Sample records for sequences located upstream

  1. A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

    PubMed

    Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

    2015-01-01

    The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

  2. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    PubMed Central

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  3. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  4. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  5. PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

    PubMed Central

    Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

    2008-01-01

    Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

  6. Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

    PubMed

    Berends Sexton, T; Jones, J T; Mullet, J E

    1990-05-01

    A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

  7. Induction of surfactin production in Bacillus subtilis by gsp, a gene located upstream of the gramicidin S operon in Bacillus brevis.

    PubMed Central

    Borchert, S; Stachelhaus, T; Marahiel, M A

    1994-01-01

    The deduced amino acid sequence of the gsp gene, located upstream of the 5' end of the gramicidin S operon (grs operon) in Bacillus brevis, showed a high degree of similarity to the sfp gene product, which is located downstream of the srfA operon in B. subtilis. The gsp gene complemented in trans a defect in the sfp gene (sfpO) and promoted production of the lipopeptide antibiotic surfactin. The functional homology of Gsp and Sfp and the sequence similarity of these two proteins to EntD suggest that the three proteins represent a new class of proteins involved in peptide secretion, in support of a hypothesis published previously (T. H. Grossman, M. Tuckman, S. Ellestad, and M. S. Osburne, J. Bacteriol. 175:6203-6211, 1993). Images PMID:7512553

  8. Improved efficiency in amplification of Escherichia coli o-antigen gene clusters using genome-wide sequence comparison

    USDA-ARS?s Scientific Manuscript database

    Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...

  9. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  10. Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

    PubMed Central

    Graveley, Brenton R.

    2008-01-01

    Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

  11. Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

    PubMed Central

    Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

    2012-01-01

    Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

  12. Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

    PubMed

    Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

    2012-09-01

    Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

    PubMed Central

    SivaRaman, L; Subramanian, S; Thimmappaya, B

    1986-01-01

    Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

  14. Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

    PubMed Central

    Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

    2015-01-01

    Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  16. A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

    PubMed Central

    Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

    2000-01-01

    Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

  17. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    PubMed

    Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

    2013-01-01

    Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liebhaber, S.A.; Weiss, I.; Cash, F.E.

    Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

  19. Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

    PubMed

    Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

    2014-08-01

    30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

  20. Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

    PubMed Central

    Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

    1982-01-01

    The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

  1. Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

    PubMed

    Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

    2013-10-01

    Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

  2. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

    1988-08-01

    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

  3. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchman, A.R.; Kimmerly, W.J.; Rine, J.

    1988-01-01

    Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

  4. Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations.

    PubMed

    Nadjar-Boger, Elisabeth; Funkenstein, Bruria

    2011-02-01

    Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.

  5. The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsugu, H.; Horowitz, R.; Gibson, N.

    1994-12-01

    Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

  6. Two novel heat shock genes encoding proteins produced in response to heterologous protein expression in Escherichia coli.

    PubMed Central

    Allen, S P; Polazzi, J O; Gierse, J K; Easton, A M

    1992-01-01

    In Escherichia coli high-level production of some heterologous proteins (specifically, human prorenin, renin, and bovine insulin-like growth factor 2) resulted in the induction of two new E. coli heat shock proteins, both of which have molecular masses of 16 kDa and are tightly associated with inclusion bodies formed during heterologous protein production. We named these inclusion body-associated proteins IbpA and IbpB. The coding sequences for IbpA and IbpB were identified and isolated from the Kohara E. coli gene bank. The genes for these proteins (ibpA and ibpB) are located at 82.5 min on the chromosome. Nucleotide sequencing of the two genes revealed that they are transcribed in the same direction and are separated by 110 bp. Putative Shine-Dalgarno sequences are located upstream from the initiation codons of both genes. A putative heat shock promoter is located upstream from ibpA, and a putative transcription terminator is located downstream from ibpB. A temperature upshift experiment in which we used a wild-type E. coli strain and an isogenic rpoH mutant strain indicated that a sigma 32-containing RNA polymerase is involved in the regulation of expression of these genes. There is 57.5% identity between the genes at the nucleotide level and 52.2% identity at the amino acid level. A search of the protein data bases showed that both of these 16-kDa proteins exhibit low levels of homology to low-molecular-weight heat shock proteins from eukaryotic species. Images PMID:1356969

  7. Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression.

    PubMed

    Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

    2008-04-08

    The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.

  8. A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

    PubMed

    Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

    1994-12-01

    We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

  9. Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

    PubMed Central

    Lo, W Y; Ting, L P

    1994-01-01

    Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

  10. Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

    PubMed

    Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

    2005-08-01

    The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

  11. Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

    PubMed Central

    Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

    2005-01-01

    The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

  12. In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

    PubMed Central

    Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

    2011-01-01

    To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

  13. Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

    PubMed Central

    Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

    2014-01-01

    The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kennedy, M.A.; Morris, C.M.; Fitzgerald, P.H.

    The human kappa deleting element (Kde) mediates loss of CK and JK genes in B cells. A probe for Kde detects two genomic sequences on Southern blots. The Kde is located 24kb 3{prime} to CK, but the position of the homologous sequence is unknown. The authors in situ hybridized m141-2 to metaphase cells of JC11, a B-cell line bearing a t(2;14)(p11;q32) in which the chromosome 2 breakpoint is within JK or the VK-JK intron. Three peaks of labelled sites were obtained. Southern analysis of BamH1 digested DNA showed that Kde (14kb) and the homologous sequence (3kb) were both intact. Kdemore » accounts for hybridization to 14q+ and the 2p- signal presumably derives from the related sequence. This locates the sequence homologous to Kde upstream from JK, possibly within the VK cluster, and may reflect transposition or some other duplicative event as proposed for the evolution of other regions of the kappa locus.« less

  15. DNA methylation inhibits expression and transposition of the Neurospora Tad retrotransposon.

    PubMed

    Zhou, Y; Cambareri, E B; Kinsey, J A

    2001-06-01

    Tad is a LINE-like retrotransposon of the filamentous fungus Neurospora crassa. We have analyzed both expression and transposition of this element using strains with a single copy of Tad located in the 5' noncoding sequences of the am (glutamate dehydrogenase) gene. Tad in this position has been shown to carry a de novo cytosine methylation signal which causes reversible methylation of both Tad and am upstream sequences. Here we find that methylation of the Tad sequences inhibits both Tad expression and transposition. This inhibition can be relieved by the use of 5-azacytidine, a drug which reduces cytosine methylation, or by placing the Tad/am sequences in a dim-2 genetic background.

  16. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

    PubMed

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

    1994-05-01

    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  17. Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression

    PubMed Central

    Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

    2008-01-01

    The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located ≈2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation. PMID:18385377

  18. End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

    PubMed

    Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

    2015-12-01

    Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

  19. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  20. Sequences required for transcription termination at the intrinsic lambdatI terminator.

    PubMed

    Martínez-Trujillo, Miguel; Sánchez-Trujillo, Alejandra; Ceja, Víctor; Avila-Moreno, Federico; Bermúdez-Cruz, Rosa María; Court, Donald; Montañez, Cecilia

    2010-02-01

    The lambdatI terminator is located approximately 280 bp beyond the lambdaint gene, and it has a typical structure of an intrinsic terminator. To identify sequences required for lambdatI transcription termination a set of deletion mutants were generated, either from the 5' or the 3' end onto the lambdatI region. The termination efficiency was determined by measuring galactokinase (galK) levels by Northern blot assays and by in vitro transcription termination. The importance of the uridines and the stability of the stem structure in the termination were demonstrated. The nontranscribed DNA beyond the 3' end also affects termination. Additionally, sequences upstream have a small effect on transcription termination. The in vivo RNA termination sites at lambdatI were determined by S1 mapping and were located at 8 different positions. Processing of transcripts from the 3' end confirmed the importance of the hairpin stem in protection against exonuclease.

  1. A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

    PubMed

    Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

    2013-12-01

    The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  2. Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

    PubMed

    Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

    2018-04-01

    In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

    PubMed

    Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

    2013-06-21

    Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

  4. The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

    PubMed

    Neuhaus, H; Link, G

    1987-01-01

    The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

  5. Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

    PubMed

    Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

    2000-05-31

    cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

  6. Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

    PubMed

    Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

    1991-11-20

    A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

  7. Kin28 regulates the transient association of Mediator with core promoters.

    PubMed

    Jeronimo, Célia; Robert, François

    2014-05-01

    Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

  8. Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

    PubMed

    Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

    2016-03-18

    Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

  9. Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

    PubMed Central

    Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

    2010-01-01

    Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

  10. Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.

    PubMed

    Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning

    2016-08-01

    miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.

  11. The REP2 Repeats of the Genome of Neisseria meningitidis Are Associated with Genes Coordinately Regulated during Bacterial Cell Interaction

    PubMed Central

    Morelle, Sandrine; Carbonnelle, Etienne; Nassif, Xavier

    2003-01-01

    Interaction with host cells is essential in meningococcal pathogenesis especially at the blood-brain barrier. This step is likely to involve a common regulatory pathway allowing coordinate regulation of genes necessary for the interaction with endothelial cells. The analysis of the genomic sequence of Neisseria meningitidis Z2491 revealed the presence of many repeats. One of these, designated REP2, contains a −24/−12 type promoter and a ribosome binding site 5 to 13 bp before an ATG. In addition most of these REP2 sequences are located immediately upstream of an ORF. Among these REP2-associated genes are pilC1 and crgA, described as being involved in steps essential for the interaction of N. meningitidis with host cells. Furthermore, the REP2 sequences located upstream of pilC1 and crgA correspond to the previously identified promoters known to be induced during the initial localized adhesion of N. meningitidis with human cells. This characteristic led us to hypothesize that at least some of the REP2-associated genes were upregulated under the same circumstances as pilC1 and crgA. Quantitative PCR in real time demonstrated that the expression of 14 out of 16 REP2-associated genes were upregulated during the initial localized adhesion of N. meningitidis. Taken together, these data suggest that these repeats control a set of genes necessary for the efficient interaction of this pathogen with host cells. Subsequent mutational analysis was performed to address the role of these genes during meningococcus-cell interaction. PMID:12670987

  12. Kin28 regulates the transient association of Mediator with core promoters

    PubMed Central

    Jeronimo, Célia; Robert, François

    2014-01-01

    Mediator is an essential, broadly utilized eukaryotic transcriptional co-activator. How and what it communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence (UAS), upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity, or in cells where the RNAPII C-terminal domain (CTD) is mutated to replace Ser5 with alanines, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is quickly released from promoters upon Ser5 phosphorylation by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter. PMID:24704787

  13. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

    PubMed Central

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

  14. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

    PubMed

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

  15. Genomic structure of two ras family genes in the slime mold Physarum polycephalum.

    PubMed

    Trzcińska-Danielewicz, Joanna; Kozlowski, Piotr; Gierdal, Katarzyna; Wiejak, Jolanta; Jagielski, Adam; Toczko, Kazimierz; Fronk, Jan

    2002-08-01

    Genomic structure of two Physarum polycephalum ras family genes, Ppras2 and Pprap1, has been determined, including the upstream region of the latter. The genes are interrupted by three and four introns, respectively. The first intron of Ppras2 has the same location within the coding sequence as the first intron in another ras homolog from this organism, Ppras1 [Trzcińska-Danielewicz, J., Kozlowski, P., and Toczko, K. (1996). "Cloning and genomic sequence of the Physarum polycephalum Ppras1 gene, a homologue of the ras protooncogene", Gene 169, pp. 143-144]. All introns, ranging from 53 to ca. 460 base pairs, have the canonical 5' and 3' ends, are greatly enriched in pyrimidines in the coding strand and have frequent pyrimidines-only tracts. These latter features seem to be responsible for the difficulties in cloning and sequencing of parts of these genes. Short sequences shared with P. polycephalum transposon-like repeats are common in the introns, indicating a possible role of transposition in intron evolution. In all three ras family genes phase zero introns are located mostly between sequences coding for regular protein secondary structure elements.

  16. DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1.

    PubMed

    Choudhary, M; Kaplan, S

    2000-02-15

    This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1 (T). The photosynthesis gene cluster is located within a approximately 73 kb Ase I genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The data were compared with the corresponding genes/ORFs from a different strain of R.sphaeroides and Rhodobacter capsulatus, a close relative of R. sphaeroides. A detailed analysis of the gene organization in the photosynthesis region revealed a similar gene order in both species with some notable differences located to the pucBAC = cycA region. In addition, photosynthesis gene regulatory protein (PpsR, FNR, IHF) binding motifs in upstream sequences of a number of photosynthesis genes have been identified and shown to differ between these two species. The difference in gene organization relative to pucBAC and cycA suggests that this region originated independently of the photosynthesis gene cluster of R.sphaeroides.

  17. Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

    PubMed Central

    Kyöstiö, S R; Cramer, C L; Lacy, G H

    1991-01-01

    The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

  18. Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

    PubMed Central

    Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

    1984-01-01

    Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

  19. Transcription of two adjacent carbohydrate utilization gene clusters in Bifidobacterium breve UCC2003 is controlled by LacI- and repressor open reading frame kinase (ROK)-type regulators.

    PubMed

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe

    2014-06-01

    Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.

  20. Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

    PubMed

    Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

    2007-08-01

    To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

  1. Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

    PubMed

    Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

    1987-12-08

    The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

  2. The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

    PubMed Central

    Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

    1988-01-01

    cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

  3. The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

    PubMed Central

    Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

    2008-01-01

    Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163

  4. Identification of a Novel Transcript and Regulatory Mechanism for Microsomal Triglyceride Transfer Protein

    PubMed Central

    Suzuki, Takashi; Brown, Judy J.; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is essential for the assembly of triglyceride-rich apolipoprotein B-containing lipoproteins. Previous studies in our laboratory identified a novel splice variant of MTP in mice that we named MTP-B. MTP-B has a unique first exon (1B) located 2.7 kB upstream of the first exon (1A) for canonical MTP (MTP-A). The two mature isoforms, though nearly identical in sequence and function, have different tissue expression patterns. In this study we report the identification of a second MTP splice variant (MTP-C), which contains both exons 1B and 1A. MTP-C is expressed in all the tissues we tested. In cells transfected with MTP-C, protein expression was less than 15% of that found when the cells were transfected with MTP-A or MTP-B. In silico analysis of the 5’-UTR of MTP-C revealed seven ATGs upstream of the start site for MTP-A, which is the only viable start site in frame with the main coding sequence. One of those ATGs was located in the 5’-UTR for MTP-A. We generated reporter constructs in which the 5’-UTRs of MTP-A or MTP-C were inserted between an SV40 promoter and the coding sequence of the luciferase gene and transfected these constructs into HEK 293 cells. Luciferase activity was significantly reduced by the MTP-C 5’-UTR, but not by the MTP-A 5’-UTR. We conclude that alternative splicing plays a key role in regulating MTP expression by introducing unique 5’-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP levels and activity. PMID:26771188

  5. The Oenococcus oeni clpX Homologue Is a Heat Shock Gene Preferentially Expressed in Exponential Growth Phase

    PubMed Central

    Jobin, Michel-Philippe; Garmyn, Dominique; Diviès, Charles; Guzzo, Jean

    1999-01-01

    Using degenerated primers from conserved regions of previously studied clpX gene products, we cloned the clpX gene of the malolactic bacterium Oenococcus oeni. The clpX gene was sequenced, and the deduced protein of 413 amino acids (predicted molecular mass of 45,650 Da) was highly similar to previously analyzed clpX gene products from other organisms. An open reading frame located upstream of the clpX gene was identified as the tig gene by similarity of its predicted product to other bacterial trigger factors. ClpX was purified by using a maltose binding protein fusion system and was shown to possess an ATPase activity. Northern analyses indicated the presence of two independent 1.6-kb monocistronic clpX and tig mRNAs and also showed an increase in clpX mRNA amount after a temperature shift from 30 to 42°C. The clpX transcript is abundant in the early exponential growth phase and progressively declines to undetectable levels in the stationary phase. Thus, unlike hsp18, the gene encoding one of the major small heat shock proteins of Oenococcus oeni, clpX expression is related to the exponential growth phase and requires de novo protein synthesis. Primer extension analysis identified the 5′ end of clpX mRNA which is located 408 nucleotides upstream of a putative AUA start codon. The putative transcription start site allowed identification of a predicted promoter sequence with a high similarity to the consensus sequence found in the housekeeping gene promoter of gram-positive bacteria as well as Escherichia coli. PMID:10542163

  6. The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

    PubMed Central

    Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

    1980-01-01

    Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

  7. Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

    PubMed

    Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

    2008-06-01

    The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

  8. Position-specific binding of FUS to nascent RNA regulates mRNA length

    PubMed Central

    Masuda, Akio; Takeda, Jun-ichi; Okuno, Tatsuya; Okamoto, Takaaki; Ohkawara, Bisei; Ito, Mikako; Ishigaki, Shinsuke; Sobue, Gen

    2015-01-01

    More than half of all human genes produce prematurely terminated polyadenylated short mRNAs. However, the underlying mechanisms remain largely elusive. CLIP-seq (cross-linking immunoprecipitation [CLIP] combined with deep sequencing) of FUS (fused in sarcoma) in neuronal cells showed that FUS is frequently clustered around an alternative polyadenylation (APA) site of nascent RNA. ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing) of RNA polymerase II (RNAP II) demonstrated that FUS stalls RNAP II and prematurely terminates transcription. When an APA site is located upstream of an FUS cluster, FUS enhances polyadenylation by recruiting CPSF160 and up-regulates the alternative short transcript. In contrast, when an APA site is located downstream from an FUS cluster, polyadenylation is not activated, and the RNAP II-suppressing effect of FUS leads to down-regulation of the alternative short transcript. CAGE-seq (cap analysis of gene expression [CAGE] combined with deep sequencing) and PolyA-seq (a strand-specific and quantitative method for high-throughput sequencing of 3' ends of polyadenylated transcripts) revealed that position-specific regulation of mRNA lengths by FUS is operational in two-thirds of transcripts in neuronal cells, with enrichment in genes involved in synaptic activities. PMID:25995189

  9. Pea chloroplast tRNA(Lys) (UUU) gene: transcription and analysis of an intron-containing gene.

    PubMed

    Boyer, S K; Mullet, J E

    1988-07-01

    The pea chloroplast trnK gene which encodes tRNA(Lys) (UUU) was sequenced. TrnK is located 210 bp upstream from the promoter of psbA and immediately downstream from the 3'-end of rbcL. The gene is transcribed from the same DNA strand as psbA and rbcL. A 2447 bp intron with class II features is located in the trnK anticodon loop. The intron contains a 506 amino acid open reading frame which could encode an RNA maturase. The primary transcript of trnK is 2.9 kb long; its 5'-end was identified as a site of transcription initiation by in vitro transcription experiments. The 5'-terminus is adjacent to DNA sequences previously identified as transcription promoter elements. The most abundant trnK transcript is 2.5 kb long with termini corresponding to the 5' and 3' ends of the trnK exons. Intron specific RNAs were not detected. This suggests that RNA processing which produces tRNA(Lys) leads to rapid degradation of intron sequences.

  10. Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

    PubMed

    Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

    1987-01-01

    The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

  11. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  12. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    PubMed

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  13. Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

    PubMed

    Fahrner, Karen A; Berg, Howard C

    2015-10-01

    Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).

    PubMed

    Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko

    2010-02-01

    GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.

  15. Transcription of Two Adjacent Carbohydrate Utilization Gene Clusters in Bifidobacterium breve UCC2003 Is Controlled by LacI- and Repressor Open Reading Frame Kinase (ROK)-Type Regulators

    PubMed Central

    O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert

    2014-01-01

    Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323

  16. Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

    PubMed Central

    Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

    2008-01-01

    Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

  17. Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

    PubMed

    Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

    2008-04-28

    In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

  18. The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

    PubMed Central

    White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

    1991-01-01

    By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

  19. Motif types, motif locations and base composition patterns around the RNA polyadenylation site in microorganisms, plants and animals

    PubMed Central

    2014-01-01

    Background The polyadenylation of RNA is critical for gene functioning, but the conserved sequence motifs (often called signal or signature motifs), motif locations and abundances, and base composition patterns around mRNA polyadenylation [poly(A)] sites are still uncharacterized in most species. The evolutionary tendency for poly(A) site selection is still largely unknown. Results We analyzed the poly(A) site regions of 31 species or phyla. Different groups of species showed different poly(A) signal motifs: UUACUU at the poly(A) site in the parasite Trypanosoma cruzi; UGUAAC (approximately 13 bases upstream of the site) in the alga Chlamydomonas reinhardtii; UGUUUG (or UGUUUGUU) at mainly the fourth base downstream of the poly(A) site in the parasite Blastocystis hominis; and AAUAAA at approximately 16 bases and approximately 19 bases upstream of the poly(A) site in animals and plants, respectively. Polyadenylation signal motifs are usually several hundred times more abundant around poly(A) sites than in whole genomes. These predominant motifs usually had very specific locations, whether upstream of, at, or downstream of poly(A) sites, depending on the species or phylum. The poly(A) site was usually an adenosine (A) in all analyzed species except for B. hominis, and there was weak A predominance in C. reinhardtii. Fungi, animals, plants, and the protist Phytophthora infestans shared a general base abundance pattern (or base composition pattern) of “U-rich—A-rich—U-rich—Poly(A) site—U-rich regions”, or U-A-U-A-U for short, with some variation for each kingdom or subkingdom. Conclusion This study identified the poly(A) signal motifs, motif locations, and base composition patterns around mRNA poly(A) sites in protists, fungi, plants, and animals and provided insight into poly(A) site evolution. PMID:25052519

  20. Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

    PubMed Central

    Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

    1984-01-01

    We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

  1. Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, C.H.; Wei, Li-Na; Copeland, N.G.

    We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less

  2. Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

    PubMed Central

    Robson, Nicole D.; Telesnitsky, Alice

    2000-01-01

    Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

  3. Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

    PubMed

    Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

    2016-03-01

    Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

  4. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    PubMed

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  5. Tobacco chloroplast tRNALys(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron

    PubMed Central

    Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro

    1985-01-01

    The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561

  6. Tobacco chloroplast tRNA(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron.

    PubMed

    Sugita, M; Shinozaki, K; Sugiura, M

    1985-06-01

    The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.

  7. Suspended-sediment loads, reservoir sediment trap efficiency, and upstream and downstream channel stability for Kanopolis and Tuttle Creek Lakes, Kansas, 2008-10

    USGS Publications Warehouse

    Juracek, Kyle E.

    2011-01-01

    Continuous streamflow and turbidity data collected from October 1, 2008, to September 30, 2010, at streamgage sites upstream and downstream from Kanopolis and Tuttle Creek Lakes, Kansas, were used to compute the total suspended-sediment load delivered to and released from each reservoir as well as the sediment trap efficiency for each reservoir. Ongoing sedimentation is decreasing the ability of the reservoirs to serve several purposes including flood control, water supply, and recreation. River channel stability upstream and downstream from the reservoirs was assessed using historical streamgage information. For Kanopolis Lake, the total 2-year inflow suspended-sediment load was computed to be 600 million pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 31 million pounds. Sediment trap efficiency for the reservoir was estimated to be 95 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 129,000 pounds per square mile per year. No pronounced changes in channel width were evident at five streamgage sites located upstream from the reservoir. At the Ellsworth streamgage site, located upstream from the reservoir, long-term channel-bed aggradation was followed by a period of stability. Current (2010) conditions at five streamgages located upstream from the reservoir were typified by channel-bed stability. At the Langley streamgage site, located immediately downstream from the reservoir, the channel bed degraded 6.15 feet from 1948 to 2010. For Tuttle Creek Lake, the total 2-year inflow suspended-sediment load was computed to be 13.3 billion pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 327 million pounds. Sediment trap efficiency for the reservoir was estimated to be 98 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 691,000 pounds per square mile per year. In general, no pronounced changes in channel width were evident at six streamgage sites located upstream from the reservoir. At the Barnes and Marysville streamgage sites, located upstream from the reservoir, long-term channel-bed degradation followed by stability was indicated. At the Frankfort streamgage site, located upstream from the reservoir, channel-bed aggradation of 1.65 feet from 1969 to 1989 followed by channel-bed degradation of 2.4 feet from 1989 to 2010 was indicated and may represent the passage of a sediment pulse caused by historical disturbances (for example, channelization) in the upstream basin. With the exception of the Frankfort streamgage site, current (2010) conditions at four streamgages located upstream from the reservoir were typified by channel-bed stability. At the Manhattan streamgage site, located downstream from the reservoir, high-flow releases associated with the 1993 flood widened the channel about 60 feet (30 percent). The channel bed at this site degraded 4.2 feet from 1960 to 1998 and since has been relatively stable. For the purpose of computing suspended-sediment concentration and load, the use of turbidity data in a regression model can provide more reliable and reproducible estimates than a regression model that uses discharge as the sole independent variable. Moreover, the use of discharge only to compute suspended-sediment concentration and load may result in overprediction. Stream channel banks, compared to channel beds, likely are a more important source of sediment to Kanopolis and Tuttle Creek Lakes from the upstream basins. Other sediment sources include surface-soil erosion in the basins and shoreline erosion in the reservoirs.

  8. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

    NASA Astrophysics Data System (ADS)

    Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

    2005-09-01

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  9. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA.

    PubMed

    Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J

    2005-09-22

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  10. Control of asgE Expression during Growth and Development of Myxococcus xanthus

    PubMed Central

    Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

    2000-01-01

    One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

  11. Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

    PubMed

    Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

    2012-07-01

    The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

    PubMed

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

    2012-05-01

    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  13. Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

    PubMed

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

  14. 3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

    PubMed Central

    Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

    2016-01-01

    Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

  15. Rivers and reciprocity: perceptions and policy on international watercourses

    NASA Astrophysics Data System (ADS)

    Tian, Fuqiang

    2017-04-01

    The paper analyses geopolitical dimensions of the 1997 United Nations Convention on the Law of the NonNavigational Uses of International Watercourses (UNWC) using quantitative data on transboundary flows and qualitative data on basin State location within a watercourse. The UNWC has had a long and difficult history. A tendency for downstream support for, and upstream ambivalence/opposition to, the UNWC is identified. It appears not widely recognized that adverse effects can be caused by any State on other States, regardless of their upstream or downstream location. Thus downstream States consider that their actions cannot harm upstream States, and upstream States consider that the UNWC provides them with greater obligations than downstream States. Clarification of the UNWC with the principle of reciprocal obligations on all States, both upstream and downstream, will remove any ambiguity, correct misperceptions, have clear policy implications for all States, promote UNWC engagement of upstream States, and contribute to long-term global water security.

  16. Appearance of the pituitary factor Pit-1 increases chromatin remodeling at hypersensitive site III in the human GH locus.

    PubMed

    Yang, Xiaoyang; Jin, Yan; Cattini, Peter A

    2010-07-01

    Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.

  17. Transcriptional mapping of the varicella-zoster virus regulatory genes encoding open reading frames 4 and 63.

    PubMed Central

    Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E

    1994-01-01

    Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496

  18. Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

    PubMed Central

    Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min

    2012-01-01

    NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166

  19. Photographic copy of drawing by Modjeski and Masters, Engineers of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of drawing by Modjeski and Masters, Engineers of the proposed Huey P. Long Bridge Widening. Original drawing located in the office of Modjeski and Masters, Consulting Engineers at 1055 St. Charles Avenue, New Orleans, LA. 70130. JUNE 30, 2004 DRAWING OF THE PROPOSED HUEY P. LONG BRIDGE WIDENING, U.S. 90, MAIN BRIDGE SUPERSTRUCTURE, SHOWING SEQUENCE OF CONSTRUCTION – 16, STAGE 5 (PLACEMENT OF NEW DECK AND FLOOR SYSTEM) AND STAGE 6. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  20. Photographic copy of drawing by Modjeski and Masters, Engineers of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of drawing by Modjeski and Masters, Engineers of the proposed Huey P. Long Bridge Widening. Original drawing located in the office of Modjeski and Masters, Consulting Engineers at 1055 St. Charles Avenue, New Orleans, LA. 70130. JUNE 30, 2004 DRAWING OF THE PROPOSED HUEY P. LONG BRIDGE WIDENING, U.S. 90, MAIN BRIDGE SUPERSTRUCTURE, SHOWING SEQUENCE OF CONSTRUCTION – 14, STAGE 3 – PHASE 1 AND STAGE 3 – PHASE 2. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  1. Photographic copy of drawing by Modjeski and Masters, Engineers of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of drawing by Modjeski and Masters, Engineers of the proposed Huey P. Long Bridge Widening. Original drawing located in the office of Modjeski and Masters, Consulting Engineers at 1055 St. Charles Avenue, New Orleans, LA. 70130. JUNE 30, 2004 DRAWING OF THE PROPOSED HUEY P. LONG BRIDGE WIDENING, U.S. 90, MAIN BRIDGE SUPERSTRUCTURE, SHOWING SEQUENCE OF CONSTRUCTION – 13, STAGE 1 AND STAGE 2 – PHASE 1 AND STAGE 2 – PHASE 2. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  2. Photographic copy of drawing by Modjeski and Masters, Engineers of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of drawing by Modjeski and Masters, Engineers of the proposed Huey P. Long Bridge Widening. Original drawing located in the office of Modjeski and Masters, Consulting Engineers at 1055 St. Charles Avenue, New Orleans, LA. 70130. JUNE 30, 2004 DRAWING OF THE PROPOSED HUEY P. LONG BRIDGE WIDENING, U.S. 90, MAIN BRIDGE SUPERSTRUCTURE, SHOWING SEQUENCE OF CONSTRUCTION – 15, STAGE 4 AND STAGE 5 (DECK AND FLOOR SYSTEM REMOVAL). - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  3. Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

    PubMed Central

    Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

    2007-01-01

    Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

  4. The silent mutation MLH1 c.543C>T resulting in aberrant splicing can cause Lynch syndrome: a case report.

    PubMed

    Yamaguchi, Tatsuro; Wakatsuki, Tomokazu; Kikuchi, Mari; Horiguchi, Shin-Ichiro; Akagi, Kiwamu

    2017-06-01

    The proband was a 67-year-old man with transverse and sigmoid colon cancer. Microsatellite instability analysis revealed a high frequency of microsatellite instability, and immunohistochemical staining showed the absence of both MLH1 and PMS2 proteins in the sigmoid colon cancer tissue specimens from the patient. DNA sequencing revealed a nucleotide substitution c.543C>T in MLH1, but this variant did not substitute an amino acid. The MLH1 c.543C>T variant was located 3 bases upstream from the end of exon 6 and created a new splice donor site 4 bases upstream from the end of exon 6. Consequently, the last 4 bases of exon 6 were deleted and frameshift occurred. Thus, the MLH1 c.543C>T silent mutation is considered 'pathogenic'. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. A murC gene from coryneform bacteria.

    PubMed

    Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K

    1999-02-01

    The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.

  6. Sequence diversity of hepatitis C virus 6a within the extended interferon sensitivity-determining region correlates with interferon-alpha/ribavirin treatment outcomes.

    PubMed

    Zhou, Daniel X M; Chan, Paul K S; Zhang, Tiejun; Tully, Damien C; Tam, John S

    2010-10-01

    Studies on the association between sequence variability of the interferon sensitivity-determining region (ISDR) of hepatitis C virus and the outcome of treatment have reached conflicting results. In this study, 25 patients infected with HCV 6a who had received interferon-alpha/ribavirin combination treatment were analyzed for the sequence variations. 14 of them had the full genome sequences obtained from a previous study, whereas the other 11 samples were sequenced for the extended ISDR (eISDR). This eISDR fragment covers 192 bp (64 amino acids) upstream and 201 bp (67 amino acids) downstream from the ISDR previously defined for HCV 1b. The comparison between interferon-alpha resistance and response groups for the amino acid mutations located in the full genome (6 and 8 patients respectively) as well as the mutations located in the eISDR (10 and 15 patients respectively) showed that the mutations I2160V, I2256V, V2292I (P<0.05) within eISDR were significantly associated with resistance to treatment. However, the extent of amino acid variations within previously defined ISDR was not associated with resistance to treatment as previously reported. Four amino acid variations I248V (P=0.03-0.06) within E1, R445K (P=0.02-0.05) and S747T (P=0.03) within E2, I861V (P=0.01) within NS2 which located outside the eISDR may also associate with treatment outcome as identified by a prescreening of variations within 14 HCV 6a full genomes. (c) 2010 Elsevier B.V. All rights reserved.

  7. Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.

    PubMed

    Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P

    2011-09-26

    HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.

  8. Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

    PubMed Central

    2011-01-01

    Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362

  9. VIEW OF LOCATION OF CHILDS POWER PLANT (SHOWING POWERHOUSE AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW OF LOCATION OF CHILDS POWER PLANT (SHOWING POWERHOUSE AND TRANSFORMER FRAMEWORK AT LEFT, BELOW POWER LINES AND THE MAINTENANCE AND RESIDENTIAL COMPOUND UPSTREAM TO RIGHT) ALONG VERDE RIVER FROM FS ROAD #502. LOOKING UPSTREAM (WEST-SOUTHWEST) - Childs-Irving Hydroelectric Project, Forest Service Road 708/502, Camp Verde, Yavapai County, AZ

  10. Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

    PubMed

    Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

    2016-01-04

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

    PubMed Central

    Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

    2015-01-01

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

  12. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    PubMed

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  13. Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene

    PubMed Central

    Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.

    2014-01-01

    Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458

  14. Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

    PubMed

    Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

    2001-06-01

    Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

  15. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

    PubMed

    Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

    1991-09-15

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

  16. The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.

    PubMed

    Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

    2003-02-01

    The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.

  17. Molecular cloning and sequence analysis of the Anticarsia gemmatalis multicapsid nuclear polyhedrosis virus GP64 glycoprotein.

    PubMed

    Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

    2003-01-01

    The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.

  18. Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.

    PubMed Central

    Eriani, G; Dirheimer, G; Gangloff, J

    1989-01-01

    The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891

  19. Profiling microbial community in a watershed heavily contaminated by an active antimony (Sb) mine in Southwest China.

    PubMed

    Sun, Weimin; Xiao, Enzong; Dong, Yiran; Tang, Song; Krumins, Valdis; Ning, Zengping; Sun, Min; Zhao, Yanlong; Wu, Shiliang; Xiao, Tangfu

    2016-04-15

    Located in Southwest China, the Chahe watershed has been severely contaminated by upstream active antimony (Sb) mines. The extremely high concentrations of Sb make the Chahe watershed an excellent model to elucidate the response of indigenous microbial activities within a severe Sb-contaminated environment. In this study, water and surface sediments from six locations in the Chahe watershed with different levels of Sb contamination were analyzed. Illumina sequencing of 16S rRNA amplicons revealed more than 40 phyla from the domain Bacteria and 2 phyla from the domain Archaea. Sequences assigned to the genera Flavobacterium, Sulfuricurvum, Halomonas, Shewanella, Lactobacillus, Acinetobacter, and Geobacter demonstrated high relative abundances in all sequencing libraries. Spearman's rank correlations indicated that a number of microbial phylotypes were positively correlated with different speciation of Sb, suggesting potential roles of these phylotypes in microbial Sb cycling. Canonical correspondence analysis further demonstrated that geochemical parameters, including water temperature, pH, total Fe, sulfate, aqueous Sb, and Eh, significantly structured the overall microbial community in Chahe watershed samples. Our findings offer a direct and reliable reference to the diversity of microbial communities in the presence of extremely high Sb concentrations, and may have potential implications for in situ bioremediation strategies of Sb contaminated sites. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Mechanisms of activation of the paternally expressed genes by the Prader-Willi imprinting center in the Prader-Willi/Angelman syndromes domains

    PubMed Central

    Rabinovitz, Shiri; Kaufman, Yotam; Ludwig, Guy; Razin, Aharon; Shemer, Ruth

    2012-01-01

    The Prader-Willi syndrome/Angelman syndrome (PWS/AS) imprinted domain is regulated by a bipartite imprinting control center (IC) composed of a sequence around the SNRPN promoter (PWS-IC) and a 880-bp sequence located 35 kb upstream (AS-IC). The AS-IC imprint is established during gametogenesis and confers repression upon PWS-IC on the maternal allele. Mutation at PWS-IC on the paternal allele leads to gene silencing across the entire PWS/AS domain. This silencing implies that PWS-IC functions on the paternal allele as a bidirectional activator. Here we examine the mechanism by which PWS-IC activates the paternally expressed genes (PEGs) using transgenes that include the PWS-IC sequence in the presence or absence of AS-IC and NDN, an upstream PEG, as an experimental model. We demonstrate that PWS-IC is in fact an activator of NDN. This activation requires an unmethylated PWS-IC in the gametes and during early embryogenesis. PWS-IC is dispensable later in development. Interestingly, a similar activation of a nonimprinted gene (APOA1) was observed, implying that PWS-IC is a universal activator. To decipher the mechanism by which PWS-IC confers activation of remote genes, we performed methylated DNA immunoprecipitation (MeDIP) array analysis on lymphoblast cell lines that revealed dispersed, rather than continued differential methylation. However, chromatin conformation capture (3c) experiments revealed a physical interaction between PWS-IC and the PEGs, suggesting that activation of PEGs may require their proximity to PWS-IC. PMID:22529396

  1. An upstream sequence modulates phenazine production at the level of transcription and translation in the biological control strain Pseudomonas chlororaphis 30-84

    PubMed Central

    Wang, Dongping; Ries, Tessa R.; Pierson, Leland S.; Pierson, Elizabeth A.

    2018-01-01

    Phenazines are bacterial secondary metabolites and play important roles in the antagonistic activity of the biological control strain P. chlororaphis 30–84 against take-all disease of wheat. The expression of the P. chlororaphis 30–84 phenazine biosynthetic operon (phzXYFABCD) is dependent on the PhzR/PhzI quorum sensing system located immediately upstream of the biosynthetic operon as well as other regulatory systems including Gac/Rsm. Bioinformatic analysis of the sequence between the divergently oriented phzR and phzX promoters identified features within the 5’-untranslated region (5’-UTR) of phzX that are conserved only among 2OHPCA producing Pseudomonas. The conserved sequence features are potentially capable of producing secondary structures that negatively modulate one or both promoters. Transcriptional and translational fusion assays revealed that deletion of 90-bp of sequence at the 5’-UTR of phzX led to up to 4-fold greater expression of the reporters with the deletion compared to the controls, which indicated this sequence negatively modulates phenazine gene expression both transcriptionally and translationally. This 90-bp sequence was deleted from the P. chlororaphis 30–84 chromosome, resulting in 30-84Enh, which produces significantly more phenazine than the wild-type while retaining quorum sensing control. The transcriptional expression of phzR/phzI and amount of AHL signal produced by 30-84Enh also were significantly greater than for the wild-type, suggesting this 90-bp sequence also negatively affects expression of the quorum sensing genes. In addition, deletion of the 90-bp partially relieved RsmE-mediated translational repression, indicating a role for Gac/RsmE interaction. Compared to the wild-type, enhanced phenazine production by 30-84Enh resulted in improvement in fungal inhibition, biofilm formation, extracellular DNA release and suppression of take-all disease of wheat in soil without negative consequences on growth or rhizosphere persistence. This work provides greater insight into the regulation of phenazine biosynthesis with potential applications for improved biological control. PMID:29451920

  2. Void/particulate detector

    DOEpatents

    Claytor, Thomas N.; Karplus, Henry B.

    1985-01-01

    Voids and particulates are detected in a flowing stream of fluid contained in a pipe by a detector which includes three transducers spaced about the pipe. A first transducer at a first location on the pipe transmits an ultrasonic signal into the stream. A second transducer detects the through-transmission of the signal at a second location and a third transducer at a third location upstream from the first location detects the back-scattering of the signal from any voids or particulates. To differentiate between voids and particulates a fourth transducer is positioned at a fourth location which is also upstream from the first location. The back-scattered signals are normalized with the through-transmission signal to minimize temperature fluctuations.

  3. Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

    PubMed Central

    Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

    2005-01-01

    Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

  4. Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

    PubMed Central

    Lloyd, G S; Busby, S J; Savery, N J

    1998-01-01

    During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

  5. Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

    PubMed

    D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

    1995-09-01

    Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

  6. Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

    PubMed

    Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

    2015-08-01

    Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

  7. Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

    PubMed

    Joshee, N; Kisaka, H; Kitagawa, Y

    1998-01-01

    One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

  8. Molecular basis and consequences of a deletion in the amelogenin gene, analyzed by capture PCR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lagerstroem-Fermer, M.; Pettersson, U.; Landegren, U.

    1993-07-01

    A mutation that disrupts the gene for one of the major proteins in tooth enamel has been investigated. The mutation is located in the amelogenin gene and causes X-linked amelogenesis imperfecta, characterized by defective mineralization of tooth enamel. The authors have isolated the breakpoints of a 5-kb deletion in the amelogenin gene on the basis of nucleotide sequence information located upstream of the lesion, using a technique termed capture PCR. The deletion removes five of the seven exons, spanning from the second intron to the last exon. Only the first two codons for the mature protein remain, consistent with themore » relatively severe phenotype of affected individuals in the present family. The mutation appears to have arisen as an illegitimate recombination event since of 11 nucleotide positions immediately surrounding the two breakpoints, 9 are identical. 17 refs., 3 figs., 1 tab.« less

  9. The 14alpha-Demethylasse(CYP51A1) Gene is Overexpressed in Venturia inaequalis Strains Resistant to Myclobutanil.

    PubMed

    Schnabel, G; Jones, A L

    2001-01-01

    ABSTRACT We identified the cytochrome P450 sterol 14alpha-demethylase (CYP51A1) gene from Venturia inaequalis and optional insertions located upstream from CYP51A1 and evaluated their potential role in conferring resistance to the sterol demethylation-inhibitor (DMI) fungicide my-clobutanil. The CYP51A1 gene was completely sequenced from one my-clobutanil sensitive (S) and two myclobutanil-resistant (R) strains. No nucleotide variation was found when the three sequences were aligned. Allele-specific polymerase chain reaction (PCR) analysis indicated that a previously described single base pair mutation that correlated with resistance to DMI fungicides in strains of other filamentous fungi was absent in 19 S and 32 R strains of V. inaequalis from Michigan and elsewhere. The sequencing results and PCR analyses suggest that resistance in these strains was not due to a mutation in the sterol demethylase target site for DMI fungicides. Expression of CYP51A1 was determined for strains from an orchard that had never been sprayed with DMI fungicides (baseline orchard), and the data provided a reference for evaluating the expression of strains collected from a research orchard and from three commercial Michigan apple orchards with a long history of DMI use and a high frequency of R strains. Overexpression of CYP51A1 was significantly higher in 9 of 11 R strains from the research orchard than in S strains from the baseline orchard. The high expression was correlated with the presence of a 553-bp insertion located upstream of CYP51A1. Overexpression of the CYP51A1 gene was also detected in eight of eight, five of nine, and nine of nine R strains from three commercial orchards, but the insertion was not detected in the majority of these strains. The results suggest that overexpression of the target-site CYP51A1 gene is an important mechanism of resistance in some field resistant strains of V. inaequalis, but other mechanisms of resistance also appear to exist.

  10. Sedimentary structures formed under water surface waves: examples from a sediment-laden flash flood observed by remote camer

    NASA Astrophysics Data System (ADS)

    Froude, Melanie; Alexander, Jan; Cole, Paul; Barclay, Jenni

    2014-05-01

    On 13-14 October 2012, Tropical Storm Rafael triggered sediment-laden flash floods in the Belham Valley on Montserrat, West Indies. Rainfall was continuous for ~38 hours and intensity peaked at 48 mm/hr. Flow was strongly unsteady, turbulent with sediment concentrations varying up to hyperconcentrated. Time-lapse images captured at >1 frame per second by remote camera overlooking a surveyed valley section show the development of trains of water surface waves at multiple channel locations during different flow stages. Waves grew and diminished in height and remained stationary or migrated upstream. Trains of waves persisted for <5 minutes, until a single wave broke, sometimes initiating the breaking of adjacent waves within the train. Channel-wide surges (bores) propagating downstream with distinct turbulent flow fronts, were observed at irregular intervals during and up to 7 hours after peak stage. These bores are mechanically similar to breaking front tidal bores and arid flood bores, and resulted in a sudden increase in flow depth and velocity. When a bore front came into close proximity (within ~10 m) upstream of a train of water surface waves, the waves appeared to break simultaneously generating a localised surge of water upstream, that was covered by the bore travelling downstream. Those trains in which waves did not break during the passage of a bore temporarily reduced in height. In both cases, water surface waves reformed immediately after the surge in the same location. Deposits from the event, were examined in <4 m deep trenches ~0.5 km downstream of the remote camera. These contained laterally extensive lenticular and sheet-like units comprised of varying admixtures of sand and gravel that are attributed to antidunes, and associated transitions from upper-stage-plane-beds. Some of the structures are organised within concave upward sequences which contain downflow shifts between foreset and backset laminae; interpreted as trough fills from chute-and-pools or water surface wave breaking. At least 90% of the deposit is interpreted upper flow regime origin. The sequence, geometry and lamina-scale texture of the sedimentary structures will be discussed with reference to remote camera images of rapidly varying, unsteady and pulsatory flow behaviour.

  11. Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

    PubMed

    Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

    2017-03-01

    To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

  12. Conservation of Transcription Start Sites within Genes across a Bacterial Genus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.

    Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less

  13. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

  14. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    PubMed

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  15. Evidence for the negative regulation of phytase gene expression in Streptomyces lividans and Streptomyces coelicolor.

    PubMed

    Boukhris, Ines; Dulermo, Thierry; Chouayekh, Hichem; Virolle, Marie-Joëlle

    2016-01-01

    Sco7697, a gene encoding a phytase, enzyme able to degrade phytate (myo-inositol 1,2,3,4,5,6-hexakis phosphate), the most abundant phosphorus storing compound in plants is present in the genome of S. coelicolor, a soil born bacteria with a saprophytic lifestyle. The expression of this gene was previously shown to be induced in conditions of Pi limitation by the response regulator PhoP binding to an operator sequence, the PHO box, located upstream of the -35 promoter sequence. A close examination of the promoter region of sco7697 revealed the presence of another putative operator site, a Direct Repeat (DR), located downstream of the -10 promoter sequence. In order to determine whether this DR played a role in regulation of sco7697 expression, different variants of the phytase gene promoter region were transcriptionally fused to the ß-glucuronidase reporter gene (GUS). As expected, deletion of the PHO box led to abolition of sco7697 induction in conditions of Pi limitation. Interestingly, alteration of the DR correlated with a dramatic increase of GUS expression but only when PhoP was present. These results demonstrated that this DR is the site of strong negative regulation by an unknown repressor. The latter would impede the necessary activation of phytase expression by PhoP. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

    PubMed Central

    Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

    1990-01-01

    We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

  17. The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

    PubMed Central

    Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

    1982-01-01

    The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

  18. Molecular Characterization of Transgene Integration by Next-Generation Sequencing in Transgenic Cattle

    PubMed Central

    Zhang, Ran; Yin, Yinliang; Zhang, Yujun; Li, Kexin; Zhu, Hongxia; Gong, Qin; Wang, Jianwu; Hu, Xiaoxiang; Li, Ning

    2012-01-01

    As the number of transgenic livestock increases, reliable detection and molecular characterization of transgene integration sites and copy number are crucial not only for interpreting the relationship between the integration site and the specific phenotype but also for commercial and economic demands. However, the ability of conventional PCR techniques to detect incomplete and multiple integration events is limited, making it technically challenging to characterize transgenes. Next-generation sequencing has enabled cost-effective, routine and widespread high-throughput genomic analysis. Here, we demonstrate the use of next-generation sequencing to extensively characterize cattle harboring a 150-kb human lactoferrin transgene that was initially analyzed by chromosome walking without success. Using this approach, the sites upstream and downstream of the target gene integration site in the host genome were identified at the single nucleotide level. The sequencing result was verified by event-specific PCR for the integration sites and FISH for the chromosomal location. Sequencing depth analysis revealed that multiple copies of the incomplete target gene and the vector backbone were present in the host genome. Upon integration, complex recombination was also observed between the target gene and the vector backbone. These findings indicate that next-generation sequencing is a reliable and accurate approach for the molecular characterization of the transgene sequence, integration sites and copy number in transgenic species. PMID:23185606

  19. A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

    PubMed Central

    Clos, J; Buttgereit, D; Grummt, I

    1986-01-01

    A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

  20. Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

    PubMed

    Lin, Min; Dan, Hanhong; Li, Yijing

    2004-02-01

    Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

  1. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    PubMed

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  2. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    PubMed Central

    Rehm, Charlotte; Wurmthaler, Lena A.; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S.

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1–5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6–9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria. PMID:26695179

  3. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G

    1988-01-01

    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  4. Use of the multipurpose transposon Tn KPK2 for the mutational analysis of chromosomal regions upstream and downstream of the sipF gene in Bradyrhizobium japonicum.

    PubMed

    Müller, P

    2004-04-01

    The DNA regions upstream and downstream of the Bradyrhizobium japonicum gene sipF were cloned by in vivo techniques and subsequently sequenced. In order to study the function of the predicted genes, a new transposon for in vitro mutagenesis, Tn KPK2, was constructed. This mutagenesis system has a number of advantages over other transposons. Tn KPK2 itself has no transposase gene, making transposition events stable. Extremely short inverted repeats minimize the length of the transposable element and facilitate the determination of the nucleotide sequence of the flanking regions. Since the transposable element carries a promoterless ' phoA reporter gene, the appearance of functional PhoA fusion proteins indicates that Tn KPK2 has inserted in a gene encoding a periplasmic or secreted protein. Although such events are extremely rare, because the transposon has to insert in-frame, in the correct orientation, and at an appropriate location in the target molecule, a direct screening procedure on agar indicator plates permits the identification of candidate clones from large numbers of colonies. In this study, Tn KPK2 was used for the construction of various symbiotic mutants of B. japonicum. One of the mutant strains, A2-10, which is defective in a gene encoding a protein that comigrates with bacterioferritin ( bcpB), was found to induce the formation of small and ineffective nodules.

  5. Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

    PubMed

    Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

    2005-06-03

    We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

  6. Gas turbine engine with recirculating bleed

    NASA Technical Reports Server (NTRS)

    Adamson, A. P. (Inventor)

    1978-01-01

    Carbon monoxide and unburned hydrocarbon emissions in a gas turbine engine are reduced by bleeding hot air from the engine cycle and introducing it back into the engine upstream of the bleed location and upstream of the combustor inlet. As this hot inlet air is recycled, the combustor inlet temperature rises rapidly at a constant engine thrust level. In most combustors, this will reduce carbon monoxide and unburned hydrocarbon emissions significantly. The preferred locations for hot air extraction are at the compressor discharge or from within the turbine, whereas the preferred reentry location is at the compressor inlet.

  7. Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

    PubMed Central

    Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

    2003-01-01

    The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

  8. Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

    PubMed Central

    Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

    1985-01-01

    The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

  9. Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

    PubMed

    Lee, Sooncheol; Kang, Changwon

    2011-05-06

    The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

  10. DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

    PubMed Central

    Link, Gerhard

    1984-01-01

    A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

  11. Noise generated by flow through large butterfly valves

    NASA Technical Reports Server (NTRS)

    Huff, Ronald G.

    1987-01-01

    A large butterfly valve (1.37 m diam) was acoustically tested to measure the noise generated and propagating in both the upstream and downstream directions. The experimental investigation used wall mounted pressure transducers to measure the fluctuating component of the pipe static pressure upstream and downstream of the valve. Microphones upstream of the pipe inlet and located in a plenum were used to measure the noise radiated from the valve in the upstream direction. Comparison of the wall pressure downstream of the valve to a prediction were made. Reasonable agreement was obtained with the valve operating at a choked condition. The noise upstream of the valve is 30 dB less than that measured downstream.

  12. Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

    PubMed

    Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

    2000-08-01

    We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

  13. Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

    PubMed Central

    Zhao, A; Guo, A; Liu, Z; Pape, L

    1997-01-01

    The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

  14. Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

    PubMed

    Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

    2015-03-20

    Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

  15. Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

    PubMed Central

    Stone, D E; Craig, E A

    1990-01-01

    To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

  16. Deregulation of polycomb repressor complex 1 modifier AUTS2 in T-cell leukemia.

    PubMed

    Nagel, Stefan; Pommerenke, Claudia; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G; MacLeod, Roderick A F

    2016-07-19

    Recently, we identified deregulated expression of the B-cell specific transcription factor MEF2C in T-cell acute lymphoid leukemia (T-ALL). Here, we performed sequence analysis of a regulatory upstream section of MEF2C in T-ALL cell lines which, however, proved devoid of mutations. Unexpectedly, we found strong conservation between the regulatory upstream region of MEF2C (located at chromosomal band 5q14) and an intergenic stretch at 7q11 located between STAG3L4 and AUTS2, covering nearly 20 kb. While the non-coding gene STAG3L4 was inconspicuously expressed, AUTS2 was aberrantly upregulated in 6% of T-ALL patients (public dataset GSE42038) and in 3/24 T-ALL cell lines, two of which represented very immature differentiation stages. AUTS2 expression was higher in normal B-cells than in T-cells, indicating lineage-specific activity in lymphopoiesis. While excluding chromosomal aberrations, examinations of AUTS2 transcriptional regulation in T-ALL cells revealed activation by IL7-IL7R-STAT5-signalling and MEF2C. AUTS2 protein has been shown to interact with polycomb repressor complex 1 subtype 5 (PRC1.5), transforming this particular complex into an activator. Accordingly, expression profiling and functional analyses demonstrated that AUTS2 activated while PCGF5 repressed transcription of NKL homeobox gene MSX1 in T-ALL cells. Forced expression and pharmacological inhibition of EZH2 in addition to H3K27me3 analysis indicated that PRC2 repressed MSX1 as well. Taken together, we found that AUTS2 and MEF2C, despite lying on different chromosomes, share strikingly similar regulatory upstream regions and aberrant expression in T-ALL subsets. Our data implicate chromatin complexes PRC1/AUTS2 and PRC2 in a gene network in T-ALL regulating early lymphoid differentiation.

  17. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    PubMed

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  18. Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus

    PubMed Central

    Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.

    2001-01-01

    Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of various elements necessary for efficient protein expression and transactivation from the structural protein gene promoter of AeDNV. PMID:11152505

  19. Characterization of ROP18 alleles in human toxoplasmosis.

    PubMed

    Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

    2014-04-01

    The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

  20. The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

    PubMed

    Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

    2005-07-01

    Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

  1. Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

    PubMed Central

    Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

    2000-01-01

    The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

  2. Growth rate regulation of Escherichia coli acetyl coenzyme A carboxylase, which catalyzes the first committed step of lipid biosynthesis.

    PubMed Central

    Li, S J; Cronan, J E

    1993-01-01

    Acetyl coenzyme A (CoA) carboxylase catalyzes the synthesis of malonyl-CoA, the first intermediate of fatty acid synthesis. The Escherichia coli enzyme is encoded by four subunits located at three different positions on the E. coli chromosome. The accBC genes lie in a small operon at min 72, whereas accA and accD are located at min 4.3 and 50, respectively. We examined the expression of the genes that encode the E. coli acetyl-CoA carboxylase subunits (accA, accBC, and accD) under a variety of growth conditions by quantitative Northern (RNA) blot analysis. We found a direct correlation between the levels of transcription of the acc genes and the rate of cellular growth. Consistent results were also obtained upon nutritional upshift and downshift experiments and upon dilution of stationary-phase cultures into fresh media. We also determined the 5' end of the accA and accD mRNAs by primer extension and did transcriptional fusion analysis of the previously reported accBC promoter. Several interesting features were found in the promoter regions of these genes, including a bent DNA sequence and an open reading frame within the unusually long leader mRNA of the accBC operon, potential stem-loop structures in the accA and accD mRNA leader regions, and a stretch of GC-rich sequences followed by AT-rich sequences common to all three promoters. In addition, both accA and accD are located in complex gene clusters. For example, the accA promoter was localized within the upstream polC gene (which encodes the DNA polymerase III catalytic subunit), suggesting that additional regulatory mechanisms exist. Images PMID:7678242

  3. Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP.

    PubMed

    Li, Yan; Sun, Yan; Yang, Qingchuan; Kang, Junmei; Zhang, Tiejun; Gruber, Margaret Yvonne; Fang, Feng

    2012-08-01

    A 1272 bp upstream sequence of MsZFN gene was cloned from alfalfa, which was designed as MsZPP (Genbank accession number: FJ 161979.2) using an adaptor-mediated genome walking method. A sole transcription start site was located 69 bp upstream of the translation start site. Its pattern of expression included roots, stem vascular tissues, floral reproductive organs, and leaves, but the promoter did not express in seeds, petals or sepals. Transcription levels can be stimulated by dark, MeJA, and IAA. However, GUS fusion activities had no change by treatments of GA, ABA, drought and high salt for 3 days. Deletion analysis revealed that all sections of the promoter can drive gus gene expression in the root, stem, leaves and floral reproductive organs; however, only fragments longer than the -460 bp promoter can stimulate strong gus gene expression in these organs. In addition, the -460 bp promoter fragment can drive gus expression not only in the vascular tissue, but also in leaf guard cells. The results suggest that the promoter MsZPP plays roles in the regulation of transgene expression, particularly due to its darkness, MeJA, and IAA responsiveness.

  4. Constitutive Expression of a Transcription Termination Factor by a Repressed Prophage: Promoters for Transcribing the Phage HK022 nun Gene

    PubMed Central

    King, Rodney A.; Madsen, Peter L.; Weisberg, Robert A.

    2000-01-01

    Lysogens of phage HK022 are resistant to infection by phage λ. Lambda resistance is caused by the action of the HK022 Nun protein, which prematurely terminates early λ transcripts. We report here that transcription of the nun gene initiates at a constitutive prophage promoter, PNun, located just upstream of the protein coding sequence. The 5′ end of the transcript was determined by primer extension analysis of RNA isolated from HK022 lysogens or RNA made in vitro by transcribing a template containing the promoter with purified Escherichia coli RNA polymerase. Inactivation of PNun by mutation greatly reduced Nun activity and Nun antigen in an HK022 lysogen. However, a low level of residual activity was detected, suggesting that a secondary promoter also contributes to nun expression. We found one possible secondary promoter, PNun′, just upstream of PNun. Neither promoter is likely to increase the expression of other phage genes in a lysogen because their transcripts should be terminated downstream of nun. We estimate that HK022 lysogens in stationary phase contain several hundred molecules of Nun per cell and that cells in exponential phase probably contain fewer. PMID:10629193

  5. Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7

    PubMed Central

    Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain

    2017-01-01

    ABSTRACT Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent −12/−24 promoter consensus. The expression of an exaA::lacZ fusion was induced maximally by glycerol and was dependent on σ54. Bioinformatic analysis of the sequence flanking the −12/−24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA. EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense. We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ54-dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ54. The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ54 in other bacteria. PMID:28439037

  6. Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7.

    PubMed

    Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain; Tripathi, Anil Kumar

    2017-07-01

    Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent -12/-24 promoter consensus. The expression of an exaA :: lacZ fusion was induced maximally by glycerol and was dependent on σ 54 Bioinformatic analysis of the sequence flanking the -12/-24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ 54 -dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ 54 The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ 54 in other bacteria. Copyright © 2017 American Society for Microbiology.

  7. X-Prolyl Dipeptidyl Aminopeptidase Gene (pepX) Is Part of the glnRA Operon in Lactobacillus rhamnosus

    PubMed Central

    Varmanen, Pekka; Savijoki, Kirsi; Åvall, Silja; Palva, Airi; Tynkkynen, Soile

    2000-01-01

    A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate l-glycyl-l-prolyl-β-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks. PMID:10613874

  8. X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

    PubMed

    Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

    2000-01-01

    A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks.

  9. Multiple Cis-acting elements modulate programmed -1 ribosomal frameshifting in Pea enation mosaic virus

    PubMed Central

    Gao, Feng; Simon, Anne E.

    2016-01-01

    Programmed -1 ribosomal frameshifting (-1 PRF) is used by many positive-strand RNA viruses for translation of required products. Despite extensive studies, it remains unresolved how cis-elements just downstream of the recoding site promote a precise level of frameshifting. The Umbravirus Pea enation mosaic virus RNA2 expresses its RNA polymerase by -1 PRF of the 5′-proximal ORF (p33). Three hairpins located in the vicinity of the recoding site are phylogenetically conserved among Umbraviruses. The central Recoding Stimulatory Element (RSE), located downstream of the p33 termination codon, is a large hairpin with two asymmetric internal loops. Mutational analyses revealed that sequences throughout the RSE and the RSE lower stem (LS) structure are important for frameshifting. SHAPE probing of mutants indicated the presence of higher order structure, and sequences in the LS may also adapt an alternative conformation. Long-distance pairing between the RSE and a 3′ terminal hairpin was less critical when the LS structure was stabilized. A basal level of frameshifting occurring in the absence of the RSE increases to 72% of wild-type when a hairpin upstream of the slippery site is also deleted. These results suggest that suppression of frameshifting may be needed in the absence of an active RSE conformation. PMID:26578603

  10. Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

    PubMed Central

    Murthy, S C; Bhat, G P; Thimmappaya, B

    1985-01-01

    A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

  11. B-Bolivia, an Allele of the Maize b1 Gene with Variable Expression, Contains a High Copy Retrotransposon-Related Sequence Immediately Upstream1

    PubMed Central

    Selinger, David A.; Chandler, Vicki L.

    2001-01-01

    The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116

  12. Two alternative ways of start site selection in human norovirus reinitiation of translation.

    PubMed

    Luttermann, Christine; Meyers, Gregor

    2014-04-25

    The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

  13. 18. View of Tombigbee River Bridge facing east showing upstream ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. View of Tombigbee River Bridge facing east showing upstream side of bridge opposite broken railing located on the downstream side. Fallen power pole and telephone cable is shown in the center of the photograph. - Tombigbee River Bridge, Spanning Tombigbee River at State Highway 182, Columbus, Lowndes County, MS

  14. Performance of Pylons Upstream of a Cavity-Based Flameholder in Non-Reacting Supersonic Flow (Postprint)

    DTIC Science & Technology

    2006-10-01

    examine the flow field at an axial location of 0.75 inches. Measurements are performed using a pitot , cone-static probe and total temperature probe ...is the injection port, and the origin of the transverse direction (y/d = 0.0) is the upstream lip of the cavity. In each figure, the bow shock ...originates just upstream of the injection port and tends to be the strongest shock feature. In the baseline configurations, the bow shock initially

  15. Performance of Pylons Upstream of a Cavity-Based Flameholder in Non-Reacting Supersonic Flow (Postprint)

    DTIC Science & Technology

    2006-07-01

    location of 0.75 inches. Measurements are performed using a pitot , cone-static probe and total temperature probe with similar test meshes. All probes are...the transverse direction (y/d = 0.0) is the upstream lip of the cavity. In each figure, the bow shock originates just upstream of the injection port...and tends to be the strongest shock feature. In the baseline configurations, the bow shock initially penetrates perpendicular to the main flow due to

  16. Immediate changes in stream channel geomorphology, aquatic habitat, and fish assemblages following dam removal in a small upland catchment

    NASA Astrophysics Data System (ADS)

    Magilligan, F. J.; Nislow, K. H.; Kynard, B. E.; Hackman, A. M.

    2016-01-01

    Dam removal is becoming an increasingly important component of river restoration, with > 1100 dams having been removed nationwide over the past three decades. Despite this recent progression of removals, the lack of pre- to post-removal monitoring and assessment limits our understanding of the magnitude, rate, and sequence of geomorphic and/or ecological recovery to dam removal. Taking advantage of the November 2012 removal of an old ( 190 year-old) 6-m high, run-of-river industrial dam on Amethyst Brook (26 km2) in central Massachusetts, we identify the immediate eco-geomorphic responses to removal. To capture the geomorphic responses to dam removal, we collected baseline data at multiple scales, both upstream ( 300 m) and downstream (> 750 m) of the dam, including monumented cross sections, detailed channel-bed longitudinal profiles, embeddedness surveys, and channel-bed grain size measurements, which were repeated during the summer of 2013. These geomorphic assessments were combined with detailed quantitative electrofishing surveys of stream fish richness and abundance above and below the dam site and throughout the watershed and visual surveys of native anadromous sea lamprey (Petromyzon marinus) nest sites. Post-removal assessments were complicated by two events: (1) upstream knickpoint migration exhumed an older (ca. late eighteenth century) intact wooden crib dam 120 m upstream of the former stone dam, and (2) the occurrence of a 10-20 year RI flood 6 months after removal that caused further upstream incision and downstream aggradation. Now that the downstream reach has been reconnected to upstream sediment supply, the predominant geomorphic response was bed aggradation and associated fining (30-60% reduction). At dam proximal locations, aggradation ranged from 0.3 to > 1 m where a large woody debris jam enhanced aggradation. Although less pronounced, distal locations still showed aggradation with a mean depth of deposition of 0.20 m over the 750-m downstream reach. Post-removal, but pre-flood, bed surveys indicate 2 m of incision had migrated 25 m upstream of the former reservoir before encountering the exhumed dam, which now acts as the new grade control, limiting progressive headcutting. Approximately 1000 m3 of sediment was evacuated in the first year, with 67% of the volume occurring by pre-flood, process-driven (e.g., changes in base level) controls. The combination of changes in channel-bed sedimentology, the occurrence of a large magnitude flood, and the emergence of the new crib dam that is a likely barrier to fish movement was associated with major reductions in abundance and richness in sites downstream and immediately upstream adjacent to the former dam in post-removal sampling. At the same time, we documented the presence of four species of fish, including sea lamprey, which were not present above the dam prior to removal, indicating that upstream passage has been achieved; and we also documented lamprey spawning activity at sites immediately below the dam, which had previously been unsuitable owing to an excessively coarse and armored riverbed. Our results point to the importance of interactions between dam removal and flood disturbance effects, with important implications for short- and long-term monitoring and assessment of dam impacts to river systems.

  17. Regulation of the cnr Cobalt and Nickel Resistance Determinant from Ralstonia sp. Strain CH34†

    PubMed Central

    Grass, Gregor; Große, Cornelia; Nies, Dietrich H.

    2000-01-01

    Ralstonia sp. strain CH34 is resistant to nickel and cobalt cations. Resistance is mediated by the cnr determinant located on plasmid pMOL28. The cnr genes are organized in two clusters, cnrYXH and cnrCBA. As revealed by reverse transcriptase PCR and primer extension, transcription from these operons is initiated from promoters located upstream of the cnrY and cnrC genes. These two promoters exhibit conserved sequences at the −10 (CCGTATA) and −35 (CRAGGGGRAG) regions. The CnrH gene product, which is required for expression of both operons, is a sigma factor belonging to the sigma L family, whose activity seems to be governed by the membrane-bound CnrY and CnrX gene products in response to Ni2+. Half-maximal activation from the cnrCBA operon was determined by using appropriate lacZ gene fusions and was shown to occur at an Ni2+ concentration of about 50 μM. PMID:10671463

  18. Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

    PubMed

    Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

    1990-03-25

    The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

  19. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

    PubMed Central

    Mavrothalassitis, G J; Watson, D K; Papas, T S

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

  20. Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

    PubMed

    Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

    2015-09-01

    The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

  1. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  2. The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

    PubMed

    Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

    2004-11-15

    Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

  3. The Pea light-independent photomorphogenesis1 Mutant Results from Partial Duplication of COP1 Generating an Internal Promoter and Producing Two Distinct Transcripts

    PubMed Central

    Sullivan, James A.; Gray, John C.

    2000-01-01

    The pea lip1 (light-independent photomorphogenesis1) mutant shows many of the characteristics of light-grown development when grown in continuous darkness. To investigate the identity of LIP1, cDNAs encoding the pea homolog of COP1, a repressor of photomorphogenesis identified in Arabidopsis, were isolated from wild-type and lip1 pea seedlings. lip1 seedlings contained a wild-type COP1 transcript as well as a larger COP1′ transcript that contained an internal in-frame duplication of 894 bp. The COP1′ transcript segregated with the lip1 phenotype in F2 seedlings and could be translated in vitro to produce a protein of ∼100 kD. The COP1 gene in lip1 peas contained a 7.5-kb duplication, consisting of exons 1 to 7 of the wild-type sequence, located 2.5 kb upstream of a region of genomic DNA identical to the wild-type COP1 DNA sequence. Transcription and splicing of the mutant COP1 gene was predicted to produce the COP1′ transcript, whereas transcription from an internal promoter in the 2.5-kb region of DNA located between the duplicated regions of COP1 would produce the wild-type COP1 transcript. The presence of small quantities of wild-type COP1 transcripts may reduce the severity of the phenotype produced by the mutated COP1′ protein. The genomic DNA sequences of the COP1 gene from wild-type and lip1 peas and the cDNA sequences of COP1 and COP1′ transcripts have been submitted to the EMBL database under the EMBL accession numbers AJ276591, AJ276592, AJ289773, and AJ289774, respectively. PMID:11041887

  4. New Carbenicillin-Hydrolyzing β-Lactamase (CARB-7) from Vibrio cholerae Non-O1, Non-O139 Strains Encoded by the VCR Region of the V. cholerae Genome†

    PubMed Central

    Melano, Roberto; Petroni, Alejandro; Garutti, Alicia; Saka, Héctor Alex; Mange, Laura; Pasterán, Fernando; Rapoport, Melina; Rossi, Alicia; Galas, Marcelo

    2002-01-01

    In a previous study, an analysis of 77 ampicillin-nonsusceptible (resistant plus intermediate categories) strains of Vibrio cholerae non-O1, non-O139, isolated from aquatic environment and diarrheal stool, showed that all of them produced a β-lactamase with a pI of 5.4. Hybridization or amplification by PCR with a probe for blaTEM or primers for blaCARB gene families was negative. In this work, an environmental ampicillin-resistant strain from this sample, ME11762, isolated from a waterway in the west region of Argentina, was studied. The nucleotide sequence of the structural gene of the β-lactamase was determined by bidirectional sequencing of a Sau3AI fragment belonging to this isolate. The gene encodes a new 288-amino-acid protein, designated CARB-7, that shares 88.5% homology with the CARB-6 enzyme; an overall 83.2% homology with PSE-4, PSE-1, CARB-3, and the Proteus mirabilis N29 enzymes; and 79% homology with CARB-4 enzyme. The gene for this β-lactamase could not be transferred to Escherichia coli by conjugation. The nucleotide sequence of the flanking regions of the blaCARB-7 gene showed the occurrence of three 123-bp V. cholerae repeated sequences, all of which were found outside the predicted open reading frame. The upstream fragment of the blaCARB-7 gene shared 93% identity with a locus situated inside V. cholerae's chromosome 2. These results strongly suggest the chromosomal location of the blaCARB-7 gene, making this the first communication of a β-lactamase gene located on the VCR island of the V. cholerae genome. PMID:12069969

  5. Transcription elongation rate has a tissue-specific impact on alternative cleavage and polyadenylation in Drosophila melanogaster.

    PubMed

    Liu, Xiaochuan; Freitas, Jaime; Zheng, Dinghai; Oliveira, Marta S; Hoque, Mainul; Martins, Torcato; Henriques, Telmo; Tian, Bin; Moreira, Alexandra

    2017-12-01

    Alternative polyadenylation (APA) is a mechanism that generates multiple mRNA isoforms with different 3'UTRs and/or coding sequences from a single gene. Here, using 3' region extraction and deep sequencing (3'READS), we have systematically mapped cleavage and polyadenylation sites (PASs) in Drosophila melanogaster , expanding the total repertoire of PASs previously identified for the species, especially those located in A-rich genomic sequences. Cis -element analysis revealed distinct sequence motifs around fly PASs when compared to mammalian ones, including the greater enrichment of upstream UAUA elements and the less prominent presence of downstream UGUG elements. We found that over 75% of mRNA genes in Drosophila melanogaster undergo APA. The head tissue tends to use distal PASs when compared to the body, leading to preferential expression of APA isoforms with long 3'UTRs as well as with distal terminal exons. The distance between the APA sites and intron location of PAS are important parameters for APA difference between body and head, suggesting distinct PAS selection contexts. APA analysis of the RpII215 C4 mutant strain, which harbors a mutant RNA polymerase II (RNAPII) with a slower elongation rate, revealed that a 50% decrease in transcriptional elongation rate leads to a mild trend of more usage of proximal, weaker PASs, both in 3'UTRs and in introns, consistent with the "first come, first served" model of APA regulation. However, this trend was not observed in the head, suggesting a different regulatory context in neuronal cells. Together, our data expand the PAS collection for Drosophila melanogaster and reveal a tissue-specific effect of APA regulation by RNAPII elongation rate. © 2017 Liu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  6. USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS

    EPA Science Inventory

    Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a baseline of fish from refer...

  7. USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS

    EPA Science Inventory

    Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a basline of fish from refere...

  8. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    PubMed Central

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of the enzyme. PMID:18442387

  9. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    PubMed

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  10. Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

    PubMed

    Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

    2004-07-01

    The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

  11. Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

    PubMed Central

    Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi

    2008-01-01

    Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429

  12. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.

    1988-01-01

    Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less

  13. The role of polymorphisms in the spliced leader addition domain in determining promoter activity in Brugia malayi.

    PubMed

    Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R

    2011-03-01

    Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Control of boundary layer transition location and plate vibration in the presence of an external acoustic field

    NASA Technical Reports Server (NTRS)

    Maestrello, L.; Grosveld, F. W.

    1991-01-01

    The experiment is aimed at controlling the boundary layer transition location and the plate vibration when excited by a flow and an upstream sound source. Sound has been found to affect the flow at the leading edge and the response of a flexible plate in a boundary layer. Because the sound induces early transition, the panel vibration is acoustically coupled to the turbulent boundary layer by the upstream radiation. Localized surface heating at the leading edge delays the transition location downstream of the flexible plate. The response of the plate excited by a turbulent boundary layer (without sound) shows that the plate is forced to vibrate at different frequencies and with different amplitudes as the flow velocity changes indicating that the plate is driven by the convective waves of the boundary layer. The acoustic disturbances induced by the upstream sound dominate the response of the plate when the boundary layer is either turbulent or laminar. Active vibration control was used to reduce the sound induced displacement amplitude of the plate.

  15. Concentrated energy addition for active drag reduction in hypersonic flow regime

    NASA Astrophysics Data System (ADS)

    Ashwin Ganesh, M.; John, Bibin

    2018-01-01

    Numerical optimization of hypersonic drag reduction technique based on concentrated energy addition is presented in this study. A reduction in wave drag is realized through concentrated energy addition in the hypersonic flowfield upstream of the blunt body. For the exhaustive optimization presented in this study, an in-house high precision inviscid flow solver has been developed. Studies focused on the identification of "optimum energy addition location" have revealed the existence of multiple minimum drag points. The wave drag coefficient is observed to drop from 0.85 to 0.45 when 50 Watts of energy is added to an energy bubble of 1 mm radius located at 74.7 mm upstream of the stagnation point. A direct proportionality has been identified between energy bubble size and wave drag coefficient. Dependence of drag coefficient on the upstream added energy magnitude is also revealed. Of the observed multiple minimum drag points, the energy deposition point (EDP) that offers minimum wave drag just after a sharp drop in drag is proposed as the most optimum energy addition location.

  16. Direct molecular regulation of the myogenic determination gene Myf5 by Pax3, with modulation by Six1/4 factors, is exemplified by the -111 kb-Myf5 enhancer.

    PubMed

    Daubas, Philippe; Buckingham, Margaret E

    2013-04-15

    The Myf5 gene plays an important role in myogenic determination during mouse embryo development. Multiple genomic regions of the Mrf4-Myf5 locus have been characterised as enhancer sequences responsible for the complex spatiotemporal expression of the Myf5 gene at the onset of myogenesis. These include an enhancer sequence, located at -111 kb upstream of the Myf5 transcription start site, which is responsible of Myf5 activation in ventral somitic domains (Ribas et al., 2011. Dev. Biol. 355, 372-380). We show that the -111 kb-Myf5 enhancer also directs transgene expression in some limb muscles, and is active at foetal as well as embryonic stages. We have carried out further characterisation of the regulation of this enhancer and show that the paired-box Pax3 transcription factor binds to it in vitro as in vivo, and that Pax binding sites are essential for its activity. This requirement is independent of the previously reported regulation by TEAD transcription factors. Six1/4 which, like Pax3, are important upstream regulators of myogenesis, also bind in vivo to sites in the -111 kb-Myf5 enhancer and modulate its activity. The -111 kb-Myf5 enhancer therefore shares common functional characteristics with another Myf5 regulatory sequence, the hypaxial and limb 145 bp-Myf5 enhancer, both being directly regulated in vivo by Pax3 and Six1/4 proteins. However, in the case of the -111 kb-Myf5 enhancer, Six has less effect and we conclude that Pax regulation plays a major role in controlling this aspect of the Myf5 gene expression at the onset of myogenesis in the embryo. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Identification of a precursor genomic segment that provided a sequence unique to glycophorin B and E genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Onda, M.; Kudo, S.; Fukuda, M.

    Human glycophorin A, B, and E (GPA, GPB, and GPE) genes belong to a gene family located at the long arm of chromosome 4. These three genes are homologous from the 5'-flanking sequence to the Alu sequence, which is 1 kb downstream from the exon encoding the transmembrane domain. Analysis of the Alu sequence and flanking direct repeat sequences suggested that the GPA gene most closely resembles the ancestral gene, whereas the GPB and GPE gene arose by homologous recombination within the Alu sequence, acquiring 3' sequences from an unrelated precursor genomic segment. Here the authors describe the identification ofmore » this putative precursor genomic segment. A human genomic library was screened by using the sequence of the 3' region of the GPB gene as a probe. The genomic clones isolated were found to contain an Alu sequence that appeared to be involved in the recombination. Downstream from the Alu sequence, the nucleotide sequence of the precursor genomic segment is almost identical to that of the GPB or GPE gene. In contrast, the upstream sequence of the genomic segment differs entirely from that of the GPA, GPB, and GPE genes. Conservation of the direct repeats flanking the Alu sequence of the genomic segment strongly suggests that the sequence of this genomic segment has been maintained during evolution. This identified genomic segment was found to reside downstream from the GPA gene by both gene mapping and in situ chromosomal localization. The precursor genomic segment was also identified in the orangutan genome, which is known to lack GPB and GPE genes. These results indicate that one of the duplicated ancestral glycophorin genes acquired a unique 3' sequence by unequal crossing-over through its Alu sequence and the further downstream Alu sequence present in the duplicated gene. Further duplication and divergence of this gene yielded the GPB and GPE genes. 37 refs., 5 figs.« less

  18. Turbine-Driven Pipe-Cleaning Brush

    NASA Technical Reports Server (NTRS)

    Werlink, Rudy J.; Rowell, David E.

    1994-01-01

    Simple pipe-cleaning device includes small turbine wheel axially connected, by standoff, to circular brush. Turbine wheel turns on hub bearing attached to end of upstream cable. Turbine-and-brush assembly inserted in pipe with cable trailing upstream and brush facing downstream. Water or cleaning solution pumped through pipe. Cable held at upstream end, so it holds turbine and brush in pipe at location to be cleaned. Flow in pipe turns turbine, which turns wheel, producing desired cleaning action. In addition to brushing action, device provides even mixing of cleaning solution in pipe.

  19. Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

    PubMed

    Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

    2003-07-04

    The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

  20. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE PAGES

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    2015-03-22

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  1. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  2. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

    PubMed

    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

    2015-06-01

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  3. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  4. Nucleotide sequence of the gene for the Mr 32,000 thylakoid membrane protein from Spinacia oleracea and Nicotiana debneyi predicts a totally conserved primary translation product of Mr 38,950

    PubMed Central

    Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick

    1982-01-01

    The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262

  5. Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

    PubMed Central

    Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

    2015-01-01

    Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

  6. Macrolide resistance in Legionella pneumophila: the role of LpeAB efflux pump.

    PubMed

    Massip, Clémence; Descours, Ghislaine; Ginevra, Christophe; Doublet, Patricia; Jarraud, Sophie; Gilbert, Christophe

    2017-05-01

    A previous study on 12 in vitro -selected azithromycin-resistant Legionella pneumophila lineages showed that ribosomal mutations were major macrolide resistance determinants. In addition to these mechanisms that have been well described in many species, mutations upstream of lpeAB operon, homologous to acrAB in Escherichia coli , were identified in two lineages. In this study, we investigated the role of LpeAB and of these mutations in macrolide resistance of L. pneumophila . The role of LpeAB was studied by testing the antibiotic susceptibility of WT, deleted and complemented L. pneumophila Paris strains. Translational fusion experiments using GFP as a reporter were conducted to investigate the consequences of the mutations observed in the upstream sequence of lpeAB operon. We demonstrated the involvement of LpeAB in an efflux pump responsible for a macrolide-specific reduced susceptibility of L. pneumophila Paris strain. Mutations in the upstream sequence of lpeAB operon were associated with an increased protein expression. Increased expression was also observed under sub-inhibitory macrolide concentrations in strains with both mutated and WT promoting regions. LpeAB are components of an efflux pump, which is a macrolide resistance determinant in L. pneumophila Paris strain. Mutations observed in the upstream sequence of lpeAB operon in resistant lineages led to an overexpression of this efflux pump. Sub-inhibitory concentrations of macrolides themselves participated in upregulating this efflux and could constitute a first step in the acquisition of a high macrolide resistance level. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).

    PubMed

    Hobson, Neil; Deyholos, Michael K

    2013-04-01

    Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.

  8. Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing

    PubMed Central

    Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin

    2012-01-01

    Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633

  9. Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

    2010-02-19

    Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

  10. Copy number variation in the region harboring SOX9 gene in dogs with testicular/ovotesticular disorder of sex development (78,XX; SRY-negative).

    PubMed

    Marcinkowska-Swojak, Malgorzata; Szczerbal, Izabela; Pausch, Hubert; Nowacka-Woszuk, Joanna; Flisikowski, Krzysztof; Dzimira, Stanislaw; Nizanski, Wojciech; Payan-Carreira, Rita; Fries, Ruedi; Kozlowski, Piotr; Switonski, Marek

    2015-10-01

    Although the disorder of sex development in dogs with female karyotype (XX DSD) is quite common, its molecular basis is still unclear. Among mutations underlying XX DSD in mammals are duplication of a long sequence upstream of the SOX9 gene (RevSex) and duplication of the SOX9 gene (also observed in dogs). We performed a comparative analysis of 16 XX DSD and 30 control female dogs, using FISH and MLPA approaches. Our study was focused on a region harboring SOX9 and a region orthologous to the human RevSex (CanRevSex), which was located by in silico analysis downstream of SOX9. Two highly polymorphic copy number variable regions (CNVRs): CNVR1 upstream of SOX9 and CNVR2 encompassing CanRevSex were identified. Although none of the detected copy number variants were specific to either affected or control animals, we observed that the average number of copies in CNVR1 was higher in XX DSD. No copy variation of SOX9 was observed. Our extensive studies have excluded duplication of SOX9 as the common cause of XX DSD in analyzed samples. However, it remains possible that the causative mutation is hidden in highly polymorphic CNVR1.

  11. Copy number variation in the region harboring SOX9 gene in dogs with testicular/ovotesticular disorder of sex development (78,XX; SRY-negative)

    PubMed Central

    Marcinkowska-Swojak, Malgorzata; Szczerbal, Izabela; Pausch, Hubert; Nowacka-Woszuk, Joanna; Flisikowski, Krzysztof; Dzimira, Stanislaw; Nizanski, Wojciech; Payan-Carreira, Rita; Fries, Ruedi; Kozlowski, Piotr; Switonski, Marek

    2015-01-01

    Although the disorder of sex development in dogs with female karyotype (XX DSD) is quite common, its molecular basis is still unclear. Among mutations underlying XX DSD in mammals are duplication of a long sequence upstream of the SOX9 gene (RevSex) and duplication of the SOX9 gene (also observed in dogs). We performed a comparative analysis of 16 XX DSD and 30 control female dogs, using FISH and MLPA approaches. Our study was focused on a region harboring SOX9 and a region orthologous to the human RevSex (CanRevSex), which was located by in silico analysis downstream of SOX9. Two highly polymorphic copy number variable regions (CNVRs): CNVR1 upstream of SOX9 and CNVR2 encompassing CanRevSex were identified. Although none of the detected copy number variants were specific to either affected or control animals, we observed that the average number of copies in CNVR1 was higher in XX DSD. No copy variation of SOX9 was observed. Our extensive studies have excluded duplication of SOX9 as the common cause of XX DSD in analyzed samples. However, it remains possible that the causative mutation is hidden in highly polymorphic CNVR1. PMID:26423656

  12. POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

    PubMed

    Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

    2002-07-26

    The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

  13. Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

    NASA Astrophysics Data System (ADS)

    Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

    2016-04-01

    The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function.

  14. [Phylogenetic analysis of CO I gene of Oncomelania snails from project of afforestation for schistosomiasis control in marshland endemic regions].

    PubMed

    Xu, Yu-Mei; Zhang, Shi-Qing; Zhu, Chuan-Gang

    2012-04-01

    To investigate the genetic difference of cytochrome oxidase I (CO I ) of Oncomelania snails from the project of afforestation for schistosomiasis control in marshland regions, so as to explore the effects of different ecological environments. The snails were collected from 3 different areas, Anqing, Tongling, Wuwei, i.e. the upstream, midstream and downstream regions along the Yangtz River in Anhui Province. Genomic DNA was extracted from the snails, and CO I gene fragments were amplified by PCR, then purified and sequenced. The sequences were edited by using Blast. The CO I genes of O. h. minima and Biomphalaria glabrata were used as the reference of exogenous gene. The genetic distances of the various regions were calculated by the Kimura method and phylogenetic trees were constructed with UPGMA and the NJ method of MEGA (3.1) software. The amplified CO I gene of the snail was a fragment about 700 bp including 2 primers in length. There were little genetic diversity among the different areas, the identities were higher than or equal to 98%. The genetic distances indicated that the distance between the projects of afforestation and woodland in Anqing was 0.003, while Tongling was 0.019, Wuwei was 0.007. The distances among the three projects of afforestation were 0.003-0.012. The two phylogenetic trees were constructed by the methods of UPGMA and NJ respectively, which took on very similar topo-structure in which isolates of Biomphalaria glabrata located in one clade and all the others in the other one. In the other one clade, O. H. minima located in one clade. There was little genetic diversity among Anqing, Tongling, Wuwei clusters. The afforestations of Anqing and Wuwei clustered into one group, while the woodlands of Anqing and Wuwei appeared as another group. There is a little genetic diversity of the snail cytochrome oxidase I (CO I ) in different ecological environments among the upstream, midstream and downstream regions along the Yangtz River in Anhui Province.

  15. Two novel genes, fanA and fanB, involved in the biogenesis of K99 fimbriae.

    PubMed

    Roosendaal, E; Boots, M; de Graaf, F K

    1987-08-11

    The nucleotide sequence of the region located transcriptionally upstream of the K99 fimbrial subunit gene (fanC) was determined. Several putative transcription signals and two open reading frames, designated fanA and fanB, became apparent. Frameshift mutations in fanA and fanB reduced K99 fimbriae expression 8-fold and 16-fold, respectively. Complementation of the mutants in trans restored the K99 expression to about 75% of the wild type level, indicating that fanA and fanB code for transacting polypeptides involved in the biogenesis of K99 fimbriae. The fanA and fanB gene products FanA and FanB were not detectable in minicell preparations, indicating that both polypeptides are synthesized in very small amounts. However, in an in vitro DNA directed translation system FanA and FanB could be identified. The deduced amino acid sequences of FanA and FanB showed that both polypeptides contain no signal peptides, indicating a cytoplasmic location. Furthermore, the polypeptides are very hydrophilic, mainly basic, and exhibit remarkable homology to each other and to a regulatory protein (papB) encoded by the pap-operon (1). Some of these features are characteristics of nucleic acid binding proteins, which suggests that FanA and FanB have a regulatory function in the synthesis of FanC and the auxiliary polypeptides FanD-H.

  16. Formation of trihalomethanes of dissolved organic matter fractions in reservoir and canal waters.

    PubMed

    Musikavong, Charongpun; Srimuang, Kanjanee; Tachapattaworakul Suksaroj, Thunwadee; Suksaroj, Chaisri

    2016-07-28

    The formation of trihalomethanes (THMs) of hydrophobic organic fraction (HPO), transphilic organic fraction (TPI), and hydrophilic organic fraction (HPI) of reservoir and canal waters from the U-Tapao River Basin, Songkhla, Thailand was investigated. Water samples were collected three times from two reservoirs, upstream, midstream, and downstream of the U-Tapao canal. The HPO was the major dissolved organic matter (DOM) fraction in reservoir and canal waters. On average, the HPO accounted for 53 and 45% of the DOM in reservoir and canal waters, respectively. The TPI of 19 and 23% in reservoir and canal waters were determined, respectively. The HPI of 29% of the reservoir water and HPI of 32% of the canal water were detected. For the reservoir water, the highest trihalomethane formation potential (THMFP)/dissolved organic carbon (DOC) was determined for the HPI, followed by the TPI and HPO, respectively. The average values of the THMFP/DOC of the HPI, TPI, and HPO of the reservoir water were 78, 52, and 49 µg THMs/mg C, respectively. The highest THMFP/DOC of the canal water was detected for the HPI, followed by HPO and TPI, respectively. Average values of the THMFP/DOC of HPI of water at upstream and midstream locations of 58 µg THMs/mg C and downstream location of 113 µg THMs/mg C were determined. Average values of THMFP/DOC of HPO of water at upstream and midstream and downstream locations were 48 and 93 µg THMs/mg C, respectively. For the lowest THMFP/DOC fraction, the average values of THMFP/DOC of TPI of water at upstream and midstream and downstream locations were 35 and 73 µg THMs/mg C, respectively.

  17. Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection

    NASA Technical Reports Server (NTRS)

    Harada, Kazuo; Orgel, Leslie E.

    1993-01-01

    We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.

  18. Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans

    PubMed Central

    Zheng, Zhaoqing; Keifer, Joyce

    2014-01-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176

  19. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    PubMed

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  20. Genetic variations associated with six-white-point coat pigmentation in Diannan small-ear pigs

    PubMed Central

    Lü, Meng-Die; Han, Xu-Man; Ma, Yun-Fei; Irwin, David M.; Gao, Yun; Deng, Jia-Kun; Adeola, Adeniyi C.; Xie, Hai-Bing; Zhang, Ya-Ping

    2016-01-01

    A common phenotypic difference among domestic animals is variation in coat color. Six-white-point is a pigmentation pattern observed in varying pig breeds, which seems to have evolved through several different mechanistic pathways. Herein, we re-sequenced whole genomes of 31 Diannan small-ear pigs from China and found that the six-white-point coat color in Diannan small-ear pigs is likely regulated by polygenic loci, rather than by the MC1R locus. Strong associations were observed at three loci (EDNRB, CNTLN, and PINK1), which explain about 20 percent of the total coat color variance in the Diannan small-ear pigs. We found a mutation that is highly differentiated between six-white-point and black Diannan small-ear pigs, which is located in a conserved noncoding sequence upstream of the EDNRB gene and is a putative binding site of the CEBPB protein. This study advances our understanding of coat color evolution in Diannan small-ear pigs and expands our traditional knowledge of coat color being a monogenic trait. PMID:27270507

  1. Genomic organization and expression of the human MSH3 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Atsushi; Ikejima, Miyoko; Suzuki, Noriko

    1996-02-01

    We have studied the expression and genomic organization of the human MSH3 gene, which encodes a human homologue of the bacterial DNA mismatch repair protein MutS. This gene is located upstream of the dihydrofolate reductase (DHFR) gene. Northern analysis has demonstrated that the hMSH3 gene is expressed in a variety of human tissues at low levels, like the DHFR gene. Characterization of cosmid clones has shown that the hMSH3 gene consists of 24 exons spanning at least 160 kb. All exon-intron junction sequences match the classical GT/AG rule, except that intron 6 has AT and AA at the ends. Twomore » major transcripts of 5.0 and 3.8 kb have been shown to be derived from the differential use of two polyadenylation sites. Elucidation of the complete genomic organization and the nucleotide sequences of the introns of the hMSH3 gene should be useful for studying the function of this gene and the possible involvement of specific mutations of the hMSH3 gene in some diseases. 34 refs., 5 figs., 1 tab.« less

  2. The disruption of a novel limb cis-regulatory element of SHH is associated with autosomal dominant preaxial polydactyly-hypertrichosis

    PubMed Central

    Petit, Florence; Jourdain, Anne-Sophie; Holder-Espinasse, Muriel; Keren, Boris; Andrieux, Joris; Duterque-Coquillaud, Martine; Porchet, Nicole; Manouvrier-Hanu, Sylvie; Escande, Fabienne

    2016-01-01

    The expression gradient of the morphogen Sonic Hedgehog (SHH) is crucial in establishing the number and the identity of the digits during anteroposterior patterning of the limb. Its anterior ectopic expression is responsible for preaxial polydactyly (PPD). Most of these malformations are due to the gain-of-function of the Zone of Polarizing Activity Regulatory Sequence, the only limb-specific enhancer of SHH known to date. We report a family affected with a novel condition associating PPD and hypertrichosis of the upper back, following an autosomal dominant mode of inheritance. This phenotype is consistent with deregulation of SHH expression during limb and follicle development. In affected members, we identified a 2 kb deletion located ~240 kb upstream from the SHH promoter. The deleted sequence is capable of repressing the transcriptional activity of the SHH promoter in vitro, consistent with a silencer activity. We hypothesize that the deletion of this silencer could be responsible for SHH deregulation during development, leading to a PPD-hypertrichosis phenotype. PMID:25782671

  3. Analysis of blaCTX-M-Carrying Plasmids from Escherichia coli Isolates Collected in the BfT-GermVet Study ▿

    PubMed Central

    Schink, Anne-Kathrin; Kadlec, Kristina; Schwarz, Stefan

    2011-01-01

    In this study, 417 Escherichia coli isolates from defined disease conditions of companion and farm animals collected in the BfT-GermVet study were investigated for the presence of extended-spectrum β-lactamase (ESBL) genes. Three ESBL-producing E. coli isolates were identified among the 100 ampicillin-resistant isolates. The E. coli isolates 168 and 246, of canine and porcine origins, respectively, harbored blaCTX-M-1, and the canine isolate 913 harbored blaCTX-M-15, as confirmed by PCR and sequence analysis. The isolates 168 and 246 belonged to the novel multilocus sequence typing (MLST) types ST1576 and ST1153, respectively, while isolate 913 had the MLST type ST410. The ESBL genes were located on structurally related IncN plasmids in isolates 168 and 246 and on an IncF plasmid in isolate 913. The blaCTX-M-1 upstream regions of plasmids pCTX168 and pCTX246 were similar, whereas the downstream regions showed structural differences. The genetic environment of the blaCTX-M-15 gene on plasmid pCTX913 differed distinctly from that of both blaCTX-M-1 genes. Detailed sequence analysis showed that the integration of insertion sequences, as well as interplasmid recombination events, accounted for the structural variability in the blaCTX-M gene regions. PMID:21685166

  4. Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

    PubMed Central

    Dunn, R. C.; Laurie, C. C.

    1995-01-01

    Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

  5. Distant sequences determine 5′ end formation of cox3 transcripts in Arabidopsis thaliana ecotype C24

    PubMed Central

    Forner, Joachim; Weber, Bärbel; Wiethölter, Caterina; Meyer, Rhonda C.; Binder, Stefan

    2005-01-01

    The genomic environments and the transcripts of the mitochondrial cox3 gene are investigated in three Arabidopsis thaliana ecotypes. While the proximate 5′ sequences up to nucleotide position −584, the coding regions and the 3′ flanking regions are identical in Columbia (Col), C24 and Landsberg erecta (Ler), genomic variation is detected in regions further upstream. In the mitochondrial DNA of Col, a 1790 bp fragment flanked by a nonanucleotide direct repeat is present beyond position −584 with respect to the ATG. While in Ler only part of this insertion is conserved, this sequence is completely absent in C24, except for a single copy of the nonanucleotide direct repeat. Northern hybridization reveals identical major transcripts in the three ecotypes, but identifies an additional abundant 60 nt larger mRNA species in C24. The extremities of the most abundant mRNA species are identical in the three ecotypes. In C24, an extra major 5′ end is abundant. This terminus and the other major 5′ ends are located in identical sequence regions. Inspection of Atcox3 transcripts in C24/Col hybrids revealed a female inheritance of the mRNA species with the extra 5′ terminus. Thus, a mitochondrially encoded factor determines the generation of an extra 5′ mRNA end. PMID:16107557

  6. Hot Spots of Recombination in Fission Yeast: Inactivation of the M26 Hot Spot by Deletion of the Ade6 Promoter and the Novel Hotspot Ura4-Aim

    PubMed Central

    Zahn-Zabal, M.; Lehmann, E.; Kohli, J.

    1995-01-01

    The M26 mutation in the ade6 gene of Schizosaccharomyces pombe creates a hot spot of meiotic recombination. A single base substitution, the M26 mutation is situated within the open reading frame, near the 5' end. It has previously been shown that the heptanucleotide sequence 5' ATGACGT 3', which includes the M26 mutation, is required for hot spot activity. The 510-bp ade6-delXB deletion encompasses the promoter and the first 23 bp of the open reading frame, ending 112 bp upstream of M26. Deletion of the promoter in cis to M26 abolishes hot spot activity, while deletion in trans to M26 has no effect. Homozygous deletion of the promoter also eliminates M26 hot spot activity, indicating that the heterology created through deletion of the promoter per se is not responsible for the loss of hot spot activity. Thus, DNA sequences other than the heptanucleotide 5' ATGACGT 3', which must be located at the 5' end of the ade6 gene, appear to be required for hot spot activity. While the M26 hotspot stimulates crossovers associated with M26 conversion, it does not affect the crossover frequency in the intervals adjacent to ade6. The flanking marker ura4-aim, a heterology created by insertion of the ura4(+) gene upstream of ade6, turned out to be a hot spot itself. It shows disparity of conversion with preferential loss of the insertion. The frequency of conversion at ura4-aim is reduced when the M26 hot spot is active 15 kb away, indicating competition for recombination factors by hot spots in close proximity. PMID:7498729

  7. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    PubMed

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  8. EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

    PubMed

    Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

    2014-11-01

    The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

  9. 5. Looking west upstream, towards the location of the erstwhile ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. Looking west upstream, towards the location of the erstwhile intake flume into canal from the upper reaches of the Potomac River above the Great Falls, on the old Potowmack Canal built by George Washington. The plan contemplated canal navigation around the Great Falls of the Potomac River, located on the Virginia side of the Potomac, about 15 miles above Washington, D.C. The Company was organized in 1785, and by 1802, this and three or four smaller canals were substantially completed and raft-like boats began operation with materials from the west to the city of Georgetown. 'Although the canals and locks of the Potomac Canal were considered a great engineering accomplishment, the improvements to the river channel were inadequate. Disappointment ... - Potowmack Company: Great Falls Canal & Locks, Great Falls, Fairfax County, VA

  10. The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

    PubMed Central

    2014-01-01

    Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

  11. Randomization and In Vivo Selection Reveal a GGRG Motif Essential for Packaging Human Immunodeficiency Virus Type 2 RNA ▿ †

    PubMed Central

    Baig, Tayyba T.; Lanchy, Jean-Marc; Lodmell, J. Stephen

    2009-01-01

    The packaging signal (ψ) of human immunodeficiency virus type 2 (HIV-2) is present in the 5′ noncoding region of RNA and contains a 10-nucleotide palindrome (pal; 5′-392-GGAGUGCUCC) located upstream of the dimerization signal stem-loop 1 (SL1). pal has been shown to be functionally important in vitro and in vivo. We previously showed that the 3′ side of pal (GCUCC-3′) is involved in base-pairing interactions with a sequence downstream of SL1 to make an extended SL1, which is important for replication in vivo and the regulation of dimerization in vitro. However, the role of the 5′ side of pal (5′-GGAGU) was less clear. Here, we characterized this role using an in vivo SELEX approach. We produced a population of HIV-2 DNA genomes with random sequences within the 5′ side of pal and transfected these into COS-7 cells. Viruses from COS-7 cells were used to infect C8166 permissive cells. After several weeks of serial passage in C8166 cells, surviving viruses were sequenced. On the 5′ side of pal there was a striking convergence toward a GGRGN consensus sequence. Individual clones with consensus and nonconsensus sequences were tested in infectivity and packaging assays. Analysis of individuals that diverged from the consensus sequence showed normal viral RNA and protein synthesis but had replication defects and impaired RNA packaging. These findings clearly indicate that the GGRG motif is essential for viral replication and genomic RNA packaging. PMID:18971263

  12. Sense transcription through the S region is essential for immunoglobulin class switch recombination

    PubMed Central

    Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine

    2011-01-01

    Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751

  13. PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

    PubMed Central

    Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

    2001-01-01

    Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

  14. A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

    PubMed Central

    León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

    2013-01-01

    Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

  15. Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

    PubMed Central

    Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

    1993-01-01

    Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

  16. Reducing DNA context dependence in bacterial promoters

    PubMed Central

    Carr, Swati B.; Densmore, Douglas M.

    2017-01-01

    Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998

  17. [Analysis of cis-regulatory element distribution in gene promoters of Gossypium raimondii and Arabidopsis thaliana].

    PubMed

    Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming

    2013-10-01

    Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.

  18. Isolation and characterization of a novel pollen-specific promoter in maize (Zea mays L.).

    PubMed

    Wang, He; Fan, Mingxia; Wang, Guohong; Zhang, Chunyu; Shi, Lei; Wei, Zhengyi; Ma, Wenjuan; Chang, Jing; Huang, Senxin; Lin, Feng

    2017-06-01

    ZmSTK2_USP, located on the long arm of chromosome 4, belongs to the serine/threonine kinase gene in maize. The sequence analysis of 2100 bp upstream from the start codon ATG has shown that it contains cis-element motifs and two types of anther/pollen-specific promoter elements (GTGA and AGAAA), suggesting that it is the pollen-specific promoter. To investigate the function of ZmSTK2_USP promoter, the GUS gene fusion system was employed. In proZmSTK2_USP-GUS genetically modified plants, GUS activity was detected in mature pollen grains and pollen tubes but not found in other floral and vegetative tissues. These results show that proZmSTK2_USP is the pollen-specific promoter and drives pollen-specific activity during the middle stage of pollen development until pollen maturation.

  19. The ygaVP Genes of Escherichia coli Form a Tributyltin-Inducible Operon▿ †

    PubMed Central

    Gueuné, Hervé; Durand, Marie-José; Thouand, Gérald; DuBow, Michael S.

    2008-01-01

    A tributyltin (TBT) luxAB transcriptional fusion in Escherichia coli revealed that a TBT-activated promoter is located upstream of two cotranscribed orphan genes, ygaV and ygaP. We demonstrate that transcription from the promoter upstream of ygaVP is constitutive in a ygaVP mutant, suggesting that YgaV is an autoregulated, TBT-inducible repressor. PMID:18245262

  20. Physical map location of the multicopy genes coding for ammonia monooxygenase and hydroxylamine oxidoreductase in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11.

    PubMed

    Hirota, R; Yamagata, A; Kato, J; Kuroda, A; Ikeda, T; Takiguchi, N; Ohtake, H

    2000-02-01

    Pulsed-field gel electrophoresis of PmeI digests of the Nitrosomonas sp. strain ENI-11 chromosome produced four bands ranging from 1,200 to 480 kb in size. Southern hybridizations suggested that a 487-kb PmeI fragment contained two copies of the amoCAB genes, coding for ammonia monooxygenase (designated amoCAB(1) and amoCAB(2)), and three copies of the hao gene, coding for hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)). In this DNA fragment, amoCAB(1) and amoCAB(2) were about 390 kb apart, while hao(1), hao(2), and hao(3) were separated by at least about 100 kb from each other. Interestingly, hao(1) and hao(2) were located relatively close to amoCAB(1) and amoCAB(2), respectively. DNA sequence analysis revealed that hao(1) and hao(2) shared 160 identical nucleotides immediately upstream of each translation initiation codon. However, hao(3) showed only 30% nucleotide identity in the 160-bp corresponding region.

  1. Physical Map Location of the Multicopy Genes Coding for Ammonia Monooxygenase and Hydroxylamine Oxidoreductase in the Ammonia-Oxidizing Bacterium Nitrosomonas sp. Strain ENI-11

    PubMed Central

    Hirota, Ryuichi; Yamagata, Akira; Kato, Junichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao

    2000-01-01

    Pulsed-field gel electrophoresis of PmeI digests of the Nitrosomonas sp. strain ENI-11 chromosome produced four bands ranging from 1,200 to 480 kb in size. Southern hybridizations suggested that a 487-kb PmeI fragment contained two copies of the amoCAB genes, coding for ammonia monooxygenase (designated amoCAB1 and amoCAB2), and three copies of the hao gene, coding for hydroxylamine oxidoreductase (hao1, hao2, and hao3). In this DNA fragment, amoCAB1 and amoCAB2 were about 390 kb apart, while hao1, hao2, and hao3 were separated by at least about 100 kb from each other. Interestingly, hao1 and hao2 were located relatively close to amoCAB1 and amoCAB2, respectively. DNA sequence analysis revealed that hao1 and hao2 shared 160 identical nucleotides immediately upstream of each translation initiation codon. However, hao3 showed only 30% nucleotide identity in the 160-bp corresponding region. PMID:10633121

  2. Disruption of a stem-loop structure located upstream of pseudoknot domain in Tobacco mosaic virus enhanced its infectivity and viral RNA accumulation.

    PubMed

    Guo, Song; Wong, Sek-Man

    2018-06-01

    A predicted stem-loop structure of 25 nucleotides, located in the coat protein (CP) gene and 3'-UTR sequences of Tobacco mosaic virus (TMV), was validated previously (Guo et al., 2015). In this study, both disrupted stem-loop and nucleotide deletion mutants of TMV replicated more rapidly in Nicotiana benthamiana protoplasts. The TMV mutant with a complete mirrored stem-loop structure showed similar level of viral RNA accumulation as TMV. Recovering the stem-loop structure also resulted in a similar replication level as TMV. All these mutants induced necrosis in N. benthamiana and assembled into typical rigid rod-shaped virions. TMV mutant without the stem-loop structure induced more local lesions in Chenopodium quinoa. When the putative stem-loop structure in Tomato mosaic virus (ToMV) was disrupted, the mutant also showed an enhanced virus replication. This suggests that the stem-loop structure of TMV is a new cis-acting element with a role in virus replication. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Searching for the Source of Salt Marsh Buried Mercury.

    NASA Astrophysics Data System (ADS)

    Brooke, C. G.; Nelson, D. C.; Fleming, E. J.

    2016-12-01

    Salt marshes provide a barrier between upstream mercury contamination and coastal ecosystems. Mercury is sorbed, transported, and deposited in estuarine systems. Once the upstream mercury source has been remediated, the downstream mercury contaminated salt marsh sediments should become "capped" or buried by uncontaminated sediments preventing further ecosystem contamination. Downstream from a remediated mercury mine, an estuarine intertidal marsh in Tomales Bay, CA, USA, scavengers/predators (e.g. Pachygrapsus crassipes, Lined Shore Crab) have leg mercury concentrations as high as 5.5 ppm (dry wt./dry wt.), which increase significantly with crab size, a surrogate for trophic level. These elevated mercury concentrations suggests that "buried" mercury is rereleased into the environment. To locate possible sources of mercury release in Walker Marsh, we sampled a transect across the marsh that included diverse micro-environments (e.g. rhizoshere, stratified sediments, faunal burrows). From each location we determined the sediment structure, sediment color, total sediment mercury, total sediment iron, and microbial composition (n = 28). Where flora or fauna had perturbed the sediment, mercury concentrations were 10% less than undisturbed stratified sediments (1025 ppb vs. 1164 ppb, respectively). High-throughput SSU rRNA gene sequencing and subsequent co-occurrence network analysis genera indicated that in flora- or fauna- perturbed sediments there was an increased likelihood that microbial genera contained mercury mobilizing genes (94% vs 57%; in perturbed vs stratified sediments, respectively). Our observations are consistent with findings by others that in perturbed sites mercury mobility increased. We did however identify a microbial and geochemical profile with increased mercury mobility. For future work we plan to quantify the role these micro-environments have on mercury-efflux from salt marshes.

  4. Field Evaluation of Detection-Control System

    DOT National Transportation Integrated Search

    2015-04-01

    In this research, a field evaluation of the Detection-Control System (D-CS) was conducted at eight sites located in four States. D-CS is similar to a traditional advance detector system in that it uses information from detectors located upstream of t...

  5. 2. Rockwork on north bank of S. Platte River located ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. Rockwork on north bank of S. Platte River located 2.1 miles upstream from the Keystone Bridge. View looking northwest at a distance of 30 feet. - Denver & Rio Grande Rockwork, East of South Platte, Waterton, Jefferson County, CO

  6. Arc burst pattern analysis fault detection system

    NASA Technical Reports Server (NTRS)

    Russell, B. Don (Inventor); Aucoin, B. Michael (Inventor); Benner, Carl L. (Inventor)

    1997-01-01

    A method and apparatus are provided for detecting an arcing fault on a power line carrying a load current. Parameters indicative of power flow and possible fault events on the line, such as voltage and load current, are monitored and analyzed for an arc burst pattern exhibited by arcing faults in a power system. These arcing faults are detected by identifying bursts of each half-cycle of the fundamental current. Bursts occurring at or near a voltage peak indicate arcing on that phase. Once a faulted phase line is identified, a comparison of the current and voltage reveals whether the fault is located in a downstream direction of power flow toward customers, or upstream toward a generation station. If the fault is located downstream, the line is de-energized, and if located upstream, the line may remain energized to prevent unnecessary power outages.

  7. Overexpression of the Lactobacillus plantarum peptidoglycan biosynthesis murA2 gene increases the tolerance of Escherichia coli to alcohols and enhances ethanol production.

    PubMed

    Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T

    2014-10-01

    A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.

  8. Satellite Altimetry based River Forecasting of Transboundary Flow

    NASA Astrophysics Data System (ADS)

    Hossain, F.; Siddique-E-Akbor, A.; Lee, H.; Shum, C.; Biancamaria, S.

    2012-12-01

    Forecasting of this transboundary flow in downstream nations however remains notoriously difficult due to the lack of basin-wide in-situ hydrologic measurements or its real-time sharing among nations. In addition, human regulation of upstream flow through diversion projects and dams, make hydrologic models less effective for forecasting on their own. Using the Ganges-Brahmaputra (GB) basin as an example, this study assesses the feasibility of using JASON-2 satellite altimetry for forecasting such transboundary flow at locations further inside the downstream nation of Bangladesh by propagating forecasts derived from upstream (Indian) locations through a hydrodynamic river model. The 5-day forecast of river levels at upstream boundary points inside Bangladesh are used to initialize daily simulation of the hydrodynamic river model and yield the 5-day forecast river level further downstream inside Bangladesh. The forecast river levels are then compared with the 5-day-later "now cast" simulation by the river model based on in-situ river level at the upstream boundary points in Bangladesh. Future directions for satellite-based forecasting of flow are also briefly overviewed.round tracks or virtual stations of JASON-2 (J2) altimeter over the GB basin shown in yellow lines. The locations where the track crosses a river and used for deriving forecasting rating curves is shown with a circle and station number (magenta- Brahmaputra basin; blue - Ganges basin). Circles without a station number represent the broader view of sampling by JASON-2 if all the ground tracks on main stem rivers and neighboring tributaries of Ganges and Brahmaputra are considered.

  9. Method and system for control of upstream flowfields of vehicle in supersonic or hypersonic atmospheric flight

    NASA Technical Reports Server (NTRS)

    Daso, Endwell O. (Inventor); Pritchett, II, Victor E. (Inventor); Wang, Ten-See (Inventor); Farr, Rebecca Ann (Inventor)

    2012-01-01

    The upstream flowfield of a vehicle traveling in supersonic or hypersonic atmospheric flight is actively controlled using attribute(s) experienced by the vehicle. Sensed attribute(s) include pressure along the vehicle's outer mold line, temperature along the vehicle's outer mold line, heat flux along the vehicle's outer mold line, and/or local acceleration response of the vehicle. A non-heated, non-plasma-producing gas is injected into an upstream flowfield of the vehicle from at least one surface location along the vehicle's outer mold line. The pressure of the gas so-injected is adjusted based on the attribute(s) so-sensed.

  10. Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

    PubMed Central

    Gilmartin, G M; Fleming, E S; Oetjen, J

    1992-01-01

    The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

  11. Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

    PubMed Central

    Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

    2006-01-01

    The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

  12. VIZARD: analysis of Affymetrix Arabidopsis GeneChip data

    NASA Technical Reports Server (NTRS)

    Moseyko, Nick; Feldman, Lewis J.

    2002-01-01

    SUMMARY: The Affymetrix GeneChip Arabidopsis genome array has proved to be a very powerful tool for the analysis of gene expression in Arabidopsis thaliana, the most commonly studied plant model organism. VIZARD is a Java program created at the University of California, Berkeley, to facilitate analysis of Arabidopsis GeneChip data. It includes several integrated tools for filtering, sorting, clustering and visualization of gene expression data as well as tools for the discovery of regulatory motifs in upstream sequences. VIZARD also includes annotation and upstream sequence databases for the majority of genes represented on the Affymetrix Arabidopsis GeneChip array. AVAILABILITY: VIZARD is available free of charge for educational, research, and not-for-profit purposes, and can be downloaded at http://www.anm.f2s.com/research/vizard/ CONTACT: moseyko@uclink4.berkeley.edu.

  13. Analysis of C. elegans VIG-1 expression.

    PubMed

    Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong

    2008-12-31

    Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.

  14. Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon

    PubMed Central

    Haut, Donald D.; Pintel, D. J.

    1998-01-01

    Alternative splicing of pre-mRNAs plays a critical role in maximizing the coding capacity of the small parvovirus genome. The small-intron region of minute virus of mice (MVM) pre-mRNAs undergoes an unusual pattern of overlapping alternative splicing—using two donors (D1 and D2) and two acceptors (A1 and A2) within a region of 120 nucleotides—that determines the steady-state ratios of the various viral mRNAs. In this report, we show that the determinants that govern excision of the small intron are complex and are also required for efficient definition of the upstream exon. For the MVM small intron in its natural context, the two donors appear to compete for the splicing machinery: the position of D1 favors its usage, while the primary sequence of D2 must be more like the consensus sequence than is D1 to be used efficiently. We have genetically defined the branch points that are used for generation of the major and minor spliced forms and show that recognition of components of the small-intron acceptors is likely to be the dominant determinant in alternative small-intron excision. We have also identified a G-rich intronic enhancer sequence within the small intron that is essential for splicing of the minor form (D2 to A2) but not the major form (D1 to A1) of MVM mRNAs and is required for efficient definition of the upstream NS2-specific exon. In its natural context, the small intron appears to be excised by a mechanism consistent with intron definition. When the MVM small intron is expanded, various parameters of its excision are altered, indicating that critical cis-acting signals are context dependent. Relative use of the donors and acceptors is altered, and the upstream NS2-specific exon is no longer efficiently defined. The fact that definition of the upstream NS2-specific exon can be achieved by the MVM small intron in its natural context, but not when it is expanded, suggests that the multiple determinants that govern definition and excision of the small intron are required, in concert, for upstream exon definition. Our data are consistent with a model in which alternative splicing of the MVM P4-generated pre-mRNAs is governed by a hybrid of intron- and exon-defining mechanisms. PMID:9499034

  15. Measurement of turbulent flow upstream and downstream of a circular pipe bend

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sakakibara, Jun; Machida, Nobuteru

    2012-04-15

    We measured velocity distribution in cross sections of a fully developed turbulent pipe flow upstream and downstream of a 90 degree sign bend by synchronizing two sets of a particle image velocimetry (PIV) system. Unsteady undulation of Dean vortices formed downstream from the bend was characterized by the azimuthal position of the stagnation point found on the inner and outer sides of the bend. Linear stochastic estimation was applied to capture the upstream flow field conditioned by the azimuthal location of the stagnation point downstream from the bend. When the inner-side stagnation point stayed below (above) the symmetry plane, themore » conditional streamwise velocity upstream from the bend exhibited high-speed streaks extended in a quasi-streamwise direction on the outer side of the curvature above (below) the symmetry plane.« less

  16. Genetic diversity among the Eurytemora affinis species complex in the Scheldt estuary and its tributaries using ISSR-PCR marker assay

    NASA Astrophysics Data System (ADS)

    Gasmi, S.; Ferval, M.; Pelissier, C.; D'Amico, F.; Maris, T.; Tackx, M.; Legal, L.

    2014-05-01

    As an estuary being restored, the Scheldt (Belgium/The Netherlands) offers an interesting setting to study the response of organisms and ecosystems to changing conditions. This study specifically deals with this with regard to the spatio-temporal distribution and possible genetic differentiation among the species complex Eurytemora affinis (copepoda, calanoida). Until the 1990s, E. affinis typically occurred downstream the Scheldt estuary (Belgium/The Netherlands). In parallel to water quality improvement, E.affinis has recently also occurred upstream the estuary and in some of the tributaries. This paper aims to assess the origin of the copepod sibling species complex E. affinis occurring upstream the Scheldt estuary through genetic characterization. Using the Inter Simple Sequence Repeat (ISSR) technique, we explored genetic pools of the E. affinis complex in three Scheldt localities (downstream, middle-estuary and upstream) and two of its tributaries. Four ISSR primers produced 75 polymorphic loci. Bayesian and hierarchical analysis revealed different but close genetic entities in both down and upstream localities. The middle-estuary individuals were genetically a composite mix of downstream and upstream populations (84% from downstream and 16% from upstream). A distinctive separation of the tributaries and the main Scheldt stream populations suggests that two fully independent genetic pools are present. It is of note that the tributaries showed a lack of genetic subdivision, that upstream and downstream E. affinis populations are closely related, and that the downstream population is most likely at the origin of the upstream one, which implies the necessity to guarantee sufficient oxygen concentration levels throughout the estuarine continuum to guarantee the presence of this species upstream. The results of the ISSR technique are discussed in comparison with genetic studies on E. affinis using COI barcoding.

  17. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    PubMed

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  18. A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

    PubMed Central

    Zock, C; Iselt, A; Doerfler, W

    1993-01-01

    Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

  19. SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

    PubMed Central

    Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

    2007-01-01

    Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

  20. Novel Plasmid-Encoded Ceftazidime-Hydrolyzing CTX-M-53 Extended-Spectrum β-Lactamase from Salmonella enterica Serotypes Westhampton and Senftenberg▿

    PubMed Central

    Doublet, Benoît; Granier, Sophie A.; Robin, Frédéric; Bonnet, Richard; Fabre, Laëtitia; Brisabois, Anne; Cloeckaert, Axel; Weill, François-Xavier

    2009-01-01

    We describe the characterization of a novel CTX-M β-lactamase from Salmonella enterica. Four S. enterica isolates (three of serotype Westhampton and one of serotype Senftenberg) resistant to extended-spectrum cephalosporins (cefotaxime and ceftazidime) were recovered in 2004 from living cockles in three supermarkets located in distant geographic areas in France, which got their supplies from the same fishery. The isolates were found to produce a novel extended-spectrum β-lactamase (ESBL) belonging to the CTX-M-1 phylogenetic group and named CTX-M-53. The CTX-M-53 β-lactamase harbored the substitution Asp240Gly, like the CTX-M-15 enzyme, which is specifically implicated in a higher catalytic efficiency against ceftazidime. The blaCTX-M-53 gene was located on a mobilizable 11-kb plasmid, pWES-1. The complete sequence of pWES-1 revealed the presence of a novel insertion sequence, ISSen2, and an IS26 element upstream and downstream of the blaCTX-M-53 gene, respectively; however, transposition assays of the blaCTX-M-53 gene were unsuccessful. IS26 elements may have contributed to the acquisition of the blaCTX-M-53 gene. Interestingly, the mobilization module of the pWES-1 plasmid was similar to that of quinolone resistance plasmids (carrying the qnrS2 gene) from aquatic sources. Although belonging to two serotypes differentiated on the basis of the O-antigen structure (E1 or E4 groups), the isolates were found to be genetically indistinguishable by pulsed-field gel electrophoresis. Multilocus sequence typing showed that the isolates of serotype Westhampton had a sequence type, ST14, common among isolates of serotype Senftenberg. This is the first characterization of the CTX-M-53 ESBL, which represents an additional ceftazidime-hydrolyzing CTX-M enzyme. PMID:19273683

  1. KpnBI is the prototype of a new family (IE) of bacterial type I restriction-modification system

    PubMed Central

    Chin, V.; Valinluck, V.; Magaki, S.; Ryu, J.

    2004-01-01

    KpnBI is a restriction-modification (R-M) system recognized in the GM236 strain of Klebsiella pneumoniae. Here, the KpnBI modification genes were cloned into a plasmid using a modification expression screening method. The modification genes that consist of both hsdM (2631 bp) and hsdS (1344 bp) genes were identified on an 8.2 kb EcoRI chromosomal fragment. These two genes overlap by one base and share the same promoter located upstream of the hsdM gene. Using recently developed plasmid R-M tests and a computer program RM Search, the DNA recognition sequence for the KpnBI enzymes was identified as a new 8 nt sequence containing one degenerate base with a 6 nt spacer, CAAANNNNNNRTCA. From Dam methylation and HindIII sensitivity tests, the methylation loci were predicted to be the italicized third adenine in the 5′ specific region and the adenine opposite the italicized thymine in the 3′ specific region. Combined with previous sequence data for hsdR, we concluded that the KpnBI system is a typical type I R-M system. The deduced amino acid sequences of the three subunits of the KpnBI system show only limited homologies (25 to 33% identity) at best, to the four previously categorized type I families (IA, IB, IC, and ID). Furthermore, their identity scores to other uncharacterized putative genome type I sequences were 53% at maximum. Therefore, we propose that KpnBI is the prototype of a new ‘type IE’ family. PMID:15475385

  2. Structural analysis of two length variants of the rDNA intergenic spacer from Eruca sativa.

    PubMed

    Lakshmikumaran, M; Negi, M S

    1994-03-01

    Restriction enzyme analysis of the rRNA genes of Eruca sativa indicated the presence of many length variants within a single plant and also between different cultivars which is unusual for most crucifers studied so far. Two length variants of the rDNA intergenic spacer (IGS) from a single individual E. sativa (cv. Itsa) plant were cloned and characterized. The complete nucleotide sequences of both the variants (3 kb and 4 kb) were determined. The intergenic spacer contains three families of tandemly repeated DNA sequences denoted as A, B and C. However, the long (4 kb) variant shows the presence of an additional repeat, denoted as D, which is a duplication of a 224 bp sequence just upstream of the putative transcription initiation site. Repeat units belonging to the three different families (A, B and C) were in the size range of 22 to 30 bp. Such short repeat elements are present in the IGS of most of the crucifers analysed so far. Sequence analysis of the variants (3 kb and 4 kb) revealed that the length heterogeneity of the spacer is located at three different regions and is due to the varying copy numbers of repeat units belonging to families A and B. Length variation of the spacer is also due to the presence of a large duplication (D repeats) in the 4 kb variant which is absent in the 3 kb variant. The putative transcription initiation site was identified by comparisons with the rDNA sequences from other plant species.

  3. Mutant swarms of a totivirus-like entities are present in the red macroalga Chondrus crispus and have been partially transferred to the nuclear genome.

    PubMed

    Rousvoal, Sylvie; Bouyer, Betty; López-Cristoffanini, Camilo; Boyen, Catherine; Collén, Jonas

    2016-08-01

    Chondrus crispus Stackhouse (Gigartinales) is a red seaweed found on North Atlantic rocky shores. Electrophoresis of RNA extracts showed a prominent band with a size of around 6,000 bp. Sequencing of the band revealed several sequences with similarity to totiviruses, double-stranded RNA viruses that normally infect fungi. This virus-like entity was named C. crispus virus (CcV). It should probably be regarded as an extreme viral quasispecies or a mutant swarm since low identity (<65%) was found between sequences. Totiviruses typically code for two genes: one capsid gene (gag) and one RNA-dependent RNA polymerase gene (pol) with a pseudoknot structure between the genes. Both the genes and the intergenic structures were found in the CcV sequences. A nonidentical gag gene was also found in the nuclear genome of C. crispus, with associated expressed sequence tags (EST) and upstream regulatory features. The gene was presumably horizontally transferred from the virus to the alga. Similar dsRNA bands were seen in extracts from different life cycle stages of C. crispus and from all geographic locations tested. In addition, similar bands were also observed in RNA extractions from other red algae; however, the significance of this apparently widespread phenomenon is unknown. Neither phenotype caused by the infection nor any virus particles or capsid proteins were identified; thus, the presence of viral particles has not been validated. These findings increase the known host range of totiviruses to include marine red algae. © 2016 Phycological Society of America.

  4. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    PubMed

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

    PubMed

    Zhang, Chun; Feng, Li; Tian, Xing-Shan

    2018-04-26

    The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

  6. Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

    PubMed Central

    Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

    2007-01-01

    Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

  7. Nucleotide sequence of the beta-lactamase gene from Enterococcus faecalis HH22 and its similarity to staphylococcal beta-lactamase genes.

    PubMed Central

    Zscheck, K K; Murray, B E

    1991-01-01

    The nucleotide sequence of the constitutively produced beta-lactamase (Bla) gene from Enterococcus faecalis HH22 was shown to be identical to the published sequences of three of four staphylococcal type A beta-lactamase genes; more differences were seen with the genes for staphylococcal type C and D enzymes. One hundred forty nucleotides upstream of the beta-lactamase start codon were determined for an inducible staphylococcal beta-lactamase and were identical to those of the constitutively expressed enterococcal gene, indicating that the changes resulting in constitutive expression are not due to changes in the promoter or operator region. Moreover, complementation studies indicated that production of the enterococcal enzyme could be repressed. The genes for the enterococcal Bla and an inducible staphylococcal Bla were each cloned into a shuttle vector and transformed into enterococcal and staphylococcal recipients. The major difference between the backgrounds of the two hosts was that more enzyme was produced by the staphylococcal host, regardless of the source of the gene. The location of the enzyme was found to be host dependent, since each cloned gene generated extracellular (free) enzyme in the staphylococcus and cell-bound enzyme in the enterococcus. On the basis of the identities of the enterococcal Bla and several staphylococcal Bla sequences, these data suggest the recent spread of beta-lactamase to enterococci and also suggest the loss of a functional repressor. PMID:1952840

  8. Transcription Start Site Evolution in Drosophila

    PubMed Central

    Main, Bradley J.; Smith, Andrew D.; Jang, Hyosik; Nuzhdin, Sergey V.

    2013-01-01

    Transcription start site (TSS) evolution remains largely undescribed in Drosophila, likely due to limited annotations in non-melanogaster species. In this study, we introduce a concise new method that selectively sequences from the 5′-end of mRNA and used it to identify TSS in four Drosophila species, including Drosophila melanogaster, D. simulans, D. sechellia, and D. pseudoobscura. For verification, we compared our results in D. melanogaster with known annotations, published 5′-rapid amplification of cDNA ends data, and with RNAseq from the same mRNA pool. Then, we paired 2,849 D. melanogaster TSS with its closest equivalent TSS in each species (likely to be its true ortholog) using the available multiple sequence alignments. Most of the D. melanogaster TSSs were successfully paired with an ortholog in each species (83%, 86%, and 55% for D. simulans, D. sechellia, and D. pseudoobscura, respectively). On the basis of the number and distribution of reads mapped at each TSS, we also estimated promoter-specific expression (PSE) and TSS peak shape, respectively. Among paired TSS orthologs, the location and promoter activity were largely conserved. TSS location appears important as PSE, and TSS peak shape was more frequently divergent among TSS that had moved. Unpaired TSS were surprisingly common in D. pseudoobscura. An increased mutation rate upstream of TSS might explain this pattern. We found an enrichment of ribosomal protein genes among diverged TSS, suggesting that TSS evolution is not uniform across the genome. PMID:23649539

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schwab, Ryan S.; Ihnatovych, Ivanna; Yunus, Sharifah Z.S.A.

    Myosin IC is a single headed member of the myosin superfamily that localizes to the cytoplasm and the nucleus, where it is involved in transcription by RNA polymerases I and II, intranuclear transport, and nuclear export. In mammalian cells, three isoforms of myosin IC are expressed that differ only in the addition of short isoform-specific N-terminal peptides. Despite the high sequence homology, the isoforms show differences in cellular distribution, in localization to nuclear substructures, and in their interaction with nuclear proteins through yet unknown mechanisms. In this study, we used EGFP-fusion constructs that express truncated or mutated versions of myosinmore » IC isoforms to detect regions that are involved in isoform-specific localization. We identified two nucleolar localization signals (NoLS). One NoLS is located in the myosin IC isoform B specific N-terminal peptide, the second NoLS is located upstream of the neck region within the head domain. We demonstrate that both NoLS are functional and necessary for nucleolar localization of specifically myosin IC isoform B. Our data provide a first mechanistic explanation for the observed functional differences between the myosin IC isoforms and are an important step toward our understanding of the underlying mechanisms that regulate the various and distinct functions of myosin IC isoforms. - Highlights: ► Two NoLS have been identified in the myosin IC isoform B sequence. ► Both NoLS are necessary for myosin IC isoform B specific nucleolar localization. ► First mechanistic explanation of functional differences between the isoforms.« less

  10. Transcriptional Analysis of the vanC Cluster from Enterococcus gallinarum Strains with Constitutive and Inducible Vancomycin Resistance

    PubMed Central

    Panesso, Diana; Abadía-Patiño, Lorena; Vanegas, Natasha; Reynolds, Peter E.; Courvalin, Patrice; Arias, Cesar A.

    2005-01-01

    The vanC glycopeptide resistance gene cluster encodes enzymes required for synthesis of peptidoglycan precursors ending in d-Ala-d-Ser. Enterococcus gallinarum BM4174 and SC1 are constitutively and inducibly resistant to vancomycin, respectively. Analysis of peptidoglycan precursors in both strains indicated that UDP-MurNAc-tetrapeptide and UDP-MurNAc-pentapeptide[d-Ser] were synthesized in E. gallinarum SC1 only in the presence of vancomycin (4 μg/ml), whereas the “resistance” precursors accumulated in the cytoplasm of BM4174 cells under both inducing and noninducing conditions. Northern hybridization and reverse transcription-PCR experiments revealed that all the genes from the cluster, vanC-1, vanXYC, vanT, vanRC, and vanSC, were transcribed from a single promoter. In the inducible SC1 isolate, transcriptional regulation appeared to be responsible for inducible expression of resistance. Promoter mapping in E. gallinarum BM4174 revealed that the transcriptional start site was located 30 nucleotides upstream from vanC-1 and that the −10 promoter consensus sequence had high identity with that of the vanA cluster. Comparison of the deduced sequence of the vanSC genes from isolates with constitutive and inducible resistance revealed several amino acid substitutions located in the X box (R200L) and in the region between the F and G2 boxes (D312N, D312A, and G320S) of the putative sensor kinase proteins from isolates with constitutive resistance. PMID:15728903

  11. Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

    PubMed Central

    Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

    2013-01-01

    In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

  12. Genomic organization and chromosomal localization of the gene TCF15 encoding the early mesodermal basic helix-loop-helix factor bHLH-EC2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hidai, H.; Quertermous, E.E.; Quertermous, T.

    1995-12-10

    bHLH-EC2 is a recently characterized member of a growing family of basic helix-loop-helix transcription factors. This family includes bHLH factors such as twist, which appear to be primarily involved in early mesodermal differentiation, and bHLH factors such as TAL-1, which have been characterized through their association with chromosomal breakpoints associated with T-cell leukemias. To provide for studies aimed at understanding the genetic regulation of bHLH-EC2, we have characterized the organization of this gene and conducted preliminary studies of the transcriptional activity of the upstream promoter region. The mouse bHLH-EC2 gene was found to consist of two exons separated by amore » 5-kb intron, an organization pattern similar to the mouse twist gene. The transcription initiation site was identified by RNase protection assay and primer extension analysis. Linked promoter-reporter gene transfection experiments in cultured cells indicated that while the identified upstream sequence can function to promote transcription, it does not function in a cell-specific fashion. To investigate the possible association of bHLH-EC2 with hematological malignancy, the chromosomal location of this gene in the human was mapped by fluorescence in situ hybridization and assigned to chromosome band 20p13. 16 refs., 3 figs.« less

  13. Organizational differences between cytoplasmic male sterile and male fertile Brassica mitochondrial genomes are confined to a single transposed locus.

    PubMed Central

    L'Homme, Y; Brown, G G

    1993-01-01

    Comparison of the physical maps of male fertile (cam) and male sterile (pol) mitochondrial genomes of Brassica napus indicates that structural differences between the two mtDNAs are confined to a region immediately upstream of the atp6 gene. Relative to cam mtDNA, pol mtDNA possesses a 4.5 kb segment at this locus that includes a chimeric gene that is cotranscribed with atp6 and lacks an approximately 1kb region located upstream of the cam atp6 gene. The 4.5 kb pol segment is present and similarly organized in the mitochondrial genome of the common nap B.napus cytoplasm; however, the nap and pol DNA regions flanking this segment are different and the nap sequences are not expressed. The 4.5 kb CMS-associated pol segment has thus apparently undergone transposition during the evolution of the nap and pol cytoplasms and has been lost in the cam genome subsequent to the pol-cam divergence. This 4.5 kb segment comprises the single DNA region that is expressed differently in fertile, pol CMS and fertility restored pol cytoplasm plants. The finding that this locus is part of the single mtDNA region organized differently in the fertile and male sterile mitochondrial genomes provides strong support for the view that it specifies the pol CMS trait. Images PMID:8388101

  14. Evolutionary differences in chromosomal locations of four early genes of the tryptophan pathway in fluorescent pseudomonads: DNA sequences and characterization of Pseudomonas putida trpE and trpGDC.

    PubMed

    Essar, D W; Eberly, L; Crawford, I P

    1990-02-01

    Pseudomonas putida possesses seven structural genes for enzymes of the tryptophan pathway. All but one, trpG, which encodes the small (beta) subunit of anthranilate synthase, have been mapped on the circular chromosome. This report describes the cloning and sequencing of P. putida trpE, trpG, trpD, and trpC. In P. putida and Pseudomonas aeruginosa, DNA sequence analysis as well as growth and enzyme assays of insertionally inactivated strains indicated that trpG is the first gene in a three-gene operon that also contains trpD and trpC. In P. putida, trpE is 2.2 kilobases upstream from the trpGDC cluster, whereas in P. aeruginosa, they are separated by at least 25 kilobases (T. Shinomiya, S. Shiga, and M. Kageyama, Mol. Gen. Genet., 189:382-389, 1983). The DNA sequence in P. putida shows an open reading frame on the opposite strand between trpE and trpGDC; this putative gene was not characterized. Evidence is also presented for sequence similarities in the 5' untranslated regions of trpE and trpGDC in both pseudomonads; the function of these regions is unknown, but it is possible that they play some role in regulation of these genes, since all the genes respond to repression by tryptophan. The sequences of the anthranilate synthase genes in the fluorescent pseudomonads resemble those of p-aminobenzoate synthase genes of the enteric bacteria more closely than the anthranilate synthase genes of those organisms; however, no requirement for p-aminobenzoate was found in the Pseudomonas mutants created in this study.

  15. Prototype foamy virus envelope glycoprotein leader peptide processing is mediated by a furin-like cellular protease, but cleavage is not essential for viral infectivity.

    PubMed

    Duda, Anja; Stange, Annett; Lüftenegger, Daniel; Stanke, Nicole; Westphal, Dana; Pietschmann, Thomas; Eastman, Scott W; Linial, Maxine L; Rethwilm, Axel; Lindemann, Dirk

    2004-12-01

    Analogous to cellular glycoproteins, viral envelope proteins contain N-terminal signal sequences responsible for targeting them to the secretory pathway. The prototype foamy virus (PFV) envelope (Env) shows a highly unusual biosynthesis. Its precursor protein has a type III membrane topology with both the N and C terminus located in the cytoplasm. Coexpression of FV glycoprotein and interaction of its leader peptide (LP) with the viral capsid is essential for viral particle budding and egress. Processing of PFV Env into the particle-associated LP, surface (SU), and transmembrane (TM) subunits occur posttranslationally during transport to the cell surface by yet-unidentified cellular proteases. Here we provide strong evidence that furin itself or a furin-like protease and not the signal peptidase complex is responsible for both processing events. N-terminal protein sequencing of the SU and TM subunits of purified PFV Env-immunoglobulin G immunoadhesin identified furin consensus sequences upstream of both cleavage sites. Mutagenesis analysis of two overlapping furin consensus sequences at the PFV LP/SU cleavage site in the wild-type protein confirmed the sequencing data and demonstrated utilization of only the first site. Fully processed SU was almost completely absent in viral particles of mutants having conserved arginine residues replaced by alanines in the first furin consensus sequence, but normal processing was observed upon mutation of the second motif. Although these mutants displayed a significant loss in infectivity as a result of reduced particle release, no correlation to processing inhibition was observed, since another mutant having normal LP/SU processing had a similar defect.

  16. The effect of wing dihedral and section suction distribution on vortex bursting

    NASA Technical Reports Server (NTRS)

    Washburn, K. E.; Gloss, B. B.

    1975-01-01

    Eleven semi-span wing models were tested in the 1/8-scale model of the Langley V/STOL tunnel to qualitatively study vortex bursting. Flow visualization was achieved by using helium filled soap bubbles introduced upstream of the model. The angle of attack range was from 0 deg to 45 deg. The results show that the vortex is unstable, that is, the bursting point location is not fixed at a given angle of attack but moves within certain bounds. Upstream of the trailing edge, the bursting point location has a range of two inches; downstream, the range is about six inches. Anhedral and dihedral appear to have an insignificant effect on the vortex and its bursting point location. Altering the section suction distribution by improving the triangularity generally increases the angle of attack at which vortex bursting occurs at the trailing edge.

  17. Requirements, model and prototype for a multi-utility locational and security information hub.

    DOT National Transportation Integrated Search

    2015-11-01

    This project lays the foundation for building an exchange hub for locational and security data and risk assessment of potential excavation work. It acts primarily at 2 stages: upstream of the mark-out process, as a decision support tool to help strea...

  18. A revised velocity-reversal and sediment-sorting model for a high-gradient, pool-riffle stream

    USGS Publications Warehouse

    Thompson, D.M.; Wohl, E.E.; Jarrett, R.D.

    1996-01-01

    Sediment-sorting processes related to varying channel-bed morphology were investigated from April to November 1993 along a 1-km pool-riffle and step-pool reach of North Saint Vrain Creek, a small mountain stream in the Rocky Mountains of northern Colorado. Measured cross-sectional areas of flow were used to suggest higher velocities in pools than in riffles at high flow. Three hundred and sixteen tracer particles, ranging in size from 16 mm to 256 mm, were placed in two separate pool-riffle-pool sequences and used to assess sediment-sorting patterns and sediment-transport competence variations. Tracer-particle depositional evidence indicated higher sediment-transport competence in pools than in riffles at high flow. Pool-riffle sediment sorting may be created by velocity reversals, and more localized sorting results from gravitational forces along the upstream sloping portion of the channel bed located at the downstream end of pools.

  19. Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

    PubMed

    Kim, K H; Hemenway, C

    1997-05-26

    The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

  20. Co-evolving Physical and Biological Organization in Step-pool Channels: Experiments from a Restoration Reach on Wildcat Creek, California

    NASA Astrophysics Data System (ADS)

    Chin, A.; O'Dowd, A. P.; Mendez, P. K.; Velasco, K. Z.; Leventhal, R. D.; Storesund, R.; Laurencio, L. R.

    2014-12-01

    Step-pools are important features in fluvial systems. Through energy dissipation, step-pools provide stability in high-energy environments that otherwise may erode and degrade. Although research has focused on geomorphological aspects of step-pool channels, the ecological significance of step-pool streams is increasingly recognized. Step-pool streams often contain higher density and diversity of benthic macroinvertebrates and are critical habitats for organisms such as salmonids and tailed frogs. Step-pools are therefore increasingly used to restore eroding channels and improve ecological conditions. This paper addresses a restoration reach of Wildcat Creek in Berkeley, California that featured an installation of step-pools in 2012. The design framework recognized step-pool formation as a self-organizing process that produces a rhythmic morphology. After placing step particles at locations where step-pools are expected to form according to hydraulic theory, the self-organizing approach allowed fluvial processes to refine the rocks into adjusted sequences over time. In addition, a 30-meter "experimental" reach was created to explore the co-evolution of geomorphological and ecological characteristics. After constructing a plane bed channel, boulders and cobbles piled at the upstream end allowed natural flows to mobilize and sort them into step-pool sequences. Ground surveys and LiDAR recorded the development of step-pool sequences over several seasons. Concurrent sampling of benthic macroinvertebrates documented the formation of biological communities in conjunction with habitat. Biological sampling in an upstream reference reach provided a comparison with the restored reach over time. Results to date show an emergent step-pool channel with steps that segment the plane bed into initial step and pool habitats. Biological communities are beginning to form, showing more distinction among habitat types during some seasons, although they do not yet approach reference values at this stage of development. Research over longer timeframes is needed to reveal how biological and physical characteristics may co-organize toward an equilibrium landscape. Such integrated understanding will assist development of innovative restoration designs.

  1. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

    PubMed

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

  2. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature

    PubMed Central

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895

  3. A structural variant in the 5’-flanking region of the TWIST2 gene affects melanocyte development in belted cattle

    PubMed Central

    Drögemüller, Cord; Jagannathan, Vidhya; Keller, Irene; Wüthrich, Daniel; Bruggmann, Rémy; Schütz, Ekkehard; Demmel, Steffi; Moser, Simon; Signer-Hasler, Heidi; Pieńkowska-Schelling, Aldona; Schelling, Claude; Sande, Marcos; Rongen, Ronald

    2017-01-01

    Belted cattle have a circular belt of unpigmented hair and skin around their midsection. The belt is inherited as a monogenic autosomal dominant trait. We mapped the causative variant to a 37 kb segment on bovine chromosome 3. Whole genome sequence data of 2 belted and 130 control cattle yielded only one private genetic variant in the critical interval in the two belted animals. The belt-associated variant was a copy number variant (CNV) involving the quadruplication of a 6 kb non-coding sequence located approximately 16 kb upstream of the TWIST2 gene. Increased copy numbers at this CNV were strongly associated with the belt phenotype in a cohort of 333 cases and 1322 controls. We hypothesized that the CNV causes aberrant expression of TWIST2 during neural crest development, which might negatively affect melanoblasts. Functional studies showed that ectopic expression of bovine TWIST2 in neural crest in transgenic zebrafish led to a decrease in melanocyte numbers. Our results thus implicate an unsuspected involvement of TWIST2 in regulating pigmentation and reveal a non-coding CNV underlying a captivating Mendelian character. PMID:28658273

  4. Real-Time Sequence-Validated Loop-Mediated Isothermal Amplification Assays for Detection of Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

    PubMed Central

    Bhadra, Sanchita; Jiang, Yu Sherry; Kumar, Mia R.; Johnson, Reed F.; Hensley, Lisa E.; Ellington, Andrew D.

    2015-01-01

    The Middle East respiratory syndrome coronavirus (MERS-CoV), an emerging human coronavirus, causes severe acute respiratory illness with a 35% mortality rate. In light of the recent surge in reported infections we have developed asymmetric five-primer reverse transcription loop-mediated isothermal amplification (RT-LAMP) assays for detection of MERS-CoV. Isothermal amplification assays will facilitate the development of portable point-of-care diagnostics that are crucial for management of emerging infections. The RT-LAMP assays are designed to amplify MERS-CoV genomic loci located within the open reading frame (ORF)1a and ORF1b genes and upstream of the E gene. Additionally we applied one-step strand displacement probes (OSD) for real-time sequence-specific verification of LAMP amplicons. Asymmetric amplification effected by incorporating a single loop primer in each assay accelerated the time-to-result of the OSD-RT-LAMP assays. The resulting assays could detect 0.02 to 0.2 plaque forming units (PFU) (5 to 50 PFU/ml) of MERS-CoV in infected cell culture supernatants within 30 to 50 min and did not cross-react with common human respiratory pathogens. PMID:25856093

  5. Modulation of tissue repair by regeneration enhancer elements.

    PubMed

    Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

    2016-04-14

    How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

  6. Translation of the mRNA of the maize transcriptional activator Opaque-2 is inhibited by upstream open reading frames present in the leader sequence.

    PubMed Central

    Lohmer, S; Maddaloni, M; Motto, M; Salamini, F; Thompson, R D

    1993-01-01

    The protein encoded by the Opaque-2 (O2) gene is a transcription factor, translated from an mRNA that possesses an unusually long 5' leader sequence containing three upstream open reading frames (uORFs). The efficiency of translation of O2 mRNA has been tested in vivo by a transient assay in which the level of activation of the b32 promoter, a natural target of O2 protein, is measured. We show that uORF-less O2 alleles possess a higher transactivation value than the wild-type allele and that the reduction in transactivation due to the uORFs is a cis-dominant effect. The data presented indicate that both uORF1 and uORF2 are involved in the reducing effect and suggest that both are likely to be translated. PMID:8439744

  7. Human Promoters Are Intrinsically Directional

    PubMed Central

    Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe

    2015-01-01

    Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469

  8. Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

    PubMed

    Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

    2017-11-01

    Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

    PubMed Central

    Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

    2014-01-01

    The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

  10. In vivo and in vitro neurochemical-based assessments of wastewater effluents from the Maumee River area of concern.

    EPA Science Inventory

    Fathead minnows (Pimephales promelas) were caged for four days at multiple locations upstream and downstream of a wastewater treatment plant (WWTP) discharge into the Maumee River (USA, OH). Grab water samples collected at the same location were extracted using several different ...

  11. 33 CFR 165.810 - Mississippi River, LA-regulated navigation area.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    .... (c) Movement of vessels in vicinity of Algiers Point, New Orleans Harbor: (1) Control lights. When... green lights designated and located as follows: Governor Nicholls Light located on the left descending bank on the wharf shed at the upstream end of Esplanade Avenue Wharf, New Orleans, approximately 94.3...

  12. Transcripts of the NADH-dehydrogenase subunit 3 gene are differentially edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Wissinger, B; Unseld, M; Brennicke, A

    1990-01-01

    A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531

  13. Myotonin protein-kinase [AGC]n trinucleotide repeat in seven nonhuman primates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Novelli, G.; Sineo, L.; Pontieri, E.

    Myotonic dystrophy (DM) is due to a genomic instability of a trinucleotide [AGC]n motif, located at the 3{prime} UTR region of a protein-kinase gene (myotonin protein kinase, MT-PK). The [AGC] repeat is meiotically and mitotically unstable, and it is directly related to the manifestations of the disorder. Although a gene dosage effect of the MT-PK has been demonstrated n DM muscle, the mechanism(s) by which the intragenic repeat expansion leads to disease is largely unknown. This non-standard mutational event could reflect an evolutionary mechanism widespread among animal genomes. We have isolated and sequenced the complete 3{prime}UTR region of the MT-PKmore » gene in seven primates (macaque, orangutan, gorilla, chimpanzee, gibbon, owl monkey, saimiri), and examined by comparative sequence nucleotide analysis the [AGC]n intragenic repeat and the surrounding nucleotides. The genomic organization, including the [AGC]n repeat structure, was conserved in all examined species, excluding the gibbon (Hylobates agilis), in which the [AGC]n upstream sequence (GGAA) is replaced by a GA dinucleotide. The number of [AGC]n in the examined species ranged between 7 (gorilla) and 13 repeats (owl monkeys), with a polymorphism informative content (PIC) similar to that observed in humans. These results indicate that the 3{prime}UTR [AGC] repeat within the MT-PK gene is evolutionarily conserved, supporting that this region has important regulatory functions.« less

  14. Preferential cleavage sites for Sau3A restriction endonuclease in human ribosomal DNA.

    PubMed

    Kupriyanova, N S; Kirilenko, P M; Netchvolodov, K K; Ryskov, A P

    2000-07-21

    Previous studies of cloned ribosomal DNA (rDNA) variants isolated from the cosmid library of human chromosome 13 have revealed some disproportion in representativity of different rDNA regions (N. S. Kupriyanova, K. K. Netchvolodov, P. M. Kirilenko, B. I. Kapanadze, N. K. Yankovsky, and A. P. Ryskov, Mol. Biol. 30, 51-60, 1996). Here we show nonrandom cleavage of human rDNA with Sau3A or its isoshizomer MboI under mild hydrolysis conditions. The hypersensitive cleavage sites were found to be located in the ribosomal intergenic spacer (rIGS), especially in the regions of about 5-5.5 and 11 kb upstream of the rRNA transcription start point. This finding is based on sequencing mapping of the rDNA insert ends in randomly selected cosmid clones of human chromosome 13 and on the data of digestion kinetics of cloned and noncloned human genomic rDNA with Sau3A and MboI. The results show that a methylation status and superhelicity state of the rIGS have no effect on cleavage site sensitivity. It is interesting that all primary cleavage sites are adjacent to or entering into Alu or Psi cdc 27 retroposons of the rIGS suggesting a possible role of neighboring sequences in nuclease accessibility. The results explain nonequal representation of rDNA sequences in the human genomic DNA library used for this study. Copyright 2000 Academic Press.

  15. Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

    PubMed Central

    Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

    1988-01-01

    We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

  16. A Novel Phenanthrene Dioxygenase from Nocardioides sp. Strain KP7: Expression in Escherichia coli

    PubMed Central

    Saito, Atsushi; Iwabuchi, Tokuro; Harayama, Shigeaki

    2000-01-01

    Nocardioides sp. strain KP7 grows on phenanthrene but not on naphthalene. This organism degrades phenanthrene via 1-hydroxy-2-naphthoate, o-phthalate, and protocatechuate. The genes responsible for the degradation of phenanthrene to o-phthalate (phd) were found by Southern hybridization to reside on the chromosome. A 10.6-kb DNA fragment containing eight phd genes was cloned and sequenced. The phdA, phdB, phdC, and phdD genes, which encode the α and β subunits of the oxygenase component, a ferredoxin, and a ferredoxin reductase, respectively, of phenanthrene dioxygenase were identified. The gene cluster, phdAB, was located 8.3 kb downstream of the previously characterized phdK gene, which encodes 2-carboxybenzaldehyde dehydrogenase. The phdCD gene cluster was located 2.9 kb downstream of the phdB gene. PhdA and PhdB exhibited moderate (less than 60%) sequence identity to the α and β subunits of other ring-hydroxylating dioxygenases. The PhdC sequence showed features of a [3Fe-4S] or [4Fe-4S] type of ferredoxin, not of the [2Fe-2S] type of ferredoxin that has been found in most of the reported ring-hydroxylating dioxygenases. PhdD also showed moderate (less than 40%) sequence identity to known reductases. The phdABCD genes were expressed poorly in Escherichia coli, even when placed under the control of strong promoters. The introduction of a Shine-Dalgarno sequence upstream of each initiation codon of the phdABCD genes improved their expression in E. coli. E. coli cells carrying phdBCD or phdACD exhibited no phenanthrene-degrading activity, and those carrying phdABD or phdABC exhibited phenanthrene-degrading activity which was significantly less than that in cells carrying the phdABCD genes. It was thus concluded that all of the phdABCD genes are necessary for the efficient expression of phenanthrene-degrading activity. The genetic organization of the phd genes, the phylogenetically diverged positions of these genes, and an unusual type of ferredoxin component suggest phenanthrene dioxygenase in Nocardioides sp. strain KP7 to be a new class of aromatic ring-hydroxylating dioxygenases. PMID:10735855

  17. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

    PubMed

    Levis, R; Schlesinger, S; Huang, H V

    1990-04-01

    Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

  18. Characterization of Cer-1 cis-regulatory region during early Xenopus development.

    PubMed

    Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

    2011-05-01

    Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

  19. Multiple splicing defects in an intronic false exon.

    PubMed

    Sun, H; Chasin, L A

    2000-09-01

    Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

  20. Suspended-sediment trapping in the tidal reach of an estuarine tributary channel

    USGS Publications Warehouse

    Downing-Kunz, Maureen; Schoellhamer, David H.

    2015-01-01

    Evidence of decreasing sediment supply to estuaries and coastal oceans worldwide illustrates the need for accurate and updated estimates. In the San Francisco Estuary (Estuary), recent research suggests a decrease in supply from its largest tributaries, implying the increasing role of smaller, local tributaries in sediment supply to this estuary. Common techniques for estimating supply from tributaries are based on gages located above head of tide, which do not account for trapping processes within the tidal reach. We investigated the effect of a tidal reach on suspended-sediment discharge for Corte Madera Creek, a small tributary of the Estuary. Discharge of water (Q) and suspended-sediment (SSD) were observed for 3 years at two locations along the creek: upstream of tidal influence and at the mouth. Comparison of upstream and mouth gages showed nearly 50 % trapping of upstream SSD input within the tidal reach over this period. At the storm time scale, suspended-sediment trapping efficiency varied greatly (range −31 to 93 %); storms were classified as low- or high-yield based on upstream SSD. As upstream peak Q increased, high-yield storms exhibited significantly decreased trapping. Tidal conditions at the mouth—ebb duration and peak ebb velocity—during storms had a minor effect on sediment trapping, suggesting fluvial processes dominate. Comparison of characteristic fluvial and tidal discharges at the storm time scale demonstrated longitudinal differences in the regulating process for SSD. These results suggest that SSD from gages situated above head of tide overestimate sediment supply to the open waters beyond tributary mouths and thus trapping processes within the tidal reach should be considered.

  1. Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

    PubMed

    Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

    2005-01-01

    We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

  2. Evolving force balance at Columbia Glacier, Alaska, during its rapid retreat

    USGS Publications Warehouse

    O'Neel, S.; Pfeffer, W.T.; Krimmel, R.; Meier, M.

    2005-01-01

    Changes in driving and resistive stresses play an essential role in governing the buoyancy forces that are important controls on the speed and irreversibility of tidewater glacier retreats. We describe changes in geometry, velocity, and strain rate and present a top-down force balance analysis performed over the lower reach of Columbia Glacier. Our analysis uses new measurements and estimates of basal topography and photogrammetric surface velocity measurements made between 1977 and 2001, while assuming depth-independent strain. Sensitivity tests show that the method is robust and insensitive to small changes in the calculation parameters. Spatial distributions of ice speed show little correspondence with driving stress. Instead, spatial patterns of ice speed exhibit a nonlinear correspondence with basal drag. Primary resistance to flow comes from basal drag, but lateral drag becomes increasingly more important throughout the retreat, which may account for observed increases in speed. Maximum basal drag is always located in a prominent constriction located ~12 km upstream from the preretreat terminus. Once the terminus retreated into deep water off the terminal moraine marking the modern maximum extent, the upstream location of this maximum basal drag helped to promote thinning and decrease effective pressure in the lower region by limiting replenishing ice flow from upstream. An increase in both ice velocity and calving resulted, initiating what appears to be an irreversible retreat. Copyright 2005 by the American Geophysical Union.

  3. Energies of backstreaming protons in the foreshock

    NASA Technical Reports Server (NTRS)

    Greenstadt, E. W.

    1976-01-01

    A predicted pattern of energy vs detector location in the cislunar region is displayed for protons of zero pitch angle traveling upstream away from the quasi-parallel bow shock. The pattern is implied by upstream wave boundary properties. In the solar ecliptic, protons are estimated to have a minimum of 1.1 times the solar wind bulk energy E sub SW when the wave boundary is in the early morning sector and a maximum of 8.2 E sub SW when the boundary is near the predawn flank.

  4. Pump CFD code validation tests

    NASA Technical Reports Server (NTRS)

    Brozowski, L. A.

    1993-01-01

    Pump CFD code validation tests were accomplished by obtaining nonintrusive flow characteristic data at key locations in generic current liquid rocket engine turbopump configurations. Data were obtained with a laser two-focus (L2F) velocimeter at scaled design flow. Three components were surveyed: a 1970's-designed impeller, a 1990's-designed impeller, and a four-bladed unshrouded inducer. Two-dimensional velocities were measured upstream and downstream of the two impellers. Three-dimensional velocities were measured upstream, downstream, and within the blade row of the unshrouded inducer.

  5. Operations Plans for Anadromous Fish Production Facilities in the Columbia River Basin, Volume II of V; 1992 Annual Report.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hutchison, Bill

    1993-05-01

    Clearwater Hatchery is located on the north bank of the North Fork of the Clearwater River, downstream from Dworshak Dam. It is approximately 72 miles from Lower Granite Dam, and 504 miles from the mouth of the Columbia River. Site elevation is approximately 994 feet above sea level. The hatchery is staffed with 7 FTE's. Clearwater Hatchery has two pipelines from Dworshak Reservoir. One is attached to a floating platform and is capable of providing various temperatures at varying depths. The other is a stationary intake about 245 feet below the top of the dam. All water is gravity fedmore » to the hatchery. An l8 inch intake pipe provides an estimated 10 cfs with temperature remaining constant at approximately 40 F. The primary 42-inch intake pipe can draw water from 5 to 45 feet in depth with temperatures ranging from 55 to 60 F and 70 cfs of flow. The hatchery facility consists of 11 chinook raceways, 24 steelhead raceways, 2 adult holding ponds, a covered spawning area with 2 live wells and 60 concrete rearing vats. There are 40 double stacks of Heath-type incubators and each vat also has an incubation jar. All facility units are in excellent condition. Clearwater Hatchery also supports satellite facilities at Red River, Crooked River and Powell. The Red River satellite facility is located approximately 15 miles east of Elk City, Idaho. It is approximately 186 miles upstream from Lower Granite Dam and 618 miles from the mouth of the Columbia River. It was first built in 1974 by the Columbia River Project and then remodeled by the U.S. Army Corps of Engineers in 1986. Red River is supplied by gravity flow from an intake located at the bottom of the South Fork of Red River, 225 yards upstream from the facility. Water rights allow for 10 cfs and during low flows in the summer about 5 cfs is available. Temperatures range from 40 F in the spring to 71 F in early August. The facility consists of two adult holding ponds, a removable tripod and panel weir, and a rearing pond. All units are in good condition due to the recent remodeling. The Crooked River satellite facility is located 20 miles downstream of Red River. The trap is located 0.5 miles upstream of the mouth of Crooked River, a tributary of the South Fork of the Clearwater River. The rearing ponds are 10 miles upstream from the Crooked River adult trap. Crooked River water is supplied by gravity flow by an intake 200 yards upstream of the facility raceways. Water rights allow for 10 cfs at the rearing facility and 10 cfs at the trapping facility. Water temperatures range from 42 to 70 F. The trap and weir are located at the mouth of Crooked River. Ten miles upstream from the mouth are two raceways, a cleaning waste pond and final settling pond. All facility units are in good condition. The Powell satellite facility is located 122 miles east of the Clear-water Hatchery at the headwaters of the Lochsa River, the confluence of the Crooked Fork Creek and White Sands Creek. Powell is 192.5 miles from Lower Granite Dam and 624 miles from the mouth of the Columbia River. The Powell Facility receives gravity flow water from Walton Creek at a rate of 7 cfs with the intake being located 100 yards upstream from the facility. Powell also has a pumped supply from White Sands Creek at 3 cfs. Water temperature ranges from 45.8 to 50.2 F from the Walton Creek intake and 41 to 65 F from the White Sands pump station. The facility consists of one rearing pond, a diversion and intake screen, two adult holding ponds, a floating weir, and an open bay spawning shelter. All facility units are in good condition.« less

  6. Identification of the promoter of the myelomonocytic leukocyte integrin CD11b.

    PubMed Central

    Hickstein, D D; Baker, D M; Gollahon, K A; Back, A L

    1992-01-01

    The CD11b (or macrophage-1 antigen; MAC-1) subunit of the leukocyte integrin family forms a noncovalently associated heterodimeric structure with the CD18 (beta) subunit on the surface of human granulocytes and monocyte/macrophages, where it enables these myeloid cells to participate in a variety of adherence-related activities. Expression of the CD11b subunit is restricted to cells of the myelomonocytic lineage and depends upon the stage of differentiation with the most mature myeloid cells expressing the highest levels of CD11b. To study the regulation of CD11b expression, a genomic clone corresponding to the 5' region of the CD11b gene was isolated from a human chromosome 16 library. Primer extension and RNase protection assays identified two major transcriptional start sites, located 90 base pairs and 54 base pairs upstream from the initiation methionine. DNA sequence analysis of 1.7 kilobases of the 5' flanking sequence of the CD11b gene indicated the absence of a "CAAT" or "TATA" box; however, potential binding sites for the transcription activators Sp1, PU.1, ets, and AP-2 are present, as well as retinoic acid response elements. The 1.7-kilobase CD11b promoter sequence displayed functional activity in transient transfection assays in the monocytic cell line THP-1 and the myeloid cell line HL-60. In contrast, this 1.7-kilobase promoter sequence did not display functional activity in the Jurkat T-lymphoid cell line. Detailed characterization of the CD11b promoter sequence should provide insight into the molecular events regulating the tissue-specific and developmental stage-specific expression of the CD11b molecule in myelomonocytic cells. Images PMID:1347945

  7. Regulation of Bacteria-Induced Intercellular Adhesion Molecule-1 by CCAAT/Enhancer Binding Proteins

    PubMed Central

    Manzel, Lori J.; Chin, Cecilia L.; Behlke, Mark A.; Look, Dwight C.

    2009-01-01

    Direct interaction between bacteria and epithelial cells may initiate or amplify the airway response through induction of epithelial defense gene expression by nuclear factor-κB (NF-κB). However, multiple signaling pathways modify NF-κB effects to modulate gene expression. In this study, the effects of CCAAT/enhancer binding protein (C/EBP) family members on induction of the leukocyte adhesion glycoprotein intercellular adhesion molecule-1 (ICAM-1) was examined in primary cultures of human tracheobronchial epithelial cells incubated with nontypeable Haemophilus influenzae. Increased ICAM-1 gene transcription in response to H. influenzae required gene sequences located at −200 to −135 in the 5′-flanking region that contain a C/EBP-binding sequence immediately upstream of the NF-κB enhancer site. Constitutive C/EBPβ was found to have an important role in epithelial cell ICAM-1 regulation, while the adjacent NF-κB sequence binds the RelA/p65 and NF-κB1/p50 members of the NF-κB family to induce ICAM-1 expression in response to H. influenzae. The expression of C/EBP proteins is not regulated by p38 mitogen-activated protein kinase activation, but p38 affects gene transcription by increasing the binding of TATA-binding protein to TATA-box–containing gene sequences. Epithelial cell ICAM-1 expression in response to H. influenzae was decreased by expressing dominant-negative protein or RNA interference against C/EBPβ, confirming its role in ICAM-1 regulation. Although airway epithelial cells express multiple constitutive and inducible C/EBP family members that bind C/EBP sequences, the results indicate that C/EBPβ plays a central role in modulation of NF-κB–dependent defense gene expression in human airway epithelial cells after exposure to H. influenzae. PMID:18703796

  8. Dissemination of blaOXA-58 in Proteus mirabilis isolates from Germany.

    PubMed

    Lange, Felix; Pfennigwerth, Niels; Gerigk, Sonja; Gohlke, Frank; Oberdorfer, Klaus; Purr, Ingvill; Wohanka, Nikolaus; Roggenkamp, Andreas; Gatermann, Sören G; Kaase, Martin

    2017-05-01

    Characterization of Proteus mirabilis isolates harbouring bla OXA-58 with emphasis on the genetic environment of this resistance determinant. Strains of P. mirabilis ( n  =   37) isolated from different patients were tested for the presence of bla OXA-58 . The genetic context of bla OXA-58 was determined by WGS of two strains and Sanger sequencing. Clonality of the strains was assessed by PFGE. Susceptibility testing was performed by microdilution according to EUCAST. Four strains isolated in different geographical regions of Germany were positive for bla OXA-58 , and WGS showed that this resistance gene was harboured on a plasmid. Sanger sequencing confirmed the presence of two nearly identical plasmids, 6219 and 6208 bp in size, in all four strains. Upstream of bla OXA-58 an IS Aba 3-like transposase gene was located. The P. mirabilis strains were not clonally related according to PFGE. MICs of meropenem for three of the strains were only just above the EUCAST breakpoint and the Carba NP test was positive for only two of the strains. To our knowledge, this is the first description of bla OXA-58 in the species P. mirabilis . The resistance gene is harboured by almost identical plasmids in strains not clonally related and from different geographical regions. Apart from an IS Aba 3-like transposase gene upstream of bla OXA-58 the genetic context is different from bla OXA-58 harboured on plasmids in the genus Acinetobacter . With MICs of meropenem well below the EUCAST breakpoint or only just above it and equivocal or false negative results from the Carba NP test, bla OXA-58 can be easily overlooked in P. mirabilis . © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

    PubMed

    Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

    1999-01-01

    In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

  10. A polymorphism upstream MIR1279 gene is associated with pericarditis development in Systemic Lupus Erythematosus and contributes to definition of a genetic risk profile for this complication.

    PubMed

    Ciccacci, C; Perricone, C; Politi, C; Rufini, S; Ceccarelli, F; Cipriano, E; Alessandri, C; Latini, A; Valesini, G; Novelli, G; Conti, F; Borgiani, P

    2017-07-01

    Recently, a study has shown that a polymorphism in the region of MIR1279 modulates the expression of the TRAF3IP2 gene. Since polymorphisms in the TRAF3IP2 gene have been described in association with systemic lupus erithematosus (SLE) susceptibility and with the development of pericarditis, our aim is to verify if the MIR1279 gene variability could also be involved. The rs1463335 SNP, located upstream MIR1279 gene, was analyzed by allelic discrimination assay in 315 Italian SLE patients and 201 healthy controls. Moreover, the MIR1279 gene was full sequenced in 50 patients. A case/control association study and a genotype/phenotype correlation analysis were performed. We also constructed a pericarditis genetic risk profile for patients with SLE. The full sequencing of the MIR1279 gene in patients with SLE did not reveal any novel or known variation. The variant allele of the rs1463335 SNP was significantly associated with susceptibility to pericarditis ( P = 0.017 and OR = 1.67). A risk profile model for pericarditis considering the risk alleles of MIR1279 and three other genes (STAT4, PTPN2 and TRAF3IP2) showed that patients with 4 or 5 risk alleles have a higher risk of developing pericarditis ( OR = 4.09 with P = 0.001 and OR = 6.04 with P = 0.04 respectively). In conclusion, we describe for the first time the contribution of a MIR1279 SNP in pericarditis development in patients with SLE and a genetic risk profile model that could be useful to identify patients more susceptible to developing pericarditis in SLE. This approach could help to improve the prediction and the management of this complication.

  11. Transition control of Mach to regular reflection induced interaction using an array of micro ramp vane-type vortex generators

    NASA Astrophysics Data System (ADS)

    Verma, Shashi B.; Chidambaranathan, Manisankar

    2015-10-01

    An experimental investigation has been conducted to favorably control/modify a Mach reflection induced interaction in a Mach 2.05 flow on a flat plate using an array of single row mechanical micro vane-type vortex generators (VGs). The objective was to study the variation in (i) control device configuration (trapezoidal and the split-trapezoidal or ramp vane-type), (ii) control device height (h/δ = 0.3, 0.5), and (iii) control location (X/δ = 9, 15 upstream of the interaction) in controlling the overall interaction. The primary aim was to investigate a control location and VG configuration which is able to effectively initiate a transition from Mach reflection to regular reflection with minimum changes to the separation characteristics for no control. While the trapezoidal configuration is seen to move the separation location upstream only slightly, the split-trapezoidal configurations result in a considerable upstream movement that is associated with significant reduction in separation shock strength. The latter flow modification causes the Mach stem to completely disappear resulting in a transition from Mach to regular reflection. The control location of X/δ = 15 seems to be most effective for all control device configurations tested. It is further observed that whilst the effectiveness of the split-trapezoidal configuration of h/δ = 0.3 in controlling the transition improves with increasing X/δ, increasing its height to h/δ = 0.5 not only controls the transition process but is also able to control the extent of separation. All the control devices, however, are seen to increase the flow unsteadiness in the intermittent region of separation for both control locations. From this perspective, increasing the height of the control device seems favorable for the closer control location as it not only completely modifies the Mach reflection but also keeps the peak rms value similar to the baseline case.

  12. Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

    2010-10-15

    Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

  13. Processing of the 5'-UTR and existence of protein factors that regulate translation of tobacco chloroplast psbN mRNA.

    PubMed

    Kuroda, Hiroshi; Sugiura, Masahiro

    2014-12-01

    The chloroplast psbB operon includes five genes encoding photosystem II and cytochrome b 6 /f complex components. The psbN gene is located on the opposite strand. PsbN is localized in the thylakoid and is present even in the dark, although its level increases upon illumination and then decreases. However, the translation mechanism of the psbN mRNA remains unclear. Using an in vitro translation system from tobacco chloroplasts and a green fluorescent protein as a reporter protein, we show that translation occurs from a tobacco primary psbN 5'-UTR of 47 nucleotides (nt). Unlike many other chloroplast 5'-UTRs, the psbN 5'-UTR has two processing sites, at -39 and -24 upstream from the initiation site. Processing at -39 enhanced the translation rate fivefold. In contrast, processing at -24 did not affect the translation rate. These observations suggest that the two distinct processing events regulate, at least in part, the level of PsbN during development. The psbN 5'-UTR has no Shine-Dalgarno (SD)-like sequence. In vitro translation assays with excess amounts of the psbN 5'-UTR or with deleted psbN 5'-UTR sequences demonstrated that protein factors are required for translation and that their binding site is an 18 nt sequence in the 5'-UTR. Mobility shift assays using 10 other chloroplast 5'-UTRs suggested that common or similar proteins are involved in translation of a set of mRNAs lacking SD-like sequences.

  14. Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

    PubMed Central

    Laimins, L; Holmgren-König, M; Khoury, G

    1986-01-01

    The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

  15. Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

    PubMed

    Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

    2013-09-01

    The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

  16. Movement of the saltwater interface in the surficial aquifer system in response to hydrologic stresses and water-management practices, Broward County, Florida

    USGS Publications Warehouse

    Dausman, Alyssa M.; Langevin, Christian D.

    2005-01-01

    A study was conducted to evaluate the relation between water-level fluctuations and saltwater intrusion in Broward County, Florida. The objective was achieved through data collection at selected wells in Broward County and through the development of a variable-density ground-water flow model. The numerical model is representative of many locations in Broward County that contain a well field, control structure, canal, the Intracoastal Waterway, and the Atlantic Ocean. The model was used to simulate short-term movement (from tidal fluctuations to monthly changes) and long-term movement (greater than 10 years) of the saltwater interface resulting from changes in rainfall, well-field withdrawals, sea-level rise, and upstream canal stage. The SEAWAT code, which is a combined version of the computer codes, MODFLOW and MT3D, was used to simulate the complex variable-density flow patterns. Model results indicated that the canal, control structure, and sea level have major effects on ground-water flow. For periods greater than 10 years, the upstream canal stage controls the movement and location of the saltwater interface. If upstream canal stage is decreased by 1 foot (0.3048 meter), the saltwater interface takes 50 years to move inland and stabilize. If the upstream canal stage is then increased by 1 foot (0.3048 meter), the saltwater interface takes 90 years to move seaward and stabilize. If sea level rises about 48 centimeters over the next 100 year as predicted, then inland movement of the saltwater interface may cause well-field contamination. For periods less than 10 years, simulation results indicated that a 3-year drought with increased well-field withdrawals probably will not have long-term effects on the position of the saltwater interface in the Biscayne aquifer. The saltwater interface returns to its original position in less than 10 years. Model results, however, indicated that the interface location in the lower part of the surficial aquifer system takes longer than 10 years to recover from a drought. Additionally, rainfall seems to have the greatest effect on saltwater interface movement in areas some distance from canals, but the upstream canal stage has the greatest effect on the movement of the saltwater interface near canals. Field data indicated that saltwater interface movement includes short-term fluctuations caused by tidal fluctuations and long-term seasonal fluctuations. Statistical analyses of daily-averaged data indicated that the saltwater interface moves in response to pumpage, rainfall, and upstream canal stage. In areas near the canal, the saltwater interface is most affected by canal stage because water-management structures control the stage in the upstream part of the canal and allow movement of the saltwater interface. In areas away from the canal, the saltwater interface is most affected by pumpage and rainfall, depending on the location of well fields. Data analyses also revealed that rainfall changes the vertical flow direction in the Biscayne aquifer. Results from the study indicated that upstream canal stage substantially affects the long-term position of the saltwater interface in the surficial aquifer system. The saltwater interface moves faster inland than seaward because of changes in upstream canal stage. For short-term problems, such as drought, the threat of saltwater intrusion in the Biscayne aquifer does not appear to be severe if the well-field withdrawal is increased; however, this conclusion is based on the assumption that well-field withdrawals will decrease once the drought is over. Sea-level rise may be a potential threat to the water supply in Broward County as the saltwater interface moves inland toward well fields.

  17. Dual Transcriptomic Profiling of Host and Microbiota during Health and Disease in Pediatric Asthma.

    PubMed

    Pérez-Losada, Marcos; Castro-Nallar, Eduardo; Bendall, Matthew L; Freishtat, Robert J; Crandall, Keith A

    2015-01-01

    High-throughput sequencing (HTS) analysis of microbial communities from the respiratory airways has heavily relied on the 16S rRNA gene. Given the intrinsic limitations of this approach, airway microbiome research has focused on assessing bacterial composition during health and disease, and its variation in relation to clinical and environmental factors, or other microbiomes. Consequently, very little effort has been dedicated to describing the functional characteristics of the airway microbiota and even less to explore the microbe-host interactions. Here we present a simultaneous assessment of microbiome and host functional diversity and host-microbe interactions from the same RNA-seq experiment, while accounting for variation in clinical metadata. Transcriptomic (host) and metatranscriptomic (microbiota) sequences from the nasal epithelium of 8 asthmatics and 6 healthy controls were separated in silico and mapped to available human and NCBI-NR protein reference databases. Human genes differentially expressed in asthmatics and controls were then used to infer upstream regulators involved in immune and inflammatory responses. Concomitantly, microbial genes were mapped to metabolic databases (COG, SEED, and KEGG) to infer microbial functions differentially expressed in asthmatics and controls. Finally, multivariate analysis was applied to find associations between microbiome characteristics and host upstream regulators while accounting for clinical variation. Our study showed significant differences in the metabolism of microbiomes from asthmatic and non-asthmatic children for up to 25% of the functional properties tested. Enrichment analysis of 499 differentially expressed host genes for inflammatory and immune responses revealed 43 upstream regulators differentially activated in asthma. Microbial adhesion (virulence) and Proteobacteria abundance were significantly associated with variation in the expression of the upstream regulator IL1A; suggesting that microbiome characteristics modulate host inflammatory and immune systems during asthma.

  18. Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

    PubMed Central

    KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

    2017-01-01

    Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

  19. Identification, cloning, and sequencing of a fragment of Amsacta moorei entomopoxvirus DNA containing the spheroidin gene and three vaccinia virus-related open reading frames.

    PubMed Central

    Hall, R L; Moyer, R W

    1991-01-01

    Entomopoxvirus virions are frequently contained within crystalline occlusion bodies, which are composed of primarily a single protein, spheroidin, which is analogous to the polyhedrin protein of baculovirus. The spheroidin gene of Amsacta moorei entomopoxvirus was identified following the microsequencing of polypeptides generated from cyanogen bromide treatment of spheroidin and the subsequent synthesis of oligonucleotide hybridization probes. DNA sequencing of a 6.8-kb region of DNA containing the spheroidin gene showed that the spheroidin protein is derived from a 3.0-kb open reading frame potentially encoding a protein of 115 kDa. Three copies of the heptanucleotide, TTTTTNT, a sequence associated with early gene transcription in the vertebrate poxviruses, and four in-frame translational termination signals were found within 60 bp upstream of the putative spheroidin gene promoter (TAAATG). The spheroidin gene promoter region contains the sequence TAAATG, which is found in many late promoters of the vertebrate poxviruses and which serves as the site of transcriptional initiation, as shown by primer extension. Primer extension experiments also showed that spheroidin gene transcripts contain 5' poly(A) sequences typical of vertebrate poxvirus late transcripts. The 92 bases upstream of the initiating TAAATG are unusually A + T rich and contain only 7 G or C residues. An analysis of open reading frames around the spheroidin gene suggests that the colinear core of "essential genes" typical of the vertebrate poxviruses is absent in A. moorei entomopoxvirus. Images PMID:1942245

  20. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

    PubMed Central

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-01-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome. PMID:20392818

  1. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

    PubMed

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-08-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

  2. Fungal Genes in Context: Genome Architecture Reflects Regulatory Complexity and Function

    PubMed Central

    Noble, Luke M.; Andrianopoulos, Alex

    2013-01-01

    Gene context determines gene expression, with local chromosomal environment most influential. Comparative genomic analysis is often limited in scope to conserved or divergent gene and protein families, and fungi are well suited to this approach with low functional redundancy and relatively streamlined genomes. We show here that one aspect of gene context, the amount of potential upstream regulatory sequence maintained through evolution, is highly predictive of both molecular function and biological process in diverse fungi. Orthologs with large upstream intergenic regions (UIRs) are strongly enriched in information processing functions, such as signal transduction and sequence-specific DNA binding, and, in the genus Aspergillus, include the majority of experimentally studied, high-level developmental and metabolic transcriptional regulators. Many uncharacterized genes are also present in this class and, by implication, may be of similar importance. Large intergenic regions also share two novel sequence characteristics, currently of unknown significance: they are enriched for plus-strand polypyrimidine tracts and an information-rich, putative regulatory motif that was present in the last common ancestor of the Pezizomycotina. Systematic consideration of gene UIR in comparative genomics, particularly for poorly characterized species, could help reveal organisms’ regulatory priorities. PMID:23699226

  3. Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

    PubMed Central

    Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

    1998-01-01

    Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

  4. PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

    PubMed

    Feng, Youjun; Cronan, John E

    2014-01-01

    Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  5. Effect of location in an array on heat transfer to a cylinder in crossflow

    NASA Technical Reports Server (NTRS)

    Simoneau, R. J.; Vanfossen, G. J., Jr.

    1982-01-01

    An experiment was conducted to measure the heat transfer from a heated cylinder in crossflow in an array of circular cylinders. All cylinders had a length-to-diameter ratio of 3.0. Both in-line and staggered array patterns were studied. The cylinders were spaced 2.67 diameters apart center-to-center in both the axial and transverse directions to the flow. The row containing the heated cylinder remained in a fixed position in the channel and the relative location of this row within the array was changed by adding up to five upstream rows. The working fluid was nitrogen gas at pressures from 100 to 600 kPa. The Reynolds number ranged based on cylinder diameter and average unobstructed channel velocity was from 5,000 to 125,000. Turbulence intensity: profiles were measured for each case at a point one half space upstream of the row containing the heated cylinder. The basis of comparison for all the heat transfer data was the single row with the heated cylinder. For the in-line cases the addition of a single row of cylinders upstream of the row containing the heated cylinder increased the heat transfer by an average of 50 percent above the base case. Adding up to five more rows caused no increase or decrease in heat transfer. Adding rows in the staggered array cases resulted in average increases in heat transfer of 21, 64, 58, 46, and 46 percent for one to five upstream rows, respectively.

  6. Submarine Alkalic Lavas Around the Hawaiian Hotspot; Plume and Non-Plume Signatures Determined by Noble Gases

    NASA Astrophysics Data System (ADS)

    Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.

    2004-12-01

    Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.

  7. Predicting recolonization patterns and interactions between potamodromous and anadromous salmonids in response to dam removal in the Elwha River, Washington State, USA

    USGS Publications Warehouse

    Brenkman, S.J.; Pess, G.R.; Torgersen, C.E.; Kloehn, K.K.; Duda, J.J.; Corbett, S.C.

    2008-01-01

    The restoration of salmonids in the Elwha River following dam removal will cause interactions between anadromous and potamodromous forms as recolonization occurs in upstream and downstream directions. Anadromous salmonids are expected to recolonize historic habitats, and rainbow trout (Oncorhynchus mykiss) and bull trout (Salvelinus confluentus) isolated above the dams for 90 years are expected to reestablish anadromy. We summarized the distribution and abundance of potamodromous salmonids, determined locations of spawning areas, and mapped natural barriers to fish migration at the watershed scale based on data collected from 1993 to 2006. Rainbow trout were far more abundant than bull trout throughout the watershed and both species were distributed up to river km 71. Spawning locations for bull trout and rainbow trout occurred in areas where we anticipate returning anadromous fish to spawn. Nonnative brook trout were confined to areas between and below the dams, and seasonal velocity barriers are expected to prevent their upstream movements. We hypothesize that the extent of interaction between potamodromous and anadromous salmonids will vary spatially due to natural barriers that will limit upstream-directed recolonization for some species of salmonids. Consequently, most competitive interactions will occur in the main stem and floodplain downstream of river km 25 and in larger tributaries. Understanding future responses of Pacific salmonids after dam removal in the Elwha River depends upon an understanding of existing conditions of the salmonid community upstream of the dams prior to dam removal.

  8. Improving upstream transmission performance using a receiver with decision threshold level adjustment in a loopback WDM-PON

    NASA Astrophysics Data System (ADS)

    Cho, Seung-Hyun; Lee, Sang-Soo; Shin, Dong-Wook

    2010-06-01

    We have experimentally demonstrated that the use of an optical receiver with decision threshold level adjustment (DTLA) improved the performance of an upstream transmission in reflective semiconductor optical amplifier (RSOA)-based loopback wavelength division multiplexing-passive optical network (WDM-PON). Even though the extinction ratio (ER) of the downstream signal was as much as 9 dB and the injection power into the RSOA at the optical network unit was about -24 dBm, we successfully obtained error-free transmission results for the upstream signal through careful control of the decision threshold value in the optical receiver located at optical line terminal (OLT). Using an optical receiver with DTLA for upstream signal detection overcame significant obstacles related to the injection power into the RSOA and the ER of the downstream signal, which were previously considered limitations of the wavelength remodulation scheme. This technique is expected to provide flexibility for the optical link design in the practical deployment of a WDM-PON.

  9. Genomic context drives transcription of insertion sequences in the bacterial endosymbiont Wolbachia wVulC.

    PubMed

    Cerveau, Nicolas; Gilbert, Clément; Liu, Chao; Garrett, Roger A; Grève, Pierre; Bouchon, Didier; Cordaux, Richard

    2015-06-10

    Transposable elements (TEs) are DNA pieces that are present in almost all the living world at variable genomic density. Due to their mobility and density, TEs are involved in a large array of genomic modifications. In eukaryotes, TE expression has been studied in detail in several species. In prokaryotes, studies of IS expression are generally linked to particular copies that induce a modification of neighboring gene expression. Here we investigated global patterns of IS transcription in the Alphaproteobacterial endosymbiont Wolbachia wVulC, using both RT-PCR and bioinformatic analyses. We detected several transcriptional promoters in all IS groups. Nevertheless, only one of the potentially functional IS groups possesses a promoter located upstream of the transposase gene, that could lead up to the production of a functional protein. We found that the majority of IS groups are expressed whatever their functional status. RT-PCR analyses indicate that the transcription of two IS groups lacking internal promoters upstream of the transposase start codon may be driven by the genomic environment. We confirmed this observation with the transcription analysis of individual copies of one IS group. These results suggest that the genomic environment is important for IS expression and it could explain, at least partly, copy number variability of the various IS groups present in the wVulC genome and, more generally, in bacterial genomes. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Proteomic identification of an embryo-specific 1Cys-Prx promoter and analysis of its activity in transgenic rice.

    PubMed

    Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh

    2011-04-29

    Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Synthetic Promoters Functional in Francisella novicida and Escherichia coli

    PubMed Central

    McWhinnie, Ralph L.

    2014-01-01

    In this work, we describe the identification of synthetic, controllable promoters that function in the bacterial pathogen Francisella novicida, a model facultative intracellular pathogen. Synthetic DNA fragments consisting of the tetracycline operator (tetO) flanked by a random nucleotide sequence were inserted into a Francisella novicida shuttle plasmid upstream of a promoterless artificial operon containing the reporter genes cat and lacZ. Fragments able to promote transcription were selected for based on their ability to drive expression of the cat gene, conferring chloramphenicol resistance. Promoters of various strengths were found, many of which were repressed in the presence of the tetracycline repressor (TetR) and promoted transcription only in the presence of the TetR inducer anhydrotetracycline. A subset of both constitutive and inducible synthetic promoters were characterized to find their induction ratios and to identify their transcription start sites. In cases where tetO was located between or downstream of the −10 and −35 regions of the promoter, control by TetR was observed. If the tetO region was upstream of the −35 region by more than 9 bp, it did not confer TetR control. We found that three of three promoters isolated in F. novicida functioned at a comparable level in E. coli; however, none of the 10 promoters isolated in E. coli functioned at a significant level in F. novicida. Our results allowed us to isolate minimal F. novicida promoters of 47 and 48 bp in length. PMID:24141126

  12. Asymmetric connectivity of spawning aggregations of a commercially important marine fish using a multidisciplinary approach

    PubMed Central

    Jackson, Alexis; Marinone, Silvio Guido; Erisman, Brad; Moreno-Baez, Marcia; Girón-Nava, Alfredo; Pfister, Tad; Aburto-Oropeza, Octavio; Torre, Jorge

    2014-01-01

    Understanding patterns of larval dispersal is key in determining whether no-take marine reserves are self-sustaining, what will be protected inside reserves and where the benefits of reserves will be observed. We followed a multidisciplinary approach that merged detailed descriptions of fishing zones and spawning time at 17 sites distributed in the Midriff Island region of the Gulf of California with a biophysical oceanographic model that simulated larval transport at Pelagic Larval Duration (PLD) 14, 21 and 28 days for the most common and targeted predatory reef fish, (leopard grouper Mycteroperca rosacea). We tested the hypothesis that source–sink larval metapopulation dynamics describing the direction and frequency of larval dispersal according to an oceanographic model can help to explain empirical genetic data. We described modeled metapopulation dynamics using graph theory and employed empirical sequence data from a subset of 11 sites at two mitochondrial genes to verify the model predictions based on patterns of genetic diversity within sites and genetic structure between sites. We employed a population graph describing a network of genetic relationships among sites and contrasted it against modeled networks. While our results failed to explain genetic diversity within sites, they confirmed that ocean models summarized via graph and adjacency distances over modeled networks can explain seemingly chaotic patterns of genetic structure between sites. Empirical and modeled networks showed significant similarities in the clustering coefficients of each site and adjacency matrices between sites. Most of the connectivity patterns observed towards downstream sites (Sonora coast) were strictly asymmetric, while those between upstream sites (Baja and the Midriffs) were symmetric. The best-supported gene flow model and analyses of modularity of the modeled networks confirmed a pulse of larvae from the Baja Peninsula, across the Midriff Island region and towards the Sonoran coastline that acts like a larval sink, in agreement with the cyclonic gyre (anti-clockwise) present at the peak of spawning (May–June). Our approach provided a mechanistic explanation of the location of fishing zones: most of the largest areas where fishing takes place seem to be sustained simultaneously by high levels of local retention, contribution of larvae from upstream sites and oceanographic patterns that concentrate larval density from all over the region. The general asymmetry in marine connectivity observed highlights that benefits from reserves are biased towards particular directions, that no-take areas need to be located upstream of targeted fishing zones, and that some fishing localities might not directly benefit from avoiding fishing within reserves located adjacent to their communities. We discuss the implications of marine connectivity for the current network of marine protected areas and no-take zones, and identify ways of improving it. PMID:25165626

  13. Novel mechanism of conjoined gene formation in the human genome.

    PubMed

    Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

    2012-03-01

    Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

  14. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

    PubMed Central

    Levis, R; Schlesinger, S; Huang, H V

    1990-01-01

    Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

  15. Carbapenem-Resistant Acinetobacter baumannii from Serbia: Revision of CarO Classification

    PubMed Central

    Novovic, Katarina; Mihajlovic, Sanja; Vasiljevic, Zorica; Filipic, Brankica; Begovic, Jelena; Jovcic, Branko

    2015-01-01

    Carbapenem-resistant A. baumannii present a significant therapeutic challenge for the treatment of nosocomial infections in many European countries. Although it is known that the gradient of A. baumannii prevalence increases from northern to southern Europe, this study provides the first data from Serbia. Twenty-eight carbapenem-resistant A. baumannii clinical isolates were collected at a Serbian pediatric hospital during a 2-year period. The majority of isolates (67.68%) belonged to the sequence type Group 1, European clonal complex II. All isolates harbored intrinsic OXA-51 and AmpC cephalosporinase. OXA-23 was detected in 16 isolates (57.14%), OXA-24 in 23 isolates (82.14%) and OXA-58 in 11 isolates (39.29%). Six of the isolates (21.43%) harbored all of the analyzed oxacillinases, except OXA-143 and OXA-235 that were not detected in this study. Production of oxacillinases was detected in different pulsotypes indicating the presence of horizontal gene transfer. NDM-1, VIM and IMP were not detected in analyzed clinical A. baumannii isolates. ISAba1 insertion sequence was present upstream of OXA-51 in one isolate, upstream of AmpC in 13 isolates and upstream of OXA-23 in 10 isolates. In silico analysis of carO sequences from analyzed A. baumannii isolates revealed the existence of two out of six highly polymorphic CarO variants. The phylogenetic analysis of CarO protein among Acinetobacter species revised the previous classification CarO variants into three groups based on strong bootstraps scores in the tree analysis. Group I comprises four variants (I-IV) while Groups II and III contain only one variant each. One half of the Serbian clinical isolates belong to Group I variant I, while the other half belongs to Group I variant III. PMID:25822626

  16. Ducks in space: from nonlinear absolute instability to noise-sustained structures in a pattern-forming system

    NASA Astrophysics Data System (ADS)

    Avitabile, D.; Desroches, M.; Knobloch, E.; Krupa, M.

    2017-11-01

    A subcritical pattern-forming system with nonlinear advection in a bounded domain is recast as a slow-fast system in space and studied using a combination of geometric singular perturbation theory and numerical continuation. Two types of solutions describing the possible location of stationary fronts are identified, whose origin is traced to the onset of convective and absolute instability when the system is unbounded. The former are present only for non-zero upstream boundary conditions and provide a quantitative understanding of noise-sustained structures in systems of this type. The latter correspond to the onset of a global mode and are present even with zero upstream boundary conditions. The role of canard trajectories in the nonlinear transition between these states is clarified and the stability properties of the resulting spatial structures are determined. Front location in the convective regime is highly sensitive to the upstream boundary condition, and its dependence on this boundary condition is studied using a combination of numerical continuation and Monte Carlo simulations of the partial differential equation. Statistical properties of the system subjected to random or stochastic boundary conditions at the inlet are interpreted using the deterministic slow-fast spatial dynamical system.

  17. Ducks in space: from nonlinear absolute instability to noise-sustained structures in a pattern-forming system.

    PubMed

    Avitabile, D; Desroches, M; Knobloch, E; Krupa, M

    2017-11-01

    A subcritical pattern-forming system with nonlinear advection in a bounded domain is recast as a slow-fast system in space and studied using a combination of geometric singular perturbation theory and numerical continuation. Two types of solutions describing the possible location of stationary fronts are identified, whose origin is traced to the onset of convective and absolute instability when the system is unbounded. The former are present only for non-zero upstream boundary conditions and provide a quantitative understanding of noise-sustained structures in systems of this type. The latter correspond to the onset of a global mode and are present even with zero upstream boundary conditions. The role of canard trajectories in the nonlinear transition between these states is clarified and the stability properties of the resulting spatial structures are determined. Front location in the convective regime is highly sensitive to the upstream boundary condition, and its dependence on this boundary condition is studied using a combination of numerical continuation and Monte Carlo simulations of the partial differential equation. Statistical properties of the system subjected to random or stochastic boundary conditions at the inlet are interpreted using the deterministic slow-fast spatial dynamical system.

  18. Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

    PubMed

    Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

    2018-04-06

    The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

  19. Investigation of the Impact of the Upstream Induction Zone on LIDAR Measurement Accuracy for Wind Turbine Control Applications using Large-Eddy Simulation

    NASA Astrophysics Data System (ADS)

    Simley, Eric; Y Pao, Lucy; Gebraad, Pieter; Churchfield, Matthew

    2014-06-01

    Several sources of error exist in lidar measurements for feedforward control of wind turbines including the ability to detect only radial velocities, spatial averaging, and wind evolution. This paper investigates another potential source of error: the upstream induction zone. The induction zone can directly affect lidar measurements and presents an opportunity for further decorrelation between upstream wind and the wind that interacts with the rotor. The impact of the induction zone is investigated using the combined CFD and aeroelastic code SOWFA. Lidar measurements are simulated upstream of a 5 MW turbine rotor and the true wind disturbances are found using a wind speed estimator and turbine outputs. Lidar performance in the absence of an induction zone is determined by simulating lidar measurements and the turbine response using the aeroelastic code FAST with wind inputs taken far upstream of the original turbine location in the SOWFA wind field. Results indicate that while measurement quality strongly depends on the amount of wind evolution, the induction zone has little effect. However, the optimal lidar preview distance and circular scan radius change slightly due to the presence of the induction zone.

  20. Predicting the Inflow Distortion Tone Noise of the NASA Glenn Advanced Noise Control Fan with a Combined Quadrupole-Dipole Model

    NASA Technical Reports Server (NTRS)

    Koch, L. Danielle

    2012-01-01

    A combined quadrupole-dipole model of fan inflow distortion tone noise has been extended to calculate tone sound power levels generated by obstructions arranged in circumferentially asymmetric locations upstream of a rotor. Trends in calculated sound power level agreed well with measurements from tests conducted in 2007 in the NASA Glenn Advanced Noise Control Fan. Calculated values of sound power levels radiated upstream were demonstrated to be sensitive to the accuracy of the modeled wakes from the cylindrical rods that were placed upstream of the fan to distort the inflow. Results indicate a continued need to obtain accurate aerodynamic predictions and measurements at the fan inlet plane as engineers work towards developing fan inflow distortion tone noise prediction tools.

  1. Genetic characterization of the UCS and Kex1 loci of Pneumocystis jirovecii.

    PubMed

    Esteves, F; Tavares, A; Costa, M C; Gaspar, J; Antunes, F; Matos, O

    2009-02-01

    Nucleotide variation in the Pneumocystis jirovecii upstream conserved sequence (UCS) and kexin-like serine protease (Kex1) loci was studied in pulmonary specimens from Portuguese HIV-positive patients. DNA was extracted and used for specific molecular sequence analysis. The number of UCS tandem repeats detected in 13 successfully sequenced isolates ranged from three (9 isolates, 69%) to four (4 isolates, 31%). A novel tandem repeat pattern and two novel polymorphisms were detected in the UCS region. For the Kex1 gene, the wild-type (24 isolates, 86%) was the most frequent sequence detected among the 28 sequenced isolates. Nevertheless, a nonsynonymous (1 isolate, 3%) and three synonymous (3 isolates, 11%) polymorphisms were detected and are described here for the first time.

  2. Observations on the Growth of Roughness Elements Into Icing Feathers

    NASA Technical Reports Server (NTRS)

    Vargas, Mario; Tsao, Jen, Ching

    2007-01-01

    This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.

  3. Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.

    PubMed

    Hutsul, J A; Worobec, E

    1994-02-01

    An oligonucleotide that encodes the N-terminal portion of a 41 kDa porin of Serratia marcescens was used to probe S. marcescens UOC-51 genomic DNA. An 11 kb EcoRI fragment which hybridized with the oligonucleotide was subcloned into Escherichia coli, examined for expression, and sequenced. The product expressed by the cloned gene was 40 kDa. The nucleotide sequence has an ORF of 1.13 kb. When the deduced amino acid sequence was aligned and compared to other enterobacterial porins the cloned S. marcescens porin most closely resembled E. coli OmpC. Although we did not detect osmoregulation or thermoregulation of any porins in S. marcescens UOC-51, sequences analogous to the E. coli osmoregulator OmpR-binding regions are seen upstream to the cloned gene. We examined the regulation of the S. marcescens porin in E. coli and found that its expression increased in a high salt environment. A micF gene, whose transcriptional product functions to inhibit synthesis of OmpF by hybridizing with the ompF transcript, was also seen upstream of the S. marcescens ompC. An alignment with the E. coli micF gene revealed that the functional region of the S. marcescens micF gene is conserved. Based on the results obtained we have determined that S. marcescens UOC-51 produces a 40 kDa porin similar to the E. coli OmpC porin.

  4. Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

    PubMed

    O'Sullivan, D J; O'Gara, F

    1991-08-01

    An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

  5. Big Spring spinedace and associated fish populations and habitat conditions in Condor Canyon, Meadow Valley Wash, Nevada

    USGS Publications Warehouse

    Jezorek, Ian G.; Connolly, Patrick J.; Munz, Carrie S.; Dixon, Chris

    2011-01-01

    Executive Summary: This project was designed to document habitat conditions and populations of native and non-native fish within the 8-kilometer Condor Canyon section of Meadow Valley Wash, Nevada, with an emphasis on Big Spring spinedace (Lepidomeda mollispinis pratensis). Other native fish present were speckled dace (Rhinichthys osculus) and desert sucker (Catostomus clarki). Big Spring spinedace were known to exist only within this drainage and were known to have been extirpated from a portion of their former habitat located downstream of Condor Canyon. Because of this extirpation and the limited distribution of Big Spring spinedace, the U.S. Fish and Wildlife Service listed this species as threatened under the Endangered Species Act in 1985. Prior to our effort, little was known about Big Spring spinedace populations or life histories and habitat associations. In 2008, personnel from the U.S. Geological Survey's Columbia River Research Laboratory began surveys of Meadow Valley Wash in Condor Canyon. Habitat surveys characterized numerous variables within 13 reaches, thermologgers were deployed at 9 locations to record water temperatures, and fish populations were surveyed at 22 individual sites. Additionally, fish were tagged with Passive Integrated Transponder (PIT) tags, which allowed movement and growth information to be collected on individual fish. The movements of tagged fish were monitored with a combination of recapture events and stationary in-stream antennas, which detected tagged fish. Meadow Valley Wash within Condor Canyon was divided by a 12-meter (m) waterfall known as Delmue Falls. About 6,100 m of stream were surveyed downstream of the falls and about 2,200 m of stream were surveyed upstream of the falls. Although about three-quarters of the surveyed stream length was downstream of Delmue Falls, the highest densities and abundance of native fish were upstream of the falls. Big Spring spinedace and desert sucker populations were highest near the upper end of Condor Canyon, where a tributary known as Kill Wash, and several springs, contribute flow and moderate high and low water temperature. Kill Wash and the area around its confluence with Meadow Valley Wash appeared important for spawning of all three native species. Detections of PIT-tagged fish indicated that there were substantial movements to this area during the spring. Our surveys included about 700 m of Meadow Valley Wash upstream of Kill Wash. A small falls about 2 m high was about 560 m upstream of Kill Wash. This falls is likely a barrier to upstream fish movement at most flows. Populations of all three native species were found upstream of this small falls. Age-0 fish of all three species were present, indicating successful spawning. The maximum upstream extent of native fish within Meadow Valley Wash was not determined. Our surveys included about 700 m of Meadow Valley Wash upstream of Kill Wash. A small falls about 2 m high was about 560 m upstream of Kill Wash. This falls is likely a barrier to upstream fish movement at most flows. Populations of all three native species were found upstream of this small falls. Age-0 fish of all three species were present, indicating successful spawning. The maximum upstream extent of native fish within Meadow Valley Wash was not determined. A population of non-native rainbow trout (Oncorhynchus mykiss) was found within the 2,000 m of stream immediately downstream of Delmue Falls. Non-native crayfish were very common both upstream and downstream of Delmue Falls. We were not able to quantify crayfish populations, but they compose a significant portion of the biomass of aquatic species in Condor Canyon. There were some distinctive habitat features that may have favored native fish upstream of Delmue Falls. Upstream of the falls, water temperatures were moderated by inputs from springs, turbidity was lower, pool habitat was more prevalent, substrate heterogeneity was higher, and there was less fine sediment than

  6. Survey of shock-wave structures of smooth-particle granular flows.

    PubMed

    Padgett, D A; Mazzoleni, A P; Faw, S D

    2015-12-01

    We show the effects of simulated supersonic granular flow made up of smooth particles passing over two prototypical bodies: a wedge and a disk. We describe a way of computationally identifying shock wave locations in granular flows and tabulate the shock wave locations for flow over wedges and disks. We quantify the shock structure in terms of oblique shock angle for wedge impediments and shock standoff distance for disk impediments. We vary granular flow parameters including upstream volume fraction, average upstream velocity, granular temperature, and the collision coefficient of restitution. Both wedges and disks have been used in the aerospace community as prototypical impediments to flowing air in order to investigate the fundamentally different shock structures emanating from sharp and blunt bodies, and we present these results in order to increase the understanding of the fundamental behavior of supersonic granular flow.

  7. Influence of Forced Flow on the Dendritic Growth of Fe-C Alloy: 3D vs 2D Simulation

    NASA Astrophysics Data System (ADS)

    Wang, Weiling; Wang, Zhaohui; Luo, Sen; Ji, Cheng; Zhu, Miaoyong

    2017-12-01

    A 3D parallel cellular automaton-finite volume method (CA-FVM) model was used to simulate the equiaxed dendritic growth of an Fe-0.82 wt pct C alloy with xy- in- out and xyz- in- out type forced flows and the columnar dendritic growth with y- in- out type forced flow. In addition, the similarities and differences between the results of the 3D and 2D models are discussed and summarized in detail. The capabilities of the 3D and 2D CA-FVM models to predict the dendritic growth of the alloy with forced flow are validated through comparison with the boundary layer correction and Oseen-Ivanstov models, respectively. Because the forced flow can pass around perpendicular arms of the dendrites, the secondary arms at the sides upstream from the perpendicular arms are more developed than those on the upstream side of the upstream arms, especially at higher inlet velocities. In addition, compared to the xy- in- out case, the growth of the downstream arms is less inhibited and the secondary arms are more developed in the xyz- in- out case because of the greater lateral flow around their tips. Compared to the 3D case, the 2D equiaxed dendrites are more asymmetrical and lack secondary arms because of the thicker solute envelope. In the 3D case, the columnar dendrites on the upstream side (left one) are promoted, while the middle and downstream dendrites are inhibited in sequence. However, the sequential inhibition starts on the upstream side in the 2D case. This is mainly because the melt can pass around the upstream branch in 3D space. However, it can only climb over the upstream tip in 2D space. Additionally, the secondary arms show upstream development, which is more significant with increasing inlet velocity. The level of development of the secondary arms is also affected by the decay of the forced flow in the flow direction.

  8. Structural variant of the intergenic internal ribosome entry site elements in dicistroviruses and computational search for their counterparts

    PubMed Central

    HATAKEYAMA, YOSHINORI; SHIBUYA, NORIHIRO; NISHIYAMA, TAKASHI; NAKASHIMA, NOBUHIKO

    2004-01-01

    The intergenic region (IGR) located upstream of the capsid protein gene in dicistroviruses contains an internal ribosome entry site (IRES). Translation initiation mediated by the IRES does not require initiator methionine tRNA. Comparison of the IGRs among dicistroviruses suggested that Taura syndrome virus (TSV) and acute bee paralysis virus have an extra side stem loop in the predicted IRES. We examined whether the side stem is responsible for translation activity mediated by the IGR using constructs with compensatory mutations. In vitro translation analysis showed that TSV has an IGR-IRES that is structurally distinct from those previously described. Because IGR-IRES elements determine the translation initiation site by virtue of their own tertiary structure formation, the discovery of this initiation mechanism suggests the possibility that eukaryotic mRNAs might have more extensive coding regions than previously predicted. To test this hypothesis, we searched full-length cDNA databases and whole genome sequences of eukaryotes using the pattern matching program, Scan For Matches, with parameters that can extract sequences containing secondary structure elements resembling those of IGR-IRES. Our search yielded several sequences, but their predicted secondary structures were suggested to be unstable in comparison to those of dicistroviruses. These results suggest that RNAs structurally similar to dicistroviruses are not common. If some eukaryotic mRNAs are translated independently of an initiator methionine tRNA, their structures are likely to be significantly distinct from those of dicistroviruses. PMID:15100433

  9. Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

    PubMed

    René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

    2000-01-04

    In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

  10. A short autocomplementary sequence plays an essential role in avian sarcoma-leukosis virus RNA dimerization.

    PubMed

    Fossé, P; Motté, N; Roumier, A; Gabus, C; Muriaux, D; Darlix, J L; Paoletti, J

    1996-12-24

    Retroviral genomes consist of two identical RNA molecules joined noncovalently near their 5'-ends. Recently, two models have been proposed for RNA dimer formation on the basis of results obtained in vitro with human immunodeficiency virus type 1 RNA and Moloney murine leukemia virus RNA. It was first proposed that viral RNA dimerizes by forming an interstrand quadruple helix with purine tetrads. The second model postulates that RNA dimerization is initiated by a loop-loop interaction between the two RNA molecules. In order to better characterize the dimerization process of retroviral genomic RNA, we analyzed the in vitro dimerization of avian sarcoma-leukosis virus (ASLV) RNA using different transcripts. We determined the requirements for heterodimer formation, the thermal dissociation of RNA dimers, and the influence of antisense DNA oligonucleotides on dimer formation. Our results strongly suggest that purine tetrads are not involved in dimer formation. Data show that an autocomplementary sequence located upstream from the splice donor site and within a major packaging signal plays a crucial role in ASLV RNA dimer formation in vitro. This sequence is able to form a stem-loop structure, and phylogenetic analysis reveals that it is conserved in 28 different avian sarcoma and leukosis viruses. These results suggest that dimerization of ASLV RNA is initiated by a loop-loop interaction between two RNA molecules and provide an additional argument for the ubiquity of the dimerization process via loop-loop interaction.

  11. Structure and genomic organization of the human B1 receptor gene for kinins (BDKRB1).

    PubMed

    Bachvarov, D R; Hess, J F; Menke, J G; Larrivée, J F; Marceau, F

    1996-05-01

    Two subtypes of mammalian bradykinin receptors, B1 and B2 (BDKRB1 and BDKRB2), have been defined based on their pharmacological properties. The B1 type kinin receptors have weak affinity for intact BK or Lys-BK but strong affinity for kinin metabolites without the C-terminal arginine (e.g., des-Arg9-BK and Lys-des-Arg9-BK, also called des-Arg10-kallidin), which are generated by kininase I. The B1 receptor expression is up-regulated following tissue injury and inflammation (hyperemia, exudation, hyperalgesia, etc.). In the present study, we have cloned and sequenced the gene encoding human B1 receptor from a human genomic library. The human B1 receptor gene contains three exons separated by two introns. The first and the second exon are noncoding, while the coding region and the 3'-flanking region are located entirely on the third exon. The exon-intron arrangement of the human B1 receptor gene shows significant similarity with the genes encoding the B2 receptor subtype in human, mouse, and rat. Sequence analysis of the 5'-flanking region revealed the presence of a consensus TATA box and of numerous candidate transcription factor binding sequences. Primer extension experiments have shown the existence of multiple transcription initiation sites situated downstream and upstream from the consensus TATA box. Genomic Southern blot analysis indicated that the human B1 receptor is encoded by a single-copy gene.

  12. Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

    PubMed

    Heyduk, E; Baichoo, N; Heyduk, T

    2001-11-30

    The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

  13. Spawning migration movements of Lost River and shortnose suckers in the Williamson and Sprague Rivers, Oregon, following the removal of Chiloquin Dam-2009 Annual Report

    USGS Publications Warehouse

    Ellsworth, Craig M.; VanderKooi, Scott P.

    2011-01-01

    The Chiloquin Dam was located at river kilometer (rkm) 1.3 on the Sprague River near the town of Chiloquin, Oregon. The dam was identified as a barrier that potentially inhibited or prevented the upstream spawning migrations and other movements of endangered Lost River suckers (Deltistes luxatus), shortnose suckers (Chasmistes brevirostris), and other fish in the Sprague River. Our research objectives in 2009 were to evaluate adult catostomid spawning migration patterns using radio telemetry to identify and describe shifts in spawning area distribution and migration behavior following the removal of Chiloquin Dam in 2008. We attached external radio transmitters to 58 Lost River suckers and 59 shortnose suckers captured at the Williamson River fish weir. A total of 17 radio-tagged Lost River suckers and one radio-tagged shortnose sucker were detected approaching the site of the former Chiloquin Dam but only two radio-tagged fish (one male Lost River sucker and one female Lost River sucker) were detected crossing upstream of the dam site. A lower proportion of radio-tagged shortnose suckers were detected migrating into the Sprague River when compared with previous years. Detections on remote passive integrated transponder (PIT) tag arrays located in the Sprague River show that although the proportion of fish coming into the Sprague River is small when compared to the number of fish crossing the Williamson River fish weir, the number of fish migrating upstream of the Chiloquin Dam site increased exponentially in the first year since its removal. These data will be used in conjunction with larval production and adult spawning distribution data to evaluate the effectiveness of dam removal in order to provide increased access to underutilized spawning habitat located further upstream in the Sprague River and to reduce the crowding of spawning fish below the dam site.

  14. Spatial and temporal patterns of micropollutants in streams and effluent of 24 WWTPs across Switzerland

    NASA Astrophysics Data System (ADS)

    Schönenberger, Urs; Spycher, Barbara; Kistler, David; Burdon, Frank; Reyes, Marta; Eggen, Rik; Joss, Adriano; Singer, Heinz; Stamm, Christian

    2016-04-01

    Treated municipal wastewater is an important source of micropollutants entering the environment. Micropollutants are a diverse range of chemicals of which concentrations vary strongly in space and time. To better quantitatively understand the spatio-temporal patterns of micropollutants in streams, we compared upstream and downstream locations at 24 wastewater treatment plants (WWTPs) across the Swiss Plateau and Jura regions. Each site represents the most upstream treatment plant in the corresponding catchment. In 2013, a broad analytical screening was applied to samples collected at 12 sites during winter (January) and summer conditions (June). Based in these results, the bi-monthly samples obtained in 2014 at 12 additional sites were analysed for a group of approximately 60 selected organic micropollutants. The screening results demonstrate that generally, pharmaceuticals, artificial sweeteners and corrosion inhibitors make up the largest share of the organic micropollutants in wastewater. Pesticides including biocides and plant protection products are also regularly found, but at lower concentrations. The opposite holds true for the concentration variability: pesticides vary the most across time and space, while pharmaceuticals exhibit more stable concentrations. Heavy metals fluctuate to a similar degree as pharmaceuticals. Principal component analyses suggest that pesticide and pharmaceutical levels at both upstream locations and in the wastewater vary independently of each other. At the upstream locations, the pesticide levels increased with the proportion of arable land in the watershed, whilst decreasing with greater cover of pasture and forest. Interestingly, the same patterns hold true for the composition of wastewater when considering land use in the catchments of the WWTPs. This suggests that pesticide-intensive agricultural crops not only impact surface water quality via diffuse pollution but also increase levels of pesticides in wastewater discharged to the streams. As a consequence, catchment land uses and effluent composition appear to be inextricably bound.

  15. Upstream movements of Atlantic Salmon in the Lower Penobscot River, Maine following two dam removals and fish passage modifications

    USGS Publications Warehouse

    Izzo, Lisa K.; Maynard, George A.; Zydlewski, Joseph D.

    2016-01-01

    The Penobscot River Restoration Project (PRRP), to be completed in 2016, involved an extensive plan of dam removal, increases in hydroelectric capacity, and fish passage modifications to increase habitat access for diadromous species. As part of the PRRP, Great Works and Veazie dams were removed, making Milford Dam the first impediment to federally endangered Atlantic Salmon Salmo salar. Upstream habitat access for Atlantic Salmon is dependent upon successful and timely passage at Milford Dam because nearly all suitable spawning habitat is located upstream. In 2014 and 2015, a total of 73 adult salmon were radio-tagged to track their upstream movements through the Penobscot River to assess potential delays at (1) the dam remnants, (2) the confluence of the Stillwater Branch and the main stem of the Penobscot River below the impassable Orono Dam, and (3) the Milford Dam fish lift (installed in 2014). Movement rates through the dam remnants and the Stillwater confluence were comparable to open river reaches. Passage efficiency of the fish lift was high in both years (95% and 100%). However, fish experienced long delays at Milford Dam, with approximately one-third of fish taking more than a week to pass in each year, well below the Federal Energy Regulatory Commission passage standard of 95% within 48 h. Telemetry indicates most fish locate the fishway entrance within 5 h of arrival and were observed at the entrance at all hours of the day. These data indicate that overall transit times through the lower river were comparable to reported movement rates prior to changes to the Penobscot River due to the substantial delays seen at Milford Dam. The results of this study show that while adult Atlantic Salmon locate the new fish lift entrance quickly, passage of these fish was significantly delayed under 2014–2015 operations.

  16. Differential regulation of proximal and distal Vbeta segments upstream of a functional VDJbeta1 rearrangement upon beta-selection.

    PubMed

    Brady, Brenna L; Bassing, Craig H

    2011-09-15

    Developmental stage-specific regulation of transcriptional accessibility helps control V(D)J recombination. Vβ segments on unrearranged TCRβ alleles are accessible in CD4(-)/CD8(-) (double-negative [DN]) thymocytes, when they recombine, and inaccessible in CD4(+)/CD8(+) (double-positive [DP]) thymocytes, when they do not rearrange. Downregulation of Vβ accessibility on unrearranged alleles is linked with Lat-dependent β-selection signals that inhibit Vβ rearrangement, stimulate Ccnd3-driven proliferation, and promote DN-to-DP differentiation. Transcription and recombination of Vβs on VDJβ-rearranged alleles in DN cells has not been studied; Vβs upstream of functional VDJβ rearrangements have been found to remain accessible, yet not recombine, in DP cells. To elucidate contributions of β-selection signals in regulating Vβ transcription and recombination on VDJβ-rearranged alleles, we analyzed wild-type, Ccnd3(-/-), and Lat(-/-) mice containing a preassembled functional Vβ1DJCβ1 (Vβ1(NT)) gene. Vβ10 segments located just upstream of this VDJCβ1 gene were the predominant germline Vβs that rearranged in Vβ1(NT/NT) and Vβ1(NT/NT)Ccnd3(-/-) thymocytes, whereas Vβ4 and Vβ16 segments located further upstream rearranged at similar levels as Vβ10 in Vβ1(NT/NT)Lat(-/-) DN cells. We previously showed that Vβ4 and Vβ16, but not Vβ10, are transcribed on Vβ1(NT) alleles in DP thymocytes; we now demonstrate that Vβ4, Vβ16, and Vβ10 are transcribed at similar levels in Vβ1(NT/NT)Lat(-/-) DN cells. These observations indicate that suppression of Vβ rearrangements is not dependent on Ccnd3-driven proliferation, and DN residence can influence the repertoire of Vβs that recombine on alleles containing an assembled VDJCβ1 gene. Our findings also reveal that β-selection can differentially silence rearrangement of germline Vβ segments located proximal and distal to functional VDJβ genes.

  17. Nucleotide sequence analysis reveals linked N-acetyl hydrolase, thioesterase, transport, and regulatory genes encoded by the bialaphos biosynthetic gene cluster of Streptomyces hygroscopicus.

    PubMed Central

    Raibaud, A; Zalacain, M; Holt, T G; Tizard, R; Thompson, C J

    1991-01-01

    Nucleotide sequence analysis of a 5,000-bp region of the bialaphos antibiotic production (bap) gene cluster defined five open reading frames (ORFs) which predicted structural genes in the order bah, ORF1, ORF2, and ORF3 followed by the regulatory gene, brpA (H. Anzai, T. Murakami, S. Imai, A. Satoh, K. Nagaoka, and C.J. Thompson, J. Bacteriol. 169:3482-3488, 1987). The four structural genes were translationally coupled and apparently cotranscribed from an undefined promoter(s) under the positive control of the brpA gene product. S1 mapping experiments indicated that brpA was transcribed by two promoters (brpAp1 and brpAp2) which initiate transcription 150 and 157 bp upstream of brp A within an intergenic region and at least one promoter further upstream within the bap gene cluster (brpAp3). All three transcripts were present at low levels during exponential growth and increased just before the stationary phase. The levels of the brpAp3 band continued to increase at the onset of stationary phase, whereas brpAp1-and brpAp2-protected fragments showed no further change. BrpA contained a possible helix-turn-helix motif at its C terminus which was similar to the C-terminal regulatory motif found in the receiver component of a family of two-component transcriptional activator proteins. This motif was not associated with the N-terminal domain conserved in other members of the family. The structural gene cluster sequenced began with bah, encoding a bialaphos acetylhydrolase which removes the N-acetyl group from bialaphos as one of the final steps in the biosynthetic pathway. The observation that Bah was similar to a rat and to a bacterial (Acinetobacter calcoaceticus) lipase probably reflects the fact that the ester bonds of triglycerides and the amide bond linking acetate to phosphinothricin are similar and hydrolysis is catalyzed by structurally related enzymes. This was followed by two regions encoding ORF1 and ORF2 which were similar to each other (48% nucleotide identity, 31% amino acid identity), as well as to GrsT, a protein encoded by a gene located adjacent to gramicidin S synthetase in Bacillus brevis, and to vertebrate (mallard duck and rat) thioesterases. The amino acid sequence and hydrophobicity profile of ORF3 indicated that it was related to a family of membrane transport proteins. It was strikingly similar to the citrate uptake protein encoded by the transposon Tn3411. Images PMID:2066341

  18. Structural Basis of the Interaction of a Trypanosoma cruzi Surface Molecule Implicated in Oral Infection with Host Cells and Gastric Mucin

    PubMed Central

    Cortez, Cristian; Yoshida, Nobuko; Bahia, Diana; Sobreira, Tiago J.P.

    2012-01-01

    Host cell invasion and dissemination within the host are hallmarks of virulence for many pathogenic microorganisms. As concerns Trypanosoma cruzi, which causes Chagas disease, the insect vector-derived metacyclic trypomastigotes (MT) initiate infection by invading host cells, and later blood trypomastigotes disseminate to diverse organs and tissues. Studies with MT generated in vitro and tissue culture-derived trypomastigotes (TCT), as counterparts of insect-borne and bloodstream parasites, have implicated members of the gp85/trans-sialidase superfamily, MT gp82 and TCT Tc85-11, in cell invasion and interaction with host factors. Here we analyzed the gp82 structure/function characteristics and compared them with those previously reported for Tc85-11. One of the gp82 sequences identified as a cell binding site consisted of an α-helix, which connects the N-terminal β-propeller domain to the C-terminal β-sandwich domain where the second binding site is nested. In the gp82 structure model, both sites were exposed at the surface. Unlike gp82, the Tc85-11 cell adhesion sites are located in the N-terminal β-propeller region. The gp82 sequence corresponding to the epitope for a monoclonal antibody that inhibits MT entry into target cells was exposed on the surface, upstream and contiguous to the α-helix. Located downstream and close to the α-helix was the gp82 gastric mucin binding site, which plays a central role in oral T. cruzi infection. The sequences equivalent to Tc85-11 laminin-binding sites, which have been associated with the parasite ability to overcome extracellular matrices and basal laminae, was poorly conserved in gp82, compatible with its reduced capacity to bind laminin. Our study indicates that gp82 is structurally suited for MT to initiate infection by the oral route, whereas Tc85-11, with its affinity for laminin, would facilitate the parasite dissemination through diverse organs and tissues. PMID:22860068

  19. A Canonical DREB2-Type Transcription Factor in Lily Is Post-translationally Regulated and Mediates Heat Stress Response

    PubMed Central

    Wu, Ze; Liang, Jiahui; Zhang, Shuai; Zhang, Bing; Zhao, Qingcui; Li, Guoqing; Yang, Xi; Wang, Chengpeng; He, Junna; Yi, Mingfang

    2018-01-01

    Based on studies of monocot crops and eudicot model plants, the DREB2 class of AP2-type transcription factor has been shown to play crucial roles in various abiotic stresses, especially in the upstream of the heat stress response; however, research on DREB2s has not been reported in non-gramineous monocot plants. Here, we identified a novel DREB2 (LlDREB2B) from lily (Lilium longiflorum), which was homologous to AtDREB2A of Arabidopsis, OsDREB2B of rice, and ZmDREB2A of maize. LlDREB2B was induced by heat, cold, salt, and mannitol stress, and its protein had transcriptional activity, was located in the nucleus, was able to bind to the dehydration-responsive element (DRE), and participated in the heat-responsive pathway of HsfA3. Overexpression of LlDREB2B in Arabidopsis activated expression of downstream genes and improved thermotolerance. LlDREB2B was not regulated by alternative splicing; functional transcripts accumulated under either normal or heat-stress conditions. A potential PEST sequence was predicted in LlDREB2B, but the stability of the LlDREB2B protein was not positively affected when the predicated PEST sequence was deleted. Further analysis revealed that the predicated PEST sequence lacked a SBC or SBC-like motif allowing interaction with BPMs and required for negative regulation. Nevertheless, LlDREB2B was still regulated at the post-translational level by interaction with AtDRIP1 and AtDRIP2 of Arabidopsis. In addition, LlDREB2B also interacted with AtRCD1 and LlRCD1 via a potential RIM motif located at amino acids 215–245. Taken together, our results show that LlDREB2B participated in the establishment of thermotolerance, and its regulation was different from that of the orthologs of gramineous and eudicot plants. PMID:29568302

  20. A Canonical DREB2-Type Transcription Factor in Lily Is Post-translationally Regulated and Mediates Heat Stress Response.

    PubMed

    Wu, Ze; Liang, Jiahui; Zhang, Shuai; Zhang, Bing; Zhao, Qingcui; Li, Guoqing; Yang, Xi; Wang, Chengpeng; He, Junna; Yi, Mingfang

    2018-01-01

    Based on studies of monocot crops and eudicot model plants, the DREB2 class of AP2-type transcription factor has been shown to play crucial roles in various abiotic stresses, especially in the upstream of the heat stress response; however, research on DREB2s has not been reported in non-gramineous monocot plants. Here, we identified a novel DREB2 (LlDREB2B) from lily ( Lilium longiflorum ), which was homologous to AtDREB2A of Arabidopsis, OsDREB2B of rice, and ZmDREB2A of maize. LlDREB2B was induced by heat, cold, salt, and mannitol stress, and its protein had transcriptional activity, was located in the nucleus, was able to bind to the dehydration-responsive element (DRE), and participated in the heat-responsive pathway of HsfA3. Overexpression of LlDREB2B in Arabidopsis activated expression of downstream genes and improved thermotolerance. LlDREB2B was not regulated by alternative splicing; functional transcripts accumulated under either normal or heat-stress conditions. A potential PEST sequence was predicted in LlDREB2B, but the stability of the LlDREB2B protein was not positively affected when the predicated PEST sequence was deleted. Further analysis revealed that the predicated PEST sequence lacked a SBC or SBC-like motif allowing interaction with BPMs and required for negative regulation. Nevertheless, LlDREB2B was still regulated at the post-translational level by interaction with AtDRIP1 and AtDRIP2 of Arabidopsis. In addition, LlDREB2B also interacted with AtRCD1 and LlRCD1 via a potential RIM motif located at amino acids 215-245. Taken together, our results show that LlDREB2B participated in the establishment of thermotolerance, and its regulation was different from that of the orthologs of gramineous and eudicot plants.

  1. Combined actions of multiple hairpin loop structures and sites of rate-limiting endonucleolytic cleavage determine differential degradation rates of individual segments within polycistronic puf operon mRNA.

    PubMed Central

    Klug, G; Cohen, S N

    1990-01-01

    Differential expression of the genes within the puf operon of Rhodobacter capsulatus is accomplished in part by differences in the rate of degradation of different segments of the puf transcript. We report here that decay of puf mRNA sequences specifying the light-harvesting I (LHI) and reaction center (RC) photosynthetic membrane peptides is initiated endoribonucleolytically within a discrete 1.4-kilobase segment of the RC-coding region. Deletion of this segment increased the half-life of the RC-coding region from 8 to 20 min while not affecting decay of LHI-coding sequences upstream from an intercistronic hairpin loop structure shown previously to impede 3'-to-5' degradation. Prolongation of RC segment half-life was dependent on the presence of other hairpin structures 3' to the RC region. Inserting the endonuclease-sensitive sites into the LHI-coding segment markedly accelerated its degradation. Our results suggest that differential degradation of the RC- and LHI-coding segments of puf mRNA is accomplished at least in part by the combined actions of RC region-specific endonuclease(s), one or more exonucleases, and several strategically located exonuclease-impeding hairpins. Images PMID:2394682

  2. Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

    PubMed

    Howe, J G; Shu, M D

    1988-08-01

    Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

  3. In vitro mapping of Myotonic Dystrophy (DM) gene promoter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Storbeck, C.J.; Sabourin, L.; Baird, S.

    1994-09-01

    The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMKmore » only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.« less

  4. 13. A CLOSEUP VIEW FROM THE SAME LOCATION AS THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. A CLOSE-UP VIEW FROM THE SAME LOCATION AS THE PREVIOUS PHOTO, LOOKING EAST, OF THE CENTRAL PIER AND THE UNDERSIDE OF THE BRIDGE. BOTH THE NORTH AND THE SOUTH SHEARWATERS ARE VISIBLE, SHOWING THE SLIGHTLY LARGER PROFILE OF THE UPSTREAM PIER. - Putnam County Bridge No. 111, Spanning Little Walnut Creek on County Road 50, Greencastle, Putnam County, IN

  5. Odor-conditioned rheotaxis of the sea lamprey: modeling, analysis and validation

    USGS Publications Warehouse

    Choi, Jongeun; Jean, Soo; Johnson, Nicholas S.; Brant, Cory O.; Li, Weiming

    2013-01-01

    Mechanisms for orienting toward and locating an odor source are sought in both biology and engineering. Chemical ecology studies have demonstrated that adult female sea lamprey show rheotaxis in response to a male pheromone with dichotomous outcomes: sexually mature females locate the source of the pheromone whereas immature females swim by the source and continue moving upstream. Here we introduce a simple switching mechanism modeled after odor-conditioned rheotaxis for the sea lamprey as they search for the source of a pheromone in a one-dimensional riverine environment. In this strategy, the females move upstream only if they detect that the pheromone concentration is higher than a threshold value and drifts down (by turning off control action to save energy) otherwise. In addition, we propose various uncertainty models such as measurement noise, actuator disturbance, and a probabilistic model of a concentration field in turbulent flow. Based on the proposed model with uncertainties, a convergence analysis showed that with this simplistic switching mechanism, the lamprey converges to the source location on average in spite of all such uncertainties. Furthermore, a slightly modified model and its extensive simulation results explain the behaviors of immature female lamprey near the source location.

  6. 78 FR 52694 - Drawbridge Operation Regulation; Trent River, New Bern, NC

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-26

    ... several times every day for recreational vessels transiting to and from the local marinas located upstream. Although openings occur throughout the day, the morning hours have the fewest vessel transits. Vessels able...

  7. Promoters, toll like receptors and microRNAs: a strange association.

    PubMed

    Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K

    2013-06-01

    Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.

  8. In vitro transcription of a cloned mouse ribosomal RNA gene.

    PubMed Central

    Mishima, Y; Yamamoto, O; Kominami, R; Muramatsu, M

    1981-01-01

    An in vitro transcription system which utilizes cloned mouse ribosomal RNA gene (rDNA) fragments and a mouse cell extract has been developed. RNA polymerases I is apparently responsible for this transcription as evidenced by the complete resistance to a high concentration (200 micrograms/ml) of alpha-amanitin. Run-off products obtained with three different truncated rDNA fragments indicated that RNA was transcribed from a unique site of rDNA. The S1 nuclease protection mapping of the in vitro product and of in vivo 45S RNA confirmed this site, indicating that, in this in vitro system, transcription of rDNA started from the same site as in vivo. This site is located at several hundred nucleotides upstream from the putative initiation site reported by us (1) and by others (2). Some sequence homology surrounding this region was noted among mouse, Xenopus laevis and Drosophila melanogaster. The data also suggest that some processing of the primary transcript occurs in this in vitro system. Images PMID:6278446

  9. Translocation-coupled DNA cleavage by the Type ISP restriction-modification enzymes

    PubMed Central

    Chand, Mahesh Kumar; Nirwan, Neha; Diffin, Fiona M.; van Aelst, Kara; Kulkarni, Manasi; Pernstich, Christian; Szczelkun, Mark D.; Saikrishnan, Kayarat

    2015-01-01

    Endonucleolytic double-strand DNA break production requires separate strand cleavage events. Although catalytic mechanisms for simple dimeric endonucleases are available, there are many complex nuclease machines which are poorly understood in comparison. Here we studied the single polypeptide Type ISP restriction-modification (RM) enzymes, which cleave random DNA between distant target sites when two enzymes collide following convergent ATP-driven translocation. We report the 2.7 Angstroms resolution X-ray crystal structure of a Type ISP enzyme-DNA complex, revealing that both the helicase-like ATPase and nuclease are unexpectedly located upstream of the direction of translocation, inconsistent with simple nuclease domain-dimerization. Using single-molecule and biochemical techniques, we demonstrate that each ATPase remodels its DNA-protein complex and translocates along DNA without looping it, leading to a collision complex where the nuclease domains are distal. Sequencing of single cleavage events suggests a previously undescribed endonuclease model, where multiple, stochastic strand nicking events combine to produce DNA scission. PMID:26389736

  10. Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

    PubMed

    Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

    2008-09-15

    Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

  11. The F-ATPase operon from the oral streptococci S. mutans and S. sanguis: How structure relates to function

    NASA Astrophysics Data System (ADS)

    Kuhnert, Wendi Lee

    1999-10-01

    The oral microbe, Streptococcus mutans is known to be a primary contributor to the most common infection in humans, dental caries. In the plaque environment, resident bacteria metabolize dietary sucrose which results in the production of organic acids and a decrease in plaque pH. The proton-translocating ATPase (F-ATPase) protects the bacteria from acidification by extruding protons, at the expense of ATP, to maintain an internal pH which is more neutral than the external environment. Examination of this enzyme will help us to gain insight regarding its contribution to the aciduricity characteristics of oral bacteria. In this work, our goal was to begin the molecular dissection of the mechanism by which streptococcal ATPases are regulated and function enzymatically. Sequence analysis of the F-ATPase from the non-pathogenic S. sanguis revealed that the structural genes are homologous to S. mutans as well as other sequenced F-ATPases. Cloned subunits were functionally similar as shown by complementing E. coli ATPase mutants. S. sanguis/E. coli hybrid enzymes hydrolyzed ATP, but proton conduction was uncoupled as demonstrated with inhibition studies. Transcriptional regulation of the F-ATPase operon from S. mutans was examined using chloramphenicol acetyltransferase gene fusions. Fusions containing 136 bp of DNA upstream of the promoter showed higher levels of expression as compared to those with only 16 bp. Similar to ATPase enzymatic activity, CAT expression also increased during growth at low pH. Analysis of RNA demonstrated that ATPase mRNA levels were higher at low pH, which supported the CAT activity data. Therefore, the F-ATPase from S. mutans was regulated, at least partially, by both the DNA located upstream of the promoter as well as by pH. Examination of structural models of the F-ATPase from the pathogenic oral organisms S. mutans and Lactobacillus casei and the non- pathogenic S. sanguis showed that the differences noted in the sequence of the catalytic β subunit do not result in structural alterations. Therefore, the contribution that the F-ATPase makes towards the aciduricity of the oral streptococci is linked to its increased expression at low pH or perhaps to structural differences in the other, less-conserved, domains of the enzyme.

  12. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  13. Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

    PubMed

    Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

    1994-06-03

    An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

  14. Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gindhart, J.G. Jr.; Kaufman, T.C.

    1995-02-01

    The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products.more » When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.« less

  15. Exhaust emission control and diagnostics

    DOEpatents

    Mazur, Christopher John; Upadhyay, Devesh

    2006-11-14

    A diesel engine emission control system uses an upstream oxidation catalyst and a downstream SCR catalyst to reduce NOx in a lean exhaust gas environment. The engine and upstream oxidation catalyst are configured to provide approximately a 1:1 ratio of NO to NO2 entering the downstream catalyst. In this way, the downstream catalyst is insensitive to sulfur contamination, and also has improved overall catalyst NOx conversion efficiency. Degradation of the system is determined when the ratio provided is no longer near the desired 1:1 ratio. This condition is detected using measurements of engine operating conditions such as from a NOx sensor located downstream of the catalysts. Finally, control action to adjust an injected amount of reductant in the exhaust gas based on the actual NO to NO2 ratio upstream of the SCR catalyst and downstream of the oxidation catalyst.

  16. Biological assessment of aquaculture effects on effluent-receiving streams in Ghana using structural and functional composition of fish and macroinvertebrate assemblages.

    PubMed

    Ansah, Yaw Boamah; Frimpong, Emmanuel A; Amisah, Stephen

    2012-07-01

    Biological assessment of aquatic ecosystems is widely employed as an alternative or complement to chemical and toxicity testing due to numerous advantages of using biota to determine ecosystem condition. These advantages, especially to developing countries, include the relatively low cost and technical requirements. This study was conducted to determine the biological impacts of aquaculture operations on effluent-receiving streams in the Ashanti Region of Ghana. We collected water, fish and benthic macroinvertebrate samples from 12 aquaculture effluent-receiving streams upstream and downstream of fish farms and 12 reference streams between May and August of 2009, and then calculated structural and functional metrics for biotic assemblages. Fish species with non-guarding mode of reproduction were more abundant in reference streams than downstream (P = 0.0214) and upstream (P = 0.0251), and sand-detritus spawning fish were less predominant in reference stream than upstream (P = 0.0222) and marginally less in downstream locations (P = 0.0539). A possible subsidy-stress response of macroinvertebrate family richness and abundance was also observed, with nutrient (nitrogen) augmentation from aquaculture and other farming activities likely. Generally, there were no, or only marginal differences among locations downstream and upstream of fish farms and in reference streams in terms of several other biotic metrics considered. Therefore, the scale of impact in the future will depend not only on the management of nutrient augmentation from pond effluents, but also on the consideration of nutrient discharges from other industries like fruit and vegetable farming within the study area.

  17. TEs or not TEs? That is the evolutionary question.

    PubMed

    Vaknin, Keren; Goren, Amir; Ast, Gil

    2009-10-23

    Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

  18. Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

    PubMed Central

    Hirsh, J; Morgan, B A; Scholnick, S B

    1986-01-01

    We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

  19. Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

    PubMed Central

    2010-01-01

    Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

  20. Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

    PubMed

    Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

    2010-07-04

    Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

  1. Evaluating the effects of check dams on channel geometry, bed sediment size and riparian vegetation in Mediterranean mountain torrents.

    PubMed

    Zema, Demetrio Antonio; Bombino, Giuseppe; Denisi, Pietro; Lucas-Borja, Manuel Esteban; Zimbone, Santo Marcello

    2018-06-12

    In mountain streams possible negative impacts of check dams on soil, water and riparian vegetation due to check dam installation can be noticed. In spite of the ample literature on the qualitative effects of engineering works on channel hydrology, morphology, sedimentary effects and riparian vegetation characteristics, quantitative evaluations of the changes induced by check dams on headwater characteristics are rare. In order to fill this gap, this study has evaluated the effects of check dams located in headwaters of Calabria (Southern Italy) on hydrological and geomorphological processes and on the response of riparian vegetation to these actions. The analysis has compared physical and vegetation indicators in transects identified around check dams (upstream and downstream) and far from their direct influence (control transects). Check dams were found to influence significantly unit discharge, surface and subsurface sediments (both upstream and downstream), channel shape and transverse distribution of riparian vegetation (upstream) as well as cover and structure of riparian complexes (downstream). The actions of the structures on torrent longitudinal slope and biodiversity of vegetation were less significant. The differences on bed profile slope were significant only between upstream and downstream transects. The results of the Agglomerative Hierarchical Cluster analysis confirmed the substantial similarity between upstream and control transects, thus highlighting that the construction of check dams, needed to mitigate the hydro-geological risks, has not strongly influenced the torrent functioning and ecology before check dam construction. Moreover, simple and quantitative linkages between torrent hydraulics, geomorphology and vegetation characteristics exist in the analysed headwaters; these relationships among physical adjustments of channels and most of the resulting characteristics of the riparian vegetation are specific for the transect locations with respect of check dams. Conversely, the biodiversity of the riparian vegetation basically eludes any quantitative relations with the physical and other vegetal characteristics of the torrent transects. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. The possible influence of upstream upper-level baroclinic processes on the development of the QE II storm

    NASA Technical Reports Server (NTRS)

    Uccellini, L. W.

    1986-01-01

    An analysis of the QE II storm of September 9-11, 1978 presents evidence for the existence of upper-level baroclinic processes upstream of the rapidly developing cyclone. The analysis shows that a deepening shortwave trough was located 400 to 500 km upstream of the site of the storm 12 h prior to rapid cyclogenesis. The trough was associated with: (1) a polar jet marked by 65 m/s winds in its core and significant vertical and horizontal wind shear, (2) positive vorticity advection and divergence at the 300 mb level, and (3) an intense frontal zone that extended from 300 mb down to the surface. It also appears that a tropopause fold likely extruded stratospheric air down to the 700-800 mb level, 400-500 km upstream of the surface low and 12 h prior to the explosive development phase of the cyclone. These findings raise questions about Gyakum's (1983) assertion that the QE II storm developed in an area in which the baroclinic support was confined to the lower troposphere and the related assertion by Anthes et al. (1983) that upper-level forcing upstream of the area of rapid cyclogenesis was weak and apparently not important in this case.

  3. Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana.

    PubMed

    Qin, Yuxiang; Tian, Yanchen; Han, Lu; Yang, Xinchao

    2013-10-25

    The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway. Copyright © 2013. Published by Elsevier Inc.

  4. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    PubMed

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  5. Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.

    PubMed

    Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li

    2014-10-01

    This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

  6. How Changes in Anti-SD Sequences Would Affect SD Sequences in Escherichia coli and Bacillus subtilis.

    PubMed

    Abolbaghaei, Akram; Silke, Jordan R; Xia, Xuhua

    2017-05-05

    The 3' end of the small ribosomal RNAs (ssu rRNA) in bacteria is directly involved in the selection and binding of mRNA transcripts during translation initiation via well-documented interactions between a Shine-Dalgarno (SD) sequence located upstream of the initiation codon and an anti-SD (aSD) sequence at the 3' end of the ssu rRNA. Consequently, the 3' end of ssu rRNA (3'TAIL) is strongly conserved among bacterial species because a change in the region may impact the translation of many protein-coding genes. Escherichia coli and Bacillus subtilis differ in their 3' ends of ssu rRNA, being GAUC ACCUCCUUA 3' in E. coli and GAUC ACCUCCUU UCU3' or GAUC ACCUCCUU UCUA3' in B. subtilis Such differences in 3'TAIL lead to species-specific SDs (designated SD Ec for E. coli and SD Bs for B. subtilis ) that can form strong and well-positioned SD/aSD pairing in one species but not in the other. Selection mediated by the species-specific 3'TAIL is expected to favor SD Bs against SD Ec in B. subtilis , but favor SD Ec against SD Bs in E. coli Among well-positioned SDs, SD Ec is used more in E. coli than in B. subtilis , and SD Bs more in B. subtilis than in E. coli Highly expressed genes and genes of high translation efficiency tend to have longer SDs than lowly expressed genes and genes with low translation efficiency in both species, but more so in B. subtilis than in E. coli Both species overuse SDs matching the bolded part of the 3'TAIL shown above. The 3'TAIL difference contributes to the host specificity of phages. Copyright © 2017 Abolbaghaei et al.

  7. Comparative genomics of four closely related Clostridium perfringens bacteriophages reveals variable evolution among core genes with therapeutic potential

    PubMed Central

    2011-01-01

    Background Because biotechnological uses of bacteriophage gene products as alternatives to conventional antibiotics will require a thorough understanding of their genomic context, we sequenced and analyzed the genomes of four closely related phages isolated from Clostridium perfringens, an important agricultural and human pathogen. Results Phage whole-genome tetra-nucleotide signatures and proteomic tree topologies correlated closely with host phylogeny. Comparisons of our phage genomes to 26 others revealed three shared COGs; of particular interest within this core genome was an endolysin (PF01520, an N-acetylmuramoyl-L-alanine amidase) and a holin (PF04531). Comparative analyses of the evolutionary history and genomic context of these common phage proteins revealed two important results: 1) strongly significant host-specific sequence variation within the endolysin, and 2) a protein domain architecture apparently unique to our phage genomes in which the endolysin is located upstream of its associated holin. Endolysin sequences from our phages were one of two very distinct genotypes distinguished by variability within the putative enzymatically-active domain. The shared or core genome was comprised of genes with multiple sequence types belonging to five pfam families, and genes belonging to 12 pfam families, including the holin genes, which were nearly identical. Conclusions Significant genomic diversity exists even among closely-related bacteriophages. Holins and endolysins represent conserved functions across divergent phage genomes and, as we demonstrate here, endolysins can have significant variability and host-specificity even among closely-related genomes. Endolysins in our phage genomes may be subject to different selective pressures than the rest of the genome. These findings may have important implications for potential biotechnological applications of phage gene products. PMID:21631945

  8. Chromosome-encoded narrow-spectrum Ambler class A beta-lactamase GIL-1 from Citrobacter gillenii.

    PubMed

    Naas, Thierry; Aubert, Daniel; Ozcan, Ayla; Nordmann, Patrice

    2007-04-01

    A novel beta-lactamase gene was cloned from the whole-cell DNA of an enterobacterial Citrobacter gillenii reference strain that displayed a weak narrow-spectrum beta-lactam-resistant phenotype and was expressed in Escherichia coli. It encoded a clavulanic acid-inhibited Ambler class A beta-lactamase, GIL-1, with a pI value of 7.5 and a molecular mass of ca. 29 kDa. GIL-1 had the highest percent amino acid sequence identity with TEM-1 and SHV-1, 77%, and 67%, respectively, and only 46%, 31%, and 32% amino acid sequence identity with CKO-1 (C. koseri), CdiA1 (C. diversus), and SED-1 (C. sedlaki), respectively. The substrate profile of the purified GIL-1 was similar to that of beta-lactamases TEM-1 and SHV-1. The blaGIL-1 gene was chromosomally located, as revealed by I-CeuI experiments, and was constitutively expressed at a low level in C. gillenii. No gene homologous to the regulatory ampR genes of chromosomal class C beta-lactamases was found upstream of the blaGIL-1 gene, which fits the noninducibility of beta-lactamase expression in C. gillenii. Rapid amplification of DNA 5' ends analysis of the promoter region revealed putative promoter sequences that diverge from what has been identified as the consensus sequence in E. coli. The blaGIL-1 gene was part of a 5.5-kb DNA fragment bracketed by a 9-bp duplication and inserted between the d-lactate dehydrogenase gene and the ydbH genes; this DNA fragment was absent in other Citrobacter species. This work further illustrates the heterogeneity of beta-lactamases in Citrobacter spp., which may indicate that the variability of Citrobacter species is greater than expected.

  9. Synchronized flow in oversaturated city traffic.

    PubMed

    Kerner, Boris S; Klenov, Sergey L; Hermanns, Gerhard; Hemmerle, Peter; Rehborn, Hubert; Schreckenberg, Michael

    2013-11-01

    Based on numerical simulations with a stochastic three-phase traffic flow model, we reveal that moving queues (moving jams) in oversaturated city traffic dissolve at some distance upstream of the traffic signal while transforming into synchronized flow. It is found that, as in highway traffic [Kerner, Phys. Rev. E 85, 036110 (2012)], such a jam-absorption effect in city traffic is explained by a strong driver's speed adaptation: Time headways (space gaps) between vehicles increase upstream of a moving queue (moving jam), resulting in moving queue dissolution. It turns out that at given traffic signal parameters, the stronger the speed adaptation effect, the shorter the mean distance between the signal location and the road location at which moving queues dissolve fully and oversaturated traffic consists of synchronized flow only. A comparison of the synchronized flow in city traffic found in this Brief Report with synchronized flow in highway traffic is made.

  10. Separated Flow over Wind Turbines

    NASA Astrophysics Data System (ADS)

    Brown, David; Lewalle, Jacques

    2015-11-01

    The motion of the separation point on an airfoil under unsteady flow can affect its performance and longevity. Of interest is to understand and control the performance decrease in wind turbines subject to turbulent flow. We examine flow separation on an airfoil at a 19 degree angle of attack under unsteady flow conditions. We are using a DU-96-W180 airfoil of chord length 242 mm. The unsteadiness is generated by a cylinder with diameter 203 mm located 7 diameters upstream of the airfoil's leading edge. The data comes from twenty surface pressure sensors located on the top and bottom of the airfoil as well as on the upstream cylinder. Methods of analysis include Mexican hat transforms, Morlet wavelet transforms, power spectra, and various cross correlations. With this study I will explore how the differences of signals on the pressure and suction sides of an airfoil are related to the motion of the separation point.

  11. Mercury accumulation in biota of Thunder Creek, Saskatchewan

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Munro, D.J.; Gummer, W.D.

    Collection of biological organisms was undertaken to investigate the bioaccumulation of mercury in the food chain, the results of which are reported. Two sites were selected on Thunder Creek; the control or background site, site number 2, is located approximately 2.5 km upstream, from site number 1. The selection of organisms for analysis was based on the presence and abundance of each at both locations. Only crayfish (Orconcetes virilis) pearl dace (Semotilus margarita) and brook stickleback (Culaea inconstans) were found to be sufficiently abundant. The importance of the data obtained is the significant difference in concentration between the upstream andmore » downstream sites on Thunder Creek. This difference shows that more mercury is available to the biological community at site number 1 than at site number 2 confirming that mercury in the contaminated sediments is being methylated and taken up into the food chain.« less

  12. Magnetic resonance imaging of living systems by remote detection

    DOEpatents

    Wemmer, David; Pines, Alexander; Bouchard, Louis; Xu, Shoujun; Harel, Elad; Budker, Dmitry; Lowery, Thomas; Ledbetter, Micah

    2013-10-29

    A novel approach to magnetic resonance imaging is disclosed. Blood flowing through a living system is prepolarized, and then encoded. The polarization can be achieved using permanent or superconducting magnets. The polarization may be carried out upstream of the region to be encoded or at the place of encoding. In the case of an MRI of a brain, polarization of flowing blood can be effected by placing a magnet over a section of the body such as the heart upstream of the head. Alternatively, polarization and encoding can be effected at the same location. Detection occurs at a remote location, using a separate detection device such as an optical atomic magnetometer, or an inductive Faraday coil. The detector may be placed on the surface of the skin next to a blood vessel such as a jugular vein carrying blood away from the encoded region.

  13. Synchronized flow in oversaturated city traffic

    NASA Astrophysics Data System (ADS)

    Kerner, Boris S.; Klenov, Sergey L.; Hermanns, Gerhard; Hemmerle, Peter; Rehborn, Hubert; Schreckenberg, Michael

    2013-11-01

    Based on numerical simulations with a stochastic three-phase traffic flow model, we reveal that moving queues (moving jams) in oversaturated city traffic dissolve at some distance upstream of the traffic signal while transforming into synchronized flow. It is found that, as in highway traffic [Kerner, Phys. Rev. EPLEEE81539-375510.1103/PhysRevE.85.036110 85, 036110 (2012)], such a jam-absorption effect in city traffic is explained by a strong driver's speed adaptation: Time headways (space gaps) between vehicles increase upstream of a moving queue (moving jam), resulting in moving queue dissolution. It turns out that at given traffic signal parameters, the stronger the speed adaptation effect, the shorter the mean distance between the signal location and the road location at which moving queues dissolve fully and oversaturated traffic consists of synchronized flow only. A comparison of the synchronized flow in city traffic found in this Brief Report with synchronized flow in highway traffic is made.

  14. A speed limit compliance model for dynamic speed display sign.

    PubMed

    Ardeshiri, Anam; Jeihani, Mansoureh

    2014-12-01

    Violating speed limits is a major cause of motor vehicle crashes. Various techniques have been adopted to ensure that posted speed limits are obeyed by drivers. This study investigates the effect of dynamic speed display signs (DSDSs) on drivers' compliance with posted speed limit. An extensive speed data collection upstream of, adjacent to, and downstream of DSDS locations on multiple road classes with different speed limits (25, 35, and 45 mph) was performed short-term and long-term after DSDS installation. Conventional statistical analysis, regression models, and a Bayesian network were developed to assess the DSDS's effectiveness. General compliance with speed limit (upstream of the DSDS location), time of day, day of week, duration of DSDS operation, and distance from the DSDS location were significantly correlated with speed limit compliance adjacent to the DSDS. While compliance with the speed limit due to the DSDS increased by 5%, speed reduction occurred in 40% of the cases. Since drivers were likely to increase their speed after passing the DSDS, it should be installed on critical points supplemented with enforcement. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Modelling the detachment dependence on strike point location in the small angle slot divertor (SAS) with SOLPS

    NASA Astrophysics Data System (ADS)

    Casali, Livia; Covele, Brent; Guo, Houyang

    2017-10-01

    The new Small Angle Slot (SAS) divertor in DIII-D is characterized by a shallow-angle target enclosed by a slot structure about the strike point (SP). SOLPS modelling results of SAS have demonstrated divertor closure's utility in widening the range of acceptable densities for adequate heat handling. An extensive database of runs has been built to study the detachment dependence on SP location in SAS. Density scans show that lower Te at lower upstream density occur when the SP is at the critical location in the slot. The cooling front spreads across the entire target at higher densities, in agreement with experimental Langmuir probe measurements. A localized increase of the atomic and molecular density takes place near the SP, which reduces the target incident power density and facilitates detachment at lower upstream density. Systematic scans of variables such as power, transport, and viscosity have been carried out to assess the detachment sensitivity. Therein, a positive role of the viscosity is found. This work supported by DOE Contract Number DE-FC02-04ER54698.

  16. Zadoff-Chu sequence-based hitless ranging scheme for OFDMA-PON configured 5G fronthaul uplinks

    NASA Astrophysics Data System (ADS)

    Reza, Ahmed Galib; Rhee, June-Koo Kevin

    2017-05-01

    A Zadoff-Chu (ZC) sequence-based low-complexity hitless upstream time synchronization scheme is proposed for an orthogonal frequency division multiple access passive optical network configured cloud radio access network fronthaul. The algorithm is based on gradual loading of the ZC sequences, where the phase discontinuity due to the cyclic prefix is alleviated by a frequency domain phase precoder, eliminating the requirements of guard bands to mitigate intersymbol interference and inter-carrier interference. Simulation results for uncontrolled-wavelength asynchronous transmissions from four concurrent transmitting optical network units are presented to demonstrate the effectiveness of the proposed scheme.

  17. Body morphology differs in wild juvenile Chinook salmon Oncorhynchus tshawytscha in the Willamette River, Oregon, USA

    USGS Publications Warehouse

    Billman, E.J.; Whitman, L.D.; Schroeder, R.K.; Sharpe, C.S.; Noakes, David L. G.; Schreck, Carl B.

    2014-01-01

    Body morphology of juvenile Chinook salmon Oncorhynchus tshawytscha in the upper Willamette River, Oregon, U.S.A., was analysed to determine if variation in body shape is correlated with migratory life-history tactics followed by juveniles. Body shape was compared between migrating juveniles that expressed different life-history tactics, i.e. autumn migrants and yearling smolts, and among parr sampled at three sites along a longitudinal river gradient. In the upper Willamette River, the expression of life-history tactics is associated with where juveniles rear in the basin with fish rearing in downstream locations generally completing ocean ward migrations earlier in life than fish rearing in upstream locations. The morphological differences that were apparent between autumn migrants and yearling smolts were similar to differences between parr rearing in downstream and upstream reaches, indicating that body morphology is correlated with life-history tactics. Autumn migrants and parr from downstream sampling sites had deeper bodies, shorter heads and deeper caudal peduncles compared with yearling smolts and parr from the upstream sampling site. This study did not distinguish between genetic and environmental effects on morphology; however, the results suggest that downstream movement of juveniles soon after emergence is associated with differentiation in morphology and with the expression of life-history variation.

  18. Distinct Escape Pathway by Hepatitis C Virus Genotype 1a from a Dominant CD8+ T Cell Response by Selection of Altered Epitope Processing.

    PubMed

    Walker, Andreas; Skibbe, Kathrin; Steinmann, Eike; Pfaender, Stephanie; Kuntzen, Thomas; Megger, Dominik A; Groten, Svenja; Sitek, Barbara; Lauer, Georg M; Kim, Arthur Y; Pietschmann, Thomas; Allen, Todd M; Timm, Joerg

    2016-01-01

    Antiviral CD8(+) T cells are a key component of the adaptive immune response against HCV, but their impact on viral control is influenced by preexisting viral variants in important target epitopes and the development of viral escape mutations. Immunodominant epitopes highly conserved across genotypes therefore are attractive for T cell based prophylactic vaccines. Here, we characterized the CD8(+) T cell response against the highly conserved HLA-B*51-restricted epitope IPFYGKAI1373-1380 located in the helicase domain of NS3 in people who inject drugs (PWID) exposed predominantly to HCV genotypes 1a and 3a. Despite this epitope being conserved in both genotypes, the corresponding CD8(+) T cell response was detected only in PWID infected with genotype 3a and HCV-RNA negative PWID, but not in PWID infected with genotype 1a. In genotype 3a, the detection of strong CD8(+) T cell responses was associated with epitope variants in the autologous virus consistent with immune escape. Analysis of viral sequences from multiple cohorts confirmed HLA-B*51-associated escape mutations inside the epitope in genotype 3a, but not in genotype 1a. Here, a distinct substitution in the N-terminal flanking region located 5 residues upstream of the epitope (S1368P; P = 0.00002) was selected in HLA-B*51-positive individuals. Functional assays revealed that the S1368P substitution impaired recognition of target cells presenting the endogenously processed epitope. The results highlight that, despite an epitope being highly conserved between two genotypes, there are major differences in the selected viral escape pathways and the corresponding T cell responses. HCV is able to evolutionary adapt to CD8(+) T cell immune pressure in multiple ways. Beyond selection of mutations inside targeted epitopes, this study demonstrates that HCV inhibits epitope processing by modification of the epitope flanking region under T cell immune pressure. Selection of a substitution five amino acids upstream of the epitope underlines that efficient antigen presentation strongly depends on its larger sequence context and that blocking of the multistep process of antigen processing by mutation is exploited also by HCV. The pathways to mutational escape of HCV are to some extent predictable but are distinct in different genotypes. Importantly, the selected escape pathway of HCV may have consequences for the destiny of antigen-specific CD8(+) T cells. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Molecular Characterization of Lactobacillus plantarum DMDL 9010, a Strain with Efficient Nitrite Degradation Capacity

    PubMed Central

    Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

    2014-01-01

    Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity. PMID:25423449

  20. Molecular characterization of Lactobacillus plantarum DMDL 9010, a strain with efficient nitrite degradation capacity.

    PubMed

    Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

    2014-01-01

    Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity.

  1. The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

    PubMed Central

    Grichnik, J M; French, B A; Schwartz, R J

    1988-01-01

    The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

  2. Isolation of a thyroid hormone-responsive gene by immunoprecipitation of thyroid hormone receptor-DNA complexes.

    PubMed Central

    Bigler, J; Eisenman, R N

    1994-01-01

    Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476

  3. Reservoir Sedimentation and Upstream Sediment Sources: Perspectives and Future Research Needs on Streambank and Gully Erosion.

    PubMed

    Fox, G A; Sheshukov, A; Cruse, R; Kolar, R L; Guertault, L; Gesch, K R; Dutnell, R C

    2016-05-01

    The future reliance on water supply and flood control reservoirs across the globe will continue to expand, especially under a variable climate. As the inventory of new potential dam sites is shrinking, construction of additional reservoirs is less likely compared to simultaneous flow and sediment management in existing reservoirs. One aspect of this sediment management is related to the control of upstream sediment sources. However, key research questions remain regarding upstream sediment loading rates. Highlighted in this article are research needs relative to measuring and predicting sediment transport rates and loading due to streambank and gully erosion within a watershed. For example, additional instream sediment transport and reservoir sedimentation rate measurements are needed across a range of watershed conditions, reservoir sizes, and geographical locations. More research is needed to understand the intricate linkage between upland practices and instream response. A need still exists to clarify the benefit of restoration or stabilization of a small reach within a channel system or maturing gully on total watershed sediment load. We need to better understand the intricate interactions between hydrological and erosion processes to improve prediction, location, and timing of streambank erosion and failure and gully formation. Also, improved process-based measurement and prediction techniques are needed that balance data requirements regarding cohesive soil erodibility and stability as compared to simpler topographic indices for gullies or stream classification systems. Such techniques will allow the research community to address the benefit of various conservation and/or stabilization practices at targeted locations within watersheds.

  4. Reservoir Sedimentation and Upstream Sediment Sources: Perspectives and Future Research Needs on Streambank and Gully Erosion

    NASA Astrophysics Data System (ADS)

    Fox, G. A.; Sheshukov, A.; Cruse, R.; Kolar, R. L.; Guertault, L.; Gesch, K. R.; Dutnell, R. C.

    2016-05-01

    The future reliance on water supply and flood control reservoirs across the globe will continue to expand, especially under a variable climate. As the inventory of new potential dam sites is shrinking, construction of additional reservoirs is less likely compared to simultaneous flow and sediment management in existing reservoirs. One aspect of this sediment management is related to the control of upstream sediment sources. However, key research questions remain regarding upstream sediment loading rates. Highlighted in this article are research needs relative to measuring and predicting sediment transport rates and loading due to streambank and gully erosion within a watershed. For example, additional instream sediment transport and reservoir sedimentation rate measurements are needed across a range of watershed conditions, reservoir sizes, and geographical locations. More research is needed to understand the intricate linkage between upland practices and instream response. A need still exists to clarify the benefit of restoration or stabilization of a small reach within a channel system or maturing gully on total watershed sediment load. We need to better understand the intricate interactions between hydrological and erosion processes to improve prediction, location, and timing of streambank erosion and failure and gully formation. Also, improved process-based measurement and prediction techniques are needed that balance data requirements regarding cohesive soil erodibility and stability as compared to simpler topographic indices for gullies or stream classification systems. Such techniques will allow the research community to address the benefit of various conservation and/or stabilization practices at targeted locations within watersheds.

  5. Contrasting terrace systems of the lower Moulouya river as indicator of crustal deformation in NE Morocco

    NASA Astrophysics Data System (ADS)

    Rixhon, Gilles; Bartz, Melanie; El Ouahabi, Meriam; Szemkus, Nina; Brückner, Helmut

    2017-02-01

    The Moulouya river has the largest catchment in Morocco and drains an area characterized by active crustal deformation during the Late Cenozoic due to the N-S convergence between the African and Eurasian plates. As yet, its Pleistocene terrace sequence remains poorly documented. Our study focuses on the lowermost reach of the river in north-eastern Morocco, which drains the Zebra-Triffa sedimentary basin directly upstream of the estuary. New field observations, measurements and sedimentological data reveal contrasting fluvial environments on each side of a newly identified, W-E striking thrust zone disrupting the sedimentary basin. On the one hand, long-lasting fluvial aggradation, materialized by 37 m-thick stacked terraces, has occurred in the footwall of the thrust. On the other hand, the hanging wall is characterized by a well-preserved terrace staircase, with three Pleistocene terrace levels. Whilst the identification of this thrust zone question some previous interpretations about the local (hydro-)geology, it is consistent with the statement that most of the Plio-Quaternary deformation in the eastern Rif mountains has concentrated in this region of Morocco. Our new data and interpretations also agree with morphometric indicators showing that the whole Moulouya catchment is at desequilibrium state (i.e. several knickzones in its longitudinal profile), showing several knickzones in its longitudinal profile, is at disequilibrium state. We also suggest that the knickzone in the Beni Snassen gorge, located directly upstream of the Zebra-Triffa sedimentary basin, could (partly) result from a transient fluvial reaction to Late Cenozoic thrusting activity and correlated uplift in the hanging wall.

  6. Site fidelity and condition metrics suggest sequential habitat use by early juvenile snook

    USGS Publications Warehouse

    Brame, Adam B.; McIvor, Carole; Peebles, Ernst B; Hollander, David J.

    2014-01-01

    The common snook Centropomus undecimalis is an estuarine-dependent fish that relies on landward wetlands as nursery habitat. Despite its economic importance, portions of the snook's early life history are poorly understood. We compared habitat use of young-of-the-year (YOY) snook in 2 geomorphic mesohabitats (tidal pond and tidal creek) along an estuarine gradient (upstream vs. downstream) within a single wetland during fall recruitment. We used abundance, length, condition indices, and stable isotopes to assess ontogenetic mesohabitat use and site fidelity. We found that (1) YOY snook were more abundant within the upstream creek and ponds; (2) the smallest snook were found only in ponds; (3) snook from ponds had lower condition (Fulton's K and hepatosomatic index); (4) snook began moving from ponds to the creek at ~40 mm standard length; and (5) snook from the 2 mesohabitats were isotopically distinct, indicating high site fidelity at rather small spatial scales. Collectively, these data identified sequential use of mesohabitats, wherein seaward-spawned YOY snook moved landward and recruited to pond habitats, where they dedicated energy to growth (as length) before making an ontogenetic habitat shift to the creek. Once in the creek, YOY snook condition improved as they approached maturity and started the downstream return towards seaward locations. The wetland network that was previously viewed as generalized nursery habitat instead consists of mesohabitats that support different life stages in sequence. This represents ontogenetic habitat complementation, in which lower availability of a required mesohabitat type may limit the entire wetland's contribution to the adult population.

  7. An analysis of effect of land use change on river flow variability

    NASA Astrophysics Data System (ADS)

    Zhang, Tao; Liu, Yuting; Yang, Xinyue; Wang, Xiang

    2018-02-01

    Land use scenario analysis, SWAT model, flow characteristic indices and flow variability technology were used to analyze the effect of land use quantity and location change on river flow. Results showed that river flow variation caused by land use change from forest to crop was larger than that caused by land use change from forest to grass; Land use change neither from upstream to downstream nor from downstream to upstream had little effect on annual average discharge and maximum annual average discharge. But it had obvious effect on maximum daily discharge; Land use change which occurred in upstream could lead to producing larger magnitude flood more easily; Land use change from forest to crop or grass could increase the number of large magnitude floods and their total duration. And it also could increase the number of small magnitude floods but decrease their duration.

  8. Fuel injection assembly for use in turbine engines and method of assembling same

    DOEpatents

    Uhm, Jong Ho; Johnson, Thomas Edward

    2015-03-24

    A fuel injection assembly for use in a turbine engine is provided. The fuel injection assembly includes a plurality of tube assemblies, wherein each of the tube assemblies includes an upstream portion and a downstream portion. Each tube assembly includes a plurality of tubes that extend from the upstream portion to the downstream portion or from the upstream portion through the downstream portion. At least one injection system is coupled to at least one tube assembly of the plurality of tube assemblies. The injection system includes a fluid supply member that extends from a fluid source to the downstream portion of the tube assembly. The fluid supply member includes a first end portion located in the downstream portion of the tube assembly, wherein the first end portion has at least one first opening for channeling fluid through the tube assembly to facilitate reducing a temperature therein.

  9. Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

    PubMed

    Bricheux, G; Brugerolle, G

    1997-08-01

    The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

  10. Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

    PubMed Central

    Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

    1995-01-01

    The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

  11. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    PubMed

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  12. Suppression subtractive hybridization identifies an autotransporter adhesin gene of E. coli IMT5155 specifically associated with avian pathogenic Escherichia coli (APEC).

    PubMed

    Dai, Jianjun; Wang, Shaohui; Guerlebeck, Doreen; Laturnus, Claudia; Guenther, Sebastian; Shi, Zhenyu; Lu, Chengping; Ewers, Christa

    2010-09-09

    Extraintestinal pathogenic E. coli (ExPEC) represent a phylogenetically diverse group of bacteria which are implicated in a large range of infections in humans and animals. Although subgroups of different ExPEC pathotypes, including uropathogenic, newborn meningitis causing, and avian pathogenic E. coli (APEC) share a number of virulence features, there still might be factors specifically contributing to the pathogenesis of a certain subset of strains or a distinct pathotype. Thus, we made use of suppression subtractive hybridization and compared APEC strain IMT5155 (O2:K1:H5; sequence type complex 95) with human uropathogenic E. coli strain CFT073 (O6:K2:H5; sequence type complex 73) to identify factors which may complete the currently existing model of APEC pathogenicity and further elucidate the position of this avian pathotype within the whole ExPEC group. Twenty-eight different genomic loci were identified, which are present in IMT5155 but not in CFT073. One of these loci contained a gene encoding a putative autotransporter adhesin. The open reading frame of the gene spans a 3,498 bp region leading to a putative 124-kDa adhesive protein. A specific antibody was raised against this protein and expression of the adhesin was shown under laboratory conditions. Adherence and adherence inhibition assays demonstrated a role for the corresponding protein in adhesion to DF-1 chicken fibroblasts. Sequence analyses revealed that the flanking regions of the chromosomally located gene contained sequences of mobile genetic elements, indicating a probable spread among different strains by horizontal gene transfer. In accordance with this hypothesis, the adhesin was found to be present not only in different phylogenetic groups of extraintestinal pathogenic but also of commensal E. coli strains, yielding a significant association with strains of avian origin. We identified a chromosomally located autotransporter gene in a highly virulent APEC strain which confers increased adherence of a non-fimbriated E. coli K-12 strain to a chicken fibroblast cell line. Even though flanked by mobile genetic elements and three different genetic regions upstream of the gene, most probably indicating horizontal gene transfer events, the adhesin gene was significantly linked with strains of avian origin. Due to the nucleotide sequence similarity of 98% to a recently published adhesin-related gene, located on plasmid pAPEC-O1-ColBM, the name aatA (APEC autotransporter adhesin A) was adopted from that study.Our data substantiate that AatA might not only be of relevance in APEC pathogenicity but also in facilitating their reservoir life style in the chicken intestine, which might pave the way for future intestinal preventive strategies.

  13. Bioinformatic dissecting of TP53 regulation pathway underlying butyrate-induced histone modification in epigenetic regulation

    USDA-ARS?s Scientific Manuscript database

    Butyrate affects cell proliferation, differentiation and motility. Butyrate inhibits histone deacetylase (HDAC) activities and induces cell cycle arrest and apoptosis. TP53 is one of the most active upstream regulators discovered by IPA in our RNA sequencing data set. The TP53 signaling pathway pl...

  14. The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

    PubMed

    Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

    1999-09-24

    To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

  15. The control of lambda DNA terminase synthesis.

    PubMed Central

    Murialdo, H; Davidson, A; Chow, S; Gold, M

    1987-01-01

    Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667

  16. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    PubMed Central

    2012-01-01

    Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

  17. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  18. Void/particulate detector

    DOEpatents

    Claytor, T.N.; Karplus, H.B.

    1983-09-26

    Apparatus for detecting voids and particulates in a flowing stream of fluid contained in a pipe may comprise: (a) a transducer for transmitting an ultrasonic signal into the stream, coupled to the pipe at a first location; (b) a second transducer for detecting the through-transmission of said signal, coupled to the pipe at a second location; (c) a third transducer for detecting the back-scattering of said signal, coupled to the pipe at a third location, said third location being upstream from said first location; (d) circuit means for normalizing the back-scattered signal from said third transducer to the through-transmitted signal from said second transducer; which normalized signal provides a measure of the voids and particulates flowing past said first location.

  19. Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

    PubMed Central

    Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

    2011-01-01

    Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

  20. Identification of hypothalamic arcuate nucleus-specific enhancer region of Kiss1 gene in mice.

    PubMed

    Goto, Teppei; Tomikawa, Junko; Ikegami, Kana; Minabe, Shiori; Abe, Hitomi; Fukanuma, Tatsuya; Imamura, Takuya; Takase, Kenji; Sanbo, Makoto; Tomita, Koichi; Hirabayashi, Masumi; Maeda, Kei-ichiro; Tsukamura, Hiroko; Uenoyama, Yoshihisa

    2015-01-01

    Pulsatile secretion of GnRH plays a pivotal role in follicular development via stimulating tonic gonadotropin secretion in mammals. Kisspeptin neurons, located in the arcuate nucleus (ARC), are considered to be an intrinsic source of the GnRH pulse generator. The present study aimed to determine ARC-specific enhancer(s) of the Kiss1 gene by an in vivo reporter assay. Three green fluorescent protein (GFP) reporter constructs (long, medium length, and short) were generated by insertion of GFP cDNA at the Kiss1 locus. Transgenic female mice bearing the long and medium-length constructs showed apparent GFP signals in kisspeptin-immunoreactive cells in both the ARC and anteroventral periventricular nucleus, in which another population of kisspeptin neurons are located. On the other hand, transgenic mice bearing 5'-truncated short construct showed few GFP signals in the ARC kisspeptin-immunoreactive cells, whereas they showed colocalization of GFP- and kisspeptin-immunoreactivities in the anteroventral periventricular nucleus. In addition, chromatin immunoprecipitation and chromosome conformation capture assays revealed recruitment of unoccupied estrogen receptor-α in the 5'-upstream region and intricate chromatin loop formation between the 5'-upstream and promoter regions of Kiss1 locus in the ARC. Taken together, the present results indicate that 5'-upstream region of Kiss1 locus plays a critical role in Kiss1 gene expression in an ARC-specific manner and that the recruitment of estrogen receptor-α and formation of a chromatin loop between the Kiss1 promoter and the 5' enhancer region may be required for the induction of ARC-specific Kiss1 gene expression. These results suggest that the 5'-upstream region of Kiss1 locus functions as an enhancer for ARC Kiss1 gene expression in mice.

  1. Location Is Everything: Evaluating the Effects of Terrestrial and Marine Resource Subsidies on an Estuarine Bivalve

    PubMed Central

    Harding, Joel M. S.; Segal, Michelle R.; Reynolds, John D.

    2015-01-01

    Estuaries are amongst the world’s most productive ecosystems, lying at the intersection between terrestrial and marine environments. They receive substantial inputs from adjacent landscapes but the importance of resource subsidies is not well understood. Here, we test hypotheses for the effects of both terrestrial- and salmon-derived resource subsidies on the diet (inferred from stable isotopes of muscle tissue), size and percent nitrogen of the soft-shell clam (Mya arenaria), a sedentary estuarine consumer. We examine how these relationships shift across natural gradients among 14 estuaries that vary in upstream watershed size and salmon density on the central coast of British Columbia, Canada. We also test how assimilation and response to subsidies vary at smaller spatial scales within estuaries. The depletion and enrichment of stable isotope ratios in soft-shell clam muscle tissue correlated with increasing upstream watershed size and salmon density, respectively. The effects of terrestrial- and salmon-derived subsidies were also strongest at locations near stream outlets. When we controlled for age of individual clams, there were larger individuals with higher percent nitrogen content in estuaries below larger watersheds, though this effect was limited to the depositional zones below river mouths. Pink salmon exhibited a stronger effect on isotope ratios of clams than chum salmon, which could reflect increased habitat overlap as spawning pink salmon concentrate in lower stream reaches, closer to intertidal clam beds. However, there were smaller clams in estuaries that had higher upstream pink salmon densities, possibly due to differences in habitat requirements. Our study highlights the importance of upstream resource subsidies to this bivalve species, but that individual responses to subsidies can vary at smaller scales within estuaries. PMID:25993002

  2. Optimization Review, Black Butte Mine Superfund Site, Lane County, Oregon

    EPA Pesticide Factsheets

    The BBM Superfund Site (the site) is located in Lane County, Oregon, approximately 35 miles southeast of Eugene and approximately 10 miles upstream from the Cottage Grove Reservoir (CGR). Mercury mining and processing operations were active at the site...

  3. A genetic switch controls the production of flagella and toxins in Clostridium difficile.

    PubMed

    Anjuwon-Foster, Brandon R; Tamayo, Rita

    2017-03-01

    In the human intestinal pathogen Clostridium difficile, flagella promote adherence to intestinal epithelial cells. Flagellar gene expression also indirectly impacts production of the glucosylating toxins, which are essential to diarrheal disease development. Thus, factors that regulate the expression of the flgB operon will likely impact toxin production in addition to flagellar motility. Here, we report the identification a "flagellar switch" that controls the phase variable production of flagella and glucosylating toxins. The flagellar switch, located upstream of the flgB operon containing the early stage flagellar genes, is a 154 bp invertible sequence flanked by 21 bp inverted repeats. Bacteria with the sequence in one orientation expressed flagellum and toxin genes, produced flagella, and secreted the toxins ("flg phase ON"). Bacteria with the sequence in the inverse orientation were attenuated for flagellar and toxin gene expression, were aflagellate, and showed decreased toxin secretion ("flg phase OFF"). The orientation of the flagellar switch is reversible during growth in vitro. We provide evidence that gene regulation via the flagellar switch occurs post-transcription initiation and requires a C. difficile-specific regulatory factor to destabilize or degrade the early flagellar gene mRNA when the flagellar switch is in the OFF orientation. Lastly, through mutagenesis and characterization of flagellar phase locked isolates, we determined that the tyrosine recombinase RecV, which catalyzes inversion at the cwpV switch, is also responsible for inversion at the flagellar switch in both directions. Phase variable flagellar motility and toxin production suggests that these important virulence factors have both advantageous and detrimental effects during the course of infection.

  4. Novel mutations of CHST6 in Iranian patients with macular corneal dystrophy

    PubMed Central

    Salehi, Zivar; Houshmand, Masoud; Mohamadi, Mohamad Javad; Promehr, Leila Azizade; Mozafarzadeh, Zahra

    2009-01-01

    Purpose To characterize mutations within the carbohydrate sulfotransferase 6 (CHST6) gene in Iranian subjects from 12 families with macular corneal dystrophy (MCD). Methods Genomic DNA was extracted from peripheral blood of 20 affected patients and 60 healthy volunteers followed by polymerase chain reaction (PCR) and direct sequencing of the CHST6 coding region. The observed nucleotide sequences were then compared with those found by investigators in other populations with MCD and in the controls. Results Analysis of CHST6 revealed 11 different mutations. These mutations were comprised of six novel missense mutations (p.F55L, p.P132L, p.S136G, p.C149Y, p.D203Y, and p.H249R), one novel nonsense mutation (p.S48X), one novel frame shift (after P297), and three previously reported missense mutations (p.P31L, p.C165Y, and p.R127C). The majority of the detected MCD mutations are located in the binding sites or the binding pocket, except the p.P31L and p.H249R mutations. Conclusions Nucleotide changes within the coding region of CHST6 are predicted to significantly alter the encoded sulfotransferase within the evolutionary conserved sequences. Our findings show that CHST6 mutations are responsible for the pathogenesis of MCD in Iranian patients. Moreover, the observation that some cases of MCD cannot be explained by mutations in the coding region of CHST6 suggests that MCD may result from possible upstream rearrangements in the CHST6 genomic region. PMID:19223992

  5. Novel mutations of CHST6 in Iranian patients with macular corneal dystrophy.

    PubMed

    Birgani, Shiva Akbari; Salehi, Zivar; Houshmand, Masoud; Mohamadi, Mohamad Javad; Promehr, Leila Azizade; Mozafarzadeh, Zahra

    2009-01-01

    To characterize mutations within the carbohydrate sulfotransferase 6 (CHST6) gene in Iranian subjects from 12 families with macular corneal dystrophy (MCD). Genomic DNA was extracted from peripheral blood of 20 affected patients and 60 healthy volunteers followed by polymerase chain reaction (PCR) and direct sequencing of the CHST6 coding region. The observed nucleotide sequences were then compared with those found by investigators in other populations with MCD and in the controls. Analysis of CHST6 revealed 11 different mutations. These mutations were comprised of six novel missense mutations (p.F55L, p.P132L, p.S136G, p.C149Y, p.D203Y, and p.H249R), one novel nonsense mutation (p.S48X), one novel frame shift (after P297), and three previously reported missense mutations (p.P31L, p.C165Y, and p.R127C). The majority of the detected MCD mutations are located in the binding sites or the binding pocket, except the p.P31L and p.H249R mutations. Nucleotide changes within the coding region of CHST6 are predicted to significantly alter the encoded sulfotransferase within the evolutionary conserved sequences. Our findings show that CHST6 mutations are responsible for the pathogenesis of MCD in Iranian patients. Moreover, the observation that some cases of MCD cannot be explained by mutations in the coding region of CHST6 suggests that MCD may result from possible upstream rearrangements in the CHST6 genomic region.

  6. Molecular identification and transcriptional regulation of porcine IFIT2 gene.

    PubMed

    Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di

    2018-04-06

    IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.

  7. 5' diversity of human hepatic PXR (NR1I2) transcripts and identification of the major transcription initiation site.

    PubMed

    Kurose, Kouichi; Koyano, Satoru; Ikeda, Shinobu; Tohkin, Masahiro; Hasegawa, Ryuichi; Sawada, Jun-Ichi

    2005-05-01

    The human pregnane X receptor (PXR) is a crucial regulator of the genes encoding several major cytochrome P450 enzymes and transporters, such as CYP3A4 and MDR1, but its own transcriptional regulation remains unclear. To elucidate the transcriptional mechanisms of human PXR gene, we first endeavored to identify the transcription initiation site of human PXR using 5'-RACE. Five types of 5'-variable transcripts (a, b, c, d, and e) with common exon 2 sequence were found, and comparison of these sequences with the genomic sequence suggested that their 5' diversity is derived from initiation by alternative promoters and alternative splicing. None of the exons found in our study contain any new in-frame coding regions. Newly identified introns IVS-a and IVS-b were found to have CT-AC splice sites that do not follow the GT-AG rule of conventional donor and acceptor splice sites. Of the five types of 5' variable transcripts identified, RT-PCR showed that type-a was the major transcript type. Four transcription initiation sites (A-D) for type-a transcript were identified by 5'-RACE using GeneRacer RACE Ready cDNA (human liver) constructed by the oligo-capping method. Putative TATA boxes were located approximately 30 bp upstream from the transcriptional start sites of the major transcript (C) and the longest minor transcript (A) expressed in the human liver. These results indicate that the initiation of transcription of human PXR is more complex than previously reported.

  8. Comparative genomic analysis reveals a novel mitochondrial isoform of human rTS protein and unusual phylogenetic distribution of the rTS gene

    PubMed Central

    Liang, Ping; Nair, Jayakumar R; Song, Lei; McGuire, John J; Dolnick, Bruce J

    2005-01-01

    Background The rTS gene (ENOSF1), first identified in Homo sapiens as a gene complementary to the thymidylate synthase (TYMS) mRNA, is known to encode two protein isoforms, rTSα and rTSβ. The rTSβ isoform appears to be an enzyme responsible for the synthesis of signaling molecules involved in the down-regulation of thymidylate synthase, but the exact cellular functions of rTS genes are largely unknown. Results Through comparative genomic sequence analysis, we predicted the existence of a novel protein isoform, rTS, which has a 27 residue longer N-terminus by virtue of utilizing an alternative start codon located upstream of the start codon in rTSβ. We observed that a similar extended N-terminus could be predicted in all rTS genes for which genomic sequences are available and the extended regions are conserved from bacteria to human. Therefore, we reasoned that the protein with the extended N-terminus might represent an ancestral form of the rTS protein. Sequence analysis strongly predicts a mitochondrial signal sequence in the extended N-terminal of human rTSγ, which is absent in rTSβ. We confirmed the existence of rTS in human mitochondria experimentally by demonstrating the presence of both rTSγ and rTSβ proteins in mitochondria isolated by subcellular fractionation. In addition, our comprehensive analysis of rTS orthologous sequences reveals an unusual phylogenetic distribution of this gene, which suggests the occurrence of one or more horizontal gene transfer events. Conclusion The presence of two rTS isoforms in mitochondria suggests that the rTS signaling pathway may be active within mitochondria. Our report also presents an example of identifying novel protein isoforms and for improving gene annotation through comparative genomic analysis. PMID:16162288

  9. Bioinformatic analysis suggests that the Orbivirus VP6 cistron encodes an overlapping gene

    PubMed Central

    Firth, Andrew E

    2008-01-01

    Background The genus Orbivirus includes several species that infect livestock – including Bluetongue virus (BTV) and African horse sickness virus (AHSV). These viruses have linear dsRNA genomes divided into ten segments, all of which have previously been assumed to be monocistronic. Results Bioinformatic evidence is presented for a short overlapping coding sequence (CDS) in the Orbivirus genome segment 9, overlapping the VP6 cistron in the +1 reading frame. In BTV, a 77–79 codon AUG-initiated open reading frame (hereafter ORFX) is present in all 48 segment 9 sequences analysed. The pattern of base variations across the 48-sequence alignment indicates that ORFX is subject to functional constraints at the amino acid level (even when the constraints due to coding in the overlapping VP6 reading frame are taken into account; MLOGD software). In fact the translated ORFX shows greater amino acid conservation than the overlapping region of VP6. The ORFX AUG codon has a strong Kozak context in all 48 sequences. Each has only one or two upstream AUG codons, always in the VP6 reading frame, and (with a single exception) always with weak or medium Kozak context. Thus, in BTV, ORFX may be translated via leaky scanning. A long (83–169 codon) ORF is present in a corresponding location and reading frame in all other Orbivirus species analysed except Saint Croix River virus (SCRV; the most divergent). Again, the pattern of base variations across sequence alignments indicates multiple coding in the VP6 and ORFX reading frames. Conclusion At ~9.5 kDa, the putative ORFX product in BTV is too small to appear on most published protein gels. Nonetheless, a review of past literature reveals a number of possible detections. We hope that presentation of this bioinformatic analysis will stimulate an attempt to experimentally verify the expression and functional role of ORFX, and hence lead to a greater understanding of the molecular biology of these important pathogens. PMID:18489030

  10. “Gate-keeper” Residues and Active-Site Rearrangements in DNA Polymerase μ Help Discriminate Non-cognate Nucleotides

    PubMed Central

    Li, Yunlang; Schlick, Tamar

    2013-01-01

    Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP

  11. The flow across a street canyon of variable width—Part 2:. Scalar dispersion from a street level line source

    NASA Astrophysics Data System (ADS)

    Simoëns, Serge; Wallace, James M.

    As described in Part 1 [Simoëns et al., 2007. The flow across a street canyon of variable width—Part 1: kinematic description. Atmospheric Environment 41, 9002-9017] measurements have been made of the velocity field around and within the canyon formed by two obstacles placed on the wall of a turbulent boundary layer. Here in Part 2 measurements of the scalar dispersion of smoke released from a two-dimensional slot in the wall perpendicular to the mean flow and located parallel to and midway between these two square obstacles are presented. The Reynolds number of the boundary layer at the slot location without the obstacles in place was Rθ≈980. Statistical properties of the concentration field and the scalar fluxes in the streamwise plane are reported here for canyon openings that have been chosen based on characteristics of the kinematic description. These opening widths, expressed as multiples of the obstacle height, are 1 h, 4 h and 8 h. The mean concentration field revealed that the much of the scalar is trapped on the leeward side of the upstream obstacle before some of it escapes the canyon and is entrained on the roof of the upstream obstacle. It then is spread downstream by the turbulence in the wake of this obstacle. Surprisingly, the root mean square (rms) concentration field reveals that high concentration fluctuations exist in a zone where velocity field turbulence is very low. Measured streamwise scalar fluxes were found to be negative above the obstacles, whereas they are mainly positive between the obstacles. The measured wall normal scalar fluxes have an inverse behavior. Within the canyon, the scalar fluxes are greatest in the region between the large primary vortex, evident in the kinematic field, and the secondary vortex located in the corner of the leeward side of the upstream obstacle. In the flow above the obstacle roofs the wake of the upstream obstacle seems to dominate the scalar transport. Between the obstacles in and above the canyon, the existence of intermittent and intense events appear to prevent the modelling of these fluxes with a simple mean concentration gradient model.

  12. Novel variable number of tandem repeats of gibbon MAOA gene and its evolutionary significance.

    PubMed

    Choi, Yuri; Jung, Yi-Deun; Ayarpadikannan, Selvam; Koga, Akihiko; Imai, Hiroo; Hirai, Hirohisa; Roos, Christian; Kim, Heui-Soo

    2014-08-01

    Variable number of tandem repeats (VNTRs) are scattered throughout the primate genome, and genetic variation of these VNTRs have been accumulated during primate radiation. Here, we analyzed VNTRs upstream of the monoamine oxidase A (MAOA) gene in 11 different gibbon species. An abundance of truncated VNTR sequences and copy number differences were observed compared to those of human VNTR sequences. To better understand the biological role of these VNTRs, a luciferase activity assay was conducted and results indicated that selected VNTR sequences of the MAOA gene from human and three different gibbon species (Hylobates klossii, Hylobates lar, and Nomascus concolor) showed silencing ability. Together, these data could be useful for understanding the evolutionary history and functional significance of MAOA VNTR sequences in gibbon species.

  13. Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.

    PubMed

    Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E

    2002-04-24

    The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.

  14. Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

    NASA Astrophysics Data System (ADS)

    Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

    1994-07-01

    We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

  15. ActiveDriverDB: human disease mutations and genome variation in post-translational modification sites of proteins

    PubMed Central

    Krassowski, Michal; Paczkowska, Marta; Cullion, Kim; Huang, Tina; Dzneladze, Irakli; Ouellette, B F Francis; Yamada, Joseph T; Fradet-Turcotte, Amelie

    2018-01-01

    Abstract Interpretation of genetic variation is needed for deciphering genotype-phenotype associations, mechanisms of inherited disease, and cancer driver mutations. Millions of single nucleotide variants (SNVs) in human genomes are known and thousands are associated with disease. An estimated 21% of disease-associated amino acid substitutions corresponding to missense SNVs are located in protein sites of post-translational modifications (PTMs), chemical modifications of amino acids that extend protein function. ActiveDriverDB is a comprehensive human proteo-genomics database that annotates disease mutations and population variants through the lens of PTMs. We integrated >385,000 published PTM sites with ∼3.6 million substitutions from The Cancer Genome Atlas (TCGA), the ClinVar database of disease genes, and human genome sequencing projects. The database includes site-specific interaction networks of proteins, upstream enzymes such as kinases, and drugs targeting these enzymes. We also predicted network-rewiring impact of mutations by analyzing gains and losses of kinase-bound sequence motifs. ActiveDriverDB provides detailed visualization, filtering, browsing and searching options for studying PTM-associated mutations. Users can upload mutation datasets interactively and use our application programming interface in pipelines. Integrative analysis of mutations and PTMs may help decipher molecular mechanisms of phenotypes and disease, as exemplified by case studies of TP53, BRCA2 and VHL. The open-source database is available at https://www.ActiveDriverDB.org. PMID:29126202

  16. Cloning and characterization of the mouse XPAC gene.

    PubMed Central

    van Oostrom, C T; de Vries, A; Verbeek, S J; van Kreijl, C F; van Steeg, H

    1994-01-01

    Xeroderma Pigmentosum is a human disease, which is, among others, characterized by a high incidence of (sunlight induced) skin cancer, due to a defect in nucleotide excision repair (NER). The human DNA repair gene XPAC corrects this defect in cells isolated from Xeroderma Pigmentosum complementation group A (XP-A) patients. To enable the development of a transgenic mouse model for XP-A by gene targeting in embryonic stem cells, we cloned and characterized the mouse homologue of the XPAC gene. The mouse XPAC gene was found to consist of 6 exons, spanning approximately 21 kb. The nucleotide sequence of the exons is identical to that of the also cloned the mouse XPAC cDNA. Furthermore, the deduced amino acid sequence of the XPAC protein is the same as the one published previously by Tanaka et al. From CAT assay analysis, the promoter of the XPAC gene appeared to be located within 313 bp upstream of the assumed transcriptional start site. Like the promoters of other eukaryotic DNA repair genes (i.e. ERCC-1 and XPBC/ERCC-3), the mouse XPAC promoter region lacks classical promoter elements like TATA-, GC- and CAAT boxes. However, it contains an unique polypyrimidine-rich box, which is so far only found in genes encoding DNA repair enzymes. The function of this box in the regulation of transcription is still unclear. PMID:8127648

  17. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

    PubMed Central

    Howe, J G; Shu, M D

    1988-01-01

    Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein. Images PMID:2839701

  19. A Metagenome-Wide Association Study and Arrayed Mutant Library Confirm Acetobacter Lipopolysaccharide Genes Are Necessary for Association with Drosophila melanogaster.

    PubMed

    White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M

    2018-03-28

    A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.

  20. Identification and subcellular localization of porcine deltacoronavirus accessory protein NS6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fang, Puxian; Fang, Liurong; Liu, Xiaorong

    Porcine deltacoronavirus (PDCoV) is an emerging swine enteric coronavirus. Accessory proteins are genus-specific for coronavirus, and two putative accessory proteins, NS6 and NS7, are predicted to be encoded by PDCoV; however, this remains to be confirmed experimentally. Here, we identified the leader-body junction sites of NS6 subgenomic RNA (sgRNA) and found that the actual transcription regulatory sequence (TRS) utilized by NS6 is non-canonical and is located upstream of the predicted TRS. Using the purified NS6 from an Escherichia coli expression system, we obtained two anti-NS6 monoclonal antibodies that could detect the predicted NS6 in cells infected with PDCoV or transfectedmore » with NS6-expressing plasmids. Further studies revealed that NS6 is always localized in the cytoplasm of PDCoV-infected cells, mainly co-localizing with the endoplasmic reticulum (ER) and ER-Golgi intermediate compartments, as well as partially with the Golgi apparatus. Together, our results identify the NS6 sgRNA and demonstrate its expression in PDCoV-infected cells. -- Highlights: •The leader-body fusion site of NS6 sgRNA is identified. •NS6 sgRNA uses a non-canonical transcription regulatory sequence (TRS). •NS6 can be expressed in PDCoV-infected cell. •NS6 predominantly localize to the ER complex and ER-Golgi intermediate compartment.« less

  1. Sulfur oxide adsorbents and emissions control

    DOEpatents

    Li, Liyu [Richland, WA; King, David L [Richland, WA

    2006-12-26

    High capacity sulfur oxide absorbents utilizing manganese-based octahedral molecular sieve (Mn--OMS) materials are disclosed. An emissions reduction system for a combustion exhaust includes a scrubber 24 containing these high capacity sulfur oxide absorbents located upstream from a NOX filter 26 or particulate trap.

  2. 10. Photocopy of Drawing, Barnstead Bridge, Pittsfield, New Hampshire, Sheet ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Photocopy of Drawing, Barnstead Bridge, Pittsfield, New Hampshire, Sheet 2, Upstream Elevation, Sections, Details and Quantities. Original located at the New Hampshire Department of Transportation, Concord, New Hampshire. - Barnstead Bridge, Spanning Suncook River at Barnstead Road, Pittsfield, Merrimack County, NH

  3. 39. DIABLO POWERHOUSE: GRAVITY LUBRICATING OIL TANKS. THESE TANKS ARE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    39. DIABLO POWERHOUSE: GRAVITY LUBRICATING OIL TANKS. THESE TANKS ARE LOCATED AT ROOF LEVEL AT THE NORTHEAST REAR CORNER OF DIABLO POWERHOUSE, 1989. - Skagit Power Development, Diablo Powerhouse, On Skagit River, 6.1 miles upstream from Newhalem, Newhalem, Whatcom County, WA

  4. Research on the upstream passage of juvenile salmon through culverts : retrofit baffles

    DOT National Transportation Integrated Search

    2006-04-01

    This report provides data from biological tests conducted November 2005 through January 2006 by Battelle for the Washington State Department of Transportation (WSDOT) at the Culvert Test Bed Facility located at the Washington Department of Fish and W...

  5. Recommendations for a wind profiling network to support Space Shuttle launches

    NASA Technical Reports Server (NTRS)

    Zamora, R. J.

    1992-01-01

    The feasibility is examined of a network of clear air radar wind profilers to forecast wind conditions before Space Shuttle launches during winter. Currently, winds are measured only in the vicinity of the shuttle launch site and wind loads on the launch vehicle are estimated using these measurements. Wind conditions upstream of the Cape are not monitored. Since large changes in the wind shear profile can be associated with weather systems moving over the Cape, it may be possible to improve wind forecasts over the launch site if wind measurements are made upstream. A radar wind profiling system is in use at the Space Shuttle launch site. This system can monitor the wind profile continuously. The existing profiler could be combined with a number of radars located upstream of the launch site. Thus, continuous wind measurements would be available upstream and at the Cape. NASA-Marshall representatives have set the requirements for radar wind profiling network. The minimum vertical resolution of the network must be set so that the wind shears over the depths greater than or = 1 km will be detected. The network should allow scientists and engineers to predict the wind profile over the Cape 6 hours before a Space Shuttle launch.

  6. Identification and management of microbial contaminations in a surface drinking water source.

    PubMed

    Aström, J; Pettersson, T J R; Stenström, T A

    2007-01-01

    Microbial contamination of surface waters constitutes a health risk for drinking water consumers which may be lowered by closing the raw water intake. We have evaluated microbial discharge events reported in the river Göta älv, which is used for raw water supply to the city of Göteborg. Elevated levels of faecal indicator bacteria were observed during periods of closed raw water intake. High bacteria levels were, however, also occasionally detected during periods of open intake, probably as a result of microbial discharge far upstream in the river which may be difficult to predict and manage by closing the intake. Accumulated upstream precipitations, resulting in surface runoff and wastewater contaminations in the catchment, correlated positively with the levels of total coliforms, E. coli, intestinal enterococci and sulfite-reducing clostridia. Levels of faecal indicator organisms were negatively correlated to the water temperature due to enhanced survival at lower temperatures. Wastewater discharges from a municipality located just upstream of the water intake resulted in elevated E. coli concentrations downstream at the raw water intake for Göteborg. To improve the prediction of microbial contaminations within the river Göta älv, monitoring data on turbidity and upstream precipitation are of particular importance.

  7. 8” x 10” black and white photographic print made from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. New 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. DECEMBER 31, 1934 PHOTOGRAPH NO. 61 OF CONTRACT NO. 4 SHOWING BRIDGE SUPERSTRUCTURE UPSTREAM CONCRETE ROADWAY. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  8. Pure Perceptual-Based Sequence Learning: A Role for Visuospatial Attention

    ERIC Educational Resources Information Center

    Remillard, Gilbert

    2009-01-01

    Learning the structure of a sequence of target locations when target location is not the response dimension and the sequence of target locations is uncorrelated with the sequence of responses is called pure perceptual-based sequence learning. The paradigm introduced by G. Remillard (2003) was used to determine whether orienting of visuospatial…

  9. [Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

    PubMed

    Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

    2015-04-01

    This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

  10. Balancing gene expression without library construction via a reusable sRNA pool.

    PubMed

    Ghodasara, Amar; Voigt, Christopher A

    2017-07-27

    Balancing protein expression is critical when optimizing genetic systems. Typically, this requires library construction to vary the genetic parts controlling each gene, which can be expensive and time-consuming. Here, we develop sRNAs corresponding to 15nt 'target' sequences that can be inserted upstream of a gene. The targeted gene can be repressed from 1.6- to 87-fold by controlling sRNA expression using promoters of different strength. A pool is built where six sRNAs are placed under the control of 16 promoters that span a ∼103-fold range of strengths, yielding ∼107 combinations. This pool can simultaneously optimize up to six genes in a system. This requires building only a single system-specific construct by placing a target sequence upstream of each gene and transforming it with the pre-built sRNA pool. The resulting library is screened and the top clone is sequenced to determine the promoter controlling each sRNA, from which the fold-repression of the genes can be inferred. The system is then rebuilt by rationally selecting parts that implement the optimal expression of each gene. We demonstrate the versatility of this approach by using the same pool to optimize a metabolic pathway (β-carotene) and genetic circuit (XNOR logic gate). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Isolation, characterization, and structure analysis of a vacuolar processing enzyme gene (MhVPEγ) from Malus hupehensis (Pamp) Rehd.

    PubMed

    Ran, Kun; Yang, Hongqiang; Sun, Xiaoli; Li, Qiang; Jiang, Qianqian; Zhang, Weiwei; Shen, Wei

    2014-05-01

    Vacuolar processing enzymes (VPEs) have received considerable attention recently, as they exhibit caspase-1-like cleavage activity and regulate the process of PCD. However, knowledge about their detailed characteristics and structures is relatively limited. In this study, a gamma vacuolar processing enzyme gene, MhVPEγ, has been isolated from the leaves of Malus hupehensis (Ramp) Rehd. var pinyiensis Jiang. MhVPEγ coded-translated protein sequence comprised of 494 amino acids with a signal peptide and a transmembrane helix structure at N-terminal, peptidase_C13 domain, and vacuolar sorting signal at C-terminal. Consequently, genomic walking approach was performed for the isolation of its upstream sequence. Computational analysis demonstrated several motifs of the promoter exhibiting hypothetic MeJA, ABA, and light-induced characteristics, as well as some typical domains universally discovered in promoter, such as TATA-box and CAAT-box. MhVPEγ transcript level was enhanced during wounding treatment, and WUN-motif, as one of the cis-acting regulatory elements existing in the upstream sequence perhaps regulates its expression. In silico-constructed 3D models revealed that MhCPYL successively interacts with MhVPEγ like that of "Induced Fit-Lock and Key" model, providing molecular conformation evidence that CPY is a direct substrate of VPEγ. This study is the first stride to understand the molecular mechanism of VPEγ and CPYL interactions.

  12. New investigations around CYP11A1 and its possible involvement in an androstenone QTL characterised in Large White pigs

    PubMed Central

    2011-01-01

    Background Previously, in boars with extreme androstenone levels, differential expression of the CYP11A1 gene in the testes has been characterised. CYP11A1 is located in a region where a QTL influencing boar fat androstenone levels has been detected in a Large White pig population. Clarifying the role of CYP11A1 in boar taint is important because it catalyses the initial step of androstenone synthesis and also of steroid synthesis. Results A genome-wide association study located CYP11A1 at approximately 1300 kb upstream from SNP H3GA0021967, defining the centre of the region containing the QTL for androstenone variation. In this study, we partially sequenced the CYP11A1 gene and identified several new single nucleotide polymorphisms (SNP) within it. Characterisation of one animal, heterozygous for CYP11A1 testicular expression but homozygous for a haplotype of a large region containing CYP11A1, revealed that variation of CYP11A1 expression is probably regulated by a mutation located downstream from the SNP H3GA0021967. We analysed CYP11A1 expression in LW families according to haplotypes of the QTL region's centre. Effects of haplotypes on CYP11A1 expression and on androstenone accumulation were not concordant. Conclusion This study shows that testicular expression of CYP11A1 is not solely responsible for the QTL influencing boar fat androstenone levels. As a conclusion, we propose to refute the hypothesis that a single mutation located near the centre of the QTL region could control androstenone accumulation in fat by regulating the CYP11A1 expression. PMID:21504607

  13. Experimental evaluation and analysis of methane fire and explosion mitigation using isolation valves integrated with a vent system.

    PubMed

    Ajrash, Mohammed J; Zanganeh, Jafar; Moghtaderi, Behdad

    2017-10-05

    There has been a surge of interest from the extractive industries in the application of mechanical means to the mitigation of flame deflagration. To verify the implementation and performance of passive and active mitigation protection, a comprehensive experimental investigation has been conducted on a large scale detonation tube, 30m long and 0.5m in diameter, with two mitigation valves (passive and active) and a burst panel venting system. The valves were used alternately to mitigate the flame deflagration of methane in concentrations ranging from 1.25% to 7.5%. The experimental work revealed that locating the passive mitigation valve at 22m distance from the ignition source mitigates the flame by fully isolating the tube. However, closing the valve structure in the axial direction generated another pressure wave upstream, which was approximately the same value as for the original pressure wave upstream. In the case of the active mitigation system, the system perfectly isolated upstream from downstream with no further pressure wave generation. When the vent was located at 6.5m from the ignition source, the total pressure was reduced by 0.48bar. Due to the counter flow of the reflected pressure wave the flame was extinguished at 12.5m from the ignition source. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Estimation of potential runoff-contributing areas in the Kansas-Lower Republican River Basin, Kansas

    USGS Publications Warehouse

    Juracek, Kyle E.

    1999-01-01

    Digital soils and topographic data were used to estimate and compare potential runoff-contributing areas for 19 selected subbasins representing soil, slope, and runoff variability within the Kansas-Lower Republican (KLR) River Basin. Potential runoff-contributing areas were estimated separately and collectively for the processes of infiltration-excess and saturation-excess overland flow using a set of environmental conditions that represented high, moderate, and low potential runoff. For infiltration-excess overland flow, various rainfall intensities and soil permeabilities were used. For saturation-excess overland flow, antecedent soil-moisture conditions and a topographic wetness index were used. Results indicated that the subbasins with relatively high potential runoff are located in the central part of the KLR River Basin. These subbasins are Black Vermillion River, Clarks Creek, Delaware River upstream from Muscotah, Grasshopper Creek, Mill Creek (Wabaunsee County), Soldier Creek, Vermillion Creek (Pottawatomie County), and Wildcat Creek. The subbasins with relatively low potential runoff are located in the western one-third of the KLR River Basin, with one exception, and are Buffalo Creek, Little Blue River upstream from Barnes, Mill Creek (Washington County), Republican River between Concordia and Clay Center, Republican River upstream from Concordia, Wakarusa River downstream from Clinton Lake (exception), and White Rock Creek. The ability to distinguish the subbasins as having relatively high or low potential runoff was possible mostly due to the variability of soil permeability across the KLR River Basin.

  15. Photographic copy of early black and white photograph. Located loose ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of early black and white photograph. Located loose in oversized box at the National Museum of American History, Smithsonian Institution, Archives Center, Work and Industry Division, Washington, D.C. Original Photographer unknown. EARLY PHOTOGRAPH OF BRIDGE TAKEN FROM WEST BANK APPROACH LOOKING NORTH TOWARD EAST BANK. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  16. Large Eddy Simulation of the fuel transport and mixing process in a scramjet combustor with rearwall-expansion cavity

    NASA Astrophysics Data System (ADS)

    Cai, Zun; Liu, Xiao; Gong, Cheng; Sun, Mingbo; Wang, Zhenguo; Bai, Xue-Song

    2016-09-01

    Large Eddy Simulation (LES) was employed to investigate the fuel/oxidizer mixing process in an ethylene fueled scramjet combustor with a rearwall-expansion cavity. The numerical solver was first validated for an experimental flow, the DLR strut-based scramjet combustor case. Shock wave structures and wall-pressure distribution from the numerical simulations were compared with experimental data and the numerical results were shown in good agreement with the available experimental data. Effects of the injection location on the flow and mixing process were then studied. It was found that with a long injection distance upstream the cavity, the fuel is transported much further into the main flow and a smaller subsonic zone is formed inside the cavity. Conversely, with a short injection distance, the fuel is entrained more into the cavity and a larger subsonic zone is formed inside the cavity, which is favorable for ignition in the cavity. For the rearwall-expansion cavity, it is suggested that the optimized ignition location with a long upstream injection distance should be in the bottom wall in the middle part of the cavity, while the optimized ignition location with a short upstream injection distance should be in the bottom wall in the front side of the cavity. By employing a cavity direct injection on the rear wall, the fuel mass fraction inside the cavity and the local turbulent intensity will both be increased due to this fueling, and it will also enhance the mixing process which will also lead to increased mixing efficiency. For the rearwall-expansion cavity, the combined injection scheme is expected to be an optimized injection scheme.

  17. Formation of fluvial knickzones in Japanese mountainous areas: A spatial analysis using GIS and DEMs

    NASA Astrophysics Data System (ADS)

    Hayakawa, Y. S.; Oguchi, T.

    2006-12-01

    Fluvial knickzones are the elements of bedrock rivers that can enhance stream erosion into bedrock, and they can be key morphologies highlighting interactions among earth surface processes such as erosion, tectonics, and volcanism. This study examines the longitudinal profiles of Japanese mountain rivers to illustrate the distribution of knickzones and discusses their role in the landscape development. Using 50-m DEMs, knickzones were extracted based on a quantitative criterion, and 5,753 knickzones were identified in the rivers of ca. 65,000 km long. The location of the knickzones was then examined along with other GIS data including topography, geology and precipitation. Overall, topographical conditions have the strongest influences on knickzone abundance, and upstream steep reaches of the rivers are more favorable for knickzone existence. The knickzone abundance for each rock type is also controlled by stream gradients, and lighologic boundaries do not show significant correlations with the knickzone locations. The controls of lithologic substrate on the knickzone locations are therefore limited. The abundant knickzones in steep river reaches indicate a hydraulic origin of knickzones, where stream erosions have enough strength in shaping the bedrock. Moreover, the knickzones are frequently observed in reaches slightly upstream from the major confluences at which stream discharge abruptly increases, indicating that the hydraulic anomalies of water flows at the confluences can cause knickzones which may later migrate upstream. The other possible causes of knickzone initiation including volcanic, tectonic and climatic effects are also suggested. The abundant knickzones in Japanese mountain rivers, resulted from the interactions among surface processes, suggest that river morphology modeling needs to consider the initiation and development of knickzones. tokyo.ac.jp/~hayakawa/

  18. Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

    PubMed Central

    Das, G; Henning, D; Wright, D; Reddy, R

    1988-01-01

    Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

  19. Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

    PubMed Central

    Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

    1987-01-01

    The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

  20. Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.

    PubMed Central

    Stewart, A F; Willis, I M; Mackinlay, A G

    1984-01-01

    The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443

  1. Nucleotide sequences and regulational analysis of genes involved in conversion of aniline to catechol in Pseudomonas putida UCC22(pTDN1).

    PubMed Central

    Fukumori, F; Saint, C P

    1997-01-01

    A 9,233-bp HindIII fragment of the aromatic amine catabolic plasmid pTDN1, isolated from a derivative of Pseudomonas putida mt-2 (UCC22), confers the ability to degrade aniline on P. putida KT2442. The fragment encodes six open reading frames which are arranged in the same direction. Their 5' upstream region is part of the direct-repeat sequence of pTDN1. Nucleotide sequence of 1.8 kb of the repeat sequence revealed only a single base pair change compared to the known sequence of IS1071 which is involved in the transposition of the chlorobenzoate genes (C. Nakatsu, J. Ng, R. Singh, N. Straus, and C. Wyndham, Proc. Natl. Acad. Sci. USA 88:8312-8316, 1991). Four open reading frames encode proteins with considerable homology to proteins found in other aromatic-compound degradation pathways. On the basis of sequence similarity, these genes are proposed to encode the large and small subunits of aniline oxygenase (tdnA1 and tdnA2, respectively), a reductase (tdnB), and a LysR-type regulatory gene (tdnR). The putative large subunit has a conserved [2Fe-2S]R Rieske-type ligand center. Two genes, tdnQ and tdnT, which may be involved in amino group transfer, are localized upstream of the putative oxygenase genes. The tdnQ gene product shares about 30% similarity with glutamine synthetases; however, a pUC-based plasmid carrying tdnQ did not support the growth of an Escherichia coli glnA strain in the absence of glutamine. TdnT possesses domains that are conserved among amidotransferases. The tdnQ, tdnA1, tdnA2, tdnB, and tdnR genes are essential for the conversion of aniline to catechol. PMID:8990291

  2. Characterization and placement of wetlands for integrated watershed conservation practice planning

    USDA-ARS?s Scientific Manuscript database

    Constructed wetlands have been recognized as an efficient and cost-effective conservation practice to protect water quality through reducing the transport of sediments and nutrients from upstream croplands to downstream water bodies. The challenge resides in targeting the strategic location of wetla...

  3. An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Damiani, R.D. Jr.; Wessler, S.R.

    1993-09-01

    The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open readingmore » frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.« less

  4. Temporal genetic monitoring of hybridization between native westslope cutthroat trout and introduced rainbow trout in the Stehekin River, Washington

    USGS Publications Warehouse

    Ostberg, Carl O.; Chase, Dorothy M.

    2012-01-01

    Introgressive hybridization with introduced rainbow trout (RBT) (Oncorhynchus mykiss) has led to the loss of native cutthroat trout species (O. clarkii) throughout their range, creating conservation concerns. Monitoring temporal hybridization trends provides resource managers with a tool for determining population status and information for establishing conservation goals for native cutthroat trout. In this study, we re-sampled six locations in 2010 within the Stehekin River watershed, North Cascades National Park, which were originally sampled between 1999 and 2003. We used genetic markers to monitor changes in hybridization levels between sampling periods in the native westslope cutthroat trout (WCT) (O. c. lewisi) stemming from past RBT introductions. Additionally, two new locations from the lower Stehekin drainage were added to the baseline data. We found that the frequency of WCT, RBT, and their hybrids was not significantly different between monitoring periods, but that RBT allele frequencies decreased in two locations and increased in one location. We also found a consistent, substantial reduction in the frequency of RBT alleles over the monitoring period in the Stehekin River upstream of Bridge Creek (SR3) compared to the Stehekin River downstream of Bridge Creek (SR1 -2) and within lower Bridge Creek (BR1) although these three locations are confined to a small geographic area (approximately 5 km). Ecological and/or evolutionary processes likely restrict the dispersal of RBT alleles in the Stehekin River upstream of Bridge Creek.

  5. Three enhancer regions regulate gbx2 gene expression in the isthmic region during zebrafish development.

    PubMed

    Islam, Md Ekramul; Kikuta, Hiroshi; Inoue, Fumitaka; Kanai, Maiko; Kawakami, Atsushi; Parvin, Mst Shahnaj; Takeda, Hiroyuki; Yamasu, Kyo

    2006-12-01

    In vertebrate embryos, positioning of the boundary between the midbrain and hindbrain (MHB) and subsequent isthmus formation are dependent upon the interaction between the Otx2 and Gbx genes. In zebrafish, sequential expression of gbx1 and gbx2 in the anterior hindbrain contributes to this process, whereas in mouse embryos, a single Gbx gene (Gbx2) is responsible for MHB development. In the present study, to investigate the regulatory mechanism of gbx2 in the MHB/isthmic region of zebrafish embryos, we cloned the gene and showed that its organization is conserved among different vertebrates. Promoter analyses revealed three enhancers that direct reporter gene expression after the end of epiboly in the anterior-most hindbrain, which is a feature of the zebrafish gbx2 gene. One of the enhancers is located upstream of gbx2 (AMH1), while the other two enhancers are located downstream of gbx2 (AMH2 and AMH3). Detailed analysis of the AMH1 enhancer showed that it directs expression in the rhombomere 1 (r1) region and the dorsal thalamus, as has been shown for gbx2, whereas no expression was induced by the AMH1 enhancer in other embryonic regions in which gbx2 is expressed. The AMH1 enhancer is composed of multiple regulatory subregions that share the same spatial specificity. The most active of the regulatory subregions is a 291-bp region that contains at least two Pax2-binding sites, both of which are necessary for the function of the main component (PB1-A region) of the AMH1 enhancer. In accordance with these results, enhancer activity in the PB1-A region, as well as gbx2 expression in r1, was missing in no isthmus mutant embryos that lacked functional pax2a. In addition, we identified an upstream conserved sequence of 227bp that suppresses the enhancer activity of AMH1. Taken together, these findings suggest that gbx2 expression during the somitogenesis stage in zebrafish is regulated by a complex mechanism involving Pax2 as well as activators and suppressors in the regions flanking the gene.

  6. Streambed stresses and flow around bridge piers

    USGS Publications Warehouse

    Parola, A.C.; Ruhl, K.J.; Hagerty, D.J.; Brown, B.M.; Ford, D.L.; Korves, A.A.

    1996-01-01

    Scour of streambed material around bridge foundations by floodwaters is the leading cause of catastrophic bridge failure in the United States. The potential for scour and the stability of riprap used to protect the streambed from scour during extreme flood events must be known to evaluate the likelihood of bridge failure. A parameter used in estimating the potential for scour and removal of riprap protection is the time-averaged shear stress on the streambed often referred to as boundary stress. Bridge components, such as bridge piers and abutments, obstruct flow and induce strong vortex systems that create streambed or boundary stresses significantly higher than those in unobstructed flow. These locally high stresses can erode the streambed around pier and abutment foundations to the extent that the foundation is undermined, resulting in settlement or collapse of bridge spans. The purpose of this study was to estimate streambed stresses at a bridge pier under full-scale flow conditions and to compare these stresses with those obtained previously in small-scale model studies. Two-dimensional velocity data were collected for three flow conditions around a bridge pier at the Kentucky State Highway 417 bridge over the Green River at Greensburg in Green County, Ky. Velocity vector plots and the horizontal component of streambed stress contour plots were developed from the velocity data. The streambed stress contours were developed using both a near-bed velocity and velocity gradient method. Maximum near-bed velocities measured at the pier for the three flow conditions were 1.5, 1.6, and 2.0 times the average near-bed velocities measured in the upstream approach flow. Maximum streambed stresses for the three flow conditions were determined to be 10, 15, and 36 times the streambed stresses of the upstream approach flow. Both the near-bed velocity measurements and approximate maximum streambed stresses at the full-scale pier were consistent with those observed in experiments using small-scale models in which similar data were collected, except for a single observation of the near-bed velocity data and the corresponding streambed stress determination. The location of the maximum streambed stress was immediately downstream of a 90 degree radial of the upstream cylinder (with the center of the upstream cylinder being the origin) for the three flow conditions. This location was close to the flow wake separation point at the upstream cylinder. Other researchers have observed the maximum streambed stress around circular cylinders at this location or at a location immediately upstream of the wake separation point. Although the magnitudes of the estimated streambed stresses measured at the full-scale pier were consistent with those measured in small-scale model studies, the stress distributions were significantly different than those measured in small-scale models. The most significant discrepancies between stress contours developed in this study and those developed in the small-scale studies for flow around cylindrical piers on a flat streambed were associated with the shape of the stress contours. The extent of the high stress region of the streambed around the full-scale pier was substantially larger than the diameter of the upstream cylinder, while small-scale models had small regions compared to the diameter of the model cylinders. In addition, considerable asymmetry in the stress contours was observed. The large region of high stress and asymmetry was attributed to several factors including (1) the geometry of the full-scale pier, (2) the non-planar topography of the streambed, (3) the 20 degree skew of the pier to the approaching flow, and (4) the non-uniformity of the approach flow. The extent of effect of the pier on streambed stresses was found to be larger for the full-scale site than for model studies. The results from the model studies indicated that the streambed stresses created by the obstruction of flow by the 3-foot wide pi

  7. Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

    PubMed

    Sakumi, K; Sekiguchi, M

    1989-01-20

    The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

  8. Characterization of the human peroxisome proliferator activated receptor delta gene and its expression.

    PubMed

    Skogsberg, J; Kannisto, K; Roshani, L; Gagne, E; Hamsten, A; Larsson, C; Ehrenborg, E

    2000-07-01

    Peroxisome proliferator activated receptors (PPARs) are nuclear receptors regulating the expression of genes involved in lipid and glucose metabolism. Three different PPARs; alpha (PPARA), gamma (PPARG) and delta (PPARD) have been characterized and they are distinguished from each other by tissue distribution and cell activation. In this study, the structure and detailed chromosomal localization of the human PPARD gene was determined. Three genomic clones containing the PPARD gene was isolated from a human P1 library. The gene spans approximately 85 kb of DNA and consists of 9 exons and 8 introns with exons ranging in size from 84 bp to 2.3 kb and introns ranging from 180 bp to 50 kb. All splice acceptor and donor sites conform to the consensus sequences including the AG-GT motif. Although PPARD lacks a TATA box, the gene is transcribed from a unique start site located 380 bp upstream of the ATG initiation codon. The 5' and 3' ends were mapped by rapid amplification of cDNA ends and the mRNA size of PPARD based upon the structure of the gene is 3803 bp. In addition, the chromosomal sublocalization of PPARD was determined by radiation hybrid mapping. The PPARD gene is located at 14 cR from the colipase gene and 15 cR from the serine kinase gene at chromosomal region 6p21.2.

  9. Quantifying the Effect of DNA Packaging on Gene Expression Level

    NASA Astrophysics Data System (ADS)

    Kim, Harold

    2010-10-01

    Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

  10. CHARGE syndrome: a recurrent hotspot of mutations in CHD7 IVS25 analyzed by bioinformatic tools and minigene assays.

    PubMed

    Legendre, Marine; Rodriguez-Ballesteros, Montserrat; Rossi, Massimiliano; Abadie, Véronique; Amiel, Jeanne; Revencu, Nicole; Blanchet, Patricia; Brioude, Frédéric; Delrue, Marie-Ange; Doubaj, Yassamine; Sefiani, Abdelaziz; Francannet, Christine; Holder-Espinasse, Muriel; Jouk, Pierre-Simon; Julia, Sophie; Melki, Judith; Mur, Sébastien; Naudion, Sophie; Fabre-Teste, Jennifer; Busa, Tiffany; Stamm, Stephen; Lyonnet, Stanislas; Attie-Bitach, Tania; Kitzis, Alain; Gilbert-Dussardier, Brigitte; Bilan, Frédéric

    2018-02-01

    CHARGE syndrome is a rare genetic disorder mainly due to de novo and private truncating mutations of CHD7 gene. Here we report an intriguing hot spot of intronic mutations (c.5405-7G > A, c.5405-13G > A, c.5405-17G > A and c.5405-18C > A) located in CHD7 IVS25. Combining computational in silico analysis, experimental branch-point determination and in vitro minigene assays, our study explains this mutation hot spot by a particular genomic context, including the weakness of the IVS25 natural acceptor-site and an unconventional lariat sequence localized outside the common 40 bp upstream the acceptor splice site. For each of the mutations reported here, bioinformatic tools indicated a newly created 3' splice site, of which the existence was confirmed using pSpliceExpress, an easy-to-use and reliable splicing reporter tool. Our study emphasizes the idea that combining these two complementary approaches could increase the efficiency of routine molecular diagnosis.

  11. Sequence variant on 8q24 confers susceptibility to urinary bladder cancer

    PubMed Central

    Kiemeney, Lambertus A.; Thorlacius, Steinunn; Sulem, Patrick; Geller, Frank; Aben, Katja K.H.; Stacey, Simon N.; Gudmundsson, Julius; Jakobsdottir, Margret; Bergthorsson, Jon T.; Sigurdsson, Asgeir; Blondal, Thorarinn; Witjes, J. Alfred; Vermeulen, Sita H.; Hulsbergen-van de Kaa, Christina A.; Swinkels, Dorine W.; Ploeg, Martine; Cornel, Erik B.; Vergunst, Henk; Thorgeirsson, Thorgeir E.; Gudbjartsson, Daniel; Gudjonsson, Sigurjon A.; Thorleifsson, Gudmar; Kristinsson, Kari T.; Mouy, Magali; Snorradottir, Steinunn; Placidi, Donatella; Campagna, Marcello; Arici, Cecilia; Koppova, Kvetoslava; Gurzau, Eugene; Rudnai, Peter; Kellen, Eliane; Polidoro, Silvia; Guarrera, Simonetta; Sacerdote, Carlotta; Sanchez, Manuel; Saez, Berta; Valdivia, Gabriel; Ryk, Charlotta; de Verdier, Petra; Lindblom, Annika; Golka, Klaus; Bishop, D. Timothy; Knowles, Margaret A.; Nikulasson, Sigfus; Petursdottir, Vigdis; Jonsson, Eirikur; Geirsson, Gudmundur; Kristjansson, Baldvin; Mayordomo, Jose I.; Steineck, Gunnar; Porru, Stefano; Buntinx, Frank; Zeegers, Maurice P.; Fletcher, Tony; Kumar, Rajiv; Matullo, Giuseppe; Vineis, Paolo; Kiltie, Anne E.; Gulcher, Jeffrey R.; Thorsteinsdottir, Unnur; Kong, Augustine; Rafnar, Thorunn; Stefansson, Kari

    2015-01-01

    We conducted a genome wide SNP association study on 1,803 Urinary Bladder Cancer (UBC) cases and 34,336 controls from Iceland and the Netherlands and follow up studies in seven additional case control groups (2,165 cases and 3,800 controls). The strongest association was observed with allele T of rs9642880 on chromosome 8q24, 30kb upstream of the c-Myc gene (allele specific OR=1.22; P=9.34×10−12). Approximately 20% of individuals of European ancestry are homozygous for rs9642880 (T) and their estimated risk of developing UBC is 1.49 times that of non-carriers with population attributable risk (PAR) of 17%. No association was observed between UBC and the four 8q24 variants previously associated with prostate, colorectal and breast cancers, nor did rs9642880 associate with any of these three cancers. A weaker signal, but nonetheless of genome wide significance, was captured by rs710521 (A) located near the TP63 gene on chromosome 3q28 (allele specific OR=1.19; P=1. 15× 10−7). PMID:18794855

  12. Cellular identification of water gustatory receptor neurons and their central projection pattern in Drosophila

    PubMed Central

    Inoshita, Tsuyoshi; Tanimura, Teiichi

    2006-01-01

    Water perception is important for insects, because they are particularly vulnerable to water loss because their body size is small. In Drosophila, gustatory receptor neurons are located at the base of the taste sensilla on the labellum, tarsi, and wing margins. One of the gustatory receptor neurons in typical sensilla is known to respond to water. To reveal the neural mechanisms of water perception in Drosophila, it is necessary to identify water receptor neurons and their projection patterns. We used a Gal4 enhancer trap strain in which GAL4 is expressed in a single gustatory receptor neuron in each sensillum on the labellum. We investigated the function of these neurons by expressing the upstream activating sequence transgenes, shibirets1, tetanus toxin light chain, or diphtheria toxin A chain. Results from the proboscis extension reflex test and electrophysiological recordings indicated that the GAL4-expressing neurons respond to water. We show here that the water receptor neurons project to a specific region in the subesophageal ganglion, thus revealing the water taste sensory map in Drosophila. PMID:16415164

  13. TIAM1 variants improve clinical outcome in neuroblastoma.

    PubMed

    Sanmartín, Elena; Yáñez, Yania; Fornés-Ferrer, Victoria; Zugaza, José L; Cañete, Adela; Castel, Victoria; Font de Mora, Jaime

    2017-07-11

    Identification of tumor driver mutations is crucial for improving clinical outcome using a personalized approach to the treatment of cancer. Neuroblastoma is a tumor of the peripheral sympathetic nervous system for which only a few driver alterations have been described including MYCN amplification and ALK mutations. We assessed 106 primary neuroblastoma tumors by next generation sequencing using a customized amplicon-based gene panel. Our results reveal that genetic variants in TIAM1 gene associate with better clinical outcome, suggesting a role for these TIAM1 variants in preventing progression of this disease. The detected variants are located within the different domains of TIAM1 that signal to the upstream regulator RAS and downstream effector molecules MYC and RAC, which are all implicated in neuroblastoma etiology and progression. Clinical outcome was improved in tumors where a TIAM1 variant was present concomitantly with either ALK mutation or MYCN amplification. Given the function of these signaling molecules in cell survival, proliferation, differentiation and neurite outgrowth, our data suggest that the TIAM1-mediated network is essential to neuroblastoma and thus, inhibiting TIAM1 reflects a rational strategy for improving therapy efficacy in neuroblastoma.

  14. The function of the Mediator complex in plant immunity.

    PubMed

    An, Chuanfu; Mou, Zhonglin

    2013-03-01

    Upon pathogen infection, plants undergo dramatic transcriptome reprogramming to shift from normal growth and development to immune response. During this rapid process, the multiprotein Mediator complex has been recognized as an important player to fine-tune gene-specific and pathway-specific transcriptional reprogramming by acting as an adaptor/coregulator between sequence-specific transcription factor and RNA polymerase II (RNAPII). Here, we review current understanding of the role of five functionally characterized Mediator subunits (MED8, MED15, MED16, MED21 and MED25) in plant immunity. All these Mediator subunits positively regulate resistance against leaf-infecting biotrophic bacteria or necrotrophic fungi. While MED21 appears to regulate defense against fungal pathogens via relaying signals from upstream regulators and chromatin modification to RNAPII, the other four Mediator subunits locate at different positions of the defense network to convey phytohormone signal(s). Fully understanding the role of Mediator in plant immunity needs to characterize more Mediator subunits in both Arabidopsis and other plant species. Identification of interacting proteins of Mediator subunits will further help to reveal their specific regulatory mechanisms in plant immunity.

  15. Consistency of gene starts among Burkholderia genomes

    PubMed Central

    2011-01-01

    Background Evolutionary divergence in the position of the translational start site among orthologous genes can have significant functional impacts. Divergence can alter the translation rate, degradation rate, subcellular location, and function of the encoded proteins. Results Existing Genbank gene maps for Burkholderia genomes suggest that extensive divergence has occurred--53% of ortholog sets based on Genbank gene maps had inconsistent gene start sites. However, most of these inconsistencies appear to be gene-calling errors. Evolutionary divergence was the most plausible explanation for only 17% of the ortholog sets. Correcting probable errors in the Genbank gene maps decreased the percentage of ortholog sets with inconsistent starts by 68%, increased the percentage of ortholog sets with extractable upstream intergenic regions by 32%, increased the sequence similarity of intergenic regions and predicted proteins, and increased the number of proteins with identifiable signal peptides. Conclusions Our findings highlight an emerging problem in comparative genomics: single-digit percent errors in gene predictions can lead to double-digit percentages of inconsistent ortholog sets. The work demonstrates a simple approach to evaluate and improve the quality of gene maps. PMID:21342528

  16. The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

    PubMed

    Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

    2007-01-01

    Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

  17. Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sternberg, E.A.; Spizz, G.; Perry, W.M.

    1988-07-01

    Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

  18. The genetic basis of adaptive pigmentation variation in Drosophila melanogaster.

    PubMed

    Pool, John E; Aquadro, Charles F

    2007-07-01

    In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kb upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony.

  19. A second gene for type I signal peptidase in Bradyrhizobium japonicum, sipF, is located near genes involved in RNA processing and cell division.

    PubMed

    Bairl, A; Müller, P

    1998-11-01

    The TnphoA-induced Bradyrhizobium japonicum mutant 184 shows slow growth and aberrant colonization of soybean nodules. Using a DNA fragment adjacent to the transposon insertion site as a probe, a 3.4-kb BglII fragment of B. japonicum 110spc4 DNA was identified and cloned. Sequence analysis indicated that two truncated ORFs and three complete ORFs were encoded on this fragment. A database search revealed homologies to several other prokaryotic proteins: PdxJ (an enzyme involved in vitamin B6 biosynthesis), AcpS (acyl carrier protein synthase), Lep or Sip (prokaryotic type I signal peptidase), RNase III (an endoribonuclease which processes double-stranded rRNA precursors and mRNA) and Era (a GTP-binding protein required for cell division). The mutation in strain 184 was found to lie within the signal peptidase gene, which was designated sipF. Therefore, sipF is located in a region that encodes gene products involved in posttranscriptional and posttranslational processing processes. By complementation of the lep(ts) E. coli mutant strain IT41 it was demonstrated that sipF indeed encodes a functional signal peptidase, and genetic complementation of B. japonicum mutant 184 by a 2.8-kb SalI fragment indicated that sipF is expressed from a promoter located directly upstream of sipF. Using a non-polar kanamycin resistance cassette, a specific sipF mutant was constructed which exhibited defects in symbiosis similar to those of the original mutant 184.

  20. Use of Heme Compounds as Iron Sources by Pathogenic Neisseriae Requires the Product of the hemO Gene

    PubMed Central

    Zhu, Wenming; Hunt, Desiree J.; Richardson, Anthony R.; Stojiljkovic, Igor

    2000-01-01

    Heme compounds are an important source of iron for neisseriae. We have identified a neisserial gene, hemO, that is essential for heme, hemoglobin (Hb), and haptoglobin-Hb utilization. The hemO gene is located 178 bp upstream of the hmbR Hb receptor gene in Neisseria meningitidis isolates. The product of the hemO gene is homologous to enzymes that degrade heme; 21% of its amino acid residues are identical, and 44% are similar, to those of the human heme oxygenase-1. DNA sequences homologous to hemO were ubiquitous in commensal and pathogenic neisseriae. HemO genetic knockout strains of Neisseria gonorrhoeae and N. meningitidis were unable to use any heme source, while the assimilation of transferrin-iron and iron-citrate complexes was unaffected. A phenotypic characterization of a conditional hemO mutant, constructed by inserting an isopropyl-β-d-thiogalactopyranoside (IPTG)-regulated promoter upstream of the ribosomal binding site of hemO, confirmed the indispensability of the HemO protein in heme utilization. The expression of HemO also protected N. meningitidis cells against heme toxicity. hemO mutants were still able to transport heme into the cell, since both heme and Hb could complement an N. meningitidis hemA hemO double mutant for growth. The expression of the HmbR receptor was reduced significantly by the inactivation of the hemO gene, suggesting that hemO and hmbR are transcriptionally linked. The expression of the unlinked Hb receptor, HpuAB, was not altered. Comparison of the polypeptide patterns of the wild type and the hemO mutant led to detection of six protein spots with an altered expression pattern, suggesting a more general role of HemO in the regulation of gene expression in Neisseriae. PMID:10629191

  1. 76 FR 56724 - Proposed Flood Elevation Determinations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-14

    .../town/county Source of flooding Location ** ground [caret] Elevation in meters (MSL) Existing Modified... Datum. Depth in feet above ground. [caret] Mean Sea Level, rounded to the nearest 0.1 meter. ** BFEs to... upstream of Cradduck Road None +876 Oklahoma Unincorporated Areas of Town Branch Approximately 400 feet...

  2. 75 FR 31361 - Proposed Flood Elevation Determinations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-03

    ... source(s) elevation ground [caret] Elevation Communities affected in meters (MSL) Effective Modified... meter. ** BFEs to be changed include the listed downstream and upstream BFEs, and include BFEs located... Sea Level, rounded to the nearest 0.1 meter. ** BFEs to be changed include the listed downstream and...

  3. 4. Rockwork on north bank of the S. Platte River. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. Rockwork on north bank of the S. Platte River. Located approximately 2.4 miles upstream from KeysTone Bridge and about 30 feet above river. View looking northwest from 70 fee. - Denver & Rio Grande Rockwork, East of South Platte, Waterton, Jefferson County, CO

  4. 77 FR 66737 - Final Flood Elevation Determinations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-07

    ... +45 upstream of Cedar Swamp Road. Clapps Swamp Approximately 0.4 mile +51 Unincorporated Areas of.... 4104, and 44 CFR part 67. FEMA has developed criteria for floodplain management in floodprone areas in... Location Depth in feet above ground [caret] Elevation in meters (MSL)Modified Unincorporated Areas of...

  5. Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene.

    PubMed

    Dale, Rodney M; Topczewski, Jacek

    2011-09-15

    Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5' of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene

    PubMed Central

    Dale, Rodney M.; Topczewski, Jacek

    2011-01-01

    Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5’ of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. PMID:21723274

  7. Prevalence and characterization of plasmid-mediated blaESBL with their genetic environment in Escherichia coli and Klebsiella pneumoniae in patients with pneumonia.

    PubMed

    Wang, Xiao-rong; Chen, Ji-chao; Kang, Yu; Jiang, Ning; An, Shu-chang; Gao, Zhan-cheng

    2012-03-01

    The extended spectrum β-lactamase (ESBL)-producing Escherichia coli (E. coli) and Klebsiella pneumoniae (K. pneumoniae) are the major pathogens causing pneumonia and have a significant impact on the clinical course. Limited data exist on molecular characterization of ESBL-producing E. coli and K. pneumoniae that cause pneumonia. The aim of this study was to investigate the comprehensive multilevel characteristics of E. coli and K. pneumoniae causing pneumonia in China for the first time. E. coli (17) and K. pneumoniae (21) isolates responsible for pneumonia were isolated from 1270 specimens collected in a prospective multi-center study in eight teaching hospitals in China from June to December in 2007. The susceptibilities, ESBL confirmation, sequence typing, blaCTX-M and blaSHV genes, their genetic environment and plasmid Inc/rep types were determined. Sixteen E. coli (94.1%) and eleven K. pneumoniae (52.4%) isolates were ESBL producers. About 77.8% and 66.7% of them were resistance to ciprofloxacin and levofloxacin, and 100% were susceptible to imipenem. The most prevalent ESBL gene was CTX-M-14, followed by SHV-2, CTX-M-15, CTX-M-3, CTX-M-65, SHV-12, SHV-26 and SHV-28. SHV-1 and SHV-11 were also detected and coexisted with blaCTX-Ms in five strains, and three strains contained only SHV-1. All CTX-M-14 were detected ISEcp1 upstream and nine were found IS903 downstream and the majority of them (64.3%) were carried by IncF plasmids. All blaSHV were flanked by recF and deoR, located on IncF, IncN, IncX and IncH plasmids. Two SHV-2, one SHV-1 and the only SHV-28 were further preceded by IS26. Genes lacY and lacZ were detected at further upstream of two blaSHV-1. The K. pneumoniae carrying SHV-28 was susceptible to β-lactams, and no mutations or deletions in gene or promoter sequences were identified to account for susceptibility. Multilocus sequence typing experiments showed the ESBL-producing strains were genetically diverse. The rate of occurrence of blaESBL in E. coli and K. pneumoniae causing pneumonia was high, and blaCTX-M-14 was dominant and probably mobilized by ISEcp1 mainly on IncF plasmids. Importantly, unexpressed blaESBL genes may occur in susceptible isolates and hence may have clinical implications.

  8. Functional elements in the minimal promoter of the human proton-coupled folate transporter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stark, Michal; Gonen, Nitzan; Assaraf, Yehuda G., E-mail: assaraf@tx.technion.ac.il

    2009-10-09

    The proton-coupled folate transporter (PCFT) is the dominant intestinal folate transporter, however, its promoter has yet to be revealed. Hence, we here cloned a 3.1 kb fragment upstream to the first ATG of the human PCFT gene and generated sequential deletion constructs evaluated in luciferase reporter assay. This analysis mapped the minimal promoter to 157 bp upstream to the first ATG. Crucial GC-box sites were identified within the minimal promoter and in its close vicinity which substantially contribute to promoter activity, as their disruption resulted in 94% loss of luciferase activity. We also identified upstream enhancer elements including YY1 andmore » AP1 which, although distantly located, prominently transactivated the minimal promoter, as their inactivation resulted in 50% decrease in reporter activity. This is the first functional identification of the minimal PCFT promoter harboring crucial GC-box elements that markedly contribute to its transcriptional activation via putative interaction with distal YY1 and AP1 enhancer elements.« less

  9. Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

    Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

  10. Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Machlin, S.M.; Hanson, R.S.

    The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

  11. Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.

    1987-01-01

    The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less

  12. RRE: a tool for the extraction of non-coding regions surrounding annotated genes from genomic datasets.

    PubMed

    Lazzarato, F; Franceschinis, G; Botta, M; Cordero, F; Calogero, R A

    2004-11-01

    RRE allows the extraction of non-coding regions surrounding a coding sequence [i.e. gene upstream region, 5'-untranslated region (5'-UTR), introns, 3'-UTR, downstream region] from annotated genomic datasets available at NCBI. RRE parser and web-based interface are accessible at http://www.bioinformatica.unito.it/bioinformatics/rre/rre.html

  13. Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

    USDA-ARS?s Scientific Manuscript database

    The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

  14. Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

    PubMed

    Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

    2006-12-01

    An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

  15. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    PubMed

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  16. Comparative RNA-Sequence Transcriptome Analysis of Phenolic Acid Metabolism in Salvia miltiorrhiza, a Traditional Chinese Medicine Model Plant

    PubMed Central

    Song, Zhenqiao; Guo, Linlin; Liu, Tian; Lin, Caicai; Wang, Jianhua

    2017-01-01

    Salvia miltiorrhiza Bunge is an important traditional Chinese medicine (TCM). In this study, two S. miltiorrhiza genotypes (BH18 and ZH23) with different phenolic acid concentrations were used for de novo RNA sequencing (RNA-seq). A total of 170,787 transcripts and 56,216 unigenes were obtained. There were 670 differentially expressed genes (DEGs) identified between BH18 and ZH23, 250 of which were upregulated in ZH23, with genes involved in the phenylpropanoid biosynthesis pathway being the most upregulated genes. Nine genes involved in the lignin biosynthesis pathway were upregulated in BH18 and thus result in higher lignin content in BH18. However, expression profiles of most genes involved in the core common upstream phenylpropanoid biosynthesis pathway were higher in ZH23 than that in BH18. These results indicated that genes involved in the core common upstream phenylpropanoid biosynthesis pathway might play an important role in downstream secondary metabolism and demonstrated that lignin biosynthesis was a putative partially competing pathway with phenolic acid biosynthesis. The results of this study expanded our understanding of the regulation of phenolic acid biosynthesis in S. miltiorrhiza. PMID:28194403

  17. Genomic analysis of a new mammalian distal-less gene: Dlx7.

    PubMed

    Nakamura, S; Stock, D W; Wydner, K L; Bollekens, J A; Takeshita, K; Nagai, B M; Chiba, S; Kitamura, T; Freeland, T M; Zhao, Z; Minowada, J; Lawrence, J B; Weiss, K M; Ruddle, F H

    1996-12-15

    We have cloned a new Dlx gene (Dlx7) from human and mouse that may represent the mammalian orthologue of the newt gene NvHBox-5. The homeodomains of these genes are highly similar to all other vertebrate Dlx genes, and regions of similarity also exist between mammalian Dlx7 and a subset of vertebrate Dlx genes downstream of the homeodomain. The sequence divergence between human and mouse Dlx7 in these regions is greater than that predicted from comparisons of other vertebrate Dlx genes, however, and there is little sequence similarity upstream of the homeodomain both between these two genes and with other Dlx genes. We present evidence for alternative splicing of mouse Dlx7 upstream of the homeodomain that may account for some of this divergence. We have mapped human DLX7 distal to the 5' end of the HOXB cluster at an estimated distance of between 1 and 2 Mb by FISH. Both the human and the mouse Dlx7 are shown to be closely linked to Dlx3 in a convergently transcribed orientation. These mapping results support the possibility that vertebrate distal-less genes have been duplicated in concert with the Hox clusters.

  18. Deterministic chaos in a model of a simple delta network

    NASA Astrophysics Data System (ADS)

    Salter, G.; Voller, V. R.; Paola, C.

    2017-12-01

    An important aspect of delta dynamics is how sediment flux is partitioned to different parts of the delta through time, affecting patterns of land-building/loss, and the formation of stratigraphy. Here, we present results from a model of a simple distributary network consisting of two orders of bifurcations: an upstream channel splits into two branches, each of which splits into two additional branches. The 1D bed elevation profiles of each branch are modeled through time, and a nodal condition accounting for a transverse bed slope just upstream of the bifurcation is used to partition the flow at bifurcations. The model generates surprisingly complex dynamics despite its simplicity. Constrained by the need to distribute sediment evenly between branches in the long-run, the system undergoes repeated full and partial avulsions. We find that the solution to the system is aperiodic, but bounded. We also observe a sensitive dependence on the initial conditions: simulations started with slightly different initial conditions diverge exponentially. These observations are the hallmark of chaos, summarized by Edward Lorenz as "where the present determines the future, but the approximate present does not approximately determine the future." In our model, chaos results from the two-way coupling between upstream and downstream bifurcations. We find that a single bifurcation may be periodic, but it is never chaotic. However, when coupled, avulsions in the upstream channel change the upstream boundary conditions for the downstream bifurcations, and conversely, avulsions in the downstream bifurcations affect the slope of their feeder channel, propagating upstream to the first bifurcation. We explore how the system generates stratigraphy, using the Shields stress at the time of deposition as a proxy. We compare the stratigraphy to the single bifurcation case, which is periodic rather than chaotic. We also examine stratigraphic completeness, and find that hiatuses in the upstream portion of the domain tend to be erosional, whereas hiatuses further downstream tend to represent pauses. Our work suggests that deltas have a limited window of predictability, and indicates that chaotic and cyclic avulsion sequences should be distinguishable in the stratigraphic record.

  19. Total Nitrogen Sources of the Three Gorges Reservoir — A Spatio-Temporal Approach

    PubMed Central

    Ren, Chunping; Wang, Lijing; Zheng, Binghui; Holbach, Andreas

    2015-01-01

    Understanding the spatial and temporal variation of nutrient concentrations, loads, and their distribution from upstream tributaries is important for the management of large lakes and reservoirs. The Three Gorges Dam was built on the Yangtze River in China, the world’s third longest river, and impounded the famous Three Gorges Reservoir (TGR). In this study, we analyzed total nitrogen (TN) concentrations and inflow data from 2003 till 2010 for the main upstream tributaries of the TGR that contribute about 82% of the TGR’s total inflow. We used time series analysis for seasonal decomposition of TN concentrations and used non-parametric statistical tests (Kruskal-Walli H, Mann-Whitney U) as well as base flow segmentation to analyze significant spatial and temporal patterns of TN pollution input into the TGR. Our results show that TN concentrations had significant spatial heterogeneity across the study area (Tuo River> Yangtze River> Wu River> Min River> Jialing River>Jinsha River). Furthermore, we derived apparent seasonal changes in three out of five upstream tributaries of the TGR rivers (Kruskal-Walli H ρ = 0.009, 0.030 and 0.029 for Tuo River, Jinsha River and Min River in sequence). TN pollution from non-point sources in the upstream tributaries accounted for 68.9% of the total TN input into the TGR. Non-point source pollution of TN revealed increasing trends for 4 out of five upstream tributaries of the TGR. Land use/cover and soil type were identified as the dominant driving factors for the spatial distribution of TN. Intensifying agriculture and increasing urbanization in the upstream catchments of the TGR were the main driving factors for non-point source pollution of TN increase from 2003 till 2010. Land use and land cover management as well as chemical fertilizer use restriction were needed to overcome the threats of increasing TN pollution. PMID:26510158

  20. 8” x 10” black and white photographic print made from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. New 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. NOVEMBER 5, 1934 PHOTOGRAPH NO. 44 OF CONTRACT NO. 4 SHOWING BRIDGE SUPERSTRUCTURE ERECTING HIGHWAY FORMS UPSTREAM ROADWAY BETWEEN PIERS V TO D. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

Top