40 CFR 60.395 - Reporting and recordkeeping requirements.

Code of Federal Regulations, 2010 CFR

2010-07-01

... temperature (or the gas temperature upstream and downstream of the catalyst bed), the total mass of VOC per... temperature upstream and downstream of the incinerator catalyst bed during coating operations for catalytic... which the average temperature immediately before the catalyst bed, when the coating system is...

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

PubMed Central

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

PubMed

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

The REP2 Repeats of the Genome of Neisseria meningitidis Are Associated with Genes Coordinately Regulated during Bacterial Cell Interaction

PubMed Central

Morelle, Sandrine; Carbonnelle, Etienne; Nassif, Xavier

2003-01-01

Interaction with host cells is essential in meningococcal pathogenesis especially at the blood-brain barrier. This step is likely to involve a common regulatory pathway allowing coordinate regulation of genes necessary for the interaction with endothelial cells. The analysis of the genomic sequence of Neisseria meningitidis Z2491 revealed the presence of many repeats. One of these, designated REP2, contains a −24/−12 type promoter and a ribosome binding site 5 to 13 bp before an ATG. In addition most of these REP2 sequences are located immediately upstream of an ORF. Among these REP2-associated genes are pilC1 and crgA, described as being involved in steps essential for the interaction of N. meningitidis with host cells. Furthermore, the REP2 sequences located upstream of pilC1 and crgA correspond to the previously identified promoters known to be induced during the initial localized adhesion of N. meningitidis with human cells. This characteristic led us to hypothesize that at least some of the REP2-associated genes were upregulated under the same circumstances as pilC1 and crgA. Quantitative PCR in real time demonstrated that the expression of 14 out of 16 REP2-associated genes were upregulated during the initial localized adhesion of N. meningitidis. Taken together, these data suggest that these repeats control a set of genes necessary for the efficient interaction of this pathogen with host cells. Subsequent mutational analysis was performed to address the role of these genes during meningococcus-cell interaction. PMID:12670987

Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

PubMed

Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

2016-01-04

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

PubMed Central

Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

1984-01-01

Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

DLocalMotif: a discriminative approach for discovering local motifs in protein sequences.

PubMed

Mehdi, Ahmed M; Sehgal, Muhammad Shoaib B; Kobe, Bostjan; Bailey, Timothy L; Bodén, Mikael

2013-01-01

Local motifs are patterns of DNA or protein sequences that occur within a sequence interval relative to a biologically defined anchor or landmark. Current protein motif discovery methods do not adequately consider such constraints to identify biologically significant motifs that are only weakly over-represented but spatially confined. Using negatives, i.e. sequences known to not contain a local motif, can further increase the specificity of their discovery. This article introduces the method DLocalMotif that makes use of positional information and negative data for local motif discovery in protein sequences. DLocalMotif combines three scoring functions, measuring degrees of motif over-representation, entropy and spatial confinement, specifically designed to discriminatively exploit the availability of negative data. The method is shown to outperform current methods that use only a subset of these motif characteristics. We apply the method to several biological datasets. The analysis of peroxisomal targeting signals uncovers several novel motifs that occur immediately upstream of the dominant peroxisomal targeting signal-1 signal. The analysis of proline-tyrosine nuclear localization signals uncovers multiple novel motifs that overlap with C2H2 zinc finger domains. We also evaluate the method on classical nuclear localization signals and endoplasmic reticulum retention signals and find that DLocalMotif successfully recovers biologically relevant sequence properties. http://bioinf.scmb.uq.edu.au/dlocalmotif/

Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

PubMed

Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

2007-08-01

To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

Energetic-ion acceleration and transport in the upstream region of Jupiter: Voyager 1 and 2

NASA Technical Reports Server (NTRS)

Baker, D. N.; Zwickl, R. D.; Carbary, J. F.; Krimigis, S. M.; Lepping, R. P.

1982-01-01

Long-lived upstream energetic ion events at Jupiter appear to be very similar in nearly all respects to upstream ion events at Earth. A notable difference between the two planetary systems is the enhanced heavy ion compositional signature reported for the Jovian events. This compositional feature has suggested that ions escaping from the Jovian magnetosphere play an important role in forming upstream ion populations at Jupiter. In contrast, models of energetic upstream ions at Earth emphasize in situ acceleration of reflected solar wind ions within the upstream region itself. Using Voyager 1 and 2 energetic ( approximately 30 keV) ion measurements near the magnetopause, in the magnetosheath, and immediately upstream of the bow shock, the compositional patterns are examined together with typical energy spectra in each of these regions. A model involving upstream Fermi acceleration early in events and emphasizing energetic particle escape in the prenoon part of the Jovian magnetosphere late in events is presented to explain many of the features in the upstream region of Jupiter.

A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

PubMed Central

Clos, J; Buttgereit, D; Grummt, I

1986-01-01

A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

Pea chloroplast tRNA(Lys) (UUU) gene: transcription and analysis of an intron-containing gene.

PubMed

Boyer, S K; Mullet, J E

1988-07-01

The pea chloroplast trnK gene which encodes tRNA(Lys) (UUU) was sequenced. TrnK is located 210 bp upstream from the promoter of psbA and immediately downstream from the 3'-end of rbcL. The gene is transcribed from the same DNA strand as psbA and rbcL. A 2447 bp intron with class II features is located in the trnK anticodon loop. The intron contains a 506 amino acid open reading frame which could encode an RNA maturase. The primary transcript of trnK is 2.9 kb long; its 5'-end was identified as a site of transcription initiation by in vitro transcription experiments. The 5'-terminus is adjacent to DNA sequences previously identified as transcription promoter elements. The most abundant trnK transcript is 2.5 kb long with termini corresponding to the 5' and 3' ends of the trnK exons. Intron specific RNAs were not detected. This suggests that RNA processing which produces tRNA(Lys) leads to rapid degradation of intron sequences.

An upstream sequence modulates phenazine production at the level of transcription and translation in the biological control strain Pseudomonas chlororaphis 30-84

PubMed Central

Wang, Dongping; Ries, Tessa R.; Pierson, Leland S.; Pierson, Elizabeth A.

2018-01-01

Phenazines are bacterial secondary metabolites and play important roles in the antagonistic activity of the biological control strain P. chlororaphis 30–84 against take-all disease of wheat. The expression of the P. chlororaphis 30–84 phenazine biosynthetic operon (phzXYFABCD) is dependent on the PhzR/PhzI quorum sensing system located immediately upstream of the biosynthetic operon as well as other regulatory systems including Gac/Rsm. Bioinformatic analysis of the sequence between the divergently oriented phzR and phzX promoters identified features within the 5’-untranslated region (5’-UTR) of phzX that are conserved only among 2OHPCA producing Pseudomonas. The conserved sequence features are potentially capable of producing secondary structures that negatively modulate one or both promoters. Transcriptional and translational fusion assays revealed that deletion of 90-bp of sequence at the 5’-UTR of phzX led to up to 4-fold greater expression of the reporters with the deletion compared to the controls, which indicated this sequence negatively modulates phenazine gene expression both transcriptionally and translationally. This 90-bp sequence was deleted from the P. chlororaphis 30–84 chromosome, resulting in 30-84Enh, which produces significantly more phenazine than the wild-type while retaining quorum sensing control. The transcriptional expression of phzR/phzI and amount of AHL signal produced by 30-84Enh also were significantly greater than for the wild-type, suggesting this 90-bp sequence also negatively affects expression of the quorum sensing genes. In addition, deletion of the 90-bp partially relieved RsmE-mediated translational repression, indicating a role for Gac/RsmE interaction. Compared to the wild-type, enhanced phenazine production by 30-84Enh resulted in improvement in fungal inhibition, biofilm formation, extracellular DNA release and suppression of take-all disease of wheat in soil without negative consequences on growth or rhizosphere persistence. This work provides greater insight into the regulation of phenazine biosynthesis with potential applications for improved biological control. PMID:29451920

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

PubMed Central

Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

2016-01-01

Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

PubMed

Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

2005-07-01

Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

PubMed

Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

2018-05-09

Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

5’-Terminal AUGs in Escherichia coli mRNAs with Shine-Dalgarno Sequences: Identification and Analysis of Their Roles in Non-Canonical Translation Initiation

PubMed Central

Beck, Heather J.; Fleming, Ian M. C.

2016-01-01

Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs) that contain a conventional untranslated leader and Shine-Dalgarno (SD) sequence upstream of the gene’s start codon while also containing an AUG triplet at the mRNA’s 5’- terminus (5’-uAUG). Fusion of the coding sequence specified by the 5’-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5’-terminal upstream open reading frames (5’-uORFs) tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5’-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5’-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5’-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5’-uORFs may play roles in downstream regulation. Since the 5’-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5’-uAUGs should be examined for their potential to function also as leaderless mRNAs. PMID:27467758

The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

PubMed Central

White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

1991-01-01

By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

PubMed Central

Robson, Nicole D.; Telesnitsky, Alice

2000-01-01

Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

PubMed Central

Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

1986-01-01

The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

Massive programmed translational jumping in mitochondria

PubMed Central

Lang, B. Franz; Jakubkova, Michaela; Hegedusova, Eva; Daoud, Rachid; Forget, Lise; Brejova, Brona; Vinar, Tomas; Kosa, Peter; Fricova, Dominika; Nebohacova, Martina; Griac, Peter; Tomaska, Lubomir; Burger, Gertraud; Nosek, Jozef

2014-01-01

Programmed translational bypassing is a process whereby ribosomes “ignore” a substantial interval of mRNA sequence. Although discovered 25 y ago, the only experimentally confirmed example of this puzzling phenomenon is expression of the bacteriophage T4 gene 60. Bypassing requires translational blockage at a “takeoff codon” immediately upstream of a stop codon followed by a hairpin, which causes peptidyl-tRNA dissociation and reassociation with a matching “landing triplet” 50 nt downstream, where translation resumes. Here, we report 81 translational bypassing elements (byps) in mitochondria of the yeast Magnusiomyces capitatus and demonstrate in three cases, by transcript analysis and proteomics, that byps are retained in mitochondrial mRNAs but not translated. Although mitochondrial byps resemble the bypass sequence in the T4 gene 60, they utilize unused codons instead of stops for translational blockage and have relaxed matching rules for takeoff/landing sites. We detected byp-like sequences also in mtDNAs of several Saccharomycetales, indicating that byps are mobile genetic elements. These byp-like sequences lack bypassing activity and are tolerated when inserted in-frame in variable protein regions. We hypothesize that byp-like elements have the potential to contribute to evolutionary diversification of proteins by adding new domains that allow exploration of new structures and functions. PMID:24711422

Target Site Recognition by a Diversity-Generating Retroelement

PubMed Central

Guo, Huatao; Tse, Longping V.; Nieh, Angela W.; Czornyj, Elizabeth; Williams, Steven; Oukil, Sabrina; Liu, Vincent B.; Miller, Jeff F.

2011-01-01

Diversity-generating retroelements (DGRs) are in vivo sequence diversification machines that are widely distributed in bacterial, phage, and plasmid genomes. They function to introduce vast amounts of targeted diversity into protein-encoding DNA sequences via mutagenic homing. Adenine residues are converted to random nucleotides in a retrotransposition process from a donor template repeat (TR) to a recipient variable repeat (VR). Using the Bordetella bacteriophage BPP-1 element as a prototype, we have characterized requirements for DGR target site function. Although sequences upstream of VR are dispensable, a 24 bp sequence immediately downstream of VR, which contains short inverted repeats, is required for efficient retrohoming. The inverted repeats form a hairpin or cruciform structure and mutational analysis demonstrated that, while the structure of the stem is important, its sequence can vary. In contrast, the loop has a sequence-dependent function. Structure-specific nuclease digestion confirmed the existence of a DNA hairpin/cruciform, and marker coconversion assays demonstrated that it influences the efficiency, but not the site of cDNA integration. Comparisons with other phage DGRs suggested that similar structures are a conserved feature of target sequences. Using a kanamycin resistance determinant as a reporter, we found that transplantation of the IMH and hairpin/cruciform-forming region was sufficient to target the DGR diversification machinery to a heterologous gene. In addition to furthering our understanding of DGR retrohoming, our results suggest that DGRs may provide unique tools for directed protein evolution via in vivo DNA diversification. PMID:22194701

Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

Distribution and abundance of stream fishes in relation to barriers: implications for monitoring stream recovery after barrier removal

USGS Publications Warehouse

Zydlewski, Joseph D.; Coghlan, Stephen M.; Gardner, C.; Saunders, R.

2011-01-01

Dams are ubiquitous in coastal regions and have altered stream habitats and the distribution and abundance of stream fishes in those habitats by disrupting hydrology, temperature regime and habitat connectivity. Dam removal is a common restoration tool, but often the response of the fish assemblage is not monitored rigorously. Sedgeunkedunk Stream, a small tributary to the Penobscot River (Maine, USA), has been the focus of a restoration effort that includes the removal of two low-head dams. In this study, we quantified fish assemblage metrics along a longitudinal gradient in Sedgeunkedunk Stream and also in a nearby reference stream. By establishing pre-removal baseline conditions and associated variability and the conditions and variability immediately following removal, we can characterize future changes in the system associated with dam removal. Over 2 years prior to dam removal, species richness and abundance in Sedgeunkedunk Stream were highest downstream of the lowest dam, lowest immediately upstream of that dam and intermediate farther upstream; patterns were similar in the reference stream. Although seasonal and annual variation in metrics within each site was substantial, the overall upstream-to-downstream pattern along the stream gradient was remarkably consistent prior to dam removal. Immediately after dam removal, we saw significant decreases in richness and abundance downstream of the former dam site and a corresponding increase in fish abundance upstream of the former dam site. No such changes occurred in reference sites. Our results show that by quantifying baseline conditions in a small stream before restoration, the effects of stream restoration efforts on fish assemblages can be monitored successfully. These data set the stage for the long-term assessment of Sedgeunkedunk Stream and provide a simple methodology for assessment in other restoration projects.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

DNA barcoding and evaluation of genetic diversity in Cyprinidae fish in the midstream of the Yangtze River.

PubMed

Shen, Yanjun; Guan, Lihong; Wang, Dengqiang; Gan, Xiaoni

2016-05-01

The Yangtze River is the longest river in China and is divided into upstream and mid-downstream regions by the Three Gorges (the natural barriers of the Yangtze River), resulting in a complex distribution of fish. Dramatic changes to habitat environments may ultimately threaten fish survival; thus, it is necessary to evaluate the genetic diversity and propose protective measures. Species identification is the most significant task in many fields of biological research and in conservation efforts. DNA barcoding, which constitutes the analysis of a short fragment of the mitochondrial cytochrome c oxidase subunit I (COI) sequence, has been widely used for species identification. In this study, we collected 561 COI barcode sequences from 35 fish from the midstream of the Yangtze River. The intraspecific distances of all species were below 2% (with the exception of Acheilognathus macropterus and Hemibarbus maculatus). Nevertheless, all species could be unambiguously identified from the trees, barcoding gaps and taxonomic resolution ratio values. Furthermore, the COI barcode diversity was found to be low (≤0.5%), with the exception of H. maculatus (0.87%), A. macropterus (2.02%) and Saurogobio dabryi (0.82%). No or few shared haplotypes were detected between the upstream and downstream populations for ten species with overall nucleotide diversities greater than 0.00%, which indicated the likelihood of significant population genetic structuring. Our analyses indicated that DNA barcoding is an effective tool for the identification of cyprinidae fish in the midstream of the Yangtze River. It is vital that some protective measures be taken immediately because of the low COI barcode diversity.

X-Prolyl Dipeptidyl Aminopeptidase Gene (pepX) Is Part of the glnRA Operon in Lactobacillus rhamnosus

PubMed Central

Varmanen, Pekka; Savijoki, Kirsi; Åvall, Silja; Palva, Airi; Tynkkynen, Soile

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate l-glycyl-l-prolyl-β-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks. PMID:10613874

X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

PubMed

Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

NASA Astrophysics Data System (ADS)

Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

2016-04-01

The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function.

Molecular characterization of a genomic region in a Lactococcus bacteriophage that is involved in its sensitivity to the phage defense mechanism AbiA.

PubMed

Dinsmore, P K; Klaenhammer, T R

1997-05-01

A spontaneous mutant of the lactococcal phage phi31 that is insensitive to the phage defense mechanism AbiA was characterized in an effort to identify the phage factor(s) involved in sensitivity of phi31 to AbiA. A point mutation was localized in the genome of the AbiA-insensitive phage (phi31A) by heteroduplex analysis of a 9-kb region. The mutation (G to T) was within a 738-bp open reading frame (ORF245) and resulted in an arginine-to-leucine change in the predicted amino acid sequence of the protein. The mutant phi31A-ORF245 reduced the sensitivity of phi31 to AbiA when present in trans, indicating that the mutation in ORF245 is responsible for the AbiA insensitivity of phi31A. Transcription of ORF245 occurs early in the phage infection cycles of phi31 and phi31A and is unaffected by AbiA. Expansion of the phi31 sequence revealed ORF169 (immediately upstream of ORF245) and ORF71 (which ends 84 bp upstream of ORF169). Two inverted repeats lie within the 84-bp region between ORF71 and ORF169. Sequence analysis of an independently isolated AbiA-insensitive phage, phi31B, identified a mutation (G to A) in one of the inverted repeats. A 118-bp fragment from phi31, encompassing the 84-bp region between ORF71 and ORF169, eliminates AbiA activity against phi31 when present in trans, establishing a relationship between AbiA and this fragment. The study of this region of phage phi31 has identified an open reading frame (ORF245) and a 118-bp DNA fragment that interact with AbiA and are likely to be involved in the sensitivity of this phage to AbiA.

Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

PubMed

Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

2001-06-01

Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

Continuous measurements of water surface height and width along a 6.5km river reach for discharge algorithm development

NASA Astrophysics Data System (ADS)

Tuozzolo, S.; Durand, M. T.; Pavelsky, T.; Pentecost, J.

2015-12-01

The upcoming Surface Water and Ocean Topography (SWOT) satellite will provide measurements of river width and water surface elevation and slope along continuous swaths of world rivers. Understanding water surface slope and width dynamics in river reaches is important for both developing and validating discharge algorithms to be used on future SWOT data. We collected water surface elevation and river width data along a 6.5km stretch of the Olentangy River in Columbus, Ohio from October to December 2014. Continuous measurements of water surface height were supplemented with periodical river width measurements at twenty sites along the study reach. The water surface slope of the entire reach ranged from during 41.58 cm/km at baseflow to 45.31 cm/km after a storm event. The study reach was also broken into sub-reaches roughly 1km in length to study smaller scale slope dynamics. The furthest upstream sub-reaches are characterized by free-flowing riffle-pool sequences, while the furthest downstream sub-reaches were directly affected by two low-head dams. In the sub-reaches immediately upstream of each dam, baseflow slope is as low as 2 cm/km, while the furthest upstream free-flowing sub-reach has a baseflow slope of 100 cm/km. During high flow events the backwater effect of the dams was observed to propagate upstream: sub-reaches impounded by the dams had increased water surface slopes, while free flowing sub-reaches had decreased water surface slopes. During the largest observed flow event, a stage change of 0.40 m affected sub-reach slopes by as much as 30 cm/km. Further analysis will examine height-width relationships within the study reach and relate cross-sectional flow area to river stage. These relationships can be used in conjunction with slope data to estimate discharge using a modified Manning's equation, and are a core component of discharge algorithms being developed for the SWOT mission.

Evidence for specularly reflected ions upstream from the quasi-parallel bow shock

NASA Technical Reports Server (NTRS)

Gosling, J. T.; Thomsen, M. F.; Bame, S. J.; Feldman, W. C.; Paschmann, G.; Sckopke, N.

1982-01-01

Ion velocity distributions in the form of bunches of gyrating particles traveling along helical paths have been observed moving sunward immediately upstream from quasi-parallel parts of the earth's bow shock using Los Alamos/Garching instruments on ISEE-1 and -2. These distributions have characteristics which indicate that they are produced by the nearly specular reflection at the shock of a portion of the incident solar wind ions. In particular, the guiding center motion and the gyrospeeds of the gyrating ions are quantitatively consistent with simple geometrical considerations for specular reflection. These considerations reveal that specularly reflected ions can escape upstream when the angle between the upstream magnetic field and the local shock normal is less than 45 deg but not when the angle is greater than 45 deg. These upstream gyrating ions are an important signature of one of the processes by which solar wind streaming energy is dissipated into other forms of energy at the shock.

Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

PubMed Central

Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G

1993-01-01

The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

Molecular basis and consequences of a deletion in the amelogenin gene, analyzed by capture PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lagerstroem-Fermer, M.; Pettersson, U.; Landegren, U.

1993-07-01

A mutation that disrupts the gene for one of the major proteins in tooth enamel has been investigated. The mutation is located in the amelogenin gene and causes X-linked amelogenesis imperfecta, characterized by defective mineralization of tooth enamel. The authors have isolated the breakpoints of a 5-kb deletion in the amelogenin gene on the basis of nucleotide sequence information located upstream of the lesion, using a technique termed capture PCR. The deletion removes five of the seven exons, spanning from the second intron to the last exon. Only the first two codons for the mature protein remain, consistent with themore » relatively severe phenotype of affected individuals in the present family. The mutation appears to have arisen as an illegitimate recombination event since of 11 nucleotide positions immediately surrounding the two breakpoints, 9 are identical. 17 refs., 3 figs., 1 tab.« less

Biodegradation of 17β-Estradiol, Estrone and Testosterone in Stream Sediments

NASA Astrophysics Data System (ADS)

Bradley, P. M.; Chapelle, F. H.; Barber, L. B.; McMahon, P. B.; Gray, J. L.; Kolpin, D. W.

2009-12-01

The potentials for in situ biodegradation of 17β-estradiol (E2), estrone (E1), and testosterone (T) were investigated in three, hydrologically-distinct, WWTP-impacted streams in the United States. Relative differences in the mineralization of [4-14C] substrates were assessed in oxic microcosms containing sediment or water-only from locations upstream and downstream of the WWTP outfall in each system. Upstream samples provided insight into the biodegradative potential of sediment microbial communities that were not under the immediate impact of WWTP effluent. Upstream sediment from all three systems demonstrated significant mineralization of the “A” ring of E2, E1 and T, with the potential of T biodegradation consistently greater than of E2 and no systematic difference in the potentials of E2 and E1. Downstream samples provided insight into the impacts of effluent on reproductive hormone biodegradation. Significant “A” ring mineralization was also observed in downstream sediment, with the potentials for E1 and T mineralization being substantially depressed relative to upstream samples. In marked contrast, the potentials for E2 mineralization immediately downstream of the WWTP outfalls were more than double that of upstream samples. E2 mineralization was also observed in water, albeit at insufficient rate to prevent substantial downstream transport in the water column. The results of this study indicate that, in combination with sediment sorption processes which effectively scavenge hydrophobic contaminants from the water column and immobilize them in the vicinity of the WWTP outfall, aerobic biodegradation of reproductive hormones can be an environmentally important mechanism for non-conservative (destructive) attenuation of hormonal endocrine disruptors in effluent-impacted streams.

Direct Spectroscopic Study of Reconstituted Transcription Complexes Reveals That Intrinsic Termination Is Driven Primarily by Thermodynamic Destabilization of the Nucleic Acid Framework*S

PubMed Central

Datta, Kausiki; von Hippel, Peter H.

2008-01-01

Changes in near UV circular dichroism (CD) and fluorescence spectra of site-specifically placed pairs of 2-aminopurine residues have been used to probe the roles of the RNA hairpin and the RNA-DNA hybrid in controlling intrinsic termination of transcription. Functional transcription complexes were assembled directly by mixing preformed nucleic acid scaffolds of defined sequence with T7 RNA polymerase (RNAP). Scaffolds containing RNA hairpins immediately upstream of a GC-rich hybrid formed complexes of reduced stability, whereas the same hairpins adjacent to a hybrid of rU-dA base pairs triggered complex dissociation and transcript release. 2-Aminopurine probes at the upstream ends of the hairpin stems show that the hairpins open on RNAP binding and that stem re-formation begins after one or two RNA bases on the downstream side of the stem have emerged from the RNAP exit tunnel. Hairpins directly adjacent to the RNA-DNA hybrid weaken RNAP binding, decrease elongation efficiency, and disrupt the upstream end of the hybrid as well as interfere with the movement of the template base at the RNAP active site. Probing the edges of the DNA transcription bubble demonstrates that termination hairpins prevent translocation of the RNAP, suggesting that they transiently “lock” the polymerase to the nucleic acid scaffold and, thus, hold the RNA-DNA hybrid “in frame.” At intrinsic terminators the weak rU-dA hybrid and the adjacent termination hairpin combine to destabilize the elongation complex sufficiently to permit significant transcript release, whereas hairpin-dependent pausing provides time for the process to go to completion. PMID:18070878

The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

PubMed Central

Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

2008-01-01

Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163

Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

PubMed Central

Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

2015-01-01

Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE PAGES

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

2016-03-09

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

33 CFR 207.275 - McClellan-Kerr Arkansas River navigation system: use, administration, and navigation.

Code of Federal Regulations, 2014 CFR

2014-07-01

.... Vessels arriving at these markers or the mooring cells immediately upstream and downstream of the lock... mooring facilities at the junction of main stem and secondary channels are to provide temporary mooring...

3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

PubMed Central

Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

2016-01-01

Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

The GhTT2_A07 gene is linked to the brown colour and natural flame retardancy phenotypes of Lc1 cotton (Gossypium hirsutum L.) fibres

PubMed Central

Hinchliffe, Doug J.; Condon, Brian D.; Thyssen, Gregory; Naoumkina, Marina; Madison, Crista A.; Reynolds, Michael; Delhom, Christopher D.; Fang, David D.; Li, Ping; McCarty, Jack

2016-01-01

Some naturally coloured brown cotton fibres from accessions of Gossypium hirsutum L. can be used to make textiles with enhanced flame retardancy (FR). Several independent brown fibre loci have been identified and mapped to chromosomes, but the underlying genes have not yet been identified, and the mechanism of lint fibre FR is not yet fully understood. In this study, we show that both the brown colour and enhanced FR of the Lc1 lint colour locus are linked to a 1.4Mb inversion on chromosome A07 that is immediately upstream of a gene with similarity to Arabidopsis TRANSPARENT TESTA 2 (TT2). As a result of the alternative upstream sequence, the transcription factor GhTT2_A07 is highly up-regulated in developing fibres. In turn, genes in the phenylpropanoid metabolic pathway are activated, leading to biosynthesis of proanthocyanidins and accumulation of inorganic elements. We show that enhanced FR and anthocyanin precursors appear in developing brown fibres well before the brown colour is detectible, demonstrating for the first time that the polymerized proanthocyanidins that constitute the brown colour are not the source of enhanced FR. Identifying the particular colourless metabolite that provides Lc1 cotton with enhanced FR could help minimize the use of synthetic chemical flame retardant additives in textiles. PMID:27567364

Organizational differences between cytoplasmic male sterile and male fertile Brassica mitochondrial genomes are confined to a single transposed locus.

PubMed Central

L'Homme, Y; Brown, G G

1993-01-01

Comparison of the physical maps of male fertile (cam) and male sterile (pol) mitochondrial genomes of Brassica napus indicates that structural differences between the two mtDNAs are confined to a region immediately upstream of the atp6 gene. Relative to cam mtDNA, pol mtDNA possesses a 4.5 kb segment at this locus that includes a chimeric gene that is cotranscribed with atp6 and lacks an approximately 1kb region located upstream of the cam atp6 gene. The 4.5 kb pol segment is present and similarly organized in the mitochondrial genome of the common nap B.napus cytoplasm; however, the nap and pol DNA regions flanking this segment are different and the nap sequences are not expressed. The 4.5 kb CMS-associated pol segment has thus apparently undergone transposition during the evolution of the nap and pol cytoplasms and has been lost in the cam genome subsequent to the pol-cam divergence. This 4.5 kb segment comprises the single DNA region that is expressed differently in fertile, pol CMS and fertility restored pol cytoplasm plants. The finding that this locus is part of the single mtDNA region organized differently in the fertile and male sterile mitochondrial genomes provides strong support for the view that it specifies the pol CMS trait. Images PMID:8388101

Biochemical and Genetic Characterization of Coagulin, a New Antilisterial Bacteriocin in the Pediocin Family of Bacteriocins, Produced by Bacillus coagulans I4

PubMed Central

Le Marrec, Claire; Hyronimus, Bertrand; Bressollier, Philippe; Verneuil, Bernard; Urdaci, Maria C.

2000-01-01

A plasmid-linked antimicrobial peptide, named coagulin, produced by Bacillus coagulans I4 has recently been reported (B. Hyronimus, C. Le Marrec and M. C. Urdaci, J. Appl. Microbiol. 85:42–50, 1998). In the present study, the complete, unambiguous primary amino acid sequence of the peptide was obtained by a combination of both N-terminal sequencing of purified peptide and the complete sequence deduced from the structural gene harbored by plasmid I4. Data revealed that this peptide of 44 residues has an amino acid sequence similar to that described for pediocins AcH and PA-1, produced by different Pediococcus acidilactici strains and 100% identical. Coagulin and pediocin differed only by a single amino acid at their C terminus. Analysis of the genetic determinants revealed the presence, on the pI4 DNA, of the entire 3.5-kb operon of four genes described for pediocin AcH and PA-1 production. No extended homology was observed between pSMB74 from P. acidilactici and pI4 when analyzing the regions upstream and downstream of the operon. An oppositely oriented gene immediately dowstream of the bacteriocin operon specifies a 474-amino-acid protein which shows homology to Mob-Pre (plasmid recombination enzyme) proteins encoded by several small plasmids extracted from gram-positive bacteria. This is the first report of a pediocin-like peptide appearing naturally in a non-lactic acid bacterium genus. PMID:11097892

Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

PubMed

Joshee, N; Kisaka, H; Kitagawa, Y

1998-01-01

One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

PubMed

Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

2017-03-01

To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

Method and apparatus for capturing carbon dioxide during combustion of carbon containing fuel

DOEpatents

Axelbaum, Richard L.; Kumfer, Benjamin M.; Xia, Fei; Gopan, Akshay; Dhungel, Bhupesh

2018-04-10

A boiler system having a series of boilers. Each boiler includes a shell having an upstream end, a downstream end, and a hollow interior. The boilers also have an oxidizer inlet entering the hollow interior adjacent the upstream end of the shell and a fuel nozzle positioned adjacent the upstream end of the shell for introducing fuel into the hollow interior of the shell. Each boiler includes a flue duct connected to the shell adjacent the downstream end for transporting flue gas from the hollow interior. Oxygen is delivered to the oxidizer inlet of the first boiler in the series. Flue gas from the immediately preceding boiler in the series is delivered through the oxidizer inlet of each boiler subsequent to the first boiler in the series.

Characterization of the Bacillus stearothermophilus manganese superoxide dismutase gene and its ability to complement copper/zinc superoxide dismutase deficiency in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bowler, C.; Inze, D.; Van Camp, W.

1990-03-01

Recombinant clones containing the manganese superoxide dismutase (MnSOD) gene of Bacillus stearothermophilus were isolated with an oligonucleotide probe designed to match a part of the previously determined amino acid sequence. Complementation analyses, performed by introducing each plasmid into a superoxide dismutase-deficient mutant of Escherichia coli, allowed us to define the region of DNA which encodes the MnSOD structural gene and to identify a promoter region immediately upstream from the gene. These data were subsequently confirmed by DNA sequencing. Since MnSOD is normally restricted to the mitochondria in eucaryotes, we were interested (i) in determining whether B. stearothermophilus MnSOD could functionmore » in eucaryotic cytosol and (ii) in determining whether MnSOD could replace the structurally unrelated copper/zinc superoxide dismutase (Cu/ZnSOD) which is normally found there. To test this, the sequence encoding bacterial MnSOD was cloned into a yeast expression vector and subsequently introduced into a Cu/ZnSOD-deficient mutant of the yeast Saccharomyces cerevisiae. Functional expression of the protein was demonstrated, and complementation tests revealed that the protein was able to provide tolerance at wild-type levels to conditions which are normally restrictive for this mutant. Thus, in spite of the evolutionary unrelatedness of these two enzymes, Cu/ZnSOD can be functionally replaced by MnSOD in yeast cytosol.« less

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

PubMed Central

Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

1990-01-01

We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

PubMed

Lin, Min; Dan, Hanhong; Li, Yijing

2004-02-01

Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

PubMed Central

Williams, N P; Mueller, P P; Hinnebusch, A G

1988-01-01

Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

PubMed Central

Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

2011-01-01

Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

PubMed Central

Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

2003-01-01

The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

PubMed

Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

2000-08-01

We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

Sedimentary structures formed under water surface waves: examples from a sediment-laden flash flood observed by remote camer

NASA Astrophysics Data System (ADS)

Froude, Melanie; Alexander, Jan; Cole, Paul; Barclay, Jenni

2014-05-01

On 13-14 October 2012, Tropical Storm Rafael triggered sediment-laden flash floods in the Belham Valley on Montserrat, West Indies. Rainfall was continuous for ~38 hours and intensity peaked at 48 mm/hr. Flow was strongly unsteady, turbulent with sediment concentrations varying up to hyperconcentrated. Time-lapse images captured at >1 frame per second by remote camera overlooking a surveyed valley section show the development of trains of water surface waves at multiple channel locations during different flow stages. Waves grew and diminished in height and remained stationary or migrated upstream. Trains of waves persisted for <5 minutes, until a single wave broke, sometimes initiating the breaking of adjacent waves within the train. Channel-wide surges (bores) propagating downstream with distinct turbulent flow fronts, were observed at irregular intervals during and up to 7 hours after peak stage. These bores are mechanically similar to breaking front tidal bores and arid flood bores, and resulted in a sudden increase in flow depth and velocity. When a bore front came into close proximity (within ~10 m) upstream of a train of water surface waves, the waves appeared to break simultaneously generating a localised surge of water upstream, that was covered by the bore travelling downstream. Those trains in which waves did not break during the passage of a bore temporarily reduced in height. In both cases, water surface waves reformed immediately after the surge in the same location. Deposits from the event, were examined in <4 m deep trenches ~0.5 km downstream of the remote camera. These contained laterally extensive lenticular and sheet-like units comprised of varying admixtures of sand and gravel that are attributed to antidunes, and associated transitions from upper-stage-plane-beds. Some of the structures are organised within concave upward sequences which contain downflow shifts between foreset and backset laminae; interpreted as trough fills from chute-and-pools or water surface wave breaking. At least 90% of the deposit is interpreted upper flow regime origin. The sequence, geometry and lamina-scale texture of the sedimentary structures will be discussed with reference to remote camera images of rapidly varying, unsteady and pulsatory flow behaviour.

Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

PubMed Central

Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

2014-01-01

The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

PubMed

Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

2015-03-20

Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

PubMed

Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

2008-09-15

Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

Regulation of Bacteria-Induced Intercellular Adhesion Molecule-1 by CCAAT/Enhancer Binding Proteins

PubMed Central

Manzel, Lori J.; Chin, Cecilia L.; Behlke, Mark A.; Look, Dwight C.

2009-01-01

Direct interaction between bacteria and epithelial cells may initiate or amplify the airway response through induction of epithelial defense gene expression by nuclear factor-κB (NF-κB). However, multiple signaling pathways modify NF-κB effects to modulate gene expression. In this study, the effects of CCAAT/enhancer binding protein (C/EBP) family members on induction of the leukocyte adhesion glycoprotein intercellular adhesion molecule-1 (ICAM-1) was examined in primary cultures of human tracheobronchial epithelial cells incubated with nontypeable Haemophilus influenzae. Increased ICAM-1 gene transcription in response to H. influenzae required gene sequences located at −200 to −135 in the 5′-flanking region that contain a C/EBP-binding sequence immediately upstream of the NF-κB enhancer site. Constitutive C/EBPβ was found to have an important role in epithelial cell ICAM-1 regulation, while the adjacent NF-κB sequence binds the RelA/p65 and NF-κB1/p50 members of the NF-κB family to induce ICAM-1 expression in response to H. influenzae. The expression of C/EBP proteins is not regulated by p38 mitogen-activated protein kinase activation, but p38 affects gene transcription by increasing the binding of TATA-binding protein to TATA-box–containing gene sequences. Epithelial cell ICAM-1 expression in response to H. influenzae was decreased by expressing dominant-negative protein or RNA interference against C/EBPβ, confirming its role in ICAM-1 regulation. Although airway epithelial cells express multiple constitutive and inducible C/EBP family members that bind C/EBP sequences, the results indicate that C/EBPβ plays a central role in modulation of NF-κB–dependent defense gene expression in human airway epithelial cells after exposure to H. influenzae. PMID:18703796

Form drag in rivers due to small-scale natural topographic features: 2. Irregular sequences

USGS Publications Warehouse

Kean, J.W.; Smith, J.D.

2006-01-01

The size, shape, and spacing of small-scale topographic features found on the boundaries of natural streams, rivers, and floodplains can be quite variable. Consequently, a procedure for determining the form drag on irregular sequences of different-sized topographic features is essential for calculating near-boundary flows and sediment transport. A method for carrying out such calculations is developed in this paper. This method builds on the work of Kean and Smith (2006), which describes the flow field for the simpler case of a regular sequence of identical topographic features. Both approaches model topographic features as two-dimensional elements with Gaussian-shaped cross sections defined in terms of three parameters. Field measurements of bank topography are used to show that (1) the magnitude of these shape parameters can vary greatly between adjacent topographic features and (2) the variability of these shape parameters follows a lognormal distribution. Simulations using an irregular set of topographic roughness elements show that the drag on an individual element is primarily controlled by the size and shape of the feature immediately upstream and that the spatial average of the boundary shear stress over a large set of randomly ordered elements is relatively insensitive to the sequence of the elements. In addition, a method to transform the topography of irregular surfaces into an equivalently rough surface of regularly spaced, identical topographic elements also is given. The methods described in this paper can be used to improve predictions of flow resistance in rivers as well as quantify bank roughness.

Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

PubMed Central

Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

2015-01-01

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

Characterization of ROP18 alleles in human toxoplasmosis.

PubMed

Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

2014-04-01

The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

LhnR and upstream operon LhnABC in Agrobacterium vitis regulate the induction of tobacco hypersensitive responses, grape necrosis and swarming motility.

PubMed

Zheng, Desen; Hao, Guixia; Cursino, Luciana; Zhang, Hongsheng; Burr, Thomas J

2012-09-01

The characterization of Tn5 transposon insertional mutants of Agrobacterium vitis strain F2/5 revealed a gene encoding a predicted LysR-type transcriptional regulator, lhnR (for 'LysR-type regulator associated with HR and necrosis'), and an immediate upstream operon consisting of three open reading frames (lhnABC) required for swarming motility, surfactant production and the induction of a hypersensitive response (HR) on tobacco and necrosis on grape. The operon lhnABC is unique to A. vitis among the sequenced members in Rhizobiaceae. Mutagenesis of lhnR and lhnABC by gene disruption and complementation of ΔlhnR and ΔlhnABC confirmed their roles in the expression of these phenotypes. Mutation of lhnR resulted in complete loss of HR, swarming motility, surfactant production and reduced necrosis, whereas mutation of lhnABC resulted in loss of swarming motility, delayed and reduced HR development and reduced surfactant production and necrosis. The data from promoter-green fluorescent protein (gfp) fusions showed that lhnR suppresses the expression of lhnABC and negatively autoregulates its own expression. It was also shown that lhnABC negatively affects its own expression and positively affects the transcription of lhnR. lhnR and lhnABC constitute a regulatory circuit that coordinates the transcription level of lhnR, resulting in the expression of swarming, surfactant, HR and necrosis phenotypes. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

PubMed

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

The GhTT2_A07 gene is linked to the brown colour and natural flame retardancy phenotypes of Lc1 cotton (Gossypium hirsutum L.) fibres.

PubMed

Hinchliffe, Doug J; Condon, Brian D; Thyssen, Gregory; Naoumkina, Marina; Madison, Crista A; Reynolds, Michael; Delhom, Christopher D; Fang, David D; Li, Ping; McCarty, Jack

2016-10-01

Some naturally coloured brown cotton fibres from accessions of Gossypium hirsutum L. can be used to make textiles with enhanced flame retardancy (FR). Several independent brown fibre loci have been identified and mapped to chromosomes, but the underlying genes have not yet been identified, and the mechanism of lint fibre FR is not yet fully understood. In this study, we show that both the brown colour and enhanced FR of the Lc1 lint colour locus are linked to a 1.4Mb inversion on chromosome A07 that is immediately upstream of a gene with similarity to Arabidopsis TRANSPARENT TESTA 2 (TT2). As a result of the alternative upstream sequence, the transcription factor GhTT2_A07 is highly up-regulated in developing fibres. In turn, genes in the phenylpropanoid metabolic pathway are activated, leading to biosynthesis of proanthocyanidins and accumulation of inorganic elements. We show that enhanced FR and anthocyanin precursors appear in developing brown fibres well before the brown colour is detectible, demonstrating for the first time that the polymerized proanthocyanidins that constitute the brown colour are not the source of enhanced FR. Identifying the particular colourless metabolite that provides Lc1 cotton with enhanced FR could help minimize the use of synthetic chemical flame retardant additives in textiles. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

PubMed Central

Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

2000-01-01

The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

A novel protocol for the production of recombinant LL-37 expressed as a thioredoxin fusion protein.

PubMed

Li, Yifeng

2012-02-01

LL-37 is the only cathelicidin-derived antimicrobial peptide found in humans and it has a multifunctional role in host defense. The peptide has been shown to possess immunomodulatory functions in addition to antimicrobial activity. To provide sufficient material for biological and structural characterization of this important peptide, various systems were developed to produce recombinant LL-37 in Escherichia coli. In one previous approach, LL-37 coding sequence was cloned into vector pET-32a, allowing the peptide to be expressed as a thioredoxin fusion. The fusion protein contains two thrombin cleavage sites: a vector-encoded one that is 30-residue upstream of the insert and an engineered one that is immediately adjacent to LL-37. Cleavage at these two sites shall generate three fragments, one of which is the target peptide. However, when the fusion protein was treated with thrombin, cleavage only occurred at the remote upstream site. A plausible explanation is that the thrombin site adjacent to LL-37 is less accessible due to the peptide's aggregation tendency and cleavage at the remote site generates a fragment, which forms a large aggregate that buries the intended site. In this study, I deleted the vector-encoded thrombin site and S tag in pET-32a, and then inserted the coding sequence for LL-37 plus a thrombin site into the modified vector. Although removing the S tag did not change the oligomeric state of the fusion protein, deletion of the vector-encoded thrombin site allowed the fusion to be cleaved at the engineered site to release LL-37. The released peptide was separated from the carrier and cleavage enzyme by size-exclusion chromatography. This new approach enables a quick production of high quality active LL-37 with a decent amount. Copyright © 2011 Elsevier Inc. All rights reserved.

An interferon regulatory factor binding site in the U5 region of the bovine leukemia virus long terminal repeat stimulates Tax-independent gene expression.

PubMed

Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L

1998-07-01

Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.

Exon-Specific QTLs Skew the Inferred Distribution of Expression QTLs Detected Using Gene Expression Array Data

PubMed Central

Veyrieras, Jean-Baptiste; Gaffney, Daniel J.; Pickrell, Joseph K.; Gilad, Yoav; Stephens, Matthew; Pritchard, Jonathan K.

2012-01-01

Mapping of expression quantitative trait loci (eQTLs) is an important technique for studying how genetic variation affects gene regulation in natural populations. In a previous study using Illumina expression data from human lymphoblastoid cell lines, we reported that cis-eQTLs are especially enriched around transcription start sites (TSSs) and immediately upstream of transcription end sites (TESs). In this paper, we revisit the distribution of eQTLs using additional data from Affymetrix exon arrays and from RNA sequencing. We confirm that most eQTLs lie close to the target genes; that transcribed regions are generally enriched for eQTLs; that eQTLs are more abundant in exons than introns; and that the peak density of eQTLs occurs at the TSS. However, we find that the intriguing TES peak is greatly reduced or absent in the Affymetrix and RNA-seq data. Instead our data suggest that the TES peak observed in the Illumina data is mainly due to exon-specific QTLs that affect 3′ untranslated regions, where most of the Illumina probes are positioned. Nonetheless, we do observe an overall enrichment of eQTLs in exons versus introns in all three data sets, consistent with an important role for exonic sequences in gene regulation. PMID:22359548

Improved efficiency in amplification of Escherichia coli o-antigen gene clusters using genome-wide sequence comparison

USDA-ARS?s Scientific Manuscript database

Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...

Two alternative ways of start site selection in human norovirus reinitiation of translation.

PubMed

Luttermann, Christine; Meyers, Gregor

2014-04-25

The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

40 CFR 90.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2011 CFR

2011-07-01

... filter and HFID. Determine these gas temperatures by a temperature sensor located immediately upstream of... analytical system description. (a) General. The exhaust gas sampling system described in this section is...-CVS must conform to all of the requirements listed for the exhaust gas PDP-CVS in § 90.420 of this...

40 CFR 90.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2010 CFR

2010-07-01

... filter and HFID. Determine these gas temperatures by a temperature sensor located immediately upstream of... analytical system description. (a) General. The exhaust gas sampling system described in this section is...-CVS must conform to all of the requirements listed for the exhaust gas PDP-CVS in § 90.420 of this...

40 CFR 60.455 - Reporting and recordkeeping requirements.

Code of Federal Regulations, 2010 CFR

2010-07-01

... upstream and downstream of the catalyst bed), and (iv) A description of the method used to establish the... temperature recorded immediately before the catalyst bed is more than 28 °C (50 °F) below the average... the average temperature difference across the catalyst bed is less than 80 percent of the average...

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

PubMed Central

Lo, W Y; Ting, L P

1994-01-01

Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

PubMed

Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

2004-07-01

The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

PubMed

Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

2003-07-04

The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE PAGES

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

2015-03-22

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

PubMed

Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

2015-06-01

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

PubMed

Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

2016-01-15

Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Macrolide resistance in Legionella pneumophila: the role of LpeAB efflux pump.

PubMed

Massip, Clémence; Descours, Ghislaine; Ginevra, Christophe; Doublet, Patricia; Jarraud, Sophie; Gilbert, Christophe

2017-05-01

A previous study on 12 in vitro -selected azithromycin-resistant Legionella pneumophila lineages showed that ribosomal mutations were major macrolide resistance determinants. In addition to these mechanisms that have been well described in many species, mutations upstream of lpeAB operon, homologous to acrAB in Escherichia coli , were identified in two lineages. In this study, we investigated the role of LpeAB and of these mutations in macrolide resistance of L. pneumophila . The role of LpeAB was studied by testing the antibiotic susceptibility of WT, deleted and complemented L. pneumophila Paris strains. Translational fusion experiments using GFP as a reporter were conducted to investigate the consequences of the mutations observed in the upstream sequence of lpeAB operon. We demonstrated the involvement of LpeAB in an efflux pump responsible for a macrolide-specific reduced susceptibility of L. pneumophila Paris strain. Mutations in the upstream sequence of lpeAB operon were associated with an increased protein expression. Increased expression was also observed under sub-inhibitory macrolide concentrations in strains with both mutated and WT promoting regions. LpeAB are components of an efflux pump, which is a macrolide resistance determinant in L. pneumophila Paris strain. Mutations observed in the upstream sequence of lpeAB operon in resistant lineages led to an overexpression of this efflux pump. Sub-inhibitory concentrations of macrolides themselves participated in upregulating this efflux and could constitute a first step in the acquisition of a high macrolide resistance level. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

High-time resolution measurements of upstream magnetic field and plasma conditions during flux transfer events at the Earth's dayside magnetopause

NASA Technical Reports Server (NTRS)

Jacob, Jamey D.; Carrell, Cynthia

1993-01-01

We present preliminary results of a study of upstream magnetic field and plasma conditions measured by IRM during flux transfer events observed at the Earth's magnetopause by CCE. This study was designed to determine the importance of various upstream factors in the formation of bipolar magnetic field signatures called flux transfer events (FTEs). Six FTE encounters were examined. In three cases, the two satellites were on similar magnetic field lines. Preliminary investigation showed that fluctuations occurred in the Bz component of the interplanetary magnetic field (IMF) resulting in a southward field preceding the FTE in all three of these cases. In two of these cases, the changes were characterized by a distinct rotation from a strong southward to a strong northward field. There were also accompanying changes in the dynamic and thermal pressure in the solar wind immediately before the FTE was encountered. Examination of the 3D plasma distributions showed that these pulses were due to the addition of energetic upstreaming foreshock particles. There were no consistent changes in either Bz or the plasma pressure at IRM for the three events when the satellites were not connected by the IMF.

76 FR 72986 - Options Price Reporting Authority; Notice of Filing and Immediate Effectiveness of Proposed...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-28

... uncontrolled retransmission of OPRA market data-- that is, as a transmission of OPRA data in respect of which... Vendor,'' since it is ``downstream'' in the dissemination of the OPRA market data from the ``upstream'' Vendor that is sending the data to it. A Vendor that receives a datafeed directly from OPRA's data...

Environmental Security in Botswana

DTIC Science & Technology

2011-10-01

concerns are vital to state survival. Upstream diversions of river water, poaching of wildlife or uncontrolled immigration can destroy ecosystems that would...gratefully accepted. Executing its first mission in October, 1987 the BDF immediately made positive impacts and dramatically reduced poaching ...experience large scale, organized cross-border poaching which overwhelmed the Botswana Department of Wildlife and National Parks. By 1987 the situation

40 CFR 91.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2010 CFR

2010-07-01

... filter and HFID. Determine these gas temperatures by a temperature sensor located immediately upstream of.... (a) General. The exhaust gas sampling system described in this section is designed to measure the...-CVS must conform to all of the requirements listed for the exhaust gas PDP-CVS in § 91.420 of this...

40 CFR 91.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2011 CFR

2011-07-01

... filter and HFID. Determine these gas temperatures by a temperature sensor located immediately upstream of.... (a) General. The exhaust gas sampling system described in this section is designed to measure the...-CVS must conform to all of the requirements listed for the exhaust gas PDP-CVS in § 91.420 of this...

Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations.

PubMed

Nadjar-Boger, Elisabeth; Funkenstein, Bruria

2011-02-01

Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression.

PubMed

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-04-08

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.

LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).

PubMed

Hobson, Neil; Deyholos, Michael K

2013-04-01

Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.

Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing

PubMed Central

Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin

2012-01-01

Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

Mean velocities and Reynolds stresses upstream of a simulated wing-fuselage juncture

NASA Technical Reports Server (NTRS)

Mcmahon, H.; Hubbartt, J.; Kubendran, L. R.

1983-01-01

Values of three mean velocity components and six turbulence stresses measured in a turbulent shear layer upstream of a simulated wing-fuselage juncture and immediately downstream of the start of the juncture are presented nd discussed. Two single-sensor hot-wire probes were used in the measurements. The separated region just upstream of the wing contains an area of reversed flow near the fuselage surface where the turbulence level is high. Outside of this area the flow skews as it passes around the body, and in this skewed region the magnitude and distribution of the turbulent normal and shear stresses within the shear layer are modified slightly by the skewing and deceleration of the flow. A short distance downstream of the wing leading edge the secondary flow vortext is tightly rolled up and redistributes both mean flow and turbulence in the juncture. The data acquisition technique employed here allows a hot wire to be used in a reversed flow region to indicate flow direction.

The Near Naked Hairless (HrN) Mutation Disrupts Hair Formation but is not Due to a Mutation in the Hairless Coding Region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yutao; Das, Suchita; Olszewski, Robert Edward

Near naked hairless (HrN) is a semi-dominant mutation that arose spontaneously and was suggested by allelism testing to be an allele of mouse Hairless (Hr). HrN mice differ from other Hr mutants in that hair loss appears as the postnatal coat begins to emerge, as opposed to failure to initiate the first postnatal hair cycle, and that the mutation displays semi-dominant inheritance. We sequenced the Hr cDNA in HrN/HrN mice and characterized the pathological and molecular phenotypes to identify the basis for hair loss in this model. HrN/HrN mice exhibit dystrophic hairs that are unable to consistently emerge from themore » hair follicle, while HrN/+ mice display a sparse coat of hair and a milder degree of follicular dystrophy than their homozygous littermates. DNA microarray analysis of cutaneous gene expression demonstrates that numerous genes are downregulated in HrN/HrN mice, primarily genes important for hair structure. By contrast, Hr expression is significantly increased. Sequencing the Hr coding region, intron-exon boundaries, 5'- and 3'- UTR and immediate upstream region did not reveal the underlying mutation. Therefore HrN does not appear to be an allele of Hr but may result from a mutation in a closely linked gene or from a regulatory mutation in Hr.« less

U6 small nuclear RNA is transcribed by RNA polymerase III.

PubMed Central

Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T

1986-01-01

A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970

Situation models and memory: the effects of temporal and causal information on recall sequence.

PubMed

Brownstein, Aaron L; Read, Stephen J

2007-10-01

Participants watched an episode of the television show Cheers on video and then reported free recall. Recall sequence followed the sequence of events in the story; if one concept was observed immediately after another, it was recalled immediately after it. We also made a causal network of the show's story and found that recall sequence followed causal links; effects were recalled immediately after their causes. Recall sequence was more likely to follow causal links than temporal sequence, and most likely to follow causal links that were temporally sequential. Results were similar at 10-minute and 1-week delayed recall. This is the most direct and detailed evidence reported on sequential effects in recall. The causal network also predicted probability of recall; concepts with more links and concepts on the main causal chain were most likely to be recalled. This extends the causal network model to more complex materials than previous research.

Physical map location of the multicopy genes coding for ammonia monooxygenase and hydroxylamine oxidoreductase in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11.

PubMed

Hirota, R; Yamagata, A; Kato, J; Kuroda, A; Ikeda, T; Takiguchi, N; Ohtake, H

2000-02-01

Pulsed-field gel electrophoresis of PmeI digests of the Nitrosomonas sp. strain ENI-11 chromosome produced four bands ranging from 1,200 to 480 kb in size. Southern hybridizations suggested that a 487-kb PmeI fragment contained two copies of the amoCAB genes, coding for ammonia monooxygenase (designated amoCAB(1) and amoCAB(2)), and three copies of the hao gene, coding for hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)). In this DNA fragment, amoCAB(1) and amoCAB(2) were about 390 kb apart, while hao(1), hao(2), and hao(3) were separated by at least about 100 kb from each other. Interestingly, hao(1) and hao(2) were located relatively close to amoCAB(1) and amoCAB(2), respectively. DNA sequence analysis revealed that hao(1) and hao(2) shared 160 identical nucleotides immediately upstream of each translation initiation codon. However, hao(3) showed only 30% nucleotide identity in the 160-bp corresponding region.

Physical Map Location of the Multicopy Genes Coding for Ammonia Monooxygenase and Hydroxylamine Oxidoreductase in the Ammonia-Oxidizing Bacterium Nitrosomonas sp. Strain ENI-11

PubMed Central

Hirota, Ryuichi; Yamagata, Akira; Kato, Junichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao

2000-01-01

Pulsed-field gel electrophoresis of PmeI digests of the Nitrosomonas sp. strain ENI-11 chromosome produced four bands ranging from 1,200 to 480 kb in size. Southern hybridizations suggested that a 487-kb PmeI fragment contained two copies of the amoCAB genes, coding for ammonia monooxygenase (designated amoCAB1 and amoCAB2), and three copies of the hao gene, coding for hydroxylamine oxidoreductase (hao1, hao2, and hao3). In this DNA fragment, amoCAB1 and amoCAB2 were about 390 kb apart, while hao1, hao2, and hao3 were separated by at least about 100 kb from each other. Interestingly, hao1 and hao2 were located relatively close to amoCAB1 and amoCAB2, respectively. DNA sequence analysis revealed that hao1 and hao2 shared 160 identical nucleotides immediately upstream of each translation initiation codon. However, hao3 showed only 30% nucleotide identity in the 160-bp corresponding region. PMID:10633121

Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection

NASA Technical Reports Server (NTRS)

Harada, Kazuo; Orgel, Leslie E.

1993-01-01

We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.

A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

PubMed Central

Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

2000-01-01

Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

PubMed

Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

2013-01-01

Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

PubMed

Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

2014-11-01

The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

PubMed Central

2014-01-01

Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

Sense transcription through the S region is essential for immunoglobulin class switch recombination

PubMed Central

Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine

2011-01-01

Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751

40 CFR 63.4568 - What are the requirements for continuous parameter monitoring system installation, operation, and...

Code of Federal Regulations, 2010 CFR

2010-07-01

..., install a gas temperature monitor in the firebox of the thermal oxidizer or in the duct immediately... gas temperature monitors upstream and/or downstream of the catalyst bed as required in § 63.3967(b... (a) and (c)(3)(i) through (v) of this section for each gas temperature monitoring device. (i) Locate...

40 CFR 63.4568 - What are the requirements for continuous parameter monitoring system installation, operation, and...

Code of Federal Regulations, 2011 CFR

2011-07-01

..., install a gas temperature monitor in the firebox of the thermal oxidizer or in the duct immediately... gas temperature monitors upstream and/or downstream of the catalyst bed as required in § 63.3967(b... (a) and (c)(3)(i) through (v) of this section for each gas temperature monitoring device. (i) Locate...

Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

PubMed Central

Graveley, Brenton R.

2008-01-01

Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

PubMed Central

Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

2001-01-01

Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

PubMed

Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

1994-12-01

We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

PubMed Central

Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

1993-01-01

Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

Reducing DNA context dependence in bacterial promoters

PubMed Central

Carr, Swati B.; Densmore, Douglas M.

2017-01-01

Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998

Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

PubMed Central

O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

1999-01-01

Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the control of a constitutive promoter resulted in heterologous enterocin A production in both E. faecalis and Lactococcus lactis. PMID:10103244

Biodegradation of 17β-estradiol, estrone, and testosterone in stream sediments

USGS Publications Warehouse

Bradley, P.M.; Chapelle, F.H.; Barber, L.B.; McMahon, P.B.; Gray, J.L.; Kolpin, D.W.

2009-01-01

The release of endocrine-disrupting chemicals (EDCs) in wastewater treatment plant (WWTP) effluent poses a significant threat to the ecology of surface water receptors, due to impacts on the hormonal control, sexual development, reproductive success and community structure of the indigenous aquatic organisms and associated wildlife. Among the EDCs commonly observed in WWTP effluent, the natural [e.g., 17??-estradiol (E2) and estrone (E1)] and synthetic [e.g., ethynylestradiol (EE2)] estrogens are particular concerns owing to their high endocrine reactivity in both in vitro and in vivo laboratory models. These reproductive hormones have been identified as the primary cause of estrogenic effects in wastewater effluent, with greater than 95% of the estrogen receptor agonist activity in effluent attributed to this contaminant group. The potentials for in situ biodegradation of 17??-estradiol (E2), estrone (E1), and testosterone (T) were investigated in three, hydrologically-distinct, WWTP-impacted streams in the United States. Relative differences in the mineralization of [4-14C] substrates were assessed in oxic microcosms containing sediment or water-only from locations upstream and downstream of the WWTP outfall in each system. Upstream samples provided insight into the biodegradative potential of sediment microbial communities that were not under the immediate impact of WWTP effluent. Upstream sediment from all three systems demonstrated significant mineralization of the "A" ring of E2, E1 and T, with the potential of T biodegradation consistently greater than of E2 and no systematic difference in the potentials of E2 and E1. Downstream samples provided insight into the impacts of effluent on reproductive hormone biodegradation. Significant "A" ring mineralization was also observed in downstream sediment, with the potentials for E1 and T mineralization being substantially depressed relative to upstream samples. In marked contrast, the potentials for E2 mineralization immediately downstream of the WWTP outfalls were more than double that of upstream samples. E2 mineralization was also observed in water, albeit at insufficient rate to prevent substantial downstream transport in the water column. The results of this study indicate that, in combination with sediment sorption processes which effectively scavenge hydrophobic contaminants from the water column and immobilize them in the vicinity of the WWTP outfall, aerobic biodegradation of reproductive hormones can be an environmentally important mechanism for nonconservative (destructive) attenuation of hormonal endocrine disruptors in effluent-impacted streams.

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Biodegradation of 17β-estradiol, estrone and testosterone in stream sediments

USGS Publications Warehouse

Bradley, Paul M.; Barber, Larry B.; Chapelle, Francis H.; Gray, James L.; Kolpin, Dana W.; McMahon, Peter B.

2009-01-01

Biodegradation of 17β-estradiol (E2), estrone (E1), and testosterone (T) was investigated in three wastewater treatment plant (WWTP) affected streams in the United States. Relative differences in the mineralization of [4-14C] substrates were assessed in oxic microcosms containing saturated sediment or water-only from locations upstream and downstream of the WWTP outfall in each system. Upstream sediment demonstrated significant mineralization of the “A” ring of E2, E1, and T, with biodegradation of T consistently greater than that of E2 and no systematic difference in E2 and E1 biodegradation. “A” ring mineralization also was observed in downstream sediment, with E1 and T mineralization being substantially depressed relative to upstream samples. In marked contrast, E2 mineralization in sediment immediately downstream from the WWTP outfalls was more than double that in upstream sediment. E2 mineralization was observed in water, albeit at insufficient rate to prevent substantial downstream transport. The results indicate that, in combination with sediment sorption processes which effectively scavenge hydrophobic contaminants from the water column and immobilize them in the vicinity of the WWTP outfall, aerobic biodegradation of reproductive hormones can be an environmentally important mechanism for nonconservative (destructive) attenuation of hormonal endocrine disruptors in effluent-affected streams.

Responses of riparian reptile communities to damming and urbanization

USGS Publications Warehouse

Hunt, Stephanie D.; Guzy, Jacquelyn C.; Price, Steven J.; Halstead, Brian J.; Eskew, Evan A.; Dorcas, Michael E.

2013-01-01

Various anthropogenic pressures, including habitat loss, threaten reptile populations worldwide. Riparian zones are critical habitat for many reptile species, but these habitats are also frequently modified by anthropogenic activities. Our study investigated the effects of two riparian habitat modifications-damming and urbanization-on overall and species-specific reptile occupancy patterns. We used time-constrained search techniques to compile encounter histories for 28 reptile species at 21 different sites along the Broad and Pacolet Rivers of South Carolina. Using a hierarchical Bayesian analysis, we modeled reptile occupancy responses to a site's distance upstream from dam, distance downstream from dam, and percent urban land use. The mean occupancy response by the reptile community indicated that reptile occupancy and species richness were maximized when sites were farther upstream from dams. Species-specific occupancy estimates showed a similar trend of lower occupancy immediately upstream from dams. Although the mean occupancy response of the reptile community was positively related to distance downstream from dams, the occupancy response to distance downstream varied among species. Percent urban land use had little effect on the occupancy response of the reptile community or individual species. Our results indicate that the conditions of impoundments and subsequent degradation of the riparian zones upstream from dams may not provide suitable habitat for a number of reptile species.

RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

PubMed

KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

2018-06-20

Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

Overexpression of the Lactobacillus plantarum peptidoglycan biosynthesis murA2 gene increases the tolerance of Escherichia coli to alcohols and enhances ethanol production.

PubMed

Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T

2014-10-01

A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression

PubMed Central

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-01-01

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located ≈2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation. PMID:18385377

Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

PubMed Central

Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

2012-01-01

Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

PubMed

Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

2013-06-21

Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

PubMed Central

Gilmartin, G M; Fleming, E S; Oetjen, J

1992-01-01

The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

PubMed

Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

2015-12-01

Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

PubMed Central

Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

2006-01-01

The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

Induction of surfactin production in Bacillus subtilis by gsp, a gene located upstream of the gramicidin S operon in Bacillus brevis.

PubMed Central

Borchert, S; Stachelhaus, T; Marahiel, M A

1994-01-01

The deduced amino acid sequence of the gsp gene, located upstream of the 5' end of the gramicidin S operon (grs operon) in Bacillus brevis, showed a high degree of similarity to the sfp gene product, which is located downstream of the srfA operon in B. subtilis. The gsp gene complemented in trans a defect in the sfp gene (sfpO) and promoted production of the lipopeptide antibiotic surfactin. The functional homology of Gsp and Sfp and the sequence similarity of these two proteins to EntD suggest that the three proteins represent a new class of proteins involved in peptide secretion, in support of a hypothesis published previously (T. H. Grossman, M. Tuckman, S. Ellestad, and M. S. Osburne, J. Bacteriol. 175:6203-6211, 1993). Images PMID:7512553

VIZARD: analysis of Affymetrix Arabidopsis GeneChip data

NASA Technical Reports Server (NTRS)

Moseyko, Nick; Feldman, Lewis J.

2002-01-01

SUMMARY: The Affymetrix GeneChip Arabidopsis genome array has proved to be a very powerful tool for the analysis of gene expression in Arabidopsis thaliana, the most commonly studied plant model organism. VIZARD is a Java program created at the University of California, Berkeley, to facilitate analysis of Arabidopsis GeneChip data. It includes several integrated tools for filtering, sorting, clustering and visualization of gene expression data as well as tools for the discovery of regulatory motifs in upstream sequences. VIZARD also includes annotation and upstream sequence databases for the majority of genes represented on the Affymetrix Arabidopsis GeneChip array. AVAILABILITY: VIZARD is available free of charge for educational, research, and not-for-profit purposes, and can be downloaded at http://www.anm.f2s.com/research/vizard/ CONTACT: moseyko@uclink4.berkeley.edu.

Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

PubMed

Berends Sexton, T; Jones, J T; Mullet, J E

1990-05-01

A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon

PubMed Central

Haut, Donald D.; Pintel, D. J.

1998-01-01

Alternative splicing of pre-mRNAs plays a critical role in maximizing the coding capacity of the small parvovirus genome. The small-intron region of minute virus of mice (MVM) pre-mRNAs undergoes an unusual pattern of overlapping alternative splicing—using two donors (D1 and D2) and two acceptors (A1 and A2) within a region of 120 nucleotides—that determines the steady-state ratios of the various viral mRNAs. In this report, we show that the determinants that govern excision of the small intron are complex and are also required for efficient definition of the upstream exon. For the MVM small intron in its natural context, the two donors appear to compete for the splicing machinery: the position of D1 favors its usage, while the primary sequence of D2 must be more like the consensus sequence than is D1 to be used efficiently. We have genetically defined the branch points that are used for generation of the major and minor spliced forms and show that recognition of components of the small-intron acceptors is likely to be the dominant determinant in alternative small-intron excision. We have also identified a G-rich intronic enhancer sequence within the small intron that is essential for splicing of the minor form (D2 to A2) but not the major form (D1 to A1) of MVM mRNAs and is required for efficient definition of the upstream NS2-specific exon. In its natural context, the small intron appears to be excised by a mechanism consistent with intron definition. When the MVM small intron is expanded, various parameters of its excision are altered, indicating that critical cis-acting signals are context dependent. Relative use of the donors and acceptors is altered, and the upstream NS2-specific exon is no longer efficiently defined. The fact that definition of the upstream NS2-specific exon can be achieved by the MVM small intron in its natural context, but not when it is expanded, suggests that the multiple determinants that govern definition and excision of the small intron are required, in concert, for upstream exon definition. Our data are consistent with a model in which alternative splicing of the MVM P4-generated pre-mRNAs is governed by a hybrid of intron- and exon-defining mechanisms. PMID:9499034

Genetic diversity among the Eurytemora affinis species complex in the Scheldt estuary and its tributaries using ISSR-PCR marker assay

NASA Astrophysics Data System (ADS)

Gasmi, S.; Ferval, M.; Pelissier, C.; D'Amico, F.; Maris, T.; Tackx, M.; Legal, L.

2014-05-01

As an estuary being restored, the Scheldt (Belgium/The Netherlands) offers an interesting setting to study the response of organisms and ecosystems to changing conditions. This study specifically deals with this with regard to the spatio-temporal distribution and possible genetic differentiation among the species complex Eurytemora affinis (copepoda, calanoida). Until the 1990s, E. affinis typically occurred downstream the Scheldt estuary (Belgium/The Netherlands). In parallel to water quality improvement, E.affinis has recently also occurred upstream the estuary and in some of the tributaries. This paper aims to assess the origin of the copepod sibling species complex E. affinis occurring upstream the Scheldt estuary through genetic characterization. Using the Inter Simple Sequence Repeat (ISSR) technique, we explored genetic pools of the E. affinis complex in three Scheldt localities (downstream, middle-estuary and upstream) and two of its tributaries. Four ISSR primers produced 75 polymorphic loci. Bayesian and hierarchical analysis revealed different but close genetic entities in both down and upstream localities. The middle-estuary individuals were genetically a composite mix of downstream and upstream populations (84% from downstream and 16% from upstream). A distinctive separation of the tributaries and the main Scheldt stream populations suggests that two fully independent genetic pools are present. It is of note that the tributaries showed a lack of genetic subdivision, that upstream and downstream E. affinis populations are closely related, and that the downstream population is most likely at the origin of the upstream one, which implies the necessity to guarantee sufficient oxygen concentration levels throughout the estuarine continuum to guarantee the presence of this species upstream. The results of the ISSR technique are discussed in comparison with genetic studies on E. affinis using COI barcoding.

Experimental investigation of sound generation by a protuberance in a laminar boundary layer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kobayashi, M.; Asai, M.; Inasawa, A.

2014-08-15

Sound radiation from a two-dimensional protuberance glued on the wall in a laminar boundary layer was investigated experimentally at low Mach numbers. When the protuberance was as high as the boundary-layer thickness, a feedback-loop mechanism set in between protuberance-generated sound and Tollmien-Schlichting (T-S) waves generated by the leading-edge receptivity to the upstream-propagating sound. Although occurrence of a separation bubble immediately upstream of the protuberance played important roles in the evolution of instability waves into vortices interacting with the protuberance, the frequency of tonal vortex sound was determined by the selective amplification of T-S waves in the linear instability stage upstreammore » of the separation bubble and was not affected by the instability of the separation bubble.« less

Introduction to Blueweb: A Decentralized Scatternet Formation Algorithm for Bluetooth Ad Hoc Networks

NASA Astrophysics Data System (ADS)

Yu, Chih-Min; Huang, Chia-Chi

In this letter, a decentralized scatternet formation algorithm called Bluelayer is proposed. First, Bluelayer uses a designated root to construct a tree-shaped subnet and propagates an integer variable k1 called counter limit as well as a constant k in its downstream direction to determine new roots. Then each new root asks its upstream master to start a return connection procedure to convert the tree-shaped subnet into a web-shaped subnet for its immediate upstream root. At the same time, each new root repeats the same procedure as the root to build its own subnet until the whole scatternet is formed. Simulation results show that Bluelayer achieves good network scalability and generates an efficient scatternet configuration for various sizes of Bluetooth ad hoc network.

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

PubMed

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Chunk formation in immediate memory and how it relates to data compression.

PubMed

Chekaf, Mustapha; Cowan, Nelson; Mathy, Fabien

2016-10-01

This paper attempts to evaluate the capacity of immediate memory to cope with new situations in relation to the compressibility of information likely to allow the formation of chunks. We constructed a task in which untrained participants had to immediately recall sequences of stimuli with possible associations between them. Compressibility of information was used to measure the chunkability of each sequence on a single trial. Compressibility refers to the recoding of information in a more compact representation. Although compressibility has almost exclusively been used to study long-term memory, our theory suggests that a compression process relying on redundancies within the structure of the list materials can occur very rapidly in immediate memory. The results indicated a span of about three items when the list had no structure, but increased linearly as structure was added. The amount of information retained in immediate memory was maximal for the most compressible sequences, particularly when information was ordered in a way that facilitated the compression process. We discuss the role of immediate memory in the rapid formation of chunks made up of new associations that did not already exist in long-term memory, and we conclude that immediate memory is the starting place for the reorganization of information. Copyright © 2016 Elsevier B.V. All rights reserved.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Two Functional Copies of the DGCR6 Gene Are Present on Human Chromosome 22q11 Due to a Duplication of an Ancestral Locus

PubMed Central

Edelmann, Lisa; Stankiewicz, Pavel; Spiteri, Elizabeth; Pandita, Raj K.; Shaffer, Lisa; Lupski, James; Morrow, Bernice E.

2001-01-01

The DGCR6 (DiGeorge critical region) gene encodes a putative protein with sequence similarity to gonadal (gdl), a Drosophila melanogaster gene of unknown function. We mapped the DGCR6 gene to chromosome 22q11 within a low copy repeat, termed sc11.1a, and identified a second copy of the gene, DGCR6L, within the duplicate locus, termed sc11.1b. Both sc11.1 repeats are deleted in most persons with velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), and they map immediately adjacent and internal to the low copy repeats, termed LCR22, that mediate the deletions associated with VCFS/DGS. We sequenced genomic clones from both loci and determined that the putative initiator methionine is located further upstream than originally described, but in a position similar to the mouse and chicken orthologs. DGCR6L encodes a highly homologous, functional copy of DGCR6, with some base changes rendering amino acid differences. Expression studies of the two genes indicate that both genes are widely expressed in fetal and adult tissues. Evolutionary studies using FISH mapping in several different species of ape combined with sequence analysis of DGCR6 in a number of different primate species indicate that the duplication is at least 12 million years old and may date back to before the divergence of Catarrhines from Platyrrhines, 35 mya. These data suggest that there has been selective evolutionary pressure toward the functional maintenance of both paralogs. Interestingly, a full-length HERV-K provirus integrated into the sc11.1a locus after the divergence of chimpanzees and humans. PMID:11157784

Representation of item position in immediate serial recall: Evidence from intrusion errors.

PubMed

Fischer-Baum, Simon; McCloskey, Michael

2015-09-01

In immediate serial recall, participants are asked to recall novel sequences of items in the correct order. Theories of the representations and processes required for this task differ in how order information is maintained; some have argued that order is represented through item-to-item associations, while others have argued that each item is coded for its position in a sequence, with position being defined either by distance from the start of the sequence, or by distance from both the start and the end of the sequence. Previous researchers have used error analyses to adjudicate between these different proposals. However, these previous attempts have not allowed researchers to examine the full set of alternative proposals. In the current study, we analyzed errors produced in 2 immediate serial recall experiments that differ in the modality of input (visual vs. aural presentation of words) and the modality of output (typed vs. spoken responses), using new analysis methods that allow for a greater number of alternative hypotheses to be considered. We find evidence that sequence positions are represented relative to both the start and the end of the sequence, and show a contribution of the end-based representation beyond the final item in the sequence. We also find limited evidence for item-to-item associations, suggesting that both a start-end positional scheme and item-to-item associations play a role in representing item order in immediate serial recall. (c) 2015 APA, all rights reserved).

Mapping contacts between gRNA and mRNA in trypanosome RNA editing.

PubMed

Leung, S S; Koslowsky, D J

1999-02-01

All guide RNAs (gRNAs) identified to date have defined 5' anchor sequences, guiding sequences and a non-encoded 3' uridylate tail. The 5' anchor is required for in vitro editing and is thought to be responsible for selection and binding to the pre-edited mRNA. Little is known, however, about how the gRNAs are used to direct RNA editing. Utilizing the photo-reactive crosslinking agent, azidophenacyl (APA), attached to the 5'- or 3'-terminus of the gRNA, we have begun to map the structural relationships between the different defined regions of the gRNA with the pre-edited mRNA. Analyses of crosslinked conjugates produced with a 5'-terminal APA group confirm that the anchor of the gRNA is correctly positioning the interacting molecules. 3' Crosslinks (X-linker placed at the 3'-end of a U10tail) have also been mapped for three different gRNA/mRNA pairs. In all cases, analyses indicate that the U-tail can interact with a range of nucleotides located upstream of the first edited site. It appears that the U-tail prefers purine-rich sites, close to the first few editing sites. These results suggest that the U-tail may act in concert with the anchor to melt out secondary structure in the mRNA in the immediate editing domain, possibly increasing the accessibility of the editing complex to the proper editing sites.

Genetic analysis of the dsz promoter and associated regulatory regions of Rhodococcus erythropolis IGTS8.

PubMed Central

Li, M Z; Squires, C H; Monticello, D J; Childs, J D

1996-01-01

The dsz gene cluster of Rhodococcus erythropolis IGTS8 comprises three genes, dszA, dszB, and dszC, whose products are involved in the conversion of dibenzothiophene (DBT) to 2-hydroxybiphenyl and sulfite. This organism can use DBT as the sole sulfur source but not as a carbon source. Dsz activity is repressed by methionine, cysteine, Casamino Acids, and sulfate but not by DBT or dimethyl sulfoxide. We cloned 385 bp of the DNA immediately 5' to dszA in front of the reporter gene lacZ of Escherichia coli. We showed that this region contains a Rhodococcus promoter and at least three dsz regulatory regions. After hydrazine mutagenesis of this DNA, colonies that were able to express beta-galactosidase in the presence of Casamino Acids were isolated. Sequencing of these mutants revealed two possible regulatory regions. One is at -263 to -244, and the other is at -93 to -38, where -1 is the base preceding the A of the initiation codon ATG of dszA. An S1 nuclease protection assay showed that the start of the dsz promoter is the G at -46 and that transcription is repressed by sulfate and cysteine but not by dimethyl sulfoxide. The promoter encompasses a region of potential diad symmetry that may contain an operator. Immediately upstream of the promoter is a protein-binding domain between -146 and -121. Deletion of this region did not affect repression, but promoter activity appeared to be reduced by threefold. Thus, it could be an activator binding site or an enhancer region. PMID:8932295

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

PubMed

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Effects of an oil spill on leafpack-inhabiting macroinvertebrates in the Chariton river, Missouri

USGS Publications Warehouse

Poulton, B.C.; Callahan, E.V.; Hurtubise, R.D.; Mueller, B.G.

1998-01-01

Artificial leaf packs were used to determine the effects of an oil spill on stream macroinvertebrate communities in the Chariton River, Missouri. Plastic mesh leaf retainers with approximately 10 g of leaves from five tree species were deployed at five sites (two upstream of the spill and three downstream) immediately after the spill and one year later. Four macroinvertebrate species dominating the community at upstream sites were virtually eliminated below the spill, including the stonefly Isoperla bilineata, the caddisfly Potamyia flava, the midge Thienemanniella xena, and blackfly larvae (Simulium sp.). Density of collector and shredder functional groups, and number of shredder taxa differed between upstream sites and the two furthest downstream sites during the 1990 sample period (Kruskal-Wallis w/Bonferroni paired comparisons, experiment wise error rate = 0.05). With one exception, no differences between sites were detected in the 1991-1992 sample period, indicating that the benthic community had at least partially recovered from the oil spill after one year. The odds of obtaining a sample with a small abundance of shredders (abundance < median) in 1990 was significantly greater downstream of the spill than upstream, and the odds of obtaining a sample with a small abundance of shredders at downstream sites was greater in 1990 than in 1991-1992. A similar pattern was observed in abundance and taxa richness of the collector functional group. No significant differences between the two sampling periods were detected at upstream sites. Observed effects appeared to be associated with oil sorption and substrate coating, creating conditions unsuitable for successful colonization.

Modulation of tissue repair by regeneration enhancer elements.

PubMed

Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

2016-04-14

How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

Translation of the mRNA of the maize transcriptional activator Opaque-2 is inhibited by upstream open reading frames present in the leader sequence.

PubMed Central

Lohmer, S; Maddaloni, M; Motto, M; Salamini, F; Thompson, R D

1993-01-01

The protein encoded by the Opaque-2 (O2) gene is a transcription factor, translated from an mRNA that possesses an unusually long 5' leader sequence containing three upstream open reading frames (uORFs). The efficiency of translation of O2 mRNA has been tested in vivo by a transient assay in which the level of activation of the b32 promoter, a natural target of O2 protein, is measured. We show that uORF-less O2 alleles possess a higher transactivation value than the wild-type allele and that the reduction in transactivation due to the uORFs is a cis-dominant effect. The data presented indicate that both uORF1 and uORF2 are involved in the reducing effect and suggest that both are likely to be translated. PMID:8439744

Human Promoters Are Intrinsically Directional

PubMed Central

Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe

2015-01-01

Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469

Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

PubMed

Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

2017-11-01

Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

PubMed Central

Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

2010-01-01

Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

Examining microbial community response to a strong chemical gradient: the effects of surface coal mining on stream bacteria

NASA Astrophysics Data System (ADS)

Bier, R.; Lindberg, T. T.; Wang, S.; Ellis, J. C.; Di Giulio, R. T.; Bernhardt, E. S.

2012-12-01

Surface coal mining is the dominant form of land cover change in northern and central Appalachia. In this process, shallow coal seams are exposed by removing overlying rock with explosives. The resulting fragmented carbonate rock and coal residues are disposed of in stream valleys. These valley fills generate alkaline mine drainage (AlkMD), dramatically increasing alkalinity, ionic strength, substrate supply (esp. SO42-), and trace element (Mn, Li, Se, U) concentrations in downstream rivers as well as significant losses of sensitive fish and macroinvertebrate species. In prior work within the Mud River, which drains the largest surface mine complex in Appalachia, we found that concentrations of AlkMD increase proportionally with the extent of upstream mining. Here we ask "How do stream microbial communities change along this strong chemical gradient?" We collected surface water and benthic biofilms from 25 stream reaches throughout the Mud River spanning the full range of surface mining impacts, with 0-96% of the contributing watershed area converted to surface coal mines. Microbial communities were collected from biofilms grown on a common substrate (red maple veneers) that were incubated in each stream reach for four months prior to collection in April, 2011. 16S rRNA genes from microbial communities at each study site were examined using 454 sequencing and compared with a generalized UniFrac distance matrix (674 sequence eveness) that was used in statistical analyses. Water chemistry at the sites was sampled monthly from July 2010 to December 2010 and again in April 2011. In April, surface water concentrations of SO42-, Ca2+, Mg2+, and Se2- increased linearly with the extent of upstream mining (all regressions R2 >0.43; p<0.004), with the resulting gradient in ionic strength extending from low conductivity (average 83 μS cm-1 S.E. 27.4) in unmined streams (n=6) to as high as 899 μS cm-1 in the mainstem and 1889 μS cm-1 immediately below the Connelly Branch valley fill. Across this gradient, we found that microbial community composition varied significantly between sites receiving mine drainage and those that were unexposed (NMDS ordination R2 =0.86; PERMANOVA; p=0.029). Bacterial diversity (OTU richness defined at 3% sequence difference) peaked at intermediate conductivities (600 μS cm-1). Environmental data that correlated significantly with the ordination axes were a variety of surface water ions characteristic of AlkMD (SO42-, Mg2+, Sr2+, Se2-, and U) as well as stream DOC concentrations (p < 0.001).

The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae)

PubMed Central

Liao, Fang; Wang, Lin; Wu, Song; Li, Yu-Ping; Zhao, Lei; Huang, Guo-Ming; Niu, Chun-Jing; Liu, Yan-Qun; Li, Ming-Gang

2010-01-01

The complete mitochondrial genome (mitogenome) of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae) was determined. The genome is a circular molecule 15 481 bp long. It presents a typical gene organization and order for completely sequenced lepidopteran mitogenomes, but differs from the insect ancestral type for the placement of tRNAMet. The nucleotide composition of the genome is also highly A + T biased, accounting for 80.38%, with a slightly positive AT skewness (0.010), indicating the occurrence of more As than Ts, as found in the Noctuoidea species. All protein-coding genes (PCGs) are initiated by ATN codons, except for COI, which is tentatively designated by the CGA codon as observed in other lepidopterans. Four of 13 PCGs harbor the incomplete termination codon, T or TA. All tRNAs have a typical clover-leaf structure of mitochondrial tRNAs, except for tRNASer(AGN), the DHU arm of which could not form a stable stem-loop structure. The intergenic spacer sequence between tRNASer(AGN) and ND1 also contains the ATACTAA motif, which is conserved across the Lepidoptera order. The H. cunea A+T-rich region of 357 bp is comprised of non-repetitive sequences, but harbors several features common to the Lepidoptera insects, including the motif ATAGA followed by an 18 bp poly-T stretch, a microsatellite-like (AT)8 element preceded by the ATTTA motif, an 11 bp poly-A present immediately upstream tRNAMet. The phylogenetic analyses support the view that the H. cunea is closerly related to the Lymantria dispar than Ochrogaster lunifer, and support the hypothesis that Noctuoidea (H. cunea, L. dispar, and O. lunifer) and Geometroidea (Phthonandria atrilineata) are monophyletic. However, in the phylogenetic trees based on mitogenome sequences among the lepidopteran superfamilies, Papillonoidea (Artogeia melete, Acraea issoria, and Coreana raphaelis) joined basally within the monophyly of Lepidoptera, which is different to the traditional classification. PMID:20376208

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

PubMed Central

Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

1988-01-01

We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

Dominant integration locus drives continuous diversification of plant immune receptors with exogenous domain fusions.

PubMed

Bailey, Paul C; Schudoma, Christian; Jackson, William; Baggs, Erin; Dagdas, Gulay; Haerty, Wilfried; Moscou, Matthew; Krasileva, Ksenia V

2018-02-19

The plant immune system is innate and encoded in the germline. Using it efficiently, plants are capable of recognizing a diverse range of rapidly evolving pathogens. A recently described phenomenon shows that plant immune receptors are able to recognize pathogen effectors through the acquisition of exogenous protein domains from other plant genes. We show that plant immune receptors with integrated domains are distributed unevenly across their phylogeny in grasses. Using phylogenetic analysis, we uncover a major integration clade, whose members underwent repeated independent integration events producing diverse fusions. This clade is ancestral in grasses with members often found on syntenic chromosomes. Analyses of these fusion events reveals that homologous receptors can be fused to diverse domains. Furthermore, we discover a 43 amino acid long motif associated with this dominant integration clade which is located immediately upstream of the fusion site. Sequence analysis reveals that DNA transposition and/or ectopic recombination are the most likely mechanisms of formation for nucleotide binding leucine rich repeat proteins with integrated domains. The identification of this subclass of plant immune receptors that is naturally adapted to new domain integration will inform biotechnological approaches for generating synthetic receptors with novel pathogen "baits."

Dmc1 of Schizosaccharomyces pombe plays a role in meiotic recombination.

PubMed

Fukushima, K; Tanaka, Y; Nabeshima, K; Yoneki, T; Tougan, T; Tanaka, S; Nojima, H

2000-07-15

We report here a Schizosaccharomyces pombe gene (dmc1(+)) that resembles budding yeast DMC1 in the region immediately upstream of the rad24(+) gene. We showed by northern and Southern blot analysis that dmc1(+) and rad24(+) are co-transcribed as a bicistronic mRNA of 2.8 kb with meiotic specificity, whereas rad24(+) itself is constitutively transcribed as a 1.0-kb mRNA species during meiosis. Induction of the bicistronic transcript is under the control of a meiosis-specific transcription factor, Ste11. Disruption of both dmc1(+) and rad24(+) had no effect on mitosis or spore formation, and dmc1Delta cells displayed no change in sensitivity to UV or gamma irradiation relative to the wild type. Tetrad analysis indicated that Dmc1 is involved in meiotic recombination. Analysis of gene conversion frequencies using single and double mutants of dmc1 and rhp51 indicated that both Dmc1 and Rhp51 function in meiotic gene conversion. These observations, together with a high level of sequence identity, indicate that the dmc1(+) gene of S. POMBE: is a structural homolog of budding yeast DMC1, sharing both similar and distinct functions in meiosis.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

PubMed

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

Characterization of Cer-1 cis-regulatory region during early Xenopus development.

PubMed

Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

2011-05-01

Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

Streamflow gain-loss characteristics of Elkhead Creek downstream from Elkhead Reservoir near Craig, Colorado, 2009

USGS Publications Warehouse

Ruddy, Barbara C.

2010-01-01

The U.S. Geological Survey (USGS), in cooperation with the Colorado Water Conservation Board, the Upper Colorado River Endangered Fish Recovery Program (UCREFRP), Colorado Division of Water Resources, and City of Craig studied the gain-loss characteristics of Elkhead Creek downstream from Elkhead Reservoir to the confluence with the Yampa River during August through October 2009. Earlier qualitative interpretation of streamflow data downstream from the reservoir indicated that there could be a transit loss of nearly 10 percent. This potential loss could be a significant portion of the releases from Elkhead Reservoir requested by UCREFRP during late summer and early fall for improving critical habitat for endangered fish downstream in the Yampa River. Information on the gain-loss characteristics was needed for the effective management of the reservoir releases. In order to determine streamflow gain-loss characteristics for Elkhead Creek, eight measurement sets were made at four strategic instream sites and at one diversion from August to early October 2009. An additional measurement set was made after the study period during low-flow conditions in November 2009. Streamflow measurements were made using an Acoustic Doppler Velocimeter to provide high accuracy and consistency, especially at low flows. During this study, streamflow ranged from about 5 cubic feet per second up to more than 90 cubic feet per second with step increments in between. Measurements were made at least 24 hours after a change in reservoir release (streamflow) during steady-state conditions. The instantaneous streamflow measurements and the streamflow volume comparisons show the reach of Elkhead Creek immediately downstream from Elkhead Reservoir to the streamflow-gaging station 09246500, Elkhead Creek near Craig, CO, is neither a gaining nor losing reach. The instantaneous measurements immediately downstream from the dam and the combined measurements of Norvell ditch plus streamflow-gaging station 09246500 are mostly within the plus or minus 5-percent measurement error of each other. The variability of data is such that sometimes the streamflow is greater upstream than downstream and sometimes the streamflow is greater downstream than upstream. Streamflow volumes were calculated for multiple time periods as determined by a change in release from the reservoir. Streamflow volumes were greater downstream than upstream for all but one time period. The predominance of greater streamflows downstream is due to the difference between the USGS instantaneous measurements and record computation with the Supervisory Control and Data Acquisition (SCADA) record at the dam. Immediately following an increase in streamflow from the reservoir, the downstream volume was smaller than the upstream volume, but this was an artifact of the traveltime between the two sites and possibly small amounts of water entering the streambank. Traveltimes were shorter at higher streamflows and when streamflow was increasing.

Neoadjuvant Radiotherapy: Changing the Treatment Sequence to Allow Immediate Free Autologous Breast Reconstruction.

PubMed

Hughes, Kimberley; Neoh, Derek

2018-06-16

 Locally advanced breast cancer (LABC) is traditionally treated with a multimodal approach of chemotherapy, surgery, and postmastectomy radiotherapy (PMRT). The advantages of immediate breast reconstruction (IBR) are well described and include improved aesthetic outcomes, fewer surgical procedures, shorter treatment period, and a higher quality of life. However, this sequence makes immediate free autologous reconstruction more challenging as PMRT can have deleterious and unpredictable effects on the flap. We have reversed this treatment sequence with neoadjuvant chemotherapy and radiotherapy, followed by mastectomy and immediate free autologous reconstruction. To our knowledge, this is the first series to assess the outcomes of neoadjuvant radiotherapy on immediate free microvascular breast reconstruction.  A review of patients with LABC who underwent immediate free autologous breast reconstruction post neoadjuvant chemoradiotherapy between 2013 and 2017 was conducted. All reconstructions were performed by a single reconstructive team. The primary end points were flap failure and surgical complications. Secondary end points were pathological response rate and disease recurrence.  A total of 40 women with an average age of 48.1 (36-61) and average body mass index of 25.6 (18-37) were included. The most common choice of flap was immediate deep inferior epigastric perforator (DIEP, 31), followed by transverse or diagonal upper gracilis (5), muscle-sparing transversus abdominis (3), and stacked DIEP (1). Our major complication rate was 12.5% and minor complication 15%. There were no cases of local recurrence and only three cases (7.5%) of distant disease progression.  From our experience, this treatment sequence allows patients to have an immediate gold standard reconstruction without an increase in surgical morbidity. It affords the benefits of IBR without concern in delaying adjuvant therapy and appears to be safe from an oncological perspective. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

PubMed

Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

2013-12-01

The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Modification of suburban carbon and nitrogen fluxes by a coupled channel/floodplain system assessed using in situ sensors

NASA Astrophysics Data System (ADS)

Wollheim, W. M.; Pellerin, B. A.; Saraceno, J.; Hopkinson, C.; Hope, A.; Morse, N.

2010-12-01

Biogeochemical fluxes in human dominated streams and rivers are highly impacted, but effects can be attenuated downstream through natural ecosystem processes. We deployed in situ nitrate, fdom, and chlorophyll sensors to characterize biogeochemical fluxes draining a suburban catchment, and modifications by a channel-floodplain system located immediately downstream. The upstream site reflects the suburban signal; the downstream site reflects the influence of the channel/floodplain on the suburban signal. FDOM showed a diurnal signal at both sites, but was stronger downstream, likely indicating new DOC production within the channel-floodplain system, which contained a small pond. In situ chlorophyll concentrations were also highly correlated with FDOM. FDOM showed a stronger storm response upstream than downstream, indicating terrestrial sources are mobilized by storms and subsequent dampening of the pulse by the floodplain. Nitrate concentrations consistently dropped from 0.6 to 0.7 mg/l upstream to less than 0.4 mg/l downstream, indicating likely nitrogen retention or removal over a relatively short distance (~500m). Use of in situ sensors is likely to greatly advance our understanding of biogeochemical processes in aquatic systems.

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

2010-10-15

Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

Channel evolution on the dammed Elwha River, Washington, USA

USGS Publications Warehouse

Draut, A.E.; Logan, J.B.; Mastin, M.C.

2011-01-01

Like many rivers in the western U.S., the Elwha River, Washington, has changed substantially over the past century in response to natural and human forcing. The lower river is affected by two upstream dams that are slated for removal as part of a major river restoration effort. In preparation for studying the effects of dam removal, we present a comprehensive field and aerial photographic analysis of dam influence on an anabranching, gravel-bed river. Over the past century with the dams in place, loss of the upstream sediment supply has caused spatial variations in the sedimentary and geomorphic character of the lower Elwha River channel. Bed sediment is armored and better sorted than on the naturally evolving bed upstream of the dams. On time scales of flood seasons, the channel immediately below the lower dam is fairly stable, but progresses toward greater mobility downstream such that the lowermost portion of the river responded to a recent 40-year flood with bank erosion and bed-elevation changes on a scale approaching that of the natural channel above the dams. In general, channel mobility in the lowest 4 km of the Elwha River has not decreased substantially with time. Enough fine sediment remains in the floodplain that – given sufficient flood forcing – the channel position, sinuosity, and braiding index change substantially. The processes by which this river accesses new fine sediment below the dams (rapid migration into noncohesive banks and avulsion of new channels) allow it to compensate for loss of upstream sediment supply more readily than would a dammed river with cohesive banks or a more limited supply of alluvium. The planned dam removal will provide a valuable opportunity to evaluate channel response to the future restoration of natural upstream sediment supply.

Paleogeomorphology of the early Colorado River inferred from relationships in Mohave and Cottonwood Valleys, Arizona, California and Nevada

USGS Publications Warehouse

Pearthree, Philip; House, P. Kyle

2014-01-01

Geologic investigations of late Miocene–early Pliocene deposits in Mohave and Cottonwood valleys provide important insights into the early evolution of the lower Colorado River system. In the latest Miocene these valleys were separate depocenters; the floor of Cottonwood Valley was ∼200 m higher than the floor of Mohave Valley. When Colorado River water arrived from the north after 5.6 Ma, a shallow lake in Cottonwood Valley spilled into Mohave Valley, and the river then filled both valleys to ∼560 m above sea level (asl) and overtopped the bedrock divide at the southern end of Mohave Valley. Sediment-starved water spilling to the south gradually eroded the outlet as siliciclastic Bouse deposits filled the lake upstream. When sediment accumulation reached the elevation of the lowering outlet, continued erosion of the outlet resulted in recycling of stored lacustrine sediment into downstream basins; depth of erosion of the outlet and upstream basins was limited by the water levels in downstream basins. The water level in the southern Bouse basin was ∼300 m asl (modern elevation) at 4.8 Ma. It must have drained and been eroded to a level <150 m asl soon after that to allow for deep erosion of bedrock divides and basins upstream, leading to removal of large volumes of Bouse sediment prior to massive early Pliocene Colorado River aggradation. Abrupt lowering of regional base level due to spilling of a southern Bouse lake to the Gulf of California could have driven observed upstream river incision without uplift. Rapid uplift of the entire region immediately after 4.8 Ma would have been required to drive upstream incision if the southern Bouse was an estuary.

Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

PubMed Central

Laimins, L; Holmgren-König, M; Khoury, G

1986-01-01

The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

Transfection and heat-inducible expression of molluscan promoter-luciferase reporter gene constructs in the Biomphalaria glabrata embryonic snail cell line.

PubMed

Yoshino, T P; Wu, X J; Liu, H D

1998-09-01

Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable integration and expression of snail genes of interest into the Bge cell line.

Dual Transcriptomic Profiling of Host and Microbiota during Health and Disease in Pediatric Asthma.

PubMed

Pérez-Losada, Marcos; Castro-Nallar, Eduardo; Bendall, Matthew L; Freishtat, Robert J; Crandall, Keith A

2015-01-01

High-throughput sequencing (HTS) analysis of microbial communities from the respiratory airways has heavily relied on the 16S rRNA gene. Given the intrinsic limitations of this approach, airway microbiome research has focused on assessing bacterial composition during health and disease, and its variation in relation to clinical and environmental factors, or other microbiomes. Consequently, very little effort has been dedicated to describing the functional characteristics of the airway microbiota and even less to explore the microbe-host interactions. Here we present a simultaneous assessment of microbiome and host functional diversity and host-microbe interactions from the same RNA-seq experiment, while accounting for variation in clinical metadata. Transcriptomic (host) and metatranscriptomic (microbiota) sequences from the nasal epithelium of 8 asthmatics and 6 healthy controls were separated in silico and mapped to available human and NCBI-NR protein reference databases. Human genes differentially expressed in asthmatics and controls were then used to infer upstream regulators involved in immune and inflammatory responses. Concomitantly, microbial genes were mapped to metabolic databases (COG, SEED, and KEGG) to infer microbial functions differentially expressed in asthmatics and controls. Finally, multivariate analysis was applied to find associations between microbiome characteristics and host upstream regulators while accounting for clinical variation. Our study showed significant differences in the metabolism of microbiomes from asthmatic and non-asthmatic children for up to 25% of the functional properties tested. Enrichment analysis of 499 differentially expressed host genes for inflammatory and immune responses revealed 43 upstream regulators differentially activated in asthma. Microbial adhesion (virulence) and Proteobacteria abundance were significantly associated with variation in the expression of the upstream regulator IL1A; suggesting that microbiome characteristics modulate host inflammatory and immune systems during asthma.

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

PubMed Central

KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

2017-01-01

Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

Identification, cloning, and sequencing of a fragment of Amsacta moorei entomopoxvirus DNA containing the spheroidin gene and three vaccinia virus-related open reading frames.

PubMed Central

Hall, R L; Moyer, R W

1991-01-01

Entomopoxvirus virions are frequently contained within crystalline occlusion bodies, which are composed of primarily a single protein, spheroidin, which is analogous to the polyhedrin protein of baculovirus. The spheroidin gene of Amsacta moorei entomopoxvirus was identified following the microsequencing of polypeptides generated from cyanogen bromide treatment of spheroidin and the subsequent synthesis of oligonucleotide hybridization probes. DNA sequencing of a 6.8-kb region of DNA containing the spheroidin gene showed that the spheroidin protein is derived from a 3.0-kb open reading frame potentially encoding a protein of 115 kDa. Three copies of the heptanucleotide, TTTTTNT, a sequence associated with early gene transcription in the vertebrate poxviruses, and four in-frame translational termination signals were found within 60 bp upstream of the putative spheroidin gene promoter (TAAATG). The spheroidin gene promoter region contains the sequence TAAATG, which is found in many late promoters of the vertebrate poxviruses and which serves as the site of transcriptional initiation, as shown by primer extension. Primer extension experiments also showed that spheroidin gene transcripts contain 5' poly(A) sequences typical of vertebrate poxvirus late transcripts. The 92 bases upstream of the initiating TAAATG are unusually A + T rich and contain only 7 G or C residues. An analysis of open reading frames around the spheroidin gene suggests that the colinear core of "essential genes" typical of the vertebrate poxviruses is absent in A. moorei entomopoxvirus. Images PMID:1942245

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

PubMed Central

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-01-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome. PMID:20392818

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

PubMed

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-08-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

Fungal Genes in Context: Genome Architecture Reflects Regulatory Complexity and Function

PubMed Central

Noble, Luke M.; Andrianopoulos, Alex

2013-01-01

Gene context determines gene expression, with local chromosomal environment most influential. Comparative genomic analysis is often limited in scope to conserved or divergent gene and protein families, and fungi are well suited to this approach with low functional redundancy and relatively streamlined genomes. We show here that one aspect of gene context, the amount of potential upstream regulatory sequence maintained through evolution, is highly predictive of both molecular function and biological process in diverse fungi. Orthologs with large upstream intergenic regions (UIRs) are strongly enriched in information processing functions, such as signal transduction and sequence-specific DNA binding, and, in the genus Aspergillus, include the majority of experimentally studied, high-level developmental and metabolic transcriptional regulators. Many uncharacterized genes are also present in this class and, by implication, may be of similar importance. Large intergenic regions also share two novel sequence characteristics, currently of unknown significance: they are enriched for plus-strand polypyrimidine tracts and an information-rich, putative regulatory motif that was present in the last common ancestor of the Pezizomycotina. Systematic consideration of gene UIR in comparative genomics, particularly for poorly characterized species, could help reveal organisms’ regulatory priorities. PMID:23699226

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

PubMed Central

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-01-01

Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

PubMed

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-04-28

In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

Relationship between wave energy and free energy from pickup ions in the Comet Halley environment

NASA Technical Reports Server (NTRS)

Huddleston, D. E.; Johnstone, A. D.

1992-01-01

The free energy available from the implanted heavy ion population at Comet Halley is calculated by assuming that the initial unstable velocity space ring distribution of the ions evolves toward a bispherical shell. Ultimately this free energy adds to the turbulence in the solar wind. Upstream and downstream free energies are obtained separately for the conditions observed along the Giotto spacecraft trajectory. The results indicate that the waves are mostly upstream propagating in the solar wind frame. The total free energy density always exceeds the measured wave energy density because, as expected in the nonlinear process of ion scattering, the available energy is not all immediately released. An estimate of the amount which has been released can be obtained from the measured oxygen ion distributions and again it exceeds that observed. The theoretical analysis is extended to calculate the k spectrum of the cometary-ion-generated turbulence.

Developmental Abilities to Form Chunks in Immediate Memory and Its Non-Relationship to Span Development.

PubMed

Mathy, Fabien; Fartoukh, Michael; Gauvrit, Nicolas; Guida, Alessandro

2016-01-01

Both adults and children -by the time they are 2-3 years old- have a general ability to recode information to increase memory efficiency. This paper aims to evaluate the ability of untrained children aged 6-10 years old to deploy such a recoding process in immediate memory. A large sample of 374 children were given a task of immediate serial report based on SIMON®, a classic memory game made of four colored buttons (red, green, yellow, blue) requiring players to reproduce a sequence of colors within which repetitions eventually occur. It was hypothesized that a primitive ability across all ages (since theoretically already available in toddlers) to detect redundancies allows the span to increase whenever information can be recoded on the fly. The chunkable condition prompted the formation of chunks based on the perceived structure of color repetition within to-be-recalled sequences of colors. Our result shows a similar linear improvement of memory span with age for both chunkable and non-chunkable conditions. The amount of information retained in immediate memory systematically increased for the groupable sequences across all age groups, independently of the average age-group span that was measured on sequences that contained fewer repetitions. This result shows that chunking gives young children an equal benefit as older children. We discuss the role of recoding in the expansion of capacity in immediate memory and the potential role of data compression in the formation of chunks in long-term memory.

Developmental Abilities to Form Chunks in Immediate Memory and Its Non-Relationship to Span Development

PubMed Central

Mathy, Fabien; Fartoukh, Michael; Gauvrit, Nicolas; Guida, Alessandro

2016-01-01

Both adults and children –by the time they are 2–3 years old– have a general ability to recode information to increase memory efficiency. This paper aims to evaluate the ability of untrained children aged 6–10 years old to deploy such a recoding process in immediate memory. A large sample of 374 children were given a task of immediate serial report based on SIMON®, a classic memory game made of four colored buttons (red, green, yellow, blue) requiring players to reproduce a sequence of colors within which repetitions eventually occur. It was hypothesized that a primitive ability across all ages (since theoretically already available in toddlers) to detect redundancies allows the span to increase whenever information can be recoded on the fly. The chunkable condition prompted the formation of chunks based on the perceived structure of color repetition within to-be-recalled sequences of colors. Our result shows a similar linear improvement of memory span with age for both chunkable and non-chunkable conditions. The amount of information retained in immediate memory systematically increased for the groupable sequences across all age groups, independently of the average age-group span that was measured on sequences that contained fewer repetitions. This result shows that chunking gives young children an equal benefit as older children. We discuss the role of recoding in the expansion of capacity in immediate memory and the potential role of data compression in the formation of chunks in long-term memory. PMID:26941675

Experimental RNomics in Aquifex aeolicus: identification of small non-coding RNAs and the putative 6S RNA homolog

PubMed Central

Willkomm, Dagmar K.; Minnerup, Jens; Hüttenhofer, Alexander; Hartmann, Roland K.

2005-01-01

By an experimental RNomics approach, we have generated a cDNA library from small RNAs expressed from the genome of the hyperthermophilic bacterium Aquifex aeolicus. The library included RNAs that were antisense to mRNAs and tRNAs as well as RNAs encoded in intergenic regions. Substantial steady-state levels in A.aeolicus cells were confirmed for several of the cloned RNAs by northern blot analysis. The most abundant intergenic RNA of the library was identified as the 6S RNA homolog of A.aeolicus. Although shorter in size (150 nt) than its γ-proteobacterial homologs (∼185 nt), it is predicted to have the most stable structure among known 6S RNAs. As in the γ-proteobacteria, the A.aeolicus 6S RNA gene (ssrS) is located immediately upstream of the ygfA gene encoding a widely conserved 5-formyltetrahydrofolate cyclo-ligase. We identifed novel 6S RNA candidates within the γ-proteobacteria but were unable to identify reasonable 6S RNA candidates in other bacterial branches, utilizing mfold analyses of the region immediately upstream of ygfA combined with 6S RNA blastn searches. By RACE experiments, we mapped the major transcription initiation site of A.aeolicus 6S RNA primary transcripts, located within the pheT gene preceding ygfA, as well as three processing sites. PMID:15814812

Novel mechanism of conjoined gene formation in the human genome.

PubMed

Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

2012-03-01

Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Carbapenem-Resistant Acinetobacter baumannii from Serbia: Revision of CarO Classification

PubMed Central

Novovic, Katarina; Mihajlovic, Sanja; Vasiljevic, Zorica; Filipic, Brankica; Begovic, Jelena; Jovcic, Branko

2015-01-01

Carbapenem-resistant A. baumannii present a significant therapeutic challenge for the treatment of nosocomial infections in many European countries. Although it is known that the gradient of A. baumannii prevalence increases from northern to southern Europe, this study provides the first data from Serbia. Twenty-eight carbapenem-resistant A. baumannii clinical isolates were collected at a Serbian pediatric hospital during a 2-year period. The majority of isolates (67.68%) belonged to the sequence type Group 1, European clonal complex II. All isolates harbored intrinsic OXA-51 and AmpC cephalosporinase. OXA-23 was detected in 16 isolates (57.14%), OXA-24 in 23 isolates (82.14%) and OXA-58 in 11 isolates (39.29%). Six of the isolates (21.43%) harbored all of the analyzed oxacillinases, except OXA-143 and OXA-235 that were not detected in this study. Production of oxacillinases was detected in different pulsotypes indicating the presence of horizontal gene transfer. NDM-1, VIM and IMP were not detected in analyzed clinical A. baumannii isolates. ISAba1 insertion sequence was present upstream of OXA-51 in one isolate, upstream of AmpC in 13 isolates and upstream of OXA-23 in 10 isolates. In silico analysis of carO sequences from analyzed A. baumannii isolates revealed the existence of two out of six highly polymorphic CarO variants. The phylogenetic analysis of CarO protein among Acinetobacter species revised the previous classification CarO variants into three groups based on strong bootstraps scores in the tree analysis. Group I comprises four variants (I-IV) while Groups II and III contain only one variant each. One half of the Serbian clinical isolates belong to Group I variant I, while the other half belongs to Group I variant III. PMID:25822626

Influence of Wastewater Discharge on the Metabolic Potential of the Microbial Community in River Sediments.

PubMed

Li, Dong; Sharp, Jonathan O; Drewes, Jörg E

2016-01-01

To reveal the variation of microbial community functions during water filtration process in river sediments, which has been utilized widely in natural water treatment systems, this study investigates the influence of municipal wastewater discharge to streams on the phylotype and metabolic potential of the microbiome in upstream and particularly various depths of downstream river sediments. Cluster analyses based on both microbial phylogenetic and functional data collectively revealed that shallow upstream sediments grouped with those from deeper subsurface downstream regions. These sediment samples were distinct from those found in shallow downstream sediments. Functional genes associated with carbohydrate, xenobiotic, and certain amino acid metabolisms were overrepresented in upstream and deep downstream samples. In contrast, the more immediate contact with wastewater discharge in shallow downstream samples resulted in an increase in the relative abundance of genes associated with nitrogen, sulfur, purine and pyrimidine metabolisms, as well as restriction-modification systems. More diverse bacterial phyla were associated with upstream and deep downstream sediments, mainly including Actinobacteria, Planctomycetes, and Firmicutes. In contrast, in shallow downstream sediments, genera affiliated with Betaproteobacteria and Gammaproteobacteria were enriched with putative functions that included ammonia and sulfur oxidation, polyphosphate accumulation, and methylotrophic bacteria. Collectively, these results highlight the enhanced capabilities of microbial communities residing in deeper stream sediments for the transformation of water contaminants and thus provide a foundation for better design of natural water treatment systems to further improve the removal of contaminants.

Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

PubMed

Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

2016-02-01

It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

Genetic characterization of the UCS and Kex1 loci of Pneumocystis jirovecii.

PubMed

Esteves, F; Tavares, A; Costa, M C; Gaspar, J; Antunes, F; Matos, O

2009-02-01

Nucleotide variation in the Pneumocystis jirovecii upstream conserved sequence (UCS) and kexin-like serine protease (Kex1) loci was studied in pulmonary specimens from Portuguese HIV-positive patients. DNA was extracted and used for specific molecular sequence analysis. The number of UCS tandem repeats detected in 13 successfully sequenced isolates ranged from three (9 isolates, 69%) to four (4 isolates, 31%). A novel tandem repeat pattern and two novel polymorphisms were detected in the UCS region. For the Kex1 gene, the wild-type (24 isolates, 86%) was the most frequent sequence detected among the 28 sequenced isolates. Nevertheless, a nonsynonymous (1 isolate, 3%) and three synonymous (3 isolates, 11%) polymorphisms were detected and are described here for the first time.

The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsugu, H.; Horowitz, R.; Gibson, N.

1994-12-01

Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

Observations on the Growth of Roughness Elements Into Icing Feathers

NASA Technical Reports Server (NTRS)

Vargas, Mario; Tsao, Jen, Ching

2007-01-01

This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.

Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.

PubMed

Hutsul, J A; Worobec, E

1994-02-01

An oligonucleotide that encodes the N-terminal portion of a 41 kDa porin of Serratia marcescens was used to probe S. marcescens UOC-51 genomic DNA. An 11 kb EcoRI fragment which hybridized with the oligonucleotide was subcloned into Escherichia coli, examined for expression, and sequenced. The product expressed by the cloned gene was 40 kDa. The nucleotide sequence has an ORF of 1.13 kb. When the deduced amino acid sequence was aligned and compared to other enterobacterial porins the cloned S. marcescens porin most closely resembled E. coli OmpC. Although we did not detect osmoregulation or thermoregulation of any porins in S. marcescens UOC-51, sequences analogous to the E. coli osmoregulator OmpR-binding regions are seen upstream to the cloned gene. We examined the regulation of the S. marcescens porin in E. coli and found that its expression increased in a high salt environment. A micF gene, whose transcriptional product functions to inhibit synthesis of OmpF by hybridizing with the ompF transcript, was also seen upstream of the S. marcescens ompC. An alignment with the E. coli micF gene revealed that the functional region of the S. marcescens micF gene is conserved. Based on the results obtained we have determined that S. marcescens UOC-51 produces a 40 kDa porin similar to the E. coli OmpC porin.

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

PubMed

Neuhaus, H; Link, G

1987-01-01

The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

Influence of Forced Flow on the Dendritic Growth of Fe-C Alloy: 3D vs 2D Simulation

NASA Astrophysics Data System (ADS)

Wang, Weiling; Wang, Zhaohui; Luo, Sen; Ji, Cheng; Zhu, Miaoyong

2017-12-01

A 3D parallel cellular automaton-finite volume method (CA-FVM) model was used to simulate the equiaxed dendritic growth of an Fe-0.82 wt pct C alloy with xy- in- out and xyz- in- out type forced flows and the columnar dendritic growth with y- in- out type forced flow. In addition, the similarities and differences between the results of the 3D and 2D models are discussed and summarized in detail. The capabilities of the 3D and 2D CA-FVM models to predict the dendritic growth of the alloy with forced flow are validated through comparison with the boundary layer correction and Oseen-Ivanstov models, respectively. Because the forced flow can pass around perpendicular arms of the dendrites, the secondary arms at the sides upstream from the perpendicular arms are more developed than those on the upstream side of the upstream arms, especially at higher inlet velocities. In addition, compared to the xy- in- out case, the growth of the downstream arms is less inhibited and the secondary arms are more developed in the xyz- in- out case because of the greater lateral flow around their tips. Compared to the 3D case, the 2D equiaxed dendrites are more asymmetrical and lack secondary arms because of the thicker solute envelope. In the 3D case, the columnar dendrites on the upstream side (left one) are promoted, while the middle and downstream dendrites are inhibited in sequence. However, the sequential inhibition starts on the upstream side in the 2D case. This is mainly because the melt can pass around the upstream branch in 3D space. However, it can only climb over the upstream tip in 2D space. Additionally, the secondary arms show upstream development, which is more significant with increasing inlet velocity. The level of development of the secondary arms is also affected by the decay of the forced flow in the flow direction.

DNA methylation inhibits expression and transposition of the Neurospora Tad retrotransposon.

PubMed

Zhou, Y; Cambareri, E B; Kinsey, J A

2001-06-01

Tad is a LINE-like retrotransposon of the filamentous fungus Neurospora crassa. We have analyzed both expression and transposition of this element using strains with a single copy of Tad located in the 5' noncoding sequences of the am (glutamate dehydrogenase) gene. Tad in this position has been shown to carry a de novo cytosine methylation signal which causes reversible methylation of both Tad and am upstream sequences. Here we find that methylation of the Tad sequences inhibits both Tad expression and transposition. This inhibition can be relieved by the use of 5-azacytidine, a drug which reduces cytosine methylation, or by placing the Tad/am sequences in a dim-2 genetic background.

Grant management procedure for energy saving TDM-PONs

NASA Astrophysics Data System (ADS)

Alaelddin, Fuad Yousif Mohammed; Newaz, S. H. Shah; AL-Hazemi, Fawaz; Choi, Jun Kyun

2018-01-01

In order to minimize energy consumption in Time Division Multiplexing-Passive Optical Network (TDM-PON), IEEE and ITU-T have mandated sleep mode mechanism for Optical Network Units (ONUs) in the latest TDM-PON standards (e.g. IEEE P1904.1 SIEPON, ITU-T G.sup45). The sleep mode mechanism is a promising mean for maximizing energy saving in an ONU. An ONU in sleep mode flips between sleep and active state depending on the presence or absent of upstream and downstream frames. To ensure Quality of Service (QoS) of upstream frames, the recent TDM-PON standards introduced an early wake-up mechanism, in which an ONU is forced to leave the sleep state on upstream frame arrival. When the Optical Line Terminal (OLT) of a TDM-PON allows early wake-up of its connected ONUs, it allocates gratuitous grants for the sleeping ONUs along with allocating upstream grants for the ONUs in active state. Note that, the gratuitous grants control message sent periodically by the OLT on Inter-Gratuitous grant Interval (IGI) time. After leaving sleep state due to the arrival of upstream frame, the ONU uses its allocated gratuitous grant to send a control message mentioning the amount of upstream bandwidth (upstream grant) required in order to forward the remaining frames in its buffer. However, the existing early wake-up process of ONU can lead to increase the energy consumption of an ONU. It is because of the ONU wakes-up immediately from the sleep state on arrival of the upstream frame, but even so, it needs to wait for forwarding the frame until its allocated gratuitous grant period, resulting in spending energy unnecessarily. In addition, current energy saving solution for TDM-PONs do not provide a clear solution on how to manage different types of grants (e.g. listening grant, upstream transmission grant) within a Dynamic Bandwidth Allocation (DBA) polling cycle. To address this problem, we propose a state-of-art Grant Management Procedure (GMP) in order to maximize energy saving in a TDM-PON with sleep mode enabled ONUs. GMP contributes in defining the location of the different types of grants during a DBA polling cycle. Furthermore, GMP devises a mechanism so as to allow an ONU to predict its assigned gratuitous grant control message arrival time, thereby allowing an ONU to remain its transceiver unit powered off until the arrival period of the next gratuitous grant control message, increasing the energy saving of the ONU. Results show that, with the increment of IGI, the energy saving performance of an ONU with GMP increases noticeably in compare to a conventional ONU (an ONU that does not use GMP) without imposing any additional upstream frame delay.

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Preliminary Feasibility and Risk Analysis of a Carbon Dioxide Barrier at Brandon Road Lock and Dam

DTIC Science & Technology

2017-09-01

designed bubble plume must be maintained. Wuest and Lorke (2003) describe this as natural (i.e., wind induced) turbulent mixing in lakes. Their study is...elevated CO2 concentrations in areas sheltered from wind and wave action (much like the approach channel and immediately upstream of the lock chamber) may...or kill them. As part of the development of fish barriers to prevent entrainment of fish into a pump turbine hydropower system, Nestler et al

Buffalo Metropolitan Area, New York Water Resources Management. Feasibility of Comprehensive Water and Related Land Management.

DTIC Science & Technology

1975-12-01

of these is the Lake Plain, a relatively flat and fertile agricultural belt which is wide in the northern portion of the region but narrow in the south...acres, occurs only during large flood events. Evidence of this can be seen in numerous highway relocations where secondary roads follow stream courses...obstructions of flow caused by fallen trees and shrub and tree growth encroaching on the high water stream channel can be seen immediately upstream of the

Interim Report on Feasibility of Improving Recreation Access and Related Water and Land Management in the Buffalo Metropolitan Area, New York.

DTIC Science & Technology

1979-04-01

Buffalo Metropolitan Study Area. One of these is the Lake Plain, a relatively flat and fertile agricultural belt which is wide in the northern portion of...events. Evidence of this can be seen in numerous highway relocations where secondary roads follow stream courses closely. A field reconnaissance was made...shrub and tree growth encroaching on the high water stream channel can be seen immediately upstream of the eroding area. The SCS has provided technical

Channel Incision Driven by Suburbanization: Impacts to Riparian Groundwater Flow and Overbank Flow Frequency

NASA Astrophysics Data System (ADS)

Bowles, C. J.; Lawrence, R. L.; Noll, C.; Hancock, G. S.

2005-12-01

Channel incision is a widely observed response to increased flow in urbanized watersheds, but the effects of channel lowering on riparian water tables is not well documented. In a rapidly incising suburban stream in the Virginia Coastal Plain, we hypothesize that stream incision has lowered floodplain water tables and decreased the overbank flow frequency. The monitored stream is a tributary to the James River draining 1.3 km2 of which 15% is impervious cover. Incision has occurred largely through upstream migration of a one meter high knickpoint at a rate of ~1.5 m/yr, primarily during high flow events. We installed 63 wells in six stream-perpendicular transects as well as a cluster of wells around the knickpoint to assess water table elevations beneath the floodplain adjacent to the incising stream. Two transects are located 30 and 50 m upstream of the knickpoint in the unincised floodplain, and the remainder are 5, 30, 70, and 100 m downstream in the incised floodplain. In one transect above and two below, pressure transducers attached to dataloggers provide a high-resolution record of water table changes. Erosion pins were installed and channel cross-sections surveyed to determine streambed stability. Significant differences are observed in bank morphology and groundwater flow above vs. below the knickpoint. Above the knickpoint, the banks are stable, ~3 m wide, and ~0.3 m deep, and widen and deepen slightly toward the knickpoint. The water table is relatively flat and is 0.2-0.4 m below the floodplain surface, and groundwater contours suggest flow is parallel to the stream direction. The water table responds immediately to precipitation events, and rises to the floodplain surface in significant rainfall events. Immediately downstream of the knickpoint, channel width increases by about a meter, and stream depth increases to ~1.5 meters. The water table immediately below the knickpoint possesses a steep gradient, and is up to one meter below the floodplain surface. Groundwater flow is redirected toward the stream. Moving downstream banks continue to widen, and the channel is up to 8 m wide and ~1.3 m deep ~100 m below the current knickpoint position. In the most downstream transects, the water table slopes gently toward the stream and remains ~1 m below the floodplain surface, equivalent to the depth of incision generated by knickpoint passage. Upstream of the knickpoint, overbank flooding occurs frequently, while below the knickpoint the majority of storm flow is contained within the incised channel and occupation of the floodplain is rare. The impact of incision to the riparian water table is dramatic, with a lowered water table and redirection of groundwater flow toward the stream. The incision is driven by suburbanization upstream of this riparian corridor, and has likely reduced the ability of this protected riparian system to improve the water quality of the suburban runoff that passes through it.

Promoters, toll like receptors and microRNAs: a strange association.

PubMed

Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K

2013-06-01

Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

PubMed

Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

1994-06-03

An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

PubMed Central

Jablonski, Joseph; Clementz, Mark; Ryan, Kevin; Valente, Susana T.

2014-01-01

The 3’ end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes precursor mRNA beyond the end of mature RNAs, and an active process of endonuclease activity is required at a specific site. Cleavage of the precursor RNA normally occurs 10-30 nt downstream from the consensus polyA site (AAUAAA) after the CA dinucleotides. Proteins from the cleavage complex, a multifactorial protein complex of approximately 800 kDa, accomplish this specific nuclease activity. Specific RNA sequences upstream and downstream of the polyA site control the recruitment of the cleavage complex. Immediately after cleavage, pre-mRNAs are polyadenylated by the polyA polymerase (PAP) to produce mature stable RNA messages. Processing of the 3’ end of an RNA transcript may be studied using cellular nuclear extracts with specific radiolabeled RNA substrates. In sum, a long 32P-labeled uncleaved precursor RNA is incubated with nuclear extracts in vitro, and cleavage is assessed by gel electrophoresis and autoradiography. When proper cleavage occurs, a shorter 5’ cleaved product is detected and quantified. Here, we describe the cleavage assay in detail using, as an example, the 3’ end processing of HIV-1 mRNAs. PMID:24835792

Bacillus subtilis IolQ (DegA) is a transcriptional repressor of iolX encoding NAD+-dependent scyllo-inositol dehydrogenase.

PubMed

Kang, Dong-Min; Michon, Christophe; Morinaga, Tetsuro; Tanaka, Kosei; Takenaka, Shinji; Ishikawa, Shu; Yoshida, Ken-Ichi

2017-07-11

Bacillus subtilis is able to utilize at least three inositol stereoisomers as carbon sources, myo-, scyllo-, and D-chiro-inositol (MI, SI, and DCI, respectively). NAD + -dependent SI dehydrogenase responsible for SI catabolism is encoded by iolX. Even in the absence of functional iolX, the presence of SI or MI in the growth medium was found to induce the transcription of iolX through an unknown mechanism. Immediately upstream of iolX, there is an operon that encodes two genes, yisR and iolQ (formerly known as degA), each of which could encode a transcriptional regulator. Here we performed an inactivation analysis of yisR and iolQ and found that iolQ encodes a repressor of the iolX transcription. The coding sequence of iolQ was expressed in Escherichia coli and the gene product was purified as a His-tagged fusion protein, which bound to two sites within the iolX promoter region in vitro. IolQ is a transcriptional repressor of iolX. Genetic evidences allowed us to speculate that SI and MI might possibly be the intracellular inducers, however they failed to antagonize DNA binding of IolQ in in vitro experiments.

SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

PubMed Central

Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

2007-01-01

Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

Biochemical and Genetic Evidence that Enterococcus faecium L50 Produces Enterocins L50A and L50B, the sec-Dependent Enterocin P, and a Novel Bacteriocin Secreted without an N-Terminal Extension Termed Enterocin Q

PubMed Central

Cintas, Luis M.; Casaus, Pilar; Herranz, Carmen; Håvarstein, Leiv Sigve; Holo, Helge; Hernández, Pablo E.; Nes, Ingolf F.

2000-01-01

Enterococcus faecium L50 grown at 16 to 32°C produces enterocin L50 (EntL50), consisting of EntL50A and EntL50B, two unmodified non-pediocin-like peptides synthesized without an N-terminal leader sequence or signal peptide. However, the bacteriocin activity found in the cell-free culture supernatants following growth at higher temperatures (37 to 47°C) is not due to EntL50. A purification procedure including cation-exchange, hydrophobic interaction, and reverse-phase liquid chromatography has shown that the antimicrobial activity is due to two different bacteriocins. Amino acid sequences obtained by Edman degradation and DNA sequencing analyses revealed that one is identical to the sec-dependent pediocin-like enterocin P produced by E. faecium P13 (L. M. Cintas, P. Casaus, L. S. Håvarstein, P. E. Hernández, and I. F. Nes, Appl. Environ. Microbiol. 63:4321–4330, 1997) and the other is a novel unmodified non-pediocin-like bacteriocin termed enterocin Q (EntQ), with a molecular mass of 3,980. DNA sequencing analysis of a 963-bp region of E. faecium L50 containing the enterocin P structural gene (entP) and the putative immunity protein gene (entiP) reveals a genetic organization identical to that previously found in E. faecium P13. DNA sequencing analysis of a 1,448-bp region identified two consecutive but diverging open reading frames (ORFs) of which one, termed entQ, encodes a 34-amino-acid protein whose deduced amino acid sequence was identical to that obtained for EntQ by amino acid sequencing, showing that EntQ, similarly to EntL50A and EntL50B, is synthesized without an N-terminal leader sequence or signal peptide. The second ORF, termed orf2, was located immediately upstream of and in opposite orientation to entQ and encodes a putative immunity protein composed of 221 amino acids. Bacteriocin production by E. faecium L50 showed that EntP and EntQ are produced in the temperature range from 16 to 47°C and maximally detected at 47 and 37 to 47°C, respectively, while EntL50A and EntL50B are maximally synthesized at 16 to 25°C and are not detected at 37°C or above. PMID:11073927

TEs or not TEs? That is the evolutionary question.

PubMed

Vaknin, Keren; Goren, Amir; Ast, Gil

2009-10-23

Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

Novel mechanism of JNK pathway activation by adenoviral E1A

PubMed Central

Morrison, Helen; Pospelova, Tatiana V.; Pospelov, Valery A.; Herrlich, Peter

2014-01-01

The adenoviral oncoprotein E1A influences cellular regulation by interacting with a number of cellular proteins. In collaboration with complementary oncogenes, E1A fully transforms primary cells. As part of this action, E1A inhibits transcription of c-Jun:Fos target genes while promoting that of c-Jun:ATF2-dependent genes including jun. Both c-Jun and ATF2 are hyperphosphorylated in response to E1A. In the current study, E1A was fused with the ligand binding domain of the estrogen receptor (E1A-ER) to monitor the immediate effect of E1A activation. With this approach we now show that E1A activates c-Jun N-terminal kinase (JNK), the upstream kinases MKK4 and MKK7, as well as the small GTPase Rac1. Activation of the JNK pathway requires the N-terminal domain of E1A, and, importantly, is independent of transcription. In addition, it requires the presence of ERM proteins. Downregulation of signaling components upstream of JNK inhibits E1A-dependent JNK/c-Jun activation. Taking these findings together, we show that E1A activates the JNK/c-Jun signaling pathway upstream of Rac1 in a transcription-independent manner, demonstrating a novel mechanism of E1A action. PMID:24742962

Cation-induced transcriptional regulation of the dlt operon of Staphylococcus aureus.

PubMed

Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P

2006-05-01

Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with D-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. D-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating D-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na(+) and moderate concentrations of Mg(2+) and Ca(2+) but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg(2+)-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg(2+)-induced repression of the dlt operon in S. aureus.

Cation-Induced Transcriptional Regulation of the dlt Operon of Staphylococcus aureus

PubMed Central

Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P.

2006-01-01

Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with d-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. d-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating d-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na+ and moderate concentrations of Mg2+ and Ca2+ but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg2+-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg2+-induced repression of the dlt operon in S. aureus. PMID:16672616

Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana.

PubMed

Qin, Yuxiang; Tian, Yanchen; Han, Lu; Yang, Xinchao

2013-10-25

The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway. Copyright © 2013. Published by Elsevier Inc.

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

PubMed

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Transcription of two adjacent carbohydrate utilization gene clusters in Bifidobacterium breve UCC2003 is controlled by LacI- and repressor open reading frame kinase (ROK)-type regulators.

PubMed

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe

2014-06-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.

Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.

PubMed

Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li

2014-10-01

This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

Identification and characterization of the p35 gene of Bombyx mori nuclear polyhedrosis virus that prevents virus-induced apoptosis.

PubMed Central

Kamita, S G; Majima, K; Maeda, S

1993-01-01

Nucleotide sequence analysis of the Bombyx mori nuclear polyhedrosis virus (BmNPV) genome revealed the existence of a gene homologous to the p35 gene of Autographa californica NPV (AcNPV), which has been shown to prevent virus-induced apoptosis. The BmNPV p35 gene showed 96.1% nucleotide and 89.6% predicted amino acid sequence identity to the AcNPV p35 gene. A mutant BmNPV (BmP35Z) lacking a functional p35 gene induced apoptosis-like cell degradation in infected BmN cells. However, unlike the p35-deleted AcNPV mutant (vAcAnh), BmP35Z replicated normally and produced polyhedral inclusion bodies. The patterns of protein synthesis and the percentages of viable BmN cells remaining following infection with either wild-type BmNPV or BmP35Z were nearly identical. BmP35Z also replicated in silkworm larvae without showing any apparent apoptotic response in infected hemocytes, fat body, or other tissues. Time to death of larvae infected with BmP35Z was similar to that for wild-type-infected larvae, and significant numbers of polyhedral inclusion bodies were produced. These results indicate that viral factors (or genes) other than p35 or host cell factors play a role in inducing, accelerating, or interfering with apoptotic processes. The evolution of baculovirus genomes is also discussed with reference to comparative analysis of the p35 and p94 gene sequences. The p94 gene is found immediately upstream of p35 in AcNPV; in BmNPV, however, the p94 gene was nearly completely missing, presumably because of large deletions in a BmNPV ancestor virus having a gene similar to the AcNPV p94 gene. Images PMID:8416377

Zadoff-Chu sequence-based hitless ranging scheme for OFDMA-PON configured 5G fronthaul uplinks

NASA Astrophysics Data System (ADS)

Reza, Ahmed Galib; Rhee, June-Koo Kevin

2017-05-01

A Zadoff-Chu (ZC) sequence-based low-complexity hitless upstream time synchronization scheme is proposed for an orthogonal frequency division multiple access passive optical network configured cloud radio access network fronthaul. The algorithm is based on gradual loading of the ZC sequences, where the phase discontinuity due to the cyclic prefix is alleviated by a frequency domain phase precoder, eliminating the requirements of guard bands to mitigate intersymbol interference and inter-carrier interference. Simulation results for uncontrolled-wavelength asynchronous transmissions from four concurrent transmitting optical network units are presented to demonstrate the effectiveness of the proposed scheme.

Molecular Characterization of Lactobacillus plantarum DMDL 9010, a Strain with Efficient Nitrite Degradation Capacity

PubMed Central

Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

2014-01-01

Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity. PMID:25423449

Molecular characterization of Lactobacillus plantarum DMDL 9010, a strain with efficient nitrite degradation capacity.

PubMed

Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

2014-01-01

Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity.

The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

PubMed Central

Grichnik, J M; French, B A; Schwartz, R J

1988-01-01

The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.

PubMed

Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning

2016-08-01

miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.

Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.

PubMed

Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P

2011-09-26

HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.

Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

PubMed Central

2011-01-01

Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

PubMed

Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

1995-01-01

Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

Spatiotemporal distribution of nitrogen dioxide within and around a large-scale wind farm - a numerical case study

NASA Astrophysics Data System (ADS)

Mo, Jingyue; Huang, Tao; Zhang, Xiaodong; Zhao, Yuan; Liu, Xiao; Li, Jixiang; Gao, Hong; Ma, Jianmin

2017-12-01

As a renewable and clean energy source, wind power has become the most rapidly growing energy resource worldwide in the past decades. Wind power has been thought not to exert any negative impacts on the environment. However, since a wind farm can alter the local meteorological conditions and increase the surface roughness lengths, it may affect air pollutants passing through and over the wind farm after released from their sources and delivered to the wind farm. In the present study, we simulated the nitrogen dioxide (NO2) air concentration within and around the world's largest wind farm (Jiuquan wind farm in Gansu Province, China) using a coupled meteorology and atmospheric chemistry model WRF-Chem. The results revealed an edge effect, which featured higher NO2 levels at the immediate upwind and border region of the wind farm and lower NO2 concentration within the wind farm and the immediate downwind transition area of the wind farm. A surface roughness length scheme and a wind turbine drag force scheme were employed to parameterize the wind farm in this model investigation. Modeling results show that both parameterization schemes yield higher concentration in the immediate upstream of the wind farm and lower concentration within the wind farm compared to the case without the wind farm. We infer this edge effect and the spatial distribution of air pollutants to be the result of the internal boundary layer induced by the changes in wind speed and turbulence intensity driven by the rotation of the wind turbine rotor blades and the enhancement of surface roughness length over the wind farm. The step change in the roughness length from the smooth to rough surfaces (overshooting) in the upstream of the wind farm decelerates the atmospheric transport of air pollutants, leading to their accumulation. The rough to the smooth surface (undershooting) in the downstream of the wind farm accelerates the atmospheric transport of air pollutants, resulting in lower concentration level.

The fluvial sediment budget of a dammed river (upper Muga, southern Pyrenees)

NASA Astrophysics Data System (ADS)

Piqué, G.; Batalla, R. J.; López, R.; Sabater, S.

2017-09-01

Many rivers in the Mediterranean region are regulated for urban and agricultural purposes. Reservoir presence and operation results in flow alteration and sediment discontinuity, altering the longitudinal structure of the fluvial system. This study presents a 3-year sediment budget of a highly dammed Mediterranean river (the Muga, southern Pyrenees), which has experienced flow regulation since the 1969 owing to a 61-hm3 reservoir. Flow discharge and suspended sediment concentration were monitored immediately upstream and downstream from the reservoir, whereas bedload transport was estimated by means of bedload formulae and estimated from regional data. Results show how the dam modifies river flow, reducing the magnitude of floods and shortening its duration. At the same time, duration of low flows increases. The downstream flow regime follows reservoir releases that are mostly driven by the irrigation needs in the lowlands. Likewise, suspended sediment and bedload transport are shown to be notably affected by the dam. Sediment transport upstream was mainly associated with floods and was therefore concentrated in short periods of time (i.e., > 90% of the sediment load occurred in < 1% of the time). Downstream from the dam, sediments were transported more constantly (i.e., 90% of the load was carried during 50% of the time). Total sediment load upstream from the dam equalled 23,074 t, while downstream it was < 1000 t. Upstream, sediment load was equally distributed between suspension and bedload (i.e., 10,278 and 12,796 t respectively), whereas suspension dominated sediment transport downstream. More than 95% of the sediments transported from the upstream basins were trapped in the reservoir, a fact that explains the sediment deficit and the river bed armouring observed downstream. Overall, the dam disrupted the natural water and sediment fluxes, generating a highly modified environment downstream. Below the dam, the whole ecosystem shifted to stable conditions owing to the reduction of water and sediment loads.

ENERGETIC PARTICLE PRESSURE AT INTERPLANETARY SHOCKS: STEREO-A OBSERVATIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lario, D.; Decker, R. B.; Roelof, E. C.

2015-11-10

We study periods of elevated energetic particle intensities observed by STEREO-A when the partial pressure exerted by energetic (≥83 keV) protons (P{sub EP}) is larger than the pressure exerted by the interplanetary magnetic field (P{sub B}). In the majority of cases, these periods are associated with the passage of interplanetary shocks. Periods when P{sub EP} exceeds P{sub B} by more than one order of magnitude are observed in the upstream region of fast interplanetary shocks where depressed magnetic field regions coincide with increases of energetic particle intensities. When solar wind parameters are available, P{sub EP} also exceeds the pressure exertedmore » by the solar wind thermal population (P{sub TH}). Prolonged periods (>12 hr) with both P{sub EP} > P{sub B} and P{sub EP} > P{sub TH} may also occur when energetic particles accelerated by an approaching shock encounter a region well upstream of the shock characterized by low magnetic field magnitude and tenuous solar wind density. Quasi-exponential increases of the sum P{sub SUM} = P{sub B} + P{sub TH} + P{sub EP} are observed in the immediate upstream region of the shocks regardless of individual changes in P{sub EP}, P{sub B}, and P{sub TH}, indicating a coupling between P{sub EP} and the pressure of the background medium characterized by P{sub B} and P{sub TH}. The quasi-exponential increase of P{sub SUM} implies a radial gradient ∂P{sub SUM}/∂r > 0 that is quasi-stationary in the shock frame and results in an outward force applied to the plasma upstream of the shock. This force can be maintained by the mobile energetic particles streaming upstream of the shocks that, in the most intense events, drive electric currents able to generate diamagnetic cavities and depressed solar wind density regions.« less

Bioinformatic dissecting of TP53 regulation pathway underlying butyrate-induced histone modification in epigenetic regulation

USDA-ARS?s Scientific Manuscript database

Butyrate affects cell proliferation, differentiation and motility. Butyrate inhibits histone deacetylase (HDAC) activities and induces cell cycle arrest and apoptosis. TP53 is one of the most active upstream regulators discovered by IPA in our RNA sequencing data set. The TP53 signaling pathway pl...

The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

PubMed

Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

1999-09-24

To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

Regulatory elements of Caenorhabditis elegans ribosomal protein genes

PubMed Central

2012-01-01

Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

Analysis of the primary structure of the long terminal repeat and the gag and pol genes of the human spumaretrovirus.

PubMed Central

Maurer, B; Bannert, H; Darai, G; Flügel, R M

1988-01-01

The nucleotide sequence of the human spumaretrovirus (HSRV) genome was determined. The 5' long terminal repeat region was analyzed by strong stop cDNA synthesis and S1 nuclease mapping. The length of the RU5 region was determined and found to be 346 nucleotides long. The 5' long terminal repeat is 1,123 base pairs long and is bound by an 18-base-pair primer-binding site complementary to the 3' end of mammalian lysine-1,2-specific tRNA. Open reading frames for gag and pol genes were identified. Surprisingly, the HSRV gag protein does not contain the cysteine motif of the nucleic acid-binding proteins found in and typical of all other retroviral gag proteins; instead the HSRV gag gene encodes a strongly basic protein reminiscent of those of hepatitis B virus and retrotransposons. The carboxy-terminal part of the HSRV gag gene products encodes a protease domain. The pol gene overlaps the gag gene and is postulated to be synthesized as a gag/pol precursor via translational frameshifting analogous to that of Rous sarcoma virus, with 7 nucleotides immediately upstream of the termination codons of gag conserved between the two viral genomes. The HSRV pol gene is 2,730 nucleotides long, and its deduced protein sequence is readily subdivided into three well-conserved domains, the reverse transcriptase, the RNase H, and the integrase. Although the degree of homology of the HSRV reverse transcriptase domain is highest to that of murine leukemia virus, the HSRV genomic organization is more similar to that of human and simian immunodeficiency viruses. The data justify classifying the spumaretroviruses as a third subfamily of Retroviridae. Images PMID:2451755

Gene organization and primary structure of human hormone-sensitive lipase: possible significance of a sequence homology with a lipase of Moraxella TA144, an antarctic bacterium.

PubMed Central

Langin, D; Laurell, H; Holst, L S; Belfrage, P; Holm, C

1993-01-01

The human hormone-sensitive lipase (HSL) gene encodes a 786-aa polypeptide (85.5 kDa). It is composed of nine exons spanning approximately 11 kb, with exons 2-5 clustered in a 1.1-kb region. The putative catalytic site (Ser423) and a possible lipid-binding region in the C-terminal part are encoded by exons 6 and 9, respectively. Exon 8 encodes the phosphorylation site (Ser551) that controls cAMP-mediated activity and a second site (Ser553) that is phosphorylated by 5'-AMP-activated protein kinase. Human HSL showed 83% identity with the rat enzyme and contained a 12-aa deletion immediately upstream of the phosphorylation sites with an unknown effect on the activity control. Besides the catalytic site motif (Gly-Xaa-Ser-Xaa-Gly) found in most lipases, HSL shows no homology with other known lipases or proteins, except for a recently reported unexpected homology between the region surrounding its catalytic site and that of the lipase 2 of Moraxella TA144, an antarctic psychrotrophic bacterium. The gene of lipase 2, which catalyses lipolysis below 4 degrees C, was absent in the genomic DNA of five other Moraxella strains living at 37 degrees C. The lipase 2-like sequence in HSL may reflect an evolutionarily conserved cold adaptability that might be of critical survival value when low-temperature-mobilized endogenous lipids are the primary energy source (e.g., in poikilotherms or hibernators). The finding that HSL at 10 degrees C retained 3- to 5-fold more of its 37 degrees C catalytic activity than lipoprotein lipase or carboxyl ester lipase is consistent with this hypothesis. Images Fig. 5 PMID:8506334

An Ancient Relative of Cyclooxygenase in Cyanobacteria Is a Linoleate 10S-Dioxygenase That Works in Tandem with a Catalase-related Protein with Specific 10S-Hydroperoxide Lyase Activity*

PubMed Central

Brash, Alan R.; Niraula, Narayan P.; Boeglin, William E.; Mashhadi, Zahra

2014-01-01

In the course of exploring the scope of catalase-related hemoprotein reactivity toward fatty acid hydroperoxides, we detected a novel candidate in the cyanobacterium Nostoc punctiforme PCC 73102. The immediate neighboring upstream gene, annotated as “cyclooxygenase-2,” appeared to be a potential fatty acid heme dioxygenase. We cloned both genes and expressed the cDNAs in Escherichia coli, confirming their hemoprotein character. Oxygen electrode recordings demonstrated a rapid (>100 turnovers/s) reaction of the heme dioxygenase with oleic and linoleic acids. HPLC, including chiral column analysis, UV, and GC-MS of the oxygenated products, identified a novel 10S-dioxygenase activity. The catalase-related hemoprotein reacted rapidly and specifically with linoleate 10S-hydroperoxide (>2,500 turnovers/s) with a hydroperoxide lyase activity specific for the 10S-hydroperoxy enantiomer. The products were identified by NMR as (8E)10-oxo-decenoic acid and the C8 fragments, 1-octen-3-ol and 2Z-octen-1-ol, in ∼3:1 ratio. Chiral HPLC analysis established strict enzymatic control in formation of the 3R alcohol configuration (99% enantiomeric excess) and contrasted with racemic 1-octen-3-ol formed in reaction of linoleate 10S-hydroperoxide with hematin or ferrous ions. The Nostoc linoleate 10S-dioxygenase, the sequence of which contains the signature catalytic sequence of cyclooxygenases and fungal linoleate dioxygenases (YRWH), appears to be a heme dioxygenase ancestor. The novel activity of the lyase expands the known reactions of catalase-related proteins and functions in Nostoc in specific transformation of the 10S-hydroperoxylinoleate. PMID:24659780

Characterization of an internal ribosomal entry segment within the 5' leader of avian reticuloendotheliosis virus type A RNA and development of novel MLV-REV-based retroviral vectors.

PubMed

López-Lastra, M; Gabus, C; Darlix, J L

1997-11-01

The murine leukemia virus (MLV)-related type C viruses constitute a major class of retroviruses that includes numerous endogenous and exogenous mammalian viruses and the related avian spleen necrosis virus (SNV). The MLV-related viruses possess a long and multifunctional 5' untranslated leader involved in key steps of the viral life cycle--splicing, translation, RNA dimerization, encapsidation, and reverse transcription. Recent studies have shown that the 5' leader of Friend murine leukemia virus and Moloney murine leukemia virus can direct cap independent translation of gag precursor proteins (Berlioz et al., 1995; Vagner et al., 1995b). These data, together with structural homology studies (Koning et al., 1992), prompted us to undertake a search for new internal ribosome entry segment (IRES) of retroviral origin. Here we describe an IRES element within the 5' leader of avian reticuloendotheliosis virus type A (REV-A) genomic RNA. Data show that the REV-A 5' IRES element maps downstream of the packaging/dimerization (E/DLS) sequence (Watanabe and Temin, 1982; Darlix et al., 1992) and the minimal IRES sequence appears to be within a 129 nt fragment (nucleotides 452-580) of the 5' leader, immediately upstream of the gag AUG codon. The REV-A IRES has been successfully utilized in the construction of novel high titer MLV-based retroviral vectors, containing one or more IRES elements of retroviral origin. These retroviral constructs, which represent a starting point for the design of novel vectors suitable for gene therapy, are also of interest as a model system of internal translation initiation and its possible regulation during development, cancer, or virus infection.

Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

PubMed

Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

2008-06-01

The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

PubMed Central

Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

2011-01-01

Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

Big Spring spinedace and associated fish populations and habitat conditions in Condor Canyon, Meadow Valley Wash, Nevada

USGS Publications Warehouse

Jezorek, Ian G.; Connolly, Patrick J.; Munz, Carrie S.; Dixon, Chris

2011-01-01

Executive Summary: This project was designed to document habitat conditions and populations of native and non-native fish within the 8-kilometer Condor Canyon section of Meadow Valley Wash, Nevada, with an emphasis on Big Spring spinedace (Lepidomeda mollispinis pratensis). Other native fish present were speckled dace (Rhinichthys osculus) and desert sucker (Catostomus clarki). Big Spring spinedace were known to exist only within this drainage and were known to have been extirpated from a portion of their former habitat located downstream of Condor Canyon. Because of this extirpation and the limited distribution of Big Spring spinedace, the U.S. Fish and Wildlife Service listed this species as threatened under the Endangered Species Act in 1985. Prior to our effort, little was known about Big Spring spinedace populations or life histories and habitat associations. In 2008, personnel from the U.S. Geological Survey's Columbia River Research Laboratory began surveys of Meadow Valley Wash in Condor Canyon. Habitat surveys characterized numerous variables within 13 reaches, thermologgers were deployed at 9 locations to record water temperatures, and fish populations were surveyed at 22 individual sites. Additionally, fish were tagged with Passive Integrated Transponder (PIT) tags, which allowed movement and growth information to be collected on individual fish. The movements of tagged fish were monitored with a combination of recapture events and stationary in-stream antennas, which detected tagged fish. Meadow Valley Wash within Condor Canyon was divided by a 12-meter (m) waterfall known as Delmue Falls. About 6,100 m of stream were surveyed downstream of the falls and about 2,200 m of stream were surveyed upstream of the falls. Although about three-quarters of the surveyed stream length was downstream of Delmue Falls, the highest densities and abundance of native fish were upstream of the falls. Big Spring spinedace and desert sucker populations were highest near the upper end of Condor Canyon, where a tributary known as Kill Wash, and several springs, contribute flow and moderate high and low water temperature. Kill Wash and the area around its confluence with Meadow Valley Wash appeared important for spawning of all three native species. Detections of PIT-tagged fish indicated that there were substantial movements to this area during the spring. Our surveys included about 700 m of Meadow Valley Wash upstream of Kill Wash. A small falls about 2 m high was about 560 m upstream of Kill Wash. This falls is likely a barrier to upstream fish movement at most flows. Populations of all three native species were found upstream of this small falls. Age-0 fish of all three species were present, indicating successful spawning. The maximum upstream extent of native fish within Meadow Valley Wash was not determined. Our surveys included about 700 m of Meadow Valley Wash upstream of Kill Wash. A small falls about 2 m high was about 560 m upstream of Kill Wash. This falls is likely a barrier to upstream fish movement at most flows. Populations of all three native species were found upstream of this small falls. Age-0 fish of all three species were present, indicating successful spawning. The maximum upstream extent of native fish within Meadow Valley Wash was not determined. A population of non-native rainbow trout (Oncorhynchus mykiss) was found within the 2,000 m of stream immediately downstream of Delmue Falls. Non-native crayfish were very common both upstream and downstream of Delmue Falls. We were not able to quantify crayfish populations, but they compose a significant portion of the biomass of aquatic species in Condor Canyon. There were some distinctive habitat features that may have favored native fish upstream of Delmue Falls. Upstream of the falls, water temperatures were moderated by inputs from springs, turbidity was lower, pool habitat was more prevalent, substrate heterogeneity was higher, and there was less fine sediment than

Appearance of the pituitary factor Pit-1 increases chromatin remodeling at hypersensitive site III in the human GH locus.

PubMed

Yang, Xiaoyang; Jin, Yan; Cattini, Peter A

2010-07-01

Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.

Closed circuit steam cooled turbine shroud and method for steam cooling turbine shroud

DOEpatents

Burdgick, Steven Sebastian; Sexton, Brendan Francis; Kellock, Iain Robertson

2002-01-01

A turbine shroud cooling cavity is partitioned to define a plurality of cooling chambers for sequentially receiving cooling steam and impingement cooling of the radially inner wall of the shoud. An impingement baffle is provided in each cooling chamber for receiving the cooling media from a cooling media inlet in the case of the first chamber or from the immediately upstream chamber in the case of the second through fourth chambers and includes a plurality of impingement holes for effecting the impingement cooling of the shroud inner wall.

A Sequence-Independent, Unstructured Internal Ribosome Entry Site Is Responsible for Internal Expression of the Coat Protein of Turnip Crinkle Virus

PubMed Central

May, Jared; Johnson, Philip; Saleem, Huma

2017-01-01

ABSTRACT To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5′ cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo. An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo. Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5′ cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary structure has IRES activity and produces low levels of viral coat protein in vitro and in vivo. Our findings may be applicable to cellular mRNA IRES that also have little or no sequences/structures in common. PMID:28179526

Novel variable number of tandem repeats of gibbon MAOA gene and its evolutionary significance.

PubMed

Choi, Yuri; Jung, Yi-Deun; Ayarpadikannan, Selvam; Koga, Akihiko; Imai, Hiroo; Hirai, Hirohisa; Roos, Christian; Kim, Heui-Soo

2014-08-01

Variable number of tandem repeats (VNTRs) are scattered throughout the primate genome, and genetic variation of these VNTRs have been accumulated during primate radiation. Here, we analyzed VNTRs upstream of the monoamine oxidase A (MAOA) gene in 11 different gibbon species. An abundance of truncated VNTR sequences and copy number differences were observed compared to those of human VNTR sequences. To better understand the biological role of these VNTRs, a luciferase activity assay was conducted and results indicated that selected VNTR sequences of the MAOA gene from human and three different gibbon species (Hylobates klossii, Hylobates lar, and Nomascus concolor) showed silencing ability. Together, these data could be useful for understanding the evolutionary history and functional significance of MAOA VNTR sequences in gibbon species.

Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.

PubMed

Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E

2002-04-24

The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.

Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

NASA Astrophysics Data System (ADS)

Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

1994-07-01

We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

Kin28 regulates the transient association of Mediator with core promoters.

PubMed

Jeronimo, Célia; Robert, François

2014-05-01

Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

An in situ Comparison of Electron Acceleration at Collisionless Shocks under Differing Upstream Magnetic Field Orientations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Masters, A.; Dougherty, M. K.; Sulaiman, A. H.

A leading explanation for the origin of Galactic cosmic rays is acceleration at high-Mach number shock waves in the collisionless plasma surrounding young supernova remnants. Evidence for this is provided by multi-wavelength non-thermal emission thought to be associated with ultrarelativistic electrons at these shocks. However, the dependence of the electron acceleration process on the orientation of the upstream magnetic field with respect to the local normal to the shock front (quasi-parallel/quasi-perpendicular) is debated. Cassini spacecraft observations at Saturn’s bow shock have revealed examples of electron acceleration under quasi-perpendicular conditions, and the first in situ evidence of electron acceleration at amore » quasi-parallel shock. Here we use Cassini data to make the first comparison between energy spectra of locally accelerated electrons under these differing upstream magnetic field regimes. We present data taken during a quasi-perpendicular shock crossing on 2008 March 8 and during a quasi-parallel shock crossing on 2007 February 3, highlighting that both were associated with electron acceleration to at least MeV energies. The magnetic signature of the quasi-perpendicular crossing has a relatively sharp upstream–downstream transition, and energetic electrons were detected close to the transition and immediately downstream. The magnetic transition at the quasi-parallel crossing is less clear, energetic electrons were encountered upstream and downstream, and the electron energy spectrum is harder above ∼100 keV. We discuss whether the acceleration is consistent with diffusive shock acceleration theory in each case, and suggest that the quasi-parallel spectral break is due to an energy-dependent interaction between the electrons and short, large-amplitude magnetic structures.« less

[Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

PubMed

Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

2015-04-01

This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

Balancing gene expression without library construction via a reusable sRNA pool.

PubMed

Ghodasara, Amar; Voigt, Christopher A

2017-07-27

Balancing protein expression is critical when optimizing genetic systems. Typically, this requires library construction to vary the genetic parts controlling each gene, which can be expensive and time-consuming. Here, we develop sRNAs corresponding to 15nt 'target' sequences that can be inserted upstream of a gene. The targeted gene can be repressed from 1.6- to 87-fold by controlling sRNA expression using promoters of different strength. A pool is built where six sRNAs are placed under the control of 16 promoters that span a ∼103-fold range of strengths, yielding ∼107 combinations. This pool can simultaneously optimize up to six genes in a system. This requires building only a single system-specific construct by placing a target sequence upstream of each gene and transforming it with the pre-built sRNA pool. The resulting library is screened and the top clone is sequenced to determine the promoter controlling each sRNA, from which the fold-repression of the genes can be inferred. The system is then rebuilt by rationally selecting parts that implement the optimal expression of each gene. We demonstrate the versatility of this approach by using the same pool to optimize a metabolic pathway (β-carotene) and genetic circuit (XNOR logic gate). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Transcription of Two Adjacent Carbohydrate Utilization Gene Clusters in Bifidobacterium breve UCC2003 Is Controlled by LacI- and Repressor Open Reading Frame Kinase (ROK)-Type Regulators

PubMed Central

O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert

2014-01-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323

Isolation, characterization, and structure analysis of a vacuolar processing enzyme gene (MhVPEγ) from Malus hupehensis (Pamp) Rehd.

PubMed

Ran, Kun; Yang, Hongqiang; Sun, Xiaoli; Li, Qiang; Jiang, Qianqian; Zhang, Weiwei; Shen, Wei

2014-05-01

Vacuolar processing enzymes (VPEs) have received considerable attention recently, as they exhibit caspase-1-like cleavage activity and regulate the process of PCD. However, knowledge about their detailed characteristics and structures is relatively limited. In this study, a gamma vacuolar processing enzyme gene, MhVPEγ, has been isolated from the leaves of Malus hupehensis (Ramp) Rehd. var pinyiensis Jiang. MhVPEγ coded-translated protein sequence comprised of 494 amino acids with a signal peptide and a transmembrane helix structure at N-terminal, peptidase_C13 domain, and vacuolar sorting signal at C-terminal. Consequently, genomic walking approach was performed for the isolation of its upstream sequence. Computational analysis demonstrated several motifs of the promoter exhibiting hypothetic MeJA, ABA, and light-induced characteristics, as well as some typical domains universally discovered in promoter, such as TATA-box and CAAT-box. MhVPEγ transcript level was enhanced during wounding treatment, and WUN-motif, as one of the cis-acting regulatory elements existing in the upstream sequence perhaps regulates its expression. In silico-constructed 3D models revealed that MhCPYL successively interacts with MhVPEγ like that of "Induced Fit-Lock and Key" model, providing molecular conformation evidence that CPY is a direct substrate of VPEγ. This study is the first stride to understand the molecular mechanism of VPEγ and CPYL interactions.

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

PubMed Central

Das, G; Henning, D; Wright, D; Reddy, R

1988-01-01

Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

PubMed

Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

2012-07-01

The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

PubMed

Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

2012-05-01

The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

Suspended-sediment loads, reservoir sediment trap efficiency, and upstream and downstream channel stability for Kanopolis and Tuttle Creek Lakes, Kansas, 2008-10

USGS Publications Warehouse

Juracek, Kyle E.

2011-01-01

Continuous streamflow and turbidity data collected from October 1, 2008, to September 30, 2010, at streamgage sites upstream and downstream from Kanopolis and Tuttle Creek Lakes, Kansas, were used to compute the total suspended-sediment load delivered to and released from each reservoir as well as the sediment trap efficiency for each reservoir. Ongoing sedimentation is decreasing the ability of the reservoirs to serve several purposes including flood control, water supply, and recreation. River channel stability upstream and downstream from the reservoirs was assessed using historical streamgage information. For Kanopolis Lake, the total 2-year inflow suspended-sediment load was computed to be 600 million pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 31 million pounds. Sediment trap efficiency for the reservoir was estimated to be 95 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 129,000 pounds per square mile per year. No pronounced changes in channel width were evident at five streamgage sites located upstream from the reservoir. At the Ellsworth streamgage site, located upstream from the reservoir, long-term channel-bed aggradation was followed by a period of stability. Current (2010) conditions at five streamgages located upstream from the reservoir were typified by channel-bed stability. At the Langley streamgage site, located immediately downstream from the reservoir, the channel bed degraded 6.15 feet from 1948 to 2010. For Tuttle Creek Lake, the total 2-year inflow suspended-sediment load was computed to be 13.3 billion pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 327 million pounds. Sediment trap efficiency for the reservoir was estimated to be 98 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 691,000 pounds per square mile per year. In general, no pronounced changes in channel width were evident at six streamgage sites located upstream from the reservoir. At the Barnes and Marysville streamgage sites, located upstream from the reservoir, long-term channel-bed degradation followed by stability was indicated. At the Frankfort streamgage site, located upstream from the reservoir, channel-bed aggradation of 1.65 feet from 1969 to 1989 followed by channel-bed degradation of 2.4 feet from 1989 to 2010 was indicated and may represent the passage of a sediment pulse caused by historical disturbances (for example, channelization) in the upstream basin. With the exception of the Frankfort streamgage site, current (2010) conditions at four streamgages located upstream from the reservoir were typified by channel-bed stability. At the Manhattan streamgage site, located downstream from the reservoir, high-flow releases associated with the 1993 flood widened the channel about 60 feet (30 percent). The channel bed at this site degraded 4.2 feet from 1960 to 1998 and since has been relatively stable. For the purpose of computing suspended-sediment concentration and load, the use of turbidity data in a regression model can provide more reliable and reproducible estimates than a regression model that uses discharge as the sole independent variable. Moreover, the use of discharge only to compute suspended-sediment concentration and load may result in overprediction. Stream channel banks, compared to channel beds, likely are a more important source of sediment to Kanopolis and Tuttle Creek Lakes from the upstream basins. Other sediment sources include surface-soil erosion in the basins and shoreline erosion in the reservoirs.

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.

PubMed Central

Stewart, A F; Willis, I M; Mackinlay, A G

1984-01-01

The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443

Sequences show rapid motor transfer and spatial translation in the oculomotor system.

PubMed

Stainer, Matthew J; Carpenter, R H S; Brotchie, Peter; Anderson, Andrew J

2016-07-01

Every day we perform learnt sequences of actions that seem to happen almost without awareness. It has been argued that for learning such sequences parallel learning networks exist - one using spatial coordinates and one using motor coordinates - with sequence acquisition involving a progressive shift from the former to the latter as a sequence is rehearsed. When sequences are interrupted by an out-of-sequence target, there is a delay in the response to the target, and so here we transiently interrupt oculomotor sequences to probe the influence of oculomotor rehearsal and spatial coordinates in sequence acquisition. For our main experiments, we used a repeating sequences of eight targets in length that was first learnt either using saccadic eye movements (left/right), manual responses (left/right or up/down) or as a sequence of colour (blue/red) requiring no motor response. The sequence was immediately repeated for saccadic eye movements, during which the influence of on out-of-sequence target (an interruption) was assessed. When a sequence is learnt beforehand in an abstract way (for example, as a sequence of colours or of orthogonally mapped manual responses), interruptions are immediately disruptive to latency, suggesting neither motor rehearsal nor specific spatial coordinates are essential for encoding sequences of actions and that sequences - no matter how they are encoded - can be rapidly translated into oculomotor coordinates. The magnitude of a disruption does, however, correspond to how well a sequence is learnt: introducing an interruption to an extended sequence before it was reliably learnt reduces the magnitude of the latency disruption. Copyright © 2016 Elsevier Ltd. All rights reserved.

Nucleotide sequences and regulational analysis of genes involved in conversion of aniline to catechol in Pseudomonas putida UCC22(pTDN1).

PubMed Central

Fukumori, F; Saint, C P

1997-01-01

A 9,233-bp HindIII fragment of the aromatic amine catabolic plasmid pTDN1, isolated from a derivative of Pseudomonas putida mt-2 (UCC22), confers the ability to degrade aniline on P. putida KT2442. The fragment encodes six open reading frames which are arranged in the same direction. Their 5' upstream region is part of the direct-repeat sequence of pTDN1. Nucleotide sequence of 1.8 kb of the repeat sequence revealed only a single base pair change compared to the known sequence of IS1071 which is involved in the transposition of the chlorobenzoate genes (C. Nakatsu, J. Ng, R. Singh, N. Straus, and C. Wyndham, Proc. Natl. Acad. Sci. USA 88:8312-8316, 1991). Four open reading frames encode proteins with considerable homology to proteins found in other aromatic-compound degradation pathways. On the basis of sequence similarity, these genes are proposed to encode the large and small subunits of aniline oxygenase (tdnA1 and tdnA2, respectively), a reductase (tdnB), and a LysR-type regulatory gene (tdnR). The putative large subunit has a conserved [2Fe-2S]R Rieske-type ligand center. Two genes, tdnQ and tdnT, which may be involved in amino group transfer, are localized upstream of the putative oxygenase genes. The tdnQ gene product shares about 30% similarity with glutamine synthetases; however, a pUC-based plasmid carrying tdnQ did not support the growth of an Escherichia coli glnA strain in the absence of glutamine. TdnT possesses domains that are conserved among amidotransferases. The tdnQ, tdnA1, tdnA2, tdnB, and tdnR genes are essential for the conversion of aniline to catechol. PMID:8990291

An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Damiani, R.D. Jr.; Wessler, S.R.

1993-09-01

The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open readingmore » frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.« less

Modeling strategic competition in hydro-thermal electricity generation markets with cascaded reservoir-hydroelectric generation plants

NASA Astrophysics Data System (ADS)

Uluca, Basak

This dissertation aims to achieve two goals. The first is to model the strategic interactions of firms that own cascaded reservoir-hydro plants in oligopolistic and mixed oligopolistic hydrothermal electricity generation markets. Although competition in thermal generation has been extensively modeled since the beginning of deregulation, the literature on competition in hydro generation is still limited; in particular, equilibrium models of oligopoly that study the competitive behavior of firms that own reservoir-hydro plants along the same river in hydrothermal electricity generation markets are still under development. In competitive markets, when the reservoirs are located along the same river, the water released from an upstream reservoir for electricity generation becomes input to the immediate downstream reservoir, which may be owned by a competitor, for current or future use. To capture the strategic interactions among firms with cascaded reservoir-hydro plants, the Upstream-Conjecture approach is proposed. Under the Upstream-Conjecture approach, a firm with an upstream reservoir-hydro plant assumes that firms with downstream reservoir-hydro plants will respond to changes in the upstream firm's water release by adjusting their water release by the same amount. The results of the Upstream Conjecture experiments indicate that firms that own upstream reservoirs in a cascade may have incentive to withhold or limit hydro generation, forcing a reduction in the utilization of the downstream hydro generation plants that are owned by competitors. Introducing competition to hydroelectricity generation markets is challenging and ownership allocation of the previously state-owned cascaded reservoir-hydro plants through privatization can have significant impact on the competitiveness of the generation market. The second goal of the dissertation is to extract empirical guidance about best policy choices for the ownership of the state-owned generation plants, including the cascaded reservoir-hydro plants. Specifically, an equilibrium model of oligopoly, where only private firms compete for electricity supply is proposed. Since some electricity generation markets are better characterized as mixed oligopolies, where the public firm coexists with the private firms for electricity supply, and not as oligopolies, another equilibrium model of mixed oligopoly is proposed. The proposed mixed oligopoly equilibrium model is the first implementation of such market structure in electricity markets. The mathematical models developed in this research are applied to the simplified representation of the Turkish electricity generation market to investigate the impact of various ownership allocation scenarios that may result from the privatization of the state owned generation plants, including the cascaded reservoir-hydro plants, on the competitive market outcomes.

Water quality in the Little Sac River basin near Springfield, Missouri, 1999-2001

USGS Publications Warehouse

Smith, Brenda J.

2002-01-01

The Little Sac River, north of Springfield, Missouri, flows through mainly agricultural and forest land. However, the quality of the river water is a concern because the river flows into Stockton Lake, which is a supplemental drinking water source for Springfield. Large bacterial densities and nutrient concentrations are primary concerns to the water quality of the river.A 29-river mile reach of the Little Sac River is on the 1998 list of waters of Missouri designated under section 303(d) of the Federal Clean Water Act because of fecal coliform densities larger than the Missouri Department of Natural Resources standard (hereinafter referred to as Missouri standard) of 200 colonies per 100 milliliters for whole-body contact recreation. During an investigation of the water quality in the Little Sac River by the U.S. Geological Survey, in cooperation with the Watershed Committee of the Ozarks, fecal coliform bacteria densities exceeded the Missouri standard (the standard applies from April 1 through October 31) in one sample from a site near Walnut Grove. At other sites on the Little Sac River, the Missouri standard was exceeded in two samples and equalled in one sample upstream from the Northwest Wastewater Treatment Plant (NW WTP) and in one sample immediately downstream from the NW WTP.Effluent from the NW WTP flows into the Little Sac River. Annually from April 1 through October 31, the effluent is disinfected to meet the Missouri standard for whole-body contact recreation. Fecal coliform bacteria densities in samples collected during this period generally were less than 100 colonies per 100 milliliters. For the rest of the year when the effluent was not disinfected, the bacteria densities in samples ranged from 50 (sample collected on November 1, 2000) to 10,100 colonies per 100 milliliters (both counts were non-ideal). When the effluent was disinfected and the fecal coliform bacteria density was small, samples from sites upstream and downstream from the NW WTP had a bacteria density larger than the density in the effluent. Other sources of bacteria are likely to be present in the study area in addition to the NW WTP. These potential sources include effluent from domestic septic systems and animal wastes.Nutrient concentrations in the Little Sac River immediately downstream from the NW WTP were affected by effluent from the NW WTP and possibly other sources. At two sites upstream from the NW WTP, median nitrite plus nitrate concentrations were 1.1 and 1.4 milligrams per liter. The median nitrite plus nitrate concentration for the effluent from the NW WTP was 6.4 milligrams per liter, and the median concentration decreased downstream in the Little Sac River to 2.2, 1.2, and 0.56 milligrams per liter.The effects of the effluent from the NW WTP on the water quality of the Little Sac River downstream from the NW WTP were reflected in an increase in discharge (effluent from the NW WTP can be as much as 50 percent of the flow at the site about 1.5 river miles downstream from the NW WTP), an increase in specific conductance values, an increase in several inorganic constituent concentrations, including calcium, magnesium, and sulfate, and a large increase in sodium and chloride concentrations. The effluent from the NW WTP seemed to have no effect on the pH value, temperature, and dissolved oxygen concentrations in the Little Sac River.Results of repetitive element polymerase chain reaction (rep-PCR) pattern analysis indicated that most Escherichia coli (E. coli) bacteria in water samples probably were from nonhuman sources, such as horses and cattle. The rep-PCR pattern analysis indicated that horses were an important source of E. coli downstream from the NW WTP, which was consistent with horses pastured adjacent to the sampling site. Fecal coliform bacteria loads increased upstream from the NW WTP from the most upstream site to the site immediately upstream from the NW WTP. Loads in the effluent from the NW WTP and also tho

Serratia entomophila bet gene induction and the impact of glycine betaine accumulation on desiccation tolerance.

PubMed

Sheen, T R; O'Callaghan, M; Smalley, D J; Ronson, C W; Hurst, M R H

2013-02-01

The genes involved in choline transport and oxidation to glycine betaine in the biopesticidal bacterium Serratia entomophila were characterized, and the potential of osmoprotectants, coupled with increased NaCl concentrations, to improve the desiccation tolerance of this species was investigated. Serratia entomophila carries sequences similar to the Escherichia coli betTIBA genes encoding a choline transporter and dehydrogenase, a betaine aldehyde dehydrogenase and a regulatory protein. Disruption of betA abolished the ability of Ser. entomophila to utilize choline as a carbon source. Quantitative reverse-transcriptase PCR analysis revealed that betA transcription was reduced compared to that of the upstream genes in the operon, and that NaCl and choline induced bet gene expression. Glycine betaine and choline increased the NaCl tolerance of Ser. entomophila, and osmotically preconditioned cultures survived better than control cultures following desiccation and immediately after application to agricultural soil. Addition of glycine betaine and NaCl to growth medium can greatly enhance the desiccation survival of Ser. entomophila, and its initial survival in soil. Serratia entomophila is sensitive to desiccation and does not persist under low soil moisture conditions. Techniques described here for enhancing the desiccation survival of Ser. entomophila can be used to improve formulations of this bacterium, and allow its application under a wider range of environmental conditions. © 2012 AgResearch.

Cellodextrin utilization by bifidobacterium breve UCC2003.

PubMed

Pokusaeva, Karina; O'Connell-Motherway, Mary; Zomer, Aldert; Macsharry, John; Fitzgerald, Gerald F; van Sinderen, Douwe

2011-03-01

Cellodextrins, the incomplete hydrolysis products from insoluble cellulose, are accessible as a carbon source to certain members of the human gut microbiota, such as Bifidobacterium breve UCC2003. Transcription of the cldEFGC gene cluster of B. breve UCC2003 was shown to be induced upon growth on cellodextrins, implicating this cluster in the metabolism of these sugars. Phenotypic analysis of a B. breve UCC2003::cldE insertion mutant confirmed that the cld gene cluster is exclusively required for cellodextrin utilization by this commensal. Moreover, our results suggest that transcription of the cld cluster is controlled by a LacI-type regulator encoded by cldR, located immediately upstream of cldE. Gel mobility shift assays using purified CldR(His) (produced by the incorporation of a His(12)-encoding sequence into the 3' end of the cldC gene) indicate that the cldEFGC promoter is subject to negative control by CldR(His), which binds to two inverted repeats. Analysis by high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) of medium samples obtained during growth of B. breve UCC2003 on a mixture of cellodextrins revealed its ability to utilize cellobiose, cellotriose, cellotetraose, and cellopentaose, with cellotriose apparently representing the preferred substrate. The cldC gene of the cld operon of B. breve UCC2003 is, to the best of our knowledge, the first described bifidobacterial β-glucosidase exhibiting hydrolytic activity toward various cellodextrins.

Rhodopseudomonas palustris CGA010 Proteome Implicates Extracytoplasmic Function Sigma Factor in Stress Response

DOE PAGES

Allen, Michael S.; Hurst, Gregory B.; Lu, Tse-Yuan S.; ...

2015-04-08

Rhodopseudomonas palustris encodes 16 extracytoplasmic function (ECF) σ factors. In this paper, to begin to investigate the regulatory network of one of these ECF σ factors, the whole proteome of R. palustris CGA010 was quantitatively analyzed by tandem mass spectrometry from cultures episomally expressing the ECF σ RPA4225 (ecfT) versus a WT control. Among the proteins with the greatest increase in abundance were catalase KatE, trehalose synthase, a DPS-like protein, and several regulatory proteins. Alignment of the cognate promoter regions driving expression of several upregulated proteins suggested a conserved binding motif in the -35 and -10 regions with the consensusmore » sequence GGAAC-18N-TT. Additionally, the putative anti-σ factor RPA4224, whose gene is contained in the same predicted operon as RPA4225, was identified as interacting directly with the predicted response regulator RPA4223 by mass spectrometry of affinity-isolated protein complexes. Furthermore, another gene (RPA4226) coding for a protein that contains a cytoplasmic histidine kinase domain is located immediately upstream of RPA4225. The genomic organization of orthologs for these four genes is conserved in several other strains of R. palustris as well as in closely related α-Proteobacteria. Finally, taken together, these data suggest that ECF σ RPA4225 and the three additional genes make up a sigma factor mimicry system in R. palustris.« less

Rhodopseudomonas palustris CGA010 Proteome Implicates Extracytoplasmic Function Sigma Factor in Stress Response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allen, Michael S.; Hurst, Gregory B.; Lu, Tse-Yuan S.

Rhodopseudomonas palustris encodes 16 extracytoplasmic function (ECF) σ factors. In this paper, to begin to investigate the regulatory network of one of these ECF σ factors, the whole proteome of R. palustris CGA010 was quantitatively analyzed by tandem mass spectrometry from cultures episomally expressing the ECF σ RPA4225 (ecfT) versus a WT control. Among the proteins with the greatest increase in abundance were catalase KatE, trehalose synthase, a DPS-like protein, and several regulatory proteins. Alignment of the cognate promoter regions driving expression of several upregulated proteins suggested a conserved binding motif in the -35 and -10 regions with the consensusmore » sequence GGAAC-18N-TT. Additionally, the putative anti-σ factor RPA4224, whose gene is contained in the same predicted operon as RPA4225, was identified as interacting directly with the predicted response regulator RPA4223 by mass spectrometry of affinity-isolated protein complexes. Furthermore, another gene (RPA4226) coding for a protein that contains a cytoplasmic histidine kinase domain is located immediately upstream of RPA4225. The genomic organization of orthologs for these four genes is conserved in several other strains of R. palustris as well as in closely related α-Proteobacteria. Finally, taken together, these data suggest that ECF σ RPA4225 and the three additional genes make up a sigma factor mimicry system in R. palustris.« less

Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

PubMed

Sakumi, K; Sekiguchi, M

1989-01-20

The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

PubMed

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sternberg, E.A.; Spizz, G.; Perry, W.M.

1988-07-01

Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

The genetic basis of adaptive pigmentation variation in Drosophila melanogaster.

PubMed

Pool, John E; Aquadro, Charles F

2007-07-01

In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kb upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony.

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

PubMed

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.

1987-01-01

The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less

Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

PubMed

Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

1987-01-01

The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

Kin28 regulates the transient association of Mediator with core promoters

PubMed Central

Jeronimo, Célia; Robert, François

2014-01-01

Mediator is an essential, broadly utilized eukaryotic transcriptional co-activator. How and what it communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence (UAS), upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity, or in cells where the RNAPII C-terminal domain (CTD) is mutated to replace Ser5 with alanines, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is quickly released from promoters upon Ser5 phosphorylation by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter. PMID:24704787

RRE: a tool for the extraction of non-coding regions surrounding annotated genes from genomic datasets.

PubMed

Lazzarato, F; Franceschinis, G; Botta, M; Cordero, F; Calogero, R A

2004-11-01

RRE allows the extraction of non-coding regions surrounding a coding sequence [i.e. gene upstream region, 5'-untranslated region (5'-UTR), introns, 3'-UTR, downstream region] from annotated genomic datasets available at NCBI. RRE parser and web-based interface are accessible at http://www.bioinformatica.unito.it/bioinformatics/rre/rre.html

Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

USDA-ARS?s Scientific Manuscript database

The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

PubMed

Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

2006-12-01

An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Comparative RNA-Sequence Transcriptome Analysis of Phenolic Acid Metabolism in Salvia miltiorrhiza, a Traditional Chinese Medicine Model Plant

PubMed Central

Song, Zhenqiao; Guo, Linlin; Liu, Tian; Lin, Caicai; Wang, Jianhua

2017-01-01

Salvia miltiorrhiza Bunge is an important traditional Chinese medicine (TCM). In this study, two S. miltiorrhiza genotypes (BH18 and ZH23) with different phenolic acid concentrations were used for de novo RNA sequencing (RNA-seq). A total of 170,787 transcripts and 56,216 unigenes were obtained. There were 670 differentially expressed genes (DEGs) identified between BH18 and ZH23, 250 of which were upregulated in ZH23, with genes involved in the phenylpropanoid biosynthesis pathway being the most upregulated genes. Nine genes involved in the lignin biosynthesis pathway were upregulated in BH18 and thus result in higher lignin content in BH18. However, expression profiles of most genes involved in the core common upstream phenylpropanoid biosynthesis pathway were higher in ZH23 than that in BH18. These results indicated that genes involved in the core common upstream phenylpropanoid biosynthesis pathway might play an important role in downstream secondary metabolism and demonstrated that lignin biosynthesis was a putative partially competing pathway with phenolic acid biosynthesis. The results of this study expanded our understanding of the regulation of phenolic acid biosynthesis in S. miltiorrhiza. PMID:28194403

Genomic analysis of a new mammalian distal-less gene: Dlx7.

PubMed

Nakamura, S; Stock, D W; Wydner, K L; Bollekens, J A; Takeshita, K; Nagai, B M; Chiba, S; Kitamura, T; Freeland, T M; Zhao, Z; Minowada, J; Lawrence, J B; Weiss, K M; Ruddle, F H

1996-12-15

We have cloned a new Dlx gene (Dlx7) from human and mouse that may represent the mammalian orthologue of the newt gene NvHBox-5. The homeodomains of these genes are highly similar to all other vertebrate Dlx genes, and regions of similarity also exist between mammalian Dlx7 and a subset of vertebrate Dlx genes downstream of the homeodomain. The sequence divergence between human and mouse Dlx7 in these regions is greater than that predicted from comparisons of other vertebrate Dlx genes, however, and there is little sequence similarity upstream of the homeodomain both between these two genes and with other Dlx genes. We present evidence for alternative splicing of mouse Dlx7 upstream of the homeodomain that may account for some of this divergence. We have mapped human DLX7 distal to the 5' end of the HOXB cluster at an estimated distance of between 1 and 2 Mb by FISH. Both the human and the mouse Dlx7 are shown to be closely linked to Dlx3 in a convergently transcribed orientation. These mapping results support the possibility that vertebrate distal-less genes have been duplicated in concert with the Hox clusters.

Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).

PubMed

Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko

2010-02-01

GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.

Streambed stresses and flow around bridge piers

USGS Publications Warehouse

Parola, A.C.; Ruhl, K.J.; Hagerty, D.J.; Brown, B.M.; Ford, D.L.; Korves, A.A.

1996-01-01

Scour of streambed material around bridge foundations by floodwaters is the leading cause of catastrophic bridge failure in the United States. The potential for scour and the stability of riprap used to protect the streambed from scour during extreme flood events must be known to evaluate the likelihood of bridge failure. A parameter used in estimating the potential for scour and removal of riprap protection is the time-averaged shear stress on the streambed often referred to as boundary stress. Bridge components, such as bridge piers and abutments, obstruct flow and induce strong vortex systems that create streambed or boundary stresses significantly higher than those in unobstructed flow. These locally high stresses can erode the streambed around pier and abutment foundations to the extent that the foundation is undermined, resulting in settlement or collapse of bridge spans. The purpose of this study was to estimate streambed stresses at a bridge pier under full-scale flow conditions and to compare these stresses with those obtained previously in small-scale model studies. Two-dimensional velocity data were collected for three flow conditions around a bridge pier at the Kentucky State Highway 417 bridge over the Green River at Greensburg in Green County, Ky. Velocity vector plots and the horizontal component of streambed stress contour plots were developed from the velocity data. The streambed stress contours were developed using both a near-bed velocity and velocity gradient method. Maximum near-bed velocities measured at the pier for the three flow conditions were 1.5, 1.6, and 2.0 times the average near-bed velocities measured in the upstream approach flow. Maximum streambed stresses for the three flow conditions were determined to be 10, 15, and 36 times the streambed stresses of the upstream approach flow. Both the near-bed velocity measurements and approximate maximum streambed stresses at the full-scale pier were consistent with those observed in experiments using small-scale models in which similar data were collected, except for a single observation of the near-bed velocity data and the corresponding streambed stress determination. The location of the maximum streambed stress was immediately downstream of a 90 degree radial of the upstream cylinder (with the center of the upstream cylinder being the origin) for the three flow conditions. This location was close to the flow wake separation point at the upstream cylinder. Other researchers have observed the maximum streambed stress around circular cylinders at this location or at a location immediately upstream of the wake separation point. Although the magnitudes of the estimated streambed stresses measured at the full-scale pier were consistent with those measured in small-scale model studies, the stress distributions were significantly different than those measured in small-scale models. The most significant discrepancies between stress contours developed in this study and those developed in the small-scale studies for flow around cylindrical piers on a flat streambed were associated with the shape of the stress contours. The extent of the high stress region of the streambed around the full-scale pier was substantially larger than the diameter of the upstream cylinder, while small-scale models had small regions compared to the diameter of the model cylinders. In addition, considerable asymmetry in the stress contours was observed. The large region of high stress and asymmetry was attributed to several factors including (1) the geometry of the full-scale pier, (2) the non-planar topography of the streambed, (3) the 20 degree skew of the pier to the approaching flow, and (4) the non-uniformity of the approach flow. The extent of effect of the pier on streambed stresses was found to be larger for the full-scale site than for model studies. The results from the model studies indicated that the streambed stresses created by the obstruction of flow by the 3-foot wide pi

Deterministic chaos in a model of a simple delta network

NASA Astrophysics Data System (ADS)

Salter, G.; Voller, V. R.; Paola, C.

2017-12-01

An important aspect of delta dynamics is how sediment flux is partitioned to different parts of the delta through time, affecting patterns of land-building/loss, and the formation of stratigraphy. Here, we present results from a model of a simple distributary network consisting of two orders of bifurcations: an upstream channel splits into two branches, each of which splits into two additional branches. The 1D bed elevation profiles of each branch are modeled through time, and a nodal condition accounting for a transverse bed slope just upstream of the bifurcation is used to partition the flow at bifurcations. The model generates surprisingly complex dynamics despite its simplicity. Constrained by the need to distribute sediment evenly between branches in the long-run, the system undergoes repeated full and partial avulsions. We find that the solution to the system is aperiodic, but bounded. We also observe a sensitive dependence on the initial conditions: simulations started with slightly different initial conditions diverge exponentially. These observations are the hallmark of chaos, summarized by Edward Lorenz as "where the present determines the future, but the approximate present does not approximately determine the future." In our model, chaos results from the two-way coupling between upstream and downstream bifurcations. We find that a single bifurcation may be periodic, but it is never chaotic. However, when coupled, avulsions in the upstream channel change the upstream boundary conditions for the downstream bifurcations, and conversely, avulsions in the downstream bifurcations affect the slope of their feeder channel, propagating upstream to the first bifurcation. We explore how the system generates stratigraphy, using the Shields stress at the time of deposition as a proxy. We compare the stratigraphy to the single bifurcation case, which is periodic rather than chaotic. We also examine stratigraphic completeness, and find that hiatuses in the upstream portion of the domain tend to be erosional, whereas hiatuses further downstream tend to represent pauses. Our work suggests that deltas have a limited window of predictability, and indicates that chaotic and cyclic avulsion sequences should be distinguishable in the stratigraphic record.

Early-Stage Chunking of Finger Tapping Sequences by Persons Who Stutter and Fluent Speakers

ERIC Educational Resources Information Center

Smits-Bandstra, Sarah; De Nil, Luc F.

2013-01-01

This research note explored the hypothesis that chunking differences underlie the slow finger-tap sequencing performance reported in the literature for persons who stutter (PWS) relative to fluent speakers (PNS). Early-stage chunking was defined as an immediate and spontaneous tendency to organize a long sequence into pauses, for motor planning,…

Total Nitrogen Sources of the Three Gorges Reservoir — A Spatio-Temporal Approach

PubMed Central

Ren, Chunping; Wang, Lijing; Zheng, Binghui; Holbach, Andreas

2015-01-01

Understanding the spatial and temporal variation of nutrient concentrations, loads, and their distribution from upstream tributaries is important for the management of large lakes and reservoirs. The Three Gorges Dam was built on the Yangtze River in China, the world’s third longest river, and impounded the famous Three Gorges Reservoir (TGR). In this study, we analyzed total nitrogen (TN) concentrations and inflow data from 2003 till 2010 for the main upstream tributaries of the TGR that contribute about 82% of the TGR’s total inflow. We used time series analysis for seasonal decomposition of TN concentrations and used non-parametric statistical tests (Kruskal-Walli H, Mann-Whitney U) as well as base flow segmentation to analyze significant spatial and temporal patterns of TN pollution input into the TGR. Our results show that TN concentrations had significant spatial heterogeneity across the study area (Tuo River> Yangtze River> Wu River> Min River> Jialing River>Jinsha River). Furthermore, we derived apparent seasonal changes in three out of five upstream tributaries of the TGR rivers (Kruskal-Walli H ρ = 0.009, 0.030 and 0.029 for Tuo River, Jinsha River and Min River in sequence). TN pollution from non-point sources in the upstream tributaries accounted for 68.9% of the total TN input into the TGR. Non-point source pollution of TN revealed increasing trends for 4 out of five upstream tributaries of the TGR. Land use/cover and soil type were identified as the dominant driving factors for the spatial distribution of TN. Intensifying agriculture and increasing urbanization in the upstream catchments of the TGR were the main driving factors for non-point source pollution of TN increase from 2003 till 2010. Land use and land cover management as well as chemical fertilizer use restriction were needed to overcome the threats of increasing TN pollution. PMID:26510158

Genes encoding Xenopus laevis Ig L chains: Implications for the evolution of [kappa] and [lambda] chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zezza, D.J.; Stewart, S.E.; Steiner, L.A.

1992-12-15

Xenopus laevis Ig contain two distinct types of L chains, designated [rho] or L1 and [sigma] or L2. The authors have analyzed Xenopus genomic DNA by Southern blotting with cDNA probes specific for L1 V and C regions. Many fragments hybridized to the V probe, but only one or two fragments hybridized to the C probe. Corresponding C, J, and V gene segments were identified on clones isolated from a genomic library prepared from the same DNA. One clone contains a C gene segment separated from a J gene segment by an intron of 3.4 kb. The J and Cmore » gene segments are nearly identical in sequence to cDNA clones analyzed previously. The C segment is somewhat more similar and the J segment considerably more similar in sequence to the corresponding segments of mammalian [kappa] chains than to those of mammalian [lambda] chains. Upstream of the J segment is a typical recombination signal sequence with a spacer of 23 bp, as in J[kappa]. A second clone from the library contains four V gene segments, separated by 2.1 to 3.6 kb. Two of these, V1 and V3, have the expected structural and regulatory features of V genes, and are very similar in sequence to each other and to mammalian V[kappa]. A third gene segment, V2, resembles V1 and V3 in its coding region and nearby 5[prime]-flanking region, but diverges in sequence 5[prime] to position [minus]95 with loss of the octamer promoter element. The fourth V-like segment is similar to the others at the 3[prime]-end, but upstream of codon 64 bears no resemblance in sequence to any Ig V region. All four V segments have typical recombination signal sequences with 12-bp spacers at their 3[prime]-ends, as in V[kappa]. Taken together, the data suggest that Xenopus L1 L chain genes are members of the [kappa] gene family. 80 refs., 9 figs.« less

Three-Dimensional, Laminar Flow Past a Short, Surface-Mounted Cylinder

NASA Astrophysics Data System (ADS)

Liakos, Anastasios; Malamataris, Nikolaos

2016-11-01

The topology and evolution of three-dimensional flow past a cylinder of slenderness ratio SR = 1 mounted in a wind tunnel is examined for 0 . 1 <= Re <= 325 (based on the diameter of the cylinder) where steady-state solutions have been obtained. Direct numerical simulations were computed using an in-house parallel finite element code. Results indicate that symmetry breaking occurs at Re = 1 , while the first prominent structure is a horseshoe vortex downstream from the cylinder. At Re = 150 , two foci are observed, indicating the formation of two tornadolike vortices downstream. Concurrently, another horseshoe vortex is formed upstream from the cylinder. For higher Reynolds numbers, the flow downstream is segmented to upper and lower parts, whereas the topology of the flow on the solid boundaries remains unaltered. Pressure distributions show that pressure, the key physical parameter in the flow, decreases everywhere except immediately upstream from the cylinder. In addition, creation of critical points from saddle-node-type bifurcations occur when the streamwise component of the pressure gradient changes sign. Finally, at Re = 325 , an additional horseshoe vorrtex is formed at the wake of the cylinder

A conserved catalytic residue in the ubiquitin-conjugating enzyme family

PubMed Central

Wu, Pei-Ying; Hanlon, Mary; Eddins, Michael; Tsui, Colleen; Rogers, Richard S.; Jensen, Jane P.; Matunis, Michael J.; Weissman, Allan M.; Wolberger, Cynthia P.; Pickart, Cecile M.

2003-01-01

Ubiquitin (Ub) regulates diverse functions in eukaryotes through its attachment to other proteins. The defining step in this protein modification pathway is the attack of a substrate lysine residue on Ub bound through its C-terminus to the active site cysteine residue of a Ub-conjugating enzyme (E2) or certain Ub ligases (E3s). So far, these E2 and E3 cysteine residues are the only enzyme groups known to participate in the catalysis of conjugation. Here we show that a strictly conserved E2 asparagine residue is critical for catalysis of E2- and E2/RING E3-dependent isopeptide bond formation, but dispensable for upstream and downstream reactions of Ub thiol ester formation. In constrast, the strictly conserved histidine and proline residues immediately upstream of the asparagine are dispensable for catalysis of isopeptide bond formation. We propose that the conserved asparagine side chain stabilizes the oxyanion intermediate formed during lysine attack. The E2 asparagine is the first non-covalent catalytic group to be proposed in any Ub conjugation factor. PMID:14517261

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

PubMed

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

PubMed

Li, Shisheng; Smerdon, Michael J

2004-04-02

Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data

PubMed Central

2010-01-01

Background In bioinformatics it is common to search for a pattern of interest in a potentially large set of rather short sequences (upstream gene regions, proteins, exons, etc.). Although many methodological approaches allow practitioners to compute the distribution of a pattern count in a random sequence generated by a Markov source, no specific developments have taken into account the counting of occurrences in a set of independent sequences. We aim to address this problem by deriving efficient approaches and algorithms to perform these computations both for low and high complexity patterns in the framework of homogeneous or heterogeneous Markov models. Results The latest advances in the field allowed us to use a technique of optimal Markov chain embedding based on deterministic finite automata to introduce three innovative algorithms. Algorithm 1 is the only one able to deal with heterogeneous models. It also permits to avoid any product of convolution of the pattern distribution in individual sequences. When working with homogeneous models, Algorithm 2 yields a dramatic reduction in the complexity by taking advantage of previous computations to obtain moment generating functions efficiently. In the particular case of low or moderate complexity patterns, Algorithm 3 exploits power computation and binary decomposition to further reduce the time complexity to a logarithmic scale. All these algorithms and their relative interest in comparison with existing ones were then tested and discussed on a toy-example and three biological data sets: structural patterns in protein loop structures, PROSITE signatures in a bacterial proteome, and transcription factors in upstream gene regions. On these data sets, we also compared our exact approaches to the tempting approximation that consists in concatenating the sequences in the data set into a single sequence. Conclusions Our algorithms prove to be effective and able to handle real data sets with multiple sequences, as well as biological patterns of interest, even when the latter display a high complexity (PROSITE signatures for example). In addition, these exact algorithms allow us to avoid the edge effect observed under the single sequence approximation, which leads to erroneous results, especially when the marginal distribution of the model displays a slow convergence toward the stationary distribution. We end up with a discussion on our method and on its potential improvements. PMID:20205909

Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data.

PubMed

Nuel, Gregory; Regad, Leslie; Martin, Juliette; Camproux, Anne-Claude

2010-01-26

In bioinformatics it is common to search for a pattern of interest in a potentially large set of rather short sequences (upstream gene regions, proteins, exons, etc.). Although many methodological approaches allow practitioners to compute the distribution of a pattern count in a random sequence generated by a Markov source, no specific developments have taken into account the counting of occurrences in a set of independent sequences. We aim to address this problem by deriving efficient approaches and algorithms to perform these computations both for low and high complexity patterns in the framework of homogeneous or heterogeneous Markov models. The latest advances in the field allowed us to use a technique of optimal Markov chain embedding based on deterministic finite automata to introduce three innovative algorithms. Algorithm 1 is the only one able to deal with heterogeneous models. It also permits to avoid any product of convolution of the pattern distribution in individual sequences. When working with homogeneous models, Algorithm 2 yields a dramatic reduction in the complexity by taking advantage of previous computations to obtain moment generating functions efficiently. In the particular case of low or moderate complexity patterns, Algorithm 3 exploits power computation and binary decomposition to further reduce the time complexity to a logarithmic scale. All these algorithms and their relative interest in comparison with existing ones were then tested and discussed on a toy-example and three biological data sets: structural patterns in protein loop structures, PROSITE signatures in a bacterial proteome, and transcription factors in upstream gene regions. On these data sets, we also compared our exact approaches to the tempting approximation that consists in concatenating the sequences in the data set into a single sequence. Our algorithms prove to be effective and able to handle real data sets with multiple sequences, as well as biological patterns of interest, even when the latter display a high complexity (PROSITE signatures for example). In addition, these exact algorithms allow us to avoid the edge effect observed under the single sequence approximation, which leads to erroneous results, especially when the marginal distribution of the model displays a slow convergence toward the stationary distribution. We end up with a discussion on our method and on its potential improvements.

Leaderless mRNAs are circularized in Chlamydomonas reinhardtii mitochondria.

PubMed

Cahoon, A Bruce; Qureshi, Ali A

2018-06-01

The mitochondrial genome of Chlamydomonas reinhardtii encodes eight protein coding genes transcribed on two polycistronic primary transcripts. The mRNAs are endonucleolytically cleaved from these transcripts directly upstream of their AUG start codons, creating leaderless mRNAs with 3' untranslated regions (UTR) comprised of most or all of their downstream intergenic regions. In this report, we provide evidence that these processed linear mRNAs are circularized, which places the 3' UTR upstream of the 5' start codon, creating a leader sequence ex post facto. The circular mRNAs were found to be ribosome associate by polysome profiling experiments suggesting they are translated. Sequencing of the 3'-5' junctions of the circularized mRNAs found the intra-molecular ligations occurred between fully processed 5' ends (the start AUG) and a variable 3' terminus. For five genes (cob, cox, nd2, nd4, and nd6), some of the 3' ends maintained an oligonucleotide addition during ligation, and for two of them, cob and nd6, these 3' termini were the most commonly recovered sequence. Previous reports have shown that after cleavage, three untemplated oligonucleotide additions may occur on the 3' termini of these mRNAs-adenylation, uridylylation, or cytidylation. These results suggest oligo(U) and oligo(C) additions may be part of the maturation process since they are maintained in the circular mRNAs. Circular RNAs occur in organisms across the biological spectrum, but their purpose in some systems, such as organelles (mitochondria and chloroplasts) is unclear. We hypothesize, that in C. reinhardtii mitochondria it may create a leader sequence to facilitate translation initiation, which may negate the need for an alternative translation initiation mechanism in this system, as previously speculated. In addition, circularization may play a protective role against exonucleases, and/or increase translational productivity.

A mutation in an alternative untranslated exon of hexokinase 1 associated with hereditary motor and sensory neuropathy -- Russe (HMSNR).

PubMed

Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald J A; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

2009-12-01

Hereditary Motor and Sensory Neuropathy -- Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to approximately 70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to approximately 26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS).

A mutation in an alternative untranslated exon of hexokinase 1 associated with Hereditary Motor and Sensory Neuropathy – Russe (HMSNR)

PubMed Central

Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald JA; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

2009-01-01

Hereditary Motor and Sensory Neuropathy – Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to ∼70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to ∼26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS). PMID:19536174

Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

PubMed

Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

1998-05-01

Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

PubMed Central

2009-01-01

Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

Characterization of Rous sarcoma virus polyadenylation site use in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maciolek, Nicole L.; McNally, Mark T.

2008-05-10

Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

PubMed Central

Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

2010-01-01

Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.

PubMed

Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A

1996-10-01

Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.

Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

PubMed

Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

2010-09-01

As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burkhardt E.; Adham, I.M.; Brosig, B.

1994-03-01

Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

PubMed

DeVry, C G; Tsai, W; Clarke, S

1996-11-15

The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

Mrp--a new auxiliary gene essential for optimal expression of methicillin resistance in Staphylococcus aureus.

PubMed

Wu, S W; De Lencastre, H

1999-01-01

Screening of a library of Tn551 insertional mutants selected for reduction in the methicillin resistance level of the parental Staphylococcus aureus strain COL resulted in the isolation of mutant RUSA266 in which the minimal inhibitory concentration (MIC) of the parent was reduced from 1,600 to 1.5 micrograms/mL. Cloning and sequencing of the vicinity of the insertion site omega 726 identified an open reading frame (orf1365) encoding a very large polypeptide of more than 1,365 amino acids. A unique feature of the deduced amino acid sequence was the presence of multiple tandem repeats of 75 amino acids in the polypeptide, reminiscent of the structure of high-molecular-weight cell-surface proteins EF* and Emb identified in some streptococcal strains. Mutant RUSA266 with the inactivated gene, which we shall provisionally refer to as mrp (for multiple repeat polypeptide), produced a peptidoglycan with altered muropeptide composition, and both the reduced antibiotic resistance and the altered cell wall composition were co-transduced in back-crosses into the parental strain COL. Additional sequencing upstream of mrp has revealed that this gene was part of a five-gene cluster occupying a 9.2-kb region of the staphylococcal chromosome and was composed of glmM (directly upstream of mrp), two open reading frames orf310 and orf269 coding for two hypothetical proteins, and the gene encoding the staphylococcal arginase (arg). Transcriptional analysis demonstrated that the five genes in the cluster were transcribed together.

Effectiveness of Immediate Verbal Feedback on Trainer Behaviour During Communication Training with Individuals with Intellectual Disability

ERIC Educational Resources Information Center

van Vonderen, A.

2004-01-01

The effect of immediate verbal feedback on trainer behaviour during communication training sessions with individuals with intellectual disability (ID) was assessed. Trainers were six undergraduate university students majoring in psychology. The procedure consisted of interrupting the sequence of trials of training by the supervisor and then giving…

Cross-Linguistic Differences in the Immediate Serial Recall of Consonants versus Vowels

ERIC Educational Resources Information Center

Kissling, Elizabeth M.

2012-01-01

The current study investigated native English and native Arabic speakers' phonological short-term memory for sequences of consonants and vowels. Phonological short-term memory was assessed in immediate serial recall tasks conducted in Arabic and English for both groups. Participants (n = 39) heard series of six consonant-vowel syllables and wrote…

Time Ordering in Frontal Lobe Patients: A Stochastic Model Approach

ERIC Educational Resources Information Center

Magherini, Anna; Saetti, Maria Cristina; Berta, Emilia; Botti, Claudio; Faglioni, Pietro

2005-01-01

Frontal lobe patients reproduced a sequence of capital letters or abstract shapes. Immediate and delayed reproduction trials allowed the analysis of short- and long-term memory for time order by means of suitable Markov chain stochastic models. Patients were as proficient as healthy subjects on the immediate reproduction trial, thus showing spared…

RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

PubMed

Brule, C E; Dean, K M; Grayhack, E J

2016-01-01

The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

Sequences downstream of AAUAAA signals affect pre-mRNA cleavage and polyadenylation in vitro both directly and indirectly.

PubMed Central

Ryner, L C; Takagaki, Y; Manley, J L

1989-01-01

To investigate the role of sequences lying downstream of the conserved AAUAAA hexanucleotide in pre-mRNA cleavage and polyadenylation, deletions or substitutions were constructed in polyadenylation signals from simian virus 40 and adenovirus, and their effects were assayed in both crude and fractionated HeLa cell nuclear extracts. As expected, these sequences influenced the efficiency of both cleavage and polyadenylation as well as the accuracy of the cleavage reaction. Sequences near or upstream of the actual site of poly(A) addition appeared to specify a unique cleavage site, since their deletion resulted, in some cases, in heterogeneous cleavage. Furthermore, the sequences that allowed the simian virus 40 late pre-RNA to be cleaved preferentially by partially purified cleavage activity were also those at the cleavage site itself. Interestingly, sequences downstream of the cleavage site interacted with factors not directly involved in catalyzing cleavage and polyadenylation, since the effects of deletions were substantially diminished when partially purified components were used in assays. In addition, these sequences contained elements that could affect 3'-end formation both positively and negatively. Images PMID:2566911

Logistic model of nitrate in streams of the upper-midwestern United States

USGS Publications Warehouse

Mueller, D.K.; Ruddy, B.C.; Battaglin, W.A.

1997-01-01

Nitrate in surface water can have adverse effects on aquatic life and, in drinking-water supplies, can be a risk to human health. As part of a regional study, nitrates as N (NO3-N) was analyzed in water samples collected from streams throughout 10 Midwestern states during synoptic surveys in 1989, 1990, and 1994. Data from the period immediately following crop planting at 124 sites were analyzed during logistic regression to relate discrete categories of NO3-N concentrations to characteristics of the basins upstream from the sites. The NO3-N data were divided into three categories representing probable background concentrations (10 mg L-1). Nitrate-N concentrations were positively correlated to streamflow, upstream area planted in corn (Zea mays L.), and upstream N- fertilizers application rates. Elevated NO3-N concentrations were associated with poorly drained soils and were weakly correlated with population density. Nitrate-N and streamflow data collected during 1989 and 1990 were used to calibrate the model, and data collected during 1994 were used for verification. The model correctly estimated NO3-N concentration categories for 79% of the samples in the calibration data set and 60% of the samples in the verification data set. The model was used to indicate where NO3-N concentrations might be elevated or exceed the NO3-N MCL in streams throughout the study area. The potential for elevated NO3-N concentrations was predicted to be greatest for streams in Illinois, Indiana, Iowa, and western Ohio.

The Effect of Old Age on Supra-Span Learning of Visuo-Spatial Sequences under Incidental and Intentional Encoding Instructions

ERIC Educational Resources Information Center

Gagnon, Sylvain; Bedard, Marie-Josee; Turcotte, Josee

2005-01-01

Recent findings [Turcotte, Gagnon, & Poirier, 2005. The effect of old age on the learning of supra-span sequences. "Psychology and Aging," 20, 251-260.] indicate that incidental learning of visuo-spatial supra-span sequences through immediate serial recall declines with old age (Hebb's paradigm). In this study, we examined whether…

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

PubMed Central

Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

1988-01-01

cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

Ground penetrating radar documents short-term near-surface hydrological changes around Old Faithful Geyser, Yellowstone National Park, USA

NASA Astrophysics Data System (ADS)

Lynne, Bridget Y.; Heasler, Henry; Jaworowski, Cheryl; Smith, Gary J.; Smith, Isaac J.; Foley, Duncan

2018-04-01

In April 2015, Ground Penetrating Radar (GPR) was used to characterize the shallow subsurface (< 5 m depth) of the western sinter slope immediately adjacent to Old Faithful Geyser and near the north side of an inferred geyser cavity. A series of time-sequence images were collected between two eruptions of Old Faithful Geyser. Each set of time-sequence GPR recordings consisted of four transects aligned to provide coverage near the potential location of the inferred 15 m deep geyser chamber. However, the deepest penetration we could achieve with a 200 MHz GPR antennae was 5 m. Seven time-sequence events were collected over a 48-minute interval to image changes in the near-surface, during pre- and post-eruptive cycles. Time-sequence GPR images revealed a series of possible micro-fractures in a highly porous siliceous sinter in the near-surface that fill and drain repetitively, immediately after an eruption and during the recharge period prior to the next main eruptive event.

Identification of early zygotic genes in the yellow fever mosquito Aedes aegypti and discovery of a motif involved in early zygotic genome activation.

PubMed

Biedler, James K; Hu, Wanqi; Tae, Hongseok; Tu, Zhijian

2012-01-01

During early embryogenesis the zygotic genome is transcriptionally silent and all mRNAs present are of maternal origin. The maternal-zygotic transition marks the time over which embryogenesis changes its dependence from maternal RNAs to zygotically transcribed RNAs. Here we present the first systematic investigation of early zygotic genes (EZGs) in a mosquito species and focus on genes involved in the onset of transcription during 2-4 hr. We used transcriptome sequencing to identify the "pure" (without maternal expression) EZGs by analyzing transcripts from four embryonic time ranges of 0-2, 2-4, 4-8, and 8-12 hr, which includes the time of cellular blastoderm formation and up to the start of gastrulation. Blast of 16,789 annotated transcripts vs. the transcriptome reads revealed evidence for 63 (P<0.001) and 143 (P<0.05) nonmaternally derived transcripts having a significant increase in expression at 2-4 hr. One third of the 63 EZG transcripts do not have predicted introns compared to 10% of all Ae. aegypti genes. We have confirmed by RT-PCR that zygotic transcription starts as early as 2-3 hours. A degenerate motif VBRGGTA was found to be overrepresented in the upstream sequences of the identified EZGs using a motif identification software called SCOPE. We find evidence for homology between this motif and the TAGteam motif found in Drosophila that has been implicated in EZG activation. A 38 bp sequence in the proximal upstream sequence of a kinesin light chain EZG (KLC2.1) contains two copies of the mosquito motif. This sequence was shown to support EZG transcription by luciferase reporter assays performed on injected early embryos, and confers early zygotic activity to a heterologous promoter from a divergent mosquito species. The results of these studies are consistent with the model of early zygotic genome activation via transcriptional activators, similar to what has been found recently in Drosophila.

Ribosomal biosynthesis of α-amanitin in Galerina marginata

PubMed Central

Luo, Hong; Hallen-Adams, Heather E.; Scott-Craig, John S.; Walton, Jonathan D.

2014-01-01

Amatoxins, including α-amanitin, are bicyclic octapeptides found in mushrooms (Agaricomycetes, Agaricales) of certain species in the genera Amanita, Galerina, Lepiota, and Conocybe. Amatoxins and the chemically similar phallotoxins are synthesized on ribosomes in Amanita bisporigera, Amanita phalloides, and Amanita ocreata. In order to determine if amatoxins are synthesized by a similar mechanism in another, distantly related mushroom, we obtained genome survey sequence data from a monokaryotic isolate of Galerina marginata, which produces α-amanitin. The genome of G. marginata contains two copies of the α-amanitin gene (GmAMA1-1 and GmAMA1-2). The α-amanitin proprotein sequences of G. marginata (35 amino acids) are highly divergent from AMA1 of A. bisporigera except for the toxin region itself (IWGIGCNP in single-letter amino acid code) and the amino acids immediately upstream (N[A/S]TRLP). G. marginata does not contain any related toxin-encoding sequences besides GmAMA1-1 and GmAMA1-2. DNA from two other α-amanitin-producing isolates of Galerina (G. badipes and G. venenata) hybridized to GmAMA1, whereas DNA from the toxin non-producing species Galerina hybrida did not. Expression of the GmAMA1 genes was induced by growth on low carbon. RNASeq evidence indicates that both copies of GmAMA1 are expressed approximately equally. A prolyl oligopeptidase (POP) is strongly implicated in processing of the cyclic peptide toxins of A. bisporigera and Conocybe apala. G. marginata has two predicted POP genes; one, like AbPOPB of A. bisporigera, is present only in the toxin-producing isolates of Galerina and the other, like AbPOPA of A. bisporigera, is present in all species. Our results indicate that G. marginata biosynthesizes amatoxins on ribosomes by a pathway similar to Amanita species, involving a genetically encoded proprotein of 35 amino acids that is post-translationally processed by a POP. However, due to the high degree of divergence, the evolutionary relationship between AMA1 in the genera Amanita and Galerina is unclear. PMID:22202811

6-phospho-alpha-D-glucosidase from Fusobacterium mortiferum: cloning, expression, and assignment to family 4 of the glycosylhydrolases.

PubMed Central

Bouma, C L; Reizer, J; Reizer, A; Robrish, S A; Thompson, J

1997-01-01

The Fusobacterium mortiferum malH gene, encoding 6-phospho-alpha-glucosidase (maltose 6-phosphate hydrolase; EC 3.2.1.122), has been isolated, characterized, and expressed in Escherichia coli. The relative molecular weight of the polypeptide encoded by malH (441 residues; Mr of 49,718) was in agreement with the estimated value (approximately 49,000) obtained by sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the enzyme purified from F. mortiferum. The N-terminal sequence of the MalH protein obtained by Edman degradation corresponded to the first 32 amino acids deduced from the malH sequence. The enzyme produced by the strain carrying the cloned malH gene cleaved [U-14C]maltose 6-phosphate to glucose 6-phosphate (Glc6P) and glucose. The substrate analogs p-nitrophenyl-alpha-D-glucopyranoside 6-phosphate (pNP alphaGlc6P) and 4-methylumbelliferyl-alpha-D-glucopyranoside 6-phosphate (4MU alphaGlc6P) were hydrolyzed to yield Glc6P and the yellow p-nitrophenolate and fluorescent 4-methylumbelliferyl aglycons, respectively. The 6-phospho-alpha-glucosidase expressed in E. coli (like the enzyme purified from F. mortiferum) required Fe2+, Mn2+, Co2+, or Ni2+ for activity and was inhibited in air. Synthesis of maltose 6-phosphate hydrolase from the cloned malH gene in E. coli was modulated by addition of various sugars to the growth medium. Computer-based analyses of MalH and its homologs revealed that the phospho-alpha-glucosidase from F. mortiferum belongs to the seven-member family 4 of the glycosylhydrolase superfamily. The cloned 2.2-kb Sau3AI DNA fragment from F. mortiferum contained a second partial open reading frame of 83 residues (designated malB) that was located immediately upstream of malH. The high degree of sequence identity of MalB with IIB(Glc)-like proteins of the phosphoenol pyruvate dependent:sugar phosphotransferase system suggests participation of MalB in translocation of maltose and related alpha-glucosides in F. mortiferum. PMID:9209025

Monte Carlo evaluation of magnetically focused proton beams for radiosurgery

NASA Astrophysics Data System (ADS)

McAuley, Grant A.; Heczko, Sarah L.; Nguyen, Theodore T.; Slater, James M.; Slater, Jerry D.; Wroe, Andrew J.

2018-03-01

The purpose of this project is to investigate the advantages in dose distribution and delivery of proton beams focused by a triplet of quadrupole magnets in the context of potential radiosurgery treatments. Monte Carlo simulations were performed using various configurations of three quadrupole magnets located immediately upstream of a water phantom. Magnet parameters were selected to match what can be commercially manufactured as assemblies of rare-earth permanent magnetic materials. Focused unmodulated proton beams with a range of ~10 cm in water were target matched with passive collimated beams (the current beam delivery method for proton radiosurgery) and properties of transverse dose, depth dose and volumetric dose distributions were compared. Magnetically focused beams delivered beam spots of low eccentricity to Bragg peak depth with full widths at the 90% reference dose contour from ~2.5 to 5 mm. When focused initial beam diameters were larger than matching unfocused beams (10 of 11 cases) the focused beams showed 16%–83% larger peak-to-entrance dose ratios and 1.3 to 3.4-fold increases in dose delivery efficiency. Peak-to-entrance and efficiency benefits tended to increase with larger magnet gradients and larger initial diameter focused beams. Finally, it was observed that focusing tended to shift dose in the water phantom volume from the 80%–20% dose range to below 20% of reference dose, compared to unfocused beams. We conclude that focusing proton beams immediately upstream from tissue entry using permanent magnet assemblies can produce beams with larger peak-to-entrance dose ratios and increased dose delivery efficiencies. Such beams could potentially be used in the clinic to irradiate small-field radiosurgical targets with fewer beams, lower entrance dose and shorter treatment times.

Generating constrained randomized sequences: item frequency matters.

PubMed

French, Robert M; Perruchet, Pierre

2009-11-01

All experimental psychologists understand the importance of randomizing lists of items. However, randomization is generally constrained, and these constraints-in particular, not allowing immediately repeated items-which are designed to eliminate particular biases, frequently engender others. We describe a simple Monte Carlo randomization technique that solves a number of these problems. However, in many experimental settings, we are concerned not only with the number and distribution of items but also with the number and distribution of transitions between items. The algorithm mentioned above provides no control over this. We therefore introduce a simple technique that uses transition tables for generating correctly randomized sequences. We present an analytic method of producing item-pair frequency tables and item-pair transitional probability tables when immediate repetitions are not allowed. We illustrate these difficulties and how to overcome them, with reference to a classic article on word segmentation in infants. Finally, we provide free access to an Excel file that allows users to generate transition tables with up to 10 different item types, as well as to generate appropriately distributed randomized sequences of any length without immediately repeated elements. This file is freely available from http://leadserv.u-bourgogne.fr/IMG/xls/TransitionMatrix.xls.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kennedy, M.A.; Morris, C.M.; Fitzgerald, P.H.

The human kappa deleting element (Kde) mediates loss of CK and JK genes in B cells. A probe for Kde detects two genomic sequences on Southern blots. The Kde is located 24kb 3{prime} to CK, but the position of the homologous sequence is unknown. The authors in situ hybridized m141-2 to metaphase cells of JC11, a B-cell line bearing a t(2;14)(p11;q32) in which the chromosome 2 breakpoint is within JK or the VK-JK intron. Three peaks of labelled sites were obtained. Southern analysis of BamH1 digested DNA showed that Kde (14kb) and the homologous sequence (3kb) were both intact. Kdemore » accounts for hybridization to 14q+ and the 2p- signal presumably derives from the related sequence. This locates the sequence homologous to Kde upstream from JK, possibly within the VK cluster, and may reflect transposition or some other duplicative event as proposed for the evolution of other regions of the kappa locus.« less

Recombined sequences between the non-coding control regions of JC and BK viruses found in the urine of a renal transplantation patient.

PubMed

Liaw, Yu-Ching; Chen, Cheng-Hsu; Shu, Kuo-Hsiung; Fang, Chiung-Yao; Ou, Wei-Chih; Chen, Pei-Lain; Shen, Cheng-Huang; Lin, Mien-Chun; Chang, Deching; Wang, Meilin

2012-12-01

Kidney cells are the common host for JC virus (JCV) and BK virus (BKV). Reactivation of JCV and/or BKV in patients after organ transplantation, such as renal transplantation, may cause hemorrhagic cystitis and polyomavirus-associated nephropathy. Furthermore, JCV and BKV may be shed in the urine after reactivation in the kidney. Rearranged as well as archetypal non-coding control regions (NCCRs) of JCV and BKV have been frequently identified in human samples. In this study, three JC/BK recombined NCCR sequences were identified in the urine of a patient who had undergone renal transplantation. They were designated as JC-BK hybrids 1, 2, and 3. The three JC/BK recombinant NCCRs contain up-stream JCV as well as down-stream BKV sequences. Deletions of both JCV and BKV sequences were found in these recombined NCCRs. Recombination of DNA sequences between JCV and BKV may occur during co-infection due to the relatively high homology of the two viral genomes.

Spliced RNA of woodchuck hepatitis virus.

PubMed

Ogston, C W; Razman, D G

1992-07-01

Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.

A high-throughput and quantitative method to assess the mutagenic potential of translesion DNA synthesis

PubMed Central

Taggart, David J.; Camerlengo, Terry L.; Harrison, Jason K.; Sherrer, Shanen M.; Kshetry, Ajay K.; Taylor, John-Stephen; Huang, Kun; Suo, Zucai

2013-01-01

Cellular genomes are constantly damaged by endogenous and exogenous agents that covalently and structurally modify DNA to produce DNA lesions. Although most lesions are mended by various DNA repair pathways in vivo, a significant number of damage sites persist during genomic replication. Our understanding of the mutagenic outcomes derived from these unrepaired DNA lesions has been hindered by the low throughput of existing sequencing methods. Therefore, we have developed a cost-effective high-throughput short oligonucleotide sequencing assay that uses next-generation DNA sequencing technology for the assessment of the mutagenic profiles of translesion DNA synthesis catalyzed by any error-prone DNA polymerase. The vast amount of sequencing data produced were aligned and quantified by using our novel software. As an example, the high-throughput short oligonucleotide sequencing assay was used to analyze the types and frequencies of mutations upstream, downstream and at a site-specifically placed cis–syn thymidine–thymidine dimer generated individually by three lesion-bypass human Y-family DNA polymerases. PMID:23470999

Genome-wide mapping of autonomous promoter activity in human cells

PubMed Central

van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas

2017-01-01

Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146

The genetic basis of adaptive pigmentation variation in Drosophila melanogaster

PubMed Central

Pool, John E.; Aquadro, Charles F.

2009-01-01

In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kilobases upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony. PMID:17614900

Representation of Item Position in Immediate Serial Recall: Evidence from Intrusion Errors

ERIC Educational Resources Information Center

Fischer-Baum, Simon; McCloskey, Michael

2015-01-01

In immediate serial recall, participants are asked to recall novel sequences of items in the correct order. Theories of the representations and processes required for this task differ in how order information is maintained; some have argued that order is represented through item-to-item associations, while others have argued that each item is…

Characterization of circulating transfer RNA-Derived RNA fragments in cattle

USDA-ARS?s Scientific Manuscript database

The objective was to characterize naturally occurring circulating transfer RNA-derived RNA Fragments (tRFs) in cattle. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences a...

Spatio-Temporal Structure, Path Characteristics, and Perceptual Grouping in Immediate Serial Spatial Recall

PubMed Central

De Lillo, Carlo; Kirby, Melissa; Poole, Daniel

2016-01-01

Immediate serial spatial recall measures the ability to retain sequences of locations in short-term memory and is considered the spatial equivalent of digit span. It is tested by requiring participants to reproduce sequences of movements performed by an experimenter or displayed on a monitor. Different organizational factors dramatically affect serial spatial recall but they are often confounded or underspecified. Untangling them is crucial for the characterization of working-memory models and for establishing the contribution of structure and memory capacity to spatial span. We report five experiments assessing the relative role and independence of factors that have been reported in the literature. Experiment 1 disentangled the effects of spatial clustering and path-length by manipulating the distance of items displayed on a touchscreen monitor. Long-path sequences segregated by spatial clusters were compared with short-path sequences not segregated by clusters. Recall was more accurate for sequences segregated by clusters independently from path-length. Experiment 2 featured conditions where temporal pauses were introduced between or within cluster boundaries during the presentation of sequences with the same paths. Thus, the temporal structure of the sequences was either consistent or inconsistent with a hierarchical representation based on segmentation by spatial clusters but the effect of structure could not be confounded with effects of path-characteristics. Pauses at cluster boundaries yielded more accurate recall, as predicted by a hierarchical model. In Experiment 3, the systematic manipulation of sequence structure, path-length, and presence of path-crossings of sequences showed that structure explained most of the variance, followed by the presence/absence of path-crossings, and path-length. Experiments 4 and 5 replicated the results of the previous experiments in immersive virtual reality navigation tasks where the viewpoint of the observer changed dynamically during encoding and recall. This suggested that the effects of structure in spatial span are not dependent on perceptual grouping processes induced by the aerial view of the stimulus array typically afforded by spatial recall tasks. These results demonstrate the independence of coding strategies based on structure from effects of path characteristics and perceptual grouping in immediate serial spatial recall. PMID:27891101

Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

PubMed

Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

2016-03-01

Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

Alternate promoter selection within a human cytomegalovirus immediate-early and early transcription unit (UL119-115) defines true late transcripts containing open reading frames for putative viral glycoproteins.

PubMed Central

Leatham, M P; Witte, P R; Stinski, M F

1991-01-01

The human cytomegalovirus open reading frames (ORFs) UL119 through UL115 (UL119-115) are located downstream of the immediate-early 1 and 2 transcription units. The promoter upstream of UL119 is active at all times after infection and drives the synthesis of a spliced 3.1-kb mRNA. The viral mRNA initiates in UL119, contains UL119-117 and UL116, and terminates just downstream of UL115. True late transcripts that are detected only after viral DNA synthesis originate from this transcription unit. True late mRNAs of 2.1 kb, containing ORFs UL116 and UL115, and 1.2 kb, containing ORF UL115 only, are synthesized. The true late viral mRNAs are 3' coterminal with the 3.1-kb mRNA. This transcription unit is an example of late promoters nested within an immediate-early-early transcription unit. The gene products of UL119-117, UL116, and UL115 are predicted to be glycoproteins. Efficient expression of the downstream ORFs at late times after infection may be related to alternate promoter usage and downstream cap site selection. Images PMID:1717716

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

PubMed

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

Two novel heat shock genes encoding proteins produced in response to heterologous protein expression in Escherichia coli.

PubMed Central

Allen, S P; Polazzi, J O; Gierse, J K; Easton, A M

1992-01-01

In Escherichia coli high-level production of some heterologous proteins (specifically, human prorenin, renin, and bovine insulin-like growth factor 2) resulted in the induction of two new E. coli heat shock proteins, both of which have molecular masses of 16 kDa and are tightly associated with inclusion bodies formed during heterologous protein production. We named these inclusion body-associated proteins IbpA and IbpB. The coding sequences for IbpA and IbpB were identified and isolated from the Kohara E. coli gene bank. The genes for these proteins (ibpA and ibpB) are located at 82.5 min on the chromosome. Nucleotide sequencing of the two genes revealed that they are transcribed in the same direction and are separated by 110 bp. Putative Shine-Dalgarno sequences are located upstream from the initiation codons of both genes. A putative heat shock promoter is located upstream from ibpA, and a putative transcription terminator is located downstream from ibpB. A temperature upshift experiment in which we used a wild-type E. coli strain and an isogenic rpoH mutant strain indicated that a sigma 32-containing RNA polymerase is involved in the regulation of expression of these genes. There is 57.5% identity between the genes at the nucleotide level and 52.2% identity at the amino acid level. A search of the protein data bases showed that both of these 16-kDa proteins exhibit low levels of homology to low-molecular-weight heat shock proteins from eukaryotic species. Images PMID:1356969

Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

PubMed

Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

1994-05-01

Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

Sequencing and diversity analyses reveal extensive similarities between some epsilon-toxin-encoding plasmids and the pCPF5603 Clostridium perfringens enterotoxin plasmid.

PubMed

Miyamoto, Kazuaki; Li, Jihong; Sayeed, Sameera; Akimoto, Shigeru; McClane, Bruce A

2008-11-01

Clostridium perfringens type B and D isolates produce epsilon-toxin, the third most potent clostridial toxin. The epsilon-toxin gene (etx) is plasmid borne in type D isolates, but etx genetics have been poorly studied in type B isolates. This study reports the first sequencing of any etx plasmid, i.e., pCP8533etx, from type B strain NCTC8533. This etx plasmid is 64.7 kb, carries tcp conjugative transfer genes, and encodes additional potential virulence factors including beta2-toxin, sortase, and collagen adhesin but not beta-toxin. Interestingly, nearly 80% of pCP8533etx open reading frames (ORFs) are also present on pCPF5603, an enterotoxin-encoding plasmid from type A isolate F5603. Pulsed-field gel electrophoresis and overlapping PCR indicated that a pCP8533etx-like etx plasmid is also present in most, if not all, other type B isolates and some beta2-toxin-positive, cpe-negative type D isolates, while other type D isolates carry different etx plasmids. Sequences upstream of the etx gene vary between type B isolates and some type D isolates that do not carry a pCP8533etx-like etx plasmid. However, nearly all type B and D isolates have an etx locus with an upstream IS1151, and those etx loci typically reside near a dcm ORF. These results suggest that pCPF5603 and pCP8533etx evolved from insertion of mobile genetic elements carrying enterotoxin or etx genes, respectively, onto a common progenitor plasmid.

Temporal and Spatial Expression of a Polygalacturonase during Leaf and Flower Abscission in Oilseed Rape and Arabidopsis1

PubMed Central

González-Carranza, Zinnia Haydé; Whitelaw, Catherine Ann; Swarup, Ranjan; Roberts, Jeremy Alan

2002-01-01

During leaf abscission in oilseed rape (Brassica napus), cell wall degradation is brought about by the action of several hydrolytic enzymes. One of these is thought to be polygalacturonase (PG). Degenerate primers were used to isolate a PG cDNA fragment by reverse transcriptase-polymerase chain reaction from RNA extracted from ethylene-promoted leaf abscission zones (AZs), and in turn a full-length clone (CAW471) from an oilseed rape AZ cDNA library. The highest homology of this cDNA (82%) was to an Arabidopsis sequence that was predicted to encode a PG protein. Analysis of expression revealed that CAW471 mRNA accumulated in the AZ of leaves and reached a peak 24 h after ethylene treatment. Ethylene-promoted leaf abscission in oilseed rape was not apparent until 42 h after exposure to the gas, reaching 50% at 48 h and 100% by 56 h. In floral organ abscission, expression of CAW471 correlated with cell separation. Genomic libraries from oilseed rape and Arabidopsis were screened with CAW471 and the respective genomic clones PGAZBRAN and PGAZAT isolated. Characterization of these PG genes revealed that they had substantial homology within both the coding regions and in the 5′-upstream sequences. Fusion of a 1,476-bp 5′-upstream sequence of PGAZAT to β-glucuronidase or green fluorescent protein and transformation of Arabidopsis revealed that this fragment was sufficient to drive expression of these reporter genes in the AZs at the base of the anther filaments, petals, and sepals. PMID:11842157

Mechanisms of activation of the paternally expressed genes by the Prader-Willi imprinting center in the Prader-Willi/Angelman syndromes domains

PubMed Central

Rabinovitz, Shiri; Kaufman, Yotam; Ludwig, Guy; Razin, Aharon; Shemer, Ruth

2012-01-01

The Prader-Willi syndrome/Angelman syndrome (PWS/AS) imprinted domain is regulated by a bipartite imprinting control center (IC) composed of a sequence around the SNRPN promoter (PWS-IC) and a 880-bp sequence located 35 kb upstream (AS-IC). The AS-IC imprint is established during gametogenesis and confers repression upon PWS-IC on the maternal allele. Mutation at PWS-IC on the paternal allele leads to gene silencing across the entire PWS/AS domain. This silencing implies that PWS-IC functions on the paternal allele as a bidirectional activator. Here we examine the mechanism by which PWS-IC activates the paternally expressed genes (PEGs) using transgenes that include the PWS-IC sequence in the presence or absence of AS-IC and NDN, an upstream PEG, as an experimental model. We demonstrate that PWS-IC is in fact an activator of NDN. This activation requires an unmethylated PWS-IC in the gametes and during early embryogenesis. PWS-IC is dispensable later in development. Interestingly, a similar activation of a nonimprinted gene (APOA1) was observed, implying that PWS-IC is a universal activator. To decipher the mechanism by which PWS-IC confers activation of remote genes, we performed methylated DNA immunoprecipitation (MeDIP) array analysis on lymphoblast cell lines that revealed dispersed, rather than continued differential methylation. However, chromatin conformation capture (3c) experiments revealed a physical interaction between PWS-IC and the PEGs, suggesting that activation of PEGs may require their proximity to PWS-IC. PMID:22529396

Microbial Community Structure and Arsenic Biogeochemistry in an Acid Vapor-Formed Spring in Tengchong Geothermal Area, China.

PubMed

Jiang, Zhou; Li, Ping; Jiang, Dawei; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Wang, Yanxin

2016-01-01

Arsenic biogeochemistry has been studied extensively in acid sulfate-chloride hot springs, but not in acid sulfate hot springs with low chloride. In this study, Zhenzhuquan in Tengchong geothermal area, a representative acid sulfate hot spring with low chloride, was chosen to study arsenic geochemistry and microbial community structure using Illumina MiSeq sequencing. Over 0.3 million 16S rRNA sequence reads were obtained from 6-paired parallel water and sediment samples along its outflow channel. Arsenic oxidation occurred in the Zhenxhuquan pool, with distinctly high ratios of arsenate to total dissolved arsenic (0.73-0.86). Coupled with iron and sulfur oxidation along the outflow channel, arsenic accumulated in downstream sediments with concentrations up to 16.44 g/kg and appeared to significantly constrain their microbial community diversity. These oxidations might be correlated with the appearance of some putative functional microbial populations, such as Aquificae and Pseudomonas (arsenic oxidation), Sulfolobus (sulfur and iron oxidation), Metallosphaera and Acidicaldus (iron oxidation). Temperature, total organic carbon and dissolved oxygen significantly shaped the microbial community structure of upstream and downstream samples. In the upstream outflow channel region, most microbial populations were microaerophilic/anaerobic thermophiles and hyperthermophiles, such as Sulfolobus, Nocardia, Fervidicoccus, Delftia, and Ralstonia. In the downstream region, aerobic heterotrophic mesophiles and thermophiles were identified, including Ktedonobacteria, Acidicaldus, Chthonomonas and Sphingobacteria. A total of 72.41-95.91% unassigned-genus sequences were derived from the downstream high arsenic sediments 16S rRNA clone libraries. This study could enable us to achieve an integrated understanding on arsenic biogeochemistry in acid hot springs.

Effects of Noncontingent Social Interaction on Immediate and Subsequent Engagement in Vocal and Motor Stereotypy in Children With Autism.

PubMed

Enloe, Kimberley A; Rapp, John T

2014-05-01

This study evaluated the effects of noncontingent social interaction (SI) on immediate and subsequent engagement in vocal and motor stereotypy in three children with autism. During SI, a therapist delivered continuous interaction in the form of reading aloud from a Kindle™ e-reader. Results showed that when compared with a no-interaction baseline sequence, SI decreased immediate engagement vocal stereotypy for all three participants without increasing subsequent engagement for any participant. Furthermore, SI also increased immediate engagement in motor stereotypy for one participant, decreased immediate engagement in motor stereotypy for two participants, but did not increase subsequent engagement in motor stereotypy for any participant. Some clinical implications and limitations of the findings are discussed. © The Author(s) 2013.

Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana.

PubMed

Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee

2017-02-21

The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.

Cellodextrin Utilization by Bifidobacterium breve UCC2003▿ †

PubMed Central

Pokusaeva, Karina; O'Connell-Motherway, Mary; Zomer, Aldert; MacSharry, John; Fitzgerald, Gerald F.; van Sinderen, Douwe

2011-01-01

Cellodextrins, the incomplete hydrolysis products from insoluble cellulose, are accessible as a carbon source to certain members of the human gut microbiota, such as Bifidobacterium breve UCC2003. Transcription of the cldEFGC gene cluster of B. breve UCC2003 was shown to be induced upon growth on cellodextrins, implicating this cluster in the metabolism of these sugars. Phenotypic analysis of a B. breve UCC2003::cldE insertion mutant confirmed that the cld gene cluster is exclusively required for cellodextrin utilization by this commensal. Moreover, our results suggest that transcription of the cld cluster is controlled by a LacI-type regulator encoded by cldR, located immediately upstream of cldE. Gel mobility shift assays using purified CldRHis (produced by the incorporation of a His12-encoding sequence into the 3′ end of the cldC gene) indicate that the cldEFGC promoter is subject to negative control by CldRHis, which binds to two inverted repeats. Analysis by high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) of medium samples obtained during growth of B. breve UCC2003 on a mixture of cellodextrins revealed its ability to utilize cellobiose, cellotriose, cellotetraose, and cellopentaose, with cellotriose apparently representing the preferred substrate. The cldC gene of the cld operon of B. breve UCC2003 is, to the best of our knowledge, the first described bifidobacterial β-glucosidase exhibiting hydrolytic activity toward various cellodextrins. PMID:21216899

The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

PubMed

Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

2009-05-01

Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

Properties of blocking and non-blocking monoclonal antibodies specific for human macrophage galactose-type C-type lectin (MGL/ClecSF10A/CD301).

PubMed

Sano, Yoshihiko; Usami, Katsuaki; Izawa, Ryota; Denda-Nagai, Kaori; Higashi, Nobuaki; Kimura, Toshifumi; Suzuki, Noriko; Irimura, Tatsuro

2007-01-01

Monoclonal antibodies (mAbs) specific for the human macrophage galactose-type calcium-type lectin (MGL) were established. The recombinant extracellular domain of MGL was used to immunize a mouse, and 10 hybridoma clones were obtained. Binding of recombinant MGL to asialo-bovine submaxillary mucin was shown to be blocked by mAbs MLD-1, 4 and 6. Immunoprecipitation of MGL from lysates of COS-1 cells transfected with MGL cDNA (form 6A) was achieved with mAbs MLD-1, 4, 7, 8 and 16. Chimeric recombinant proteins between human MGL and mouse MGL1 were used to determine the location of the epitopes for these mAbs. mAbs MLD-8, 13, 15 and 16 interacted with the amino terminal side of the conserved WVDGTD sequence immediately upstream of QPD, whereas mAbs MLD-7, 12 and 17 interacted with the other side. mAbs MLD-1, 4, and 6 apparently required both sides of this boundary. mAbs MLD-15 and 16 were shown to recognize the protein products of alternatively spliced mRNA 6A/8A and 6C/8A, having deletions at the boundary of exons 7 and 8, in addition to full length and other spliced forms of MGL (6A, 6B and 6C), whereas the other mAbs bound only full length and forms 6A, 6B and 6C.

Statistical Analysis of Readthrough Levels for Nonsense Mutations in Mammalian Cells Reveals a Major Determinant of Response to Gentamicin

PubMed Central

Floquet, Célia; Hatin, Isabelle; Rousset, Jean-Pierre; Bidou, Laure

2012-01-01

The efficiency of translation termination depends on the nature of the stop codon and the surrounding nucleotides. Some molecules, such as aminoglycoside antibiotics (gentamicin), decrease termination efficiency and are currently being evaluated for diseases caused by premature termination codons. However, the readthrough response to treatment is highly variable and little is known about the rules governing readthrough level and response to aminoglycosides. In this study, we carried out in-depth statistical analysis on a very large set of nonsense mutations to decipher the elements of nucleotide context responsible for modulating readthrough levels and gentamicin response. We quantified readthrough for 66 sequences containing a stop codon, in the presence and absence of gentamicin, in cultured mammalian cells. We demonstrated that the efficiency of readthrough after treatment is determined by the complex interplay between the stop codon and a larger sequence context. There was a strong positive correlation between basal and induced readthrough levels, and a weak negative correlation between basal readthrough level and gentamicin response (i.e. the factor of increase from basal to induced readthrough levels). The identity of the stop codon did not affect the response to gentamicin treatment. In agreement with a previous report, we confirm that the presence of a cytosine in +4 position promotes higher basal and gentamicin-induced readthrough than other nucleotides. We highlight for the first time that the presence of a uracil residue immediately upstream from the stop codon is a major determinant of the response to gentamicin. Moreover, this effect was mediated by the nucleotide itself, rather than by the amino-acid or tRNA corresponding to the −1 codon. Finally, we point out that a uracil at this position associated with a cytosine at +4 results in an optimal gentamicin-induced readthrough, which is the therapeutically relevant variable. PMID:22479203

Assessing Stream Restoration Potential of Recreational Enhancements on an Urban Stream, Springfield, OH

NASA Astrophysics Data System (ADS)

Ritter, J. B.; Evelsizor, A.; Minter, K.; Rigsby, C.; Shaw, K.; Shearer, K.

2010-12-01

Restoration potential of urban streams is inherently constrained by urban infrastructure. Roads and built structures may necessitate a static stream planform while water, sewage, and electrical utilities buried in the stream channel require a stable grade. A privately-led initiative to improve the recreational potential of a 9-km reach of Buck Creek and its tributary Beaver Creek in Springfield, Ohio, includes the modification of four lowhead dams with hydraulic heights up to 3 m. Modifications to the dams include replacing their hydraulic height with a series of drop structures engineered to create hydraulics conducive to kayak play. Two of the lowhead dams have been modified to date. The purpose of this study is to assess the potential benefits of modifications designed for their recreational value for stream restoration. The drop structure is a constructed channel constriction comprised of a hard step in the long stream profile immediately upstream of a scour pool, forming a morphologic sequence of constriction, step, and pool. Up to 4 drop structures are used along a given stream reach, constructed in the area of the former dam, its scour pool and a portion of the impounded area. Though not designed for stream restoration purposes, these structures potentially act as series a riffle-pool sequences. Changes in the stream habitat, water chemistry, and macroinvertebrates in response to dam modification highlight the potential for incorporating stream restoration into the engineering design. Following modification of two of the dams, the in-stream habitat quality, as measured by physical and biological indices, increased at one site and decreased at the other site, depending on whether the uppermost drop structure at the site reduced or expanded the impounded area. In the best case, channel sands and gravels, free of fine sand, silt, and organics, have deposited in a crescentic-shaped bar paralleling and grading to the constriction and step. Greater abundance and diversity of pollution-intolerant macroinvertebrates, supported by higher dissolved oxygen in the substrate, characterizes riffles at these sites.

Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

PubMed

Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

2014-04-01

The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

A Rapid Method for Engineering Recombinant Polioviruses or Other Enteroviruses.

PubMed

Bessaud, Maël; Pelletier, Isabelle; Blondel, Bruno; Delpeyroux, Francis

2016-01-01

The cloning of large enterovirus RNA sequences is labor-intensive because of the frequent instability in bacteria of plasmidic vectors containing the corresponding cDNAs. In order to circumvent this issue we have developed a PCR-based method that allows the generation of highly modified or chimeric full-length enterovirus genomes. This method relies on fusion PCR which enables the concatenation of several overlapping cDNA amplicons produced separately. A T7 promoter sequence added upstream the fusion PCR products allows its transcription into infectious genomic RNAs directly in transfected cells constitutively expressing the phage T7 RNA polymerase. This method permits the rapid recovery of modified viruses that can be subsequently amplified on adequate cell-lines.

Recent research on the high-probability instructional sequence: A brief review.

PubMed

Lipschultz, Joshua; Wilder, David A

2017-04-01

The high-probability (high-p) instructional sequence consists of the delivery of a series of high-probability instructions immediately before delivery of a low-probability or target instruction. It is commonly used to increase compliance in a variety of populations. Recent research has described variations of the high-p instructional sequence and examined the conditions under which the sequence is most effective. This manuscript reviews the most recent research on the sequence and identifies directions for future research. Recommendations for practitioners regarding the use of the high-p instructional sequence are also provided. © 2017 Society for the Experimental Analysis of Behavior.

Sequence verification as quality-control step for production of cDNA microarrays.

PubMed

Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

2001-07-01

To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

XX males SRY negative: a confirmed cause of infertility.

PubMed

Vetro, Annalisa; Ciccone, Roberto; Giorda, Roberto; Patricelli, Maria Grazia; Della Mina, Erika; Forlino, Antonella; Zuffardi, Orsetta

2011-10-01

SOX9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation. It is considered to be the direct target gene of the protein encoded by SRY and its overexpression in an XX murine gonad can lead to male development in the absence of Sry. Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of SOX9 in which 46,XY duplicated persons were completely normal and fertile whereas the 46,XX ones were males who came to clinical attention because of infertility. We report a family with two azoospermic brothers, both 46,XX, SRY negative, having a 96 kb triplication 500 kb upstream of SOX9. Both subjects have been analyzed trough oligonucleotide array-CGH and the triplication was confirmed and characterised through qPCR, defining the minimal region of amplification upstream of SOX9 associated with 46,XX infertile males, SRY negative. Our results confirm that even in absence of SRY, complete male differentiation may occur, possibly driven by overexpression of SOX9 in the gonadal ridge, as a consequence of the amplification of a gene desert region. We hypothesize that this region contains gonadal specific long-range regulation elements whose alteration may impair the normal sex development. Our data show that normal XX males, with alteration in copy number or, possibly, in the critical sequence upstream to SOX9 are a new category of infertility inherited in a dominant way with expression limited to the XX background.

O2 and CO2 glow-discharge-assisted oxygen transport through Ag

NASA Astrophysics Data System (ADS)

Outlaw, R. A.

1990-08-01

The permeation of oxygen through Ag normally occurs by a sequence of steps which include the initial dissociative adsorption of molecular oxygen at the upstream surface, the dissolution of the atoms into the bulk, and the subsequent migration of the atoms between octahedral sites of the lattice until they arrive at the vacuum interface downstream. The dissociative adsorption step, however, proceeds slowly, as indicated by the low sticking coefficient of O2 on Ag(10-6-10-3). The application of a dc field in 0.5 Torr of O2 (E/n˜10-14 V cm2) on the upstream side of a Ag membrane generated gas phase atomic oxygen that substantially enhanced the transport. The transport flux was observed to increase from a value of 4.4×1013 cm-2 s-1 to a glow discharge value of 2.83×1014 cm-2 s-1 at a membrane temperature of 650 °C. This suggests that the dissociative adsorption step limits the supply of oxygen atoms to the upstream side of the membrane. When the upstream O2 was replaced by an equal pressure of CO2, only a small permeation signal was observed, but the application of the glow discharge substantially increased the transport flux from 3.25×1012 cm-2 s-1 to 1.74×1014 cm-2 s-1. This method of separating O2 from a CO2 environment may be a possible mechanism for providing a supply of oxygen for astronauts in a manned mission to Mars.

Characterization of a Fluorescent Protein Reporter System

DTIC Science & Technology

2008-03-01

pathways are initiated with the binding of a small molecule to a catalytic ribonucleic acid molecule (RNA), called a ribozyme (Thodima et al., 2006). The... ribozyme is part of a larger RNA construct, called a riboswitch, which initiates translation of a specific genetic sequence on a plasmid (circular...protein gene. Yen et al. (2004) reported insertion of a self-cleaving ribozyme upstream of the reporter gene. In the absence of a regulator (“off

The pineapple AcMADS1 promoter confers high level expression in tomato and arabidopsis flowering and fruiting tissues, but AcMADS1 does not complement the tomato LeMADS-RIN (rin) mutant

USDA-ARS?s Scientific Manuscript database

A previous EST study identified a MADS box transcription factor coding sequence, AcMADS1, that is strongly induced during non-climacteric pineapple fruit ripening. Phylogenetic analyses place the AcMADS1 protein in the same superclade as LeMADS-RIN, a master regulator of fruit ripening upstream of e...

In Vivo Imaging of MDR1A Gene Expression

DTIC Science & Technology

2004-12-01

Engineer PGK-neo and Renilla luciferase cassettes, already available, with appropriate loxP sites, into mdrla locus. Repeat for HSV-tk reporter. The...of the gene-targeting vector. under the control of the PGK promoter. Luc: Renilla luciferase fused in- frame with the translated sequences of exon 2...between the two loxP sites, upstream of the Neo cassette. A cloning strategy was then devised to fuse Renilla luciferase in-frame with the translated

Crosstalk between mTORC1 and cAMP Signaling

DTIC Science & Technology

2016-09-01

2010). It has been suggested that the low mTOR activity retained under moderate hyper - tonic conditions facilitates the expression of some osmo...member of the MAP kinase (MAPK) subfamily. It is notable that the activation loop ofNLK protein possesses the sequence Thr–Gln–Glu (TQE) motif...Ishitani et al. 2011). Thus, NLK can be activated without being phosphorylated in the activation loop by upstream kinases. Moreover, high levels of

The Role of eIF4E Activity in Breast Cancer

DTIC Science & Technology

2010-08-01

ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less product...have previously shown that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem

Bedload transport over run-of-river dams, Delaware, U.S.A.

NASA Astrophysics Data System (ADS)

Pearson, Adam J.; Pizzuto, Jim

2015-11-01

We document the detailed morphology and bed sediment size distribution of a stream channel upstream and downstream of a 200-year-old run-of-river dam on the Red Clay Creek, a fifth order stream in the Piedmont of northern Delaware, and combine these data with HEC-RAS modeling and bedload transport computations. We hypothesize that coarse bed material can be carried through run-of-river impoundments before they completely fill with sediment, and we explore mechanisms to facilitate this transport. Only 25% of the accommodation space in our study site is filled with sediment, and maximum water depths are approximately equal to the dam height. All grain-size fractions present upstream of the impoundment are also present throughout the impoundment. A characteristic coarse-grained sloping ramp leads from the floor of the impoundment to the crest of the dam. A 2.3-m-deep plunge pool has been excavated below the dam, followed immediately downstream by a mid-channel bar composed of coarse bed material similar in size distribution to the bed material of the impoundment. The mid-channel bar stores 1472 m3 of sediment, exceeding the volume excavated from the plunge pool by a factor of 2.8. These field observations are typical of five other sites nearby and suggest that all bed material grain-size fractions supplied from upstream can be transported through the impoundment, up the sloping ramp, and over the top of the dam. Sediment transport computations suggest that all grain sizes are in transport upstream and within the impoundment at all discharges with return periods from 1 to 50 years. Our computations suggest that transport of coarse bed material through the impoundment is facilitated by its smooth, sandy bed. Model results suggest that the impoundment is currently aggrading at 0.26 m/year, but bed elevations may be recovering after recent scour from a series of large floods during water year 2011-2012. We propose that impoundments upstream of these run-of-river dams behave as long pools that adjust their bed elevation and texture to transport the load supplied by the watershed, rather than as impounded reservoirs with little bed material transport capacity. Scour may only occur during episodic high flows, followed by aggradation during periods of low flow.

An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations

PubMed Central

Yam, Wing Cheong; Zhang, Ying; Kao, Richard Y. T.

2014-01-01

Although the major causes of isoniazid (INH) resistance in Mycobacterium tuberculosis are confined to structural mutations in katG and promoter mutations in the mabA-inhA operon, a significant proportion of INH-resistant strains have unknown resistance mechanisms. Recently, we identified a high-level INH-resistant M. tuberculosis clinical isolate, GB005, with no known resistance-associated mutations. A comprehensive study was performed to investigate the molecular basis of drug resistance in this strain. Although no mutations were found throughout the katG and furA-katG intergenic region, the katG expression and the catalase activity were greatly diminished compared to those in H37Rv (P < 0.01). Northern blotting revealed that the katG transcript from the isolate was smaller than that of H37Rv. Sequencing analysis of furA and upstream genes discovered a 7.2-kb truncation extended from the 96th base preceding the initiation codon of katG. Complementation of the M. tuberculosis Δ(furA-katG) strain with katG and different portions of the truncated region identified a 134-bp upstream fragment of furA that was essential for full catalase activity and INH susceptibility in M. tuberculosis. The promoter activity of this fragment was also shown to be stronger than that of the furA-katG intergenic region (P < 0.01). Collectively, these findings demonstrate that deletion of the 134-bp furA upstream fragment is responsible for the reduction in katG expression, resulting in INH resistance in GB005. To our knowledge, this is the first report showing that deletion of the upstream region preceding the furA-katG operon causes high-level INH resistance in a clinical isolate of M. tuberculosis. PMID:25092698

Evolutionary mechanisms involved in the virulence of infectious salmon anaemia virus (ISAV), a piscine orthomyxovirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Markussen, Turhan; Jonassen, Christine Monceyron; Numanovic, Sanela

2008-05-10

Infectious salmon anaemia virus (ISAV) is an orthomyxovirus causing a multisystemic, emerging disease in Atlantic salmon. Here we present, for the first time, detailed sequence analyses of the full-genome sequence of a presumed avirulent isolate displaying a full-length hemagglutinin-esterase (HE) gene (HPR0), and compare this with full-genome sequences of 11 Norwegian ISAV isolates from clinically diseased fish. These analyses revealed the presence of a virulence marker right upstream of the putative cleavage site R{sub 267} in the fusion (F) protein, suggesting a Q{sub 266} {yields} L{sub 266} substitution to be a prerequisite for virulence. To gain virulence in isolates lackingmore » this substitution, a sequence insertion near the cleavage site seems to be required. This strongly suggests the involvement of a protease recognition pattern at the cleavage site of the fusion protein as a determinant of virulence, as seen in highly pathogenic influenza A virus H5 or H7 and the paramyxovirus Newcastle disease virus.« less

Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

PubMed

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.

PubMed Central

Lao, G; Ghangas, G S; Jung, E D; Wilson, D B

1991-01-01

The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434

Leaf Litter Decomposition as a Functional Assessment of a Natural Stream Channel Design Project

NASA Astrophysics Data System (ADS)

Gentry, A.; Word, D.; Carreiro, M.; Jack, J.

2005-05-01

In October 2003, a 965m reach of Wilson Creek (Bernheim Research Forest, Kentucky, USA) was relocated, and meanders and riffle-pool sequences were restored, providing a unique opportunity to measure the re-establishment of post-restoration stream functions. Leaf litter bags were placed across riffles in the restored reach, in an upstream reference site and in two reference streams. Bags were collected for nine months, and mass loss, N dynamics and fungal ergosterol were measured. Daily mass loss rates in the restored and reference riffles in Wilson Creek were faster (k= -0.00759 and k= -0.00855, respectively) than those of the two reference streams (k= -0.00511 and k= -0.00308). This is equivalent to litter mean residence times of 132 days for the restored reach in Wilson, 117 days in the upstream reference site, and 196 and 325 days for the reference streams. It appears that the decay rate in the restored reach is similar to the upstream portion of Wilson Creek, indicating rapid mass loss recovery in the restored reach. We also determined that same-stream reference sites are important for evaluating the restoration of stream functions, because of high decay rate variation among nearby streams within the same watershed.

Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene

PubMed Central

Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.

2014-01-01

Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458

Role of the open reading frames of Rous sarcoma virus leader RNA in translation and genome packaging.

PubMed Central

Donzé, O; Spahr, P F

1992-01-01

The Rous sarcoma virus (RSV) RNA leader sequence carries three open reading frames (uORFs) upstream of the AUG initiator of the gag gene. We studied, in vivo, the role of these uORFs by changing two or three nucleotides of the three AUGs or by deleting the first uORF. Our results show that (i) unlike most previously characterized uORFs, which decrease translation, the first uORF (AUG1) of RSV acts as an enhancer of translation, since absence of the first AUG decreased translation; AUG3 also modulates translation, probably by interfering with scanning ribosomes as described for other upstream ORFs, and mutation of AUG2 had no effect on translation. (ii) Mutation of each of the upstream AUGs lowered the infectivity of progeny virions. (iii) Unexpectedly, mutation of AUG1 and/or AUG3 dramatically reduced RNA packaging by 50-to 100-fold, unlike mutation of AUG2 which did not alter RNA packaging efficiency. Additional mutants in the vicinity of uORF1 and uORF3 were constructed in order to elucidate the mechanism by which uORFs affect RNA packaging: a translation model requiring uORFs 1 and 3, and involving ribosome pausing at AUG 3 is discussed. Images PMID:1327749

Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

PubMed

Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

1985-09-01

The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this.

Use of signal sequences as an in situ removable sequence element to stimulate protein synthesis in cell-free extracts

PubMed Central

Ahn, Jin-Ho; Hwang, Mi-Yeon; Lee, Kyung-Ho; Choi, Cha-Yong; Kim, Dong-Myung

2007-01-01

This study developed a method to boost the expression of recombinant proteins in a cell-free protein synthesis system without leaving additional amino acid residues. It was found that the nucleotide sequences of the signal peptides serve as an efficient downstream box to stimulate protein synthesis when they were fused upstream of the target genes. The extent of stimulation was critically affected by the identity of the second codons of the signal sequences. Moreover, the yield of the synthesized protein was enhanced by as much as 10 times in the presence of an optimal second codon. The signal peptides were in situ cleaved and the target proteins were produced in their native sizes by carrying out the cell-free synthesis reactions in the presence of Triton X-100, most likely through the activation of signal peptidase in the S30 extract. The amplification of the template DNA and the addition of the signal sequences were accomplished by PCR. Hence, elevated levels of recombinant proteins were generated within several hours. PMID:17185295

Tenebrio molitor antifreeze protein gene identification and regulation.

PubMed

Qin, Wensheng; Walker, Virginia K

2006-02-15

The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

Membrane-bound human orphan cytochrome P450 2U1: Sequence singularities, construction of a full 3D model, and substrate docking.

PubMed

Ducassou, Lionel; Dhers, Laura; Jonasson, Gabriella; Pietrancosta, Nicolas; Boucher, Jean-Luc; Mansuy, Daniel; André, François

2017-09-01

Human cytochrome P450 2U1 (CYP2U1) is an orphan CYP that exhibits several distinctive characteristics among the 57 human CYPs with a highly conserved sequence in almost all living organisms. We compared its protein sequence with those of the 57 human CYPs and constructed a 3D structure of a full-length CYP2U1 model bound to a POPC membrane. We also performed docking experiments of arachidonic acid (AA) and N-arachidonoylserotonin (AS) in this model. The protein sequence of CYP2U1 displayed two unique characteristics when compared to those of the human CYPs, the presence of a longer N-terminal region upstream of the putative trans-membrane helix (TMH) containing 8 proline residues, and of an insert of about 20 amino acids containing 5 arginine residues between helices A' and A. Its N-terminal part upstream of TMH involved an additional short terminal helix, in a manner similar to what was reported in the crystal structure of Saccharomyces cerevisiae CYP51. Our model also showed a specific interaction between the charged residues of insert AA' and phosphate groups of lipid polar heads, suggesting a possible role of this insert in substrate recruitment. Docking of AA and AS in this model showed these substrates in channel 2ac, with the terminal alkyl chain of AA or the indole ring of AS close to the heme, in agreement with the reported CYP2U1-catalyzed AA and AS hydroxylation regioselectivities. This model should be useful to find new endogenous or exogenous CYP2U1 substrates and to interpret the regioselectivity of their hydroxylation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

1994-12-31

Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

PubMed

Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

2009-10-19

Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

Two Distinct Origins of Long-Term Learning Effects in Verbal Short-Term Memory

ERIC Educational Resources Information Center

Majerus, Steve; Perez, Trecy Martinez; Oberauer, Klaus

2012-01-01

Verbal short-term memory (STM) is highly sensitive to learning effects: digit sequences or nonword sequences which have been rendered more familiar via repeated exposure are recalled more accurately. In this study we show that sublist-level, incidental learning of item co-occurrence regularities affects immediate serial recall of words and…

Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7

PubMed Central

Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain

2017-01-01

ABSTRACT Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent −12/−24 promoter consensus. The expression of an exaA::lacZ fusion was induced maximally by glycerol and was dependent on σ54. Bioinformatic analysis of the sequence flanking the −12/−24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA. EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense. We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ54-dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ54. The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ54 in other bacteria. PMID:28439037

Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7.

PubMed

Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain; Tripathi, Anil Kumar

2017-07-01

Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent -12/-24 promoter consensus. The expression of an exaA :: lacZ fusion was induced maximally by glycerol and was dependent on σ 54 Bioinformatic analysis of the sequence flanking the -12/-24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ 54 -dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ 54 The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ 54 in other bacteria. Copyright © 2017 American Society for Microbiology.

A duplication upstream of SOX9 was not positively correlated with the SRY-negative 46,XX testicular disorder of sex development: A case report and literature review

PubMed Central

XIA, XIN-YI; ZHANG, CUI; LI, TIAN-FU; WU, QIU-YUE; LI, NA; LI, WEI-WEI; CUI, YING-XIA; LI, XIAO-JUN; SHI, YI-CHAO

2015-01-01

The 46,XX male disorder of sex development (DSD) is rarely observed in humans. Patients with DSD are all male with testicular tissue differentiation. The mechanism of sex determination and differentiation remains to be elucidated. In the present case report, an 46,XX inv (9) infertile male negative for the sex-determining region of the Y chromosome (SRY) gene was examined. This infertile male was systemically assessed by semen analysis, serum hormone testing and gonadal biopsy. Formalin-fixed and paraffin-embedded gonad tissues were assessed histochemically. The SRY gene was analyzed by fluorescence in situ hybridization (FISH) and polymerase chain reaction (PCR). The other 23 specific loci, including the azoospermia factor region on the Y chromosome and the sequence-targeted sites of the SRY-box 9 (SOX9) gene were analyzed by PCR. The genes RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 were also assessed using sequencing analysis. Affymetrix Cytogenetics Whole Genome 2.7 M Arrays were used for detecting the genomic DNA from the patient and the parents. The patient with the 46,XX inv (9) (p11q13) karyotype exhibited male primary, however, not secondary sexual characteristics. However, the patient's mother with the 46, XX inv (9) karyotype was unaffected. The testicular tissue dysplasia of the patient was confirmed by tissue biopsy and absence of the SRY gene, and the other 23 loci on the Y chromosome were confirmed by FISH and/or PCR. The RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 genes were sequenced and no mutations were detected. A duplication on the 3 M site in the upstream region of SOX9 was identified in the patient as well as in the mother. The patient with the 46,XX testicular DSD and SRY-negative status was found to be infertile. The duplication on the 3 M site in the upstream region of SOX9 was a polymorphism, which indicated that the change was not a cause of 46,XX male SDS. These clinical, molecular and cytogenetic findings suggested that other unidentified genetic or environmental factors are significant in the regulation of SDS. PMID:26260363

A duplication upstream of SOX9 was not positively correlated with the SRY‑negative 46,XX testicular disorder of sex development: A case report and literature review.

PubMed

Xia, Xin-Yi; Zhang, Cui; Li, Tian-Fu; Wu, Qiu-Yue; Li, Na; Li, Wei-Wei; Cui, Ying-Xia; Li, Xiao-Jun; Shi, Yi-Chao

2015-10-01

The 46,XX male disorder of sex development (DSD) is rarely observed in humans. Patients with DSD are all male with testicular tissue differentiation. The mechanism of sex determination and differentiation remains to be elucidated. In the present case report, an 46,XX inv (9) infertile male negative for the sex‑determining region of the Y chromosome (SRY) gene was examined. This infertile male was systemically assessed by semen analysis, serum hormone testing and gonadal biopsy. Formalin‑fixed and paraffin‑embedded gonad tissues were assessed histochemically. The SRY gene was analyzed by fluorescence in situ hybridization (FISH) and polymerase chain reaction (PCR). The other 23 specific loci, including the azoospermia factor region on the Y chromosome and the sequence-targeted sites of the SRY‑box 9 (SOX9) gene were analyzed by PCR. The genes RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 were also assessed using sequencing analysis. Affymetrix Cytogenetics Whole Genome 2.7 M Arrays were used for detecting the genomic DNA from the patient and the parents. The patient with the 46,XX inv (9) (p11q13) karyotype exhibited male primary, however, not secondary sexual characteristics. However, the patient's mother with the 46, XX inv (9) karyotype was unaffected. The testicular tissue dysplasia of the patient was confirmed by tissue biopsy and absence of the SRY gene, and the other 23 loci on the Y chromosome were confirmed by FISH and/or PCR. The RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 genes were sequenced and no mutations were detected. A duplication on the 3 M site in the upstream region of SOX9 was identified in the patient as well as in the mother. The patient with the 46,XX testicular DSD and SRY‑negative status was found to be infertile. The duplication on the 3 M site in the upstream region of SOX9 was a polymorphism, which indicated that the change was not a cause of 46,XX male SDS. These clinical, molecular and cytogenetic findings suggested that other unidentified genetic or environmental factors are significant in the regulation of SDS.

Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

PubMed

Fahrner, Karen A; Berg, Howard C

2015-10-01

Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

[A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

PubMed

Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

2003-01-01

To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

Sequences required for transcription termination at the intrinsic lambdatI terminator.

PubMed

Martínez-Trujillo, Miguel; Sánchez-Trujillo, Alejandra; Ceja, Víctor; Avila-Moreno, Federico; Bermúdez-Cruz, Rosa María; Court, Donald; Montañez, Cecilia

2010-02-01

The lambdatI terminator is located approximately 280 bp beyond the lambdaint gene, and it has a typical structure of an intrinsic terminator. To identify sequences required for lambdatI transcription termination a set of deletion mutants were generated, either from the 5' or the 3' end onto the lambdatI region. The termination efficiency was determined by measuring galactokinase (galK) levels by Northern blot assays and by in vitro transcription termination. The importance of the uridines and the stability of the stem structure in the termination were demonstrated. The nontranscribed DNA beyond the 3' end also affects termination. Additionally, sequences upstream have a small effect on transcription termination. The in vivo RNA termination sites at lambdatI were determined by S1 mapping and were located at 8 different positions. Processing of transcripts from the 3' end confirmed the importance of the hairpin stem in protection against exonuclease.

A Gibbs sampler for motif detection in phylogenetically close sequences

NASA Astrophysics Data System (ADS)

Siddharthan, Rahul; van Nimwegen, Erik; Siggia, Eric

2004-03-01

Genes are regulated by transcription factors that bind to DNA upstream of genes and recognize short conserved ``motifs'' in a random intergenic ``background''. Motif-finders such as the Gibbs sampler compare the probability of these short sequences being represented by ``weight matrices'' to the probability of their arising from the background ``null model'', and explore this space (analogous to a free-energy landscape). But closely related species may show conservation not because of functional sites but simply because they have not had sufficient time to diverge, so conventional methods will fail. We introduce a new Gibbs sampler algorithm that accounts for common ancestry when searching for motifs, while requiring minimal ``prior'' assumptions on the number and types of motifs, assessing the significance of detected motifs by ``tracking'' clusters that stay together. We apply this scheme to motif detection in sporulation-cycle genes in the yeast S. cerevisiae, using recent sequences of other closely-related Saccharomyces species.

Tobacco chloroplast tRNALys(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron

PubMed Central

Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro

1985-01-01

The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561

Tobacco chloroplast tRNA(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron.

PubMed

Sugita, M; Shinozaki, K; Sugiura, M

1985-06-01

The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.

Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

PubMed

Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

2014-01-01

Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus

PubMed Central

Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.

2001-01-01

Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of various elements necessary for efficient protein expression and transactivation from the structural protein gene promoter of AeDNV. PMID:11152505

Environmental Health: Advancing Emancipatory Policies for the Common Good.

PubMed

Valentine-Maher, Sarah K; Butterfield, Patricia G; Laustsen, Gary

Human health is substantially impacted by the state of the environment, and environmental degradation has a disproportionate impact on persons with less immediate access to financial and social power. This article calls for upstream nursing action to address the natural environment in order to turn about health injustices and improve health for all. Such action would move nursing towards a greater actualization of the nursing environmental domain. The health impacts of climate change, air and water quality, and toxic chemical exposure are substantiated and specific policy leadership recommendations are proposed. Recommended actions include work to build environmental health literacy and empowerment, advocacy for regulatory protection and enforcement, and environmental engagement within health care systems.

Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.

1991-02-15

In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less

Understanding the hydrologic impacts of wastewater treatment plant discharge to shallow groundwater: Before and after plant shutdown

USGS Publications Warehouse

Hubbard, Laura E.; Keefe, Steffanie H.; Kolpin, Dana W.; Barber, Larry B.; Duris, Joseph W.; Hutchinson, Kasey J.; Bradley, Paul M.

2016-01-01

Effluent-impacted surface water has the potential to transport not only water, but wastewater-derived contaminants to shallow groundwater systems. To better understand the effects of effluent discharge on in-stream and near-stream hydrologic conditions in wastewater-impacted systems, water-level changes were monitored in hyporheic-zone and shallow-groundwater piezometers in a reach of Fourmile Creek adjacent to and downstream of the Ankeny (Iowa, USA) wastewater treatment plant (WWTP). Water-level changes were monitored from approximately 1.5 months before to 0.5 months after WWTP closure. Diurnal patterns in WWTP discharge were closely mirrored in stream and shallow-groundwater levels immediately upstream and up to 3 km downstream of the outfall, indicating that such discharge was the primary control on water levels before shutdown. The hydrologic response to WWTP shutdown was immediately observed throughout the study reach, verifying the far-reaching hydraulic connectivity and associated contaminant transport risk. The movement of WWTP effluent into alluvial aquifers has implications for potential WWTP-derived contamination of shallow groundwater far removed from the WWTP outfall.

The Role of elF4E Activity in Breast Cancer

DTIC Science & Technology

2011-08-01

protein; ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...Reactions were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less...that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem-loop structure6. This

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

PubMed Central

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

2016-01-01

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

PubMed

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

PubMed

Fleckenstein, E C; Dirks, W G; Drexler, H G

2000-02-01

The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

ASR5 is involved in the regulation of miRNA expression in rice.

PubMed

Neto, Lauro Bücker; Arenhart, Rafael Augusto; de Oliveira, Luiz Felipe Valter; de Lima, Júlio Cesar; Bodanese-Zanettini, Maria Helena; Margis, Rogerio; Margis-Pinheiro, Márcia

2015-11-01

The work describes an ASR knockdown transcriptomic analysis by deep sequencing of rice root seedlings and the transactivation of ASR cis-acting elements in the upstream region of a MIR gene. MicroRNAs are key regulators of gene expression that guide post-transcriptional control of plant development and responses to environmental stresses. ASR (ABA, Stress and Ripening) proteins are plant-specific transcription factors with key roles in different biological processes. In rice, ASR proteins have been suggested to participate in the regulation of stress response genes. This work describes the transcriptomic analysis by deep sequencing two libraries, comparing miRNA abundance from the roots of transgenic ASR5 knockdown rice seedlings with that of the roots of wild-type non-transformed rice seedlings. Members of 59 miRNA families were detected, and 276 mature miRNAs were identified. Our analysis detected 112 miRNAs that were differentially expressed between the two libraries. A predicted inverse correlation between miR167abc and its target gene (LOC_Os07g29820) was confirmed using RT-qPCR. Protoplast transactivation assays showed that ASR5 is able to recognize binding sites upstream of the MIR167a gene and drive its expression in vivo. Together, our data establish a comparative study of miRNAome profiles and is the first study to suggest the involvement of ASR proteins in miRNA gene regulation.

Interaction of the Transcription Start Site Core Region and Transcription Factor YY1 Determine Ascorbate Transporter SVCT2 Exon 1a Promoter Activity

PubMed Central

Qiao, Huan; May, James M.

2012-01-01

Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872

COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

PubMed Central

Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

2002-01-01

Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

PubMed Central

Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

1992-01-01

Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

Specific Increase of Protein Levels by Enhancing Translation Using Antisense Oligonucleotides Targeting Upstream Open Frames.

PubMed

Liang, Xue-Hai; Shen, Wen; Crooke, Stanley T

2017-01-01

A number of diseases are caused by low levels of key proteins; therefore, increasing the amount of specific proteins in human bodies is of therapeutic interest. Protein expression is downregulated by some structural or sequence elements present in the 5' UTR of mRNAs, such as upstream open reading frames (uORF). Translation initiation from uORF(s) reduces translation from the downstream primary ORF encoding the main protein product in the same mRNA, leading to a less efficient protein expression. Therefore, it is possible to use antisense oligonucleotides (ASOs) to specifically inhibit translation of the uORF by base-pairing with the uAUG region of the mRNA, redirecting translation machinery to initiate from the primary AUG site. Here we review the recent findings that translation of specific mRNAs can be enhanced using ASOs targeting uORF regions. Appropriately designed and optimized ASOs are highly specific, and they act in a sequence- and position-dependent manner, with very minor off-target effects. Protein levels can be increased using this approach in different types of human and mouse cells, and, importantly, also in mice. Since uORFs are present in around half of human mRNAs, the uORF-targeting ASOs may thus have valuable potential as research tools and as therapeutics to increase the levels of proteins for a variety of genes.

A novel pathogenic variant in an Iranian Ataxia telangiectasia family revealed by next-generation sequencing followed by in silico analysis.

PubMed

Tabatabaiefar, Mohammad Amin; Alipour, Paria; Pourahmadiyan, Azam; Fattahi, Najmeh; Shariati, Laleh; Golchin, Neda; Mohammadi-Asl, Javad

2017-08-15

Ataxia telangiectasia (A-T) is a neurodegenerative autosomal recessive disorder with the main characteristics of progressive cerebellar degeneration, sensitivity to ionizing radiation, immunodeficiency, telangiectasia, premature aging, recurrent sinopulmonary infections, and increased risk of malignancy, especially of lymphoid origin. Ataxia Telangiectasia Mutated gene, ATM, as a causative gene for the A-T disorder, encodes the ATM protein, which plays an important role in the activation of cell-cycle checkpoints and initiation of DNA repair in response to DNA damage. Targeted next-generation sequencing (NGS) was performed on an Iranian 5-year-old boy presented with truncal and limb ataxia, telangiectasia of the eye, Hodgkin lymphoma, hyper pigmentation, total alopecia, hepatomegaly, and dysarthria. Sanger sequencing was used to confirm the candidate pathogenic variants. Computational docking was done using the HEX software to examine how this change affects the interactions of ATM with the upstream and downstream proteins. Three different variants were identified comprising two homozygous SNPs and one novel homozygous frameshift variant (c.80468047delTA, p.Thr2682ThrfsX5), which creates a stop codon in exon 57 leaving the protein truncated at its C-terminal portion. Therefore, the activation and phosphorylation of target proteins are lost. Moreover, the HEX software confirmed that the mutated protein lost its interaction with upstream and downstream proteins. The variant was classified as pathogenic based on the American College of Medical Genetics and Genomics guideline. This study expands the spectrum of ATM pathogenic variants in Iran and demonstrates the utility of targeted NGS in genetic diagnostics. Copyright © 2017. Published by Elsevier B.V.

Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, Yuxiang, E-mail: yuxiangqin@126.com; Tian, Yanchen; Han, Lu

Highlights: •A class II WRKY transcription factor, TaWRKY79 was isolated and characterized. •TaWRKY79 was induced by NaCl or abscisic acid. •843 bp regulatory segment was sufficient to respond to ABA or NaCl treatment. •TaWRKY79 enhanced salinity and ionic tolerance while reduced sensitivity to ABA. •TaWRKY79 increased salinity and ionic tolerance in an ABA-dependent pathway. -- Abstract: The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusionmore » between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway.« less

Identification of a Novel Transcript and Regulatory Mechanism for Microsomal Triglyceride Transfer Protein

PubMed Central

Suzuki, Takashi; Brown, Judy J.; Swift, Larry L.

2016-01-01

Microsomal triglyceride transfer protein (MTP) is essential for the assembly of triglyceride-rich apolipoprotein B-containing lipoproteins. Previous studies in our laboratory identified a novel splice variant of MTP in mice that we named MTP-B. MTP-B has a unique first exon (1B) located 2.7 kB upstream of the first exon (1A) for canonical MTP (MTP-A). The two mature isoforms, though nearly identical in sequence and function, have different tissue expression patterns. In this study we report the identification of a second MTP splice variant (MTP-C), which contains both exons 1B and 1A. MTP-C is expressed in all the tissues we tested. In cells transfected with MTP-C, protein expression was less than 15% of that found when the cells were transfected with MTP-A or MTP-B. In silico analysis of the 5’-UTR of MTP-C revealed seven ATGs upstream of the start site for MTP-A, which is the only viable start site in frame with the main coding sequence. One of those ATGs was located in the 5’-UTR for MTP-A. We generated reporter constructs in which the 5’-UTRs of MTP-A or MTP-C were inserted between an SV40 promoter and the coding sequence of the luciferase gene and transfected these constructs into HEK 293 cells. Luciferase activity was significantly reduced by the MTP-C 5’-UTR, but not by the MTP-A 5’-UTR. We conclude that alternative splicing plays a key role in regulating MTP expression by introducing unique 5’-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP levels and activity. PMID:26771188

Microbial Community Structure and Arsenic Biogeochemistry in an Acid Vapor-Formed Spring in Tengchong Geothermal Area, China

PubMed Central

Jiang, Zhou; Li, Ping; Jiang, Dawei; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Wang, Yanxin

2016-01-01

Arsenic biogeochemistry has been studied extensively in acid sulfate-chloride hot springs, but not in acid sulfate hot springs with low chloride. In this study, Zhenzhuquan in Tengchong geothermal area, a representative acid sulfate hot spring with low chloride, was chosen to study arsenic geochemistry and microbial community structure using Illumina MiSeq sequencing. Over 0.3 million 16S rRNA sequence reads were obtained from 6-paired parallel water and sediment samples along its outflow channel. Arsenic oxidation occurred in the Zhenxhuquan pool, with distinctly high ratios of arsenate to total dissolved arsenic (0.73–0.86). Coupled with iron and sulfur oxidation along the outflow channel, arsenic accumulated in downstream sediments with concentrations up to 16.44 g/kg and appeared to significantly constrain their microbial community diversity. These oxidations might be correlated with the appearance of some putative functional microbial populations, such as Aquificae and Pseudomonas (arsenic oxidation), Sulfolobus (sulfur and iron oxidation), Metallosphaera and Acidicaldus (iron oxidation). Temperature, total organic carbon and dissolved oxygen significantly shaped the microbial community structure of upstream and downstream samples. In the upstream outflow channel region, most microbial populations were microaerophilic/anaerobic thermophiles and hyperthermophiles, such as Sulfolobus, Nocardia, Fervidicoccus, Delftia, and Ralstonia. In the downstream region, aerobic heterotrophic mesophiles and thermophiles were identified, including Ktedonobacteria, Acidicaldus, Chthonomonas and Sphingobacteria. A total of 72.41–95.91% unassigned-genus sequences were derived from the downstream high arsenic sediments 16S rRNA clone libraries. This study could enable us to achieve an integrated understanding on arsenic biogeochemistry in acid hot springs. PMID:26761709

Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

1994-04-01

The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

PubMed

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

The Oenococcus oeni clpX Homologue Is a Heat Shock Gene Preferentially Expressed in Exponential Growth Phase

PubMed Central

Jobin, Michel-Philippe; Garmyn, Dominique; Diviès, Charles; Guzzo, Jean

1999-01-01

Using degenerated primers from conserved regions of previously studied clpX gene products, we cloned the clpX gene of the malolactic bacterium Oenococcus oeni. The clpX gene was sequenced, and the deduced protein of 413 amino acids (predicted molecular mass of 45,650 Da) was highly similar to previously analyzed clpX gene products from other organisms. An open reading frame located upstream of the clpX gene was identified as the tig gene by similarity of its predicted product to other bacterial trigger factors. ClpX was purified by using a maltose binding protein fusion system and was shown to possess an ATPase activity. Northern analyses indicated the presence of two independent 1.6-kb monocistronic clpX and tig mRNAs and also showed an increase in clpX mRNA amount after a temperature shift from 30 to 42°C. The clpX transcript is abundant in the early exponential growth phase and progressively declines to undetectable levels in the stationary phase. Thus, unlike hsp18, the gene encoding one of the major small heat shock proteins of Oenococcus oeni, clpX expression is related to the exponential growth phase and requires de novo protein synthesis. Primer extension analysis identified the 5′ end of clpX mRNA which is located 408 nucleotides upstream of a putative AUA start codon. The putative transcription start site allowed identification of a predicted promoter sequence with a high similarity to the consensus sequence found in the housekeeping gene promoter of gram-positive bacteria as well as Escherichia coli. PMID:10542163

Sequencing artifacts in the type A influenza databases and attempts to correct them.

PubMed

Suarez, David L; Chester, Nikki; Hatfield, Jason

2014-07-01

There are over 276 000 influenza gene sequences in public databases, with the quality of the sequences determined by the contributor. As part of a high school class project, influenza sequences with possible errors were identified in the public databases based on the size of the gene being longer than expected, with the hypothesis that these sequences would have an error. Students contacted sequence submitters alerting them of the possible sequence issue(s) and requested they the suspect sequence(s) be correct as appropriate. Type A influenza viruses were screened, and gene segments longer than the accepted size were identified for further analysis. Attention was placed on sequences with additional nucleotides upstream or downstream of the highly conserved non-coding ends of the viral segments. A total of 1081 sequences were identified that met this criterion. Three types of errors were commonly observed: non-influenza primer sequence wasn't removed from the sequence; PCR product was cloned and plasmid sequence was included in the sequence; and Taq polymerase added an adenine at the end of the PCR product. Internal insertions of nucleotide sequence were also commonly observed, but in many cases it was unclear if the sequence was correct or actually contained an error. A total of 215 sequences, or 22.8% of the suspect sequences, were corrected in the public databases in the first year of the student project. Unfortunately 138 additional sequences with possible errors were added to the databases in the second year. Additional awareness of the need for data integrity of sequences submitted to public databases is needed to fully reap the benefits of these large data sets. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

Standardization and quality management in next-generation sequencing.

PubMed

Endrullat, Christoph; Glökler, Jörn; Franke, Philipp; Frohme, Marcus

2016-09-01

DNA sequencing continues to evolve quickly even after > 30 years. Many new platforms suddenly appeared and former established systems have vanished in almost the same manner. Since establishment of next-generation sequencing devices, this progress gains momentum due to the continually growing demand for higher throughput, lower costs and better quality of data. In consequence of this rapid development, standardized procedures and data formats as well as comprehensive quality management considerations are still scarce. Here, we listed and summarized current standardization efforts and quality management initiatives from companies, organizations and societies in form of published studies and ongoing projects. These comprise on the one hand quality documentation issues like technical notes, accreditation checklists and guidelines for validation of sequencing workflows. On the other hand, general standard proposals and quality metrics are developed and applied to the sequencing workflow steps with the main focus on upstream processes. Finally, certain standard developments for downstream pipeline data handling, processing and storage are discussed in brief. These standardization approaches represent a first basis for continuing work in order to prospectively implement next-generation sequencing in important areas such as clinical diagnostics, where reliable results and fast processing is crucial. Additionally, these efforts will exert a decisive influence on traceability and reproducibility of sequence data.

Interplanetary Circumstances of Quasi-Perpendicular Interplanetary Shocks in 1996-2005

NASA Technical Reports Server (NTRS)

Richardson, I. G.; Cane, H. V.

2010-01-01

The angle (theta(sub Bn)) between the normal to an interplanetary shock front and the upstream magnetic field direction, though often thought of as a property "of the shock," is also determined by the configuration of the magnetic field immediately upstream of the shock. We investigate the interplanetary circumstances of 105 near-Earth quasi-perpendicular shocks during 1996-2005 identified by theta(sub Bn) greater than or equal to 80 degrees and/or by evidence of shock drift particle acceleration. Around 87% of these shocks were driven by interplanetary coronal mass ejections (ICMEs); the remainder were probably the forward shocks of corotating interaction regions. For around half of the shocks, the upstream field was approximately perpendicular to the radial direction, either east-west or west-east or highly inclined to the ecliptic. Such field directions will give quasi-perpendicular configurations for radially propagating shocks. Around 30% of the shocks were propagating through, or closely followed, ICMEs at the time of observation. Another quarter were propagating through the heliospheric plasma sheet (HPS), and a further quarter occurred in slow solar wind that did not have characteristics of the HPS. Around 11% were observed in high-speed streams, and 7% in the sheaths following other shocks. The fraction of shocks found in high-speed streams is around a third of that expected based on the fraction of the time when such streams were observed at Earth. Quasi-perpendicular shocks are found traveling through ICMEs around 2-3 times more frequently than expected. In addition, shocks propagating through ICMEs are more likely to have larger values of theta(sub Bn) than shocks outside ICMEs.

Increasing Classroom Compliance: Using a High-Probability Command Sequence with Noncompliant Students

ERIC Educational Resources Information Center

Axelrod, Michael I.; Zank, Amber J.

2012-01-01

Noncompliance is one of the most problematic behaviors within the school setting. One strategy to increase compliance of noncompliant students is a high-probability command sequence (HPCS; i.e., a set of simple commands in which an individual is likely to comply immediately prior to the delivery of a command that has a lower probability of…

Laminar Cortical Dynamics of Cognitive and Motor Working Memory, Sequence Learning and Performance: Toward a Unified Theory of How the Cerebral Cortex Works

ERIC Educational Resources Information Center

Grossberg, Stephen; Pearson, Lance R.

2008-01-01

How does the brain carry out working memory storage, categorization, and voluntary performance of event sequences? The LIST PARSE neural model proposes an answer that unifies the explanation of cognitive, neurophysiological, and anatomical data. It quantitatively simulates human cognitive data about immediate serial recall and free recall, and…

Effects of Mental and Physical Practice on a Finger Opposition Task among Children

ERIC Educational Resources Information Center

de Paula Asa, Sabrina Kyoko; Santos Melo, Mara Cristina; Piemonte, Maria Elisa Pimentel

2014-01-01

Purpose: We sought to compare the effects of physical practice (PP) and mental practice (MP) on the immediate and long-term learning of the finger-to-thumb opposition sequence task (FOS) in children; in addition, we investigated the transfer of this learning to an untrained sequence of movements and to the contralateral untrained hand. Method:…

Simple, quick and cost-efficient: A universal RT-PCR and sequencing strategy for genomic characterisation of foot-and-mouth disease viruses.

PubMed

Dill, V; Beer, M; Hoffmann, B

2017-08-01

Foot-and-mouth disease (FMD) is a major contributor to poverty and food insecurity in Africa and Asia, and it is one of the biggest threats to agriculture in highly developed countries. As FMD is extremely contagious, strategies for its prevention, early detection, and the immediate characterisation of outbreak strains are of great importance. The generation of whole-genome sequences enables phylogenetic characterisation, the epidemiological tracing of virus transmission pathways and is supportive in disease control strategies. This study describes the development and validation of a rapid, universal and cost-efficient RT-PCR system to generate genome sequences of FMDV, reaching from the IRES to the end of the open reading frame. The method was evaluated using twelve different virus strains covering all seven serotypes of FMDV. Additionally, samples from experimentally infected animals were tested to mimic diagnostic field samples. All primer pairs showed a robust amplification with a high sensitivity for all serotypes. In summary, the described assay is suitable for the generation of FMDV sequences from all serotypes to allow immediate phylogenetic analysis, detailed genotyping and molecular epidemiology. Copyright © 2017 Elsevier B.V. All rights reserved.

Prose memory deficits associated with schizophrenia.

PubMed

Lee, Tatia M C; Chan, Michelle W C; Chan, Chetwyn C H; Gao, Junling; Wang, Kai; Chen, Eric Y H

2006-01-31

Memory of contextual information is essential to one's quality of living. This study investigated if the different components of prose memory, across three recall conditions: first learning trial immediate recall, fifth learning trial immediate recall, and 30-min delayed recall, are differentially impaired in people with schizophrenia, relative to healthy controls. A total of 39 patients with schizophrenia and 39 matched healthy controls were recruited. Their prose memory, in terms of recall accuracy, temporal sequence, recognition accuracy and false positives, commission of distortions, and rates of learning, forgetting, and retention were tested and compared. After controlling for the level of intelligence and depression, the patients with schizophrenia were found to commit more distortions. Furthermore, they performed poorer on recall accuracy and temporal sequence accuracy only during the first initial immediate recall. On the other hand, the rates of forgetting/retention and recognition accuracy were comparable between the two groups. These findings suggest that people with schizophrenia could be benefited by repeated exposure to the materials to be remembered. These results may have important implications for rehabilitation of verbal declarative memory deficits in schizophrenia.

The loess/paleosol record and the nature of the younger dryas climate in central China

USGS Publications Warehouse

Madsen, D.B.; Jingzen, L.; Elston, R.G.; Cheng, X.; Bettinger, R.L.; Kan, G.; Jeff, Brantingham P.; Kan, Z.

1998-01-01

The use of latest Pleistocene-Holocene paleosols in defining Chinese climatic sequences is plagued by poor chronological controls caused primarily by the use of radiocarbon dates derived from bulk soil carbon. Dating of a post-glacial aeolian/paleosol sequence in the Pigeon Mountain basin of north-central China, using culturally deposited charcoal, support a wide array of other data suggesting the Younger Dryas was a period of cooler dryer conditions marked by wide-spread aeolian deposition. Periods of soil formation and higher lake levels bracket this climatic event. Climatic variability immediately before, during and immediately after the Younger Dryas interval is associated with rapid technological elaboration and innovation in the production and use of chipped stone tools, and perhaps, ground stone. ?? 1998 John Wiley & Sons, Inc.

Dam Breach Release of Non-Cohesive Sediments: Channel Response and Recovery Rates

NASA Astrophysics Data System (ADS)

Collins, M. J.; Boardman, G.; Banks, W.; Andrews, M.; Conlon, M.; Dillow, J. J. A.; Gellis, A.; Lowe, S.; McClain, S.; Miller, A. J.; Snyder, N. P.; Wilcock, P. R.

2014-12-01

Dam removals featuring unchecked releases of non-cohesive sediments are excellent opportunities to learn more about stream channel response to abrupt increases in bed material supply that can occur deliberately or by natural processes like landslides and volcanic eruptions. Understanding channel response to sediment pulses, including response rates, is essential because human uses of river channels and floodplains are impacted by these events as are aquatic habitats. We had the opportunity to study a dam removal site at the Simkins Dam in Maryland, USA, that shares many important geophysical attributes of another well-studied dam removal in the humid northeast United States [Merrimack Village Dam, New Hampshire; Pearson et al., 2011]. The watershed sizes are the same order of magnitude (102 km2), and at both sites relatively low head dams were removed (~ 3-4 m) and ~60,000 m3 of dominantly sand-sized sediments discharged to low-gradient reaches immediately downstream. Analyzing four years of repeat morphometry and bed sediment grain size surveys at the Simkins site on the Patapsco River, as well as continuous discharge and suspended sediment gaging data, we clearly document a two-phase response in the upstream reach as described by Pearson et al. [2011] for their New Hampshire site and noted at other dam removals [e.g., Major et al., 2012]. In the early phase, approximately 50% of the impounded sediment mass was eroded rapidly over a period of about three months when flows were very modest (Figure 1). After incision to base level and channel widening in the former impoundment, a second phase began when further erosion depended on floods large enough to access impounded sediments more distant from the newly-formed channel. We also found important differences in the upstream responses at the Maryland and New Hampshire sites that appear to be related to valley type (non-glaciated versus glaciated, respectively). Response variances immediately downstream between the respective sites are potentially related to local gradient and hydraulics.

Accuracy of Phase-Contrast Velocity Mapping Proximal and Distal to Stent Artifact During Cardiac Magnetic Resonance Imaging.

PubMed

Avitabile, Catherine M; Harris, Matthew A; Doddasomayajula, Ravi S; Chopski, Steven G; Gillespie, Matthew J; Dori, Yoav; Glatz, Andrew C; Fogel, Mark A; Whitehead, Kevin K

2018-06-15

Little data are available on the accuracy of phase-contrast magnetic resonance imaging (PC-MRI) velocity mapping in the vicinity of intravascular metal stents other than nitinol stents. Therefore, we sought to determine this accuracy using in vitro experiments. An in vitro flow phantom was used with 3 stent types: (1) 316L stainless steel, (2) nitinol self-expanding, and (3) platinum-iridium. Steady and pulsatile flow was delivered with a magnetic resonance imaging-compatible pump (CardioFlow 5000, Shelley Medical, London, Ontario, Canada). Flows were measured using a transit time flow meter (ME13PXN, Transonic, Inc, Ithaca, New York). Mean flows ranged from 0.5 to 7 L/min. For each condition, 5 PC-MRI acquisitions were made: within the stent, immediately adjacent to both edges of the stent artifact, and 1 cm upstream and downstream of the artifact. Mean PC-MRI flows were calculated by segmenting the tube lumen using clinical software (ARGUS, Siemens, Inc, Erlangen, Germany). PC-MRI and flow meter flows were compared by location and stent type using linear regression, Bland-Altman, and intraclass correlation (ICC). PC-MRI flows within the stent artifact were inaccurate for all stents studied, generally underestimating flow meter-measured flow. Agreement between PC-MRI and flow meter-measured flows was excellent for all stent types, both immediately adjacent to and 1 cm away from the edge of the stent artifact. Agreement was highest for the platinum-iridium stent (R = 0.999, ICC = 0.999) and lowest for the nitinol stent (R = 0.993, ICC = 0.987). In conclusion, PC-MRI flows are highly accurate just upstream and downstream of a variety of clinically used stents, supporting its use to directly measure flows in stented vessels. Copyright © 2018 Elsevier Inc. All rights reserved.

Geomorphic responses to large check-dam removal on a mountain river in Taiwan

NASA Astrophysics Data System (ADS)

Wang, H.; Stark, C. P.; Cook, K. L.; Kuo, W.

2011-12-01

Dam removal has become an important aspect of river restoration in recent years, but studies documenting the physical and ecological response to dam removal are still lacking - particularly in mountain rivers and following major floods. This presentation documents the recent removal of a large dam on a coarse-grained, steep (an order of magnitude greater than on the Marmot) mountain channel in Taiwan. The Chijiawan river, a tributary of the Tachia River draining a 1236 km2 watershed, is the only habitat in Taiwan of the endangered Formosan landlocked salmon. The habitat of this fish has been cut significantly since the 1960s following construction of check dams designed to prevent reservoir sedimentation downstream. The largest and lowermost barrier on Chijiawan creek is the 15m high, "No. 1 Check Dam" built in 1971. Forty years later, in early 2011, the sediment wedge behind the dam had reached an estimated 0.2 million m3 and the dam toe had been scoured about 4m below its foundation, posing a serious risk of dam failure. For these reasons, the Shei-Pa National Park removed the dam in late May 2011. To monitor the response of the river to dam removal, we installed video cameras, time-lapse cameras, stage recorders, and turbidity sensors, conducted surveys of grain size distributions and longitudinal profiles, and carried out repeat photography. Channel changes were greatest immediately following removal as a result of the high stream power, steep energy slope, and unconsolidated alluvial fill behind the dam. Headcut propagation caused immediate removal of the sand-grade sediment and progressive channel widening. One month after dam removal, a minor flood event excavated a big wedge of sediment from the impoundment. Most of the subsequent downstream deposition occurred within 500m of the dam, with alluviation reaching up to 0.5m in places. Two months after dam removal, erosion had propagated 300m upstream into the impounded sediment along a bed profile of gradient at 1.4% at a headcut with a local gradient of 5.1%. The change in grain size was a fining of the sediment at the two downstream sites and a slight coarsening at the upstream site from April 2010 to July 2011. This is likely due to the increase in energy upstream of the dam post-removal, which has transported the fine-grained sediments downstream. As the river adjusts over coming months and years, we anticipate that observations such as these will help generate an important resource for all those concerned with dam removal and river restoration.

Detecting and Characterizing Repeating Earthquake Sequences During Volcanic Eruptions

NASA Astrophysics Data System (ADS)

Tepp, G.; Haney, M. M.; Wech, A.

2017-12-01

A major challenge in volcano seismology is forecasting eruptions. Repeating earthquake sequences often precede volcanic eruptions or lava dome activity, providing an opportunity for short-term eruption forecasting. Automatic detection of these sequences can lead to timely eruption notification and aid in continuous monitoring of volcanic systems. However, repeating earthquake sequences may also occur after eruptions or along with magma intrusions that do not immediately lead to an eruption. This additional challenge requires a better understanding of the processes involved in producing these sequences to distinguish those that are precursory. Calculation of the inverse moment rate and concepts from the material failure forecast method can lead to such insights. The temporal evolution of the inverse moment rate is observed to differ for precursory and non-precursory sequences, and multiple earthquake sequences may occur concurrently. These observations suggest that sequences may occur in different locations or through different processes. We developed an automated repeating earthquake sequence detector and near real-time alarm to send alerts when an in-progress sequence is identified. Near real-time inverse moment rate measurements can further improve our ability to forecast eruptions by allowing for characterization of sequences. We apply the detector to eruptions of two Alaskan volcanoes: Bogoslof in 2016-2017 and Redoubt Volcano in 2009. The Bogoslof eruption produced almost 40 repeating earthquake sequences between its start in mid-December 2016 and early June 2017, 21 of which preceded an explosive eruption, and 2 sequences in the months before eruptive activity. Three of the sequences occurred after the implementation of the alarm in late March 2017 and successfully triggered alerts. The nearest seismometers to Bogoslof are over 45 km away, requiring a detector that can work with few stations and a relatively low signal-to-noise ratio. During the Redoubt eruption, earthquake sequences were observed in the months leading up to the eruptive activity beginning in March 2009 as well as immediately preceding 7 of the 19 explosive events. In contrast to Bogoslof, Redoubt has a local monitoring network which allows for better detection and more detailed analysis of the repeating earthquake sequences.

[Impacts on skin blood flow under moving cupping along meridians in different directions].

PubMed

Tian, Yu-Ying; Wang, Guang-Jun; Huang, Tao; Jia, Shu-Yong; Zhang, Yu-Qin; Zhang, Wei-Bo

2013-03-01

To compare the impacts on skin blood flow between moving cupping following the meridian running direction and that against the running direction. JLG-2 meridian cupping drainage instru ment was used for moving cupping on the back along the Bladder Meridian running course in either single direction for 20 times. The cupping device was Bian stone cup, 44 mm in inner diameter, negative pressure from -0.03 to -0.04 MPa. PeriScan PIM II laser Doppler perfusion imager was used to observe the changes in skin blood flow on the running course of the Bladder Meridian with cup moved up and down and in the same region on the contralateral Bladder Meridian. Blood flow was measured before cupping, at the immediate time after cupping and 10 min after cupping separately. Fourteen healthy volunteers received the test. The measuring region was subdivided into a moving cupping area, an upstream area, a downstream area, a contralateral moving cupping area, a contralateral upstream area and a contralateral downstream area. The mean blood flow was calculated in each area. Blood flow was increased significantly in each area and was more apparently increased in the moving cupping area. In comparison of the changing rate of blood flow between cupping following the meridian running direction and that against the running direction, it was only found that the changing rate in the upstream area of moving cupping against the running direction was significantly higher than that following the running direction (P < 0.05). The differences were not statistically significant in comparison among the other areas. Additionally, the changing rates of blood flow in the upstream and downstream area of the Bladder Meridian were increased significantly as compared with the contralateral Bladder Meridian. The local effects are similar between moving cupping following the meridian running direction and that against the running direction. The abscopal effect of moving cupping against the running direction is superior to that following the running direction. It is suggested that the dual-directional moving cupping is applicable for the treatment of local disorders and the abscopal effect is better with moving cupping against the meridian running direction.

The effect of session order on the physiological, neuromuscular, and endocrine responses to maximal speed and weight training sessions over a 24-h period.

PubMed

Johnston, Michael; Johnston, Julia; Cook, Christian J; Costley, Lisa; Kilgallon, Mark; Kilduff, Liam P

2017-05-01

Athletes are often required to undertake multiple training sessions on the same day with these sessions needing to be sequenced correctly to allow the athlete to maximize the responses of each session. We examined the acute effect of strength and speed training sequence on neuromuscular, endocrine, and physiological responses over 24h. 15 academy rugby union players completed this randomized crossover study. Players performed a weight training session followed 2h later by a speed training session (weights speed) and on a separate day reversed the order (speed weights). Countermovement jumps, perceived muscle soreness, and blood samples were collected immediately prior, immediately post, and 24h post-sessions one and two respectively. Jumps were analyzed for power, jump height, rate of force development, and velocity. Blood was analyzed for testosterone, cortisol, lactate and creatine kinase. There were no differences between countermovement jump variables at any of the post-training time points (p>0.05). Likewise, creatine kinase, testosterone, cortisol, and muscle soreness were unaffected by session order (p>0.05). However, 10m sprint time was significantly faster (mean±standard deviation; speed weights 1.80±0.11s versus weights speed 1.76±0.08s; p>0.05) when speed was sequenced second. Lactate levels were significantly higher immediately post-speed sessions versus weight training sessions at both time points (p<0.05). The sequencing of strength and speed training does not affect the neuromuscular, endocrine, and physiological recovery over 24h. However, speed may be enhanced when performed as the second session. Copyright © 2016 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

The silent mutation MLH1 c.543C>T resulting in aberrant splicing can cause Lynch syndrome: a case report.

PubMed

Yamaguchi, Tatsuro; Wakatsuki, Tomokazu; Kikuchi, Mari; Horiguchi, Shin-Ichiro; Akagi, Kiwamu

2017-06-01

The proband was a 67-year-old man with transverse and sigmoid colon cancer. Microsatellite instability analysis revealed a high frequency of microsatellite instability, and immunohistochemical staining showed the absence of both MLH1 and PMS2 proteins in the sigmoid colon cancer tissue specimens from the patient. DNA sequencing revealed a nucleotide substitution c.543C>T in MLH1, but this variant did not substitute an amino acid. The MLH1 c.543C>T variant was located 3 bases upstream from the end of exon 6 and created a new splice donor site 4 bases upstream from the end of exon 6. Consequently, the last 4 bases of exon 6 were deleted and frameshift occurred. Thus, the MLH1 c.543C>T silent mutation is considered 'pathogenic'. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A murC gene from coryneform bacteria.

PubMed

Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K

1999-02-01

The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.

Flow Instabilities in Feather Seals due to Upstream Harmonic Pressure Fluctuations

NASA Technical Reports Server (NTRS)

Deng, D.; Braun, M. J.; Henricks, Robert C.

2008-01-01

Feather seals (also called slot seals) typically found in turbine stators limit leakage from the platform into the core cavities and from the shroud to the case. They are of various geometric shapes, yet all are contoured to fit the aerodynamic shape of the stator and placed as close as thermomechanically reasonable the powerstream flow passage. Oscillations engendered in the compressor or combustor alter the steady leakage characteristics of these sealing elements and in some instances generate flow instabilities downstream of the seal interface. In this study, a generic feather seal geometry was studied numerically by imposing an upstream harmonic pressure disturbance on the simulated stator-blade gap. The flow and thermal characteristics were determined; it was found that for high pressure drops, large fluctuations in flows in the downstream blade-stator gap can occur. These leakages and pulsations in themselves are not all that significant, yet if coupled with cavity parameters, they could set up resonance events. Computationally generated time-dependent flow fields are captured in sequence video streaming.

TPA can overcome the requirement for EIa and together act synergistically in stimulating expression of the adenovirus EIII promoter.

PubMed Central

Buckbinder, L; Miralles, V J; Reinberg, D

1989-01-01

We have examined the control of gene expression from the adenovirus early region III (Ad-EIII) promoter, which contains two previously defined elements, the AP1 and ATF sites. We found that the AP1 element is capable of mediating activation by the adenovirus immediate early (EIa) gene products. Consistent with studies demonstrating that the AP1 site mediates signal transduction in response to 12-O-tetradecanoylphorbol 13-acetate (TPA) we have shown that TPA can activate Ad-EIII expression and overcome the requirement for EIa. Together TPA and EIa elicited a synergistic response in expression from the Ad-EIII promoter during both transient expression assays and viral infections. This synergistic effect required the AP1 element. An EIII promoter construct, in which sequences upstream of the TATA box had been replaced with four AP1 sites, was responsive to TPA and EIa and in combination promoted the synergistic effect. The analysis of specific factors involved in transcription from the Ad-EIII indicated that proteins recognizing the ATF and AP1 sites were important in expression from this promoter in vitro. Purification of protein factors that specifically stimulated EIII expression resulted in the isolation of a set of factors of the AP1 family. Affinity purified AP1 recognized and activated transcription through both the AP1 and ATF elements. In addition, a protein fraction was identified with DNA binding activity specific for the ATF element. This fraction was dependent on the ATF site for transcriptional activity. Images PMID:2531661

Cnm is a major virulence factor of invasive Streptococcus mutans and part of a conserved three-gene locus

PubMed Central

Avilés-Reyes, A.; Miller, J.H.; Simpson-Haidaris, P.J.; Lemos, J.A.; Abranches, J.

2014-01-01

SUMMARY Cnm, a collagen- and laminin-binding protein present in a subset of Streptococcus mutans strains, mediates binding to extracellular matrices (ECM), intracellular invasion and virulence in the Galleria mellonella model. Antibodies raised against Cnm were used to confirm expression and the cell surface localization of Cnm in the highly invasive OMZ175 strain. Sequence analysis identified two additional genes (cnaB and cbpA) encoding putative surface proteins immediately upstream of cnm. Inactivation of cnaB and cbpA in OMZ175, individually or in combination, did not decrease the ability of this highly invasive and virulent strain to bind to different ECM proteins, invade human coronary artery endothelial cells (HCAEC), or kill G. mellonella. Similarly, expression of cnaB and cbpA in the cnm− strain UA159 revealed that these genes did not enhance Cnmrelated phenotypes. However, integration of cnm in the chromosome of UA159 significantly increased its ability to bind to collagen and laminin, invade HCAEC, and kill G. mellonella. Moreover, the presence of antibodies against Cnm nearly abolished the ability of OMZ175 to bind to collagen and laminin and invade HCAEC, and significantly protected G. mellonella against OMZ175 infection. We concluded that neither CnaB nor CbpA is necessary for the expression of Cnm-related traits. We also provided definitive evidence that Cnm is an important virulence factor and a suitable target for the development of novel preventive and therapeutic strategies to combat invasive S. mutans strains. PMID:24103776

Zinc finger protein designed to target 2-long terminal repeat junctions interferes with human immunodeficiency virus integration.

PubMed

Sakkhachornphop, Supachai; Barbas, Carlos F; Keawvichit, Rassamee; Wongworapat, Kanlaya; Tayapiwatana, Chatchai

2012-09-01

Integration of the human immunodeficiency virus type 1 (HIV-1) genome into the host chromosome is a vital step in the HIV life cycle. The highly conserved cytosine-adenine (CA) dinucleotide sequence immediately upstream of the cleavage site is crucial for integrase (IN) activity. As this viral enzyme has an important role early in the HIV-1 replication cycle, interference with the IN substrate has become an attractive strategy for therapeutic intervention. We demonstrated that a designed zinc finger protein (ZFP) fused to green fluorescent protein (GFP) targets the 2-long terminal repeat (2-LTR) circle junctions of HIV-1 DNA with nanomolar affinity. We report now that 2LTRZFP-GFP stably transduced into 293T cells interfered with the expression of vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral red fluorescent protein (RFP), as shown by the suppression of RFP expression. We also used a third-generation lentiviral vector and pCEP4 expression vector to deliver the 2LTRZFP-GFP transgene into human T-lymphocytic cells, and a stable cell line for long-term expression studies was selected for HIV-1 challenge. HIV-1 integration and replication were inhibited as measured by Alu-gag real-time PCR and p24 antigen assay. In addition, the molecular activity of 2LTRZFP-GFP was evaluated in peripheral blood mononuclear cells. The results were confirmed by Alu-gag real-time PCR for integration interference. We suggest that the expression of 2LTRZFP-GFP limited viral integration on intracellular immunization, and that it has potential for use in HIV gene therapy in the future.

Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana

PubMed Central

Park, Jin-Sup; Frost, Jennifer M.; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S.; Fischer, Robert L.; Choi, Yeonhee

2017-01-01

The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana. DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation. PMID:28130550

ECHS1 mutations in Leigh disease: a new inborn error of metabolism affecting valine metabolism.

PubMed

Peters, Heidi; Buck, Nicole; Wanders, Ronald; Ruiter, Jos; Waterham, Hans; Koster, Janet; Yaplito-Lee, Joy; Ferdinandusse, Sacha; Pitt, James

2014-11-01

Two siblings with fatal Leigh disease had increased excretion of S-(2-carboxypropyl)cysteine and several other metabolites that are features of 3-hydroxyisobutyryl-CoA hydrolase (HIBCH) deficiency, a rare defect in the valine catabolic pathway associated with Leigh-like disease. However, this diagnosis was excluded by HIBCH sequencing and normal enzyme activity. In contrast to HIBCH deficiency, the excretion of 3-hydroxyisobutyryl-carnitine was normal in the children, suggesting deficiency of short-chain enoyl-CoA hydratase (ECHS1 gene). This mitochondrial enzyme is active in several metabolic pathways involving fatty acids and amino acids, including valine, and is immediately upstream of HIBCH in the valine pathway. Both children were compound heterozygous for a c.473C > A (p.A158D) missense mutation and a c.414+3G>C splicing mutation in ECHS1. ECHS1 activity was markedly decreased in cultured fibroblasts from both siblings, ECHS1 protein was undetectable by immunoblot analysis and transfection of patient cells with wild-type ECHS1 rescued ECHS1 activity. The highly reactive metabolites methacrylyl-CoA and acryloyl-CoA accumulate in deficiencies of both ECHS1 and HIBCH and are probably responsible for the brain pathology in both disorders. Deficiency of ECHS1 or HIBCH should be considered in children with Leigh disease. Urine metabolite testing can detect and distinguish between these two disorders. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

High cancer-specific expression of mesothelin (MSLN) is attributable to an upstream enhancer containing a transcription enhancer factor dependent MCAT motif.

PubMed

Hucl, Tomas; Brody, Jonathan R; Gallmeier, Eike; Iacobuzio-Donahue, Christine A; Farrance, Iain K; Kern, Scott E

2007-10-01

Identification of genes with cancer-specific overexpression offers the potential to efficiently discover cancer-specific activities in an unbiased manner. We apply this paradigm to study mesothelin (MSLN) overexpression, a nearly ubiquitous, diagnostically and therapeutically useful characteristic of pancreatic cancer. We identified an 18-bp upstream enhancer, termed CanScript, strongly activating transcription from an otherwise weak tissue-nonspecific promoter and operating selectively in cells having aberrantly elevated cancer-specific MSLN transcription. Introducing mutations into CanScript showed two functionally distinct sites: an Sp1-like site and an MCAT element. Gel retardation and chromatin immunoprecipitation assays showed the MCAT element to be bound by transcription enhancer factor (TEF)-1 (TEAD1) in vitro and in vivo. The presence of TEF-1 was required for MSLN protein overexpression as determined by TEF-1 knockdown experiments. The cancer specificity seemed to be provided by a putative limiting cofactor of TEF-1 that could be outcompeted by exogenous TEF-1 only in a MSLN-overexpressing cell line. A CanScript concatemer offered enhanced activity. These results identify a TEF family member as a major regulator of MSLN overexpression, a fundamental characteristic of pancreatic and other cancers, perhaps due to an upstream and highly frequent aberrant cellular activity. The CanScript sequence represents a modular element for cancer-specific targeting, potentially suitable for nearly a third of human malignancies.

Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

PubMed Central

Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

2005-01-01

Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

PubMed Central

Lloyd, G S; Busby, S J; Savery, N J

1998-01-01

During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

Modeling migratory energetics of Connecticut River American shad (Alosa sapidissima): implications for the conservation of an iteroparous anadromous fish

USGS Publications Warehouse

Castro-Santos, Theodore; Letcher, Benjamin H.

2010-01-01

We present a simulation model in which individual adult migrant American shad (Alosa sapidissima) ascend the Connecticut River and spawn, and survivors return to the marine environment. Our approach synthesizes bioenergetics, reproductive biology, and behavior to estimate the effects of migratory distance and delays incurred at dams on spawning success and survival. We quantified both the magnitude of effects and the consequences of uncertainty in the estimates of input variables. Behavior, physiology, and energetics strongly affected both the distribution of spawning effort and survival to the marine environment. Delays to both upstream and downstream movements had dramatic effects on spawning success, determining total fecundity and spatial extent of spawning. Delays, combined with cues for migratory reversal, also determined the likelihood of survival. Spawning was concentrated in the immediate vicinity of dams and increased with greater migratory distance and delays to downstream migration. More research is needed on reproductive biology, behavior, energetics, and barrier effects to adequately understand the interplay of the various components of this model; it does provide a framework, however, that suggests that provision of upstream passage at dams in the absence of expeditious downstream passage may increase spawning success — but at the expense of reduced iteroparity. 

Ion dynamics at supercritical quasi-parallel shocks: Hybrid simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su Yanqing; Lu Quanming; Gao Xinliang

2012-09-15

By separating the incident ions into directly transmitted, downstream thermalized, and diffuse ions, we perform one-dimensional (1D) hybrid simulations to investigate ion dynamics at a supercritical quasi-parallel shock. In the simulations, the angle between the upstream magnetic field and shock nominal direction is {theta}{sub Bn}=30 Degree-Sign , and the Alfven Mach number is M{sub A}{approx}5.5. The shock exhibits a periodic reformation process. The ion reflection occurs at the beginning of the reformation cycle. Part of the reflected ions is trapped between the old and new shock fronts for an extended time period. These particles eventually form superthermal diffuse ions aftermore » they escape to the upstream of the new shock front at the end of the reformation cycle. The other reflected ions may return to the shock immediately or be trapped between the old and new shock fronts for a short time period. When the amplitude of the new shock front exceeds that of the old shock front and the reformation cycle is finished, these ions become thermalized ions in the downstream. No noticeable heating can be found in the directly transmitted ions. The relevance of our simulations to the satellite observations is also discussed in the paper.« less

The CUG-initiated larger form coat protein of Chinese wheat mosaic virus binds to the cysteine-rich RNA silencing suppressor.

PubMed

Sun, Liying; Andika, Ida Bagus; Shen, Jiangfeng; Yang, Di; Ratti, Claudio; Chen, Jianping

2013-10-01

Some viruses use alternative translation initiation at non-AUG codons as a strategy to produce multiple proteins during gene expression. Here we show that, using this strategy, Chinese wheat mosaic virus (CWMV; Furovirus) expresses a larger form of coat protein (N-ext/CP) in infected plants. Site-directed mutagenesis and transient expression analysis confirmed that CWMV N-ext/CP is initiated at an upstream in-frame CUG codon at nucleotide position 207-209 of RNA 2, which adds a 39 amino acid (aa) N-terminal extension to the major CP. Interestingly, in planta and in vitro analyses indicated that CWMV N-ext/CP but not CP interacts with the CWMV cysteine-rich protein (CRP), an RNA silencing suppressor. We further determined that the N-terminal 39 aa extension, particularly the 10 aa region immediately upstream of the major CP coding region is responsible for the interaction of N-ext/CP with CRP. In an Agrobacterium co-infiltration assay, co-expression with N-ext/CP did not affect CRP silencing suppression activity. Thus the alternative translation initiation at a CUG codon provides the CWMV N-ext/CP with the ability to bind to the viral silencing suppressor. Copyright © 2013 Elsevier B.V. All rights reserved.

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

PubMed Central

Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

1985-01-01

The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this. Images PMID:3016521

Genomic structure of two ras family genes in the slime mold Physarum polycephalum.

PubMed

Trzcińska-Danielewicz, Joanna; Kozlowski, Piotr; Gierdal, Katarzyna; Wiejak, Jolanta; Jagielski, Adam; Toczko, Kazimierz; Fronk, Jan

2002-08-01

Genomic structure of two Physarum polycephalum ras family genes, Ppras2 and Pprap1, has been determined, including the upstream region of the latter. The genes are interrupted by three and four introns, respectively. The first intron of Ppras2 has the same location within the coding sequence as the first intron in another ras homolog from this organism, Ppras1 [Trzcińska-Danielewicz, J., Kozlowski, P., and Toczko, K. (1996). "Cloning and genomic sequence of the Physarum polycephalum Ppras1 gene, a homologue of the ras protooncogene", Gene 169, pp. 143-144]. All introns, ranging from 53 to ca. 460 base pairs, have the canonical 5' and 3' ends, are greatly enriched in pyrimidines in the coding strand and have frequent pyrimidines-only tracts. These latter features seem to be responsible for the difficulties in cloning and sequencing of parts of these genes. Short sequences shared with P. polycephalum transposon-like repeats are common in the introns, indicating a possible role of transposition in intron evolution. In all three ras family genes phase zero introns are located mostly between sequences coding for regular protein secondary structure elements.

Deep learning of the regulatory grammar of yeast 5′ untranslated regions from 500,000 random sequences

PubMed Central

Groves, Benjamin; Kuchina, Anna; Rosenberg, Alexander B.; Jojic, Nebojsa; Fields, Stanley; Seelig, Georg

2017-01-01

Our ability to predict protein expression from DNA sequence alone remains poor, reflecting our limited understanding of cis-regulatory grammar and hampering the design of engineered genes for synthetic biology applications. Here, we generate a model that predicts the protein expression of the 5′ untranslated region (UTR) of mRNAs in the yeast Saccharomyces cerevisiae. We constructed a library of half a million 50-nucleotide-long random 5′ UTRs and assayed their activity in a massively parallel growth selection experiment. The resulting data allow us to quantify the impact on protein expression of Kozak sequence composition, upstream open reading frames (uORFs), and secondary structure. We trained a convolutional neural network (CNN) on the random library and showed that it performs well at predicting the protein expression of both a held-out set of the random 5′ UTRs as well as native S. cerevisiae 5′ UTRs. The model additionally was used to computationally evolve highly active 5′ UTRs. We confirmed experimentally that the great majority of the evolved sequences led to higher protein expression rates than the starting sequences, demonstrating the predictive power of this model. PMID:29097404

DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1.

PubMed

Choudhary, M; Kaplan, S

2000-02-15

This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1 (T). The photosynthesis gene cluster is located within a approximately 73 kb Ase I genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The data were compared with the corresponding genes/ORFs from a different strain of R.sphaeroides and Rhodobacter capsulatus, a close relative of R. sphaeroides. A detailed analysis of the gene organization in the photosynthesis region revealed a similar gene order in both species with some notable differences located to the pucBAC = cycA region. In addition, photosynthesis gene regulatory protein (PpsR, FNR, IHF) binding motifs in upstream sequences of a number of photosynthesis genes have been identified and shown to differ between these two species. The difference in gene organization relative to pucBAC and cycA suggests that this region originated independently of the photosynthesis gene cluster of R.sphaeroides.

Investigation of DNA sequence recognition by a streptomycete MarR family transcriptional regulator through surface plasmon resonance and X-ray crystallography

PubMed Central

Stevenson, Clare E. M.; Assaad, Aoun; Chandra, Govind; Le, Tung B. K.; Greive, Sandra J.; Bibb, Mervyn J.; Lawson, David M.

2013-01-01

Consistent with their complex lifestyles and rich secondary metabolite profiles, the genomes of streptomycetes encode a plethora of transcription factors, the vast majority of which are uncharacterized. Herein, we use Surface Plasmon Resonance (SPR) to identify and delineate putative operator sites for SCO3205, a MarR family transcriptional regulator from Streptomyces coelicolor that is well represented in sequenced actinomycete genomes. In particular, we use a novel SPR footprinting approach that exploits indirect ligand capture to vastly extend the lifetime of a standard streptavidin SPR chip. We define two operator sites upstream of sco3205 and a pseudopalindromic consensus sequence derived from these enables further potential operator sites to be identified in the S. coelicolor genome. We evaluate each of these through SPR and test the importance of the conserved bases within the consensus sequence. Informed by these results, we determine the crystal structure of a SCO3205-DNA complex at 2.8 Å resolution, enabling molecular level rationalization of the SPR data. Taken together, our observations support a DNA recognition mechanism involving both direct and indirect sequence readout. PMID:23748564

Molecular cloning and sequence analysis of the Anticarsia gemmatalis multicapsid nuclear polyhedrosis virus GP64 glycoprotein.

PubMed

Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

2003-01-01

The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.

Auxin, the organizer of the hormonal/environmental signals for root hair growth

PubMed Central

Lee, Richard D.-W.; Cho, Hyung-Taeg

2013-01-01

The root hair development is controlled by diverse factors such as fate-determining developmental cues, auxin-related environmental factors, and hormones. In particular, the soil environmental factors are important as they maximize their absorption by modulating root hair development. These environmental factors affect the root hair developmental process by making use of diverse hormones. These hormonal factors interact with each other to modulate root hair development in which auxin appears to form the most intensive networks with the pathways from environmental factors and hormones. Moreover, auxin action for root hair development is genetically located immediately upstream of the root hair-morphogenetic genes. These observations suggest that auxin plays as an organizing node for environmental/hormonal pathways to modulate root hair growth. PMID:24273547

Effects of barge traffic on distribution and survival of ichthyoplankton and small fishes in the upper Mississippi River

USGS Publications Warehouse

Holland, L.E.

1986-01-01

Short-term impacts of commercial barge traffic on fish eggs, larvae, young-of-the-year (age-0) fishes, and small adults in the main channel of the upper Mississippi River were examined. Barge passages caused significant changes in the distribution of eggs and larvae in the study area. The mean catch of ichthyoplankton was reduced in both surface and bottom waters for 90 min after passage of vessels downstream. The effects of upstream traffic on catch ranged from nil in surface or bottom samples to short-term increases in surface samples immediately after passage. No consistent effect on the catch of age-0 or small adult fishes in surface or bottom trawls was evident.

Designing robust watermark barcodes for multiplex long-read sequencing.

PubMed

Ezpeleta, Joaquín; Krsticevic, Flavia J; Bulacio, Pilar; Tapia, Elizabeth

2017-03-15

To attain acceptable sample misassignment rates, current approaches to multiplex single-molecule real-time sequencing require upstream quality improvement, which is obtained from multiple passes over the sequenced insert and significantly reduces the effective read length. In order to fully exploit the raw read length on multiplex applications, robust barcodes capable of dealing with the full single-pass error rates are needed. We present a method for designing sequencing barcodes that can withstand a large number of insertion, deletion and substitution errors and are suitable for use in multiplex single-molecule real-time sequencing. The manuscript focuses on the design of barcodes for full-length single-pass reads, impaired by challenging error rates in the order of 11%. The proposed barcodes can multiplex hundreds or thousands of samples while achieving sample misassignment probabilities as low as 10-7 under the above conditions, and are designed to be compatible with chemical constraints imposed by the sequencing process. Software tools for constructing watermark barcode sets and demultiplexing barcoded reads, together with example sets of barcodes and synthetic barcoded reads, are freely available at www.cifasis-conicet.gov.ar/ezpeleta/NS-watermark . ezpeleta@cifasis-conicet.gov.ar. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

A two-stage stochastic rule-based model to determine pre-assembly buffer content

NASA Astrophysics Data System (ADS)

Gunay, Elif Elcin; Kula, Ufuk

2018-01-01

This study considers instant decision-making needs of the automobile manufactures for resequencing vehicles before final assembly (FA). We propose a rule-based two-stage stochastic model to determine the number of spare vehicles that should be kept in the pre-assembly buffer to restore the altered sequence due to paint defects and upstream department constraints. First stage of the model decides the spare vehicle quantities, where the second stage model recovers the scrambled sequence respect to pre-defined rules. The problem is solved by sample average approximation (SAA) algorithm. We conduct a numerical study to compare the solutions of heuristic model with optimal ones and provide following insights: (i) as the mismatch between paint entrance and scheduled sequence decreases, the rule-based heuristic model recovers the scrambled sequence as good as the optimal resequencing model, (ii) the rule-based model is more sensitive to the mismatch between the paint entrance and scheduled sequences for recovering the scrambled sequence, (iii) as the defect rate increases, the difference in recovery effectiveness between rule-based heuristic and optimal solutions increases, (iv) as buffer capacity increases, the recovery effectiveness of the optimization model outperforms heuristic model, (v) as expected the rule-based model holds more inventory than the optimization model.

Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

PubMed

Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

2008-04-30

The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

Recognition of the Xenopus ribosomal core promoter by the transcription factor xUBF involves multiple HMG box domains and leads to an xUBF interdomain interaction.

PubMed

Leblanc, B; Read, C; Moss, T

1993-02-01

The interaction of the ribosomal transcription factor xUBF with the RNA polymerase I core promoter of Xenopus laevis has been studied both at the DNA and protein levels. It is shown that a single xUBF-DNA complex forms over the 40S initiation site (+1) and involves at least the DNA sequences between -20 and +60 bp. DNA sequences upstream of +10 and downstream of +18 are each sufficient to direct complex formation independently. HMG box 1 of xUBF independently recognizes the sequences -20 to -1 and +1 to +22 and the addition of the N-terminal dimerization domain to HMG box 1 stabilizes its interaction with these sequences approximately 10-fold. HMG boxes 2/3 interact with the DNA downstream of +22 and can independently position xUBF across the initiation site. The C-terminal segment of xUBF, HMG boxes 4, 5 or the acidic domain, directly or indirectly interact with HMG box 1, making the core promoter sequences between -11 and -15 hypersensitive to DNase. This interaction also requires the DNA sequences between +17 and +32, i.e. the HMG box 2/3 binding site. The data suggest extensive folding of the core promoter within the xUBF complex.

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

PubMed Central

Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

2008-01-01

Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of the enzyme. PMID:18442387

An Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat.

PubMed

Kenney, S; Kamine, J; Markovitz, D; Fenrick, R; Pagano, J

1988-03-01

Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, we demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses.

Development of a Tightly Controlled Off Switch for Saccharomyces cerevisiae Regulated by Camphor, a Low-Cost Natural Product

PubMed Central

Ikushima, Shigehito; Zhao, Yu; Boeke, Jef D.

2015-01-01

Here we describe the engineering of a distant homolog of the Tet repressor, CamR, isolated from Pseudomonas putida, that is regulated by camphor, a very inexpensive small molecule (at micromolar concentrations) for use in Saccharomyces cerevisiae. The repressor was engineered by expression from a constitutive yeast promoter, fusion to a viral activator protein cassette, and codon optimization. A suitable promoter responsive to the CamR fusion protein was engineered by embedding a P. putida operator binding sequence within an upstream activating sequence (UAS)-less CYC1 promoter from S. cerevisiae. The switch, named the Camphor-Off switch, activates expression of a reporter gene in camphor-free media and represses it with micromolar concentrations of camphor. PMID:26206350

Characterization of a highly polymorphic region 5′ to JH in the human immunoglobulin heavy chain

PubMed Central

Silva, Alcino J.; Johnson, John P.; White, Raymond L.

1987-01-01

A cloned DNA segment 1.25 kilobases (kb) upstream from the joining segments of the human heavy chain immunoglobulin gene revealed extensive polymorphic variation at this locus, and the polymorphic pattern was stably transmitted to the next generation. Genomic restriction analysis showed that the polymorphism was caused by insertions/deletions within an MspI/BamHI fragment. Sequencing of one allele, 848 base pairs (bp) long, revealed eleven 50-base-pair tandem repeats. A second allele, 648 bp long, was cloned from a human genomic cosmid library, sequenced, and found to contain four fewer repeats than the first allele. A survey of 186 chromosomes from unrelated individuals of primarily northern European descent revealed at least six alleles. Images PMID:2884636

The memory is in the details: relations between memory for the specific features of events and long-term recall during infancy.

PubMed

Bauer, Patricia J; Lukowski, Angela F

2010-09-01

The second year of life is marked by pronounced changes in the length of time over which events are remembered. We tested whether the age-related differences are related to differences in memory for the specific features of events. In our study, 16- and 20-month-olds were tested for immediate and long-term recall of individual actions and temporal order of actions of three-step sequences in an elicited imitation paradigm as well as for forced-choice recognition of the specific feature of the props used to produce the sequences. Memory for the props was related to long-term recall of the events only for the 20-month-olds. It accounted for unique variance above and beyond the variance explained by immediate recall of the individual actions and the temporal order of actions of the sequences. The different pattern of relations in the older and younger infants seemingly reflects a developmental difference in the determinants of long-term recall over the second year of life. Copyright 2010 Elsevier Inc. All rights reserved.

Immediate Placement of Ultrawide-Diameter Implants in Molar Sockets: Description of a Recommended Technique.

PubMed

Hattingh, André C; De Bruyn, Hugo; Ackermann, Andrew; Vandeweghe, Stefan

Immediate implant placement is performed less frequently in molar extraction sockets than in single root sockets. This is mainly due to the tripodal anatomical configuration of molar roots, which is perceived as complex and therefore unsuitable. The mechanical burden of molar sites, combined with much larger socket dimensions, make it amenable to the use of ultrawide-diameter dental implants. This article describes a practical, sequenced technique that can be used predictably for immediate implant placement in maxillary and mandibular first molar sockets, using a dry skull model for clarification. This detailed description is based on the experience of more than 580 clinical cases over a 10-year period.

Use of the multipurpose transposon Tn KPK2 for the mutational analysis of chromosomal regions upstream and downstream of the sipF gene in Bradyrhizobium japonicum.

PubMed

Müller, P

2004-04-01

The DNA regions upstream and downstream of the Bradyrhizobium japonicum gene sipF were cloned by in vivo techniques and subsequently sequenced. In order to study the function of the predicted genes, a new transposon for in vitro mutagenesis, Tn KPK2, was constructed. This mutagenesis system has a number of advantages over other transposons. Tn KPK2 itself has no transposase gene, making transposition events stable. Extremely short inverted repeats minimize the length of the transposable element and facilitate the determination of the nucleotide sequence of the flanking regions. Since the transposable element carries a promoterless ' phoA reporter gene, the appearance of functional PhoA fusion proteins indicates that Tn KPK2 has inserted in a gene encoding a periplasmic or secreted protein. Although such events are extremely rare, because the transposon has to insert in-frame, in the correct orientation, and at an appropriate location in the target molecule, a direct screening procedure on agar indicator plates permits the identification of candidate clones from large numbers of colonies. In this study, Tn KPK2 was used for the construction of various symbiotic mutants of B. japonicum. One of the mutant strains, A2-10, which is defective in a gene encoding a protein that comigrates with bacterioferritin ( bcpB), was found to induce the formation of small and ineffective nodules.

Abundance and functional diversity of riboswitches in microbial communities

PubMed Central

Kazanov, Marat D; Vitreschak, Alexey G; Gelfand, Mikhail S

2007-01-01

Background Several recently completed large-scale enviromental sequencing projects produced a large amount of genetic information about microbial communities ('metagenomes') which is not biased towards cultured organisms. It is a good source for estimation of the abundance of genes and regulatory structures in both known and unknown members of microbial communities. In this study we consider the distribution of RNA regulatory structures, riboswitches, in the Sargasso Sea, Minnesota Soil and Whale Falls metagenomes. Results Over three hundred riboswitches were found in about 2 Gbp metagenome DNA sequences. The abundabce of riboswitches in metagenomes was highest for the TPP, B12 and GCVT riboswitches; the S-box, RFN, YKKC/YXKD, YYBP/YKOY regulatory elements showed lower but significant abundance, while the LYS, G-box, GLMS and YKOK riboswitches were rare. Regions downstream of identified riboswitches were scanned for open reading frames. Comparative analysis of identified ORFs revealed new riboswitch-regulated functions for several classes of riboswitches. In particular, we have observed phosphoserine aminotransferase serC (COG1932) and malate synthase glcB (COG2225) to be regulated by the glycine (GCVT) riboswitch; fatty acid desaturase ole1 (COG1398), by the cobalamin (B12) riboswitch; 5-methylthioribose-1-phosphate isomerase ykrS (COG0182), by the SAM-riboswitch. We also identified conserved riboswitches upstream of genes of unknown function: thiamine (TPP), cobalamine (B12), and glycine (GCVT, upstream of genes from COG4198). Conclusion This study demonstrates applicability of bioinformatics to the analysis of RNA regulatory structures in metagenomes. PMID:17908319

Scapula development is governed by genetic interactions of Pbx1 with its family members and with Emx2 via their cooperative control of Alx1

PubMed Central

Capellini, Terence D.; Vaccari, Giulia; Ferretti, Elisabetta; Fantini, Sebastian; He, Mu; Pellegrini, Massimo; Quintana, Laura; Di Giacomo, Giuseppina; Sharpe, James; Selleri, Licia; Zappavigna, Vincenzo

2010-01-01

The genetic pathways underlying shoulder blade development are largely unknown, as gene networks controlling limb morphogenesis have limited influence on scapula formation. Analysis of mouse mutants for Pbx and Emx2 genes has suggested their potential roles in girdle development. In this study, by generating compound mutant mice, we examined the genetic control of scapula development by Pbx genes and their functional relationship with Emx2. Analyses of Pbx and Pbx1;Emx2 compound mutants revealed that Pbx genes share overlapping functions in shoulder development and that Pbx1 genetically interacts with Emx2 in this process. Here, we provide a biochemical basis for Pbx1;Emx2 genetic interaction by showing that Pbx1 and Emx2 can bind specific DNA sequences as heterodimers. Moreover, the expression of genes crucial for scapula development is altered in these mutants, indicating that Pbx genes act upstream of essential pathways for scapula formation. In particular, expression of Alx1, an effector of scapula blade patterning, is absent in all compound mutants. We demonstrate that Pbx1 and Emx2 bind in vivo to a conserved sequence upstream of Alx1 and cooperatively activate its transcription via this potential regulatory element. Our results establish an essential role for Pbx1 in genetic interactions with its family members and with Emx2 and delineate novel regulatory networks in shoulder girdle development. PMID:20627960

Co-expression of the Thermotoga neapolitana aglB gene with an upstream 3'-coding fragment of the malG gene improves enzymatic characteristics of recombinant AglB cyclomaltodextrinase.

PubMed

Lunina, Natalia A; Agafonova, Elena V; Chekanovskaya, Lyudmila A; Dvortsov, Igor A; Berezina, Oksana V; Shedova, Ekaterina N; Kostrov, Sergey V; Velikodvorskaya, Galina A

2007-07-01

A cluster of Thermotoga neapolitana genes participating in starch degradation includes the malG gene of sugar transport protein and the aglB gene of cyclomaltodextrinase. The start and stop codons of these genes share a common overlapping sequence, aTGAtg. Here, we compared properties of expression products of three different constructs with aglB from T. neapolitana. The first expression vector contained the aglB gene linked to an upstream 90-bp 3'-terminal region of the malG gene with the stop codon overlapping with the start codon of aglB. The second construct included the isolated coding sequence of aglB with two tandem potential start codons. The expression product of this construct in Escherichia coli had two tandem Met residues at its N terminus and was characterized by low thermostability and high tendency to aggregate. In contrast, co-expression of aglB and the 3'-terminal region of malG (the first construct) resulted in AglB with only one N-terminal Met residue and a much higher specific activity of cyclomaltodextrinase. Moreover, the enzyme expressed by such a construct was more thermostable and less prone to aggregation. The third construct was the same as the second one except that it contained only one ATG start codon. The product of its expression had kinetic and other properties similar to those of the enzyme with only one N-terminal Met residue.