both hookworms differs from Ascaris suum only in the location of the AT-rich region, whereas there are substantial differences when compared with Onchocerca volvulus, including four gene or gene-block translocations and the positions of some transfer RNA genes and the AT-rich region. Based on genome organisation and amino acid sequence identity, A. duodenale and N. americanus were more closely related to C. elegans than to A. suum or O. volvulus (all secernentean nematodes), consistent with a previous phylogenetic study using ribosomal DNA sequence data. Determination of the complete mitochondrial genome sequences for two human hookworms (the first members of the order Strongylida ever sequenced) provides a foundation for studying the systematics, population genetics and ecology of these and other nematodes of socio-economic importance.

  19. BCL2 oncogene translocation is mediated by a chi-like consensus

    PubMed Central

    1992-01-01

    Examination of 64 translocations involving the major breakpoint region (mbr) of the BCL2 oncogene and the immunoglobulin heavy chain locus identified three short (14, 16, and 18 bp) segments within the mbr at which translocations occurred with very high frequency. Each of these clusters was associated with a 15-bp region of sequence homology, the principal one containing an octamer related to chi, the procaryotic activator of recombination. The presence of short deletions and N nucleotide additions at the breakpoints, as well as involvement of JH and DH coding regions, suggested that these sequences served as signals capable of interacting with the VDJ recombinase complex, even though no homology with the traditional heptamer/spacer/nonamer (IgRSS) existed. Furthermore, the BCL2 signal sequences were employed in a bidirectional fashion and could mediate recombination of one mbr region with another. Segments homologous to the BCL2 signal sequences flanked individual members of the XP family of diversity gene segments, which were themselves highly overrepresented in the reciprocal products (18q-) of BCL2 translocation. We propose that the chi-like signal sequences of BCL2 represent a distinct class of recognition sites for the recombinase complex, responsible for initiating interactions between regions of DNA separated by great distances, and that BCL2 translocation begins by a recombination event between mbr and DXP chi signals. Since recombinant joints containing chi, not IgRSS, occur in brain cells expressing RAG-1 (Matsuoka, M., F. Nagawa, K. Okazaki, L. Kingsbury, K. Yoshida, U. Muller, D. T. Larue, J. A. Winer, and H. Sakano. 1991. Science [Wash. DC]. 254:81; reference 1), we further suggest that the product of this gene could mediate both BCL2 translocation and the first step of normal DJ assembly through the creation of chi joints, rather than signal or coding joints. PMID:1588282

  20. Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

    PubMed Central

    Liu, X; Gorovsky, M A

    1996-01-01

    A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

  1. Method for altering antibody light chain interactions

    DOEpatents

    Stevens, Fred J.; Stevens, Priscilla Wilkins; Raffen, Rosemarie; Schiffer, Marianne

    2002-01-01

    A method for recombinant antibody subunit dimerization including modifying at least one codon of a nucleic acid sequence to replace an amino acid occurring naturally in the antibody with a charged amino acid at a position in the interface segment of the light polypeptide variable region, the charged amino acid having a first polarity; and modifying at least one codon of the nucleic acid sequence to replace an amino acid occurring naturally in the antibody with a charged amino acid at a position in an interface segment of the heavy polypeptide variable region corresponding to a position in the light polypeptide variable region, the charged amino acid having a second polarity opposite the first polarity. Nucleic acid sequences which code for novel light chain proteins, the latter of which are used in conjunction with the inventive method, are also provided.

  2. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    PubMed

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  3. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    PubMed Central

    Rehm, Charlotte; Wurmthaler, Lena A.; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S.

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1–5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6–9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria. PMID:26695179

  4. The structure of the coding and 5'-flanking region of the type 1 iodothyronine deiodinase (dio1) gene is normal in a patient with suspected congenital dio1 deficiency.

    PubMed

    Toyoda, N; Kleinhaus, N; Larsen, P R

    1996-06-01

    We analyzed the exon-intron structure of the human type 1 deiodinase gene (dio1) and compared it with that of a patient with suspected congenital type 1 deiodinase (D1) deficiency. The hdio1 gene is identical in exon-intron arrangement to the mouse gene, with coding sequences and a selenocysteine insertion sequence (SECIS) element contained in four exons. There were no mutations in the sequences of exons 1-4 of the patient's genomic DNA. Functional studies by transient expression techniques showed no difference in basal promoter activity or T3 responsiveness between the patient's and the normal dio1 gene. A structural abnormality in the dio1 gene is not a likely explanation for this patient's D1-deficient phenotype.

  5. A +1 ribosomal frameshifting motif prevalent among plant amalgaviruses.

    PubMed

    Nibert, Max L; Pyle, Jesse D; Firth, Andrew E

    2016-11-01

    Sequence accessions attributable to novel plant amalgaviruses have been found in the Transcriptome Shotgun Assembly database. Sixteen accessions, derived from 12 different plant species, appear to encompass the complete protein-coding regions of the proposed amalgaviruses, which would substantially expand the size of genus Amalgavirus from 4 current species. Other findings include evidence for UUU_CGN as a +1 ribosomal frameshifting motif prevalent among plant amalgaviruses; for a variant version of this motif found thus far in only two amalgaviruses from solanaceous plants; for a region of α-helical coiled coil propensity conserved in a central region of the ORF1 translation product of plant amalgaviruses; and for conserved sequences in a C-terminal region of the ORF2 translation product (RNA-dependent RNA polymerase) of plant amalgaviruses, seemingly beyond the region of conserved polymerase motifs. These results additionally illustrate the value of mining the TSA database and others for novel viral sequences for comparative analyses. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Functional Testing of SLC26A4 Variants—Clinical and Molecular Analysis of a Cohort with Enlarged Vestibular Aqueduct from Austria

    PubMed Central

    Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia

    2018-01-01

    The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412

  7. The complete chloroplast genome sequence of Citrus sinensis (L.) Osbeck var 'Ridge Pineapple': organization and phylogenetic relationships to other angiosperms

    PubMed Central

    Bausher, Michael G; Singh, Nameirakpam D; Lee, Seung-Bum; Jansen, Robert K; Daniell, Henry

    2006-01-01

    Background The production of Citrus, the largest fruit crop of international economic value, has recently been imperiled due to the introduction of the bacterial disease Citrus canker. No significant improvements have been made to combat this disease by plant breeding and nuclear transgenic approaches. Chloroplast genetic engineering has a number of advantages over nuclear transformation; it not only increases transgene expression but also facilitates transgene containment, which is one of the major impediments for development of transgenic trees. We have sequenced the Citrus chloroplast genome to facilitate genetic improvement of this crop and to assess phylogenetic relationships among major lineages of angiosperms. Results The complete chloroplast genome sequence of Citrus sinensis is 160,129 bp in length, and contains 133 genes (89 protein-coding, 4 rRNAs and 30 distinct tRNAs). Genome organization is very similar to the inferred ancestral angiosperm chloroplast genome. However, in Citrus the infA gene is absent. The inverted repeat region has expanded to duplicate rps19 and the first 84 amino acids of rpl22. The rpl22 gene in the IRb region has a nonsense mutation resulting in 9 stop codons. This was confirmed by PCR amplification and sequencing using primers that flank the IR/LSC boundaries. Repeat analysis identified 29 direct and inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Comparison of protein-coding sequences with expressed sequence tags revealed six putative RNA edits, five of which resulted in non-synonymous modifications in petL, psbH, ycf2 and ndhA. Phylogenetic analyses using maximum parsimony (MP) and maximum likelihood (ML) methods of a dataset composed of 61 protein-coding genes for 30 taxa provide strong support for the monophyly of several major clades of angiosperms, including monocots, eudicots, rosids and asterids. The MP and ML trees are incongruent in three areas: the position of Amborella and Nymphaeales, relationship of the magnoliid genus Calycanthus, and the monophyly of the eurosid I clade. Both MP and ML trees provide strong support for the monophyly of eurosids II and for the placement of Citrus (Sapindales) sister to a clade including the Malvales/Brassicales. Conclusion This is the first complete chloroplast genome sequence for a member of the Rutaceae and Sapindales. Expansion of the inverted repeat region to include rps19 and part of rpl22 and presence of two truncated copies of rpl22 is unusual among sequenced chloroplast genomes. Availability of a complete Citrus chloroplast genome sequence provides valuable information on intergenic spacer regions and endogenous regulatory sequences for chloroplast genetic engineering. Phylogenetic analyses resolve relationships among several major clades of angiosperms and provide strong support for the monophyly of the eurosid II clade and the position of the Sapindales sister to the Brassicales/Malvales. PMID:17010212

  8. Translating working memory into action: behavioral and neural evidence for using motor representations in encoding visuo-spatial sequences.

    PubMed

    Langner, Robert; Sternkopf, Melanie A; Kellermann, Tanja S; Grefkes, Christian; Kurth, Florian; Schneider, Frank; Zilles, Karl; Eickhoff, Simon B

    2014-07-01

    The neurobiological organization of action-oriented working memory is not well understood. To elucidate the neural correlates of translating visuo-spatial stimulus sequences into delayed (memory-guided) sequential actions, we measured brain activity using functional magnetic resonance imaging while participants encoded sequences of four to seven dots appearing on fingers of a left or right schematic hand. After variable delays, sequences were to be reproduced with the corresponding fingers. Recall became less accurate with longer sequences and was initiated faster after long delays. Across both hands, encoding and recall activated bilateral prefrontal, premotor, superior and inferior parietal regions as well as the basal ganglia, whereas hand-specific activity was found (albeit to a lesser degree during encoding) in contralateral premotor, sensorimotor, and superior parietal cortex. Activation differences after long versus short delays were restricted to motor-related regions, indicating that rehearsal during long delays might have facilitated the conversion of the memorandum into concrete motor programs at recall. Furthermore, basal ganglia activity during encoding selectively predicted correct recall. Taken together, the results suggest that to-be-reproduced visuo-spatial sequences are encoded as prospective action representations (motor intentions), possibly in addition to retrospective sensory codes. Overall, our study supports and extends multi-component models of working memory, highlighting the notion that sensory input can be coded in multiple ways depending on what the memorandum is to be used for. Copyright © 2013 Wiley Periodicals, Inc.

  9. Complete mitochondrial genome of Lutzomyia (Nyssomyia) umbratilis (Diptera: Psychodidae), the main vector of Leishmania guyanensis.

    PubMed

    Kocher, Arthur; Gantier, Jean-Charles; Holota, Hélène; Jeziorski, Céline; Coissac, Eric; Bañuls, Anne-Laure; Girod, Romain; Gaborit, Pascal; Murienne, Jérôme

    2016-11-01

    The nearly complete mitochondrial genome of Lutzomyia umbratilis Ward & Fraiha, 1977 (Psychodidae: Phlebotominae), considered as the main vector of Leishmania guyanensis, is presented. The sequencing has been performed on an Illumina Hiseq 2500 platform, with a genome skimming strategy. The full nuclear ribosomal RNA segment was also assembled. The mitogenome of L. umbratilis was determined to be at least 15,717 bp-long and presents an architecture found in many mitogenomes of insect (13 protein-coding genes, 22 transfer RNAs, two ribosomal RNAs, and one non-coding region also referred as the control region). The control region contains a large repeated element of c. 370 bp and a poly-AT region of unknown length. This is the first mitogenome of Psychodidae to be described.

  10. Rapid Mitochondrial Genome Evolution through Invasion of Mobile Elements in Two Closely Related Species of Arbuscular Mycorrhizal Fungi

    PubMed Central

    Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

    2013-01-01

    Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers. PMID:23637766

  11. Rapid mitochondrial genome evolution through invasion of mobile elements in two closely related species of arbuscular mycorrhizal fungi.

    PubMed

    Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

    2013-01-01

    Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers.

  12. Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)

    NASA Technical Reports Server (NTRS)

    Shibata, K.; Abe, S.; Davies, E.

    2001-01-01

    Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.

  13. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    PubMed

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  14. Complete mitochondrial DNA sequence of the Eastern keelback mullet Liza affinis.

    PubMed

    Gong, Xiaoling; Zhu, Wenjia; Bao, Baolong

    2016-05-01

    Eastern keelback mullet (Liza affinis) inhabits inlet waters and estuaries of rivers. In this paper, we initially determined the complete mitochondrial genome of Liza affinis. The entire mtDNA sequence is 16,831 bp in length, including 2 rRNA genes, 22 tRNA genes, 13 protein-coding genes and 1 putative control region. Its order and numbers of genes are similar to most bony fishes.

  15. The complete chloroplast genome sequence of American bird pepper (Capsicum annuum var. glabriusculum).

    PubMed

    Zeng, Fan-chun; Gao, Cheng-wen; Gao, Li-zhi

    2016-01-01

    The complete chloroplast genome sequence of American bird pepper (Capsicum annuum var. glabriusculum) is reported and characterized in this study. The genome size is 156,612 bp, containing a pair of inverted repeats (IRs) of 25,776 bp separated by a large single-copy region of 87,213 bp and a small single-copy region of 17,851 bp. The chloroplast genome harbors 130 known genes, including 89 protein-coding genes, 8 ribosomal RNA genes, and 37 tRNA genes. A total of 18 of these genes are duplicated in the inverted repeat regions, 16 genes contain 1 intron, and 2 genes and one ycf have 2 introns.

  16. Characterization of petunia flower mottle virus (PetFMV), a new potyvirus infecting Petunia x hybrida.

    PubMed

    Feldhoff, A; Wetzel, T; Peters, D; Kellner, R; Krczal, G

    1998-01-01

    With the introduction of cutting-grown Petunia x hybrida plants on the European market, a new potyvirus which showed no serological reaction with antisera against any other potyviruses infecting petunias was discovered. Infected leaves contained flexuous rod-shaped virus particles of 750-800 nm in length and inclusion bodies (pinwheel structures) typical for potyviruses in ultrathin leaf sections. The purified coat protein with a Mr of approximately 36 kDa could be detected in Western immunoblots with a specific antibody to the coat protein of the petunia-infecting virus. The 3' end of the viral genome encompassing the 3' non-coding region, the coat protein gene, and part of the NIb gene was amplified from infected leaf material by IC/PCR using degenerate and specific primers. Sequences of PCR-generated cDNA clones were compared to other known sequences of potyviruses. Maximum homology of 56% was found in the 3' non-coding region between the petunia isolate and other potyviruses. A maximum homology of 69% was found between the amino acid sequence of the coat protein of the petunia isolate and corresponding sequences of other potyviruses. These data indicate that the petunia-infecting virus is a previously undescribed potyvirus and the name petunia flower mottle virus (PetFMV) is suggested.

  17. The complete chloroplast genome sequence of Hibiscus syriacus.

    PubMed

    Kwon, Hae-Yun; Kim, Joon-Hyeok; Kim, Sea-Hyun; Park, Ji-Min; Lee, Hyoshin

    2016-09-01

    The complete chloroplast genome sequence of Hibiscus syriacus L. is presented in this study. The genome is composed of 161 019 bp in length, with a typical circular structure containing a pair of inverted repeats of 25 745 bp of length separated by a large single-copy region and a small single-copy region of 89 698 bp and 19 831 bp of length, respectively. The overall GC content is 36.8%. One hundred and fourteen genes were annotated, including 81 protein-coding genes, 4 ribosomal RNA genes and 29 transfer RNA genes.

  18. Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005

    PubMed Central

    Klein, Joern; Hussain, Manzoor; Ahmad, Munir; Normann, Preben; Afzal, Muhammad; Alexandersen, Soren

    2007-01-01

    Background According to the World Reference Laboratory for FMD, a new subtype of FMDV serotype A was detected in Iran in 2005. This subtype was designated A/IRN/2005, and rapidly spread throughout Iran and moved westwards into Saudi Arabia and Turkey where it was initially detected from August 2005 and subsequently caused major disease problems in the spring of 2006. The same subtype reached Jordan in 2007. As part of an ongoing project we have also detected this subtype in Pakistan with the first positive samples detected in April 2006. To characterise this subtype in detail, we have sequenced and analysed the complete coding sequence of three subtype A/IRN/2005 isolates collected in Pakistan in 2006, the complete coding sequence of one subtype A/IRN/2005 isolate collected during the first outbreak in Turkey in 2005 and, in addition, the partial 1D coding sequence derived from 4 epithelium samples and 34 swab-samples from Asian buffaloes or cattle subsequently found to be infected with the A/IRN/2005 subtype. Results The phylogenies of the genome regions encoding for the structural proteins, displayed, with the exception of 1A, distinct, serotype-specific clustering and an evolutionary relationship of the A/IRN/2005 sublineage with the A22 sublineage. Potential recombination events have been detected in parts of the genome region coding for the non-structural proteins of FMDV. In addition, amino acid substitutions have been detected in the deduced VP1 protein sequence, potentially related to clinical or subclinical outcome of FMD. Indications of differential susceptibility for developing a subclinical course of disease between Asian buffaloes and cattle have been detected. Furthermore, hitherto unknown insertions of 2 amino acids before the second start codon, as well as sublineage specific amino acids have been detected in the genome region encoding for the leader proteinase of A/IRN/2005 sublineage. Conclusion Our findings indicate that the A/IRN/2005 sublineage has undergone two different paths of evolution for the structural and non-structural genome regions. The structural genome regions have had their evolutionary starting point in the A22 sublineage. It can be assumed that, due to the quasispecies structure of FMDV populations and the error-prone replication process, advantageous mutations in a changed environment have been fixed and lead to the occurrence of the new A/IRN/2005 sublineage. Together with this mechanism, recombination within the non-structural genome regions, potentially modifying the virulence of the virus, may be involved in the success of this new sublineage. The possible origin of this recombinant virus may be a co-infection with Asia1 and a serotype A precursor of the A/IRN/2005 sublineage potentially within Asian Buffaloes, as these appears to relatively easy become infected, but usually without developing clinical disease and consequently showing not a strong acute inflammatory immune response against a second FMDV infection. PMID:18001482

  19. Mitochondrial DNA haplogroup phylogeny of the dog: Proposal for a cladistic nomenclature.

    PubMed

    Fregel, Rosa; Suárez, Nicolás M; Betancor, Eva; González, Ana M; Cabrera, Vicente M; Pestano, José

    2015-05-01

    Canis lupus familiaris mitochondrial DNA analysis has increased in recent years, not only for the purpose of deciphering dog domestication but also for forensic genetic studies or breed characterization. The resultant accumulation of data has increased the need for a normalized and phylogenetic-based nomenclature like those provided for human maternal lineages. Although a standardized classification has been proposed, haplotype names within clades have been assigned gradually without considering the evolutionary history of dog mtDNA. Moreover, this classification is based only on the D-loop region, proven to be insufficient for phylogenetic purposes due to its high number of recurrent mutations and the lack of relevant information present in the coding region. In this study, we design 1) a refined mtDNA cladistic nomenclature from a phylogenetic tree based on complete sequences, classifying dog maternal lineages into haplogroups defined by specific diagnostic mutations, and 2) a coding region SNP analysis that allows a more accurate classification into haplogroups when combined with D-loop sequencing, thus improving the phylogenetic information obtained in dog mitochondrial DNA studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Gene end-like sequences within the 3' non-coding region of the Nipah virus genome attenuate viral gene transcription.

    PubMed

    Sugai, Akihiro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko

    2017-08-01

    The regulation of transcription during Nipah virus (NiV) replication is poorly understood. Using a bicistronic minigenome system, we investigated the involvement of non-coding regions (NCRs) in the transcriptional re-initiation efficiency of NiV RNA polymerase. Reporter assays revealed that attenuation of NiV gene expression was not constant at each gene junction, and that the attenuating property was controlled by the 3' NCR. However, this regulation was independent of the gene-end, gene-start and intergenic regions. Northern blot analysis indicated that regulation of viral gene expression by the phosphoprotein (P) and large protein (L) 3' NCRs occurred at the transcription level. We identified uridine-rich tracts within the L 3' NCR that are similar to gene-end signals. These gene-end-like sequences were recognized as weak transcription termination signals by the viral RNA polymerase, thereby reducing downstream gene transcription. Thus, we suggest that NiV has a unique mechanism of transcriptional regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Characteristics and phylogenetic analysis of the complete mitochondrial genome of Cheilodactylus quadricornis (Perciformes, Cheilodactylidae).

    PubMed

    Wang, Aishuai; Sun, Yuena; Wu, Changwen

    2016-11-01

    The complete mitochondrial genome of the Cheilodactylus quadricornis was firstly determined in the present study. The mitochondrial genome of C. quadricornis is 16 521 nucleotides, comprising 13 protein-coding genes and 2 ribosomal RNA genes, 22 tRNA genes and 2 main non-coding regions (the control region and the origin of the light-strand replication). The overall base composition was T, 26.3%; C, 29.6%; A, 27.8% and G, 16.3%. The gene arrangement, base composition, and tRNA structures of the complete mitochondrial genome of C. quadricornis is similar to other teleosts. Only two central conserved sequence blocks (CSB-2 and CSB-3) were identified in the control region. In addition, the conserved motif 5'-GCCGG-3' was identified in the origin of light-strand replication of C. quadricornis. The complete mitochondrial genome of C. quadricornis was used to construct phylogenetic tree, which shows that C. quadricornis and C. variegatus clustered in a clade and formed a sister relationship. This mitogenome sequence data would play an important role in population genetics and phylogenetic analysis of the Cheilodactylidae.

  2. Stable chromosome condensation revealed by chromosome conformation capture

    PubMed Central

    Eagen, Kyle P.; Hartl, Tom A.; Kornberg, Roger D.

    2015-01-01

    SUMMARY Chemical cross-linking and DNA sequencing have revealed regions of intra-chromosomal interaction, referred to as topologically associating domains (TADs), interspersed with regions of little or no interaction, in interphase nuclei. We find that TADs and the regions between them correspond with the bands and interbands of polytene chromosomes of Drosophila. We further establish the conservation of TADs between polytene and diploid cells of Drosophila. From direct measurements on light micrographs of polytene chromosomes, we then deduce the states of chromatin folding in the diploid cell nucleus. Two states of folding, fully extended fibers containing regulatory regions and promoters, and fibers condensed up to ten-fold containing coding regions of active genes, constitute the euchromatin of the nuclear interior. Chromatin fibers condensed up to 30-fold, containing coding regions of inactive genes, represent the heterochromatin of the nuclear periphery. A convergence of molecular analysis with direct observation thus reveals the architecture of interphase chromosomes. PMID:26544940

  3. A subset of conserved mammalian long non-coding RNAs are fossils of ancestral protein-coding genes.

    PubMed

    Hezroni, Hadas; Ben-Tov Perry, Rotem; Meir, Zohar; Housman, Gali; Lubelsky, Yoav; Ulitsky, Igor

    2017-08-30

    Only a small portion of human long non-coding RNAs (lncRNAs) appear to be conserved outside of mammals, but the events underlying the birth of new lncRNAs in mammals remain largely unknown. One potential source is remnants of protein-coding genes that transitioned into lncRNAs. We systematically compare lncRNA and protein-coding loci across vertebrates, and estimate that up to 5% of conserved mammalian lncRNAs are derived from lost protein-coding genes. These lncRNAs have specific characteristics, such as broader expression domains, that set them apart from other lncRNAs. Fourteen lncRNAs have sequence similarity with the loci of the contemporary homologs of the lost protein-coding genes. We propose that selection acting on enhancer sequences is mostly responsible for retention of these regions. As an example of an RNA element from a protein-coding ancestor that was retained in the lncRNA, we describe in detail a short translated ORF in the JPX lncRNA that was derived from an upstream ORF in a protein-coding gene and retains some of its functionality. We estimate that ~ 55 annotated conserved human lncRNAs are derived from parts of ancestral protein-coding genes, and loss of coding potential is thus a non-negligible source of new lncRNAs. Some lncRNAs inherited regulatory elements influencing transcription and translation from their protein-coding ancestors and those elements can influence the expression breadth and functionality of these lncRNAs.

  4. Simultaneous mutation and copy number variation (CNV) detection by multiplex PCR-based GS-FLX sequencing.

    PubMed

    Goossens, Dirk; Moens, Lotte N; Nelis, Eva; Lenaerts, An-Sofie; Glassee, Wim; Kalbe, Andreas; Frey, Bruno; Kopal, Guido; De Jonghe, Peter; De Rijk, Peter; Del-Favero, Jurgen

    2009-03-01

    We evaluated multiplex PCR amplification as a front-end for high-throughput sequencing, to widen the applicability of massive parallel sequencers for the detailed analysis of complex genomes. Using multiplex PCR reactions, we sequenced the complete coding regions of seven genes implicated in peripheral neuropathies in 40 individuals on a GS-FLX genome sequencer (Roche). The resulting dataset showed highly specific and uniform amplification. Comparison of the GS-FLX sequencing data with the dataset generated by Sanger sequencing confirmed the detection of all variants present and proved the sensitivity of the method for mutation detection. In addition, we showed that we could exploit the multiplexed PCR amplicons to determine individual copy number variation (CNV), increasing the spectrum of detected variations to both genetic and genomic variants. We conclude that our straightforward procedure substantially expands the applicability of the massive parallel sequencers for sequencing projects of a moderate number of amplicons (50-500) with typical applications in resequencing exons in positional or functional candidate regions and molecular genetic diagnostics. 2008 Wiley-Liss, Inc.

  5. Four out of eight genes in a mouse chromosome 7 congenic donor region are candidate obesity genes.

    PubMed

    Sarahan, Kari A; Fisler, Janis S; Warden, Craig H

    2011-09-22

    We previously identified a region of mouse chromosome 7 that influences body fat mass in F2 littermates of congenic × background intercrosses. Current analyses revealed that alleles in the donor region of the subcongenic B6.C-D7Mit318 (318) promoted a twofold increase in adiposity in homozygous lines of 318 compared with background C57BL/6ByJ (B6By) mice. Parent-of-origin effects were discounted through cross-fostering studies and an F1 reciprocal cross. Mapping of the donor region revealed that it has a maximal size of 2.8 Mb (minimum 1.8 Mb) and contains a maximum of eight protein coding genes. Quantitative PCR in whole brain, liver, and gonadal white adipose tissue (GWAT) revealed differential expression between genotypes for three genes in females and two genes in males. Alpha-2,8-sialyltransferase 8B (St8sia2) showed reduced 318 mRNA levels in brain for females and males and in GWAT for females only. Both sexes of 318 mice had reduced Repulsive guidance molecule-a (Rgma) expression in GWAT. In brain, Family with sequence similarity 174 member b (Fam174b) had increased expression in 318 females, whereas Chromodomain helicase DNA binding protein 2 (Chd2-2) had reduced expression in 318 males. No donor region genes were differentially expressed in liver. Sequence analysis of coding exons for all genes in the 318 donor region revealed only one single nucleotide polymorphism that produced a nonsynonymous missense mutation, Gln7Pro, in Fam174b. Our findings highlight the difficulty of using expression and sequence to identify quantitative trait genes underlying obesity even in small genomic regions.

  6. DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

    PubMed Central

    Link, Gerhard

    1984-01-01

    A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

  7. Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

    PubMed

    Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

    1997-03-01

    cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent; (2) an N-glycosylation site is located right at the entrance to the heme channel. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify mRNAs coding for ATP 1a/b and ATP 2a/b in germinating seeds, seedlings, roots, leaves, stems, flowers and cell suspension culture using elongation factor 1alpha (EF-1alpha) for the first time as a positive control. Both mRNAs were transcribed at levels comparable to EF-1alpha in all plant tissues investigated which were more than two days old, and in cell suspension culture. In addition, the mRNA coding for ATP 1a/b was found in two day old germinating seeds. The abundant transcription of ATP 1a/b and ATP 2a/b is in line with their many entries in dbEST, and indicates essential roles for these novel peroxidases.

  8. Reconsideration of systematic relationships within the order Euplotida (Protista, Ciliophora) using new sequences of the gene coding for small-subunit rRNA and testing the use of combined data sets to construct phylogenies of the Diophrys-complex.

    PubMed

    Yi, Zhenzhen; Song, Weibo; Clamp, John C; Chen, Zigui; Gao, Shan; Zhang, Qianqian

    2009-03-01

    Comprehensive molecular analyses of phylogenetic relationships within euplotid ciliates are relatively rare, and the relationships among some families remain questionable. We performed phylogenetic analyses of the order Euplotida based on new sequences of the gene coding for small-subunit RNA (SSrRNA) from a variety of taxa across the entire order as well as sequences from some of these taxa of other genes (ITS1-5.8S-ITS2 region and histone H4) that have not been included in previous analyses. Phylogenetic trees based on SSrRNA gene sequences constructed with four different methods had a consistent branching pattern that included the following features: (1) the "typical" euplotids comprised a paraphyletic assemblage composed of two divergent clades (family Uronychiidae and families Euplotidae-Certesiidae-Aspidiscidae-Gastrocirrhidae), (2) in the family Uronychiidae, the genera Uronychia and Paradiophrys formed a clearly outlined, well-supported clade that seemed to be rather divergent from Diophrys and Diophryopsis, suggesting that the Diophrys-complex may have had a longer and more separate evolutionary history than previously supposed, (3) inclusion of 12 new SSrRNA sequences in analyses of Euplotidae revealed two new clades of species within the family and cast additional doubt on the present classification of genera within the family, and (4) the intraspecific divergence among five species of Aspidisca was far greater than those of closely related genera. The ITS1-5.8S-ITS2 coding regions and partial histone H4 genes of six morphospecies in the Diophrys-complex were sequenced along with their SSrRNA genes and used to compare phylogenies constructed from single data sets to those constructed from combined sets. Results indicated that combined analyses could be used to construct more reliable, less ambiguous phylogenies of complex groups like the order Euplotida, because they provide a greater amount and diversity of information.

  9. The complete mitochondrial genome sequence of Malus hupehensis var. pinyiensis.

    PubMed

    Duan, Naibin; Sun, Honghe; Wang, Nan; Fei, Zhangjun; Chen, Xuesen

    2016-07-01

    The complete mitochondrial genome sequence of Malus hupehensis var. pinyiensis, a widely used apple rootstock, was determined using the Illumina high-throughput sequencing approach. The genome is 422,555 bp in length and has a GC content of 45.21%. It is separated by a pair of inverted repeats of 32,504 bp, to form a large single copy region of 213,055 bp and a small single copy region of 144,492 bp. The genome contains 38 protein-coding genes, four pseudogenes, 25 tRNA genes, and three rRNA genes. The genome is 25,608 bp longer than that of M. domestica, and several structural variations between these two mitogenomes were detected.

  10. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    PubMed

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  11. Acinetobacter phage genome is similar to Sphinx 2.36, the circular DNA copurified with TSE infected particles.

    PubMed

    Longkumer, Toshisangba; Kamireddy, Swetha; Muthyala, Venkateswar Reddy; Akbarpasha, Shaikh; Pitchika, Gopi Krishna; Kodetham, Gopinath; Ayaluru, Murali; Siddavattam, Dayananda

    2013-01-01

    While analyzing plasmids of Acinetobacter sp. DS002 we have detected a circular DNA molecule pTS236, which upon further investigation is identified as the genome of a phage. The phage genome has shown sequence similarity to the recently discovered Sphinx 2.36 DNA sequence co-purified with the Transmissible Spongiform Encephalopathy (TSE) particles isolated from infected brain samples collected from diverse geographical regions. As in Sphinx 2.36, the phage genome also codes for three proteins. One of them codes for RepA and is shown to be involved in replication of pTS236 through rolling circle (RC) mode. The other two translationally coupled ORFs, orf106 and orf96, code for coat proteins of the phage. Although an orf96 homologue was not previously reported in Sphinx 2.36, a closer examination of DNA sequence of Sphinx 2.36 revealed its presence downstream of orf106 homologue. TEM images and infection assays revealed existence of phage AbDs1 in Acinetobacter sp. DS002.

  12. Acinetobacter phage genome is similar to Sphinx 2.36, the circular DNA copurified with TSE infected particles

    PubMed Central

    Longkumer, Toshisangba; Kamireddy, Swetha; Muthyala, Venkateswar Reddy; Akbarpasha, Shaikh; Pitchika, Gopi Krishna; Kodetham, Gopinath; Ayaluru, Murali; Siddavattam, Dayananda

    2013-01-01

    While analyzing plasmids of Acinetobacter sp. DS002 we have detected a circular DNA molecule pTS236, which upon further investigation is identified as the genome of a phage. The phage genome has shown sequence similarity to the recently discovered Sphinx 2.36 DNA sequence co-purified with the Transmissible Spongiform Encephalopathy (TSE) particles isolated from infected brain samples collected from diverse geographical regions. As in Sphinx 2.36, the phage genome also codes for three proteins. One of them codes for RepA and is shown to be involved in replication of pTS236 through rolling circle (RC) mode. The other two translationally coupled ORFs, orf106 and orf96, code for coat proteins of the phage. Although an orf96 homologue was not previously reported in Sphinx 2.36, a closer examination of DNA sequence of Sphinx 2.36 revealed its presence downstream of orf106 homologue. TEM images and infection assays revealed existence of phage AbDs1 in Acinetobacter sp. DS002. PMID:23867905

  13. Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

    PubMed

    Ken, C F; Lin, C T; Wu, J L; Shaw, J F

    2000-06-01

    A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

  14. Gene calling and bacterial genome annotation with BG7.

    PubMed

    Tobes, Raquel; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Kovach, Evdokim; Alekhin, Alexey; Pareja, Eduardo

    2015-01-01

    New massive sequencing technologies are providing many bacterial genome sequences from diverse taxa but a refined annotation of these genomes is crucial for obtaining scientific findings and new knowledge. Thus, bacterial genome annotation has emerged as a key point to investigate in bacteria. Any efficient tool designed specifically to annotate bacterial genomes sequenced with massively parallel technologies has to consider the specific features of bacterial genomes (absence of introns and scarcity of nonprotein-coding sequence) and of next-generation sequencing (NGS) technologies (presence of errors and not perfectly assembled genomes). These features make it convenient to focus on coding regions and, hence, on protein sequences that are the elements directly related with biological functions. In this chapter we describe how to annotate bacterial genomes with BG7, an open-source tool based on a protein-centered gene calling/annotation paradigm. BG7 is specifically designed for the annotation of bacterial genomes sequenced with NGS. This tool is sequence error tolerant maintaining their capabilities for the annotation of highly fragmented genomes or for annotating mixed sequences coming from several genomes (as those obtained through metagenomics samples). BG7 has been designed with scalability as a requirement, with a computing infrastructure completely based on cloud computing (Amazon Web Services).

  15. The complete plastid genome sequence of Eustrephus latifolius (Asparagaceae: Lomandroideae).

    PubMed

    Kim, Hyoung Tae; Kim, Jung Sung; Kim, Joo-Hwan

    2016-01-01

    The complete chloroplast (cp) genome sequence of Eustrephus latifolius was firstly determined in subfamily Lomandriodeae of family Asparagaceae. It was 159,736 bp and contained a large single copy region (82,403 bp) and a small single copy region (13,607 bp) which were separated by two inverted repeat regions (31,863 bp). In total, 132 genes were identified and they were consisted of 83 coding genes, 8 rRNA genes, 38 tRNA genes, 3 pseudogenes. rpl23 and clpP were pseudogenes due to sequence deletions. Among 23 genes containing introns, rps12 and ycf3 contained two introns and the rest had just one intron. The intact ycf68 was identified within an intron of trnI-GAU. The amino acid sequence was almost identical with Phoenix dactylifera in Aracales. Ycf1 of E. latifolius was completely located in IR. It was similar to cp genome structure of Lemna minor, Spirodela polyrhiza, Wolffiella lingulata, Wolffia australiana in Alismatales.

  16. The LINE-1 DNA sequences in four mammalian orders predict proteins that conserve homologies to retrovirus proteins.

    PubMed Central

    Fanning, T; Singer, M

    1987-01-01

    Recent work suggests that one or more members of the highly repeated LINE-1 (L1) DNA family found in all mammals may encode one or more proteins. Here we report the sequence of a portion of an L1 cloned from the domestic cat (Felis catus). These data permit comparison of the L1 sequences in four mammalian orders (Carnivore, Lagomorph, Rodent and Primate) and the comparison supports the suggested coding potential. In two separate, noncontiguous regions in the carboxy terminal half of the proteins predicted from the DNA sequences, there are several strongly conserved segments. In one region, these share homology with known or suspected reverse transcriptases, as described by others in rodents and primates. In the second region, closer to the carboxy terminus, the strongly conserved segments are over 90% homologous among the four orders. One of the latter segments is cysteine rich and resembles the putative metal binding domains of nucleic acid binding proteins, including those of TFIIIA and retroviruses. PMID:3562227

  17. High throughput SNP discovery and genotyping in grapevine (Vitis vinifera L.) by combining a re-sequencing approach and SNPlex technology

    PubMed Central

    Lijavetzky, Diego; Cabezas, José Antonio; Ibáñez, Ana; Rodríguez, Virginia; Martínez-Zapater, José M

    2007-01-01

    Background Single-nucleotide polymorphisms (SNPs) are the most abundant type of DNA sequence polymorphisms. Their higher availability and stability when compared to simple sequence repeats (SSRs) provide enhanced possibilities for genetic and breeding applications such as cultivar identification, construction of genetic maps, the assessment of genetic diversity, the detection of genotype/phenotype associations, or marker-assisted breeding. In addition, the efficiency of these activities can be improved thanks to the ease with which SNP genotyping can be automated. Expressed sequence tags (EST) sequencing projects in grapevine are allowing for the in silico detection of multiple putative sequence polymorphisms within and among a reduced number of cultivars. In parallel, the sequence of the grapevine cultivar Pinot Noir is also providing thousands of polymorphisms present in this highly heterozygous genome. Still the general application of those SNPs requires further validation since their use could be restricted to those specific genotypes. Results In order to develop a large SNP set of wide application in grapevine we followed a systematic re-sequencing approach in a group of 11 grape genotypes corresponding to ancient unrelated cultivars as well as wild plants. Using this approach, we have sequenced 230 gene fragments, what represents the analysis of over 1 Mb of grape DNA sequence. This analysis has allowed the discovery of 1573 SNPs with an average of one SNP every 64 bp (one SNP every 47 bp in non-coding regions and every 69 bp in coding regions). Nucleotide diversity in grape (π = 0.0051) was found to be similar to values observed in highly polymorphic plant species such as maize. The average number of haplotypes per gene sequence was estimated as six, with three haplotypes representing over 83% of the analyzed sequences. Short-range linkage disequilibrium (LD) studies within the analyzed sequences indicate the existence of a rapid decay of LD within the selected grapevine genotypes. To validate the use of the detected polymorphisms in genetic mapping, cultivar identification and genetic diversity studies we have used the SNPlex™ genotyping technology in a sample of grapevine genotypes and segregating progenies. Conclusion These results provide accurate values for nucleotide diversity in coding sequences and a first estimate of short-range LD in grapevine. Using SNPlex™ genotyping we have shown the application of a set of discovered SNPs as molecular markers for cultivar identification, linkage mapping and genetic diversity studies. Thus, the combination a highly efficient re-sequencing approach and the SNPlex™ high throughput genotyping technology provide a powerful tool for grapevine genetic analysis. PMID:18021442

  18. Highly conserved elements discovered in vertebrates are present in non-syntenic loci of tunicates, act as enhancers and can be transcribed during development

    PubMed Central

    Sanges, Remo; Hadzhiev, Yavor; Gueroult-Bellone, Marion; Roure, Agnes; Ferg, Marco; Meola, Nicola; Amore, Gabriele; Basu, Swaraj; Brown, Euan R.; De Simone, Marco; Petrera, Francesca; Licastro, Danilo; Strähle, Uwe; Banfi, Sandro; Lemaire, Patrick; Birney, Ewan; Müller, Ferenc; Stupka, Elia

    2013-01-01

    Co-option of cis-regulatory modules has been suggested as a mechanism for the evolution of expression sites during development. However, the extent and mechanisms involved in mobilization of cis-regulatory modules remains elusive. To trace the history of non-coding elements, which may represent candidate ancestral cis-regulatory modules affirmed during chordate evolution, we have searched for conserved elements in tunicate and vertebrate (Olfactores) genomes. We identified, for the first time, 183 non-coding sequences that are highly conserved between the two groups. Our results show that all but one element are conserved in non-syntenic regions between vertebrate and tunicate genomes, while being syntenic among vertebrates. Nevertheless, in all the groups, they are significantly associated with transcription factors showing specific functions fundamental to animal development, such as multicellular organism development and sequence-specific DNA binding. The majority of these regions map onto ultraconserved elements and we demonstrate that they can act as functional enhancers within the organism of origin, as well as in cross-transgenesis experiments, and that they are transcribed in extant species of Olfactores. We refer to the elements as ‘Olfactores conserved non-coding elements’. PMID:23393190

  19. RNA Editing in Plant Mitochondria

    NASA Astrophysics Data System (ADS)

    Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

    1989-12-01

    Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

  20. Uncoupling cis-Acting RNA Elements from Coding Sequences Revealed a Requirement of the N-Terminal Region of Dengue Virus Capsid Protein in Virus Particle Formation

    PubMed Central

    Samsa, Marcelo M.; Mondotte, Juan A.; Caramelo, Julio J.

    2012-01-01

    Little is known about the mechanism of flavivirus genome encapsidation. Here, functional elements of the dengue virus (DENV) capsid (C) protein were investigated. Study of the N-terminal region of DENV C has been limited by the presence of overlapping cis-acting RNA elements within the protein-coding region. To dissociate these two functions, we used a recombinant DENV RNA with a duplication of essential RNA structures outside the C coding sequence. By the use of this system, the highly conserved amino acids FNML, which are encoded in the RNA cyclization sequence 5′CS, were found to be dispensable for C function. In contrast, deletion of the N-terminal 18 amino acids of C impaired DENV particle formation. Two clusters of basic residues (R5-K6-K7-R9 and K17-R18-R20-R22) were identified as important. A systematic mutational analysis indicated that a high density of positive charges, rather than particular residues at specific positions, was necessary. Furthermore, a differential requirement of N-terminal sequences of C for viral particle assembly was observed in mosquito and human cells. While no viral particles were observed in human cells with a virus lacking the first 18 residues of C, DENV propagation was detected in mosquito cells, although to a level about 50-fold less than that observed for a wild-type (WT) virus. We conclude that basic residues at the N terminus of C are necessary for efficient particle formation in mosquito cells but that they are crucial for propagation in human cells. This is the first report demonstrating that the N terminus of C plays a role in DENV particle formation. In addition, our results suggest that this function of C is differentially modulated in different host cells. PMID:22072762

  1. Identification and subspecific differentiation of Mycobacterium scrofulaceum by automated sequencing of a region of the gene (hsp65) encoding a 65-kilodalton heat shock protein.

    PubMed Central

    Swanson, D S; Pan, X; Musser, J M

    1996-01-01

    Mycobacterium scrofulaceum is most commonly recovered from children with cervical lymphadenitis, although it also accounts for approximately 2% of the mycobacterial infections in AIDS patients. Species assignment of M. scrofulaceum isolated by conventional techniques can be difficult and time-consuming. To develop a strategy for rapid species assignment of these organisms, a 360-bp region of the gene (hsp65) encoding a 65-kDa heat shock protein in 37 isolates from diverse sources was sequenced. Eight hsp65 alleles were identified, and these sequences formed phylogenetic clusters and lineages largely distinct from other Mycobacterium species. There was incomplete correlation between serovar designation and hsp65 allele assignment. The hsp65 data correlated strongly with the results of sequence analysis of the gene coding for 16S rRNA. Automated DNA sequencing of a 360-bp region of the hsp65 gene provides a rapid and unambiguous method for species assignment of these acid-fast organisms for diagnostic purposes. PMID:8940463

  2. The complete mitochondrial genome of the Border Collie dog.

    PubMed

    Wu, An-Quan; Zhang, Yong-Liang; Li, Li-Li; Chen, Long; Yang, Tong-Wen

    2016-01-01

    Border Collie dog is one of the famous breed of dog. In the present work we report the complete mitochondrial genome sequence of Border Collie dog for the first time. The total length of the mitogenome was 16,730 bp with the base composition of 31.6% for A, 28.7% for T, 25.5% for C, and 14.2% for G and an A-T (60.3%)-rich feature was detected. It harbored 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes and one non-coding control region (D-loop region). The arrangement of all genes was identical to the typical mitochondrial genomes of dogs.

  3. A multiplex primer design algorithm for target amplification of continuous genomic regions.

    PubMed

    Ozturk, Ahmet Rasit; Can, Tolga

    2017-06-19

    Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.

  4. Molecular taxonomy and phylogeny

    USDA-ARS?s Scientific Manuscript database

    The cyst nematodes comprise a group of sedentary endoparasitic nematodes that impact a wide range of crops in both tropical and temperate regions of the world. This chapter updates the taxonomy and phylogeny of this group and describes the nuclear protein coding, ribosomal, and mitochondrial sequenc...

  5. Discovery and Complete Genome Sequence of a Bacteriophage from an Obligate Intracellular Symbiont of a Cellulolytic Protist in the Termite Gut

    PubMed Central

    Pramono, Ajeng K.; Kuwahara, Hirokazu; Itoh, Takehiko; Toyoda, Atsushi; Yamada, Akinori; Hongoh, Yuichi

    2017-01-01

    Termites depend nutritionally on their gut microbes, and protistan, bacterial, and archaeal gut communities have been extensively studied. However, limited information is available on viruses in the termite gut. We herein report the complete genome sequence (99,517 bp) of a phage obtained during a genome analysis of “Candidatus Azobacteroides pseudotrichonymphae” phylotype ProJPt-1, which is an obligate intracellular symbiont of the cellulolytic protist Pseudotrichonympha sp. in the gut of the termite Prorhinotermes japonicus. The genome of the phage, designated ProJPt-Bp1, was circular or circularly permuted, and was not integrated into the two circular chromosomes or five circular plasmids composing the host ProJPt-1 genome. The phage was putatively affiliated with the order Caudovirales based on sequence similarities with several phage-related genes; however, most of the 52 protein-coding sequences had no significant homology to sequences in the databases. The phage genome contained a tRNA-Gln (CAG) gene, which showed the highest sequence similarity to the tRNA-Gln (CAA) gene of the host “Ca. A. pseudotrichonymphae” phylotype ProJPt-1. Since the host genome lacked a tRNA-Gln (CAG) gene, the phage tRNA gene may compensate for differences in codon usage bias between the phage and host genomes. The phage genome also contained a non-coding region with high nucleotide sequence similarity to a region in one of the host plasmids. No other phage-related sequences were found in the host ProJPt-1 genome. To the best of our knowledge, this is the first report of a phage from an obligate, mutualistic endosymbiont permanently associated with eukaryotic cells. PMID:28321010

  6. Mutations in nsP1 and PE2 are critical determinants of Ross River virus-induced musculoskeletal inflammatory disease in a mouse model

    PubMed Central

    Jupille, Henri J.; Oko, Lauren; Stoermer, Kristina A.; Heise, Mark T.; Mahalingam, Suresh; Gunn, Bronwyn M.; Morrison, Thomas E.

    2010-01-01

    The viral determinants of Alphavirus-induced rheumatic disease have not been elucidated. We identified an RRV strain (DC5692) which, in contrast to the T48 strain, does not induce musculoskeletal inflammation in a mouse model of RRV disease. Substitution of the RRV T48 strain nonstructural protein 1 (nsP1) coding sequence with that from strain DC5692 generated a virus that was attenuated in vivo despite similar viral loads in tissues. In contrast, substitution of the T48 PE2 coding region with the PE2 coding region from DC5692 resulted in attenuation in vivo and reduced viral loads in tissues. In gain of virulence experiments, substitution of the DC5692 strain nsP1 and PE2 coding regions with those from the T48 strain was sufficient to restore full virulence to the DC5692 strain. These findings indicate that determinants in both nsP1 and PE2 have critical and distinct roles in the pathogenesis of RRV-induced musculoskeletal inflammatory disease in mice. PMID:21131014

  7. Functional Anthology of Intrinsic Disorder. II. Cellular Components, Domains, Technical Terms, Developmental Processes and Coding Sequence Diversities Correlated with Long Disordered Regions

    PubMed Central

    Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M.; Oldfield, Christopher J.; Dunker, A. Keith; Obradovic, Zoran; Uversky, Vladimir N.

    2008-01-01

    Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie H., Vucetic S., Iakoucheva L.M., Oldfield C.J., Dunker A.K., Obradovic Z., Uversky V.N. (2006) Functional anthology of intrinsic disorder. I. Biological processes and functions of proteins with long disordered regions. J. Proteome Res.). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes ~90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes and coding sequence diversities possessing strong positive and negative correlation with long disordered regions. PMID:17391015

  8. Functional anthology of intrinsic disorder. 2. Cellular components, domains, technical terms, developmental processes, and coding sequence diversities correlated with long disordered regions.

    PubMed

    Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M; Oldfield, Christopher J; Dunker, A Keith; Obradovic, Zoran; Uversky, Vladimir N

    2007-05-01

    Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie, H.; Vucetic, S.; Iakoucheva, L. M.; Oldfield, C. J.; Dunker, A. K.; Obradovic, Z.; Uversky, V. N. Functional anthology of intrinsic disorder. 1. Biological processes and functions of proteins with long disordered regions. J. Proteome Res. 2007, 5, 1882-1898). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes approximately 90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes, and coding sequence diversities possessing strong positive and negative correlation with long disordered regions.

  9. Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

    PubMed

    René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

    2000-01-04

    In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

  10. Artificial Intelligence, DNA Mimicry, and Human Health.

    PubMed

    Stefano, George B; Kream, Richard M

    2017-08-14

    The molecular evolution of genomic DNA across diverse plant and animal phyla involved dynamic registrations of sequence modifications to maintain existential homeostasis to increasingly complex patterns of environmental stressors. As an essential corollary, driver effects of positive evolutionary pressure are hypothesized to effect concerted modifications of genomic DNA sequences to meet expanded platforms of regulatory controls for successful implementation of advanced physiological requirements. It is also clearly apparent that preservation of updated registries of advantageous modifications of genomic DNA sequences requires coordinate expansion of convergent cellular proofreading/error correction mechanisms that are encoded by reciprocally modified genomic DNA. Computational expansion of operationally defined DNA memory extends to coordinate modification of coding and previously under-emphasized noncoding regions that now appear to represent essential reservoirs of untapped genetic information amenable to evolutionary driven recruitment into the realm of biologically active domains. Additionally, expansion of DNA memory potential via chemical modification and activation of noncoding sequences is targeted to vertical augmentation and integration of an expanded cadre of transcriptional and epigenetic regulatory factors affecting linear coding of protein amino acid sequences within open reading frames.

  11. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  12. Genome variability of foot-and-mouth disease virus during the short period of the 2010 epidemic in Japan.

    PubMed

    Nishi, Tatsuya; Yamada, Manabu; Fukai, Katsuhiko; Shimada, Nobuaki; Morioka, Kazuki; Yoshida, Kazuo; Sakamoto, Kenichi; Kanno, Toru; Yamakawa, Makoto

    2017-02-01

    Foot-and-mouth disease virus (FMDV) is highly contagious and has a high mutation rate, leading to extensive genetic variation. To investigate how FMDV genetically evolves over a short period of an epidemic after initial introduction into an FMD-free area, whole L-fragment sequences of 104 FMDVs isolated from the 2010 epidemic in Japan, which continued for less than three months were determined and phylogenetically and comparatively analyzed. Phylogenetic analysis of whole L-fragment sequences showed that these isolates were classified into a single group, indicating that FMDV was introduced into Japan in the epidemic via a single introduction. Nucleotide sequences of 104 virus isolates showed more than 99.56% pairwise identity rates without any genetic deletion or insertion, although no sequences were completely identical with each other. These results indicate that genetic substitutions of FMDV occurred gradually and constantly during the epidemic and generation of an extensive mutant virus could have been prevented by rapid eradication strategy. From comparative analysis of variability of each FMDV protein coding region, VP4 and 2C regions showed the highest average identity rates and invariant rates, and were confirmed as highly conserved. In contrast, the protein coding regions VP2 and VP1 were confirmed to be highly variable regions with the lowest average identity rates and invariant rates, respectively. Our data demonstrate the importance of rapid eradication strategy in an FMD epidemic and provide valuable information on the genome variability of FMDV during the short period of an epidemic. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Molecular cloning of the mouse gene coding for {alpha}{sub 2}-macroglobulin and targeting of the gene in embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Umans, L.; Serneels, L.; Hilliker, C.

    1994-08-01

    The authors have cloned the mouse gene coding for {alpha}{sub 2}-macroglobulin in overlapping {lambda} clones and have analyzed its structure. The gene contains 36 exons, coding for the 4.8-kb cDNA that we cloned previously. Including putative control elements in the 5{prime} flanking region, the gene covers about 45 kb. A region of 3.8 kb, stretching from 835 bases upstream of the cDNA start site to exon 4, including all intervening sequences, was sequenced completely. The analysis demonstrated that the putative promoter region of the mouse A2M gene differed considerably from the known promoter sequences of the human A2M gene andmore » of the rat acute-phas A2M gene. Comparison of the exon-intron structure of all known genes of the A2M family confirmed that the rat acute phase A2M gene is more closely related to the human gene than to the mouse A2M gene. To generate mice with the A2M gene inactivated, an insertion type of construct containing 7.5 kb of genomic DNA of the mouse strain 129/J, encompassing exons 16 to 19, was synthesized. A hygromycin marker gene was embedded in intron 17. After electroporation, 198 hygromycin-resistant ES cell lines were isolated and analyzed by Southern blotting. Five ES cell lines were obtained with one allele of the mouse A2M gene targeted by this insertion construct, demonstrating that the position and the characteristics of the vector served the intended goal.« less

  14. GenomeVista

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poliakov, Alexander; Couronne, Olivier

    2002-11-04

    Aligning large vertebrate genomes that are structurally complex poses a variety of problems not encountered on smaller scales. Such genomes are rich in repetitive elements and contain multiple segmental duplications, which increases the difficulty of identifying true orthologous SNA segments in alignments. The sizes of the sequences make many alignment algorithms designed for comparing single proteins extremely inefficient when processing large genomic intervals. We integrated both local and global alignment tools and developed a suite of programs for automatically aligning large vertebrate genomes and identifying conserved non-coding regions in the alignments. Our method uses the BLAT local alignment program tomore » find anchors on the base genome to identify regions of possible homology for a query sequence. These regions are postprocessed to find the best candidates which are then globally aligned using the AVID global alignment program. In the last step conserved non-coding segments are identified using VISTA. Our methods are fast and the resulting alignments exhibit a high degree of sensitivity, covering more than 90% of known coding exons in the human genome. The GenomeVISTA software is a suite of Perl programs that is built on a MySQL database platform. The scheduler gets control data from the database, builds a queve of jobs, and dispatches them to a PC cluster for execution. The main program, running on each node of the cluster, processes individual sequences. A Perl library acts as an interface between the database and the above programs. The use of a separate library allows the programs to function independently of the database schema. The library also improves on the standard Perl MySQL database interfere package by providing auto-reconnect functionality and improved error handling.« less

  15. Complete mitochondrial genome of Platevindex sp. (Gastropoda: Pulmonata: Systellommatophora: Onchidiidae).

    PubMed

    Liu, Chen; Shen, He Ding; Zhou, Na

    2016-01-01

    The complete mitochondrial genome sequence of Platevindex sp. is firstly described in the article. The mitogenome (13,908 bp) contains 22 tRNA genes, 2 ribosomal RNA genes and 13 protein-coding genes, and 1 putative control region (CR). CR is not well characterized due to lack of discrete conserved sequence blocks. This characteristic is similar with CRs of other invertebrate mitochondrial genomes. The characteristic is the typical bivalvia mitochondrial gene composition.

  16. The complete mitochondrial genome of the cryptic "lineage B" big-fin reef squid, Sepioteuthis lessoniana (Cephalopoda: Loliginidae) in Indo-West Pacific.

    PubMed

    Shen, Kang-Ning; Yen, Ta-Chi; Chen, Ching-Hung; Ye, Jeng-Jia; Hsiao, Chung-Der

    2016-05-01

    In this study, the complete mitogenome sequence of the cryptic "lineage B" big-fin reef squid, Sepioteuthis lessoniana (Cephalopoda: Loliginidae) has been sequenced by next-generation sequencing method. The assembled mitogenome consisting of 16,694 bp, includes 13 protein coding genes, 25 transfer RNAs, 2 ribosomal RNAs genes. The overall base composition of "lineage B" S. lessoniana is 36.7% for A, 18.9 % for C, 34.5 % for T and 9.8 % for G and show 90% identities to "lineage C" S. lessoniana. It is also exhibits high T + A content (71.2%), two non-coding regions with TA tandem repeats. The complete mitogenome of the cryptic "lineage B" S. lessoniana provides essential and important DNA molecular data for further phylogeography and evolutionary analysis for big-fin reef squid species complex.

  17. The complete mitochondrial genome of the cryptic "lineage A" big-fin reef squid, Sepioteuthis lessoniana (Cephalopoda: Loliginidae) in Indo-West Pacific.

    PubMed

    Hsiao, Chung-Der; Shen, Kang-Ning; Ching, Tzu-Yun; Wang, Ya-Hsien; Ye, Jeng-Jia; Tsai, Shiou-Yi; Wu, Shan-Chun; Chen, Ching-Hung; Wang, Chia-Hui

    2016-07-01

    In this study, the complete mitogenome sequence of the cryptic "lineage A" big-fin reef squid, Sepioteuthis lessoniana (Cephalopoda: Loliginidae) has been sequenced by the next-generation sequencing method. The assembled mitogenome consists of 16,605 bp, which includes 13 protein-coding genes, 22 transfer RNAs, and 2 ribosomal RNAs genes. The overall base composition of "lineage A" S. lessoniana is 37.5% for A, 17.4% for C, 9.1% for G, and 35.9% for T and shows 87% identities to "lineage C" S. lessoniana. It is also noticed by its high T + A content (73.4%), two non-coding regions with TA tandem repeats. The complete mitogenome of the cryptic "lineage A" S. lessoniana provides essential and important DNA molecular data for further phylogeography and evolutionary analysis for big-fin reef squid species complex.

  18. Unique BK virus non-coding control region (NCCR) variants in hematopoietic stem cell transplant recipients with and without hemorrhagic cystitis.

    PubMed

    Carr, Michael J; McCormack, Grace P; Mutton, Ken J; Crowley, Brendan

    2006-04-01

    Hematopoietic stem cell transplant recipients frequently develop BK virus (BKV)-associated hemorrhagic cystitis, which coincides with BK viruria. However, the precise role of BKV in the etiology of hemorrhagic cystitis in hematopoietic stem cell transplant recipients remains unclear, since approximately 50% of all such adult transplant recipients excrete BKV, yet do not develop this clinical condition. In the present study, BKV were analyzed to determine if mutations in the non-coding control region (NCCR), and specific BKV sub-types defined by sequence analysis of major capsid protein VP1, were associated with development of hemorrhagic cystitis in hematopoietic stem cell transplant recipients. The regions encoding VP1 and NCCRs of BKV in urine samples collected from 15 hematopoietic stem cell transplant recipients with hemorrhagic cystitis and 20 without this illness were amplified and sequenced. Sequence variations in the NCCRs of BKV were identified in urine samples from those with and without hemorrhagic cystitis. Furthermore, five unique sequence variations within transcription factor binding sites in the canonical NCCR, O-P-Q-R-S, were identified, representing new BKV variants from a population of cloned quasi-species obtained from patients with and without hemorrhagic cystitis. Thirty-five BKV VP1 sequences were analyzed by phylogenetic analysis but no specific BKV sub-type was associated with hemorrhagic cystitis. Five previously unrecognized naturally occurring variants of the BKV are described which involve amplifications, deletions, and rearrangements of the archetypal BKV NCCRs in individuals with and without hemorrhagic cystitis. Architectural rearrangements in the NCCRs of BKV did not appear to be a prerequisite for development of hemorrhagic cystitis in hematopoietic stem cell transplant recipients. Copyright 2006 Wiley-Liss, Inc.

  19. Genetic diagnosis of Duchenne and Becker muscular dystrophy using next-generation sequencing technology: comprehensive mutational search in a single platform.

    PubMed

    Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee

    2011-11-01

    Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.

  20. Audiovisual focus of attention and its application to Ultra High Definition video compression

    NASA Astrophysics Data System (ADS)

    Rerabek, Martin; Nemoto, Hiromi; Lee, Jong-Seok; Ebrahimi, Touradj

    2014-02-01

    Using Focus of Attention (FoA) as a perceptual process in image and video compression belongs to well-known approaches to increase coding efficiency. It has been shown that foveated coding, when compression quality varies across the image according to region of interest, is more efficient than the alternative coding, when all region are compressed in a similar way. However, widespread use of such foveated compression has been prevented due to two main conflicting causes, namely, the complexity and the efficiency of algorithms for FoA detection. One way around these is to use as much information as possible from the scene. Since most video sequences have an associated audio, and moreover, in many cases there is a correlation between the audio and the visual content, audiovisual FoA can improve efficiency of the detection algorithm while remaining of low complexity. This paper discusses a simple yet efficient audiovisual FoA algorithm based on correlation of dynamics between audio and video signal components. Results of audiovisual FoA detection algorithm are subsequently taken into account for foveated coding and compression. This approach is implemented into H.265/HEVC encoder producing a bitstream which is fully compliant to any H.265/HEVC decoder. The influence of audiovisual FoA in the perceived quality of high and ultra-high definition audiovisual sequences is explored and the amount of gain in compression efficiency is analyzed.

  1. a Simple Symmetric Algorithm Using a Likeness with Introns Behavior in RNA Sequences

    NASA Astrophysics Data System (ADS)

    Regoli, Massimo

    2009-02-01

    The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. The RNA sequences has some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algoritnm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.

  2. RNA-dependent RNA polymerase of hepatitis C virus binds to its coding region RNA stem-loop structure, 5BSL3.2, and its negative strand.

    PubMed

    Kanamori, Hiroshi; Yuhashi, Kazuhito; Ohnishi, Shin; Koike, Kazuhiko; Kodama, Tatsuhiko

    2010-05-01

    The hepatitis C virus NS5B RNA-dependent RNA polymerase (RdRp) is a key enzyme involved in viral replication. Interaction between NS5B RdRp and the viral RNA sequence is likely to be an important step in viral RNA replication. The C-terminal half of the NS5B-coding sequence, which contains the important cis-acting replication element, has been identified as an NS5B-binding sequence. In the present study, we confirm the specific binding of NS5B to one of the RNA stem-loop structures in the region, 5BSL3.2. In addition, we show that NS5B binds to the complementary strand of 5BSL3.2 (5BSL3.2N). The bulge structure of 5BSL3.2N was shown to be indispensable for tight binding to NS5B. In vitro RdRp activity was inhibited by 5BSL3.2N, indicating the importance of the RNA element in the polymerization by RdRp. These results suggest the involvement of the RNA stem-loop structure of the negative strand in the replication process.

  3. Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa

    PubMed Central

    2012-01-01

    Background Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Results Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Conclusions Two transcriptome sets were built that are valuable resources for marker development, comparative genomic studies and candidate gene approaches. Next generation sequencing of leaf transcriptome is very effective; however, deeper sequencing and using more tissues and stages is advisable for extended comparative studies. PMID:23167289

  4. Complete mitochondrial genome of the frillneck lizard (Chlamydosaurus kingii, Reptilia; Agamidae), another squamate with two control regions.

    PubMed

    Ujvari, Beata; Madsen, Thomas

    2008-10-01

    Using PCR, the complete mitochondrial genome was sequenced in three frillneck lizards (Chlamydosaurus kingii). The mitochondria spanned over 16,761bp. As in other vertebrates, two rRNA genes, 22 tRNA genes and 13 protein coding genes were identified. However, similar to some other squamate reptiles, two control regions (CRI and CRII) were identified, spanning 801 and 812 bp, respectively. Our results were compared with another Australian member of the family Agamidae, the bearded dragon (Pogana vitticeps). The overall base composition of the light-strand sequence largely mirrored that observed in P vitticeps. Furthermore, similar to P. vitticeps, we observed an insertion 801 bp long between the ND5 and ND6 genes. However, in contrast to P vitticeps we did not observe a conserved sequence block III region. Based on a comparison among the three frillneck lizards, we also present data on the proportion of variable sites within the major mitochondrial regions.

  5. Dissociable Contributions of Imagination and Willpower to the Malleability of Human Patience.

    PubMed

    Jenkins, Adrianna C; Hsu, Ming

    2017-07-01

    The ability to exercise patience is important for human functioning. Although it is known that patience can be promoted by using top-down control, or willpower, to override impatient impulses, patience is also malleable-in particular, susceptible to framing effects-in ways that are difficult to explain using willpower alone. So far, the mechanisms underlying framing effects on patience have been elusive. We investigated the role of imagination in these effects. In a behavioral experiment (Experiment 1), a classic framing manipulation (sequence framing) increased self-reported and independently coded imagination during intertemporal choice. In an investigation of neural responses during decision making (Experiment 2), sequence framing increased the extent to which patience was related to activation in brain regions associated with imagination, relative to activation in regions associated with willpower, and increased functional connectivity of brain regions associated with imagination, but not willpower, relative to regions associated with valuation. Our results suggest that sequence framing can increase the role of imagination in decision making without increasing the exertion of willpower.

  6. Gene and genon concept: coding versus regulation

    PubMed Central

    2007-01-01

    We analyse here the definition of the gene in order to distinguish, on the basis of modern insight in molecular biology, what the gene is coding for, namely a specific polypeptide, and how its expression is realized and controlled. Before the coding role of the DNA was discovered, a gene was identified with a specific phenotypic trait, from Mendel through Morgan up to Benzer. Subsequently, however, molecular biologists ventured to define a gene at the level of the DNA sequence in terms of coding. As is becoming ever more evident, the relations between information stored at DNA level and functional products are very intricate, and the regulatory aspects are as important and essential as the information coding for products. This approach led, thus, to a conceptual hybrid that confused coding, regulation and functional aspects. In this essay, we develop a definition of the gene that once again starts from the functional aspect. A cellular function can be represented by a polypeptide or an RNA. In the case of the polypeptide, its biochemical identity is determined by the mRNA prior to translation, and that is where we locate the gene. The steps from specific, but possibly separated sequence fragments at DNA level to that final mRNA then can be analysed in terms of regulation. For that purpose, we coin the new term “genon”. In that manner, we can clearly separate product and regulative information while keeping the fundamental relation between coding and function without the need to introduce a conceptual hybrid. In mRNA, the program regulating the expression of a gene is superimposed onto and added to the coding sequence in cis - we call it the genon. The complementary external control of a given mRNA by trans-acting factors is incorporated in its transgenon. A consequence of this definition is that, in eukaryotes, the gene is, in most cases, not yet present at DNA level. Rather, it is assembled by RNA processing, including differential splicing, from various pieces, as steered by the genon. It emerges finally as an uninterrupted nucleic acid sequence at mRNA level just prior to translation, in faithful correspondence with the amino acid sequence to be produced as a polypeptide. After translation, the genon has fulfilled its role and expires. The distinction between the protein coding information as materialised in the final polypeptide and the processing information represented by the genon allows us to set up a new information theoretic scheme. The standard sequence information determined by the genetic code expresses the relation between coding sequence and product. Backward analysis asks from which coding region in the DNA a given polypeptide originates. The (more interesting) forward analysis asks in how many polypeptides of how many different types a given DNA segment is expressed. This concerns the control of the expression process for which we have introduced the genon concept. Thus, the information theoretic analysis can capture the complementary aspects of coding and regulation, of gene and genon. PMID:18087760

  7. Landscape of somatic mutations in 560 breast cancer whole-genome sequences

    DOE PAGES

    Nik-Zainal, Serena; Davies, Helen; Staaf, Johan; ...

    2016-05-02

    Here, we analysed whole-genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. We found that 93 protein-coding cancer genes carried probable driver mutations. Some non-coding regions exhibited high mutation frequencies, but most have distinctive structural features probably causing elevated mutation rates and do not contain driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed twelve base substitution and six rearrangement signatures. Three rearrangement signatures, characterized by tandem duplications or deletions, appear associated with defective homologous-recombination-based DNA repair: one with deficient BRCA1 function, anothermore » with deficient BRCA1 or BRCA2 function, the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operating, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer.« less

  8. Landscape of somatic mutations in 560 breast cancer whole-genome sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nik-Zainal, Serena; Davies, Helen; Staaf, Johan

    Here, we analysed whole-genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. We found that 93 protein-coding cancer genes carried probable driver mutations. Some non-coding regions exhibited high mutation frequencies, but most have distinctive structural features probably causing elevated mutation rates and do not contain driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed twelve base substitution and six rearrangement signatures. Three rearrangement signatures, characterized by tandem duplications or deletions, appear associated with defective homologous-recombination-based DNA repair: one with deficient BRCA1 function, anothermore » with deficient BRCA1 or BRCA2 function, the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operating, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer.« less

  9. Novel human CRYGD rare variant in a Brazilian family with congenital cataract

    PubMed Central

    Giordano, Gabriel Gorgone; Tavares, Anderson; da Silva, Márcio José; de Vasconcellos, José Paulo Cabral; Arieta, Carlos Eduardo Leite; de Melo, Mônica Barbosa

    2011-01-01

    Purpose To describe a novel polymorphism in the γD-crystallin (CRYGD) gene in a Brazilian family with congenital cataract. Methods A Brazilian four-generation family was analyzed. The proband had bilateral lamellar cataract and the phenotypes were classified by slit lamp examination. Genomic DNA was extracted from peripheral blood and coding regions and intron/exon boundaries of the αA-crystallin (CRYAA), γC-crystallin (CRYGC), and CRYGD genes were amplified by polymerase chain reaction and directly sequenced. Results Sequencing of the coding regions of CRYGD showed the presence of a heterozygous A→G transversion at c.401 position, which results in the substitution of a tyrosine to a cysteine (Y134C). The polymorphism was identified in three individuals, two affected and one unaffected. Conclusions A novel rare variant in CRYGD (Y134C) was detected in a Brazilian family with congenital cataract. Because there is no segregation between the substitution and the phenotypes in this family, other genetic alterations are likely to be present. PMID:21866214

  10. Landscape of somatic mutations in 560 breast cancer whole genome sequences

    PubMed Central

    Nik-Zainal, Serena; Davies, Helen; Staaf, Johan; Ramakrishna, Manasa; Glodzik, Dominik; Zou, Xueqing; Martincorena, Inigo; Alexandrov, Ludmil B.; Martin, Sancha; Wedge, David C.; Van Loo, Peter; Ju, Young Seok; Smid, Marcel; Brinkman, Arie B; Morganella, Sandro; Aure, Miriam R.; Lingjærde, Ole Christian; Langerød, Anita; Ringnér, Markus; Ahn, Sung-Min; Boyault, Sandrine; Brock, Jane E.; Broeks, Annegien; Butler, Adam; Desmedt, Christine; Dirix, Luc; Dronov, Serge; Fatima, Aquila; Foekens, John A.; Gerstung, Moritz; Hooijer, Gerrit KJ; Jang, Se Jin; Jones, David R.; Kim, Hyung-Yong; King, Tari A.; Krishnamurthy, Savitri; Lee, Hee Jin; Lee, Jeong-Yeon; Li, Yilong; McLaren, Stuart; Menzies, Andrew; Mustonen, Ville; O’Meara, Sarah; Pauporté, Iris; Pivot, Xavier; Purdie, Colin A.; Raine, Keiran; Ramakrishnan, Kamna; Rodríguez-González, F. Germán; Romieu, Gilles; Sieuwerts, Anieta M.; Simpson, Peter T; Shepherd, Rebecca; Stebbings, Lucy; Stefansson, Olafur A; Teague, Jon; Tommasi, Stefania; Treilleux, Isabelle; Van den Eynden, Gert G.; Vermeulen, Peter; Vincent-Salomon, Anne; Yates, Lucy; Caldas, Carlos; van’t Veer, Laura; Tutt, Andrew; Knappskog, Stian; Tan, Benita Kiat Tee; Jonkers, Jos; Borg, Åke; Ueno, Naoto T; Sotiriou, Christos; Viari, Alain; Futreal, P. Andrew; Campbell, Peter J; Span, Paul N.; Van Laere, Steven; Lakhani, Sunil R; Eyfjord, Jorunn E.; Thompson, Alastair M.; Birney, Ewan; Stunnenberg, Hendrik G; van de Vijver, Marc J; Martens, John W.M.; Børresen-Dale, Anne-Lise; Richardson, Andrea L.; Kong, Gu; Thomas, Gilles; Stratton, Michael R.

    2016-01-01

    We analysed whole genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. 93 protein-coding cancer genes carried likely driver mutations. Some non-coding regions exhibited high mutation frequencies but most have distinctive structural features probably causing elevated mutation rates and do not harbour driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed 12 base substitution and six rearrangement signatures. Three rearrangement signatures, characterised by tandem duplications or deletions, appear associated with defective homologous recombination based DNA repair: one with deficient BRCA1 function; another with deficient BRCA1 or BRCA2 function; the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operative, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer. PMID:27135926

  11. The complete mitochondrial genome of Gobiobotia filifer (Teleostei, Cypriniformes: Cyprinidae).

    PubMed

    Li, Qiang; Liu, Ya; Zhou, Jian; Gong, Quan; Li, Hua; Lai, Jiansheng; Li, Lianman

    2016-09-01

    The Gobiobotia filifer is a small economic fish which distributes in the upstream of Yangtze River and its distributaries. For the environmental pollution and overfishing, its population declined drastically in recent decades, so it is essential to protect its resource. In this study, the complete mitochondrial genome sequence of G. filifer was determined with PCR technology, which contains 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and a non-coding control region with the total length of 16,613 bp. The order and composition of genes were similar to most of the other teleost fish. Most of the genes were encoded on heavy strand, except for ND6 genes and eight tRNAs. Just like most other vertebrates, the bias of G and C has been found in different genes/regions. The complete mitochondrial genome sequence of G. filifer would contribute to better understand evolution of this lineage, population genetics, and will help administrative department to make rules and laws to protect this lineage.

  12. Low-coverage, whole-genome sequencing of Artocarpus camansi (Moraceae) for phylogenetic marker development and gene discovery1

    PubMed Central

    Gardner, Elliot M.; Johnson, Matthew G.; Ragone, Diane; Wickett, Norman J.; Zerega, Nyree J. C.

    2016-01-01

    Premise of the study: We used moderately low-coverage (17×) whole-genome sequencing of Artocarpus camansi (Moraceae) to develop genomic resources for Artocarpus and Moraceae. Methods and Results: A de novo assembly of Illumina short reads (251,378,536 pairs, 2 × 100 bp) accounted for 93% of the predicted genome size. Predicted coding regions were used in a three-way orthology search with published genomes of Morus notabilis and Cannabis sativa. Phylogenetic markers for Moraceae were developed from 333 inferred single-copy exons. Ninety-eight putative MADS-box genes were identified. Analysis of all predicted coding regions resulted in preliminary annotation of 49,089 genes. An analysis of synonymous substitutions for pairs of orthologs (Ks analysis) in M. notabilis and A. camansi strongly suggested a lineage-specific whole-genome duplication in Artocarpus. Conclusions: This study substantially increases the genomic resources available for Artocarpus and Moraceae and demonstrates the value of low-coverage de novo assemblies for nonmodel organisms with moderately large genomes. PMID:27437173

  13. The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

    PubMed

    Le Chevanton, L; Leblon, G

    1989-04-15

    We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

  14. Complete mitochondrial genome sequences of the northern spotted owl (Strix occidentalis caurina) and the barred owl (Strix varia; Aves: Strigiformes: Strigidae) confirm the presence of a duplicated control region

    PubMed Central

    Henderson, James B.; Sellas, Anna B.; Fuchs, Jérôme; Bowie, Rauri C.K.; Dumbacher, John P.

    2017-01-01

    We report here the successful assembly of the complete mitochondrial genomes of the northern spotted owl (Strix occidentalis caurina) and the barred owl (S. varia). We utilized sequence data from two sequencing methodologies, Illumina paired-end sequence data with insert lengths ranging from approximately 250 nucleotides (nt) to 9,600 nt and read lengths from 100–375 nt and Sanger-derived sequences. We employed multiple assemblers and alignment methods to generate the final assemblies. The circular genomes of S. o. caurina and S. varia are comprised of 19,948 nt and 18,975 nt, respectively. Both code for two rRNAs, twenty-two tRNAs, and thirteen polypeptides. They both have duplicated control region sequences with complex repeat structures. We were not able to assemble the control regions solely using Illumina paired-end sequence data. By fully spanning the control regions, Sanger-derived sequences enabled accurate and complete assembly of these mitochondrial genomes. These are the first complete mitochondrial genome sequences of owls (Aves: Strigiformes) possessing duplicated control regions. We searched the nuclear genome of S. o. caurina for copies of mitochondrial genes and found at least nine separate stretches of nuclear copies of gene sequences originating in the mitochondrial genome (Numts). The Numts ranged from 226–19,522 nt in length and included copies of all mitochondrial genes except tRNAPro, ND6, and tRNAGlu. Strix occidentalis caurina and S. varia exhibited an average of 10.74% (8.68% uncorrected p-distance) divergence across the non-tRNA mitochondrial genes. PMID:29038757

  15. Complete mitochondrial genome from South American catfish Pseudoplatystoma reticulatum (Eigenmann & Eigenmann) and its impact in Siluriformes phylogenetic tree.

    PubMed

    Villela, Luciana Cristine Vasques; Alves, Anderson Luis; Varela, Eduardo Sousa; Yamagishi, Michel Eduardo Beleza; Giachetto, Poliana Fernanda; da Silva, Naiara Milagres Augusto; Ponzetto, Josi Margarete; Paiva, Samuel Rezende; Caetano, Alexandre Rodrigues

    2017-02-01

    The cachara (Pseudoplatystoma reticulatum) is a Neotropical freshwater catfish from family Pimelodidae (Siluriformes) native to Brazil. The species is of relative economic importance for local aquaculture production and basic biological information is under development to help boost efforts to domesticate and raise the species in commercial systems. The complete cachara mitochondrial genome was obtained by assembling Illumina RNA-seq data from pooled samples. The full mitogenome was found to be 16,576 bp in length, showing the same basic structure, order, and genetic organization observed in other Pimelodidae, with 13 protein-coding genes, 2 rNA genes, 22 trNAs, and a control region. Observed base composition was 24.63% T, 28.47% C, 31.45% A, and 15.44% G. With the exception of NAD6 and eight tRNAs, all of the observed mitochondrial genes were found to be coded on the H strand. A total of 107 SNPs were identified in P. reticulatum mtDNA, 67 of which were located in coding regions. Of these SNPs, 10 result in amino acid changes. Analysis of the obtained sequence with 94 publicly available full Siluriformes mitogenomes resulted in a phylogenetic tree that generally agreed with available phylogenetic proposals for the order. The first report of the complete Pseudoplatystoma reticulatum mitochondrial genome sequence revealed general gene organization, structure, content, and order similar to most vertebrates. Specific sequence and content features were observed and may have functional attributes which are now available for further investigation.

  16. Parallel evolution of chordate cis-regulatory code for development.

    PubMed

    Doglio, Laura; Goode, Debbie K; Pelleri, Maria C; Pauls, Stefan; Frabetti, Flavia; Shimeld, Sebastian M; Vavouri, Tanya; Elgar, Greg

    2013-11-01

    Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs), yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C. intestinalis and C. savignyi to identify putative urochordate cis-regulatory sequences. Ciona conserved non-coding elements (ciCNEs) are associated with largely the same key regulatory genes as vertebrate CNEs. Furthermore, some of the tested ciCNEs are able to activate reporter gene expression in both zebrafish and Ciona embryos, in a pattern that at least partially overlaps that of the gene they associate with, despite the absence of sequence identity. We also show that the ability of a ciCNE to up-regulate gene expression in vertebrate embryos can in some cases be localised to short sub-sequences, suggesting that functional cross-talk may be defined by small regions of ancestral regulatory logic, although functional sub-sequences may also be dispersed across the whole element. We conclude that the structure and organisation of cis-regulatory modules is very different between vertebrates and urochordates, reflecting their separate evolutionary histories. However, functional cross-talk still exists because the same repertoire of transcription factors has likely guided their parallel evolution, exploiting similar sets of binding sites but in different combinations.

  17. The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

    PubMed Central

    Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

    1986-01-01

    The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

  18. Complete sequence and gene organization of the mitochondrial genome of Asio flammeus (Strigiformes, strigidae).

    PubMed

    Zhang, Yanan; Song, Tao; Pan, Tao; Sun, Xiaonan; Sun, Zhonglou; Qian, Lifu; Zhang, Baowei

    2016-07-01

    The complete sequence of the mitochondrial genome was determined for Asio flammeus, which is distributed widely in geography. The length of the complete mitochondrial genome was 18,966 bp, containing 2 rRNA genes, 22 tRNA genes, 13 protein-coding genes (PCGs), and 1 non-coding region (D-loop). All the genes were distributed on the H-strand, except for the ND6 subunit gene and eight tRNA genes which were encoded on the L-strand. The D-loop of A. flammeus contained many tandem repeats of varying lengths and repeat numbers. The molecular-based phylogeny showed that our species acted as the sister group to A. capensis and the supported Asio was the monophyletic group.

  19. Population genetic implications from sequence variation in four Y chromosome genes.

    PubMed

    Shen, P; Wang, F; Underhill, P A; Franco, C; Yang, W H; Roxas, A; Sung, R; Lin, A A; Hyman, R W; Vollrath, D; Davis, R W; Cavalli-Sforza, L L; Oefner, P J

    2000-06-20

    Some insight into human evolution has been gained from the sequencing of four Y chromosome genes. Primary genomic sequencing determined gene SMCY to be composed of 27 exons that comprise 4,620 bp of coding sequence. The unfinished sequencing of the 5' portion of gene UTY1 was completed by primer walking, and a total of 20 exons were found. By using denaturing HPLC, these two genes, as well as DBY and DFFRY, were screened for polymorphic sites in 53-72 representatives of the five continents. A total of 98 variants were found, yielding nucleotide diversity estimates of 2.45 x 10(-5), 5. 07 x 10(-5), and 8.54 x 10(-5) for the coding regions of SMCY, DFFRY, and UTY1, respectively, with no variant having been observed in DBY. In agreement with most autosomal genes, diversity estimates for the noncoding regions were about 2- to 3-fold higher and ranged from 9. 16 x 10(-5) to 14.2 x 10(-5) for the four genes. Analysis of the frequencies of derived alleles for all four genes showed that they more closely fit the expectation of a Luria-Delbrück distribution than a distribution expected under a constant population size model, providing evidence for exponential population growth. Pairwise nucleotide mismatch distributions date the occurrence of population expansion to approximately 28,000 years ago. This estimate is in accord with the spread of Aurignacian technology and the disappearance of the Neanderthals.

  20. The complete chloroplast genome of Gentiana straminea (Gentianaceae), an endemic species to the Sino-Himalayan subregion.

    PubMed

    Ni, Lianghong; Zhao, Zhili; Xu, Hongxi; Chen, Shilin; Dorje, Gaawe

    2016-02-15

    Endemic to the Sino-Himalayan subregion, the medicinal alpine plant Gentiana straminea is a threatened species. The genetic and molecular data about it is deficient. Here we report the complete chloroplast (cp) genome sequence of G. straminea, as the first sequenced member of the family Gentianaceae. The cp genome is 148,991bp in length, including a large single copy (LSC) region of 81,240bp, a small single copy (SSC) region of 17,085bp and a pair of inverted repeats (IRs) of 25,333bp. It contains 112 unique genes, including 78 protein-coding genes, 30 tRNAs and 4 rRNAs. The rps16 gene lacks exon2 between trnK-UUU and trnQ-UUG, which is the first rps16 pseudogene found in the nonparasitic plants of Asterids clade. Sequence analysis revealed the presence of 13 forward repeats, 13 palindrome repeats and 39 simple sequence repeats (SSRs). An entire cp genome comparison study of G. straminea and four other species in Gentianales was carried out. Phylogenetic analyses using maximum likelihood (ML) and maximum parsimony (MP) were performed based on 69 protein-coding genes from 36 species of Asterids. The results strongly supported the position of Gentianaceae as one member of the order Gentianales. The complete chloroplast genome sequence will provide intragenic information for its conservation and contribute to research on the genetic and phylogenetic analyses of Gentianales and Asterids. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. The complete chloroplast genome sequence of Dianthus superbus var. longicalycinus.

    PubMed

    Gurusamy, Raman; Lee, Do-Hyung; Park, SeonJoo

    2016-05-01

    The complete chloroplast genome (cpDNA) sequence of Dianthus superbus var. longicalycinus is an economically important traditional Chinese medicine was reported and characterized. The cpDNA of Dianthus superbus var. longicalycinus is 149,539 bp, with 36.3% GC content. A pair of inverted repeats (IRs) of 24,803 bp is separated by a large single-copy region (LSC, 82,805 bp) and a small single-copy region (SSC, 17,128 bp). It encodes 85 protein-coding genes, 36 tRNA genes and 8 rRNA genes. Of 129 individual genes, 13 genes encoded one intron and three genes have two introns.

  2. Complete chloroplast genome sequences of Drimys, Liriodendron, andPiper: Implications for the phylogeny of magnoliids and the evolution ofGC content

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhengqiu, C.; Penaflor, C.; Kuehl, J.V.

    2006-06-01

    The magnoliids represent the largest basal angiosperm clade with four orders, 19 families and 8,500 species. Although several recent angiosperm molecular phylogenies have supported the monophyly of magnoliids and suggested relationships among the orders, the limited number of genes examined resulted in only weak support, and these issues remain controversial. Furthermore, considerable incongruence has resulted in phylogenies supporting three different sets of relationships among magnoliids and the two large angiosperm clades, monocots and eudicots. This is one of the most important remaining issues concerning relationships among basal angiosperms. We sequenced the chloroplast genomes of three magnoliids, Drimys (Canellales), Liriodendron (Magnoliales),more » and Piper (Piperales), and used these data in combination with 32 other completed angiosperm chloroplast genomes to assess phylogenetic relationships among magnoliids. The Drimys and Piper chloroplast genomes are nearly identical in size at 160,606 and 160,624 bp, respectively. The genomes include a pair of inverted repeats of 26,649 bp (Drimys) and 27,039 (Piper), separated by a small single copy region of 18,621 (Drimys) and 18,878 (Piper) and a large single copy region of 88,685 bp (Drimys) and 87,666 bp (Piper). The gene order of both taxa is nearly identical to many other unrearranged angiosperm chloroplast genomes, including Calycanthus, the other published magnoliid genome. Comparisons of angiosperm chloroplast genomes indicate that GC content is not uniformly distributed across the genome. Overall GC content ranges from 34-39%, and coding regions have a substantially higher GC content than non-coding regions (both intergenic spacers and introns). Among protein-coding genes, GC content varies by codon position with 1st codon > 2nd codon > 3rd codon, and it varies by functional group with photosynthetic genes having the highest percentage and NADH genes the lowest. Across the genome, GC content is highest in the inverted repeat due to the presence of rRNA genes and lowest in the small single copy region where most NADH genes are located. Phylogenetic analyses using maximum parsimony and maximum likelihood methods were performed on DNA sequences of 61 protein-coding genes. Trees from both analyses provided strong support for the monophyly of magnoliids and two strongly supported groups were identified, the Canellales/Piperales and the Laurales/Magnoliales. The phylogenies also provided moderate to strong support for the basal position of Amborella, and a sister relationship of magnoliids to a clade that includes monocots and eudicots. The complete sequences of three magnoliid chloroplast genomes provide new data from the largest basal angiosperm clade. Evolutionary comparisons of these new genome sequences, combined with other published angiosperm genome, confirm that GC content is unevenly distributed across the genome by location, codon position, and functional group. Furthermore, phylogenetic analyses provide the strongest support so far for the hypothesis that the magnoliids are sister to a large clade that includes both monocots and eudicots.« less

  3. Complete Chloroplast Genome Sequences of Important Oilseed Crop Sesamum indicum L

    PubMed Central

    Yi, Dong-Keun; Kim, Ki-Joong

    2012-01-01

    Sesamum indicum is an important crop plant species for yielding oil. The complete chloroplast (cp) genome of S. indicum (GenBank acc no. JN637766) is 153,324 bp in length, and has a pair of inverted repeat (IR) regions consisting of 25,141 bp each. The lengths of the large single copy (LSC) and the small single copy (SSC) regions are 85,170 bp and 17,872 bp, respectively. Comparative cp DNA sequence analyses of S. indicum with other cp genomes reveal that the genome structure, gene order, gene and intron contents, AT contents, codon usage, and transcription units are similar to the typical angiosperm cp genomes. Nucleotide diversity of the IR region between Sesamum and three other cp genomes is much lower than that of the LSC and SSC regions in both the coding region and noncoding region. As a summary, the regional constraints strongly affect the sequence evolution of the cp genomes, while the functional constraints weakly affect the sequence evolution of cp genomes. Five short inversions associated with short palindromic sequences that form step-loop structures were observed in the chloroplast genome of S. indicum. Twenty-eight different simple sequence repeat loci have been detected in the chloroplast genome of S. indicum. Almost all of the SSR loci were composed of A or T, so this may also contribute to the A-T richness of the cp genome of S. indicum. Seven large repeated loci in the chloroplast genome of S. indicum were also identified and these loci are useful to developing S. indicum-specific cp genome vectors. The complete cp DNA sequences of S. indicum reported in this paper are prerequisite to modifying this important oilseed crop by cp genetic engineering techniques. PMID:22606240

  4. High-throughput sequencing of the entire genomic regions of CCM1/KRIT1, CCM2 and CCM3/PDCD10 to search for pathogenic deep-intronic splice mutations in cerebral cavernous malformations.

    PubMed

    Rath, Matthias; Jenssen, Sönke E; Schwefel, Konrad; Spiegler, Stefanie; Kleimeier, Dana; Sperling, Christian; Kaderali, Lars; Felbor, Ute

    2017-09-01

    Cerebral cavernous malformations (CCM) are vascular lesions of the central nervous system that can cause headaches, seizures and hemorrhagic stroke. Disease-associated mutations have been identified in three genes: CCM1/KRIT1, CCM2 and CCM3/PDCD10. The precise proportion of deep-intronic variants in these genes and their clinical relevance is yet unknown. Here, a long-range PCR (LR-PCR) approach for target enrichment of the entire genomic regions of the three genes was combined with next generation sequencing (NGS) to screen for coding and non-coding variants. NGS detected all six CCM1/KRIT1, two CCM2 and four CCM3/PDCD10 mutations that had previously been identified by Sanger sequencing. Two of the pathogenic variants presented here are novel. Additionally, 20 stringently selected CCM index cases that had remained mutation-negative after conventional sequencing and exclusion of copy number variations were screened for deep-intronic mutations. The combination of bioinformatics filtering and transcript analyses did not reveal any deep-intronic splice mutations in these cases. Our results demonstrate that target enrichment by LR-PCR combined with NGS can be used for a comprehensive analysis of the entire genomic regions of the CCM genes in a research context. However, its clinical utility is limited as deep-intronic splice mutations in CCM1/KRIT1, CCM2 and CCM3/PDCD10 seem to be rather rare. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Analysis and recognition of 5′ UTR intron splice sites in human pre-mRNA

    PubMed Central

    Eden, E.; Brunak, S.

    2004-01-01

    Prediction of splice sites in non-coding regions of genes is one of the most challenging aspects of gene structure recognition. We perform a rigorous analysis of such splice sites embedded in human 5′ untranslated regions (UTRs), and investigate correlations between this class of splice sites and other features found in the adjacent exons and introns. By restricting the training of neural network algorithms to ‘pure’ UTRs (not extending partially into protein coding regions), we for the first time investigate the predictive power of the splicing signal proper, in contrast to conventional splice site prediction, which typically relies on the change in sequence at the transition from protein coding to non-coding. By doing so, the algorithms were able to pick up subtler splicing signals that were otherwise masked by ‘coding’ noise, thus enhancing significantly the prediction of 5′ UTR splice sites. For example, the non-coding splice site predicting networks pick up compositional and positional bias in the 3′ ends of non-coding exons and 5′ non-coding intron ends, where cytosine and guanine are over-represented. This compositional bias at the true UTR donor sites is also visible in the synaptic weights of the neural networks trained to identify UTR donor sites. Conventional splice site prediction methods perform poorly in UTRs because the reading frame pattern is absent. The NetUTR method presented here performs 2–3-fold better compared with NetGene2 and GenScan in 5′ UTRs. We also tested the 5′ UTR trained method on protein coding regions, and discovered, surprisingly, that it works quite well (although it cannot compete with NetGene2). This indicates that the local splicing pattern in UTRs and coding regions is largely the same. The NetUTR method is made publicly available at www.cbs.dtu.dk/services/NetUTR. PMID:14960723

  6. The Comprehensive AOCMF Classification: Skull Base and Cranial Vault Fractures – Level 2 and 3 Tutorial

    PubMed Central

    Ieva, Antonio Di; Audigé, Laurent; Kellman, Robert M.; Shumrick, Kevin A.; Ringl, Helmut; Prein, Joachim; Matula, Christian

    2014-01-01

    The AOCMF Classification Group developed a hierarchical three-level craniomaxillofacial classification system with increasing level of complexity and details. The highest level 1 system distinguish four major anatomical units, including the mandible (code 91), midface (code 92), skull base (code 93), and cranial vault (code 94). This tutorial presents the level 2 and more detailed level 3 systems for the skull base and cranial vault units. The level 2 system describes fracture location outlining the topographic boundaries of the anatomic regions, considering in particular the endocranial and exocranial skull base surfaces. The endocranial skull base is divided into nine regions; a central skull base adjoining a left and right side are divided into the anterior, middle, and posterior skull base. The exocranial skull base surface and cranial vault are divided in regions defined by the names of the bones involved: frontal, parietal, temporal, sphenoid, and occipital bones. The level 3 system allows assessing fracture morphology described by the presence of fracture fragmentation, displacement, and bone loss. A documentation of associated intracranial diagnostic features is proposed. This tutorial is organized in a sequence of sections dealing with the description of the classification system with illustrations of the topographical skull base and cranial vault regions along with rules for fracture location and coding, a series of case examples with clinical imaging and a general discussion on the design of this classification. PMID:25489394

  7. The complete mitochondrial genome of Pomacea canaliculata (Gastropoda: Ampullariidae).

    PubMed

    Zhou, Xuming; Chen, Yu; Zhu, Shanliang; Xu, Haigen; Liu, Yan; Chen, Lian

    2016-01-01

    The mitochondrial genome of Pomacea canaliculata (Gastropoda: Ampullariidae) is the first complete mtDNA sequence reported in the genus Pomacea. The total length of mtDNA is 15,707 bp, which containing 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a 359 bp non-coding region. The A + T content of the overall base composition of H-strand is 71.7% (T: 41%, C: 12.7%, A: 30.7%, G: 15.6%). ATP6, ATP8, CO1, CO2, ND1-3, ND5, ND6, ND4L and Cyt b genes begin with ATG as start codon, CO3 and ND4 begin with ATA. ATP8, CO2-3, ND4L, ND2-6 and Cyt b genes are terminated with TAA as stop codon, ATP6, ND1, and CO1 end with TAG. A long non-coding region is found and a 23 bp repeat unit repeat 11 times in this region.

  8. DNA replication-timing analysis of human chromosome 22 at high resolution and different developmental states.

    PubMed

    White, Eric J; Emanuelsson, Olof; Scalzo, David; Royce, Thomas; Kosak, Steven; Oakeley, Edward J; Weissman, Sherman; Gerstein, Mark; Groudine, Mark; Snyder, Michael; Schübeler, Dirk

    2004-12-21

    Duplication of the genome during the S phase of the cell cycle does not occur simultaneously; rather, different sequences are replicated at different times. The replication timing of specific sequences can change during development; however, the determinants of this dynamic process are poorly understood. To gain insights into the contribution of developmental state, genomic sequence, and transcriptional activity to replication timing, we investigated the timing of DNA replication at high resolution along an entire human chromosome (chromosome 22) in two different cell types. The pattern of replication timing was correlated with respect to annotated genes, gene expression, novel transcribed regions of unknown function, sequence composition, and cytological features. We observed that chromosome 22 contains regions of early- and late-replicating domains of 100 kb to 2 Mb, many (but not all) of which are associated with previously described chromosomal bands. In both cell types, expressed sequences are replicated earlier than nontranscribed regions. However, several highly transcribed regions replicate late. Overall, the DNA replication-timing profiles of the two different cell types are remarkably similar, with only nine regions of difference observed. In one case, this difference reflects the differential expression of an annotated gene that resides in this region. Novel transcribed regions with low coding potential exhibit a strong propensity for early DNA replication. Although the cellular function of such transcripts is poorly understood, our results suggest that their activity is linked to the replication-timing program.

  9. Improving performance of DS-CDMA systems using chaotic complex Bernoulli spreading codes

    NASA Astrophysics Data System (ADS)

    Farzan Sabahi, Mohammad; Dehghanfard, Ali

    2014-12-01

    The most important goal of spreading spectrum communication system is to protect communication signals against interference and exploitation of information by unintended listeners. In fact, low probability of detection and low probability of intercept are two important parameters to increase the performance of the system. In Direct Sequence Code Division Multiple Access (DS-CDMA) systems, these properties are achieved by multiplying the data information in spreading sequences. Chaotic sequences, with their particular properties, have numerous applications in constructing spreading codes. Using one-dimensional Bernoulli chaotic sequence as spreading code is proposed in literature previously. The main feature of this sequence is its negative auto-correlation at lag of 1, which with proper design, leads to increase in efficiency of the communication system based on these codes. On the other hand, employing the complex chaotic sequences as spreading sequence also has been discussed in several papers. In this paper, use of two-dimensional Bernoulli chaotic sequences is proposed as spreading codes. The performance of a multi-user synchronous and asynchronous DS-CDMA system will be evaluated by applying these sequences under Additive White Gaussian Noise (AWGN) and fading channel. Simulation results indicate improvement of the performance in comparison with conventional spreading codes like Gold codes as well as similar complex chaotic spreading sequences. Similar to one-dimensional Bernoulli chaotic sequences, the proposed sequences also have negative auto-correlation. Besides, construction of complex sequences with lower average cross-correlation is possible with the proposed method.

  10. Identification of three novel NHS mutations in families with Nance-Horan syndrome.

    PubMed

    Huang, Kristen M; Wu, Junhua; Brooks, Simon P; Hardcastle, Alison J; Lewis, Richard Alan; Stambolian, Dwight

    2007-03-27

    Nance-Horan Syndrome (NHS) is an infrequent and often overlooked X-linked disorder characterized by dense congenital cataracts, microphthalmia, and dental abnormalities. The syndrome is caused by mutations in the NHS gene, whose function is not known. The purpose of this study was to identify the frequency and distribution of NHS gene mutations and compare genotype with Nance-Horan phenotype in five North American NHS families. Genomic DNA was isolated from white blood cells from NHS patients and family members. The NHS gene coding region and its splice site donor and acceptor regions were amplified from genomic DNA by PCR, and the amplicons were sequenced directly. We identified three unique NHS coding region mutations in these NHS families. This report extends the number of unique identified NHS mutations to 14.

  11. Theria-Specific Homeodomain and cis-Regulatory Element Evolution of the Dlx3–4 Bigene Cluster in 12 Different Mammalian Species

    PubMed Central

    SUMIYAMA, KENTA; MIYAKE, TSUTOMU; GRIMWOOD, JANE; STUART, ANDREW; DICKSON, MARK; SCHMUTZ, JEREMY; RUDDLE, FRANK H.; MYERS, RICHARD M.; AMEMIYA, CHRIS T.

    2013-01-01

    The mammalian Dlx3 and Dlx4 genes are configured as a bigene cluster, and their respective expression patterns are controlled temporally and spatially by cis-elements that largely reside within the intergenic region of the cluster. Previous work revealed that there are conspicuously conserved elements within the intergenic region of the Dlx3–4 bigene clusters of mouse and human. In this paper we have extended these analyses to include 12 additional mammalian taxa (including a marsupial and a monotreme) in order to better define the nature and molecular evolutionary trends of the coding and non-coding functional elements among morphologically divergent mammals. Dlx3–4 regions were fully sequenced from 12 divergent taxa of interest. We identified three theria-specific amino acid replacements in homeodomain of Dlx4 gene that functions in placenta. Sequence analyses of constrained nucleotide sites in the intergenic non-coding region showed that many of the intergenic conserved elements are highly conserved and have evolved slowly within the mammals. In contrast, a branchial arch/craniofacial enhancer I37-2 exhibited accelerated evolution at the branch between the monotreme and therian common ancestor despite being highly conserved among therian species. Functional analysis of I37-2 in transgenic mice has shown that the equivalent region of the platypus fails to drive transcriptional activity in branchial arches. These observations, taken together with our molecular evolutionary data, suggest that theria-specific episodic changes in the I37-2 element may have contributed to craniofacial innovation at the base of the mammalian lineage. PMID:22951979

  12. Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

    PubMed

    Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

    2017-09-11

    The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

  13. Molecular Cloning, Characterization, and Differential Expression of a Glucoamylase Gene from the Basidiomycetous Fungus Lentinula edodes

    PubMed Central

    Zhao, J.; Chen, Y. H.; Kwan, H. S.

    2000-01-01

    The complete nucleotide sequence of putative glucoamylase gene gla1 from the basidiomycetous fungus Lentinula edodes strain L54 is reported. The coding region of the genomic glucoamylase sequence, which is preceded by eukaryotic promoter elements CAAT and TATA, spans 2,076 bp. The gla1 gene sequence codes for a putative polypeptide of 571 amino acids and is interrupted by seven introns. The open reading frame sequence of the gla1 gene shows strong homology with those of other fungal glucoamylase genes and encodes a protein with an N-terminal catalytic domain and a C-terminal starch-binding domain. The similarity between the Gla1 protein and other fungal glucoamylases is from 45 to 61%, with the region of highest conservation found in catalytic domains and starch-binding domains. We compared the kinetics of glucoamylase activity and levels of gene expression in L. edodes strain L54 grown on different carbon sources (glucose, starch, cellulose, and potato extract) and in various developmental stages (mycelium growth, primordium appearance, and fruiting body formation). Quantitative reverse transcription PCR utilizing pairs of primers specific for gla1 gene expression shows that expression of gla1 was induced by starch and increased during the process of fruiting body formation, which indicates that glucoamylases may play an important role in the morphogenesis of the basidiomycetous fungus. PMID:10831434

  14. Non-coding-regulatory regions of human brain genes delineated by bacterial artificial chromosome knock-in mice.

    PubMed

    Schmouth, Jean-François; Castellarin, Mauro; Laprise, Stéphanie; Banks, Kathleen G; Bonaguro, Russell J; McInerny, Simone C; Borretta, Lisa; Amirabbasi, Mahsa; Korecki, Andrea J; Portales-Casamar, Elodie; Wilson, Gary; Dreolini, Lisa; Jones, Steven J M; Wasserman, Wyeth W; Goldowitz, Daniel; Holt, Robert A; Simpson, Elizabeth M

    2013-10-14

    The next big challenge in human genetics is understanding the 98% of the genome that comprises non-coding DNA. Hidden in this DNA are sequences critical for gene regulation, and new experimental strategies are needed to understand the functional role of gene-regulation sequences in health and disease. In this study, we build upon our HuGX ('high-throughput human genes on the X chromosome') strategy to expand our understanding of human gene regulation in vivo. In all, ten human genes known to express in therapeutically important brain regions were chosen for study. For eight of these genes, human bacterial artificial chromosome clones were identified, retrofitted with a reporter, knocked single-copy into the Hprt locus in mouse embryonic stem cells, and mouse strains derived. Five of these human genes expressed in mouse, and all expressed in the adult brain region for which they were chosen. This defined the boundaries of the genomic DNA sufficient for brain expression, and refined our knowledge regarding the complexity of gene regulation. We also characterized for the first time the expression of human MAOA and NR2F2, two genes for which the mouse homologs have been extensively studied in the central nervous system (CNS), and AMOTL1 and NOV, for which roles in CNS have been unclear. We have demonstrated the use of the HuGX strategy to functionally delineate non-coding-regulatory regions of therapeutically important human brain genes. Our results also show that a careful investigation, using publicly available resources and bioinformatics, can lead to accurate predictions of gene expression.

  15. Selective forces and mutational biases drive stop codon usage in the human genome: a comparison with sense codon usage.

    PubMed

    Trotta, Edoardo

    2016-05-17

    The three stop codons UAA, UAG, and UGA signal the termination of mRNA translation. As a result of a mechanism that is not adequately understood, they are normally used with unequal frequencies. In this work, we showed that selective forces and mutational biases drive stop codon usage in the human genome. We found that, in respect to sense codons, stop codon usage was affected by stronger selective forces but was less influenced by neutral mutational biases. UGA is the most frequent termination codon in human genome. However, UAA was the preferred stop codon in genes with high breadth of expression, high level of expression, AT-rich coding sequences, housekeeping functions, and in gene ontology categories with the largest deviation from expected stop codon usage. Selective forces associated with the breadth and the level of expression favoured AT-rich sequences in the mRNA region including the stop site and its proximal 3'-UTR, but acted with scarce effects on sense codons, generating two regions, upstream and downstream of the stop codon, with strongly different base composition. By favouring low levels of GC-content, selection promoted labile local secondary structures at the stop site and its proximal 3'-UTR. The compositional and structural context favoured by selection was surprisingly emphasized in the class of ribosomal proteins and was consistent with sequence elements that increase the efficiency of translational termination. Stop codons were also heterogeneously distributed among chromosomes by a mechanism that was strongly correlated with the GC-content of coding sequences. In human genome, the nucleotide composition and the thermodynamic stability of stop codon site and its proximal 3'-UTR are correlated with the GC-content of coding sequences and with the breadth and the level of gene expression. In highly expressed genes stop codon usage is compositionally and structurally consistent with highly efficient translation termination signals.

  16. Identification of a deep intronic mutation in the COL6A2 gene by a novel custom oligonucleotide CGH array designed to explore allelic and genetic heterogeneity in collagen VI-related myopathies

    PubMed Central

    2010-01-01

    Background Molecular characterization of collagen-VI related myopathies currently relies on standard sequencing, which yields a detection rate approximating 75-79% in Ullrich congenital muscular dystrophy (UCMD) and 60-65% in Bethlem myopathy (BM) patients as PCR-based techniques tend to miss gross genomic rearrangements as well as copy number variations (CNVs) in both the coding sequence and intronic regions. Methods We have designed a custom oligonucleotide CGH array in order to investigate the presence of CNVs in the coding and non-coding regions of COL6A1, A2, A3, A5 and A6 genes and a group of genes functionally related to collagen VI. A cohort of 12 patients with UCMD/BM negative at sequencing analysis and 2 subjects carrying a single COL6 mutation whose clinical phenotype was not explicable by inheritance were selected and the occurrence of allelic and genetic heterogeneity explored. Results A deletion within intron 1A of the COL6A2 gene, occurring in compound heterozygosity with a small deletion in exon 28, previously detected by routine sequencing, was identified in a BM patient. RNA studies showed monoallelic transcription of the COL6A2 gene, thus elucidating the functional effect of the intronic deletion. No pathogenic mutations were identified in the remaining analyzed patients, either within COL6A genes, or in genes functionally related to collagen VI. Conclusions Our custom CGH array may represent a useful complementary diagnostic tool, especially in recessive forms of the disease, when only one mutant allele is detected by standard sequencing. The intronic deletion we identified represents the first example of a pure intronic mutation in COL6A genes. PMID:20302629

  17. Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

    PubMed Central

    Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

    1993-01-01

    A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

  18. A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes

    PubMed Central

    Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

    2016-01-01

    The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including “codon capture,” “genome streamlining,” and “ambiguous intermediate” theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNAAla containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. PMID:27197221

  19. The phylogenomic position of the grey nurse shark Carcharias taurus Rafinesque, 1810 (Lamniformes, Odontaspididae) inferred from the mitochondrial genome.

    PubMed

    Bowden, Deborah L; Vargas-Caro, Carolina; Ovenden, Jennifer R; Bennett, Michael B; Bustamante, Carlos

    2016-11-01

    The complete mitochondrial genome of the grey nurse shark Carcharias taurus is described from 25 963 828 sequences obtained using Illumina NGS technology. Total length of the mitogenome is 16 715 bp, consisting of 2 rRNAs, 13 protein-coding regions, 22 tRNA and 2 non-coding regions thus updating the previously published mitogenome for this species. The phylogenomic reconstruction inferred from the mitogenome of 15 species of Lamniform and Carcharhiniform sharks supports the inclusion of C. taurus in a clade with the Lamnidae and Cetorhinidae. This complete mitogenome contributes to ongoing investigation into the monophyly of the Family Odontaspididae.

  20. Complete mitochondrial genome of Cynopterus sphinx (Pteropodidae: Cynopterus).

    PubMed

    Li, Linmiao; Li, Min; Wu, Zhengjun; Chen, Jinping

    2015-01-01

    We have characterized the complete mitochondrial genome of Cynopterus sphinx (Pteropodidae: Cynopterus) and described its organization in this study. The total length of C. sphinx complete mitochondrial genome was 16,895 bp with the base composition of 32.54% A, 14.05% G, 25.82% T and 27.59% C. The complete mitochondrial genome included 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes (12S rRNA and 16S rRNA) and 1 control region (D-loop). The control region was 1435 bp long with the sequence CATACG repeat 64 times. Three protein-coding genes (ND1, COI and ND4) were ended with incomplete stop codon TA or T.

  1. The complete chloroplast genome sequence of Chikusichloa aquatica (Poaceae: Oryzeae).

    PubMed

    Zhang, Jie; Zhang, Dan; Shi, Chao; Gao, Ju; Gao, Li-Zhi

    2016-07-01

    The complete chloroplast sequence of the Chikusichloa aquatica was determined in this study. The genome consists of 136 563 bp containing a pair of inverted repeats (IRs) of 20 837 bp, which was separated by a large single-copy region and a small single-copy region of 82 315 bp and 33 411 bp, respectively. The C. aquatica cp genome encodes 111 functional genes (71 protein-coding genes, four rRNA genes, and 36 tRNA genes): 92 are unique, while 19 are duplicated in the IR regions. The genic regions account for 58.9% of whole cp genome, and the GC content of the plastome is 39.0%. A phylogenomic analysis showed that C. aquatica is closely related to Rhynchoryza subulata that belongs to the tribe Oryzeae.

  2. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    PubMed

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was shared by mitochondrial genomes of CMS and male-fertile pepper lines, extensive genome rearrangements were detected. CMS candidate genes located on the edges of highly-rearranged CMS-specific DNA regions and near to repeat sequences. These characteristics were detected among CMS-associated genes in other species, implying a common mechanism might be involved in the evolution of CMS-associated genes.

  3. Genetic diversity of Histoplasma and Sporothrix complexes based on sequences of their ITS1-5.8S-ITS2 regions from the BOLD System.

    PubMed

    Estrada-Bárcenas, Daniel Alfonso; Vite-Garín, Tania; Navarro-Barranco, Hortensia; de la Torre-Arciniega, Raúl; Pérez-Mejía, Amelia; Rodríguez-Arellanes, Gabriela; Ramirez, Jose Antonio; Humberto Sahaza, Jorge; Taylor, Maria Lucia; Toriello, Conchita

    2014-01-01

    High sensitivity and specificity of molecular biology techniques have proven usefulness for the detection, identification and typing of different pathogens. The ITS (Internal Transcribed Spacer) regions of the ribosomal DNA are highly conserved non-coding regions, and have been widely used in different studies including the determination of the genetic diversity of human fungal pathogens. This article wants to contribute to the understanding of the intra- and interspecific genetic diversity of isolates of the Histoplasma capsulatum and Sporothrix schenckii species complexes by an analysis of the available sequences of the ITS regions from different sequence databases. ITS1-5.8S-ITS2 sequences of each fungus, either deposited in GenBank, or from our research groups (registered in the Fungi Barcode of Life Database), were analyzed using the maximum likelihood (ML) method. ML analysis of the ITS sequences discriminated isolates from distant geographic origins and particular wild hosts, depending on the fungal species analyzed. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  4. A sequence-based genetic map of Medicago truncatula and comparison of marker colinearity with M. sativa.

    PubMed Central

    Choi, Hong-Kyu; Kim, Dongjin; Uhm, Taesik; Limpens, Eric; Lim, Hyunju; Mun, Jeong-Hwan; Kalo, Peter; Penmetsa, R Varma; Seres, Andrea; Kulikova, Olga; Roe, Bruce A; Bisseling, Ton; Kiss, Gyorgy B; Cook, Douglas R

    2004-01-01

    A core genetic map of the legume Medicago truncatula has been established by analyzing the segregation of 288 sequence-characterized genetic markers in an F(2) population composed of 93 individuals. These molecular markers correspond to 141 ESTs, 80 BAC end sequence tags, and 67 resistance gene analogs, covering 513 cM. In the case of EST-based markers we used an intron-targeted marker strategy with primers designed to anneal in conserved exon regions and to amplify across intron regions. Polymorphisms were significantly more frequent in intron vs. exon regions, thus providing an efficient mechanism to map transcribed genes. Genetic and cytogenetic analysis produced eight well-resolved linkage groups, which have been previously correlated with eight chromosomes by means of FISH with mapped BAC clones. We anticipated that mapping of conserved coding regions would have utility for comparative mapping among legumes; thus 60 of the EST-based primer pairs were designed to amplify orthologous sequences across a range of legume species. As an initial test of this strategy, we used primers designed against M. truncatula exon sequences to rapidly map genes in M. sativa. The resulting comparative map, which includes 68 bridging markers, indicates that the two Medicago genomes are highly similar and establishes the basis for a Medicago composite map. PMID:15082563

  5. Sequencing of emerging canine distemper virus strain reveals new distinct genetic lineage in the United States associated with disease in wildlife and domestic canine populations.

    PubMed

    Riley, Matthew C; Wilkes, Rebecca P

    2015-12-18

    Recent outbreaks of canine distemper have prompted examination of strains from clinical samples submitted to the University of Tennessee College of Veterinary Medicine (UTCVM) Clinical Virology Lab. We previously described a new strain of CDV that significantly diverged from all genotypes reported to date including America 2, the genotype proposed to be the main lineage currently circulating in the US. The aim of this study was to determine when this new strain appeared and how widespread it is in animal populations, given that it has also been detected in fully vaccinated adult dogs. Additionally, we sequenced complete viral genomes to characterize the strain and determine if variation is confined to known variable regions of the genome or if the changes are also present in more conserved regions. Archived clinical samples were genotyped using real-time RT-PCR amplification and sequencing. The genomes of two unrelated viruses from a dog and fox each from a different state were sequenced and aligned with previously published genomes. Phylogenetic analysis was performed using coding, non-coding and genome-length sequences. Virus neutralization assays were used to evaluate potential antigenic differences between this strain and a vaccine strain and mixed ANOVA test was used to compare the titers. Genotyping revealed this strain first appeared in 2011 and was detected in dogs from multiple states in the Southeast region of the United States. It was the main strain detected among the clinical samples that were typed from 2011-2013, including wildlife submissions. Genome sequencing demonstrated that it is highly conserved within a new lineage and preliminary serologic testing showed significant differences in neutralizing antibody titers between this strain and the strain commonly used in vaccines. This new strain represents an emerging CDV in domestic dogs in the US, may be associated with a stable reservoir in the wildlife population, and could facilitate vaccine escape.

  6. [Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

    PubMed

    Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

    2012-01-01

    Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

  7. Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

    PubMed

    Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

    1988-04-01

    The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

  8. Informational structure of genetic sequences and nature of gene splicing

    NASA Astrophysics Data System (ADS)

    Trifonov, E. N.

    1991-10-01

    Only about 1/20 of DNA of higher organisms codes for proteins, by means of classical triplet code. The rest of DNA sequences is largely silent, with unclear functions, if any. The triplet code is not the only code (message) carried by the sequences. There are three levels of molecular communication, where the same sequence ``talks'' to various bimolecules, while having, respectively, three different appearances: DNA, RNA and protein. Since the molecular structures and, hence, sequence specific preferences of these are substantially different, the original DNA sequence has to carry simultaneously three types of sequence patterns (codes, messages), thus, being a composite structure in which one had the same letter (nucleotide) is frequently involved in several overlapping codes of different nature. This multiplicity and overlapping of the codes is a unique feature of the Gnomic, language of genetic sequences. The coexisting codes have to be degenerate in various degrees to allow an optimal and concerted performance of all the encoded functions. There is an obvious conflict between the best possible performance of a given function and necessity to compromise the quality of a given sequence pattern in favor of other patterns. It appears that the major role of various changes in the sequences on their ``ontogenetic'' way from DNA to RNA to protein, like RNA editing and splicing, or protein post-translational modifications is to resolve such conflicts. New data are presented strongly indicating that the gene splicing is such a device to resolve the conflict between the code of DNA folding in chromatin and the triplet code for protein synthesis.

  9. The first complete chloroplast genome of the Genistoid legume Lupinus luteus: evidence for a novel major lineage-specific rearrangement and new insights regarding plastome evolution in the legume family

    PubMed Central

    Martin, Guillaume E.; Rousseau-Gueutin, Mathieu; Cordonnier, Solenn; Lima, Oscar; Michon-Coudouel, Sophie; Naquin, Delphine; de Carvalho, Julie Ferreira; Aïnouche, Malika; Salmon, Armel; Aïnouche, Abdelkader

    2014-01-01

    Background and Aims To date chloroplast genomes are available only for members of the non-protein amino acid-accumulating clade (NPAAA) Papilionoid lineages in the legume family (i.e. Millettioids, Robinoids and the ‘inverted repeat-lacking clade’, IRLC). It is thus very important to sequence plastomes from other lineages in order to better understand the unusual evolution observed in this model flowering plant family. To this end, the plastome of a lupine species, Lupinus luteus, was sequenced to represent the Genistoid lineage, a noteworthy but poorly studied legume group. Methods The plastome of L. luteus was reconstructed using Roche-454 and Illumina next-generation sequencing. Its structure, repetitive sequences, gene content and sequence divergence were compared with those of other Fabaceae plastomes. PCR screening and sequencing were performed in other allied legumes in order to determine the origin of a large inversion identified in L. luteus. Key Results The first sequenced Genistoid plastome (L. luteus: 155 894 bp) resulted in the discovery of a 36-kb inversion, embedded within the already known 50-kb inversion in the large single-copy (LSC) region of the Papilionoideae. This inversion occurs at the base or soon after the Genistoid emergence, and most probably resulted from a flip–flop recombination between identical 29-bp inverted repeats within two trnS genes. Comparative analyses of the chloroplast gene content of L. luteus vs. Fabaceae and extra-Fabales plastomes revealed the loss of the plastid rpl22 gene, and its functional relocation to the nucleus was verified using lupine transcriptomic data. An investigation into the evolutionary rate of coding and non-coding sequences among legume plastomes resulted in the identification of remarkably variable regions. Conclusions This study resulted in the discovery of a novel, major 36-kb inversion, specific to the Genistoids. Chloroplast mutational hotspots were also identified, which contain novel and potentially informative regions for molecular evolutionary studies at various taxonomic levels in the legumes. Taken together, the results provide new insights into the evolutionary landscape of the legume plastome. PMID:24769537

  10. The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsugu, H.; Horowitz, R.; Gibson, N.

    1994-12-01

    Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

  11. Genomic organization of human fetal specific P-450IIIA7 (cytochrome P-450HFLa)-related gene(s) and interaction of transcriptional regulatory factor with its DNA element in the 5' flanking region.

    PubMed

    Itoh, S; Yanagimoto, T; Tagawa, S; Hashimoto, H; Kitamura, R; Nakajima, Y; Okochi, T; Fujimoto, S; Uchino, J; Kamataki, T

    1992-03-24

    P-450IIIA7 is a form of cytochrome P-450 which was isolated from human fetal livers and termed P-450HFLa. This form has been clarified to be expressed during fetal life specifically (Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. and Kamataki, T. (1990) Biochemistry 29, 4430-4433). In the present study, we isolated five independent clones which probably corresponded to the human P-450IIIA7 gene. These clones were completely sequenced, all exons, exon-intron junctions and the 5' flanking region from the cap site to-869. Although the sequences in the coding region were completely identical to P-450IIIA7, it is possible that genomic fragments sequenced in this study encode portions of other P-450IIIA7-related genes since we could not obtain a complete overlapping set of genomic clones. Within its 5' flanking sequence, the putative binding sites of several transcriptional regulatory factors existed. Among them, it was shown that a basic transcription element binding factor (BTEB) actually interacted with the 5' flanking region of this gene.

  12. Understanding Neurodevelopmental Disorders: The Promise of Regulatory Variation in the 3'UTRome.

    PubMed

    Wanke, Kai A; Devanna, Paolo; Vernes, Sonja C

    2018-04-01

    Neurodevelopmental disorders have a strong genetic component, but despite widespread efforts, the specific genetic factors underlying these disorders remain undefined for a large proportion of affected individuals. Given the accessibility of exome sequencing, this problem has thus far been addressed from a protein-centric standpoint; however, protein-coding regions only make up ∼1% to 2% of the human genome. With the advent of whole genome sequencing we are in the midst of a paradigm shift as it is now possible to interrogate the entire sequence of the human genome (coding and noncoding) to fill in the missing heritability of complex disorders. These new technologies bring new challenges, as the number of noncoding variants identified per individual can be overwhelming, making it prudent to focus on noncoding regions of known function, for which the effects of variation can be predicted and directly tested to assess pathogenicity. The 3'UTRome is a region of the noncoding genome that perfectly fulfills these criteria and is of high interest when searching for pathogenic variation related to complex neurodevelopmental disorders. Herein, we review the regulatory roles of the 3'UTRome as binding sites for microRNAs or RNA binding proteins, or during alternative polyadenylation. We detail existing evidence that these regions contribute to neurodevelopmental disorders and outline strategies for identification and validation of novel putatively pathogenic variation in these regions. This evidence suggests that studying the 3'UTRome will lead to the identification of new risk factors, new candidate disease genes, and a better understanding of the molecular mechanisms contributing to neurodevelopmental disorders. Copyright © 2017 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  13. Genetic Code Analysis Toolkit: A novel tool to explore the coding properties of the genetic code and DNA sequences

    NASA Astrophysics Data System (ADS)

    Kraljić, K.; Strüngmann, L.; Fimmel, E.; Gumbel, M.

    2018-01-01

    The genetic code is degenerated and it is assumed that redundancy provides error detection and correction mechanisms in the translation process. However, the biological meaning of the code's structure is still under current research. This paper presents a Genetic Code Analysis Toolkit (GCAT) which provides workflows and algorithms for the analysis of the structure of nucleotide sequences. In particular, sets or sequences of codons can be transformed and tested for circularity, comma-freeness, dichotomic partitions and others. GCAT comes with a fertile editor custom-built to work with the genetic code and a batch mode for multi-sequence processing. With the ability to read FASTA files or load sequences from GenBank, the tool can be used for the mathematical and statistical analysis of existing sequence data. GCAT is Java-based and provides a plug-in concept for extensibility. Availability: Open source Homepage:http://www.gcat.bio/

  14. Hidden Structural Codes in Protein Intrinsic Disorder.

    PubMed

    Borkosky, Silvia S; Camporeale, Gabriela; Chemes, Lucía B; Risso, Marikena; Noval, María Gabriela; Sánchez, Ignacio E; Alonso, Leonardo G; de Prat Gay, Gonzalo

    2017-10-17

    Intrinsic disorder is a major structural category in biology, accounting for more than 30% of coding regions across the domains of life, yet consists of conformational ensembles in equilibrium, a major challenge in protein chemistry. Anciently evolved papillomavirus genomes constitute an unparalleled case for sequence to structure-function correlation in cases in which there are no folded structures. E7, the major transforming oncoprotein of human papillomaviruses, is a paradigmatic example among the intrinsically disordered proteins. Analysis of a large number of sequences of the same viral protein allowed for the identification of a handful of residues with absolute conservation, scattered along the sequence of its N-terminal intrinsically disordered domain, which intriguingly are mostly leucine residues. Mutation of these led to a pronounced increase in both α-helix and β-sheet structural content, reflected by drastic effects on equilibrium propensities and oligomerization kinetics, and uncovers the existence of local structural elements that oppose canonical folding. These folding relays suggest the existence of yet undefined hidden structural codes behind intrinsic disorder in this model protein. Thus, evolution pinpoints conformational hot spots that could have not been identified by direct experimental methods for analyzing or perturbing the equilibrium of an intrinsically disordered protein ensemble.

  15. The complete mitochondrial genome of Rapana venosa (Gastropoda, Muricidae).

    PubMed

    Sun, Xiujun; Yang, Aiguo

    2016-01-01

    The complete mitochondrial (mt) genome of the veined rapa whelk, Rapana venosa, was determined using genome walking techniques in this study. The total length of the mt genome sequence of R. venosa was 15,271 bp, which is comparable to the reported Muricidae mitogenomes to date. It contained 13 protein-coding genes, 21 transfer RNA genes, and two ribosomal RNA genes. A bias towards a higher representation of nucleotides A and T (69%) was detected in the mt genome of R. venosa. A small number of non-coding nucleotides (302 bp) was detected, and the largest non-coding region was 74 bp in length.

  16. DROP: Detecting Return-Oriented Programming Malicious Code

    NASA Astrophysics Data System (ADS)

    Chen, Ping; Xiao, Hai; Shen, Xiaobin; Yin, Xinchun; Mao, Bing; Xie, Li

    Return-Oriented Programming (ROP) is a new technique that helps the attacker construct malicious code mounted on x86/SPARC executables without any function call at all. Such technique makes the ROP malicious code contain no instruction, which is different from existing attacks. Moreover, it hides the malicious code in benign code. Thus, it circumvents the approaches that prevent control flow diversion outside legitimate regions (such as W ⊕ X ) and most malicious code scanning techniques (such as anti-virus scanners). However, ROP has its own intrinsic feature which is different from normal program design: (1) uses short instruction sequence ending in "ret", which is called gadget, and (2) executes the gadgets contiguously in specific memory space, such as standard GNU libc. Based on the features of the ROP malicious code, in this paper, we present a tool DROP, which is focused on dynamically detecting ROP malicious code. Preliminary experimental results show that DROP can efficiently detect ROP malicious code, and have no false positives and negatives.

  17. Exome capture from the spruce and pine giga-genomes.

    PubMed

    Suren, H; Hodgins, K A; Yeaman, S; Nurkowski, K A; Smets, P; Rieseberg, L H; Aitken, S N; Holliday, J A

    2016-09-01

    Sequence capture is a flexible tool for generating reduced representation libraries, particularly in species with massive genomes. We used an exome capture approach to sequence the gene space of two of the dominant species in Canadian boreal and montane forests - interior spruce (Picea glauca x engelmanii) and lodgepole pine (Pinus contorta). Transcriptome data generated with RNA-seq were coupled with draft genome sequences to design baits corresponding to 26 824 genes from pine and 28 649 genes from spruce. A total of 579 samples for spruce and 631 samples for pine were included, as well as two pine congeners and six spruce congeners. More than 50% of targeted regions were sequenced at >10× depth in each species, while ~12% captured near-target regions within 500 bp of a bait position were sequenced to a depth >10×. Much of our read data arose from off-target regions, which was likely due to the fragmented and incomplete nature of the draft genome assemblies. Capture in general was successful for the related species, suggesting that baits designed for a single species are likely to successfully capture sequences from congeners. From these data, we called approximately 10 million SNPs and INDELs in each species from coding regions, introns, untranslated and flanking regions, as well as from the intergenic space. Our study demonstrates the utility of sequence capture for resequencing in complex conifer genomes, suggests guidelines for improving capture efficiency and provides a rich resource of genetic variants for studies of selection and local adaptation in these species. © 2016 John Wiley & Sons Ltd.

  18. kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets

    PubMed Central

    Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.

    2013-01-01

    Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org. PMID:23771147

  19. kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets.

    PubMed

    Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S; Beer, Michael A

    2013-07-01

    Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167-80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org.

  20. SEQassembly: A Practical Tools Program for Coding Sequences Splicing

    NASA Astrophysics Data System (ADS)

    Lee, Hongbin; Yang, Hang; Fu, Lei; Qin, Long; Li, Huili; He, Feng; Wang, Bo; Wu, Xiaoming

    CDS (Coding Sequences) is a portion of mRNA sequences, which are composed by a number of exon sequence segments. The construction of CDS sequence is important for profound genetic analysis such as genotyping. A program in MATLAB environment is presented, which can process batch of samples sequences into code segments under the guide of reference exon models, and splice these code segments of same sample source into CDS according to the exon order in queue file. This program is useful in transcriptional polymorphism detection and gene function study.

  1. Differentiation of Populus species using chloroplast single nucleotide polymorphism (SNP) markers--essential for comprehensible and reliable poplar breeding.

    PubMed

    Schroeder, H; Hoeltken, A M; Fladung, M

    2012-03-01

    Within the genus Populus several species belonging to different sections are cross-compatible. Hence, high numbers of interspecies hybrids occur naturally and, additionally, have been artificially produced in huge breeding programmes during the last 100 years. Therefore, determination of a single poplar species, used for the production of 'multi-species hybrids' is often difficult, and represents a great challenge for the use of molecular markers in species identification. Within this study, over 20 chloroplast regions, both intergenic spacers and coding regions, have been tested for their ability to differentiate different poplar species using 23 already published barcoding primer combinations and 17 newly designed primer combinations. About half of the published barcoding primers yielded amplification products, whereas the new primers designed on the basis of the total sequenced cpDNA genome of Populus trichocarpa Torr. & Gray yielded much higher amplification success. Intergenic spacers were found to be more variable than coding regions within the genus Populus. The highest discrimination power of Populus species was found in the combination of two intergenic spacers (trnG-psbK, psbK-psbl) and the coding region rpoC. In barcoding projects, the coding regions matK and rbcL are often recommended, but within the genus Populus they only show moderate variability and are not efficient in species discrimination. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

  2. Analysis of variable sites between two complete South China tiger (Panthera tigris amoyensis) mitochondrial genomes.

    PubMed

    Zhang, Wenping; Yue, Bisong; Wang, Xiaofang; Zhang, Xiuyue; Xie, Zhong; Liu, Nonglin; Fu, Wenyuan; Yuan, Yaohua; Chen, Daqing; Fu, Danghua; Zhao, Bo; Yin, Yuzhong; Yan, Xiahui; Wang, Xinjing; Zhang, Rongying; Liu, Jie; Li, Maoping; Tang, Yao; Hou, Rong; Zhang, Zhihe

    2011-10-01

    In order to investigate the mitochondrial genome of Panthera tigris amoyensis, two South China tigers (P25 and P27) were analyzed following 15 cymt-specific primer sets. The entire mtDNA sequence was found to be 16,957 bp and 17,001 bp long for P25 and P27 respectively, and this difference in length between P25 and P27 occurred in the number of tandem repeats in the RS-3 segment of the control region. The structural characteristics of complete P. t. amoyensis mitochondrial genomes were also highly similar to those of P. uncia. Additionally, the rate of point mutation was only 0.3% and a total of 59 variable sites between P25 and P27 were found. Out of the 59 variable sites, 6 were located in 6 different tRNA genes, 6 in the 2 rRNA genes, 7 in non-coding regions (one located between tRNA-Asn and tRNA-Tyr and six in the D-loop), and 40 in 10 protein-coding genes. COI held the largest amount of variable sites (9 sites) and Cytb contained the highest variable rate (0.7%) in the complete sequences. Moreover, out of the 40 variable sites located in 10 protein-coding genes, 12 sites were nonsynonymous.

  3. Transcriptional mapping of the ribosomal RNA region of mouse L-cell mitochondrial DNA.

    PubMed Central

    Nagley, P; Clayton, D A

    1980-01-01

    The map positions in mouse mitochondrial DNA of the two ribosomal RNA genes and adjacent genes coding several small transcripts have been determined precisely by application of a procedure in which DNA-RNA hybrids have been subjected to digestion by S1 nuclease under conditions of varying severity. Digestion of the DNA-RNA hybrids with S1 nuclease yielded a series of species which were shown to contain ribosomal RNA molecules together with adjacent transcripts hybridized conjointly to a continuous segment of mitochondrial DNA. There is one small transcript about 60 bases long whose gene adjoins the sequences coding the 5'-end of the small ribosomal RNA (950 bases) and which lies approximately 200 nucleotides from the D-loop origin of heavy strand mitochondrial DNA synthesis. An 80-base transcript lies between the small and large ribosomal RNA genes, and genes for two further short transcript (each about 80 bases in length) abut the sequences coding the 3'-end of the large ribosomal RNA (approximately 1500 bases). The ability to isolate a discrete DNA-RNA hybrid species approximately 2700 base pairs in length containing all these transcripts suggests that there can be few nucleotides in this region of mouse mitochondrial DNA which are not represented as stable RNA species. Images PMID:6253898

  4. Transterm—extended search facilities and improved integration with other databases

    PubMed Central

    Jacobs, Grant H.; Stockwell, Peter A.; Tate, Warren P.; Brown, Chris M.

    2006-01-01

    Transterm has now been publicly available for >10 years. Major changes have been made since its last description in this database issue in 2002. The current database provides data for key regions of mRNA sequences, a curated database of mRNA motifs and tools to allow users to investigate their own motifs or mRNA sequences. The key mRNA regions database is derived computationally from Genbank. It contains 3′ and 5′ flanking regions, the initiation and termination signal context and coding sequence for annotated CDS features from Genbank and RefSeq. The database is non-redundant, enabling summary files and statistics to be prepared for each species. Advances include providing extended search facilities, the database may now be searched by BLAST in addition to regular expressions (patterns) allowing users to search for motifs such as known miRNA sequences, and the inclusion of RefSeq data. The database contains >40 motifs or structural patterns important for translational control. In this release, patterns from UTRsite and Rfam are also incorporated with cross-referencing. Users may search their sequence data with Transterm or user-defined patterns. The system is accessible at . PMID:16381889

  5. Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing.

    PubMed

    Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean

    2003-08-01

    A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.

  6. Complete genome sequences of two highly divergent Japanese isolates of Plantago asiatica mosaic virus.

    PubMed

    Komatsu, Ken; Yamashita, Kazuo; Sugawara, Kota; Verbeek, Martin; Fujita, Naoko; Hanada, Kaoru; Uehara-Ichiki, Tamaki; Fuji, Shin-Ichi

    2017-02-01

    Plantago asiatica mosaic virus (PlAMV) is a member of the genus Potexvirus and has an exceptionally wide host range. It causes severe damage to lilies. Here we report on the complete nucleotide sequences of two new Japanese PlAMV isolates, one from the eudicot weed Viola grypoceras (PlAMV-Vi), and the other from the eudicot shrub Nandina domestica Thunb. (PlAMV-NJ). Their genomes contain five open reading frames (ORFs), which is characteristic of potexviruses. Surprisingly, the isolates showed only 76.0-78.0 % sequence identity with each other and with other PlAMV isolates, including isolates from Japanese lily and American nandina. Amino acid alignments of the replicase coding region encoded by ORF1 showed that the regions between the methyltransferase and helicase domains were less conserved than other regions, with several insertions and/or deletions. Phylogenetic analyses of the full-length nucleotide sequences revealed a moderate correlation between phylogenetic clustering and the original host plants of the PlAMV isolates. This study revealed the presence of two highly divergent PlAMV isolates in Japan.

  7. Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

    PubMed

    Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

    1996-02-01

    A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

  8. The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome.

    PubMed

    Kim, K S; Lee, S E; Jeong, H W; Ha, J H

    1998-10-01

    The complete nucleotide sequence of the mitochondrial genome of the domestic dog, Canis familiaris, was determined. The length of the sequence was 16,728 bp; however, the length was not absolute due to the variation (heteroplasmy) caused by differing numbers of the repetitive motif, 5'-GTACACGT(A/G)C-3', in the control region. The genome organization, gene contents, and codon usage conformed to those of other mammalian mitochondrial genomes. Although its features were unknown, the "CTAGA" duplication event which followed the translational stop codon of the COII gene was not observed in other mammalian mitochondrial genomes. In order to determine the possible differences between mtDNAs in carnivores, two rRNA and 13 protein-coding genes from the cat, dog, and seal were compared. The combined molecular differences, in two rRNA genes as well as in the inferred amino acid sequences of the mitochondrial 13 protein-coding genes, suggested that there is a closer relationship between the dog and the seal than there is between either of these species and the cat. Based on the molecular differences of the mtDNA, the evolutionary divergence between the cat, the dog, and the seal was dated to approximately 50 +/- 4 million years ago. The degree of difference between carnivore mtDNAs varied according to the individual protein-coding gene applied, showing that the evolutionary relationships of distantly related species should be presented in an extended study based on ample sequence data like complete mtDNA molecules. Copyright 1998 Academic Press.

  9. Cellulases and coding sequences

    DOEpatents

    Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

    2001-02-20

    The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.

  10. Cellulases and coding sequences

    DOEpatents

    Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

    2001-01-01

    The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.

  11. A comprehensive analysis of three Asiatic black bear mitochondrial genomes (subspecies ussuricus, formosanus and mupinensis), with emphasis on the complete mtDNA sequence of Ursus thibetanus ussuricus (Ursidae).

    PubMed

    Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong

    2008-08-01

    In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.

  12. Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

    PubMed

    Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

    2007-06-01

    As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

  13. The flaA locus of Bacillus subtilis is part of a large operon coding for flagellar structures, motility functions, and an ATPase-like polypeptide.

    PubMed Central

    Albertini, A M; Caramori, T; Crabb, W D; Scoffone, F; Galizzi, A

    1991-01-01

    We cloned and sequenced 8.3 kb of Bacillus subtilis DNA corresponding to the flaA locus involved in flagellar biosynthesis, motility, and chemotaxis. The DNA sequence revealed the presence of 10 complete and 2 incomplete open reading frames. Comparison of the deduced amino acid sequences to data banks showed similarities of nine of the deduced products to a number of proteins of Escherichia coli and Salmonella typhimurium for which a role in flagellar functioning has been directly demonstrated. In particular, the sequence data suggest that the flaA operon codes for the M-ring protein, components of the motor switch, and the distal part of the basal-body rod. The gene order is remarkably similar to that described for region III of the enterobacterial flagellar regulon. One of the open reading frames was translated into a protein with 48% amino acid identity to S. typhimurium FliI and 29% identity to the beta subunit of E. coli ATP synthase. PMID:1828465

  14. Sequence-independent construction of ordered combinatorial libraries with predefined crossover points.

    PubMed

    Jézéquel, Laetitia; Loeper, Jacqueline; Pompon, Denis

    2008-11-01

    Combinatorial libraries coding for mosaic enzymes with predefined crossover points constitute useful tools to address and model structure-function relationships and for functional optimization of enzymes based on multivariate statistics. The presented method, called sequence-independent generation of a chimera-ordered library (SIGNAL), allows easy shuffling of any predefined amino acid segment between two or more proteins. This method is particularly well adapted to the exchange of protein structural modules. The procedure could also be well suited to generate ordered combinatorial libraries independent of sequence similarities in a robotized manner. Sequence segments to be recombined are first extracted by PCR from a single-stranded template coding for an enzyme of interest using a biotin-avidin-based method. This technique allows the reduction of parental template contamination in the final library. Specific PCR primers allow amplification of two complementary mosaic DNA fragments, overlapping in the region to be exchanged. Fragments are finally reassembled using a fusion PCR. The process is illustrated via the construction of a set of mosaic CYP2B enzymes using this highly modular approach.

  15. Complete mitochondrial genome of the versicoloured emerald hummingbird Amazilia versicolor, a polymorphic species.

    PubMed

    Prosdocimi, Francisco; Souto, Helena Magarinos; Ruschi, Piero Angeli; Furtado, Carolina; Jennings, W Bryan

    2016-09-01

    The genome of the versicoloured emerald hummingbird (Amazilia versicolor) was partially sequenced in one-sixth of an Illumina HiSeq lane. The mitochondrial genome was assembled using MIRA and MITObim software, yielding a circular molecule of 16,861 bp in length and deposited in GenBank under the accession number KF624601. The mitogenome contained 13 protein-coding genes, 22 transfer tRNAs, 2 ribosomal RNAs and 1 non-coding control region. The molecule was assembled using 21,927 sequencing reads of 100 bp each, resulting in ∼130 × coverage of uniformly distributed reads along the genome. This is the forth mitochondrial genome described for this highly diverse family of birds and may benefit further phylogenetic, phylogeographic, population genetic and species delimitation studies of hummingbirds.

  16. The complete chloroplast genome of Sinopodophyllum hexandrum Ying (Berberidaceae).

    PubMed

    Meng, Lihua; Liu, Ruijuan; Chen, Jianbing; Ding, Chenxu

    2017-05-01

    The complete nucleotide sequence of the Sinopodophyllum hexandrum Ying chloroplast genome (cpDNA) was determined based on next-generation sequencing technologies in this study. The genome was 157 203 bp in length, containing a pair of inverted repeat (IRa and IRb) regions of 25 960 bp, which were separated by a large single-copy (LSC) region of 87 065 bp and a small single-copy (SSC) region of 18 218 bp, respectively. The cpDNA contained 148 genes, including 96 protein-coding genes, 8 ribosomal RNA genes, and 44 tRNA genes. In these genes, eight harbored a single intron, and two (ycf3 and clpP) contained a couple of introns. The cpDNA AT content of S. hexandrum cpDNA is 61.5%.

  17. The complete chloroplast genome of the Dendrobium strongylanthum (Orchidaceae: Epidendroideae).

    PubMed

    Li, Jing; Chen, Chen; Wang, Zhe-Zhi

    2016-07-01

    Complete chloroplast genome sequence is very useful for studying the phylogenetic and evolution of species. In this study, the complete chloroplast genome of Dendrobium strongylanthum was constructed from whole-genome Illumina sequencing data. The chloroplast genome is 153 058 bp in length with 37.6% GC content and consists of two inverted repeats (IRs) of 26 316 bp. The IR regions are separated by large single-copy region (LSC, 85 836 bp) and small single-copy (SSC, 14 590 bp) region. A total of 130 chloroplast genes were successfully annotated, including 84 protein coding genes, 38 tRNA genes, and eight rRNA genes. Phylogenetic analyses showed that the chloroplast genome of Dendrobium strongylanthum is related to that of the Dendrobium officinal.

  18. Evolution of the Iga Heavy Chain Gene in the Genus Mus

    PubMed Central

    Osborne, B. A.; Golde, T. E.; Schwartz, R. L.; Rudikoff, S.

    1988-01-01

    To examine questions of immunoglobulin gene evolution, the IgA α heavy chain gene from Mus pahari, an evolutionarily distant relative to Mus musculus domesticus, was cloned and sequenced. The sequence, when compared to the IgA gene of BALB/c or human, demonstrated that the IgA gene is evolving in a mosaic fashion with the hinge region accumulating mutations most rapidly and the third domain at a considerably lower frequency. In spite of this pronounced accumulation of mutations, the hinge region appears to maintain the conformation of a random coil. A marked propensity to accumulate replacement over silent site changes in the coding regions was noted, as was a definite codon bias. The possibility that these two phenomena are interrelated is discussed. PMID:2842228

  19. The Complete Mitogenome of the Wood-Feeding Cockroach Cryptocercus meridianus (Blattodea: Cryptocercidae) and Its Phylogenetic Relationship among Cockroach Families.

    PubMed

    Li, Weijun; Wang, Zongqing; Che, Yanli

    2017-11-12

    In this study, the complete mitochondrial genome of Cryptocercus meridianus was sequenced. The circular mitochondrial genome is 15,322 bp in size and contains 13 protein-coding genes, two ribosomal RNA genes (12S rRNA and 16S rRNA), 22 transfer RNA genes, and one D-loop region. We compare the mitogenome of C. meridianus with that of C. relictus and C. kyebangensis . The base composition of the whole genome was 45.20%, 9.74%, 16.06%, and 29.00% for A, G, C, and T, respectively; it shows a high AT content (74.2%), similar to the mitogenomes of C. relictus and C. kyebangensis . The protein-coding genes are initiated with typical mitochondrial start codons except for cox1 with TTG. The gene order of the C. meridianus mitogenome differs from the typical insect pattern for the translocation of tRNA-Ser AGN , while the mitogenomes of the other two Cryptocercus species, C. relictus and C. kyebangensis , are consistent with the typical insect pattern. There are two very long non-coding intergenic regions lying on both sides of the rearranged gene tRNA-Ser AGN . The phylogenetic relationships were constructed based on the nucleotide sequence of 13 protein-coding genes and two ribosomal RNA genes. The mitogenome of C. meridianus is the first representative of the order Blattodea that demonstrates rearrangement, and it will contribute to the further study of the phylogeny and evolution of the genus Cryptocercus and related taxa.

  20. Vacuolar H[sup +]-ATPase 69-kilodalton catalytic subunit cDNA from developing cotton (Gossypium hirsutum) ovules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilkins, T.A.

    1993-06-01

    This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.

Top