VWF mutations and new sequence variations identified in healthy controls are more frequent in the African-American population.

PubMed

Bellissimo, Daniel B; Christopherson, Pamela A; Flood, Veronica H; Gill, Joan Cox; Friedman, Kenneth D; Haberichter, Sandra L; Shapiro, Amy D; Abshire, Thomas C; Leissinger, Cindy; Hoots, W Keith; Lusher, Jeanne M; Ragni, Margaret V; Montgomery, Robert R

2012-03-01

Diagnosis and classification of VWD is aided by molecular analysis of the VWF gene. Because VWF polymorphisms have not been fully characterized, we performed VWF laboratory testing and gene sequencing of 184 healthy controls with a negative bleeding history. The controls included 66 (35.9%) African Americans (AAs). We identified 21 new sequence variations, 13 (62%) of which occurred exclusively in AAs and 2 (G967D, T2666M) that were found in 10%-15% of the AA samples, suggesting they are polymorphisms. We identified 14 sequence variations reported previously as VWF mutations, the majority of which were type 1 mutations. These controls had VWF Ag levels within the normal range, suggesting that these sequence variations might not always reduce plasma VWF levels. Eleven mutations were found in AAs, and the frequency of M740I, H817Q, and R2185Q was 15%-18%. Ten AA controls had the 2N mutation H817Q; 1 was homozygous. The average factor VIII level in this group was 99 IU/dL, suggesting that this variation may confer little or no clinical symptoms. This study emphasizes the importance of sequencing healthy controls to understand ethnic-specific sequence variations so that asymptomatic sequence variations are not misidentified as mutations in other ethnic or racial groups.

Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

PubMed

Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

2018-01-10

Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Dissecting genetic and environmental mutation signatures with model organisms.

PubMed

Segovia, Romulo; Tam, Annie S; Stirling, Peter C

2015-08-01

Deep sequencing has impacted on cancer research by enabling routine sequencing of genomes and exomes to identify genetic changes associated with carcinogenesis. Researchers can now use the frequency, type, and context of all mutations in tumor genomes to extract mutation signatures that reflect the driving mutational processes. Identifying mutation signatures, however, may not immediately suggest a mechanism. Consequently, several recent studies have employed deep sequencing of model organisms exposed to discrete genetic or environmental perturbations. These studies exploit the simpler genomes and availability of powerful genetic tools in model organisms to analyze mutation signatures under controlled conditions, forging mechanistic links between mutational processes and signatures. We discuss the power of this approach and suggest that many such studies may be on the horizon. Copyright © 2015 Elsevier Ltd. All rights reserved.

Whole Genome Sequencing of High-Risk Families to Identify New Mutational Mechanisms of Breast Cancer Predisposition

DTIC Science & Technology

2014-10-01

INTRODUCTION: Despite tremendous advances in mutation detection with gene panels and exome sequencing the majority of high risk breast...2a. Align reads to the reference sequence (months 4-10) 2b. Identify SNPs, indels, CNVs and rearrangements by bioinformatic tools (months 4-10) 2c

High-Throughput Identification of Loss-of-Function Mutations for Anti-Interferon Activity in the Influenza A Virus NS Segment

PubMed Central

Wu, Nicholas C.; Young, Arthur P.; Al-Mawsawi, Laith Q.; Olson, C. Anders; Feng, Jun; Qi, Hangfei; Luan, Harding H.; Li, Xinmin; Wu, Ting-Ting

2014-01-01

ABSTRACT Viral proteins often display several functions which require multiple assays to dissect their genetic basis. Here, we describe a systematic approach to screen for loss-of-function mutations that confer a fitness disadvantage under a specified growth condition. Our methodology was achieved by genetically monitoring a mutant library under two growth conditions, with and without interferon, by deep sequencing. We employed a molecular tagging technique to distinguish true mutations from sequencing error. This approach enabled us to identify mutations that were negatively selected against, in addition to those that were positively selected for. Using this technique, we identified loss-of-function mutations in the influenza A virus NS segment that were sensitive to type I interferon in a high-throughput fashion. Mechanistic characterization further showed that a single substitution, D92Y, resulted in the inability of NS to inhibit RIG-I ubiquitination. The approach described in this study can be applied under any specified condition for any virus that can be genetically manipulated. IMPORTANCE Traditional genetics focuses on a single genotype-phenotype relationship, whereas high-throughput genetics permits phenotypic characterization of numerous mutants in parallel. High-throughput genetics often involves monitoring of a mutant library with deep sequencing. However, deep sequencing suffers from a high error rate (∼0.1 to 1%), which is usually higher than the occurrence frequency for individual point mutations within a mutant library. Therefore, only mutations that confer a fitness advantage can be identified with confidence due to an enrichment in the occurrence frequency. In contrast, it is impossible to identify deleterious mutations using most next-generation sequencing techniques. In this study, we have applied a molecular tagging technique to distinguish true mutations from sequencing errors. It enabled us to identify mutations that underwent negative selection, in addition to mutations that experienced positive selection. This study provides a proof of concept by screening for loss-of-function mutations on the influenza A virus NS segment that are involved in its anti-interferon activity. PMID:24965464

A KCNH2 branch point mutation causing aberrant splicing contributes to an explanation of genotype-negative long QT syndrome.

PubMed

Crotti, Lia; Lewandowska, Marzena A; Schwartz, Peter J; Insolia, Roberto; Pedrazzini, Matteo; Bussani, Erica; Dagradi, Federica; George, Alfred L; Pagani, Franco

2009-02-01

Genetic screening of long QT syndrome (LQTS) fails to identify disease-causing mutations in about 30% of patients. So far, molecular screening has focused mainly on coding sequence mutations or on substitutions at canonical splice sites. The purpose of this study was to explore the possibility that intronic variants not at canonical splice sites might affect splicing regulatory elements, lead to aberrant transcripts, and cause LQTS. Molecular screening was performed through DHPLC and sequence analysis. The role of the intronic mutation identified was assessed with a hybrid minigene splicing assay. A three-generation LQTS family was investigated. Molecular screening failed to identify an obvious disease-causing mutation in the coding sequences of the major LQTS genes but revealed an intronic A-to-G substitution in KCNH2 (IVS9-28A/G) cosegregating with the clinical phenotype in family members. In vitro analysis proved that the mutation disrupts the acceptor splice site definition by affecting the branch point (BP) sequence and promoting intron retention. We further demonstrated a tight functional relationship between the BP and the polypyrimidine tract, whose weakness is responsible for the pathological effect of the IVS9-28A/G mutation. We identified a novel BP mutation in KCNH2 that disrupts the intron 9 acceptor splice site definition and causes LQT2. The present finding demonstrates that intronic mutations affecting pre-mRNA processing may contribute to the failure of traditional molecular screening in identifying disease-causing mutations in LQTS subjects and offers a rationale strategy for the reduction of genotype-negative cases.

Rare Compound Heterozygous Frameshift Mutations in ALMS1 Gene Identified Through Exome Sequencing in a Taiwanese Patient With Alström Syndrome.

PubMed

Tsai, Meng-Che; Yu, Hui-Wen; Liu, Tsunglin; Chou, Yen-Yin; Chiou, Yuan-Yow; Chen, Peng-Chieh

2018-01-01

Alström syndrome (AS) is a rare autosomal recessive disorder that shares clinical features with other ciliopathy-related diseases. Genetic mutation analysis is often required in making differential diagnosis but usually costly in time and effort using conventional Sanger sequencing. Herein we describe a Taiwanese patient presenting cone-rod dystrophy and early-onset obesity that progressed to diabetes mellitus with marked insulin resistance during adolescence. Whole exome sequencing of the patient's genomic DNA identified a novel frameshift mutation in exons 15 (c.10290_10291delTA, p.Lys3431Serfs * 10) and a rare mutation in 16 (c.10823_10824delAG, p.Arg3609Alafs * 6) of ALMS1 gene. The compound heterozygous mutations were predicted to render truncated proteins. This report highlighted the clinical utility of exome sequencing and extended the knowledge of mutation spectrum in AS patients.

De Novo Paternal FBN1 Mutation Detected in Embryos Before Implantation.

PubMed

Wang, Shuling; Niu, Ziru; Wang, Hui; Ma, Minyue; Zhang, Wei; Fang Wang, Shu; Wang, Jun; Yan, Hong; Liu, Yifan; Duan, Na; Zhang, Xiandong; Yao, Yuanqing

2017-06-26

BACKGROUND Marfan syndrome (MFS) is an autosomal dominant disease caused by mutations in the Fibrillin (FBN)1 gene and characterized by disorders in the cardiovascular, skeletal, and visual systems. The diversity of mutations and phenotypic heterogeneity of MFS make prenatal molecular diagnoses difficult. In this study, we used pre-implantation genetic diagnosis (PGD) to identify the pathogenic mutation in a male patient with MFS and to determine whether his offspring would be free of the disease. MATERIAL AND METHODS The history and pedigree of the proband were analyzed. Mutation analysis was performed on the couple and immediate family members. The couple chose IVF treatment and 4 blastocysts were biopsied. PGD was carried out by targeted high-throughput sequencing of the FBN1 gene in the embryos, along with single-nucleotide polymorphism haplotyping. Sanger sequencing was used to confirm the causative mutation. RESULTS c.2647T>C (p.Trp883Arg) was identified as the de novo likely pathogenic mutation in the proband. Whole-genome amplification and sequencing of the 3 embryos revealed that they did not carry the mutation, and 1 blastocyst was transferred back to the uterus. The amniocentesis test result analyzed by Sanger sequencing confirmed the PGD. A premature but healthy infant free of heart malformations was born. CONCLUSIONS The de novo mutation c.2647T>C (p.Trp883Arg) in FBN1 was identified in a Chinese patient with MFS. Embryos without the mutation were identified by PGD and resulted in a successful pregnancy.

Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients

PubMed Central

2014-01-01

Background Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. Methods We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Results Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients’ clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Conclusions Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology. PMID:24885126

Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients.

PubMed

Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan

2014-05-15

Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.

Brief Report: Cryopyrin-Associated Periodic Syndrome Caused by a Myeloid-Restricted Somatic NLRP3 Mutation.

PubMed

Zhou, Qing; Aksentijevich, Ivona; Wood, Geryl M; Walts, Avram D; Hoffmann, Patrycja; Remmers, Elaine F; Kastner, Daniel L; Ombrello, Amanda K

2015-09-01

To identify the cause of disease in an adult patient presenting with recent-onset fevers, chills, urticaria, fatigue, and profound myalgia, who was found to be negative for cryopyrin-associated periodic syndrome (CAPS) NLRP3 mutations by conventional Sanger DNA sequencing. We performed whole-exome sequencing and targeted deep sequencing using DNA from the patient's whole blood to identify a possible NLRP3 somatic mutation. We then screened for this mutation in subcloned NLRP3 amplicons from fibroblasts, buccal cells, granulocytes, negatively selected monocytes, and T and B lymphocytes and further confirmed the somatic mutation by targeted sequencing of exon 3. We identified a previously reported CAPS-associated mutation, p.Tyr570Cys, with a mutant allele frequency of 15% based on exome data. Targeted sequencing and subcloning of NLRP3 amplicons confirmed the presence of the somatic mutation in whole blood at a ratio similar to the exome data. The mutant allele frequency was in the range of 13.3-16.8% in monocytes and 15.2-18% in granulocytes. Notably, this mutation was either absent or present at a very low frequency in B and T lymphocytes, in buccal cells, and in the patient's cultured fibroblasts. Our findings indicate the possibility of myeloid-restricted somatic mosaicism in the pathogenesis of CAPS, underscoring the emerging role of massively parallel sequencing in clinical diagnosis. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

X-exome sequencing in Finnish families with Intellectual Disability - four novel mutations and two novel syndromic phenotypes

PubMed Central

2014-01-01

Background X-linked intellectual disability (XLID) is a group of genetically heterogeneous disorders characterized by substantial impairment in cognitive abilities, social and behavioral adaptive skills. Next generation sequencing technologies have become a powerful approach for identifying molecular gene mutations relevant for diagnosis. Methods & objectives Enrichment of X-chromosome specific exons and massively parallel sequencing was performed for identifying the causative mutations in 14 Finnish families, each of them having several males affected with intellectual disability of unknown cause. Results We found four novel mutations in known XLID genes. Two mutations; one previously reported missense mutation (c.1111C > T), and one novel frameshift mutation (c. 990_991insGCTGC) were identified in SLC16A2, a gene that has been linked to Allan-Herndon-Dudley syndrome (AHDS). One novel missense mutation (c.1888G > C) was found in GRIA3 and two novel splice donor site mutations (c.357 + 1G > C and c.985 + 1G > C) were identified in the DLG3 gene. One missense mutation (c.1321C > T) was identified in the candidate gene ZMYM3 in three affected males with a previously unrecognized syndrome characterized by unique facial features, aortic stenosis and hypospadia was detected. All of the identified mutations segregated in the corresponding families and were absent in > 100 Finnish controls and in the publicly available databases. In addition, a previously reported benign variant (c.877G > A) in SYP was identified in a large family with nine affected males in three generations, who have a syndromic phenotype. Conclusions All of the mutations found in this study are being reported for the first time in Finnish families with several affected male patients whose etiological diagnoses have remained unknown to us, in some families, for more than 30 years. This study illustrates the impact of X-exome sequencing to identify rare gene mutations and the challenges of interpreting the results. Further functional studies are required to confirm the cause of the syndromic phenotypes associated with ZMYM3 and SYP in this study. PMID:24721225

Performance characteristics of the AmpliSeq Cancer Hotspot panel v2 in combination with the Ion Torrent Next Generation Sequencing Personal Genome Machine.

PubMed

Butler, Kimberly S; Young, Megan Y L; Li, Zhihua; Elespuru, Rosalie K; Wood, Steven C

2016-02-01

Next-Generation Sequencing is a rapidly advancing technology that has research and clinical applications. For many cancers, it is important to know the precise mutation(s) present, as specific mutations could indicate or contra-indicate certain treatments as well as be indicative of prognosis. Using the Ion Torrent Personal Genome Machine and the AmpliSeq Cancer Hotspot panel v2, we sequenced two pancreatic cancer cell lines, BxPC-3 and HPAF-II, alone or in mixtures, to determine the error rate, sensitivity, and reproducibility of this system. The system resulted in coverage averaging 2000× across the various amplicons and was able to reliably and reproducibly identify mutations present at a rate of 5%. Identification of mutations present at a lower rate was possible by altering the parameters by which calls were made, but with an increase in erroneous, low-level calls. The panel was able to identify known mutations in these cell lines that are present in the COSMIC database. In addition, other, novel mutations were also identified that may prove clinically useful. The system was assessed for systematic errors such as homopolymer effects, end of amplicon effects and patterns in NO CALL sequence. Overall, the system is adequate at identifying the known, targeted mutations in the panel. Published by Elsevier Inc.

Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

PubMed

Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

2013-08-08

Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of 23 (35%) of 'missing' mutations in Usher type 2 probands with only a single heterozygous USH2A mutation detected with Sanger sequencing could be attributed to deletions, duplications or a pathogenic deep intronic variant. Future mutation detection strategies and genetic counselling will need to take into account the prevalence of these types of mutations in order to provide a more comprehensive diagnostic service.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hraber, Peter; Korber, Bette; Wagh, Kshitij

Within-host genetic sequencing from samples collected over time provides a dynamic view of how viruses evade host immunity. Immune-driven mutations might stimulate neutralization breadth by selecting antibodies adapted to cycles of immune escape that generate within-subject epitope diversity. Comprehensive identification of immune-escape mutations is experimentally and computationally challenging. With current technology, many more viral sequences can readily be obtained than can be tested for binding and neutralization, making down-selection necessary. Typically, this is done manually, by picking variants that represent different time-points and branches on a phylogenetic tree. Such strategies are likely to miss many relevant mutations and combinations ofmore » mutations, and to be redundant for other mutations. Longitudinal Antigenic Sequences and Sites from Intrahost Evolution (LASSIE) uses transmitted founder loss to identify virus “hot-spots” under putative immune selection and chooses sequences that represent recurrent mutations in selected sites. LASSIE favors earliest sequences in which mutations arise. Here, with well-characterized longitudinal Env sequences, we confirmed selected sites were concentrated in antibody contacts and selected sequences represented diverse antigenic phenotypes. Finally, practical applications include rapidly identifying immune targets under selective pressure within a subject, selecting minimal sets of reagents for immunological assays that characterize evolving antibody responses, and for immunogens in polyvalent “cocktail” vaccines.« less

Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

PubMed

Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

2016-11-01

Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

PIK3CA-associated developmental disorders exhibit distinct classes of mutations with variable expression and tissue distribution

PubMed Central

Timms, Andrew E.; Conti, Valerio; Girisha, Katta M.; Martin, Beth; Olds, Carissa; Collins, Sarah; Park, Kaylee; Carter, Melissa; Krägeloh-Mann, Inge; Chitayat, David; Parikh, Aditi Shah; Bradshaw, Rachael; Torti, Erin; Braddock, Stephen; Burke, Leah; Ghedia, Sondhya; Stephan, Mark; Stewart, Fiona; Prasad, Chitra; Napier, Melanie; Saitta, Sulagna; Straussberg, Rachel; Gabbett, Michael; O’Connor, Bridget C.; Yin, Lim Jiin; Lai, Angeline Hwei Meeng; Martin, Nicole; McKinnon, Margaret; Addor, Marie-Claude; Schwartz, Charles E.; Lanoel, Agustina; Conway, Robert L.; Devriendt, Koenraad; Tatton-Brown, Katrina; Pierpont, Mary Ella; Painter, Michael; Worgan, Lisa; Reggin, James; Hennekam, Raoul; Pritchard, Colin C.; Aracena, Mariana; Gripp, Karen W.; Cordisco, Maria; Van Esch, Hilde; Garavelli, Livia; Curry, Cynthia; Goriely, Anne; Kayserilli, Hulya; Shendure, Jay; Graham, John; Guerrini, Renzo; Dobyns, William B.

2016-01-01

Mosaicism is increasingly recognized as a cause of developmental disorders with the advent of next-generation sequencing (NGS). Mosaic mutations of PIK3CA have been associated with the widest spectrum of phenotypes associated with overgrowth and vascular malformations. We performed targeted NGS using 2 independent deep-coverage methods that utilize molecular inversion probes and amplicon sequencing in a cohort of 241 samples from 181 individuals with brain and/or body overgrowth. We identified PIK3CA mutations in 60 individuals. Several other individuals (n = 12) were identified separately to have mutations in PIK3CA by clinical targeted-panel testing (n = 6), whole-exome sequencing (n = 5), or Sanger sequencing (n = 1). Based on the clinical and molecular features, this cohort segregated into three distinct groups: (a) severe focal overgrowth due to low-level but highly activating (hotspot) mutations, (b) predominantly brain overgrowth and less severe somatic overgrowth due to less-activating mutations, and (c) intermediate phenotypes (capillary malformations with overgrowth) with intermediately activating mutations. Sixteen of 29 PIK3CA mutations were novel. We also identified constitutional PIK3CA mutations in 10 patients. Our molecular data, combined with review of the literature, show that PIK3CA-related overgrowth disorders comprise a discontinuous spectrum of disorders that correlate with the severity and distribution of mutations. PMID:27631024

Whole Exome Sequencing Identifies de Novo Mutations in GATA6 Associated with Congenital Diaphragmatic Hernia

PubMed Central

Yu, Lan; Bennett, James T.; Wynn, Julia; Carvill, Gemma L.; Cheung, Yee Him; Shen, Yufeng; Mychaliska, George B.; Azarow, Kenneth S.; Crombleholme, Timothy M.; Chung, Dai H.; Potoka, Douglas; Warner, Brad W.; Bucher, Brian; Lim, Foong-Yen; Pietsch, John; Stolar, Charles; Aspelund, Gudrun; Arkovitz, Marc S.; Mefford, Heather; Chung, Wendy K.

2014-01-01

Background Congenital diaphragmatic hernia (CDH) is a common birth defect affecting 1 in 3,000 births. It is characterized by herniation of abdominal viscera through an incompletely formed diaphragm. Although chromosomal anomalies and mutations in several genes have been implicated, the cause for most patients is unknown. Methods We used whole exome sequencing in two families with CDH and congenital heart disease, and identified mutations in GATA6 in both. Results In the first family, we identified a de novo missense mutation (c.1366C>T, p.R456C) in a sporadic CDH patient with tetralogy of Fallot. In the second, a nonsense mutation (c.712G>T, p.G238*) was identified in two siblings with CDH and a large ventricular septal defect. The G238* mutation was inherited from their mother, who was clinically affected with congenital absence of the pericardium, patent ductus arteriosus, and intestinal malrotation. Deep sequencing of blood and saliva derived DNA from the mother suggested somatic mosaicism as an explanation for her milder phenotype, with only approximately 15% mutant alleles. To determine the frequency of GATA6 mutations in CDH, we sequenced the gene in 378 patients with CDH. We identified one additional de novo mutation (c.1071delG, p.V358Cfs34*). Conclusions Mutations in GATA6 have been previously associated with pancreatic agenesis and congenital heart disease. We conclude that, in addition to the heart and the pancreas, GATA6 is involved in development of two additional organs, the diaphragm and the pericardium. In addition we have shown that de novo mutations can contribute to the development of CDH, a common birth defect. PMID:24385578

Novel DDR2 mutation identified by whole exome sequencing in a Moroccan patient with spondylo-meta-epiphyseal dysplasia, short limb-abnormal calcification type.

PubMed

Mansouri, Maria; Kayserili, Hülya; Elalaoui, Siham Chafai; Nishimura, Gen; Iida, Aritoshi; Lyahyai, Jaber; Miyake, Noriko; Matsumoto, Naomichi; Sefiani, Abdelaziz; Ikegawa, Shiro

2016-02-01

Spondylo-meta-epiphyseal dysplasia (SMED), short limb-abnormal calcification type (SMED, SL-AC), is a very rare autosomal recessive disorder with various skeletal changes characterized by premature calcification leading to severe disproportionate short stature. Twenty-two patients have been reported until now, but only five mutations (four missense and one splice-site) in the conserved sequence encoding the tyrosine kinase domain of the DDR2 gene has been identified. We report here a novel DDR2 missense mutation, c.370C > T (p.Arg124Trp) in a Moroccan girl with SMED, SL-AC, identified by whole exome sequencing. Our study has expanded the mutational spectrum of this rare disease and it has shown that exome sequencing is a powerful and cost-effective tool for the diagnosis of clinically heterogeneous disorders such as SMED. © 2015 Wiley Periodicals, Inc.

Myophosphorylase (PYGM) mutations determined by next generation sequencing in a cohort from Turkey with McArdle disease.

PubMed

Inal-Gültekin, Güldal; Toptaş-Hekimoğlu, Bahar; Görmez, Zeliha; Gelişin, Özlem; Durmuş, Hacer; Ergüner, Bekir; Demirci, Hüseyin; Sağıroğlu, Mahmut Ş; Parman, Yeşim; Deymeer, Feza; Yılmaz-Aydoğan, Hülya; Pençe, Sadrettin; Bekircan-Kurt, Can Ebru; Tan, Ersin; Erdem-Özdamar, Sevim; Üstek, Duran; Giger, Urs; Öztürk, Oğuz; Serdaroğlu-Oflazer, Piraye

2017-11-01

This study aimed to identify PYGM mutations in patients with McArdle disease from Turkey by next generation sequencing (NGS). Genomic DNA was extracted from the blood of the McArdle patients (n = 67) and unrelated healthy volunteers (n = 53). The PYGM gene was sequenced with NGS and the observed mutations were validated by direct Sanger sequencing. A diagnostic algorithm was developed for patients with suspected McArdle disease. A total of 16 deleterious PYGM mutations were identified, of which 5 were novel, including 1 splice-site donor, 1 frame-shift, and 3 non-synonymous variants. The p.Met1Val (27-patients/11-families) was the most common PYGM mutation, followed by p.Arg576* (6/4), c.1827+7A>G (5/4), c.772+2_3delTG (5/3), p.Phe710del (4/2), p.Lys754Asnfs (2/1), and p.Arg50* (1/1). A molecular diagnostic flowchart is proposed for the McArdle patients in Turkey, covering the 6 most common PYGM mutations found in Turkey as well as the most common mutation in Europe. The diagnostic algorithm may alleviate the need for muscle biopsies in 77.6% of future patients. A prevalence of any of the mutations to a geographical region in Turkey was not identified. Furthermore, the NGS approach to sequence the entire PYGM gene was successful in detecting a common missense mutation and discovering novel mutations in this population study. Copyright © 2017 Elsevier B.V. All rights reserved.

Pseudouridines have context-dependent mutation and stop rates in high-throughput sequencing.

PubMed

Zhou, Katherine I; Clark, Wesley C; Pan, David W; Eckwahl, Matthew J; Dai, Qing; Pan, Tao

2018-05-11

The abundant RNA modification pseudouridine (Ψ) has been mapped transcriptome-wide by chemically modifying pseudouridines with carbodiimide and detecting the resulting reverse transcription stops in high-throughput sequencing. However, these methods have limited sensitivity and specificity, in part due to the use of reverse transcription stops. We sought to use mutations rather than just stops in sequencing data to identify pseudouridine sites. Here, we identify reverse transcription conditions that allow read-through of carbodiimide-modified pseudouridine (CMC-Ψ), and we show that pseudouridines in carbodiimide-treated human ribosomal RNA have context-dependent mutation and stop rates in high-throughput sequencing libraries prepared under these conditions. Furthermore, accounting for the context-dependence of mutation and stop rates can enhance the detection of pseudouridine sites. Similar approaches could contribute to the sequencing-based detection of many RNA modifications.

Target enrichment and high-throughput sequencing of 80 ribosomal protein genes to identify mutations associated with Diamond-Blackfan anaemia.

PubMed

Gerrard, Gareth; Valgañón, Mikel; Foong, Hui En; Kasperaviciute, Dalia; Iskander, Deena; Game, Laurence; Müller, Michael; Aitman, Timothy J; Roberts, Irene; de la Fuente, Josu; Foroni, Letizia; Karadimitris, Anastasios

2013-08-01

Diamond-Blackfan anaemia (DBA) is caused by inactivating mutations in ribosomal protein (RP) genes, with mutations in 13 of the 80 RP genes accounting for 50-60% of cases. The remaining 40-50% cases may harbour mutations in one of the remaining RP genes, but the very low frequencies render conventional genetic screening as challenging. We, therefore, applied custom enrichment technology combined with high-throughput sequencing to screen all 80 RP genes. Using this approach, we identified and validated inactivating mutations in 15/17 (88%) DBA patients. Target enrichment combined with high-throughput sequencing is a robust and improved methodology for the genetic diagnosis of DBA. © 2013 John Wiley & Sons Ltd.

Variants of the D{sub 5} dopamine receptor gene found in patients with schizophrenia: Identification of a nonsense mutation and multiple missense changes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sobell, J.L.; Lind, T.J.; Sommer, S.S.

To determine whether mutations in the D{sub 5} dopamine receptor (D{sub 5}DR) gene are associated with schizophrenia, the gene was examined in 78 unrelated schizophrenic individuals. After amplification by the polymerase chain reaction, products were examined by dideoxy fingerprinting (ddF), a highly sensitive screening method related to single strand conformational polymorphism analysis. All samples with unusual ddF patterns were sequenced to precisely identify the sequence change. In the 156 D{sub 5}DR alleles examined, nine sequence changes were identified. Four of the nine did not affect protein structure; of these, three were silent changes and one was a transition in themore » 3{prime} untranslated region. The remaining five sequence changes result in protein alterations: of these, one is a missense change in a non-conserved amino acid, 3 are missense changes in amino acids that are conserved in some dopamine D{sub 5} receptors and the last is a nonsense mutation. To investigate whether the nonsense mutation was associated with schizophrenia, 400 additional schizophrenic cases of western European descent and 1914 ethnically-similar controls were screened for the change. One additional schizophrenic carrier was identified and verified by direct genomic sequencing (allele frequency: .0013), but eight carriers also were found and confirmed among the non-schizophrenics (allele frequency: .0021)(p>.25). The gene was re-examined in all newly identified carriers of the nonsense mutation by direct sequencing and/or ddF in search of additional mutations. None were identified. Family studies also were conducted to investigate possible cosegregation of the mutation with other neuropsychiatric diseases, but this was not demonstrated. Thus, the mutation does not appear to be associated with an increased risk of schizophrenia nor does an initial analysis suggest cosegregation with other neuropsychiatric disorders or symptom complexes.« less

Molecular Genetics of the Usher Syndrome in Lebanon: Identification of 11 Novel Protein Truncating Mutations by Whole Exome Sequencing

PubMed Central

Reddy, Ramesh; Fahiminiya, Somayyeh; El Zir, Elie; Mansour, Ahmad; Megarbane, Andre; Majewski, Jacek; Slim, Rima

2014-01-01

Background Usher syndrome (USH) is a genetically heterogeneous condition with ten disease-causing genes. The spectrum of genes and mutations causing USH in the Lebanese and Middle Eastern populations has not been described. Consequently, diagnostic approaches designed to screen for previously reported mutations were unlikely to identify the mutations in 11 unrelated families, eight of Lebanese and three of Middle Eastern origins. In addition, six of the ten USH genes consist of more than 20 exons, each, which made mutational analysis by Sanger sequencing of PCR-amplified exons from genomic DNA tedious and costly. The study was aimed at the identification of USH causing genes and mutations in 11 unrelated families with USH type I or II. Methods Whole exome sequencing followed by expanded familial validation by Sanger sequencing. Results We identified disease-causing mutations in all the analyzed patients in four USH genes, MYO7A, USH2A, GPR98 and CDH23. Eleven of the mutations were novel and protein truncating, including a complex rearrangement in GPR98. Conclusion Our data highlight the genetic diversity of Usher syndrome in the Lebanese population and the time and cost-effectiveness of whole exome sequencing approach for mutation analysis of genetically heterogeneous conditions caused by large genes. PMID:25211151

Molecular genetics of the Usher syndrome in Lebanon: identification of 11 novel protein truncating mutations by whole exome sequencing.

PubMed

Reddy, Ramesh; Fahiminiya, Somayyeh; El Zir, Elie; Mansour, Ahmad; Megarbane, Andre; Majewski, Jacek; Slim, Rima

2014-01-01

Usher syndrome (USH) is a genetically heterogeneous condition with ten disease-causing genes. The spectrum of genes and mutations causing USH in the Lebanese and Middle Eastern populations has not been described. Consequently, diagnostic approaches designed to screen for previously reported mutations were unlikely to identify the mutations in 11 unrelated families, eight of Lebanese and three of Middle Eastern origins. In addition, six of the ten USH genes consist of more than 20 exons, each, which made mutational analysis by Sanger sequencing of PCR-amplified exons from genomic DNA tedious and costly. The study was aimed at the identification of USH causing genes and mutations in 11 unrelated families with USH type I or II. Whole exome sequencing followed by expanded familial validation by Sanger sequencing. We identified disease-causing mutations in all the analyzed patients in four USH genes, MYO7A, USH2A, GPR98 and CDH23. Eleven of the mutations were novel and protein truncating, including a complex rearrangement in GPR98. Our data highlight the genetic diversity of Usher syndrome in the Lebanese population and the time and cost-effectiveness of whole exome sequencing approach for mutation analysis of genetically heterogeneous conditions caused by large genes.

Mutation Analysis of SLC26A4 for Pendred Syndrome and Nonsyndromic Hearing Loss by High-Resolution Melting

PubMed Central

Chen, Neng; Tranebjærg, Lisbeth; Rendtorff, Nanna Dahl; Schrijver, Iris

2011-01-01

Pendred syndrome and DFNB4 (autosomal recessive nonsyndromic congenital deafness, locus 4) are associated with autosomal recessive congenital sensorineural hearing loss and mutations in the SLC26A4 gene. Extensive allelic heterogeneity, however, necessitates analysis of all exons and splice sites to identify mutations for individual patients. Although Sanger sequencing is the gold standard for mutation detection, screening methods supplemented with targeted sequencing can provide a cost-effective alternative. One such method, denaturing high-performance liquid chromatography, was developed for clinical mutation detection in SLC26A4. However, this method inherently cannot distinguish homozygous changes from wild-type sequences. High-resolution melting (HRM), on the other hand, can detect heterozygous and homozygous changes cost-effectively, without any post-PCR modifications. We developed a closed-tube HRM mutation detection method specific for SLC26A4 that can be used in the clinical diagnostic setting. Twenty-eight primer pairs were designed to cover all 21 SLC26A4 exons and splice junction sequences. Using the resulting amplicons, initial HRM analysis detected all 45 variants previously identified by sequencing. Subsequently, a 384-well plate format was designed for up to three patient samples per run. Blinded HRM testing on these plates of patient samples collected over 1 year in a clinical diagnostic laboratory accurately detected all variants identified by sequencing. In conclusion, HRM with targeted sequencing is a reliable, simple, and cost-effective method for SLC26A4 mutation screening and detection. PMID:21704276

WholeGenome Sequencing of High-Risk Families to Identify New Mutational Mechanisms of Breast Cancer Predisposition

DTIC Science & Technology

2014-10-01

4 APPENDICES 4 INTRODUCTION: Despite tremendous advances in mutation detection with gene panels...population frequency and overlap with ENCODE regions. 2a. Align reads to the reference sequence (months 4-10) 2b. Identify SNPs, indels, CNVs and

Targeted sequencing-based analyses of candidate gene variants in ulcerative colitis-associated colorectal neoplasia.

PubMed

Chakrabarty, Sanjiban; Varghese, Vinay Koshy; Sahu, Pranoy; Jayaram, Pradyumna; Shivakumar, Bhadravathi M; Pai, Cannanore Ganesh; Satyamoorthy, Kapaettu

2017-06-27

Long-standing ulcerative colitis (UC) leading to colorectal cancer (CRC) is one of the most serious and life-threatening consequences acknowledged globally. Ulcerative colitis-associated colorectal carcinogenesis showed distinct molecular alterations when compared with sporadic colorectal carcinoma. Targeted sequencing of 409 genes in tissue samples of 18 long-standing UC subjects at high risk of colorectal carcinoma (UCHR) was performed to identify somatic driver mutations, which may be involved in the molecular changes during the transformation of non-dysplastic mucosa to high-grade dysplasia. Findings from the study are also compared with previously published genome wide and exome sequencing data in inflammatory bowel disease-associated and sporadic colorectal carcinoma. Next-generation sequencing analysis identified 1107 mutations in 275 genes in UCHR subjects. In addition to TP53 (17%) and KRAS (22%) mutations, recurrent mutations in APC (33%), ACVR2A (61%), ARID1A (44%), RAF1 (39%) and MTOR (61%) were observed in UCHR subjects. In addition, APC, FGFR3, FGFR2 and PIK3CA driver mutations were identified in UCHR subjects. Recurrent mutations in ARID1A (44%), SMARCA4 (17%), MLL2 (44%), MLL3 (67%), SETD2 (17%) and TET2 (50%) genes involved in histone modification and chromatin remodelling were identified in UCHR subjects. Our study identifies new oncogenic driver mutations which may be involved in the transition of non-dysplastic cells to dysplastic phenotype in the subjects with long-standing UC with high risk of progression into colorectal neoplasia.

Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration.

PubMed

Briggs, C E; Rucinski, D; Rosenfeld, P J; Hirose, T; Berson, E L; Dryja, T P

2001-09-01

To determine the spectrum of ABCR mutations associated with Stargardt macular degeneration and cone-rod degeneration (CRD). One hundred eighteen unrelated patients with recessive Stargardt macular degeneration and eight with recessive CRD were screened for mutations in ABCR (ABCA4) by single-strand conformation polymorphism analysis. Variants were characterized by direct genomic sequencing. Segregation analysis was performed on the families of 20 patients in whom at least two or more likely pathogenic sequence changes were identified. The authors found 77 sequence changes likely to be pathogenic: 21 null mutations (15 novel), 55 missense changes (26 novel), and one deletion of a consensus glycosylation site (also novel). Fifty-two patients with Stargardt macular degeneration (44% of those screened) and five with CRD each had two of these sequence changes or were homozygous for one of them. Segregation analyses in the families of 19 of these patients were informative and revealed that the index cases and all available affected siblings were compound heterozygotes or homozygotes. The authors found one instance of an apparently de novo mutation, Ile824Thr, in a patient. Thirty-seven (31%) of the 118 patients with Stargardt disease and one with CRD had only one likely pathogenic sequence change. Twenty-nine patients with Stargardt disease (25%) and two with CRD had no identified sequence changes. This report of 42 novel mutations brings the growing number of identified likely pathogenic sequence changes in ABCR to approximately 250.

Targeted Analysis of Whole Genome Sequence Data to Diagnose Genetic Cardiomyopathy

DOE PAGES

Golbus, Jessica R.; Puckelwartz, Megan J.; Dellefave-Castillo, Lisa; ...

2014-09-01

Background—Cardiomyopathy is highly heritable but genetically diverse. At present, genetic testing for cardiomyopathy uses targeted sequencing to simultaneously assess the coding regions of more than 50 genes. New genes are routinely added to panels to improve the diagnostic yield. With the anticipated $1000 genome, it is expected that genetic testing will shift towards comprehensive genome sequencing accompanied by targeted gene analysis. Therefore, we assessed the reliability of whole genome sequencing and targeted analysis to identify cardiomyopathy variants in 11 subjects with cardiomyopathy. Methods and Results—Whole genome sequencing with an average of 37× coverage was combined with targeted analysis focused onmore » 204 genes linked to cardiomyopathy. Genetic variants were scored using multiple prediction algorithms combined with frequency data from public databases. This pipeline yielded 1-14 potentially pathogenic variants per individual. Variants were further analyzed using clinical criteria and/or segregation analysis. Three of three previously identified primary mutations were detected by this analysis. In six subjects for whom the primary mutation was previously unknown, we identified mutations that segregated with disease, had clinical correlates, and/or had additional pathological correlation to provide evidence for causality. For two subjects with previously known primary mutations, we identified additional variants that may act as modifiers of disease severity. In total, we identified the likely pathological mutation in 9 of 11 (82%) subjects. We conclude that these pilot data demonstrate that ~30-40× coverage whole genome sequencing combined with targeted analysis is feasible and sensitive to identify rare variants in cardiomyopathy-associated genes.« less

Statistical Methods for Identifying Sequence Motifs Affecting Point Mutations

PubMed Central

Zhu, Yicheng; Neeman, Teresa; Yap, Von Bing; Huttley, Gavin A.

2017-01-01

Mutation processes differ between types of point mutation, genomic locations, cells, and biological species. For some point mutations, specific neighboring bases are known to be mechanistically influential. Beyond these cases, numerous questions remain unresolved, including: what are the sequence motifs that affect point mutations? How large are the motifs? Are they strand symmetric? And, do they vary between samples? We present new log-linear models that allow explicit examination of these questions, along with sequence logo style visualization to enable identifying specific motifs. We demonstrate the performance of these methods by analyzing mutation processes in human germline and malignant melanoma. We recapitulate the known CpG effect, and identify novel motifs, including a highly significant motif associated with A→G mutations. We show that major effects of neighbors on germline mutation lie within ±2 of the mutating base. Models are also presented for contrasting the entire mutation spectra (the distribution of the different point mutations). We show the spectra vary significantly between autosomes and X-chromosome, with a difference in T→C transition dominating. Analyses of malignant melanoma confirmed reported characteristic features of this cancer, including statistically significant strand asymmetry, and markedly different neighboring influences. The methods we present are made freely available as a Python library https://bitbucket.org/pycogent3/mutationmotif. PMID:27974498

The Sequences of 1504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid Functional Genomic Studies

PubMed Central

Pham, Nikki T.; Wei, Tong; Schackwitz, Wendy S.; Lipzen, Anna M.; Duong, Phat Q.; Jones, Kyle C.; Ruan, Deling; Bauer, Diane; Peng, Yi; Schmutz, Jeremy

2017-01-01

The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. PMID:28576844

Genetic mutation analysis of human gastric adenocarcinomas using ion torrent sequencing platform.

PubMed

Xu, Zhi; Huo, Xinying; Ye, Hua; Tang, Chuanning; Nandakumar, Vijayalakshmi; Lou, Feng; Zhang, Dandan; Dong, Haichao; Sun, Hong; Jiang, Shouwen; Zhang, Guangchun; Liu, Zhiyuan; Dong, Zhishou; Guo, Baishuai; He, Yan; Yan, Chaowei; Wang, Lu; Su, Ziyi; Li, Yangyang; Gu, Dongying; Zhang, Xiaojing; Wu, Xiaomin; Wei, Xiaowei; Hong, Lingzhi; Zhang, Yangmei; Yang, Jinsong; Gong, Yonglin; Tang, Cuiju; Jones, Lindsey; Huang, Xue F; Chen, Si-Yi; Chen, Jinfei

2014-01-01

Gastric cancer is the one of the major causes of cancer-related death, especially in Asia. Gastric adenocarcinoma, the most common type of gastric cancer, is heterogeneous and its incidence and cause varies widely with geographical regions, gender, ethnicity, and diet. Since unique mutations have been observed in individual human cancer samples, identification and characterization of the molecular alterations underlying individual gastric adenocarcinomas is a critical step for developing more effective, personalized therapies. Until recently, identifying genetic mutations on an individual basis by DNA sequencing remained a daunting task. Recent advances in new next-generation DNA sequencing technologies, such as the semiconductor-based Ion Torrent sequencing platform, makes DNA sequencing cheaper, faster, and more reliable. In this study, we aim to identify genetic mutations in the genes which are targeted by drugs in clinical use or are under development in individual human gastric adenocarcinoma samples using Ion Torrent sequencing. We sequenced 737 loci from 45 cancer-related genes in 238 human gastric adenocarcinoma samples using the Ion Torrent Ampliseq Cancer Panel. The sequencing analysis revealed a high occurrence of mutations along the TP53 locus (9.7%) in our sample set. Thus, this study indicates the utility of a cost and time efficient tool such as Ion Torrent sequencing to screen cancer mutations for the development of personalized cancer therapy.

Targeted next-generation sequencing analysis identifies novel mutations in families with severe familial exudative vitreoretinopathy.

PubMed

Huang, Xiao-Yan; Zhuang, Hong; Wu, Ji-Hong; Li, Jian-Kang; Hu, Fang-Yuan; Zheng, Yu; Tellier, Laurent Christian Asker M; Zhang, Sheng-Hai; Gao, Feng-Juan; Zhang, Jian-Guo; Xu, Ge-Zhi

2017-01-01

Familial exudative vitreoretinopathy (FEVR) is a genetically and clinically heterogeneous disease, characterized by failure of vascular development of the peripheral retina. The symptoms of FEVR vary widely among patients in the same family, and even between the two eyes of a given patient. This study was designed to identify the genetic defect in a patient cohort of ten Chinese families with a definitive diagnosis of FEVR. To identify the causative gene, next-generation sequencing (NGS)-based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members by using Sanger sequencing and quantitative real-time PCR (QPCR). Of the cohort of ten FEVR families, six pathogenic variants were identified, including four novel and two known heterozygous mutations. Of the variants identified, four were missense variants, and two were novel heterozygous deletion mutations [ LRP5 , c.4053 DelC (p.Ile1351IlefsX88); TSPAN12 , EX8Del]. The two novel heterozygous deletion mutations were not observed in the control subjects and could give rise to a relatively severe FEVR phenotype, which could be explained by the protein function prediction. We identified two novel heterozygous deletion mutations [ LRP5 , c.4053 DelC (p.Ile1351IlefsX88); TSPAN12 , EX8Del] using targeted NGS as a causative mutation for FEVR. These genetic deletion variations exhibit a severe form of FEVR, with tractional retinal detachments compared with other known point mutations. The data further enrich the mutation spectrum of FEVR and enhance our understanding of genotype-phenotype correlations to provide useful information for disease diagnosis, prognosis, and effective genetic counseling.

Targeted next-generation sequencing analysis identifies novel mutations in families with severe familial exudative vitreoretinopathy

PubMed Central

Huang, Xiao-Yan; Zhuang, Hong; Wu, Ji-Hong; Li, Jian-Kang; Hu, Fang-Yuan; Zheng, Yu; Tellier, Laurent Christian Asker M.; Zhang, Sheng-Hai; Gao, Feng-Juan; Zhang, Jian-Guo

2017-01-01

Purpose Familial exudative vitreoretinopathy (FEVR) is a genetically and clinically heterogeneous disease, characterized by failure of vascular development of the peripheral retina. The symptoms of FEVR vary widely among patients in the same family, and even between the two eyes of a given patient. This study was designed to identify the genetic defect in a patient cohort of ten Chinese families with a definitive diagnosis of FEVR. Methods To identify the causative gene, next-generation sequencing (NGS)-based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members by using Sanger sequencing and quantitative real-time PCR (QPCR). Results Of the cohort of ten FEVR families, six pathogenic variants were identified, including four novel and two known heterozygous mutations. Of the variants identified, four were missense variants, and two were novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del]. The two novel heterozygous deletion mutations were not observed in the control subjects and could give rise to a relatively severe FEVR phenotype, which could be explained by the protein function prediction. Conclusions We identified two novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del] using targeted NGS as a causative mutation for FEVR. These genetic deletion variations exhibit a severe form of FEVR, with tractional retinal detachments compared with other known point mutations. The data further enrich the mutation spectrum of FEVR and enhance our understanding of genotype–phenotype correlations to provide useful information for disease diagnosis, prognosis, and effective genetic counseling. PMID:28867931

Deep Sequencing Reveals Spatially Distributed Distinct Hot Spot Mutations in DICER1-Related Multinodular Goiter.

PubMed

de Kock, Leanne; Bah, Ismaël; Revil, Timothée; Bérubé, Pierre; Wu, Mona K; Sabbaghian, Nelly; Priest, John R; Ragoussis, Jiannis; Foulkes, William D

2016-10-01

Nontoxic multinodular goiter (MNG) occurs frequently, but its genetic etiology is not well established. Familial MNG and MNG occurring with ovarian Sertoli-Leydig cell tumor are associated with germline DICER1 mutations. We recently identified second somatic DICER1 ribonuclease (RNase) IIIb mutations in two MNGs. The objective of the study was to investigate the occurrence of somatic DICER1 mutations and mutational clonality in MNG. MNGs from 15 patients (10 with and five without germline DICER1 mutations) were selected based on tissue availability. Core biopsies/scrapings (n = 70) were obtained, sampling areas of follicular hyperplasia, hyperplasia within colloid pools, unremarkable thyroid parenchyma, and areas of thyroid parenchyma, not classified. After capture with a Fluidigm access array, the coding sequence of DICER1 was deep sequenced using DNA from each core/scraping. All germline DICER1-mutated cases were found to harbor at least one RNase III mutation. Specifically, we identified 12 individually distinct DICER1 RNase IIIb hot spot mutations in 32 of the follicular hyperplasia or hyperplasia within colloid pools cores/scrapings. These mutations are predicted to affect the metal-ion binding residues at positions p.Glu1705, p.Asp1709, p.Gly1809, p.Asp1810, and p.Glu1813. Somatic RNase IIIb mutations were identified in the 10 DICER1 germline mutated MNGs as follows: two cases contained one somatic mutation, five cases contained two mutations, and three cases contained three distinct somatic hot spot mutations. No RNase IIIb mutations were identified in the MNGs from individuals without germline DICER1 mutations. This study demonstrates that nodules within MNG occurring in DICER1 syndrome are associated with spatially distributed somatic DICER1 RNase IIIb mutations.

Cancer genes mutation profiling in calcifying epithelial odontogenic tumour.

PubMed

de Sousa, Sílvia Ferreira; Diniz, Marina Gonçalves; França, Josiane Alves; Fontes Pereira, Thaís Dos Santos; Moreira, Rennan Garcias; Santos, Jean Nunes Dos; Gomez, Ricardo Santiago; Gomes, Carolina Cavalieri

2018-03-01

To identify calcifying epithelial odontogenic tumour (CEOT) mutations in oncogenes and tumour suppressor genes. A panel of 50 genes commonly mutated in cancer was sequenced in CEOT by next-generation sequencing. Sanger sequencing was used to cover the region of the frameshift deletion identified in one sample. Missense single nucleotide variants (SNVs) with minor allele frequency (MAF) <1% were detected in PTEN , MET and JAK3 . A frameshift deletion in CDKN2A occurred in association with a missense mutation in the same gene region, suggesting a second hit in the inactivation of this gene. APC, KDR, KIT, PIK3CA and TP53 missense SNVs were identified; however, these are common SNVs, showing MAF >1%. CEOT harbours mutations in the tumour suppressor PTEN and CDKN2A and in the oncogenes JAK3 and MET . As these mutations occurred in only one case each, they are probably not driver mutations for these tumours. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Golbus, Jessica R.; Puckelwartz, Megan J.; Dellefave-Castillo, Lisa

Background—Cardiomyopathy is highly heritable but genetically diverse. At present, genetic testing for cardiomyopathy uses targeted sequencing to simultaneously assess the coding regions of more than 50 genes. New genes are routinely added to panels to improve the diagnostic yield. With the anticipated $1000 genome, it is expected that genetic testing will shift towards comprehensive genome sequencing accompanied by targeted gene analysis. Therefore, we assessed the reliability of whole genome sequencing and targeted analysis to identify cardiomyopathy variants in 11 subjects with cardiomyopathy. Methods and Results—Whole genome sequencing with an average of 37× coverage was combined with targeted analysis focused onmore » 204 genes linked to cardiomyopathy. Genetic variants were scored using multiple prediction algorithms combined with frequency data from public databases. This pipeline yielded 1-14 potentially pathogenic variants per individual. Variants were further analyzed using clinical criteria and/or segregation analysis. Three of three previously identified primary mutations were detected by this analysis. In six subjects for whom the primary mutation was previously unknown, we identified mutations that segregated with disease, had clinical correlates, and/or had additional pathological correlation to provide evidence for causality. For two subjects with previously known primary mutations, we identified additional variants that may act as modifiers of disease severity. In total, we identified the likely pathological mutation in 9 of 11 (82%) subjects. We conclude that these pilot data demonstrate that ~30-40× coverage whole genome sequencing combined with targeted analysis is feasible and sensitive to identify rare variants in cardiomyopathy-associated genes.« less

High-throughput discovery of mutations in tef semi-dwarfing genes by next-generation sequencing analysis.

PubMed

Zhu, Qihui; Smith, Shavannor M; Ayele, Mulu; Yang, Lixing; Jogi, Ansuya; Chaluvadi, Srinivasa R; Bennetzen, Jeffrey L

2012-11-01

Tef (Eragrostis tef) is a major cereal crop in Ethiopia. Lodging is the primary constraint to increasing productivity in this allotetraploid species, accounting for losses of ∼15-45% in yield each year. As a first step toward identifying semi-dwarf varieties that might have improved lodging resistance, an ∼6× fosmid library was constructed and used to identify both homeologues of the dw3 semi-dwarfing gene of Sorghum bicolor. An EMS mutagenized population, consisting of ∼21,210 tef plants, was planted and leaf materials were collected into 23 superpools. Two dwarfing candidate genes, homeologues of dw3 of sorghum and rht1 of wheat, were sequenced directly from each superpool with 454 technology, and 120 candidate mutations were identified. Out of 10 candidates tested, six independent mutations were validated by Sanger sequencing, including two predicted detrimental mutations in both dw3 homeologues with a potential to improve lodging resistance in tef through further breeding. This study demonstrates that high-throughput sequencing can identify potentially valuable mutations in under-studied plant species like tef and has provided mutant lines that can now be combined and tested in breeding programs for improved lodging resistance.

Deep sequencing detects very-low-grade somatic mosaicism in the unaffected mother of siblings with nemaline myopathy.

PubMed

Miyatake, Satoko; Koshimizu, Eriko; Hayashi, Yukiko K; Miya, Kazushi; Shiina, Masaaki; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Miyake, Noriko; Saitsu, Hirotomo; Ogata, Kazuhiro; Nishino, Ichizo; Matsumoto, Naomichi

2014-07-01

When an expected mutation in a particular disease-causing gene is not identified in a suspected carrier, it is usually assumed to be due to germline mosaicism. We report here very-low-grade somatic mosaicism in ACTA1 in an unaffected mother of two siblings affected with a neonatal form of nemaline myopathy. The mosaicism was detected by deep resequencing using a next-generation sequencer. We identified a novel heterozygous mutation in ACTA1, c.448A>G (p.Thr150Ala), in the affected siblings. Three-dimensional structural modeling suggested that this mutation may affect polymerization and/or actin's interactions with other proteins. In this family, we expected autosomal dominant inheritance with either parent demonstrating germline or somatic mosaicism. Sanger sequencing identified no mutation. However, further deep resequencing of this mutation on a next-generation sequencer identified very-low-grade somatic mosaicism in the mother: 0.4%, 1.1%, and 8.3% in the saliva, blood leukocytes, and nails, respectively. Our study demonstrates the possibility of very-low-grade somatic mosaicism in suspected carriers, rather than germline mosaicism. Copyright © 2014 Elsevier B.V. All rights reserved.

Exome capture sequencing identifies a novel mutation in BBS4

PubMed Central

Wang, Hui; Chen, Xianfeng; Dudinsky, Lynn; Patenia, Claire; Chen, Yiyun; Li, Yumei; Wei, Yue; Abboud, Emad B.; Al-Rajhi, Ali A.; Lewis, Richard Alan; Lupski, James R.; Mardon, Graeme; Gibbs, Richard A.; Perkins, Brian D.

2011-01-01

Purpose Leber congenital amaurosis (LCA) is one of the most severe eye dystrophies characterized by severe vision loss at an early stage and accounts for approximately 5% of all retinal dystrophies. The purpose of this study was to identify a novel LCA disease allele or gene and to develop an approach combining genetic mapping with whole exome sequencing. Methods Three patients from King Khaled Eye Specialist Hospital (KKESH205) underwent whole genome single nucleotide polymorphism genotyping, and a single candidate region was identified. Taking advantage of next-generation high-throughput DNA sequencing technologies, whole exome capture sequencing was performed on patient KKESH205#7. Sanger direct sequencing was used during the validation step. The zebrafish model was used to examine the function of the mutant allele. Results A novel missense mutation in Bardet-Biedl syndrome 4 protein (BBS4) was identified in a consanguineous family from Saudi Arabia. This missense mutation in the fifth exon (c.253G>C;p.E85Q) of BBS4 is likely a disease-causing mutation as it segregates with the disease. The mutation is not found in the single nucleotide polymorphism (SNP) database, the 1000 Genomes Project, or matching normal controls. Functional analysis of this mutation in zebrafish indicates that the G253C allele is pathogenic. Coinjection of the G253C allele cannot rescue the mislocalization of rhodopsin in the retina when BBS4 is knocked down by morpholino injection. Immunofluorescence analysis in cell culture shows that this missense mutation in BBS4 does not cause obvious defects in protein expression or pericentriolar localization. Conclusions This mutation likely mainly reduces or abolishes BBS4 function in the retina. Further studies of this allele will provide important insights concerning the pleiotropic nature of BBS4 function. PMID:22219648

THAP1/DYT6 sequence variants in non-DYT1 early-onset primary dystonia in China and their effects on RNA expression.

PubMed

Cheng, Fu Bo; Ozelius, Laurie J; Wan, Xin Hua; Feng, Jia Chun; Ma, Ling Yan; Yang, Ying Mai; Wang, Lin

2012-02-01

Mutations in the THAP1 gene were recently identified as the cause of DYT6 primary dystonia. More than 40 mutations in this gene have been described in different populations. However, no previous report has identified sequence variations that affect the transcript process of the THAP1 gene. In addition, the mutation frequency in Chinese early-onset primary dystonia has not been well characterized. One hundred and two unrelated patients with non-DYT1 early-onset primary dystonia (age at onset <26 years), family members of participants with mutations, and 200 neurologically normal controls were screened for THAP1 gene mutations. The effects of the identified mutations on RNA expression were analyzed using semi-quantitative real-time PCR. Seven sequence variants (c.63_66del TTTC, c.161G>T, c.224A>T, c.267G>A, c.339T>C, c.449A>C, and c.539T>C) were identified in this group of patients (6.9%). In this cohort, 15 subjects (seven unrelated patients and eight family members) were detected to have THAP1 sequence variants. Among these 15 subjects, 11 were manifested (penetrance of DYT6 was 73.3%) and seven presented with craniocervical involvement (63.6%). However, one patient manifested paroxysmal headshake, and one presented with essential hand tremor. Semi-quantitative real-time PCR indicated that a novel silent mutation (c.267G>A) decreased the expression of THAP1 in human lymphocytes. Our findings indicated that THAP1 sequence variants are not common in non-DYT1 early-onset primary dystonia in China and that the clinical manifestation may vary. One silent mutation (c.267G>A) was shown to affect THAP1 expression.

Intronic splicing mutations in PTCH1 cause Gorlin syndrome.

PubMed

Bholah, Zaynab; Smith, Miriam J; Byers, Helen J; Miles, Emma K; Evans, D Gareth; Newman, William G

2014-09-01

Gorlin syndrome is an autosomal dominant disorder characterized by multiple early-onset basal cell carcinoma, odontogenic keratocysts and skeletal abnormalities. It is caused by heterozygous mutations in the tumour suppressor PTCH1. Routine clinical genetic testing, by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) to confirm a clinical diagnosis of Gorlin syndrome, identifies a mutation in 60-90 % of cases. We undertook RNA analysis on lymphocytes from ten individuals diagnosed with Gorlin syndrome, but without known PTCH1 mutations by exonic sequencing or MLPA. Two altered PTCH1 transcripts were identified. Genomic DNA sequence analysis identified an intron 7 mutation c.1068-10T>A, which created a strong cryptic splice acceptor site, leading to an intronic insertion of eight bases; this is predicted to create a frameshift p.(His358Alafs*12). Secondly, a deep intronic mutation c.2561-2057A>G caused an inframe insertion of 78 intronic bases in the cDNA transcript, leading to a premature stop codon p.(Gly854fs*3). The mutations are predicted to cause loss of function of PTCH1, consistent with its tumour suppressor function. The findings indicate the importance of RNA analysis to detect intronic mutations in PTCH1 not identified by routine screening techniques.

Phenotype/genotype correlation in a case series of Stargardt's patients identifies novel mutations in the ABCA4 gene.

PubMed

Gemenetzi, M; Lotery, A J

2013-11-01

To investigate phenotypic variability in terms of best-corrected visual acuity (BCVA) in patients with Stargardt disease (STGD) and confirmed ABCA4 mutations. Entire coding region analysis of the ABCA4 gene by direct sequencing of seven patients with clinical findings of STGD seen in the Retina Clinics of Southampton Eye Unit between 2002 and 2011.Phenotypic variables recorded were BCVA, fluorescein angiographic appearance, electrophysiology, and visual fields. All patients had heterozygous amino acid-changing variants (missense mutations) in the ABCA4 gene. A splice sequence change was found in a 30-year-old patient with severly affected vision. Two novel sequence changes were identified: a missense mutation in a mildly affected 44-year-old patient and a frameshift mutation in a severly affected 34-year-old patient. The identified ABCA4 mutations were compatible with the resulting phenotypes in terms of BCVA. Higher BCVAs were recorded in patients with missense mutations. Sequence changes, predicted to have more deleterious effect on protein function, resulted in a more severe phenotype. This case series of STGD patients demonstrates novel genotype/phenotype correlations, which may be useful to counselling of patients. This information may prove useful in selection of candidates for clinical trials in ABCA4 disease.

Exome Sequencing Identified a Recessive RDH12 Mutation in a Family with Severe Early-Onset Retinitis Pigmentosa

PubMed Central

Gong, Bo; Wei, Bo; Huang, Lulin; Hao, Jilong; Li, Xiulan; Yang, Yin; Zhou, Yu; Hao, Fang; Cui, Zhihua; Zhang, Dingding; Wang, Le

2015-01-01

Retinitis pigmentosa (RP) is the most important hereditary retinal disease caused by progressive degeneration of the photoreceptor cells. This study is to identify gene mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in a Chinese family using next-generation sequencing technology. A Chinese family with 7 members including two individuals affected with severe early-onset RP was studied. All patients underwent a complete ophthalmic examination. Exome sequencing was performed on a single RP patient (the proband of this family) and direct Sanger sequencing on other family members and normal controls was followed to confirm the causal mutations. A homozygous mutation c.437T

The evolutionary history of the DMRT3 'Gait keeper' haplotype.

PubMed

Staiger, E A; Almén, M S; Promerová, M; Brooks, S; Cothran, E G; Imsland, F; Jäderkvist Fegraeus, K; Lindgren, G; Mehrabani Yeganeh, H; Mikko, S; Vega-Pla, J L; Tozaki, T; Rubin, C J; Andersson, L

2017-10-01

A previous study revealed a strong association between the DMRT3:Ser301STOP mutation in horses and alternate gaits as well as performance in harness racing. Several follow-up studies have confirmed a high frequency of the mutation in gaited horse breeds and an effect on gait quality. The aim of this study was to determine when and where the mutation arose, to identify additional potential causal mutations and to determine the coalescence time for contemporary haplotypes carrying the stop mutation. We utilized sequences from 89 horses representing 26 breeds to identify 102 SNPs encompassing the DMRT3 gene that are in strong linkage disequilibrium with the stop mutation. These 102 SNPs were genotyped in an additional 382 horses representing 72 breeds, and we identified 14 unique haplotypes. The results provided conclusive evidence that DMRT3:Ser301STOP is causal, as no other sequence polymorphisms showed an equally strong association to locomotion traits. The low sequence diversity among mutant chromosomes demonstrated that they must have diverged from a common ancestral sequence within the last 10 000 years. Thus, the mutation occurred either just before domestication or more likely some time after domestication and then spread across the world as a result of selection on locomotion traits. © 2017 Stichting International Foundation for Animal Genetics.

Detection of ESR1 mutations in plasma and tumors from metastatic breast cancer patients using next-generation sequencing.

PubMed

Yanagawa, Takehiro; Kagara, Naofumi; Miyake, Tomohiro; Tanei, Tomonori; Naoi, Yasuto; Shimoda, Masafumi; Shimazu, Kenzo; Kim, Seung Jin; Noguchi, Shinzaburo

2017-06-01

Liquid biopsy using digital PCR (dPCR) has been widely used for the screening of ESR1 mutations, since they are frequently identified in the hotspot. However, dPCR is limited to the known mutations. Therefore, we aimed to analyze the utility of next-generation sequencing (NGS) to discover novel ESR1 mutations. Whole exon sequencing of the ESR1 gene using NGS was performed in 16 primary and 47 recurrent tumor samples and 38 plasma samples from hormone receptor-positive metastatic breast cancer patients. Functional analyses were then performed for the novel mutations we detected. We identified no mutations in primary tumors and six mutations in five recurrent tumors, including three types of known mutations (Y537C, Y537N, and D538G) and two novel mutations (E279V and G557R). We also identified seven mutations in five plasma samples, including three types of known mutations (S463P, Y537S, and D538G) and one mutation not reported in COSMIC database (L536H). All nine patients with ESR1 mutations were treated with aromatase inhibitors (AIs) prior to sampling, and the mutations were frequently detected in patients who received AI treatments in the metastatic setting. Among the three novel mutations (E279V, L536H, and G557R), L536H, but not E279V and G557R, showed ligand-independent activity. All three mutant proteins showed nuclear localization and had no relation with non-genomic ER pathways. Although the molecular mechanisms of the E279V and G557R mutations remain unclear, our data suggest the utility of NGS as a liquid biopsy for metastatic breast cancer patients and the potential to identify novel ESR1 mutations.

The Frequency of MEFV Gene Mutations and Genotypes in Sanliurfa Province, South-Eastern Region of Turkey, after the Syrian Civil War by Using Next Generation Sequencing and Report of a Novel Exon 4 Mutation (I423T).

PubMed

Gumus, Evren

2018-05-07

Familial Mediterranean Fever (FMF) is a genetic disorder characterized by recurrent episodes of fever and abdominal pain. Mutations in the Mediterranean fever (MEFV) gene are localized on the p arm of chromosome 16. Over 333 MEFV sequence variants have been identified so far in FMF patients, which occur mostly in the 2nd and 10th exons of the gene. In this study, 296 unrelated patients with clinical suspicion of FMF, which were admitted during January⁻December 2017, were retrospectively reviewed to identify the frequency of MEFV gene mutations by using next generation sequencing. Eighteen different mutations, 45 different genotypes and a novel exon 4 (I423T) mutation were identified in this study. This mutation is the fourth mutation identified in exon 4.The most frequent mutation was R202Q, followed by M694V, E148Q, M680I, R761H, V726A and R354W. One of the most important aims of this study is to investigate the MEFV mutation type and genotype of migrants coming to Sanliurfa after the civil war of Syria. This study also examines the effect of the condition on the region’s gene pool and the distribution of different types of mutations. Our results indicated that MEFV mutations are highly heterogeneous in our patient population, which is consistent with the findings of other studies in our region. Previously used methods, such as Restriction Fragment Length Polymorphism (RFLP), do not define uncommon or especially novel mutations. Therefore, Next Generation Sequencing (NGS) analysis of the MEFV gene could be useful for finding novel mutations, except for those located on exon 2 and 10.

Novel myosin mutations for hereditary hearing loss revealed by targeted genomic capture and massively parallel sequencing

PubMed Central

Brownstein, Zippora; Abu-Rayyan, Amal; Karfunkel-Doron, Daphne; Sirigu, Serena; Davidov, Bella; Shohat, Mordechai; Frydman, Moshe; Houdusse, Anne; Kanaan, Moien; Avraham, Karen B

2014-01-01

Hereditary hearing loss is genetically heterogeneous, with a large number of genes and mutations contributing to this sensory, often monogenic, disease. This number, as well as large size, precludes comprehensive genetic diagnosis of all known deafness genes. A combination of targeted genomic capture and massively parallel sequencing (MPS), also referred to as next-generation sequencing, was applied to determine the deafness-causing genes in hearing-impaired individuals from Israeli Jewish and Palestinian Arab families. Among the mutations detected, we identified nine novel mutations in the genes encoding myosin VI, myosin VIIA and myosin XVA, doubling the number of myosin mutations in the Middle East. Myosin VI mutations were identified in this population for the first time. Modeling of the mutations provided predicted mechanisms for the damage they inflict in the molecular motors, leading to impaired function and thus deafness. The myosin mutations span all regions of these molecular motors, leading to a wide range of hearing phenotypes, reinforcing the key role of this family of proteins in auditory function. This study demonstrates that multiple mutations responsible for hearing loss can be identified in a relatively straightforward manner by targeted-gene MPS technology and concludes that this is the optimal genetic diagnostic approach for identification of mutations responsible for hearing loss. PMID:24105371

Mutation detection using automated fluorescence-based sequencing.

PubMed

Montgomery, Kate T; Iartchouck, Oleg; Li, Li; Perera, Anoja; Yassin, Yosuf; Tamburino, Alex; Loomis, Stephanie; Kucherlapati, Raju

2008-04-01

The development of high-throughput DNA sequencing techniques has made direct DNA sequencing of PCR-amplified genomic DNA a rapid and economical approach to the identification of polymorphisms that may play a role in disease. Point mutations as well as small insertions or deletions are readily identified by DNA sequencing. The mutations may be heterozygous (occurring in one allele while the other allele retains the normal sequence) or homozygous (occurring in both alleles). Sequencing alone cannot discriminate between true homozygosity and apparent homozygosity due to the loss of one allele due to a large deletion. In this unit, strategies are presented for using PCR amplification and automated fluorescence-based sequencing to identify sequence variation. The size of the project and laboratory preference and experience will dictate how the data is managed and which software tools are used for analysis. A high-throughput protocol is given that has been used to search for mutations in over 200 different genes at the Harvard Medical School - Partners Center for Genetics and Genomics (HPCGG, http://www.hpcgg.org/). Copyright 2008 by John Wiley & Sons, Inc.

Exome Sequencing Identifies Potentially Druggable Mutations in Nasopharyngeal Carcinoma.

PubMed

Chow, Yock Ping; Tan, Lu Ping; Chai, San Jiun; Abdul Aziz, Norazlin; Choo, Siew Woh; Lim, Paul Vey Hong; Pathmanathan, Rajadurai; Mohd Kornain, Noor Kaslina; Lum, Chee Lun; Pua, Kin Choo; Yap, Yoke Yeow; Tan, Tee Yong; Teo, Soo Hwang; Khoo, Alan Soo-Beng; Patel, Vyomesh

2017-03-03

In this study, we first performed whole exome sequencing of DNA from 10 untreated and clinically annotated fresh frozen nasopharyngeal carcinoma (NPC) biopsies and matched bloods to identify somatically mutated genes that may be amenable to targeted therapeutic strategies. We identified a total of 323 mutations which were either non-synonymous (n = 238) or synonymous (n = 85). Furthermore, our analysis revealed genes in key cancer pathways (DNA repair, cell cycle regulation, apoptosis, immune response, lipid signaling) were mutated, of which those in the lipid-signaling pathway were the most enriched. We next extended our analysis on a prioritized sub-set of 37 mutated genes plus top 5 mutated cancer genes listed in COSMIC using a custom designed HaloPlex target enrichment panel with an additional 88 NPC samples. Our analysis identified 160 additional non-synonymous mutations in 37/42 genes in 66/88 samples. Of these, 99/160 mutations within potentially druggable pathways were further selected for validation. Sanger sequencing revealed that 77/99 variants were true positives, giving an accuracy of 78%. Taken together, our study indicated that ~72% (n = 71/98) of NPC samples harbored mutations in one of the four cancer pathways (EGFR-PI3K-Akt-mTOR, NOTCH, NF-κB, DNA repair) which may be potentially useful as predictive biomarkers of response to matched targeted therapies.

Exome Sequencing Identifies Potentially Druggable Mutations in Nasopharyngeal Carcinoma

PubMed Central

Chow, Yock Ping; Tan, Lu Ping; Chai, San Jiun; Abdul Aziz, Norazlin; Choo, Siew Woh; Lim, Paul Vey Hong; Pathmanathan, Rajadurai; Mohd Kornain, Noor Kaslina; Lum, Chee Lun; Pua, Kin Choo; Yap, Yoke Yeow; Tan, Tee Yong; Teo, Soo Hwang; Khoo, Alan Soo-Beng; Patel, Vyomesh

2017-01-01

In this study, we first performed whole exome sequencing of DNA from 10 untreated and clinically annotated fresh frozen nasopharyngeal carcinoma (NPC) biopsies and matched bloods to identify somatically mutated genes that may be amenable to targeted therapeutic strategies. We identified a total of 323 mutations which were either non-synonymous (n = 238) or synonymous (n = 85). Furthermore, our analysis revealed genes in key cancer pathways (DNA repair, cell cycle regulation, apoptosis, immune response, lipid signaling) were mutated, of which those in the lipid-signaling pathway were the most enriched. We next extended our analysis on a prioritized sub-set of 37 mutated genes plus top 5 mutated cancer genes listed in COSMIC using a custom designed HaloPlex target enrichment panel with an additional 88 NPC samples. Our analysis identified 160 additional non-synonymous mutations in 37/42 genes in 66/88 samples. Of these, 99/160 mutations within potentially druggable pathways were further selected for validation. Sanger sequencing revealed that 77/99 variants were true positives, giving an accuracy of 78%. Taken together, our study indicated that ~72% (n = 71/98) of NPC samples harbored mutations in one of the four cancer pathways (EGFR-PI3K-Akt-mTOR, NOTCH, NF-κB, DNA repair) which may be potentially useful as predictive biomarkers of response to matched targeted therapies. PMID:28256603

ESR1 Mutations in Circulating Plasma Tumor DNA from Metastatic Breast Cancer Patients.

PubMed

Chu, David; Paoletti, Costanza; Gersch, Christina; VanDenBerg, Dustin A; Zabransky, Daniel J; Cochran, Rory L; Wong, Hong Yuen; Toro, Patricia Valda; Cidado, Justin; Croessmann, Sarah; Erlanger, Bracha; Cravero, Karen; Kyker-Snowman, Kelly; Button, Berry; Parsons, Heather A; Dalton, W Brian; Gillani, Riaz; Medford, Arielle; Aung, Kimberly; Tokudome, Nahomi; Chinnaiyan, Arul M; Schott, Anne; Robinson, Dan; Jacks, Karen S; Lauring, Josh; Hurley, Paula J; Hayes, Daniel F; Rae, James M; Park, Ben Ho

2016-02-15

Mutations in the estrogen receptor (ER)α gene, ESR1, have been identified in breast cancer metastases after progression on endocrine therapies. Because of limitations of metastatic biopsies, the reported frequency of ESR1 mutations may be underestimated. Here, we show a high frequency of ESR1 mutations using circulating plasma tumor DNA (ptDNA) from patients with metastatic breast cancer. We retrospectively obtained plasma samples from eight patients with known ESR1 mutations and three patients with wild-type ESR1 identified by next-generation sequencing (NGS) of biopsied metastatic tissues. Three common ESR1 mutations were queried for using droplet digital PCR (ddPCR). In a prospective cohort, metastatic tissue and plasma were collected contemporaneously from eight ER-positive and four ER-negative patients. Tissue biopsies were sequenced by NGS, and ptDNA ESR1 mutations were analyzed by ddPCR. In the retrospective cohort, all corresponding mutations were detected in ptDNA, with two patients harboring additional ESR1 mutations not present in their metastatic tissues. In the prospective cohort, three ER-positive patients did not have adequate tissue for NGS, and no ESR1 mutations were identified in tissue biopsies from the other nine patients. In contrast, ddPCR detected seven ptDNA ESR1 mutations in 6 of 12 patients (50%). We show that ESR1 mutations can occur at a high frequency and suggest that blood can be used to identify additional mutations not found by sequencing of a single metastatic lesion. ©2015 American Association for Cancer Research.

Search for Novel Candidate Mutations for Metronidazole Resistance in Helicobacter pylori Using Next-Generation Sequencing

PubMed Central

Binh, Tran Thanh; Suzuki, Rumiko; Trang, Tran Thi Huyen; Kwon, Dong Hyeon

2015-01-01

Metronidazole resistance is a key factor associated with Helicobacter pylori treatment failure. Although this resistance is mainly associated with mutations in the rdxA and frxA genes, the question of whether metronidazole resistance is caused by the inactivation of frxA alone is still debated. Furthermore, it is unclear whether there are other mutations involved in addition to the two genes that are associated with resistance. A metronidazole-resistant strain was cultured from the metronidazole-susceptible H. pylori strain 26695-1 by exposure to low concentrations of metronidazole. The genome sequences of both susceptible and resistant H. pylori strains were determined by Illumina next-generation sequencing, from which putative candidate resistance mutations were identified. Natural transformation was used to introduce PCR products containing candidate mutations into the susceptible parent strain 26695-1, and the metronidazole MIC was determined for each strain. Mutations in frxA (hp0642), rdxA (hp0954), and rpsU (hp0562) were confirmed by the Sanger method. The mutated sequence in rdxA was successfully transformed into strain 26695-1, and the transformants showed resistance to metronidazole. The transformants containing a single mutation in rdxA showed a low MIC (16 mg/liter), while those containing mutations in both rdxA and frxA showed a higher MIC (48 mg/liter). No transformants containing a single mutation in frxA or rpsU were obtained. Next-generation sequencing was used to identify mutations related to drug resistance. We confirmed that the mutations in rdxA are mainly associated with metronidazole resistance, and mutations in frxA are able to enhance H. pylori resistance only in the presence of rdxA mutations. Moreover, mutations in rpsU may play a role in metronidazole resistance. PMID:25645832

Identification of novel mutations in the α-galactosidase A gene in patients with Fabry disease: pitfalls of mutation analyses in patients with low α-galactosidase A activity.

PubMed

Yoshimitsu, Makoto; Higuchi, Koji; Miyata, Masaaki; Devine, Sean; Mattman, Andre; Sirrs, Sandra; Medin, Jeffrey A; Tei, Chuwa; Takenaka, Toshihiro

2011-05-01

Fabry disease is an X-linked lysosomal storage disorder caused by mutations of the α-galactosidase A (GLA) gene, and the disease is a relatively prevalent cause of left ventricular hypertrophy followed by conduction abnormalities and arrhythmias. Mutation analysis of the GLA gene is a valuable tool for accurate diagnosis of affected families. In this study, we carried out molecular studies of 10 unrelated families diagnosed with Fabry disease. Genetic analysis of the GLA gene using conventional genomic sequencing was performed in 9 hemizygous males and 6 heterozygous females. In patients with no mutations in coding DNA sequence, multiplex ligation-dependent probe amplification (MLPA) and/or cDNA sequencing were performed. We identified a novel exon 2 deletion (IVS1_IVS2) in a heterozygous female by MLPA, which was undetectable by conventional sequencing methods. In addition, the g.9331G>A mutation that has previously been found only in patients with cardiac Fabry disease was found in 3 unrelated, newly-diagnosed, cardiac Fabry patients by sequencing GLA genomic DNA and cDNA. Two other novel mutations, g.8319A>G and 832delA were also found in addition to 4 previously reported mutations (R112C, C142Y, M296I, and G373D) in 6 other families. We could identify GLA gene mutations in all hemizygotes and heterozygotes from 10 families with Fabry disease. Mutations in 4 out of 10 families could not be identified by classical genomic analysis, which focuses on exons and the flanking region. Instead, these data suggest that MLPA analysis and cDNA sequence should be considered in genetic testing surveys of patients with Fabry disease. Copyright © 2011 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

Finding cancer driver mutations in the era of big data research.

PubMed

Poulos, Rebecca C; Wong, Jason W H

2018-04-02

In the last decade, the costs of genome sequencing have decreased considerably. The commencement of large-scale cancer sequencing projects has enabled cancer genomics to join the big data revolution. One of the challenges still facing cancer genomics research is determining which are the driver mutations in an individual cancer, as these contribute only a small subset of the overall mutation profile of a tumour. Focusing primarily on somatic single nucleotide mutations in this review, we consider both coding and non-coding driver mutations, and discuss how such mutations might be identified from cancer sequencing datasets. We describe some of the tools and database that are available for the annotation of somatic variants and the identification of cancer driver genes. We also address the use of genome-wide variation in mutation load to establish background mutation rates from which to identify driver mutations under positive selection. Finally, we describe the ways in which mutational signatures can act as clues for the identification of cancer drivers, as these mutations may cause, or arise from, certain mutational processes. By defining the molecular changes responsible for driving cancer development, new cancer treatment strategies may be developed or novel preventative measures proposed.

The spectrum and clinical impact of epigenetic modifier mutations in myeloma

PubMed Central

Pawlyn, Charlotte; Kaiser, Martin F; Heuck, Christoph; Melchor, Lorenzo; Wardell, Christopher P; Murison, Alex; Chavan, Shweta; Johnson, David C; Begum, Dil; Dahir, Nasrin; Proszek, Paula; Cairns, David A; Boyle, Eileen M; Jones, John R; Cook, Gordon; Drayson, Mark T; Owen, Roger G; Gregory, Walter M; Jackson, Graham H; Barlogie, Bart; Davies, Faith E; Walker, Brian A; Morgan, Gareth J

2016-01-01

Purpose Epigenetic dysregulation is known to be an important contributor to myeloma pathogenesis but, unlike in other B cell malignancies, the full spectrum of somatic mutations in epigenetic modifiers has not been previously reported. We sought to address this using results from whole-exome sequencing in the context of a large prospective clinical trial of newly diagnosed patients and targeted sequencing in a cohort of previously treated patients for comparison. Experimental Design Whole-exome sequencing analysis of 463 presenting myeloma cases entered in the UK NCRI Myeloma XI study and targeted sequencing analysis of 156 previously treated cases from the University of Arkansas for Medical Sciences. We correlated the presence of mutations with clinical outcome from diagnosis and compared the mutations found at diagnosis with later stages of disease. Results In diagnostic myeloma patient samples we identify significant mutations in genes encoding the histone 1 linker protein, previously identified in other B-cell malignancies. Our data suggest an adverse prognostic impact from the presence of lesions in genes encoding DNA methylation modifiers and the histone demethylase KDM6A/UTX. The frequency of mutations in epigenetic modifiers appears to increase following treatment most notably in genes encoding histone methyltransferases and DNA methylation modifiers. Conclusions Numerous mutations identified raise the possibility of targeted treatment strategies for patients either at diagnosis or relapse supporting the use of sequencing-based diagnostics in myeloma to help guide therapy as more epigenetic targeted agents become available. PMID:27235425

Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms

PubMed Central

Milosevic Feenstra, Jelena D.; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N.; Cazzola, Mario

2016-01-01

Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed “triple negative.” We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. PMID:26423830

Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms.

PubMed

Milosevic Feenstra, Jelena D; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N; Cazzola, Mario; Kralovics, Robert

2016-01-21

Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed "triple negative." We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. © 2016 by The American Society of Hematology.

The Sequences of 1504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid Functional Genomic Studies.

PubMed

Li, Guotian; Jain, Rashmi; Chern, Mawsheng; Pham, Nikki T; Martin, Joel A; Wei, Tong; Schackwitz, Wendy S; Lipzen, Anna M; Duong, Phat Q; Jones, Kyle C; Jiang, Liangrong; Ruan, Deling; Bauer, Diane; Peng, Yi; Barry, Kerrie W; Schmutz, Jeremy; Ronald, Pamela C

2017-06-01

The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake ( Oryza sativa ssp japonica ), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. © 2017 American Society of Plant Biologists. All rights reserved.

The Sequences of 1,504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid Functional Genomic Studies

DOE PAGES

Li, Guotian; Jain, Rashmi; Chern, Mawsheng; ...

2017-06-02

The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportionmore » of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. In conclusion, this work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations.« less

Mutation Scanning in Wheat by Exon Capture and Next-Generation Sequencing.

PubMed

King, Robert; Bird, Nicholas; Ramirez-Gonzalez, Ricardo; Coghill, Jane A; Patil, Archana; Hassani-Pak, Keywan; Uauy, Cristobal; Phillips, Andrew L

2015-01-01

Targeted Induced Local Lesions in Genomes (TILLING) is a reverse genetics approach to identify novel sequence variation in genomes, with the aims of investigating gene function and/or developing useful alleles for breeding. Despite recent advances in wheat genomics, most current TILLING methods are low to medium in throughput, being based on PCR amplification of the target genes. We performed a pilot-scale evaluation of TILLING in wheat by next-generation sequencing through exon capture. An oligonucleotide-based enrichment array covering ~2 Mbp of wheat coding sequence was used to carry out exon capture and sequencing on three mutagenised lines of wheat containing previously-identified mutations in the TaGA20ox1 homoeologous genes. After testing different mapping algorithms and settings, candidate SNPs were identified by mapping to the IWGSC wheat Chromosome Survey Sequences. Where sequence data for all three homoeologues were found in the reference, mutant calls were unambiguous; however, where the reference lacked one or two of the homoeologues, captured reads from these genes were mis-mapped to other homoeologues, resulting either in dilution of the variant allele frequency or assignment of mutations to the wrong homoeologue. Competitive PCR assays were used to validate the putative SNPs and estimate cut-off levels for SNP filtering. At least 464 high-confidence SNPs were detected across the three mutagenized lines, including the three known alleles in TaGA20ox1, indicating a mutation rate of ~35 SNPs per Mb, similar to that estimated by PCR-based TILLING. This demonstrates the feasibility of using exon capture for genome re-sequencing as a method of mutation detection in polyploid wheat, but accurate mutation calling will require an improved genomic reference with more comprehensive coverage of homoeologues.

TREM2 mutations are rare in a French cohort of patients with frontotemporal dementia.

PubMed

Lattante, Serena; Le Ber, Isabelle; Camuzat, Agnès; Dayan, Sarah; Godard, Chloé; Van Bortel, Inge; De Septenville, Anne; Ciura, Sorana; Brice, Alexis; Kabashi, Edor

2013-10-01

Homozygous mutations in TREM2 have been recently identified by exome sequencing in families presenting with frontotemporal dementia (FTD)-like phenotype. No study has evaluated the exact frequency of TREM2 mutations in cohorts of FTD patients so far. We sequenced TREM2 in 175 patients with pure FTD, mostly French, to test whether mutations could be implicated in the pathogenesis of the disease. No disease-causing mutation was identified in 175 individuals from the French cohort of FTD patients. We did not identify the polymorphism p.R47H (rs75932628), strongly associated with an increased risk of developing Alzheimer's disease. We conclude that TREM2 mutations are extremely rare in patients with pure FTD, although further investigation in larger populations is needed. Copyright © 2013 Elsevier Inc. All rights reserved.

Competitive allele-specific TaqMan PCR (Cast-PCR) is a sensitive, specific and fast method for BRAF V600 mutation detection in Melanoma patients

PubMed Central

Barbano, Raffaela; Pasculli, Barbara; Coco, Michelina; Fontana, Andrea; Copetti, Massimiliano; Rendina, Michelina; Valori, Vanna Maria; Graziano, Paolo; Maiello, Evaristo; Fazio, Vito Michele; Parrella, Paola

2015-01-01

BRAF codon 600 mutation testing of melanoma patients is mandatory for the choice of the most appropriate therapy in the clinical setting. Competitive allele specific TaqMan PCR (Cast-PCR) technology allows not only the selective amplification of minor alleles, but it also blocks the amplification of non-mutant allele. We genotyped codon 600 of the BRAF gene in 54 patients’ samples by Cast-PCR and bidirectional direct sequence analysis. All the mutations detected by sequencing were also identified by Cast-PCR. In addition, Cast-PCR assay detected four samples carrying mutations and was able to clearly identify two mutations of uncertain interpretation by Sanger sequencing. The limit of detection of Cast-PCR was evaluated by constructing dilution curves of BRAFV600E and BRAFV600K mutated clinical samples mixed with a not-mutated specimens. Both mutations could be detected until a 1:100 mutated/not mutated ratio. Cloning and sequencing of the clones was used to confirm mutations on representative discrepant cases. Cast PCR performances were not affected by intratumour heterogeneity, and less affected by melanin content. Our results indicate that Cast-PCR is a reliable diagnostic tool for the identification of melanoma patients as eligible to be treated with TKIs and might be implemented in the clinical setting as elective screening method. PMID:26690267

BMPR1B mutation causes Pierre Robin sequence

PubMed Central

Yao, Xu; Zhang, Rong; Yang, Hui; Zhao, Rui; Guo, Jihong; Jin, Ke; Mei, Haibo; Luo, Yongqi; Zhao, Liu; Tu, Ming; Zhu, Yimin

2017-01-01

Background We investigated a large family with Pierre Robin sequence (PRS). Aim of the study This study aims to determine the genetic cause of PRS. Results The reciprocal translocation t(4;6)(q22;p21) was identified to be segregated with PRS in a three-generation family. Whole-genome sequencing and Sanger sequencing successfully detected breakpoints in the intragenic regions of BMRP1B and GRM4. We hypothesized that PRS in this family was caused by (i) haploinsufficiency for BMPR1B or (ii) a gain of function mechanism mediated by the BMPR1B-GRM4 fusion gene. In an unrelated family, we identified another BMPR1B-splicing mutation that co-segregated with PRS. Conclusion We detected two BMPR1B mutations in two unrelated PRS families, suggesting that BMPR1B disruption is probably a cause of human PRS. Methods GTG banding, comparative genomic hybridization, whole-genome sequencing, and Sanger sequencing were performed to identify the gene causing PRS. PMID:28418932

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Guotian; Jain, Rashmi; Chern, Mawsheng

The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportionmore » of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. In conclusion, this work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations.« less

[A boy with Meier-Gorlin syndrome carrying a novel ORC6 mutation and uniparental disomy of chromosome 16].

PubMed

Li, Juan; Ding, Yu; Chang, Guoying; Cheng, Qing; Li, Xin; Wang, Jian; Wang, Xiumin; Shen, Yiping

2017-02-10

To identify the genetic cause for a 11-year-old Chinese boy with Meier-Gorlin syndrome (MGS). Chromosomal microarray analysis (CMA) was used to detect potential variations, while whole exome sequencing (WES) was used to identify sequence variants. Sanger sequencing was used to confirm the suspected variants. The boy has featured short stature, microtia, small patella, slender body build, craniofacial anomalies, and small testes with normal gonadotropin. A complete uniparental disomy of chromosome 16 was revealed by CMA. WES has identified a novel homozygous mutation c.67A>G (p.Lys23Glu) in ORC6 gene mapped to chromosome 16. As predicted by Alamut functional software, the mutation may affect the function of structural domain of the ORC6 protein. The patient is probably the first diagnosed MGS case in China, who carried a novel homozygous mutation of the ORC6 gene and uniparental disomy of chromosome 16. The effect of this novel mutation on the growth and development needs to be further investigated.

Enhanced sensitivity for detection of low-level germline mosaic RB1 mutations in sporadic retinoblastoma cases using deep semiconductor sequencing.

PubMed

Chen, Zhao; Moran, Kimberly; Richards-Yutz, Jennifer; Toorens, Erik; Gerhart, Daniel; Ganguly, Tapan; Shields, Carol L; Ganguly, Arupa

2014-03-01

Sporadic retinoblastoma (RB) is caused by de novo mutations in the RB1 gene. Often, these mutations are present as mosaic mutations that cannot be detected by Sanger sequencing. Next-generation deep sequencing allows unambiguous detection of the mosaic mutations in lymphocyte DNA. Deep sequencing of the RB1 gene on lymphocyte DNA from 20 bilateral and 70 unilateral RB cases was performed, where Sanger sequencing excluded the presence of mutations. The individual exons of the RB1 gene from each sample were amplified, pooled, ligated to barcoded adapters, and sequenced using semiconductor sequencing on an Ion Torrent Personal Genome Machine. Six low-level mosaic mutations were identified in bilateral RB and four in unilateral RB cases. The incidence of low-level mosaic mutation was estimated to be 30% and 6%, respectively, in sporadic bilateral and unilateral RB cases, previously classified as mutation negative. The frequency of point mutations detectable in lymphocyte DNA increased from 96% to 97% for bilateral RB and from 13% to 18% for unilateral RB. The use of deep sequencing technology increased the sensitivity of the detection of low-level germline mosaic mutations in the RB1 gene. This finding has significant implications for improved clinical diagnosis, genetic counseling, surveillance, and management of RB. © 2013 WILEY PERIODICALS, INC.

Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

PubMed

Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

2017-11-08

The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

PubMed

Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

2017-01-01

The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Kuwait and Dubai.

PubMed

Ahmad, Suhail; Mokaddas, Eiman; Fares, Esther

2002-11-01

Mutations conferring resistance to rifampin in rifampin-resistant clinical Mycobacterium tuberculosis isolates occur mostly in the 81 bp rifampin-resistance-determining region (RRDR) of the rpoB gene. In this study, 29 rifampin-resistant and 12 -susceptible clinical M. tuberculosis isolates were tested for characterization of mutations in the rpoB gene by line probe (INNO-LiPA Rif. TB) assay and the results were confirmed and extended by DNA sequencing of the PCR amplified target DNA. The line probe assay identified all 12 susceptible strains as rifampin-sensitive and the DNA sequence of RRDR in the amplified rpoB gene from two isolates matched perfectly with the wild-type sequence. The line probe assay identified 28 resistant isolates as rifampin-resistant with specific detection of mutation in 22 isolates including one isolate that exhibited hetro-resistance containing both the wild-type pattern as well as a specific mutation within RRDR while one of the rifampin-resistant strain was identified as rifampin-susceptible. DNA sequencing confirmed these results and, in addition, led to the specific detection of mutations in 5 rifampin-resistant isolates in which specific base changes within RRDR could not be determined by the line probe assay. These analyses identified 8 different mutations within RRDR of the rpoB gene including one novel mutation (S522W) that has not been reported so far. The genotyping performed on the isolates carrying similar mutations showed that majority of these isolates were unique as they exhibited varying DNA banding patterns. Correlating the ethnic origin of the infected TB patients with the occurrence of specific mutations at three main codon positions (516, 526 and 531) in the rpoB gene showed that most patients (11 of 15) from South Asian region contained mutations at codon 526 while majority of isolates from patients (6 of 11) of Middle Eastern origin contained mutations at codon 531.

Whole-exome sequencing identifies novel homozygous mutation in NPAS2 in family with nonobstructive azoospermia.

PubMed

Ramasamy, Ranjith; Bakırcıoğlu, M Emre; Cengiz, Cenk; Karaca, Ender; Scovell, Jason; Jhangiani, Shalini N; Akdemir, Zeynep C; Bainbridge, Matthew; Yu, Yao; Huff, Chad; Gibbs, Richard A; Lupski, James R; Lamb, Dolores J

2015-08-01

To investigate the genetic cause of nonobstructive azoospermia (NOA) in a consanguineous Turkish family through homozygosity mapping followed by targeted exon/whole-exome sequencing to identify genetic variations. Whole-exome sequencing (WES). Research laboratory. Two siblings in a consanguineous family with NOA. Validating all variants passing filter criteria with Sanger sequencing to confirm familial segregation and absence in the control population. Discovery of a mutation that could potentially cause NOA. A novel nonsynonymous mutation in the neuronal PAS-2 domain (NPAS2) was identified in a consanguineous family from Turkey. This mutation in exon 14 (chr2: 101592000 C>G) of NPAS2 is likely a disease-causing mutation as it is predicted to be damaging, it is a novel variant, and it segregates with the disease. Family segregation of the variants showed the presence of the homozygous mutation in the three brothers with NOA and a heterozygous mutation in the mother as well as one brother and one sister who were both fertile. The mutation is not found in the single-nucleotide polymorphism database, the 1000 Genomes Project, the Baylor College of Medicine cohort of 500 Turkish patients (not a population-specific polymorphism), or the matching 50 fertile controls. With the use of WES we identified a novel homozygous mutation in NPAS2 as a likely disease-causing variant in a Turkish family diagnosed with NOA. Our data reinforce the clinical role of WES in the molecular diagnosis of highly heterogeneous genetic diseases for which conventional genetic approaches have previously failed to find a molecular diagnosis. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Pitfalls in genetic testing: the story of missed SCN1A mutations.

PubMed

Djémié, Tania; Weckhuysen, Sarah; von Spiczak, Sarah; Carvill, Gemma L; Jaehn, Johanna; Anttonen, Anna-Kaisa; Brilstra, Eva; Caglayan, Hande S; de Kovel, Carolien G; Depienne, Christel; Gaily, Eija; Gennaro, Elena; Giraldez, Beatriz G; Gormley, Padhraig; Guerrero-López, Rosa; Guerrini, Renzo; Hämäläinen, Eija; Hartmann, Corinna; Hernandez-Hernandez, Laura; Hjalgrim, Helle; Koeleman, Bobby P C; Leguern, Eric; Lehesjoki, Anna-Elina; Lemke, Johannes R; Leu, Costin; Marini, Carla; McMahon, Jacinta M; Mei, Davide; Møller, Rikke S; Muhle, Hiltrud; Myers, Candace T; Nava, Caroline; Serratosa, Jose M; Sisodiya, Sanjay M; Stephani, Ulrich; Striano, Pasquale; van Kempen, Marjan J A; Verbeek, Nienke E; Usluer, Sunay; Zara, Federico; Palotie, Aarno; Mefford, Heather C; Scheffer, Ingrid E; De Jonghe, Peter; Helbig, Ingo; Suls, Arvid

2016-07-01

Sanger sequencing, still the standard technique for genetic testing in most diagnostic laboratories and until recently widely used in research, is gradually being complemented by next-generation sequencing (NGS). No single mutation detection technique is however perfect in identifying all mutations. Therefore, we wondered to what extent inconsistencies between Sanger sequencing and NGS affect the molecular diagnosis of patients. Since mutations in SCN1A, the major gene implicated in epilepsy, are found in the majority of Dravet syndrome (DS) patients, we focused on missed SCN1A mutations. We sent out a survey to 16 genetic centers performing SCN1A testing. We collected data on 28 mutations initially missed using Sanger sequencing. All patients were falsely reported as SCN1A mutation-negative, both due to technical limitations and human errors. We illustrate the pitfalls of Sanger sequencing and most importantly provide evidence that SCN1A mutations are an even more frequent cause of DS than already anticipated.

High prevalence of DUOX2 mutations in Japanese patients with permanent congenital hypothyroidism or transient hypothyroidism.

PubMed

Matsuo, Kumihiro; Tanahashi, Yusuke; Mukai, Tokuo; Suzuki, Shigeru; Tajima, Toshihiro; Azuma, Hiroshi; Fujieda, Kenji

2016-07-01

Dual oxidase 2 (DUOX2) mutations are a cause of dyshormonogenesis (DH) and have been identified in patients with permanent congenital hypothyroidism (PH) and with transient hypothyroidism (TH). We aimed to elucidate the prevalence and phenotypical variations of DUOX2 mutations. Forty-eight Japanese DH patients were enroled and analysed for sequence variants of DUOX2, DUOXA2, and TPO using polymerase chain reaction-amplified direct sequencing. Fourteen sequence variants of DUOX2, including 10 novel variants, were identified in 11 patients. DUOX2 variants were more prevalent (11/48, 22.9%) than TPO (3/48, 6.3%) (p=0.020). The prevalence of DUOX2 variants in TH was slightly, but not significantly, higher than in PH. Furthermore, one patient had digenic heterozygous sequence variants of both DUOX2 and TPO. Our results suggest that DUOX2 mutations might be the most common cause of both PH and TH, and that phenotypes of these mutations might be milder than those of other causes.

BCOR and BCORL1 mutations in myelodysplastic syndromes and related disorders.

PubMed

Damm, Frederik; Chesnais, Virginie; Nagata, Yasunobu; Yoshida, Kenichi; Scourzic, Laurianne; Okuno, Yusuke; Itzykson, Raphael; Sanada, Masashi; Shiraishi, Yuichi; Gelsi-Boyer, Véronique; Renneville, Aline; Miyano, Satoru; Mori, Hiraku; Shih, Lee-Yung; Park, Sophie; Dreyfus, François; Guerci-Bresler, Agnes; Solary, Eric; Rose, Christian; Cheze, Stéphane; Prébet, Thomas; Vey, Norbert; Legentil, Marion; Duffourd, Yannis; de Botton, Stéphane; Preudhomme, Claude; Birnbaum, Daniel; Bernard, Olivier A; Ogawa, Seishi; Fontenay, Michaela; Kosmider, Olivier

2013-10-31

Patients with low-risk myelodysplastic syndromes (MDS) that rapidly progress to acute myeloid leukemia (AML) remain a challenge in disease management. Using whole-exome sequencing of an MDS patient, we identified a somatic mutation in the BCOR gene also mutated in AML. Sequencing of BCOR and related BCORL1 genes in a cohort of 354 MDS patients identified 4.2% and 0.8% of mutations respectively. BCOR mutations were associated with RUNX1 (P = .002) and DNMT3A mutations (P = .015). BCOR is also mutated in chronic myelomonocytic leukemia patients (7.4%) and BCORL1 in AML patients with myelodysplasia-related changes (9.1%). Using deep sequencing, we show that BCOR mutations arise after mutations affecting genes involved in splicing machinery or epigenetic regulation. In univariate analysis, BCOR mutations were associated with poor prognosis in MDS (overall survival [OS]: P = .013; cumulative incidence of AML transformation: P = .005). Multivariate analysis including age, International Prognostic Scoring System, transfusion dependency, and mutational status confirmed a significant inferior OS to patients with a BCOR mutation (hazard ratio, 3.3; 95% confidence interval, 1.4-8.1; P = .008). These data suggest that BCOR mutations define the clinical course rather than disease initiation. Despite infrequent mutations, BCOR analyses should be considered in risk stratification.

Massively Parallel DNA Sequencing Facilitates Diagnosis of Patients with Usher Syndrome Type 1

PubMed Central

Yoshimura, Hidekane; Iwasaki, Satoshi; Nishio, Shin-ya; Kumakawa, Kozo; Tono, Tetsuya; Kobayashi, Yumiko; Sato, Hiroaki; Nagai, Kyoko; Ishikawa, Kotaro; Ikezono, Tetsuo; Naito, Yasushi; Fukushima, Kunihiro; Oshikawa, Chie; Kimitsuki, Takashi; Nakanishi, Hiroshi; Usami, Shin-ichi

2014-01-01

Usher syndrome is an autosomal recessive disorder manifesting hearing loss, retinitis pigmentosa and vestibular dysfunction, and having three clinical subtypes. Usher syndrome type 1 is the most severe subtype due to its profound hearing loss, lack of vestibular responses, and retinitis pigmentosa that appears in prepuberty. Six of the corresponding genes have been identified, making early diagnosis through DNA testing possible, with many immediate and several long-term advantages for patients and their families. However, the conventional genetic techniques, such as direct sequence analysis, are both time-consuming and expensive. Targeted exon sequencing of selected genes using the massively parallel DNA sequencing technology will potentially enable us to systematically tackle previously intractable monogenic disorders and improve molecular diagnosis. Using this technique combined with direct sequence analysis, we screened 17 unrelated Usher syndrome type 1 patients and detected probable pathogenic variants in the 16 of them (94.1%) who carried at least one mutation. Seven patients had the MYO7A mutation (41.2%), which is the most common type in Japanese. Most of the mutations were detected by only the massively parallel DNA sequencing. We report here four patients, who had probable pathogenic mutations in two different Usher syndrome type 1 genes, and one case of MYO7A/PCDH15 digenic inheritance. This is the first report of Usher syndrome mutation analysis using massively parallel DNA sequencing and the frequency of Usher syndrome type 1 genes in Japanese. Mutation screening using this technique has the power to quickly identify mutations of many causative genes while maintaining cost-benefit performance. In addition, the simultaneous mutation analysis of large numbers of genes is useful for detecting mutations in different genes that are possibly disease modifiers or of digenic inheritance. PMID:24618850

Massively parallel DNA sequencing facilitates diagnosis of patients with Usher syndrome type 1.

PubMed

Yoshimura, Hidekane; Iwasaki, Satoshi; Nishio, Shin-Ya; Kumakawa, Kozo; Tono, Tetsuya; Kobayashi, Yumiko; Sato, Hiroaki; Nagai, Kyoko; Ishikawa, Kotaro; Ikezono, Tetsuo; Naito, Yasushi; Fukushima, Kunihiro; Oshikawa, Chie; Kimitsuki, Takashi; Nakanishi, Hiroshi; Usami, Shin-Ichi

2014-01-01

Usher syndrome is an autosomal recessive disorder manifesting hearing loss, retinitis pigmentosa and vestibular dysfunction, and having three clinical subtypes. Usher syndrome type 1 is the most severe subtype due to its profound hearing loss, lack of vestibular responses, and retinitis pigmentosa that appears in prepuberty. Six of the corresponding genes have been identified, making early diagnosis through DNA testing possible, with many immediate and several long-term advantages for patients and their families. However, the conventional genetic techniques, such as direct sequence analysis, are both time-consuming and expensive. Targeted exon sequencing of selected genes using the massively parallel DNA sequencing technology will potentially enable us to systematically tackle previously intractable monogenic disorders and improve molecular diagnosis. Using this technique combined with direct sequence analysis, we screened 17 unrelated Usher syndrome type 1 patients and detected probable pathogenic variants in the 16 of them (94.1%) who carried at least one mutation. Seven patients had the MYO7A mutation (41.2%), which is the most common type in Japanese. Most of the mutations were detected by only the massively parallel DNA sequencing. We report here four patients, who had probable pathogenic mutations in two different Usher syndrome type 1 genes, and one case of MYO7A/PCDH15 digenic inheritance. This is the first report of Usher syndrome mutation analysis using massively parallel DNA sequencing and the frequency of Usher syndrome type 1 genes in Japanese. Mutation screening using this technique has the power to quickly identify mutations of many causative genes while maintaining cost-benefit performance. In addition, the simultaneous mutation analysis of large numbers of genes is useful for detecting mutations in different genes that are possibly disease modifiers or of digenic inheritance.

Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

PubMed

Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

2017-11-01

Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

PubMed Central

Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

2017-01-01

Purpose: Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND. PMID:29133643

Assessment of clinical analytical sensitivity and specificity of next-generation sequencing for detection of simple and complex mutations.

PubMed

Chin, Ephrem L H; da Silva, Cristina; Hegde, Madhuri

2013-02-19

Detecting mutations in disease genes by full gene sequence analysis is common in clinical diagnostic laboratories. Sanger dideoxy terminator sequencing allows for rapid development and implementation of sequencing assays in the clinical laboratory, but it has limited throughput, and due to cost constraints, only allows analysis of one or at most a few genes in a patient. Next-generation sequencing (NGS), on the other hand, has evolved rapidly, although to date it has mainly been used for large-scale genome sequencing projects and is beginning to be used in the clinical diagnostic testing. One advantage of NGS is that many genes can be analyzed easily at the same time, allowing for mutation detection when there are many possible causative genes for a specific phenotype. In addition, regions of a gene typically not tested for mutations, like deep intronic and promoter mutations, can also be detected. Here we use 20 previously characterized Sanger-sequenced positive controls in disease-causing genes to demonstrate the utility of NGS in a clinical setting using standard PCR based amplification to assess the analytical sensitivity and specificity of the technology for detecting all previously characterized changes (mutations and benign SNPs). The positive controls chosen for validation range from simple substitution mutations to complex deletion and insertion mutations occurring in autosomal dominant and recessive disorders. The NGS data was 100% concordant with the Sanger sequencing data identifying all 119 previously identified changes in the 20 samples. We have demonstrated that NGS technology is ready to be deployed in clinical laboratories. However, NGS and associated technologies are evolving, and clinical laboratories will need to invest significantly in staff and infrastructure to build the necessary foundation for success.

Single-Exome sequencing identified a novel RP2 mutation in a child with X-linked retinitis pigmentosa.

PubMed

Lim, Hassol; Park, Young-Mi; Lee, Jong-Keuk; Taek Lim, Hyun

2016-10-01

To present an efficient and successful application of a single-exome sequencing study in a family clinically diagnosed with X-linked retinitis pigmentosa. Exome sequencing study based on clinical examination data. An 8-year-old proband and his family. The proband and his family members underwent comprehensive ophthalmologic examinations. Exome sequencing was undertaken in the proband using Agilent SureSelect Human All Exon Kit and Illumina HiSeq 2000 platform. Bioinformatic analysis used Illumina pipeline with Burrows-Wheeler Aligner-Genome Analysis Toolkit (BWA-GATK), followed by ANNOVAR to perform variant functional annotation. All variants passing filter criteria were validated by Sanger sequencing to confirm familial segregation. Analysis of exome sequence data identified a novel frameshift mutation in RP2 gene resulting in a premature stop codon (c.665delC, p.Pro222fsTer237). Sanger sequencing revealed this mutation co-segregated with the disease phenotype in the child's family. We identified a novel causative mutation in RP2 from a single proband's exome sequence data analysis. This study highlights the effectiveness of the whole-exome sequencing in the genetic diagnosis of X-linked retinitis pigmentosa, over the conventional sequencing methods. Even using a single exome, exome sequencing technology would be able to pinpoint pathogenic variant(s) for X-linked retinitis pigmentosa, when properly applied with aid of adequate variant filtering strategy. Copyright © 2016 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.

Novel mutations in CRB1 gene identified in a chinese pedigree with retinitis pigmentosa by targeted capture and next generation sequencing

PubMed Central

Lo, David; Weng, Jingning; Liu, xiaohong; Yang, Juhua; He, Fen; Wang, Yun; Liu, Xuyang

2016-01-01

PURPOSE To detect the disease-causing gene in a Chinese pedigree with autosomal-recessive retinitis pigmentosa (ARRP). METHODS All subjects in this family underwent a complete ophthalmic examination. Targeted-capture next generation sequencing (NGS) was performed on the proband to detect variants. All variants were verified in the remaining family members by PCR amplification and Sanger sequencing. RESULTS All the affected subjects in this pedigree were diagnosed with retinitis pigmentosa (RP). The compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations in the Crumbs homolog 1 (CRB1) gene were identified in all the affected patients but not in the unaffected individuals in this family. These mutations were inherited from their parents, respectively. CONCLUSION The novel compound heterozygous mutations in CRB1 were identified in a Chinese pedigree with ARRP using targeted-capture next generation sequencing. After evaluating the significant heredity and impaired protein function, the compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations are the causal genes of early onset ARRP in this pedigree. To the best of our knowledge, there is no previous report regarding the compound mutations. PMID:27806333

Whole-exome sequencing for mutation detection in pediatric disorders of insulin secretion: Maturity onset diabetes of the young and congenital hyperinsulinism.

PubMed

Johnson, S R; Leo, P J; McInerney-Leo, A M; Anderson, L K; Marshall, M; McGown, I; Newell, F; Brown, M A; Conwell, L S; Harris, M; Duncan, E L

2018-06-01

To assess the utility of whole-exome sequencing (WES) for mutation detection in maturity-onset diabetes of the young (MODY) and congenital hyperinsulinism (CHI). MODY and CHI are the two commonest monogenic disorders of glucose-regulated insulin secretion in childhood, with 13 causative genes known for MODY and 10 causative genes identified for CHI. The large number of potential genes makes comprehensive screening using traditional methods expensive and time-consuming. Ten subjects with MODY and five with CHI with known mutations underwent WES using two different exome capture kits (Nimblegen SeqCap EZ Human v3.0 Exome Enrichment Kit, Nextera Rapid Capture Exome Kit). Analysis was blinded to previously identified mutations, and included assessment for large deletions. The target capture of five exome capture technologies was also analyzed using sequencing data from >2800 unrelated samples. Four of five MODY mutations were identified using Nimblegen (including a large deletion in HNF1B). Although targeted, one mutation (in INS) had insufficient coverage for detection. Eleven of eleven mutations (six MODY, five CHI) were identified using Nextera Rapid (including the previously missed mutation). On reconciliation, all mutations concorded with previous data and no additional variants in MODY genes were detected. There were marked differences in the performance of the capture technologies. WES can be useful for screening for MODY/CHI mutations, detecting both point mutations and large deletions. However, capture technologies require careful selection. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Whole-genome sequencing identifies recurrent mutations in chronic lymphocytic leukaemia

PubMed Central

Puente, Xose S.; Pinyol, Magda; Quesada, Víctor; Conde, Laura; Ordóñez, Gonzalo R.; Villamor, Neus; Escaramis, Georgia; Jares, Pedro; Beà, Sílvia; González-Díaz, Marcos; Bassaganyas, Laia; Baumann, Tycho; Juan, Manel; López-Guerra, Mónica; Colomer, Dolors; Tubío, José M. C.; López, Cristina; Navarro, Alba; Tornador, Cristian; Aymerich, Marta; Rozman, María; Hernández, Jesús M.; Puente, Diana A.; Freije, José M. P.; Velasco, Gloria; Gutiérrez-Fernández, Ana; Costa, Dolors; Carrió, Anna; Guijarro, Sara; Enjuanes, Anna; Hernández, Lluís; Yagüe, Jordi; Nicolás, Pilar; Romeo-Casabona, Carlos M.; Himmelbauer, Heinz; Castillo, Ester; Dohm, Juliane C.; de Sanjosé, Silvia; Piris, Miguel A.; de Alava, Enrique; Miguel, Jesús San; Royo, Romina; Gelpí, Josep L.; Torrents, David; Orozco, Modesto; Pisano, David G.; Valencia, Alfonso; Guigó, Roderic; Bayés, Mónica; Heath, Simon; Gut, Marta; Klatt, Peter; Marshall, John; Raine, Keiran; Stebbings, Lucy A.; Futreal, P. Andrew; Stratton, Michael R.; Campbell, Peter J.; Gut, Ivo; López-Guillermo, Armando; Estivill, Xavier; Montserrat, Emili; López-Otín, Carlos; Campo, Elías

2012-01-01

Chronic lymphocytic leukaemia (CLL), the most frequent leukaemia in adults in Western countries, is a heterogeneous disease with variable clinical presentation and evolution1,2. Two major molecular subtypes can be distinguished, characterized respectively by a high or low number of somatic hypermutations in the variable region of immunoglobulin genes3,4. The molecular changes leading to the pathogenesis of the disease are still poorly understood. Here we performed whole-genome sequencing of four cases of CLL and identified 46 somatic mutations that potentially affect gene function. Further analysis of these mutations in 363 patients with CLL identified four genes that are recurrently mutated: notch 1 (NOTCH1), exportin 1 (XPO1), myeloid differentiation primary response gene 88 (MYD88) and kelch-like 6 (KLHL6). Mutations in MYD88 and KLHL6 are predominant in cases of CLL with mutated immunoglobulin genes, whereas NOTCH1 and XPO1 mutations are mainly detected in patients with unmutated immunoglobulins. The patterns of somatic mutation, supported by functional and clinical analyses, strongly indicate that the recurrent NOTCH1, MYD88 and XPO1 mutations are oncogenic changes that contribute to the clinical evolution of the disease. To our knowledge, this is the first comprehensive analysis of CLL combining whole-genome sequencing with clinical characteristics and clinical outcomes. It highlights the usefulness of this approach for the identification of clinically relevant mutations in cancer. PMID:21642962

Molecular analysis of Fanconi anemia: the experience of the Bone Marrow Failure Study Group of the Italian Association of Pediatric Onco-Hematology

PubMed Central

De Rocco, Daniela; Bottega, Roberta; Cappelli, Enrico; Cavani, Simona; Criscuolo, Maria; Nicchia, Elena; Corsolini, Fabio; Greco, Chiara; Borriello, Adriana; Svahn, Johanna; Pillon, Marta; Mecucci, Cristina; Casazza, Gabriella; Verzegnassi, Federico; Cugno, Chiara; Locasciulli, Anna; Farruggia, Piero; Longoni, Daniela; Ramenghi, Ugo; Barberi, Walter; Tucci, Fabio; Perrotta, Silverio; Grammatico, Paola; Hanenberg, Helmut; Della Ragione, Fulvio; Dufour, Carlo; Savoia, Anna

2014-01-01

Fanconi anemia is an inherited disease characterized by congenital malformations, pancytopenia, cancer predisposition, and sensitivity to cross-linking agents. The molecular diagnosis of Fanconi anemia is relatively complex for several aspects including genetic heterogeneity with mutations in at least 16 different genes. In this paper, we report the mutations identified in 100 unrelated probands enrolled into the National Network of the Italian Association of Pediatric Hematoly and Oncology. In approximately half of these cases, mutational screening was carried out after retroviral complementation analyses or protein analysis. In the other half, the analysis was performed on the most frequently mutated genes or using a next generation sequencing approach. We identified 108 distinct variants of the FANCA, FANCG, FANCC, FANCD2, and FANCB genes in 85, 9, 3, 2, and 1 families, respectively. Despite the relatively high number of private mutations, 45 of which are novel Fanconi anemia alleles, 26% of the FANCA alleles are due to 5 distinct mutations. Most of the mutations are large genomic deletions and nonsense or frameshift mutations, although we identified a series of missense mutations, whose pathogenetic role was not always certain. The molecular diagnosis of Fanconi anemia is still a tiered procedure that requires identifying candidate genes to avoid useless sequencing. Introduction of next generation sequencing strategies will greatly improve the diagnostic process, allowing a rapid analysis of all the genes. PMID:24584348

Identification of coding and non-coding mutational hotspots in cancer genomes.

PubMed

Piraino, Scott W; Furney, Simon J

2017-01-05

The identification of mutations that play a causal role in tumour development, so called "driver" mutations, is of critical importance for understanding how cancers form and how they might be treated. Several large cancer sequencing projects have identified genes that are recurrently mutated in cancer patients, suggesting a role in tumourigenesis. While the landscape of coding drivers has been extensively studied and many of the most prominent driver genes are well characterised, comparatively less is known about the role of mutations in the non-coding regions of the genome in cancer development. The continuing fall in genome sequencing costs has resulted in a concomitant increase in the number of cancer whole genome sequences being produced, facilitating systematic interrogation of both the coding and non-coding regions of cancer genomes. To examine the mutational landscapes of tumour genomes we have developed a novel method to identify mutational hotspots in tumour genomes using both mutational data and information on evolutionary conservation. We have applied our methodology to over 1300 whole cancer genomes and show that it identifies prominent coding and non-coding regions that are known or highly suspected to play a role in cancer. Importantly, we applied our method to the entire genome, rather than relying on predefined annotations (e.g. promoter regions) and we highlight recurrently mutated regions that may have resulted from increased exposure to mutational processes rather than selection, some of which have been identified previously as targets of selection. Finally, we implicate several pan-cancer and cancer-specific candidate non-coding regions, which could be involved in tumourigenesis. We have developed a framework to identify mutational hotspots in cancer genomes, which is applicable to the entire genome. This framework identifies known and novel coding and non-coding mutional hotspots and can be used to differentiate candidate driver regions from likely passenger regions susceptible to somatic mutation.

Exome-wide Sequencing Shows Low Mutation Rates and Identifies Novel Mutated Genes in Seminomas.

PubMed

Cutcutache, Ioana; Suzuki, Yuka; Tan, Iain Beehuat; Ramgopal, Subhashini; Zhang, Shenli; Ramnarayanan, Kalpana; Gan, Anna; Lee, Heng Hong; Tay, Su Ting; Ooi, Aikseng; Ong, Choon Kiat; Bolthouse, Jonathan T; Lane, Brian R; Anema, John G; Kahnoski, Richard J; Tan, Patrick; Teh, Bin Tean; Rozen, Steven G

2015-07-01

Testicular germ cell tumors are the most common cancer diagnosed in young men, and seminomas are the most common type of these cancers. There have been no exome-wide examinations of genes mutated in seminomas or of overall rates of nonsilent somatic mutations in these tumors. The objective was to analyze somatic mutations in seminomas to determine which genes are affected and to determine rates of nonsilent mutations. Eight seminomas and matched normal samples were surgically obtained from eight patients. DNA was extracted from tissue samples and exome sequenced on massively parallel Illumina DNA sequencers. Single-nucleotide polymorphism chip-based copy number analysis was also performed to assess copy number alterations. The DNA sequencing read data were analyzed to detect somatic mutations including single-nucleotide substitutions and short insertions and deletions. The detected mutations were validated by independent sequencing and further checked for subclonality. The rate of nonsynonymous somatic mutations averaged 0.31 mutations/Mb. We detected nonsilent somatic mutations in 96 genes that were not previously known to be mutated in seminomas, of which some may be driver mutations. Many of the mutations appear to have been present in subclonal populations. In addition, two genes, KIT and KRAS, were affected in two tumors each with mutations that were previously observed in other cancers and are presumably oncogenic. Our study, the first report on exome sequencing of seminomas, detected somatic mutations in 96 new genes, several of which may be targetable drivers. Furthermore, our results show that seminoma mutation rates are five times higher than previously thought, but are nevertheless low compared to other common cancers. Similar low rates are seen in other cancers that also have excellent rates of remission achieved with chemotherapy. We examined the DNA sequences of seminomas, the most common type of testicular germ cell cancer. Our study identified 96 new genes in which mutations occurred during seminoma development, some of which might contribute to cancer development or progression. The study also showed that the rates of DNA mutations during seminoma development are higher than previously thought, but still lower than for other common solid-organ cancers. Such low rates are also observed among other cancers that, like seminomas, show excellent rates of disease remission after chemotherapy. Copyright © 2015 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Germline loss-of-function mutations in LZTR1 predispose to an inherited disorder of multiple schwannomas

PubMed Central

Piotrowski, Arkadiusz; Xie, Jing; Liu, Ying F; Poplawski, Andrzej B; Gomes, Alicia R; Madanecki, Piotr; Fu, Chuanhua; Crowley, Michael R; Crossman, David K; Armstrong, Linlea; Babovic-Vuksanovic, Dusica; Bergner, Amanda; Blakeley, Jaishri O; Blumenthal, Andrea L; Daniels, Molly S; Feit, Howard; Gardner, Kathy; Hurst, Stephanie; Kobelka, Christine; Lee, Chung; Nagy, Rebecca; Rauen, Katherine A; Slopis, John M; Suwannarat, Pim; Westman, Judith A; Zanko, Andrea; Korf, Bruce R; Messiaen, Ludwine M

2015-01-01

Constitutional SMARCB1 mutations at 22q11.23 have been found in ~50% of familial and <10% of sporadic schwannomatosis cases1. We sequenced highly conserved regions along 22q from eight individuals with schwannomatosis whose schwannomas involved somatic loss of one copy of 22q, encompassing SMARCB1 and NF2, with a different somatic mutation of the other NF2 allele in every schwannoma but no mutation of the remaining SMARCB1 allele in blood and tumor samples. LZTR1 germline mutations were identified in seven of the eight cases. LZTR1 sequencing in 12 further cases with the same molecular signature identified 9 additional germline mutations. Loss of heterozygosity with retention of an LZTR1 mutation was present in all 25 schwannomas studied. Mutations segregated with disease in all available affected first-degree relatives, although four asymptomatic parents also carried an LZTR1 mutation. Our findings identify LZTR1 as a gene predisposing to an autosomal dominant inherited disorder of multiple schwannomas in ~80% of 22q-related schwannomatosis cases lacking mutation in SMARCB1. PMID:24362817

Comparative oncology DNA sequencing of canine T cell lymphoma via human hotspot panel

PubMed Central

Beheshti, Afshin; Pilichowska, Monika; Burgess, Kristine; Ricks-Santi, Luisel; McNiel, Elizabeth; London, Cheryl B.; Ravi, Dashnamoorthy; Evens, Andrew M.

2018-01-01

T-cell lymphoma (TCL) is an uncommon and aggressive form of human cancer. Lymphoma is the most common hematopoietic tumor in canines (companion animals), with TCL representing approximately 30% of diagnoses. Collectively, the canine is an appealing model for cancer research given the spontaneous occurrence of cancer, intact immune system, and phytogenetic proximity to humans. We sought to establish mutational congruence of the canine with known human TCL mutations in order to identify potential actionable oncogenic pathways. Following pathologic confirmation, DNA was sequenced in 16 canine TCL (cTCL) cases using a custom Human Cancer Hotspot Panel of 68 genes commonly mutated in human TCL. Sequencing identified 4,527,638 total reads with average length of 229 bases containing 346 unique variants and 1,474 total variants; each sample had an average of 92 variants. Among these, there were 258 germline and 32 somatic variants. Among the 32 somatic variants there were 8 missense variants, 1 splice junction variant and the remaining were intron or synonymous variants. A frequency of 4 somatic mutations per sample were noted with >7 mutations detected in MET, KDR, STK11 and BRAF. Expression of these associated proteins were also detected via Western blot analyses. In addition, Sanger sequencing confirmed three variants of high quality (MYC, MET, and TP53 missense mutation). Taken together, the mutational spectrum and protein analyses showed mutations in signaling pathways similar to human TCL and also identified novel mutations that may serve as drug targets as well as potential biomarkers. PMID:29854308

SIGMAR1 mutation associated with autosomal recessive Silver-like syndrome

PubMed Central

Horga, Alejandro; Tomaselli, Pedro J.; Gonzalez, Michael A.; Laurà, Matilde; Muntoni, Francesco; Manzur, Adnan Y.; Hanna, Michael G.; Blake, Julian C.; Houlden, Henry; Züchner, Stephan

2016-01-01

Objective: To describe the genetic and clinical features of a simplex patient with distal hereditary motor neuropathy (dHMN) and lower limb spasticity (Silver-like syndrome) due to a mutation in the sigma nonopioid intracellular receptor–1 gene (SIGMAR1) and review the phenotypic spectrum of mutations in this gene. Methods: We used whole-exome sequencing to investigate the proband. The variants of interest were investigated for segregation in the family using Sanger sequencing. Subsequently, a larger cohort of 16 unrelated dHMN patients was specifically screened for SIGMAR1 mutations. Results: In the proband, we identified a homozygous missense variant (c.194T>A, p.Leu65Gln) in exon 2 of SIGMAR1 as the probable causative mutation. Pathogenicity is supported by evolutionary conservation, in silico analyses, and the strong phenotypic similarities with previously reported cases carrying coding sequence mutations in SIGMAR1. No other mutations were identified in 16 additional patients with dHMN. Conclusions: We suggest that coding sequence mutations in SIGMAR1 present clinically with a combination of dHMN and pyramidal tract signs, with or without spasticity, in the lower limbs. Preferential involvement of extensor muscles of the upper limbs may be a distinctive feature of the disease. These observations should be confirmed in future studies. PMID:27629094

SIGMAR1 mutation associated with autosomal recessive Silver-like syndrome.

PubMed

Horga, Alejandro; Tomaselli, Pedro J; Gonzalez, Michael A; Laurà, Matilde; Muntoni, Francesco; Manzur, Adnan Y; Hanna, Michael G; Blake, Julian C; Houlden, Henry; Züchner, Stephan; Reilly, Mary M

2016-10-11

To describe the genetic and clinical features of a simplex patient with distal hereditary motor neuropathy (dHMN) and lower limb spasticity (Silver-like syndrome) due to a mutation in the sigma nonopioid intracellular receptor-1 gene (SIGMAR1) and review the phenotypic spectrum of mutations in this gene. We used whole-exome sequencing to investigate the proband. The variants of interest were investigated for segregation in the family using Sanger sequencing. Subsequently, a larger cohort of 16 unrelated dHMN patients was specifically screened for SIGMAR1 mutations. In the proband, we identified a homozygous missense variant (c.194T>A, p.Leu65Gln) in exon 2 of SIGMAR1 as the probable causative mutation. Pathogenicity is supported by evolutionary conservation, in silico analyses, and the strong phenotypic similarities with previously reported cases carrying coding sequence mutations in SIGMAR1. No other mutations were identified in 16 additional patients with dHMN. We suggest that coding sequence mutations in SIGMAR1 present clinically with a combination of dHMN and pyramidal tract signs, with or without spasticity, in the lower limbs. Preferential involvement of extensor muscles of the upper limbs may be a distinctive feature of the disease. These observations should be confirmed in future studies. © 2016 American Academy of Neurology.

Novel genomic findings in multiple myeloma identified through routine diagnostic sequencing.

PubMed

Ryland, Georgina L; Jones, Kate; Chin, Melody; Markham, John; Aydogan, Elle; Kankanige, Yamuna; Caruso, Marisa; Guinto, Jerick; Dickinson, Michael; Prince, H Miles; Yong, Kwee; Blombery, Piers

2018-05-14

Multiple myeloma is a genomically complex haematological malignancy with many genomic alterations recognised as important in diagnosis, prognosis and therapeutic decision making. Here, we provide a summary of genomic findings identified through routine diagnostic next-generation sequencing at our centre. A cohort of 86 patients with multiple myeloma underwent diagnostic sequencing using a custom hybridisation-based panel targeting 104 genes. Sequence variants, genome-wide copy number changes and structural rearrangements were detected using an inhouse-developed bioinformatics pipeline. At least one mutation was found in 69 (80%) patients. Frequently mutated genes included TP53 (36%), KRAS (22.1%), NRAS (15.1%), FAM46C/DIS3 (8.1%) and TET2/FGFR3 (5.8%), including multiple mutations not previously described in myeloma. Importantly we observed TP53 mutations in the absence of a 17 p deletion in 8% of the cohort, highlighting the need for sequencing-based assessment in addition to cytogenetics to identify these high-risk patients. Multiple novel copy number changes and immunoglobulin heavy chain translocations are also discussed. Our results demonstrate that many clinically relevant genomic findings remain in multiple myeloma which have not yet been identified through large-scale sequencing efforts, and provide important mechanistic insights into plasma cell pathobiology. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

A novel dysfunctional germline P53 mutation identified in a family with Li-Fraumeni syndrome.

PubMed

Ji, Min; Wang, Lin; Shao, Yuguo; Cao, Wei; Xu, Ting; Chen, Shujie; Wang, Zhiwei; He, Qi; Yang, Kuo

2018-01-01

Li-Fraumeni Syndrome (LFS), which is a rare dominantly inherited cancer predisposition syndrome, is associated with germline P53 mutations. Mutations of the tumor suppressor protein P53 are associated with more than 50% of human cancers; however, almost 30% of P53 mutations occur rarely and this has raised questions about their significance. It therefore appeared of particular interest that we identified a novel mutation in a patient suffering from breast cancer and fulfilling the diagnostic criteria of LFS. In this study, a patient with remarkable family history developed breast cancer and was diagnosed with LFS. By performing next-generation sequencing on the patient and subsequent verification by Sanger sequencing among other family members, a new germ-line P53 replication error, a trinucleotide repeat mutation in the coding region, was identified in two generations of this Li-Fraumeni family.

[Mutation analysis of beta myosin heavy chain gene in hypertrophic cardiomyopathy families].

PubMed

Fan, Xin-ping; Yang, Zhong-wei; Feng, Xiu-li; Yang, Fu-hui; Xiao, Bai; Liang, Yan

2011-08-01

To detect the gene mutations of beta-myosin heavy chain gene (MYH7) in Chinese pedigrees with hypertrophic cardiomyopathy (HCM), and to analyze the correlation between the genotype and phenotype. Exons 3, 5, 7-9, 11-16 and 18-23 of the MYH7 gene were amplified with PCR in three Chinese pedigrees with HCM. The products were sequenced. Sequence alignment between the detected and the standard sequences was performed. A missense mutation of Thr441Met in exon 14 was identified in a pedigree, which was not detected in the controls. Several synonymous mutations of MYH7 gene were detected in the three pedigrees. The mutation of Thr441Met, located in the actin binding domain of the globular head, was first identified in Chinese. It probably caused HCM. HCM is a heterogeneous disease. Many factors are involved in the process of its occurrence and development.

Identification of rare paired box 3 variant in strabismus by whole exome sequencing

PubMed Central

Gong, Hui-Min; Wang, Jing; Xu, Jing; Zhou, Zhan-Yu; Li, Jing-Wen; Chen, Shu-Fang

2017-01-01

AIM To identify the potentially pathogenic gene variants that contributes to the etiology of strabismus. METHODS A Chinese pedigree with strabismus was collected and the exomes of two affected individuals were sequenced using the next-generation sequencing technology. The resulting variants from exome sequencing were filtered by subsequent bioinformatics methods and the candidate mutation was verified as heterozygous in the affected proposita and her mother by sanger sequencing. RESULTS Whole exome sequencing and filtering identified a nonsynonymous mutation c.434G-T transition in paired box 3 (PAX3) in the two affected individuals, which were predicted to be deleterious by more than 4 bioinformatics programs. This altered amino acid residue was located in the conserved PAX domain of PAX3. This gene encodes a member of the PAX family of transcription factors, which play critical roles during fetal development. Mutations in PAX3 were associated with Waardenburg syndrome with strabismus. CONCLUSION Our results report that the c.434G-T mutation (p.R145L) in PAX3 may contribute to strabismus, expanding our understanding of the causally relevant genes for this disorder. PMID:28861346

Identification of rare paired box 3 variant in strabismus by whole exome sequencing.

PubMed

Gong, Hui-Min; Wang, Jing; Xu, Jing; Zhou, Zhan-Yu; Li, Jing-Wen; Chen, Shu-Fang

2017-01-01

To identify the potentially pathogenic gene variants that contributes to the etiology of strabismus. A Chinese pedigree with strabismus was collected and the exomes of two affected individuals were sequenced using the next-generation sequencing technology. The resulting variants from exome sequencing were filtered by subsequent bioinformatics methods and the candidate mutation was verified as heterozygous in the affected proposita and her mother by sanger sequencing. Whole exome sequencing and filtering identified a nonsynonymous mutation c.434G-T transition in paired box 3 (PAX3) in the two affected individuals, which were predicted to be deleterious by more than 4 bioinformatics programs. This altered amino acid residue was located in the conserved PAX domain of PAX3. This gene encodes a member of the PAX family of transcription factors, which play critical roles during fetal development. Mutations in PAX3 were associated with Waardenburg syndrome with strabismus. Our results report that the c.434G-T mutation (p.R145L) in PAX3 may contribute to strabismus, expanding our understanding of the causally relevant genes for this disorder.

Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1.

PubMed

Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui; Liu, Mugen

2013-01-01

To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A.

Targeted next-generation sequencing helps to decipher the genetic and phenotypic heterogeneity of hypertrophic cardiomyopathy

PubMed Central

Cecconi, Massimiliano; Parodi, Maria I.; Formisano, Francesco; Spirito, Paolo; Autore, Camillo; Musumeci, Maria B.; Favale, Stefano; Forleo, Cinzia; Rapezzi, Claudio; Biagini, Elena; Davì, Sabrina; Canepa, Elisabetta; Pennese, Loredana; Castagnetta, Mauro; Degiorgio, Dario; Coviello, Domenico A.

2016-01-01

Hypertrophic cardiomyopathy (HCM) is mainly associated with myosin, heavy chain 7 (MYH7) and myosin binding protein C, cardiac (MYBPC3) mutations. In order to better explain the clinical and genetic heterogeneity in HCM patients, in this study, we implemented a target-next generation sequencing (NGS) assay. An Ion AmpliSeq™ Custom Panel for the enrichment of 19 genes, of which 9 of these did not encode thick/intermediate and thin myofilament (TTm) proteins and, among them, 3 responsible of HCM phenocopy, was created. Ninety-two DNA samples were analyzed by the Ion Personal Genome Machine: 73 DNA samples (training set), previously genotyped in some of the genes by Sanger sequencing, were used to optimize the NGS strategy, whereas 19 DNA samples (discovery set) allowed the evaluation of NGS performance. In the training set, we identified 72 out of 73 expected mutations and 15 additional mutations: the molecular diagnosis was achieved in one patient with a previously wild-type status and the pre-excitation syndrome was explained in another. In the discovery set, we identified 20 mutations, 5 of which were in genes encoding non-TTm proteins, increasing the diagnostic yield by approximately 20%: a single mutation in genes encoding non-TTm proteins was identified in 2 out of 3 borderline HCM patients, whereas co-occuring mutations in genes encoding TTm and galactosidase alpha (GLA) altered proteins were characterized in a male with HCM and multiorgan dysfunction. Our combined targeted NGS-Sanger sequencing-based strategy allowed the molecular diagnosis of HCM with greater efficiency than using the conventional (Sanger) sequencing alone. Mutant alleles encoding non-TTm proteins may aid in the complete understanding of the genetic and phenotypic heterogeneity of HCM: co-occuring mutations of genes encoding TTm and non-TTm proteins could explain the wide variability of the HCM phenotype, whereas mutations in genes encoding only the non-TTm proteins are identifiable in patients with a milder HCM status. PMID:27600940

Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6.

PubMed

Evans, Ben A; Smith, Olivia L; Pickerill, Ethan S; York, Mary K; Buenconsejo, Kristen J P; Chambers, Antonio E; Bernstein, Douglas A

2018-01-01

Introduction of point mutations to a gene of interest is a powerful tool when determining protein function. CRISPR-mediated genome editing allows for more efficient transfer of a desired mutation into a wide range of model organisms. Traditionally, PCR amplification and DNA sequencing is used to determine if isolates contain the intended mutation. However, mutation efficiency is highly variable, potentially making sequencing costly and time consuming. To more efficiently screen for correct transformants, we have identified restriction enzymes sites that encode for two identical amino acids or one or two stop codons. We used CRISPR to introduce these restriction sites directly upstream of the Candida albicans UME6 Zn 2+ -binding domain, a known regulator of C. albicans filamentation. While repair templates coding for different restriction sites were not equally successful at introducing mutations, restriction digest screening enabled us to rapidly identify isolates with the intended mutation in a cost-efficient manner. In addition, mutated isolates have clear defects in filamentation and virulence compared to wild type C. albicans . Our data suggest restriction digestion screening efficiently identifies point mutations introduced by CRISPR and streamlines the process of identifying residues important for a phenotype of interest.

Deep intronic GPR143 mutation in a Japanese family with ocular albinism

PubMed Central

Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

2015-01-01

Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease. PMID:26061757

Deep intronic GPR143 mutation in a Japanese family with ocular albinism.

PubMed

Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

2015-06-10

Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease.

A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

PubMed Central

Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

2017-01-01

Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene (ERCC6), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family. PMID:28848724

A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

PubMed

Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

2017-01-01

Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

Targeted next generation sequencing of mucosal melanomas identifies frequent NF1 and RAS mutations.

PubMed

Cosgarea, Ioana; Ugurel, Selma; Sucker, Antje; Livingstone, Elisabeth; Zimmer, Lisa; Ziemer, Mirjana; Utikal, Jochen; Mohr, Peter; Pfeiffer, Christiane; Pföhler, Claudia; Hillen, Uwe; Horn, Susanne; Schadendorf, Dirk; Griewank, Klaus G; Roesch, Alexander

2017-06-20

Mucosal melanoma represents ~1% of all melanomas, frequently having a poor prognosis due to diagnosis at a late stage of disease. Mucosal melanoma differs from cutaneous melanoma not only in terms of poorer clinical outcome but also on the molecular level having e.g. less BRAF and more frequent KIT mutations than cutaneous melanomas. For the majority of mucosal melanomas oncogenic driver mutations remain unknown. In our study, 75 tumor tissues from patients diagnosed with mucosal melanoma were analyzed, applying a targeted next generation sequencing panel covering 29 known recurrently mutated genes in melanoma. NF1 and RAS mutations were identified as the most frequently mutated genes occurring in 18.3% and 16.9% of samples, respectively. Mutations in BRAF were identified in 8.4% and KIT in 7.0% of tumor samples. Our study identifies NF1 as the most frequently occurring driver mutation in mucosal melanoma. RAS alterations, consisting of NRAS and KRAS mutations, were the second most frequent mutation type. BRAF and KIT mutations were rare with frequencies below 10% each. Our data indicate that in mucosal melanomas RAS/NF1 alterations are frequent, implying a significant pathogenetic role for MAPK and potentially PI3K pathway activation in these tumors.

Targeted next generation sequencing of mucosal melanomas identifies frequent NF1 and RAS mutations

PubMed Central

Cosgarea, Ioana; Ugurel, Selma; Sucker, Antje; Livingstone, Elisabeth; Zimmer, Lisa; Ziemer, Mirjana; Utikal, Jochen; Mohr, Peter; Pfeiffer, Christiane; Pföhler, Claudia; Hillen, Uwe; Horn, Susanne; Schadendorf, Dirk

2017-01-01

Purpose Mucosal melanoma represents ~1% of all melanomas, frequently having a poor prognosis due to diagnosis at a late stage of disease. Mucosal melanoma differs from cutaneous melanoma not only in terms of poorer clinical outcome but also on the molecular level having e.g. less BRAF and more frequent KIT mutations than cutaneous melanomas. For the majority of mucosal melanomas oncogenic driver mutations remain unknown. Experimental Design and Results In our study, 75 tumor tissues from patients diagnosed with mucosal melanoma were analyzed, applying a targeted next generation sequencing panel covering 29 known recurrently mutated genes in melanoma. NF1 and RAS mutations were identified as the most frequently mutated genes occurring in 18.3% and 16.9% of samples, respectively. Mutations in BRAF were identified in 8.4% and KIT in 7.0% of tumor samples. Conclusions Our study identifies NF1 as the most frequently occurring driver mutation in mucosal melanoma. RAS alterations, consisting of NRAS and KRAS mutations, were the second most frequent mutation type. BRAF and KIT mutations were rare with frequencies below 10% each. Our data indicate that in mucosal melanomas RAS/NF1 alterations are frequent, implying a significant pathogenetic role for MAPK and potentially PI3K pathway activation in these tumors. PMID:28380455

Dealing with the incidental finding of secondary variants by the example of SRNS patients undergoing targeted next-generation sequencing.

PubMed

Weber, Stefanie; Büscher, Anja K; Hagmann, Henning; Liebau, Max C; Heberle, Christian; Ludwig, Michael; Rath, Sabine; Alberer, Martin; Beissert, Antje; Zenker, Martin; Hoyer, Peter F; Konrad, Martin; Klein, Hanns-Georg; Hoefele, Julia

2016-01-01

Steroid-resistant nephrotic syndrome (SRNS) is a severe cause of progressive renal disease. Genetic forms of SRNS can present with autosomal recessive or autosomal dominant inheritance. Recent studies have identified mutations in multiple podocyte genes responsible for SRNS. Improved sequencing methods (next-generation sequencing, NGS) now promise rapid mutational testing of SRNS genes. In the present study, a simultaneous screening of ten SRNS genes in 37 SRNS patients was performed by NGS. In 38 % of the patients, causative mutations in one SRNS gene were found. In 22 % of the patients, in addition to these mutations, a secondary variant in a different gene was identified. This high incidence of accumulating sequence variants was unexpected but, although they might have modifier effects, the pathogenic potential of these additional sequence variants seems unclear so far. The example of molecular diagnostics by NGS in SRNS patients shows that these new sequencing technologies might provide further insight into molecular pathogenicity in genetic disorders but will also generate results, which will be difficult to interpret and complicate genetic counseling. Although NGS promises more frequent identification of disease-causing mutations, the identification of causative mutations, the interpretation of incidental findings and possible pitfalls might pose problems, which hopefully will decrease by further experience and elucidation of molecular interactions.

Using whole-exome sequencing to investigate the genetic bases of lysosomal storage diseases of unknown etiology.

PubMed

Wang, Nan; Zhang, Yeting; Gedvilaite, Erika; Loh, Jui Wan; Lin, Timothy; Liu, Xiuping; Liu, Chang-Gong; Kumar, Dibyendu; Donnelly, Robert; Raymond, Kimiyo; Schuchman, Edward H; Sleat, David E; Lobel, Peter; Xing, Jinchuan

2017-11-01

Lysosomes are membrane-bound, acidic eukaryotic cellular organelles that play important roles in the degradation of macromolecules. Mutations that cause the loss of lysosomal protein function can lead to a group of disorders categorized as the lysosomal storage diseases (LSDs). Suspicion of LSD is frequently based on clinical and pathologic findings, but in some cases, the underlying genetic and biochemical defects remain unknown. Here, we performed whole-exome sequencing (WES) on 14 suspected LSD cases to evaluate the feasibility of using WES for identifying causal mutations. By examining 2,157 candidate genes potentially associated with lysosomal function, we identified eight variants in five genes as candidate disease-causing variants in four individuals. These included both known and novel mutations. Variants were corroborated by targeted sequencing and, when possible, functional assays. In addition, we identified nonsense mutations in two individuals in genes that are not known to have lysosomal function. However, mutations in these genes could have resulted in phenotypes that were diagnosed as LSDs. This study demonstrates that WES can be used to identify causal mutations in suspected LSD cases. We also demonstrate cases where a confounding clinical phenotype may potentially reflect more than one lysosomal protein defect. © 2017 Wiley Periodicals, Inc.

Novel compound heterozygous mutations in the GPR98 (USH2C) gene identified by whole exome sequencing in a Moroccan deaf family.

PubMed

Bousfiha, Amale; Bakhchane, Amina; Charoute, Hicham; Detsouli, Mustapha; Rouba, Hassan; Charif, Majida; Lenaers, Guy; Barakat, Abdelhamid

2017-10-01

In the present work, we identified two novel compound heterozygote mutations in the GPR98 (G protein-coupled receptor 98) gene causing Usher syndrome. Whole-exome sequencing was performed to study the genetic causes of Usher syndrome in a Moroccan family with three affected siblings. We identify two novel compound heterozygote mutations (c.1054C > A, c.16544delT) in the GPR98 gene in the three affected siblings carrying post-linguale bilateral moderate hearing loss with normal vestibular functions and before installing visual disturbances. This is the first time that mutations in the GPR98 gene are described in the Moroccan deaf patients.

Exome sequencing identifies a novel homozygous mutation in the phosphate transporter SLC34A1 in hypophosphatemia and nephrocalcinosis.

PubMed

Rajagopal, Abbhirami; Braslavsky, Débora; Lu, James T; Kleppe, Soledad; Clément, Florencia; Cassinelli, Hamilton; Liu, David S; Liern, Jose Miguel; Vallejo, Graciela; Bergadá, Ignacio; Gibbs, Richard A; Campeau, Phillipe M; Lee, Brendan H

2014-11-01

Two Argentinean siblings (a boy and a girl) from a nonconsanguineous family presented with hypercalcemia, hypercalciuria, hypophosphatemia, low parathyroid hormone (PTH), and nephrocalcinosis. The goal of this study was to identify genetic causes of the clinical findings in the two siblings. Whole exome sequencing was performed to identify disease-causing mutations in the youngest sibling, and a candidate variant was screened in other family members by Sanger sequencing. In vitro experiments were conducted to determine the effects of the mutation that was identified. Affected siblings (2 y.o. female and 10 y.o male) and their parents were included in the study. Informed consent was obtained for genetic studies. A novel homozygous mutation in the gene encoding the renal sodium-dependent phosphate transporter SLC34A1 was identified in both siblings (c.1484G>A, p.Arg495His). In vitro studies showed that the p.Arg495His mutation resulted in decreased phosphate uptake when compared to wild-type SLC34A1. The homozygous G>A transition that results in the substitution of histidine for arginine at position 495 of the renal sodium-dependent phosphate transporter, SLC34A1, is involved in disease pathogenesis in these patients. Our report of the second family with two mutated SLC34A1 alleles expands the known phenotype of this rare condition.

Mutational Survey of the PHEX Gene in Patients with X-linked Hypophosphatemic Rickets

PubMed Central

Ichikawa, Shoji; Traxler, Elizabeth A.; Estwick, Selina A.; Curry, Leah R.; Johnson, Michelle L.; Sorenson, Andrea H.; Imel, Erik A.; Econs, Michael J.

2008-01-01

X-linked hypophosphatemic rickets (XLH) is a dominantly inherited disorder characterized by renal phosphate wasting, aberrant vitamin D metabolism, and abnormal bone mineralization. XLH is caused by inactivating mutations in PHEX (phosphate-regulating gene with homologies to endopeptidases on the X chromosome). In this study, we sequenced the PHEX gene in subjects from 26 kindreds who were clinically diagnosed with XLH. Sequencing revealed 18 different mutations, of which thirteen have not been reported previously. In addition to deletions, splice site mutations, and missense and nonsense mutations, a rare point mutation in the 3’-untranslated region (3’-UTR) was identified as a novel cause of XLH. In summary, we identified a wide spectrum of mutations in the PHEX gene. Our data, in accord with those of others, indicate that there is no single predominant PHEX mutation responsible for XLH. PMID:18625346

Whole-exome sequencing reveals the spectrum of gene mutations and the clonal evolution patterns in paediatric acute myeloid leukaemia.

PubMed

Shiba, Norio; Yoshida, Kenichi; Shiraishi, Yuichi; Okuno, Yusuke; Yamato, Genki; Hara, Yusuke; Nagata, Yasunobu; Chiba, Kenichi; Tanaka, Hiroko; Terui, Kiminori; Kato, Motohiro; Park, Myoung-Ja; Ohki, Kentaro; Shimada, Akira; Takita, Junko; Tomizawa, Daisuke; Kudo, Kazuko; Arakawa, Hirokazu; Adachi, Souichi; Taga, Takashi; Tawa, Akio; Ito, Etsuro; Horibe, Keizo; Sanada, Masashi; Miyano, Satoru; Ogawa, Seishi; Hayashi, Yasuhide

2016-11-01

Acute myeloid leukaemia (AML) is a molecularly and clinically heterogeneous disease. Targeted sequencing efforts have identified several mutations with diagnostic and prognostic values in KIT, NPM1, CEBPA and FLT3 in both adult and paediatric AML. In addition, massively parallel sequencing enabled the discovery of recurrent mutations (i.e. IDH1/2 and DNMT3A) in adult AML. In this study, whole-exome sequencing (WES) of 22 paediatric AML patients revealed mutations in components of the cohesin complex (RAD21 and SMC3), BCORL1 and ASXL2 in addition to previously known gene mutations. We also revealed intratumoural heterogeneities in many patients, implicating multiple clonal evolution events in the development of AML. Furthermore, targeted deep sequencing in 182 paediatric AML patients identified three major categories of recurrently mutated genes: cohesion complex genes [STAG2, RAD21 and SMC3 in 17 patients (8·3%)], epigenetic regulators [ASXL1/ASXL2 in 17 patients (8·3%), BCOR/BCORL1 in 7 patients (3·4%)] and signalling molecules. We also performed WES in four patients with relapsed AML. Relapsed AML evolved from one of the subclones at the initial phase and was accompanied by many additional mutations, including common driver mutations that were absent or existed only with lower allele frequency in the diagnostic samples, indicating a multistep process causing leukaemia recurrence. © 2016 John Wiley & Sons Ltd.

Next generation sequencing in women affected by nonsyndromic premature ovarian failure displays new potential causative genes and mutations.

PubMed

Fonseca, Dora Janeth; Patiño, Liliana Catherine; Suárez, Yohjana Carolina; de Jesús Rodríguez, Asid; Mateus, Heidi Eliana; Jiménez, Karen Marcela; Ortega-Recalde, Oscar; Díaz-Yamal, Ivonne; Laissue, Paul

2015-07-01

To identify new molecular actors involved in nonsyndromic premature ovarian failure (POF) etiology. This is a retrospective case-control cohort study. University research group and IVF medical center. Twelve women affected by nonsyndromic POF. The control group included 176 women whose menopause had occurred after age 50 and had no antecedents regarding gynecological disease. A further 345 women from the same ethnic origin (general population group) were also recruited to assess allele frequency for potentially deleterious sequence variants. Next generation sequencing (NGS), Sanger sequencing, and bioinformatics analysis. The complete coding regions of 70 candidate genes were massively sequenced, via NGS, in POF patients. Bioinformatics and genetics were used to confirm NGS results and to identify potential sequence variants related to the disease pathogenesis. We have identified mutations in two novel genes, ADAMTS19 and BMPR2, that are potentially related to POF origin. LHCGR mutations, which might have contributed to the phenotype, were also detected. We thus recommend NGS as a powerful tool for identifying new molecular actors in POF and for future diagnostic/prognostic purposes. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

PRSS1 and SPINK1 mutations in idiopathic chronic and recurrent acute pancreatitis.

PubMed

Pelaez-Luna, Mario; Robles-Diaz, Guillermo; Canizales-Quinteros, Samuel; Tusié-Luna, Maria T

2014-09-07

To identify gene mutations in PRSS1 and SPINK1 in individuals with early onset idiopathic chronic or recurrent acute pancreatitis. The cationic trypsinogen gene (PRSS1; exons 2 and 3) and the serine protease inhibitor Kazal 1 gene (SPINK1; exon 3) were selectively amplified and sequenced from blood samples of 19 patients admitted to the Pancreas Clinic at our institution with chronic pancreatitis and/or idiopathic recurrent acute pancreatitis that were diagnosed or with onset before age 35. Fifty healthy volunteers served as controls. Whole blood samples were collected and gene specific sequences were amplified by polymerase chain reaction (PCR). All PCR products were subsequently sequenced in order to identify the presence of any mutations. Nineteen patients with pancreatitis (14 males; median age 24 years, range 15-48 years) were included in this study, of which five showed the presence of gene mutations. Direct sequencing results indicated the presence of two previously unidentified mutations in exon 2 of PRSS1 (V39E and N42S) in two patients with recurrent acute pancreatitis. Two cases had the N34S SPINK1 mutation. Analysis of the relatives of one patient homozygous for this mutation showed that five of the six family members carried the N34S SPINK1 mutation. Of these members, three were healthy heterozygous carriers and two were homozygotes (one sibling had diabetes, the other was healthy). Another patient was heterozygous for a novel SPINK1 mutation located on exon 3 (V46D). All members from this patient's family had normal genotypes, indicating that it was a de novo mutation. No mutations in either gene were present in the control subjects. Two novel PRSS1 mutations and one novel SPINK1 mutation were identified in Mexican patients with early onset idiopathic recurrent acute pancreatitis.

Mapping Challenging Mutations by Whole-Genome Sequencing

PubMed Central

Smith, Harold E.; Fabritius, Amy S.; Jaramillo-Lambert, Aimee; Golden, Andy

2016-01-01

Whole-genome sequencing provides a rapid and powerful method for identifying mutations on a global scale, and has spurred a renewed enthusiasm for classical genetic screens in model organisms. The most commonly characterized category of mutation consists of monogenic, recessive traits, due to their genetic tractability. Therefore, most of the mapping methods for mutation identification by whole-genome sequencing are directed toward alleles that fulfill those criteria (i.e., single-gene, homozygous variants). However, such approaches are not entirely suitable for the characterization of a variety of more challenging mutations, such as dominant and semidominant alleles or multigenic traits. Therefore, we have developed strategies for the identification of those classes of mutations, using polymorphism mapping in Caenorhabditis elegans as our model for validation. We also report an alternative approach for mutation identification from traditional recombinant crosses, and a solution to the technical challenge of sequencing sterile or terminally arrested strains where population size is limiting. The methods described herein extend the applicability of whole-genome sequencing to a broader spectrum of mutations, including classes that are difficult to map by traditional means. PMID:26945029

A three-step programmed method for the identification of causative gene mutations of maturity onset diabetes of the young (MODY).

PubMed

Li, Qian; Cao, Xi; Qiu, Hai-Yan; Lu, Jing; Gao, Rui; Liu, Chao; Yuan, Ming-Xia; Yang, Guang-Ran; Yang, Jin-Kui

2016-08-22

To establish a three-step programmed method to find gene mutations related to maturity onset diabetes of the young (MODY). Target region capture and next-generation sequencing (NGS) were performed using customized oligonucleotide probes designed to capture suspected genes for MODY in 11 probands with clinically diagnosed MODY. The suspected associations of certain genes with MODY were then confirmed by Sanger sequencing in the probands and their family members. Finally, to validate variants of one of the genes of interest (glucokinase, GCK) as pathogenic mutations, protein function editing by the variant genes was assessed. In the target region capture and NGS phase, a total of nine variants of seven genes (GCK, WFS1, SLC19A2, SH2B1, SERPINB4, RFX6, and GATA6) were identified in eight probands. Two heterozygous GCK mutations located on the same allele (p.Leu77Arg and p.Val101Met) were identified in a MODY family. Sanger sequencing was used to confirm the variants identified by NGS to be present in probands and their diabetic family members, but not in non-diabetic family members. Finally, enzyme kinetic and thermal stability analyses revealed that the p.Leu77Arg mutation or the p.Leu77Arg mutation in combination with the p.Val101Met mutation inactivates GCK function and stability, while mutation of p.Val101Met alone does not. The p.Leu77Arg but not p.Val101Met GCK mutation is therefore considered a pathogenic mutation associated with MODY. Genetic screening coupled with gene-editing protein function testing is an effective and reliable method by which causative gene mutations of MODY can be identified. Copyright © 2016 Elsevier B.V. All rights reserved.

Whole exome sequencing is an efficient, sensitive and specific method for determining the genetic cause of short-rib thoracic dystrophies.

PubMed

McInerney-Leo, A M; Harris, J E; Leo, P J; Marshall, M S; Gardiner, B; Kinning, E; Leong, H Y; McKenzie, F; Ong, W P; Vodopiutz, J; Wicking, C; Brown, M A; Zankl, A; Duncan, E L

2015-12-01

Short-rib thoracic dystrophies (SRTDs) are congenital disorders due to defects in primary cilium function. SRTDs are recessively inherited with mutations identified in 14 genes to date (comprising 398 exons). Conventional mutation detection (usually by iterative Sanger sequencing) is inefficient and expensive, and often not undertaken. Whole exome massive parallel sequencing has been used to identify new genes for SRTD (WDR34, WDR60 and IFT172); however, the clinical utility of whole exome sequencing (WES) has not been established. WES was performed in 11 individuals with SRTDs. Compound heterozygous or homozygous mutations were identified in six confirmed SRTD genes in 10 individuals (IFT172, DYNC2H1, TTC21B, WDR60, WDR34 and NEK1), giving overall sensitivity of 90.9%. WES data from 993 unaffected individuals sequenced using similar technology showed two individuals with rare (minor allele frequency <0.005) compound heterozygous variants of unknown significance in SRTD genes (specificity >99%). Costs for consumables, laboratory processing and bioinformatic analysis were

Limited copy number - high resolution melting (LCN-HRM) enables the detection and identification by sequencing of low level mutations in cancer biopsies

PubMed Central

Do, Hongdo; Dobrovic, Alexander

2009-01-01

Background Mutation detection in clinical tumour samples is challenging when the proportion of tumour cells, and thus mutant alleles, is low. The limited sensitivity of conventional sequencing necessitates the adoption of more sensitive approaches. High resolution melting (HRM) is more sensitive than sequencing but identification of the mutation is desirable, particularly when it is important to discriminate false positives due to PCR errors or template degradation from true mutations. We thus developed limited copy number - high resolution melting (LCN-HRM) which applies limiting dilution to HRM. Multiple replicate reactions with a limited number of target sequences per reaction allow low level mutations to be detected. The dilutions used (based on Ct values) are chosen such that mutations, if present, can be detected by the direct sequencing of amplicons with aberrant melting patterns. Results Using cell lines heterozygous for mutations, we found that the mutations were not readily detected when they comprised 10% of total alleles (20% tumour cells) by sequencing, whereas they were readily detectable at 5% total alleles by standard HRM. LCN-HRM allowed these mutations to be identified by direct sequencing of those positive reactions. LCN-HRM was then used to review formalin-fixed paraffin-embedded (FFPE) clinical samples showing discordant findings between sequencing and HRM for KRAS exon 2 and EGFR exons 19 and 21. Both true mutations present at low levels and sequence changes due to artefacts were detected by LCN-HRM. The use of high fidelity polymerases showed that the majority of the artefacts were derived from the damaged template rather than replication errors during amplification. Conclusion LCN-HRM bridges the sensitivity gap between HRM and sequencing and is effective in distinguishing between artefacts and true mutations. PMID:19811662

Limited copy number-high resolution melting (LCN-HRM) enables the detection and identification by sequencing of low level mutations in cancer biopsies.

PubMed

Do, Hongdo; Dobrovic, Alexander

2009-10-08

Mutation detection in clinical tumour samples is challenging when the proportion of tumour cells, and thus mutant alleles, is low. The limited sensitivity of conventional sequencing necessitates the adoption of more sensitive approaches. High resolution melting (HRM) is more sensitive than sequencing but identification of the mutation is desirable, particularly when it is important to discriminate false positives due to PCR errors or template degradation from true mutations.We thus developed limited copy number - high resolution melting (LCN-HRM) which applies limiting dilution to HRM. Multiple replicate reactions with a limited number of target sequences per reaction allow low level mutations to be detected. The dilutions used (based on Ct values) are chosen such that mutations, if present, can be detected by the direct sequencing of amplicons with aberrant melting patterns. Using cell lines heterozygous for mutations, we found that the mutations were not readily detected when they comprised 10% of total alleles (20% tumour cells) by sequencing, whereas they were readily detectable at 5% total alleles by standard HRM. LCN-HRM allowed these mutations to be identified by direct sequencing of those positive reactions.LCN-HRM was then used to review formalin-fixed paraffin-embedded (FFPE) clinical samples showing discordant findings between sequencing and HRM for KRAS exon 2 and EGFR exons 19 and 21. Both true mutations present at low levels and sequence changes due to artefacts were detected by LCN-HRM. The use of high fidelity polymerases showed that the majority of the artefacts were derived from the damaged template rather than replication errors during amplification. LCN-HRM bridges the sensitivity gap between HRM and sequencing and is effective in distinguishing between artefacts and true mutations.

Identification of novel mutations in X-linked retinitis pigmentosa families and implications for diagnostic testing

PubMed Central

Glaus, Esther; Lorenz, Birgit; Netzer, Christian; Li, Yün; Schambeck, Maria; Wittmer, Mariana; Feil, Silke; Kirschner-Schwabe, Renate; Rosenberg, Thomas; Cremers, Frans P.M.; Bergen, Arthur A.B.; Barthelmes, Daniel; Baraki, Husnia; Schmid, Fabian; Tanner, Gaby; Fleischhauer, Johannes; Orth, Ulrike; Becker, Christian; Wegscheider, Erika; Nürnberg, Gudrun; Nürnberg, Peter; Bolz, Hanno Jörn; Gal, Andreas; Berger, Wolfgang

2008-01-01

Purpose The goal of this study was to identify mutations in X-chromosomal genes associated with retinitis pigmentosa (RP) in patients from Germany, The Netherlands, Denmark, and Switzerland. Methods In addition to all coding exons of RP2, exons 1 through 15, 9a, ORF15, 15a and 15b of RPGR were screened for mutations. PCR products were amplified from genomic DNA extracted from blood samples and analyzed by direct sequencing. In one family with apparently dominant inheritance of RP, linkage analysis identified an interval on the X chromosome containing RPGR, and mutation screening revealed a pathogenic variant in this gene. Patients of this family were examined clinically and by X-inactivation studies. Results This study included 141 RP families with possible X-chromosomal inheritance. In total, we identified 46 families with pathogenic sequence alterations in RPGR and RP2, of which 17 mutations have not been described previously. Two of the novel mutations represent the most 3’-terminal pathogenic sequence variants in RPGR and RP2 reported to date. In exon ORF15 of RPGR, we found eight novel and 14 known mutations. All lead to a disruption of open reading frame. Of the families with suggested X-chromosomal inheritance, 35% showed mutations in ORF15. In addition, we found five novel mutations in other exons of RPGR and four in RP2. Deletions in ORF15 of RPGR were identified in three families in which female carriers showed variable manifestation of the phenotype. Furthermore, an ORF15 mutation was found in an RP patient who additionally carries a 6.4 kbp deletion downstream of the coding region of exon ORF15. We did not identify mutations in 39 sporadic male cases from Switzerland. Conclusions RPGR mutations were confirmed to be the most frequent cause of RP in families with an X-chromosomal inheritance pattern. We propose a screening strategy to provide molecular diagnostics in these families. PMID:18552978

Acral peeling skin syndrome resulting from a homozygous nonsense mutation in the CSTA gene encoding cystatin A.

PubMed

Krunic, Aleksandar L; Stone, Kristina L; Simpson, Michael A; McGrath, John A

2013-01-01

Acral peeling skin syndrome (APSS) is a clinically and genetically heterogeneous disorder. We used whole-exome sequencing to identify the molecular basis of APSS in a consanguineous Jordanian-American pedigree. We identified a homozygous nonsense mutation (p.Lys22X) in the CSTA gene, encoding cystatin A, that was confirmed using Sanger sequencing. Cystatin A is a protease inhibitor found in the cornified cell envelope, and loss-of-function mutations have previously been reported in two cases of exfoliative ichthyosis. Our study expands the molecular pathology of APSS and demonstrates the value of next-generation sequencing in the genetic characterization of inherited skin diseases. © 2013 Wiley Periodicals, Inc.

Identification of a novel PHEX mutation in a Chinese family with X-linked hypophosphatemic rickets using exome sequencing.

PubMed

Yuan, Lamei; Wu, Song; Xu, Hongbo; Xiao, Jingjing; Yang, Zhijian; Xia, Hong; Liu, An; Hu, Pengzhi; Lu, Anjie; Chen, Yulan; Xu, Fengping; Deng, Hao

2015-01-01

Familial hypophosphatemic rickets (HR), the most common inherited form of rickets, is a group of inherited renal phosphate wasting disorders characterized by growth retardation, rickets with bone deformities, osteomalacia, poor dental development, and hypophosphatemia. The purpose of this study was to identify the genetic defect responsible for familial HR in a four-generation Chinese Han pedigree by exome sequencing and Sanger sequencing. Clinical features include skeletal deformities, teeth abnormalities, hearing impairments and variable serum phosphate level in patients of this family. A novel deletion mutation, c.1553delT (p.F518Sfs*4), was identified in the X-linked phosphate regulating endopeptidase homolog gene (PHEX). The mutation is predicted to result in prematurely truncated and loss-of-function PHEX protein. Our data suggest that exome sequencing is a powerful tool to discover mutation(s) in HR, a disorder with genetic and clinical heterogeneity. The findings may also provide new insights into the cause and diagnosis of HR, and have implications for genetic counseling and clinical management.

Small-scale high-throughput sequencing-based identification of new therapeutic tools in cystic fibrosis.

PubMed

Bonini, Jennifer; Varilh, Jessica; Raynal, Caroline; Thèze, Corinne; Beyne, Emmanuelle; Audrezet, Marie-Pierre; Ferec, Claude; Bienvenu, Thierry; Girodon, Emmanuelle; Tuffery-Giraud, Sylvie; Des Georges, Marie; Claustres, Mireille; Taulan-Cadars, Magali

2015-10-01

Although 97-99% of CFTR mutations have been identified, great efforts must be made to detect yet-unidentified mutations. We developed a small-scale next-generation sequencing approach for reliably and quickly scanning the entire gene, including noncoding regions, to identify new mutations. We applied this approach to 18 samples from patients suffering from cystic fibrosis (CF) in whom only one mutation had hitherto been identified. Using an in-house bioinformatics pipeline, we could rapidly identify a second disease-causing CFTR mutation for 16 of 18 samples. Of them, c.1680-883A>G was found in three unrelated CF patients. Analysis of minigenes and patients' transcripts showed that this mutation results in aberrantly spliced transcripts because of the inclusion of a pseudoexon. It is located only three base pairs from the c.1680-886A>G mutation (1811+1.6kbA>G), the fourth most frequent mutation in southwestern Europe. We next tested the effect of antisense oligonucleotides targeting splice sites on these two mutations on pseudoexon skipping. Oligonucleotide transfection resulted in the restoration of the full-length, in-frame CFTR transcript, demonstrating the effect of antisense oligonucleotide-induced pseudoexon skipping in CF. Our data confirm the importance of analyzing noncoding regions to find unidentified mutations, which is essential to designing targeted therapeutic approaches.

[Detection of pathogenic mutations in Marfan syndrome by targeted next-generation semiconductor sequencing].

PubMed

Lu, Chaoxia; Wu, Wei; Xiao, Jifang; Meng, Yan; Zhang, Shuyang; Zhang, Xue

2013-06-01

To detect pathogenic mutations in Marfan syndrome (MFS) using an Ion Torrent Personal Genome Machine (PGM) and to validate the result of targeted next-generation semiconductor sequencing for the diagnosis of genetic disorders. Peripheral blood samples were collected from three MFS patients and a normal control with informed consent. Genomic DNA was isolated by standard method and then subjected to targeted sequencing using an Ion Ampliseq(TM) Inherited Disease Panel. Three multiplex PCR reactions were carried out to amplify the coding exons of 328 genes including FBN1, TGFBR1 and TGFBR2. DNA fragments from different samples were ligated with barcoded sequencing adaptors. Template preparation and emulsion PCR, and Ion Sphere Particles enrichment were carried out using an Ion One Touch system. The ion sphere particles were sequenced on a 318 chip using the PGM platform. Data from the PGM runs were processed using an Ion Torrent Suite 3.2 software to generate sequence reads. After sequence alignment and extraction of SNPs and indels, all the variants were filtered against dbSNP137. DNA sequences were visualized with an Integrated Genomics Viewer. The most likely disease-causing variants were analyzed by Sanger sequencing. The PGM sequencing has yielded an output of 855.80 Mb, with a > 100 × median sequencing depth and a coverage of > 98% for the targeted regions in all the four samples. After data analysis and database filtering, one known missense mutation (p.E1811K) and two novel premature termination mutations (p.E2264X and p.L871FfsX23) in the FBN1 gene were identified in the three MFS patients. All mutations were verified by conventional Sanger sequencing. Pathogenic FBN1 mutations have been identified in all patients with MFS, indicating that the targeted next-generation sequencing on the PGM sequencers can be applied for accurate and high-throughput testing of genetic disorders.

Whole-exome sequencing identifies novel compound heterozygous mutations in USH2A in Spanish patients with autosomal recessive retinitis pigmentosa.

PubMed

Méndez-Vidal, Cristina; González-Del Pozo, María; Vela-Boza, Alicia; Santoyo-López, Javier; López-Domingo, Francisco J; Vázquez-Marouschek, Carmen; Dopazo, Joaquin; Borrego, Salud; Antiñolo, Guillermo

2013-01-01

Retinitis pigmentosa (RP) is an inherited retinal dystrophy characterized by extreme genetic and clinical heterogeneity. Thus, the diagnosis is not always easily performed due to phenotypic and genetic overlap. Current clinical practices have focused on the systematic evaluation of a set of known genes for each phenotype, but this approach may fail in patients with inaccurate diagnosis or infrequent genetic cause. In the present study, we investigated the genetic cause of autosomal recessive RP (arRP) in a Spanish family in which the causal mutation has not yet been identified with primer extension technology and resequencing. We designed a whole-exome sequencing (WES)-based approach using NimbleGen SeqCap EZ Exome V3 sample preparation kit and the SOLiD 5500×l next-generation sequencing platform. We sequenced the exomes of both unaffected parents and two affected siblings. Exome analysis resulted in the identification of 43,204 variants in the index patient. All variants passing filter criteria were validated with Sanger sequencing to confirm familial segregation and absence in the control population. In silico prediction tools were used to determine mutational impact on protein function and the structure of the identified variants. Novel Usher syndrome type 2A (USH2A) compound heterozygous mutations, c.4325T>C (p.F1442S) and c.15188T>G (p.L5063R), located in exons 20 and 70, respectively, were identified as probable causative mutations for RP in this family. Family segregation of the variants showed the presence of both mutations in all affected members and in two siblings who were apparently asymptomatic at the time of family ascertainment. Clinical reassessment confirmed the diagnosis of RP in these patients. Using WES, we identified two heterozygous novel mutations in USH2A as the most likely disease-causing variants in a Spanish family diagnosed with arRP in which the cause of the disease had not yet been identified with commonly used techniques. Our data reinforce the clinical role of WES in the molecular diagnosis of highly heterogeneous genetic diseases where conventional genetic approaches have previously failed in achieving a proper diagnosis.

Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation

PubMed Central

Li, Tao; Zhang, Zhao-jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-nan; Liu, Hong-yan; Wang, Hong-dan; Wu, Dong; Lou, Gui-yu; Wang, Xin; Zhang, Chao-yang; Liao, Shi-xiu

2017-01-01

Abstract Background: Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. Methods: First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. Results: MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. Conclusion: The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. PMID:29390271

Novel USH2A compound heterozygous mutations cause RP/USH2 in a Chinese family.

PubMed

Liu, Xiaowen; Tang, Zhaohui; Li, Chang; Yang, Kangjuan; Gan, Guanqi; Zhang, Zibo; Liu, Jingyu; Jiang, Fagang; Wang, Qing; Liu, Mugen

2010-03-17

To identify the disease-causing gene in a four-generation Chinese family affected with retinitis pigmentosa (RP). Linkage analysis was performed with a panel of microsatellite markers flanking the candidate genetic loci of RP. These loci included 38 known RP genes. The complete coding region and exon-intron boundaries of Usher syndrome 2A (USH2A) were sequenced with the proband DNA to screen the disease-causing gene mutation. Restriction fragment length polymorphism (RFLP) analysis and direct DNA sequence analysis were done to demonstrate co-segregation of the USH2A mutations with the family disease. One hundred normal controls were used without the mutations. The disease-causing gene in this Chinese family was linked to the USH2A locus on chromosome 1q41. Direct DNA sequence analysis of USH2A identified two novel mutations in the patients: one missense mutation p.G1734R in exon 26 and a splice site mutation, IVS32+1G>A, which was found in the donor site of intron 32 of USH2A. Neither the p.G1734R nor the IVS32+1G>A mutation was found in the unaffected family members or the 100 normal controls. One patient with a homozygous mutation displayed only RP symptoms until now, while three patients with compound heterozygous mutations in the family of study showed both RP and hearing impairment. This study identified two novel mutations: p.G1734R and IVS32+1G>A of USH2A in a four-generation Chinese RP family. In this study, the heterozygous mutation and the homozygous mutation in USH2A may cause Usher syndrome Type II or RP, respectively. These two mutations expand the mutant spectrum of USH2A.

Spectrum of SMPD1 mutations in Asian-Indian patients with acid sphingomyelinase (ASM)-deficient Niemann-Pick disease.

PubMed

Ranganath, Prajnya; Matta, Divya; Bhavani, Gandham SriLakshmi; Wangnekar, Savita; Jain, Jamal Mohammed Nurul; Verma, Ishwar C; Kabra, Madhulika; Puri, Ratna Dua; Danda, Sumita; Gupta, Neerja; Girisha, Katta M; Sankar, Vaikom H; Patil, Siddaramappa J; Ramadevi, Akella Radha; Bhat, Meenakshi; Gowrishankar, Kalpana; Mandal, Kausik; Aggarwal, Shagun; Tamhankar, Parag Mohan; Tilak, Preetha; Phadke, Shubha R; Dalal, Ashwin

2016-10-01

Acid sphingomyelinase (ASM)-deficient Niemann-Pick disease is an autosomal recessive lysosomal storage disorder caused by biallelic mutations in the SMPD1 gene. To date, around 185 mutations have been reported in patients with ASM-deficient NPD world-wide, but the mutation spectrum of this disease in India has not yet been reported. The aim of this study was to ascertain the mutation profile in Indian patients with ASM-deficient NPD. We sequenced SMPD1 in 60 unrelated families affected with ASM-deficient NPD. A total of 45 distinct pathogenic sequence variants were found, of which 14 were known and 31 were novel. The variants included 30 missense, 4 nonsense, and 9 frameshift (7 single base deletions and 2 single base insertions) mutations, 1 indel, and 1 intronic duplication. The pathogenicity of the novel mutations was inferred with the help of the mutation prediction software MutationTaster, SIFT, Polyphen-2, PROVEAN, and HANSA. The effects of the identified sequence variants on the protein structure were studied using the structure modeled with the help of the SWISS-MODEL workspace program. The p. (Arg542*) (c.1624C>T) mutation was the most commonly identified mutation, found in 22% (26 out of 120) of the alleles tested, but haplotype analysis for this mutation did not identify a founder effect for the Indian population. To the best of our knowledge, this is the largest study on mutation analysis of patients with ASM-deficient Niemann-Pick disease reported in literature and also the first study on the SMPD1 gene mutation spectrum in India. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Autosomal Dominant Mutation in the Signal Peptide of Renin in a Kindred with Anemia, Hyperuricemia, and CKD

PubMed Central

Beck, Bodo B.; Trachtman, Howard; Gitman, Michael; Miller, Ilene; Sayer, John A.; Pannes, Andrea; Baasner, Anne; Hildebrandt, Friedhelm; Wolf, Matthias T.F.

2012-01-01

Homozygous or compound heterozygous Renin (REN) mutations cause renal tubular dysgenesis (RTD), which is characterized by death in utero due to renal failure and pulmonary hypoplasia. The phenotype resembles the fetopathy caused by angiotensin-converting enzyme inhibitor or angiotensin receptor blocker intake during pregnancy. Recently, heterozygous REN mutations were shown to result in early-onset hyperuricemia, anemia and chronic renal failure. So far, only three different heterozygous REN mutations were reported. We performed mutation analysis of the REN gene in 39 kindreds with hyperuricemia and chronic kidney disease (CKD) previously tested negative for mutations in the UMOD and HNF1β genes. We identified one kindred with a novel c.28T>C (p.W10R) REN mutation in the signal sequence, concluding that REN mutations are rare events in CKD patients. Affected individuals over four generations were identified carrying the novel REN mutation and were characterized by significant anemia, hyperuricemia and CKD. Anemia was severe and disproportional to the degree of renal impairment. Moreover all heterozygous REN mutations are localized in the signal sequence. Therefore, screening of the REN gene for CKD patients with hyperuricemia and anemia may be focusing on exon 1 sequencing, which encodes the signal peptide. PMID:21903317

Molecular analysis of brazilian patients with combined pituitary hormone deficiency and orthotopic posterior pituitary lobe reveals eight different PROP1 alterations with three novel mutations.

PubMed

Madeira, Joao Lo; Nishi, Mirian Y; Nakaguma, Marilena; Benedetti, Anna F; Biscotto, Isabela Peixoto; Fernandes, Thamiris; Pequeno, Thiago; Figueiredo, Thalita; Franca, Marcela M; Correa, Fernanda A; Otto, Aline P; Abrão, Milena; Miras, Mirta B; Santos, Silvana; Jorge, Alexander Al; Costalonga, Everlayny F; Mendonca, Berenice B; Arnhold, Ivo Jp; Carvalho, Luciani R

2017-12-01

Mutations in PROP1, HESX1 and LHX3 are associated with combined pituitary hormone deficiency (CPHD) and orthotopic posterior pituitary lobe (OPP). To identify mutations in PROP1, HESX1 and LHX3 in a large cohort of patients with CPHD and OPP (35 Brazilian, two Argentinian). We studied 23 index patients with CPHD and OPP (six familial and 17 sporadic) as well as 14 relatives. PROP1 was sequenced by the Sanger method in all except one sporadic case studied using a candidate gene panel. Multiplex ligation-dependent probe amplification (MLPA) was applied to one familial case in whom PROP1 failed to amplify by PCR. In the 13 patients without PROP1 mutations, HESX1 and LHX3 were sequenced by the Sanger method. We identified PROP1 mutations in 10 index cases. Three mutations were novel: one affecting the initiation codon (c.1A>G) and two affecting splicing sites, c.109+1G>A and c.342+1G>C. The known mutations, c.150delA (p.Arg53Aspfs*112), c.218G>A (p.Arg73His), c.263T>C (p.Phe88Ser) and c.301_302delAG (p.Leu102Cysfs*8), were also detected. MLPA confirmed complete PROP1 deletion in one family. We did not identify HESX1 and LHX3 mutations by Sanger. PROP1 mutations are a prevalent cause of congenital CPHD with OPP, and therefore, PROP1 sequencing must be the first step of molecular investigation in patients with CPHD and OPP, especially in populations with a high frequency of PROP1 mutations. In the absence of mutations, massively parallel sequencing is a promising approach. The high prevalence and diversity of PROP1 mutations is associated with the ethnic background of this cohort. © 2017 John Wiley & Sons Ltd.

Genome-Wide Linkage, Exome Sequencing and Functional Analyses Identify ABCB6 as the Pathogenic Gene of Dyschromatosis Universalis Hereditaria

PubMed Central

Wang, Na; Wang, Chuan; Chen, Xuechao; Sheng, Donglai; Fu, Xi’an; See, Kelvin; Foo, Jia Nee; Low, Huiqi; Liany, Herty; Irwan, Ishak Darryl; Liu, Jian; Yang, Baoqi; Chen, Mingfei; Yu, Yongxiang; Yu, Gongqi; Niu, Guiye; You, Jiabao; Zhou, Yan; Ma, Shanshan; Wang, Ting; Yan, Xiaoxiao; Goh, Boon Kee; Common, John E. A.; Lane, Birgitte E.; Sun, Yonghu; Zhou, Guizhi; Lu, Xianmei; Wang, Zhenhua; Tian, Hongqing; Cao, Yuanhua; Chen, Shumin; Liu, Qiji; Liu, Jianjun; Zhang, Furen

2014-01-01

Background As a genetic disorder of abnormal pigmentation, the molecular basis of dyschromatosis universalis hereditaria (DUH) had remained unclear until recently when ABCB6 was reported as a causative gene of DUH. Methodology We performed genome-wide linkage scan using Illumina Human 660W-Quad BeadChip and exome sequencing analyses using Agilent SureSelect Human All Exon Kits in a multiplex Chinese DUH family to identify the pathogenic mutations and verified the candidate mutations using Sanger sequencing. Quantitative RT-PCR and Immunohistochemistry was performed to verify the expression of the pathogenic gene, Zebrafish was also used to confirm the functional role of ABCB6 in melanocytes and pigmentation. Results Genome-wide linkage (assuming autosomal dominant inheritance mode) and exome sequencing analyses identified ABCB6 as the disease candidate gene by discovering a coding mutation (c.1358C>T; p.Ala453Val) that co-segregates with the disease phenotype. Further mutation analysis of ABCB6 in four other DUH families and two sporadic cases by Sanger sequencing confirmed the mutation (c.1358C>T; p.Ala453Val) and discovered a second, co-segregating coding mutation (c.964A>C; p.Ser322Lys) in one of the four families. Both mutations were heterozygous in DUH patients and not present in the 1000 Genome Project and dbSNP database as well as 1,516 unrelated Chinese healthy controls. Expression analysis in human skin and mutagenesis interrogation in zebrafish confirmed the functional role of ABCB6 in melanocytes and pigmentation. Given the involvement of ABCB6 mutations in coloboma, we performed ophthalmological examination of the DUH carriers of ABCB6 mutations and found ocular abnormalities in them. Conclusion Our study has advanced our understanding of DUH pathogenesis and revealed the shared pathological mechanism between pigmentary DUH and ocular coloboma. PMID:24498303

Rapid diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis using a molecular-based diagnostic algorithm.

PubMed

Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

2014-10-01

There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Molecular diagnosis of putative Stargardt disease probands by exome sequencing

PubMed Central

2012-01-01

Background The commonest genetic form of juvenile or early adult onset macular degeneration is Stargardt Disease (STGD) caused by recessive mutations in the gene ABCA4. However, high phenotypic and allelic heterogeneity and a small but non-trivial amount of locus heterogeneity currently impede conclusive molecular diagnosis in a significant proportion of cases. Methods We performed whole exome sequencing (WES) of nine putative Stargardt Disease probands and searched for potentially disease-causing genetic variants in previously identified retinal or macular dystrophy genes. Follow-up dideoxy sequencing was performed for confirmation and to screen for mutations in an additional set of affected individuals lacking a definitive molecular diagnosis. Results Whole exome sequencing revealed seven likely disease-causing variants across four genes, providing a confident genetic diagnosis in six previously uncharacterized participants. We identified four previously missed mutations in ABCA4 across three individuals. Likely disease-causing mutations in RDS/PRPH2, ELOVL, and CRB1 were also identified. Conclusions Our findings highlight the enormous potential of whole exome sequencing in Stargardt Disease molecular diagnosis and research. WES adequately assayed all coding sequences and canonical splice sites of ABCA4 in this study. Additionally, WES enables the identification of disease-related alleles in other genes. This work highlights the importance of collecting parental genetic material for WES testing as the current knowledge of human genome variation limits the determination of causality between identified variants and disease. While larger sample sizes are required to establish the precision and accuracy of this type of testing, this study supports WES for inherited early onset macular degeneration disorders as an alternative to standard mutation screening techniques. PMID:22863181

Detection of Somatic Mutations in Gastroenteropancreatic Neuroendocrine Tumors Using Targeted Deep Sequencing.

PubMed

Backman, Samuel; Norlén, Olov; Eriksson, Barbro; Skogseid, Britt; Stålberg, Peter; Crona, Joakim

2017-02-01

Mutations affecting the mechanistic target of rapamycin (MTOR) signalling pathway are frequent in human cancer and have been identified in up to 15% of pancreatic neuroendocrine tumours (NETs). Grade A evidence supports the efficacy of MTOR inhibition with everolimus in pancreatic NETs. Although a significant proportion of patients experience disease stabilization, only a minority will show objective tumour responses. It has been proposed that genomic mutations resulting in activation of MTOR signalling could be used to predict sensitivity to everolimus. Patients with NETs that underwent treatment with everolimus at our Institution were identified and those with available tumour tissue were selected for further analysis. Targeted next-generation sequencing (NGS) was used to re-sequence 22 genes that were selected on the basis of documented involvement in the MTOR signalling pathway or in the tumourigenesis of gastroenterpancreatic NETs. Radiological responses were documented using Response Evaluation Criteria in Solid Tumours. Six patients were identified, one had a partial response and four had stable disease. Sequencing of tumour tissue resulted in a median sequence depth of 667.1 (range=404-1301) with 1-fold coverage of 95.9-96.5% and 10-fold coverage of 87.6-92.2%. A total of 494 genetic variants were discovered, four of which were identified as pathogenic. All pathogenic variants were validated using Sanger sequencing and were found exclusively in menin 1 (MEN1) and death domain associated protein (DAXX) genes. No mutations in the MTOR pathway-related genes were observed. Targeted NGS is a feasible method with high diagnostic yield for genetic characterization of pancreatic NETs. A potential association between mutations in NETs and response to everolimus should be investigated by future studies. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Using single cell sequencing data to model the evolutionary history of a tumor.

PubMed

Kim, Kyung In; Simon, Richard

2014-01-24

The introduction of next-generation sequencing (NGS) technology has made it possible to detect genomic alterations within tumor cells on a large scale. However, most applications of NGS show the genetic content of mixtures of cells. Recently developed single cell sequencing technology can identify variation within a single cell. Characterization of multiple samples from a tumor using single cell sequencing can potentially provide information on the evolutionary history of that tumor. This may facilitate understanding how key mutations accumulate and evolve in lineages to form a heterogeneous tumor. We provide a computational method to infer an evolutionary mutation tree based on single cell sequencing data. Our approach differs from traditional phylogenetic tree approaches in that our mutation tree directly describes temporal order relationships among mutation sites. Our method also accommodates sequencing errors. Furthermore, we provide a method for estimating the proportion of time from the earliest mutation event of the sample to the most recent common ancestor of the sample of cells. Finally, we discuss current limitations on modeling with single cell sequencing data and possible improvements under those limitations. Inferring the temporal ordering of mutational sites using current single cell sequencing data is a challenge. Our proposed method may help elucidate relationships among key mutations and their role in tumor progression.

Exome Sequencing in 32 Patients with Anophthalmia/Microphthalmia and Developmental Eye Defects

PubMed Central

Slavotinek, Anne M.; Garcia, Sarah T.; Chandratillake, Gemma; Bardakjian, Tanya; Ullah, Ehsan; Wu, Di; Umeda, Kyle; Lao, Richard; Tang, Paul Ling-Fung; Wan, Eunice; Madireddy, Lohith; Lyalina, Svetlana; Mendelsohn, Bryce A.; Dugan, Sarah; Tirch, Jean; Tischler, Reana; Harris, Jason; Clark, Michael J.; Chervitz, Stephen; Patwardhan, Anil; West, John M.; Ursell, Phillip; de Alba Campomanes, Alejandra; Schneider, Adele; Kwok, Pui-yan; Baranzini, Sergio; Chen, Richard O.

2014-01-01

Anophthalmia/microphthalmia (A/M) is a genetically heterogeneous birth defect for which the etiology is unknown in more than 50% of patients. We used exome sequencing with the ACE Exome™ (Personalis, Inc; 18 cases) and UCSF Genomics Core (21 cases) to sequence 28 patients with A/M and four patients with varied developmental eye defects. In the 28 patients with A/M, we identified de novo mutations in three patients (OTX2, p.(Gln91His), RARB, p.Arg387Cys and GDF6, p.Ala249Glu) and inherited mutations in STRA6 in two patients. In patients with developmental eye defects, a female with cataracts and cardiomyopathy had a de novo COL4A1 mutation, p.(Gly773Arg), expanding the phenotype associated with COL4A1 to include cardiomyopathy. A male with a chorioretinal defect, microcephaly, seizures and sensorineural deafness had two PNPT1 mutations, p.(Ala507Ser) and c.401-1G>A, and we describe eye defects associated with this gene for the first time. Exome sequencing was efficient for identifying mutations in pathogenic genes for which there is no clinical testing available and for identifying cases that expand phenotypic spectra, such as the PNPT1 and COL4A1-associated disorders described here. PMID:25457163

A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family

NASA Astrophysics Data System (ADS)

Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

2014-11-01

Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

Novel mutations in LRP6 highlight the role of WNT signaling in tooth agenesis

PubMed Central

Ludwig, Kerstin U.; Sullivan, Robert; van Rooij, Iris A.L.M.; Thonissen, Michelle; Swinnen, Steven; Phan, Milien; Conte, Federica; Ishorst, Nina; Gilissen, Christian; RoaFuentes, Laury; van de Vorst, Maartje; Henkes, Arjen; Steehouwer, Marloes; van Beusekom, Ellen; Bloemen, Marjon; Vankeirsbilck, Bruno; Bergé, Stefaan; Hens, Greet; Schoenaers, Joseph; Poorten, Vincent Vander; Roosenboom, Jasmien; Verdonck, An; Devriendt, Koen; Roeleveldt, Nel; Jhangiani, Shalini N.; Vissers, Lisenka E.L.M.; Lupski, James R.; de Ligt, Joep; Von den Hoff, Johannes W.; Pfundt, Rolph; Brunner, Han G.; Zhou, Huiqing; Dixon, Jill; Mangold, Elisabeth; van Bokhoven, Hans; Dixon, Michael J.; Kleefstra, Tjitske

2016-01-01

Purpose Here we aimed to identify a novel genetic cause of tooth agenesis (TA) and/or orofacial clefting (OFC) by combining whole exome sequencing (WES) and targeted re-sequencing in a large cohort of TA and OFC patients. Methods WES was performed in two unrelated patients, one with severe TA and OFC and another with severe TA only. After identifying deleterious mutations in a gene encoding the low density lipoprotein receptor-related protein 6 (LRP6), all its exons were re-sequenced with molecular inversion probes, in 67 patients with TA, 1,072 patients with OFC and in 706 controls. Results We identified a frameshift (c.4594delG, p.Cys1532fs) and a canonical splice site mutation (c.3398-2A>C, p.?) in LRP6 respectively in the patient with TA and OFC, and in the patient with severe TA only. The targeted re-sequencing showed significant enrichment of unique LRP6 variants in TA patients, but not in nonsyndromic OFC. From the 5 variants in patients with TA, 2 affect the canonical splice site and 3 were missense variants; all variants segregated with the dominant phenotype and in 1 case the missense mutation occurred de novo. Conclusion Mutations in LRP6 cause tooth agenesis in man. PMID:26963285

A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family.

PubMed

Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

2014-11-06

Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

A Mismatch EndoNuclease Array-Based Methodology (MENA) for Identifying Known SNPs or Novel Point Mutations.

PubMed

Comeron, Josep M; Reed, Jordan; Christie, Matthew; Jacobs, Julia S; Dierdorff, Jason; Eberl, Daniel F; Manak, J Robert

2016-04-05

Accurate and rapid identification or confirmation of single nucleotide polymorphisms (SNPs), point mutations and other human genomic variation facilitates understanding the genetic basis of disease. We have developed a new methodology (called MENA (Mismatch EndoNuclease Array)) pairing DNA mismatch endonuclease enzymology with tiling microarray hybridization in order to genotype both known point mutations (such as SNPs) as well as identify previously undiscovered point mutations and small indels. We show that our assay can rapidly genotype known SNPs in a human genomic DNA sample with 99% accuracy, in addition to identifying novel point mutations and small indels with a false discovery rate as low as 10%. Our technology provides a platform for a variety of applications, including: (1) genotyping known SNPs as well as confirming newly discovered SNPs from whole genome sequencing analyses; (2) identifying novel point mutations and indels in any genomic region from any organism for which genome sequence information is available; and (3) screening panels of genes associated with particular diseases and disorders in patient samples to identify causative mutations. As a proof of principle for using MENA to discover novel mutations, we report identification of a novel allele of the beethoven (btv) gene in Drosophila, which encodes a ciliary cytoplasmic dynein motor protein important for auditory mechanosensation.

Whole exome sequencing identifies driver mutations in asymptomatic computed tomography-detected lung cancers with normal karyotype.

PubMed

Belloni, Elena; Veronesi, Giulia; Rotta, Luca; Volorio, Sara; Sardella, Domenico; Bernard, Loris; Pece, Salvatore; Di Fiore, Pier Paolo; Fumagalli, Caterina; Barberis, Massimo; Spaggiari, Lorenzo; Pelicci, Pier Giuseppe; Riva, Laura

2015-04-01

The efficacy of curative surgery for lung cancer could be largely improved by non-invasive screening programs, which can detect the disease at early stages. We previously showed that 18% of screening-identified lung cancers demonstrate a normal karyotype and, following high-density genome scanning, can be subdivided into samples with 1) numerous; 2) none; and 3) few copy number alterations. Whole exome sequencing was applied to the two normal karyotype, screening-detected lung cancers, constituting group 2, as well as normal controls. We identified mutations in both tumors, including KEAP1 (commonly mutated in lung cancers) in one, and TP53, PMS1, and MSH3 (well-characterized DNA-repair genes) in the other. The two normal karyotype screening-detected lung tumors displayed a typical lung cancer mutational profile that only next generation sequencing could reveal, which offered an additional contribution to the over-diagnosis bias concept hypothesized within lung cancer screening programs. Copyright © 2015 Elsevier Inc. All rights reserved.

Exome sequencing of hepatocellular carcinomas identifies new mutational signatures and potential therapeutic targets

DOE PAGES

Schulze, Kornelius; Imbeaud, Sandrine; Letouzé, Eric; ...

2015-03-30

Our genomic analyses promise to improve tumor characterization to optimize personalized treatment for patients with hepatocellular carcinoma (HCC). Exome sequencing analysis of 243 liver tumors identified mutational signatures associated with specific risk factors, mainly combined alcohol and tobacco consumption and exposure to aflatoxin B1. We identified 161 putative driver genes associated with 11 recurrently altered pathways. Associations of mutations defined 3 groups of genes related to risk factors and centered on CTNNB1 (alcohol), TP53 (hepatitis B virus, HBV) and AXIN1. These analyses according to tumor stage progression identified TERT promoter mutation as an early event, whereasFGF3, FGF4, FGF19 or CCND1more » amplification and TP53 and CDKN2A alterations appeared at more advanced stages in aggressive tumors. In 28% of the tumors, we identified genetic alterations potentially targetable by US Food and Drug Administration (FDA)–approved drugs. Finally, we identified risk factor–specific mutational signatures and defined the extensive landscape of altered genes and pathways in HCC, which will be useful to design clinical trials for targeted therapy.« less

Exome sequencing of hepatocellular carcinomas identifies new mutational signatures and potential therapeutic targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schulze, Kornelius; Imbeaud, Sandrine; Letouzé, Eric

Our genomic analyses promise to improve tumor characterization to optimize personalized treatment for patients with hepatocellular carcinoma (HCC). Exome sequencing analysis of 243 liver tumors identified mutational signatures associated with specific risk factors, mainly combined alcohol and tobacco consumption and exposure to aflatoxin B1. We identified 161 putative driver genes associated with 11 recurrently altered pathways. Associations of mutations defined 3 groups of genes related to risk factors and centered on CTNNB1 (alcohol), TP53 (hepatitis B virus, HBV) and AXIN1. These analyses according to tumor stage progression identified TERT promoter mutation as an early event, whereasFGF3, FGF4, FGF19 or CCND1more » amplification and TP53 and CDKN2A alterations appeared at more advanced stages in aggressive tumors. In 28% of the tumors, we identified genetic alterations potentially targetable by US Food and Drug Administration (FDA)–approved drugs. Finally, we identified risk factor–specific mutational signatures and defined the extensive landscape of altered genes and pathways in HCC, which will be useful to design clinical trials for targeted therapy.« less

Next-generation sequencing identifies three novel missense variants in ILDR1 and MYO6 genes in an Iranian family with hearing loss with review of the literature.

PubMed

Talebi, Farah; Mardasi, Farideh Ghanbari; Asl, Javad Mohammadi; Sayahi, Masoomeh

2017-12-01

Hearing impairment is the most common sensorineural disorder and is genetically heterogeneous. Identification of the pathogenic mutations underlying hearing impairment is difficult, since causative mutations in 127 different genes have so far been reported. In this study, we performed Next-generation sequencing (NGS) in 2 individuals from a consanguineous family with hearing loss. Three novel mutations in known deafness genes were identified in the family; MYO6-p.R928C and -p.D1223N in heterozygous state and ILDR1-p.Y143C in homozygous state. Sanger sequencing confirmed co-segregation of the three mutations with deafness in the family. The identified mutation in ILDR1 gene is located in the immunoglobulin-type domain of the ILDR1 protein and the detected mutations in MY06 are located in the tail domain of the MYO6 protein. The mutations are predicted to be pathogenic by SIFT, PolyPhen and Mutation Taster. Our results suggest that either the homozygous ILDR1-p.Y143C mutation might be the pathogenic variant for ARNSHL or heterozygous MYO6- p.R928C, -p.D1223N might be involved in these patient's disorder due to compound heterozygousity. To our knowledge, this is the first ILDR1 and MYO6 mutations recognized in the southwest Iran. Our data expands the spectrum of mutations in ILDR1 and MYO6 genes. Copyright © 2017 Elsevier B.V. All rights reserved.

Interpreting short tandem repeat variations in humans using mutational constraint

PubMed Central

Gymrek, Melissa; Willems, Thomas; Reich, David; Erlich, Yaniv

2017-01-01

Identifying regions of the genome that are depleted of mutations can reveal potentially deleterious variants. Short tandem repeats (STRs), also known as microsatellites, are among the largest contributors of de novo mutations in humans. However, per-locus studies of STR mutations have been limited to highly ascertained panels of several dozen loci. Here, we harnessed bioinformatics tools and a novel analytical framework to estimate mutation parameters for each STR in the human genome by correlating STR genotypes with local sequence heterozygosity. We applied our method to obtain robust estimates of the impact of local sequence features on mutation parameters and used this to create a framework for measuring constraint at STRs by comparing observed vs. expected mutation rates. Constraint scores identified known pathogenic variants with early onset effects. Our metric will provide a valuable tool for prioritizing pathogenic STRs in medical genetics studies. PMID:28892063

Exome sequencing supports a de novo mutational paradigm for schizophrenia

PubMed Central

Xu, Bin; Roos, J. Louw; Dexheimer, Phillip; Boone, Braden; Plummer, Brooks; Levy, Shawn; Gogos, Joseph A.; Karayiorgou, Maria

2011-01-01

Despite high heritability, a large fraction of cases with schizophrenia do not have a family history of the disease (sporadic cases). Here, we examine the possibility that rare de novo protein-altering mutations contribute to the genetic component of schizophrenia by sequencing the exome of 53 sporadic cases, 22 unaffected controls and their parents. We identified 40 de novo mutations in 27 patients affecting 40 genes including a potentially disruptive mutation in DGCR2, a gene removed by the recurrent schizophrenia-predisposing 22q11.2 microdeletion. Comparison to rare inherited variants revealed that the identified de novo mutations show a large excess of nonsynonymous changes in cases, as well as a greater potential to affect protein structure and function. Our analysis reveals a major role of de novo mutations in schizophrenia and also a large mutational target, which together provide a plausible explanation for the high global incidence and persistence of the disease. PMID:21822266

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

PubMed

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-02-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes

PubMed Central

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-01-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information. PMID:22384404

Novel compound heterozygous mutations in MYO7A gene associated with autosomal recessive sensorineural hearing loss in a Chinese family.

PubMed

Ma, Yalin; Xiao, Yun; Zhang, Fengguo; Han, Yuechen; Li, Jianfeng; Xu, Lei; Bai, Xiaohui; Wang, Haibo

2016-04-01

Mutations in MYO7A gene have been reported to be associated with Usher Syndrome type 1B (USH1B) and nonsyndromic hearing loss (DFNB2, DFNA11). Most mutations in MYO7A gene caused USH1B, whereas only a few reported mutations led to DFNB2 and DFNA11. The current study was designed to investigate the mutations among a Chinese family with autosomal recessive hearing loss. In this study, we present the clinical, genetic and molecular characteristics of a Chinese family. Targeted capture of 127 known deafness genes and next-generation sequencing were employed to study the genetic causes of two siblings in the Chinese family. Sanger sequencing was employed to examine those variant mutations in the members of this family and other ethnicity-matched controls. We identified the novel compound heterozygous mutant alleles of MYO7A gene: a novel missense mutation c.3671C>A (p.A1224D) and a reported insert mutation c.390_391insC (p.P131PfsX9). Variants were further confirmed by Sanger sequencing. These two compound heterozygous variants were co-segregated with autosomal recessive hearing loss phenotype. The gene mutation analysis and protein sequence alignment further supported that the novel compound heterozygous mutations were pathogenic. The novel compound heterozygous mutations (c.3671C>A and c.390_391insC) in MYO7A gene identified in this study were responsible for the autosomal recessive sensorineural hearing loss of this Chinese family. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

PubMed

Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

2006-09-01

Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

Novel recurrently mutated genes and a prognostic mutation signature in colorectal cancer.

PubMed

Yu, Jun; Wu, William K K; Li, Xiangchun; He, Jun; Li, Xiao-Xing; Ng, Simon S M; Yu, Chang; Gao, Zhibo; Yang, Jie; Li, Miao; Wang, Qiaoxiu; Liang, Qiaoyi; Pan, Yi; Tong, Joanna H; To, Ka F; Wong, Nathalie; Zhang, Ning; Chen, Jie; Lu, Youyong; Lai, Paul B S; Chan, Francis K L; Li, Yingrui; Kung, Hsiang-Fu; Yang, Huanming; Wang, Jun; Sung, Joseph J Y

2015-04-01

Characterisation of colorectal cancer (CRC) genomes by next-generation sequencing has led to the discovery of novel recurrently mutated genes. Nevertheless, genomic data has not yet been used for CRC prognostication. To identify recurrent somatic mutations with prognostic significance in patients with CRC. Exome sequencing was performed to identify somatic mutations in tumour tissues of 22 patients with CRC, followed by validation of 187 recurrent and pathway-related genes using targeted capture sequencing in additional 160 cases. Seven significantly mutated genes, including four reported (APC, TP53, KRAS and SMAD4) and three novel recurrently mutated genes (CDH10, FAT4 and DOCK2), exhibited high mutation prevalence (6-14% for novel cancer genes) and higher-than-expected number of non-silent mutations in our CRC cohort. For prognostication, a five-gene-signature (CDH10, COL6A3, SMAD4, TMEM132D, VCAN) was devised, in which mutation(s) in one or more of these genes was significantly associated with better overall survival independent of tumor-node-metastasis (TNM) staging. The median survival time was 80.4 months in the mutant group versus 42.4 months in the wild type group (p=0.0051). The prognostic significance of this signature was successfully verified using the data set from the Cancer Genome Atlas study. The application of next-generation sequencing has led to the identification of three novel significantly mutated genes in CRC and a mutation signature that predicts survival outcomes for stratifying patients with CRC independent of TNM staging. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

[Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

PubMed

Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

2017-08-10

To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

Next-Generation Sequencing of Matched Primary and Metastatic Rectal Adenocarcinomas Demonstrates Minimal Mutation Gain and Concordance to Colonic Adenocarcinomas.

PubMed

Crumley, Suzanne M; Pepper, Kristi L; Phan, Alexandria T; Olsen, Randall J; Schwartz, Mary R; Portier, Bryce P

2016-06-01

-Colorectal carcinoma is the third most common cause of cancer death in males and females in the United States. Rectal adenocarcinoma can have distinct therapeutic and surgical management from colonic adenocarcinoma owing to its location and anatomic considerations. -To determine the oncologic driver mutations and better understand the molecular pathogenesis of rectal adenocarcinoma in relation to colon adenocarcinoma. -Next-generation sequencing was performed on 20 cases of primary rectal adenocarcinoma with a paired lymph node or solid organ metastasis by using an amplicon-based assay of more than 2800 Catalogue of Somatic Mutations in Cancer (COSMIC)-identified somatic mutations. -Next-generation sequencing data were obtained on both the primary tumor and metastasis from 16 patients. Most rectal adenocarcinoma cases demonstrated identical mutations in the primary tumor and metastasis (13 of 16, 81%). The mutations identified, listed in order of frequency, included TP53, KRAS, APC, FBXW7, GNAS, FGFR3, BRAF, NRAS, PIK3CA, and SMAD4. -The somatic mutations identified in our rectal adenocarcinoma cohort showed a strong correlation to those previously characterized in colonic adenocarcinoma. In addition, most rectal adenocarcinomas harbored identical somatic mutations in both the primary tumor and metastasis. These findings demonstrate evidence that rectal adenocarcinoma follows a similar molecular pathogenesis as colonic adenocarcinoma and that sampling either the primary or metastatic lesion is valid for initial evaluation of somatic mutations and selection of possible targeted therapy.

Molecular genetics of cystinuria: Identification of four new mutations and seven polymorphisms, and evidence for genetic heterogeneity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gasparini, P.; Bisceglia, L.; Notarangelo, A.

A cystinuria disease gene (rBAT) has been recently identified, and some mutations causing the disease have been described. The frequency of these mutations has been investigated in a large sample of 51 Italian and Spanish cystinuric patients. In addition, to identify new mutated alleles, genomic DNA has been analyzed by an accurate and sensitive method able to detect nucleotide changes. Because of the lack of information available on the genomic structure of rBAT gene, the study was carried out using the sequence data so far obtained by us. More than 70% of the entire coding sequence and 8 intron-exon boundariesmore » have been analyzed. Four new mutations and seven intragenic polymorphisms have been detected. All mutations so far identified in rBAT belong only to cystinuria type I alleles, accounting for {approximately} 44% of all type I cystinuric chromosomes. Mutation M467T is the most common mutated allele in the Italian and Spanish populations. After analysis of 70% of the rBAT coding region, we have detected normal sequences in cystinuria type II and type III chromosomes. The presence of rBAT mutated alleles only in type I chromosomes of homozygous (type I/I) and heterozygous (type I/III) patients provides evidence for genetic heterogeneity where rBAT would be responsible only for type I cystinuria and suggests a complementation mechanism to explain the intermediate type I/type III phenotype. 25 refs., 1 fig., 3 tabs.« less

[Identification of novel pathogenic gene mutations in pediatric acute myeloid leukemia by whole-exome resequencing].

PubMed

Shiba, Norio

2015-12-01

A new class of gene mutations, identified in the pathogenesis of adult acute myeloid leukemia (AML), includes DNMT3A, IDH1/2, TET2 and EZH2. However, these mutations are rare in pediatric AML cases, indicating that pathogeneses differ between adult and pediatric forms of AML. Meanwhile, the recent development of massively parallel sequencing technologies has provided a new opportunity to discover genetic changes across entire genomes or proteincoding sequences. In order to reveal a complete registry of gene mutations, we performed whole exome resequencing of paired tumor-normal specimens from 19 pediatric AML cases using Illumina HiSeq 2000. In total, 80 somatic mutations or 4.2 mutations per sample were identified. Many of the recurrent mutations identified in this study involved previously reported targets in AML, such as FLT3, CEBPA, KIT, CBL, NRAS, WT1 and EZH2. On the other hand, several genes were newly identified in the current study, including BCORL1 and major cohesin components such as SMC3 and RAD21. Whole exome resequencing revealed a complex array of gene mutations in pediatric AML genomes. Our results indicate that a subset of pediatric AML represents a discrete entity that could be discriminated from its adult counterpart, in terms of the spectrum of gene mutations.

Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6

PubMed Central

Evans, Ben A.; Smith, Olivia L.; Pickerill, Ethan S.; York, Mary K.; Buenconsejo, Kristen J.P.; Chambers, Antonio E.

2018-01-01

Introduction of point mutations to a gene of interest is a powerful tool when determining protein function. CRISPR-mediated genome editing allows for more efficient transfer of a desired mutation into a wide range of model organisms. Traditionally, PCR amplification and DNA sequencing is used to determine if isolates contain the intended mutation. However, mutation efficiency is highly variable, potentially making sequencing costly and time consuming. To more efficiently screen for correct transformants, we have identified restriction enzymes sites that encode for two identical amino acids or one or two stop codons. We used CRISPR to introduce these restriction sites directly upstream of the Candida albicans UME6 Zn2+-binding domain, a known regulator of C. albicans filamentation. While repair templates coding for different restriction sites were not equally successful at introducing mutations, restriction digest screening enabled us to rapidly identify isolates with the intended mutation in a cost-efficient manner. In addition, mutated isolates have clear defects in filamentation and virulence compared to wild type C. albicans. Our data suggest restriction digestion screening efficiently identifies point mutations introduced by CRISPR and streamlines the process of identifying residues important for a phenotype of interest. PMID:29892505

New mutations in non-syndromic primary ovarian insufficiency patients identified via whole-exome sequencing.

PubMed

Patiño, Liliana Catherine; Beau, Isabelle; Carlosama, Carolina; Buitrago, July Constanza; González, Ronald; Suárez, Carlos Fernando; Patarroyo, Manuel Alfonso; Delemer, Brigitte; Young, Jacques; Binart, Nadine; Laissue, Paul

2017-07-01

Is it possible to identify new mutations potentially associated with non-syndromic primary ovarian insufficiency (POI) via whole-exome sequencing (WES)? WES is an efficient tool to study genetic causes of POI as we have identified new mutations, some of which lead to protein destablization potentially contributing to the disease etiology. POI is a frequently occurring complex pathology leading to infertility. Mutations in only few candidate genes, mainly identified by Sanger sequencing, have been definitively related to the pathogenesis of the disease. This is a retrospective cohort study performed on 69 women affected by POI. WES and an innovative bioinformatics analysis were used on non-synonymous sequence variants in a subset of 420 selected POI candidate genes. Mutations in BMPR1B and GREM1 were modeled by using fragment molecular orbital analysis. Fifty-five coding variants in 49 genes potentially related to POI were identified in 33 out of 69 patients (48%). These genes participate in key biological processes in the ovary, such as meiosis, follicular development, granulosa cell differentiation/proliferation and ovulation. The presence of at least two mutations in distinct genes in 42% of the patients argued in favor of a polygenic nature of POI. It is possible that regulatory regions, not analyzed in the present study, carry further variants related to POI. WES and the in silico analyses presented here represent an efficient approach for mapping variants associated with POI etiology. Sequence variants presented here represents potential future genetic biomarkers. This study was supported by the Universidad del Rosario and Colciencias (Grants CS/CIGGUR-ABN062-2016 and 672-2014). Colciencias supported Liliana Catherine Patiño´s work (Fellowship: 617, 2013). The authors declare no conflict of interest. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Upadhyaya, M.; Osborn, M.; Maynard, J.

Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detectedmore » in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.« less

Exome sequencing identifies MAX mutations as a cause of hereditary pheochromocytoma.

PubMed

Comino-Méndez, Iñaki; Gracia-Aznárez, Francisco J; Schiavi, Francesca; Landa, Iñigo; Leandro-García, Luis J; Letón, Rocío; Honrado, Emiliano; Ramos-Medina, Rocío; Caronia, Daniela; Pita, Guillermo; Gómez-Graña, Alvaro; de Cubas, Aguirre A; Inglada-Pérez, Lucía; Maliszewska, Agnieszka; Taschin, Elisa; Bobisse, Sara; Pica, Giuseppe; Loli, Paola; Hernández-Lavado, Rafael; Díaz, José A; Gómez-Morales, Mercedes; González-Neira, Anna; Roncador, Giovanna; Rodríguez-Antona, Cristina; Benítez, Javier; Mannelli, Massimo; Opocher, Giuseppe; Robledo, Mercedes; Cascón, Alberto

2011-06-19

Hereditary pheochromocytoma (PCC) is often caused by germline mutations in one of nine susceptibility genes described to date, but there are familial cases without mutations in these known genes. We sequenced the exomes of three unrelated individuals with hereditary PCC (cases) and identified mutations in MAX, the MYC associated factor X gene. Absence of MAX protein in the tumors and loss of heterozygosity caused by uniparental disomy supported the involvement of MAX alterations in the disease. A follow-up study of a selected series of 59 cases with PCC identified five additional MAX mutations and suggested an association with malignant outcome and preferential paternal transmission of MAX mutations. The involvement of the MYC-MAX-MXD1 network in the development and progression of neural crest cell tumors is further supported by the lack of functional MAX in rat PCC (PC12) cells and by the amplification of MYCN in neuroblastoma and suggests that loss of MAX function is correlated with metastatic potential.

Asn391Thr Mutation of β-Myosin Heavy Chain in a Hypertrophic Cardiomyopathy Family.

PubMed

Feng, Xiaotong; He, Tingting; Wang, Ji-Gang; Zhao, Peng

2018-05-30

The present study was performed to identify the genetic abnormalities in a family with familial hypertrophic cardiomyopathy.Peripheral blood samples were collected from 22 members of a Chinese family with hypertrophic cardiomyopathy and 307 healthy controls. A total of 26 candidate pathogenic genes were analyzed in the proband using targeted capture sequencing. Identified mutations were analyzed using Sanger sequencing in all family members and healthy controls.A missense mutation (c.1172A>C, p. Asn391Thr) in exon 12 of MYH7 was identified in eight family members, among which six of them were hypertrophic cardiomyopathy carriers. Three carriers presented with cardiac dysfunction. Four members of this pedigree died suddenly, three of whom were diagnosed with hypertrophic cardiomyopathy.From the results of this study, we concluded that the Asn391Thr mutation of MYH7 is a malignant mutation for HCM and that mutation carriers should get effective treatment to prevent sudden death.

Molecular Testing of 163 Patients with Morquio A (Mucopolysaccharidosis IVA) Identifies 39 Novel GALNS Mutations

PubMed Central

Morrone, A; Tylee, K.L.; Al-Sayed, M; Brusius-Facchin, A.C.; Caciotti, A.; Church, H.J.; Coll, M.J.; Davidson, K.; Fietz, M.J.; Gort, L.; Hegde, M.; Kubaski, F.; Lacerda, L.; Laranjeira, F.; Leistner-Segal, S.; Mooney, S.; Pajares, S.; Pollard, L.; Riberio, I.; Wang, R.Y.; Miller, N.

2014-01-01

Morquio A (Mucopolysaccharidosis IVA; MPS IVA) is an autosomal recessive lysosomal storage disorder caused by partial or total deficiency of the enzyme galactosamine-6-sulfate sulfatase (GALNS; also known as N-acetylgalactosamine-6-sulfate sulfatase) encoded by the GALNS gene. Patients who inherit two mutated GALNS gene alleles produce protein with decreased ability to degrade the glycosaminoglycans (GAGs) keratan sulfate and chondroitin 6-sulfate, thereby causing GAG accumulation within lysosomes and consequently pleiotropic disease. GALNS mutations occur throughout the gene and many mutations are identified only in single patients or families, causing difficulties both in mutation detection and interpretation. In this study, molecular analysis of 163 patients with Morquio A identified 99 unique mutations in the GALNS gene believed to negatively impact GALNS protein function, of which 39 are previously unpublished, together with 26 single-nucleotide polymorphisms. Recommendations for the molecular testing of patients, clear reporting of sequence findings, and interpretation of sequencing data are provided. PMID:24726177

KRAS Mutation Test in Korean Patients with Colorectal Carcinomas: A Methodological Comparison between Sanger Sequencing and a Real-Time PCR-Based Assay.

PubMed

Lee, Sung Hak; Chung, Arthur Minwoo; Lee, Ahwon; Oh, Woo Jin; Choi, Yeong Jin; Lee, Youn-Soo; Jung, Eun Sun

2017-01-01

Mutations in the KRAS gene have been identified in approximately 50% of colorectal cancers (CRCs). KRAS mutations are well established biomarkers in anti-epidermal growth factor receptor therapy. Therefore, assessment of KRAS mutations is needed in CRC patients to ensure appropriate treatment. We compared the analytical performance of the cobas test to Sanger sequencing in 264 CRC cases. In addition, discordant specimens were evaluated by 454 pyrosequencing. KRAS mutations for codons 12/13 were detected in 43.2% of cases (114/264) by Sanger sequencing. Of 257 evaluable specimens for comparison, KRAS mutations were detected in 112 cases (43.6%) by Sanger sequencing and 118 cases (45.9%) by the cobas test. Concordance between the cobas test and Sanger sequencing for each lot was 93.8% positive percent agreement (PPA) and 91.0% negative percent agreement (NPA) for codons 12/13. Results from the cobas test and Sanger sequencing were discordant for 20 cases (7.8%). Twenty discrepant cases were subsequently subjected to 454 pyrosequencing. After comprehensive analysis of the results from combined Sanger sequencing-454 pyrosequencing and the cobas test, PPA was 97.5% and NPA was 100%. The cobas test is an accurate and sensitive test for detecting KRAS -activating mutations and has analytical power equivalent to Sanger sequencing. Prescreening using the cobas test with subsequent application of Sanger sequencing is the best strategy for routine detection of KRAS mutations in CRC.

Myelin protein zero gene sequencing diagnoses Charcot-Marie-Tooth Type 1B disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Y.; Zhang, H.; Madrid, R.

1994-09-01

Charcot-Marie-Tooth disease (CMT), the most common genetic neuropathy, affects about 1 in 2600 people in Norway and is found worldwide. CMT Type 1 (CMT1) has slow nerve conduction with demyelinated Schwann cells. Autosomal dominant CMT Type 1B (CMT1B) results from mutations in the myelin protein zero gene which directs the synthesis of more than half of all Schwann cell protein. This gene was mapped to the chromosome 1q22-1q23.1 borderline by fluorescence in situ hybridization. The first 7 of 7 reported CMT1B mutations are unique. Thus the most effective means to identify CMT1B mutations in at-risk family members and fetuses ismore » to sequence the entire coding sequence in dominant or sporadic CMT patients without the CMT1A duplication. Of the 19 primers used in 16 pars to uniquely amplify the entire MPZ coding sequence, 6 primer pairs were used to amplify and sequence the 6 exons. The DyeDeoxy Terminator cycle sequencing method used with four different color fluorescent lables was superior to manual sequencing because it sequences more bases unambiguously from extracted genomic DNA samples within 24 hours. This protocol was used to test 28 CMT and Dejerine-Sottas patients without CMT1A gene duplication. Sequencing MPZ gene-specific amplified fragments identified 9 polymorphic sites within the 6 exons that encode the 248 amino acid MPZ protein. The large number of major CMT1B mutations identified by single strand sequencing are being verified by reverse strand sequencing and when possible, by restriction enzyme analysis. This protocol can be used to distringuish CMT1B patients from othre CMT phenotypes and to determine the CMT1B status of relatives both presymptomatically and prenatally.« less

Whole-exome sequencing and targeted gene sequencing provide insights into the role of PALB2 as a male breast cancer susceptibility gene.

PubMed

Silvestri, Valentina; Zelli, Veronica; Valentini, Virginia; Rizzolo, Piera; Navazio, Anna Sara; Coppa, Anna; Agata, Simona; Oliani, Cristina; Barana, Daniela; Castrignanò, Tiziana; Viel, Alessandra; Russo, Antonio; Tibiletti, Maria Grazia; Zanna, Ines; Masala, Giovanna; Cortesi, Laura; Manoukian, Siranoush; Azzollini, Jacopo; Peissel, Bernard; Bonanni, Bernardo; Peterlongo, Paolo; Radice, Paolo; Palli, Domenico; Giannini, Giuseppe; Chillemi, Giovanni; Montagna, Marco; Ottini, Laura

2017-01-01

Male breast cancer (MBC) is a rare disease whose etiology appears to be largely associated with genetic factors. BRCA1 and BRCA2 mutations account for about 10% of all MBC cases. Thus, a fraction of MBC cases are expected to be due to genetic factors not yet identified. To further explain the genetic susceptibility for MBC, whole-exome sequencing (WES) and targeted gene sequencing were applied to high-risk, BRCA1/2 mutation-negative MBC cases. Germ-line DNA of 1 male and 2 female BRCA1/2 mutation-negative breast cancer (BC) cases from a pedigree showing a first-degree family history of MBC was analyzed with WES. Targeted gene sequencing for the validation of WES results was performed for 48 high-risk, BRCA1/2 mutation-negative MBC cases from an Italian multicenter study of MBC. A case-control series of 433 BRCA1/2 mutation-negative MBC and female breast cancer (FBC) cases and 849 male and female controls was included in the study. WES in the family identified the partner and localizer of BRCA2 (PALB2) c.419delA truncating mutation carried by the proband, her father, and her paternal uncle (all affected with BC) and the N-acetyltransferase 1 (NAT1) c.97C>T nonsense mutation carried by the proband's maternal aunt. Targeted PALB2 sequencing detected the c.1984A>T nonsense mutation in 1 of the 48 BRCA1/2 mutation-negative MBC cases. NAT1 c.97C>T was not found in the case-control series. These results add strength to the evidence showing that PALB2 is involved in BC risk for both sexes and indicate that consideration should be given to clinical testing of PALB2 for BRCA1/2 mutation-negative families with multiple MBC and FBC cases. Cancer 2017;123:210-218. © 2016 American Cancer Society. © 2016 American Cancer Society.

Exome sequencing for simultaneous mutation screening in children with hemophagocytic lymphohistiocytosis.

PubMed

Mukda, Ekchol; Trachoo, Objoon; Pasomsub, Ekawat; Tiyasirichokchai, Rawiphorn; Iemwimangsa, Nareenart; Sosothikul, Darintr; Chantratita, Wasun; Pakakasama, Samart

2017-08-01

In the present study, we used exome sequencing to analyze PRF1, UNC13D, STX11, and STXBP2, as well as genes associated with primary immunodeficiency disease (RAB27A, LYST, AP3B1, SH2D1A, ITK, CD27, XIAP, and MAGT1) in Thai children with hemophagocytic lymphohistiocytosis (HLH). We performed mutation analysis of HLH-associated genes in 25 Thai children using an exome sequencing method. Genetic variations found within these target genes were compared to exome sequencing data from 133 healthy individuals. Variants identified with minor allele frequencies <5% and novel mutations were confirmed using Sanger sequencing. Exome sequencing data revealed 101 non-synonymous single nucleotide polymorphisms (SNPs) in all subjects. These SNPs were classified as pathogenic (n = 1), likely pathogenic (n = 16), variant of unknown significance (n = 12), or benign variant (n = 72). Homozygous, compound heterozygous, and double-gene heterozygous variants, involving mutations in PRF1 (n = 3), UNC13D (n = 2), STXBP2 (n = 3), LYST (n = 3), XIAP (n = 2), AP3B1 (n = 1), RAB27A (n = 1), and MAGT1 (n = 1), were demonstrated in 12 patients. Novel mutations were found in most patients in this study. In conclusion, exome sequencing demonstrated the ability to identify rare genetic variants in HLH patients. This method is useful in the detection of mutations in multi-gene associated diseases.

Identification of a Variety of Mutations in Cancer Predisposition Genes in Patients With Suspected Lynch Syndrome.

PubMed

Yurgelun, Matthew B; Allen, Brian; Kaldate, Rajesh R; Bowles, Karla R; Judkins, Thaddeus; Kaushik, Praveen; Roa, Benjamin B; Wenstrup, Richard J; Hartman, Anne-Renee; Syngal, Sapna

2015-09-01

Multigene panels are commercially available tools for hereditary cancer risk assessment that allow for next-generation sequencing of numerous genes in parallel. However, it is not clear if these panels offer advantages over traditional genetic testing. We investigated the number of cancer predisposition gene mutations identified by parallel sequencing in individuals with suspected Lynch syndrome. We performed germline analysis with a 25-gene, next-generation sequencing panel using DNA from 1260 individuals who underwent clinical genetic testing for Lynch syndrome from 2012 through 2013. All patients had a history of Lynch syndrome-associated cancer and/or polyps. We classified all identified germline alterations for pathogenicity and calculated the frequencies of pathogenic mutations and variants of uncertain clinical significance (VUS). We also analyzed data on patients' personal and family history of cancer, including fulfillment of clinical guidelines for genetic testing. Of the 1260 patients, 1112 met National Comprehensive Cancer Network (NCCN) criteria for Lynch syndrome testing (88%; 95% confidence interval [CI], 86%-90%). Multigene panel testing identified 114 probands with Lynch syndrome mutations (9.0%; 95% CI, 7.6%-10.8%) and 71 with mutations in other cancer predisposition genes (5.6%; 95% CI, 4.4%-7.1%). Fifteen individuals had mutations in BRCA1 or BRCA2; 93% of these met the NCCN criteria for Lynch syndrome testing and 33% met NCCN criteria for BRCA1 and BRCA2 analysis (P = .0017). An additional 9 individuals carried mutations in other genes linked to high lifetime risks of cancer (5 had mutations in APC, 3 had bi-allelic mutations in MUTYH, and 1 had a mutation in STK11); all of these patients met NCCN criteria for Lynch syndrome testing. A total of 479 individuals had 1 or more VUS (38%; 95% CI, 35%-41%). In individuals with suspected Lynch syndrome, multigene panel testing identified high-penetrance mutations in cancer predisposition genes, many of which were unexpected based on patients' histories. Parallel sequencing also detected a high number of potentially uninformative germline findings, including VUS. Copyright © 2015 AGA Institute. Published by Elsevier Inc. All rights reserved.

Usher syndrome type 2 caused by activation of an USH2A pseudoexon: implications for diagnosis and therapy.

PubMed

Vaché, Christel; Besnard, Thomas; le Berre, Pauline; García-García, Gema; Baux, David; Larrieu, Lise; Abadie, Caroline; Blanchet, Catherine; Bolz, Hanno Jörn; Millan, Jose; Hamel, Christian; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise

2012-01-01

USH2A sequencing in three affected members of a large family, referred for the recessive USH2 syndrome, identified a single pathogenic alteration in one of them and a different mutation in the two affected nieces. As the patients carried a common USH2A haplotype, they likely shared a mutation not found by standard sequencing techniques. Analysis of RNA from nasal cells in one affected individual identified an additional pseudoexon (PE) resulting from a deep intronic mutation. This was confirmed by minigene assay. This is the first example in Usher syndrome (USH) with a mutation causing activation of a PE. The finding of this alteration in eight other individuals of mixed European origin emphasizes the importance of including RNA analysis in a comprehensive diagnostic service. Finally, this mutation, which would not have been found by whole-exome sequencing, could offer, for the first time in USH, the possibility of therapeutic correction by antisense oligonucleotides (AONs). © 2011 Wiley Periodicals, Inc.

Intratumor heterogeneity in localized lung adenocarcinomas delineated by multiregion sequencing.

PubMed

Zhang, Jianjun; Fujimoto, Junya; Zhang, Jianhua; Wedge, David C; Song, Xingzhi; Zhang, Jiexin; Seth, Sahil; Chow, Chi-Wan; Cao, Yu; Gumbs, Curtis; Gold, Kathryn A; Kalhor, Neda; Little, Latasha; Mahadeshwar, Harshad; Moran, Cesar; Protopopov, Alexei; Sun, Huandong; Tang, Jiabin; Wu, Xifeng; Ye, Yuanqing; William, William N; Lee, J Jack; Heymach, John V; Hong, Waun Ki; Swisher, Stephen; Wistuba, Ignacio I; Futreal, P Andrew

2014-10-10

Cancers are composed of populations of cells with distinct molecular and phenotypic features, a phenomenon termed intratumor heterogeneity (ITH). ITH in lung cancers has not been well studied. We applied multiregion whole-exome sequencing (WES) on 11 localized lung adenocarcinomas. All tumors showed clear evidence of ITH. On average, 76% of all mutations and 20 out of 21 known cancer gene mutations were identified in all regions of individual tumors, which suggested that single-region sequencing may be adequate to identify the majority of known cancer gene mutations in localized lung adenocarcinomas. With a median follow-up of 21 months after surgery, three patients have relapsed, and all three patients had significantly larger fractions of subclonal mutations in their primary tumors than patients without relapse. These data indicate that a larger subclonal mutation fraction may be associated with increased likelihood of postsurgical relapse in patients with localized lung adenocarcinomas. Copyright © 2014, American Association for the Advancement of Science.

Long-range PCR facilitates the identification of PMS2-specific mutations.

PubMed

Clendenning, Mark; Hampel, Heather; LaJeunesse, Jennifer; Lindblom, Annika; Lockman, Jan; Nilbert, Mef; Senter, Leigha; Sotamaa, Kaisa; de la Chapelle, Albert

2006-05-01

Mutations within the DNA mismatch repair gene, "postmeiotic segregation increased 2" (PMS2), have been associated with a predisposition to hereditary nonpolyposis colorectal cancer (HNPCC; Lynch syndrome). The presence of a large family of highly homologous PMS2 pseudogenes has made previous attempts to sequence PMS2 very difficult. Here, we describe a novel method that utilizes long-range PCR as a way to preferentially amplify PMS2 and not the pseudogenes. A second, exon-specific, amplification from diluted long-range products enables us to obtain a clean sequence that shows no evidence of pseudogene contamination. This method has been used to screen a cohort of patients whose tumors were negative for the PMS2 protein by immunohistochemistry and had not shown any mutations within the MLH1 gene. Sequencing of the PMS2 gene from 30 colorectal and 11 endometrial cancer patients identified 10 novel sequence changes as well as 17 sequence changes that had previously been identified. In total, putative pathologic mutations were detected in 11 of the 41 families. Among these were five novel mutations, c.705+1G>T, c.736_741del6ins11, c.862_863del, c.1688G>T, and c.2007-1G>A. We conclude that PMS2 mutation detection in selected Lynch syndrome and Lynch syndrome-like patients is both feasible and desirable. Published 2006 Wiley-Liss, Inc.

Common founder mutation in the LDL receptor gene causing familial hypercholesterolaemia in the Icelandic population.

PubMed

Gudnason, V; Sigurdsson, G; Nissen, H; Humphries, S E

1997-01-01

Haplotype analysis in 18 apparently unrelated families with familial hypercholesterolaemia (FH) in Iceland has identified at least five different chromosomes cosegregating with hypercholesterolaemia. The most common haplotype was identified in 11 of the 18 families, indicating a responsible for FH in the Icelandic population. By using single-strand conformation polymorphism (SSCP) and direct sequencing of amplified DNA, we identified a novel mutation (a T to a C) in the second nucleotide in the 5' part of intron 4 in the LDL receptor gene. This mutation was present in approximately 60% of the FH families (10/18), supporting the prediction of a common founder. These families could be traced to a common ancestor in half of the cases by going back no further than the eighteenth century. The mutation was predicted to affect correct splicing of exon 4, and analysis at the cellular level demonstrated an abnormal mRNA containing intron 4 sequence in lymphoblastoid cells from a patient carrying this mutation. Translation of the mRNA would lead to a premature stop codon and a truncated nonfunctional protein of 285 amino acids. The novel sequence change created a new restriction site for the restriction endonuclease NlaIII, and using this assay, 29 unrelated individuals with possible FH attending a lipid clinic for treatment were examined for this mutation. Two individuals in this group of patients were found to be carriers of this mutation, supporting the suggestion of a founder mutation. Using this assay for the detection of FH in the Icelandic population should identify > 60% of these individuals.

A CACNA1D mutation in a patient with persistent hyperinsulinaemic hypoglycaemia, heart defects, and severe hypotonia.

PubMed

Flanagan, S E; Vairo, F; Johnson, M B; Caswell, R; Laver, T W; Lango Allen, H; Hussain, K; Ellard, S

2017-06-01

Congenital hyperinsulinaemic hypoglycaemia (HH) can occur in isolation or it may present as part of a wider syndrome. For approximately 40%-50% of individuals with this condition, sequence analysis of the known HH genes identifies a causative mutation. Identifying the underlying genetic aetiology in the remaining cases is important as a genetic diagnosis will inform on recurrence risk, may guide medical management and will provide valuable insights into β-cell physiology. We sequenced the exome of a child with persistent diazoxide-responsive HH, mild aortic insufficiency, severe hypotonia, and developmental delay as well as the unaffected parents. This analysis identified a de novo mutation, p.G403D, in the proband's CACNA1D gene. CACNA1D encodes the main L-type voltage-gated calcium channel in the pancreatic β-cell, a key component of the insulin secretion pathway. The p.G403D mutation had been reported previously as an activating mutation in an individual with primary hyper-aldosteronism, neuromuscular abnormalities, and transient hypoglycaemia. Sequence analysis of the CACNA1D gene in 60 further cases with HH did not identify a pathogenic mutation. Identification of an activating CACNA1D mutation in a second patient with congenital HH confirms the aetiological role of CACNA1D mutations in this disorder. A genetic diagnosis is important as treatment with a calcium channel blocker may be an option for the medical management of this patient. © 2017 The Authors. Pediatric Diabetes published by John Wiley & Sons Ltd.

Exome Sequencing Identifies a Novel Homozygous Mutation in the Phosphate Transporter SLC34A1 in Hypophosphatemia and Nephrocalcinosis

PubMed Central

Rajagopal, Abbhirami; Braslavsky, Débora; Lu, James T.; Kleppe, Soledad; Clément, Florencia; Cassinelli, Hamilton; Liu, David S.; Liern, Jose Miguel; Vallejo, Graciela; Bergadá, Ignacio; Gibbs, Richard A.; Campeau, Phillipe M.

2014-01-01

Context: Two Argentinean siblings (a boy and a girl) from a nonconsanguineous family presented with hypercalcemia, hypercalciuria, hypophosphatemia, low parathyroid hormone (PTH), and nephrocalcinosis. Objective: The goal of this study was to identify genetic causes of the clinical findings in the two siblings. Design: Whole exome sequencing was performed to identify disease-causing mutations in the youngest sibling, and a candidate variant was screened in other family members by Sanger sequencing. In vitro experiments were conducted to determine the effects of the mutation that was identified. Patients and Other Participants: Affected siblings (2 y.o. female and 10 y.o male) and their parents were included in the study. Informed consent was obtained for genetic studies. Results: A novel homozygous mutation in the gene encoding the renal sodium-dependent phosphate transporter SLC34A1 was identified in both siblings (c.1484G>A, p.Arg495His). In vitro studies showed that the p.Arg495His mutation resulted in decreased phosphate uptake when compared to wild-type SLC34A1. Conclusions: The homozygous G>A transition that results in the substitution of histidine for arginine at position 495 of the renal sodium-dependent phosphate transporter, SLC34A1, is involved in disease pathogenesis in these patients. Our report of the second family with two mutated SLC34A1 alleles expands the known phenotype of this rare condition. PMID:25050900

[Pro731Ser mutation in the β-myosin heavy chain and hypertrophic cardiomyopathy in a Chinese pedigree].

PubMed

Zhao, Xintao; Wu, Yajie; Chen, Yi; Feng, Xinxing; Song, Ying; Wang, Yilu; Zou, Yubao; Wang, Jizheng; Shao, Yibing; Hui, Rutai; Song, Lei; Wang, Xu

2014-07-01

To identify the casual mutation of a Chinese pedigree with hypertrophic cardiomyopathy (HCM), and to analyze the genotype-phenotype relationship. The coding exons of 26 reported disease genes were sequenced by targeted resequencing in the proband and the identified mutation were detected with bi-directional Sanger sequencing in all family members and 307 healthy controls. The genotype-phenotype correlation was analyzed in the family. A missense mutation (c.2191C > T, p. Pro731Ser) in the 20th exon of MYH7 gene was identified. This mutation was absent in 307 healthy controls and predicted to be pathogenic by PolyPhen-HCM. Totally 13 family members carried this mutation, including 10 patients with HCM and 3 asymptomatic mutation carriers. The proband manifested severe congestive heart failure and 8 patients expressed various clinical manifestations of heart failure, including dyspnea, palpitations, chest pain, amaurosis or syncope. Five patients were diagnosed as HCM at the age of 16 or younger. One family member suffered sudden cardiac death. The Pro731Ser of MYH7 gene mutation is a causal and malignant mutation linked with familiar HCM.

Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1

PubMed Central

Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui

2013-01-01

Purpose To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). Methods An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Results Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. Conclusions In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A. PMID:23559863

No exonic mutations at GJB2, GJB3, GJB4, GJB6, ARS (Component B), and LOR genes responsible for a Chinese patient affected by progressive symmetric erythrokeratodermia with pseudoainhum.

PubMed

Zhou, Fusheng; Fu, Hongyang; Liu, Linghua; Cui, Yong; Zhang, Zhengzhong; Chang, Ruixue; Yue, Zhen; Yang, Sen; Zhang, Xuejun

2014-09-01

Progressive symmetric erythrokeratodermia (PSEK) is characterized by symmetric and growing erythematous hyperkeratotic patches over the body shortly after birth, particularly trunk and limbs, the buttocks, and the face, sometimes together with palmoplantar keratoderma (PPK). The GJB2, GJB3, GJB4, GJB6, ARS (Component B), and LOR gene mutation might contribute to PSEK manifestation. This study aimed to identify sequence alteration of these genes in a Chinese PSEK patient with pseudoainhum. Genomic DNA was purified from the patient's peripheral blood. Mutation analysis of target genes was performed by direct sequencing using ABI 3730 sequencer No exonic mutations was identified in the aforementioned genes. The result underlines the genetic heterogeneity of PSEK and other related erythrokeratodermas. © 2014 The International Society of Dermatology.

Comparison of Immunohistochemistry and Direct Sanger Sequencing for Detection of the BRAFV600E Mutation in Thyroid Neoplasm

PubMed Central

Oh, Hye-Seon; Kwon, Hyemi; Park, Suyeon; Kim, Mijin; Jeon, Min Ji; Kim, Tae Yong; Shong, Young Kee; Kim, Won Bae; Choi, Jene

2018-01-01

Background The BRAFV600E mutation is the most common genetic alteration identified in papillary thyroid carcinoma (PTC). Because of its costs effectiveness and sensitivity, direct Sanger sequencing has several limitations. The aim of this study was to evaluate the efficiency of immunohistochemistry (IHC) as an alternative method to detect the BRAFV600E mutation in preoperative and postoperative tissue samples. Methods We evaluated 71 patients who underwent thyroid surgery with the result of direct sequencing of the BRAFV600E mutation. IHC staining of the BRAFV600E mutation was performed in 49 preoperative and 23 postoperative thyroid specimens. Results Sixty-two patients (87.3%) had PTC, and of these, BRAFV600E was confirmed by direct sequencing in 57 patients (91.9%). In 23 postoperative tissue samples, the BRAFV600E mutation was detected in 16 samples (70%) by direct sequencing and 18 samples (78%) by IHC. In 24 fine needle aspiration (FNA) samples, BRAFV600E was detected in 18 samples (75%) by direct sequencing and 16 samples (67%) by IHC. In 25 core needle biopsy (CNB) samples, the BRAFV600E mutation was detected in 15 samples (60%) by direct sequencing and 16 samples (64%) by IHC. The sensitivity and specificity of IHC for detecting the BRAFV600E mutation were 77.8% and 66.7% in FNA samples and 99.3% and 80.0% in CNB samples. Conclusion IHC could be an alternative method to direct Sanger sequencing for BRAFV600E mutation detection both in postoperative and preoperative samples. However, application of IHC to detect the BRAFV600E mutation in FNA samples is of limited value compared with direct sequencing. PMID:29388401

EIF2AK4 Mutations in Patients Diagnosed With Pulmonary Arterial Hypertension.

PubMed

Best, D Hunter; Sumner, Kelli L; Smith, Benjamin P; Damjanovich-Colmenares, Kristy; Nakayama, Ikue; Brown, Lynette M; Ha, Youna; Paul, Eleri; Morris, Ashley; Jama, Mohamed A; Dodson, Mark W; Bayrak-Toydemir, Pinar; Elliott, C Gregory

2017-04-01

Differentiating pulmonary venoocclusive disease (PVOD) and pulmonary capillary hemangiomatosis (PCH) from idiopathic pulmonary arterial hypertension (IPAH) or heritable pulmonary arterial hypertension (HPAH) is important clinically. Mutations in eukaryotic translation initiation factor 2 alpha kinase 4 (EIF2AK4) cause heritable PVOD and PCH, whereas mutations in other genes cause HPAH. The aim of this study was to describe the frequency of pathogenic EIF2AK4 mutations in patients diagnosed clinically with IPAH or HPAH. Sanger sequencing and deletion/duplication analysis were performed to detect mutations in the bone morphogenetic protein receptor type II (BMPR2) gene in 81 patients diagnosed at 30 North American medical centers with IPAH (n = 72) or HPAH (n = 9). BMPR2 mutation-negative patients (n = 67) were sequenced for mutations in four other genes (ACVRL1, ENG, CAV1, and KCNK3) known to cause HPAH. Patients negative for mutations in all known PAH genes (n = 66) were then sequenced for mutations in EIF2AK4. We assessed the pathogenicity of EIF2AK4 mutations and reviewed clinical characteristics of patients with pathogenic EIF2AK4 mutations. Pathogenic BMPR2 mutations were identified in 8 of 72 (11.1%) patients with IPAH and 6 of 9 (66.7%) patients with HPAH. A novel homozygous EIF2AK4 mutation (c.257+4A>C) was identified in 1 of 9 (11.1%) patients diagnosed with HPAH. The novel EIF2AK4 mutation (c.257+4A>C) was homozygous in two sisters with severe pulmonary hypertension. None of the 72 patients with IPAH had biallelic EIF2AK4 mutations. Pathogenic biallelic EIF2AK4 mutations are rarely identified in patients diagnosed with HPAH. Identification of pathogenic biallelic EIF2AK4 mutations can aid clinicians in differentiating HPAH from heritable PVOD or PCH. Copyright © 2016 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

Sequence alterations in RX in patients with microphthalmia, anophthalmia, and coloboma

PubMed Central

London, Nikolas J.S.; Kessler, Patricia; Williams, Bryan; Pauer, Gayle J.; Hagstrom, Stephanie A.

2009-01-01

Purpose Microphthalmia, anophthalmia, and coloboma are ocular malformations with a significant genetic component. Rx is a homeobox gene expressed early in the developing retina and is important in retinal cell fate specification as well as stem cell proliferation. We screened a group of 24 patients with microphthalmia, coloboma, and/or anophthalmia for RX mutations. Methods We used standard PCR and automated sequencing techniques to amplify and sequence each of the three RX exons. Patients’ charts were reviewed for clinical information. The pathologic impact of the identified sequence variant was analyzed by computational methods using PolyPhen and PMut algorithms. Results In addition to the polymorphisms we identified a single patient with coloboma having a heterozygous nucleotide change (g.197G>C) in the first exon that results in a missense mutation of arginine to threonine at amino acid position 66 (R66T). In silico analysis predicted R66T to be a deleterious mutation. Conclusions Sequence variations in RX are uncommon in patients with congenital ocular malformations, but may play a role in disease pathogenesis. We observed a missense mutation in RX in a patient with a small, typical chorioretinal coloboma, and postulate that the mutation is responsible for the patient’s phenotype. PMID:19158959

Unexpected allelic heterogeneity and spectrum of mutations in Fowler syndrome revealed by next-generation exome sequencing.

PubMed

Lalonde, Emilie; Albrecht, Steffen; Ha, Kevin C H; Jacob, Karine; Bolduc, Nathalie; Polychronakos, Constantin; Dechelotte, Pierre; Majewski, Jacek; Jabado, Nada

2010-08-01

Protein coding genes constitute approximately 1% of the human genome but harbor 85% of the mutations with large effects on disease-related traits. Therefore, efficient strategies for selectively sequencing complete coding regions (i.e., "whole exome") have the potential to contribute our understanding of human diseases. We used a method for whole-exome sequencing coupling Agilent whole-exome capture to the Illumina DNA-sequencing platform, and investigated two unrelated fetuses from nonconsanguineous families with Fowler Syndrome (FS), a stereotyped phenotype lethal disease. We report novel germline mutations in feline leukemia virus subgroup C cellular-receptor-family member 2, FLVCR2, which has recently been shown to cause FS. Using this technology, we identified three types of genetic abnormalities: point-mutations, insertions-deletions, and intronic splice-site changes (first pathogenic report using this technology), in the fetuses who both were compound heterozygotes for the disease. Although revealing a high level of allelic heterogeneity and mutational spectrum in FS, this study further illustrates the successful application of whole-exome sequencing to uncover genetic defects in rare Mendelian disorders. Of importance, we show that we can identify genes underlying rare, monogenic and recessive diseases using a limited number of patients (n=2), in the absence of shared genetic heritage and in the presence of allelic heterogeneity.

Detection of Rare Mutations in EGFR-ARMS-PCR-Negative Lung Adenocarcinoma by Sanger Sequencing.

PubMed

Liang, Chaoyue; Wu, Zhuolin; Gan, Xiaohong; Liu, Yuanbin; You, You; Liu, Chenxian; Zhou, Chengzhi; Liang, Ying; Mo, Haiyun; Chen, Allen M; Zhang, Jiexia

2018-01-01

This study aimed to identify potential epidermal growth factor receptor (EGFR) gene mutations in non-small cell lung cancer that went undetected by amplification refractory mutation system-Scorpion real-time PCR (ARMS-PCR). A total of 200 specimens were obtained from the First Affiliated Hospital of Guangzhou Medical University from August 2014 to August 2015. In total, 100 ARMS-negative and 100 ARMS-positive specimens were evaluated for EGFR gene mutations by Sanger sequencing. The methodology and sensitivity of each method and the outcomes of EGFR-tyrosine kinase inhibitor (TKI) therapy were analyzed. Among the 100 ARMS-PCR-positive samples, 90 were positive by Sanger sequencing, while 10 cases were considered negative, because the mutation abundance was less than 10%. Among the 100 negative cases, three were positive for a rare EGFR mutation by Sanger sequencing. In the curative effect analysis of EGFR-TKIs, the progression-free survival (PFS) analysis based on ARMS and Sanger sequencing results showed no difference. However, the PFS of patients with a high abundance of EGFR mutation was 12.4 months [95% confidence interval (CI), 11.6-12.4 months], which was significantly higher than that of patients with a low abundance of mutations detected by Sanger sequencing (95% CI, 10.7-11.3 months) (p<0.001). The ARMS method demonstrated higher sensitivity than Sanger sequencing, but was prone to missing mutations due to primer design. Sanger sequencing was able to detect rare EGFR mutations and deemed applicable for confirming EGFR status. A clinical trial evaluating the efficacy of EGFR-TKIs in patients with rare EGFR mutations is needed. © Copyright: Yonsei University College of Medicine 2018

Whole genome re-sequencing identifies a mutation in an ABC transporter (mdr2) in a Plasmodium chabaudi clone with altered susceptibility to antifolate drugs☆

PubMed Central

Martinelli, Axel; Henriques, Gisela; Cravo, Pedro; Hunt, Paul

2011-01-01

In malaria parasites, mutations in two genes of folate biosynthesis encoding dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) modify responses to antifolate therapies which target these enzymes. However, the involvement of other genes which modify the availability of exogenous folate, for example, has been proposed. Here, we used short-read whole-genome re-sequencing to determine the mutations in a clone of the rodent malaria parasite, Plasmodium chabaudi, which has altered susceptibility to both sulphadoxine and pyrimethamine. This clone bears a previously identified S106N mutation in dhfr and no mutation in dhps. Instead, three additional point mutations in genes on chromosomes 2, 13 and 14 were identified. The mutated gene on chromosome 13 (mdr2 K392Q) encodes an ABC transporter. Because Quantitative Trait Locus analysis previously indicated an association of genetic markers on chromosome 13 with responses to individual and combined antifolates, MDR2 is proposed to modulate antifolate responses, possibly mediated by the transport of folate intermediates. PMID:20858498

Usher syndrome in Denmark: mutation spectrum and some clinical observations.

PubMed

Dad, Shzeena; Rendtorff, Nanna Dahl; Tranebjærg, Lisbeth; Grønskov, Karen; Karstensen, Helena Gásdal; Brox, Vigdis; Nilssen, Øivind; Roux, Anne-Françoise; Rosenberg, Thomas; Jensen, Hanne; Møller, Lisbeth Birk

2016-09-01

Usher syndrome (USH) is a genetically heterogeneous deafness-blindness syndrome, divided into three clinical subtypes: USH1, USH2 and USH3. Mutations in 21 out of 26 investigated Danish unrelated individuals with USH were identified, using a combination of molecular diagnostic methods. Before Next Generation Sequencing (NGS) became available mutations in nine individuals (1 USH1, 7 USH2, 1 USH3) were identified by Sanger sequencing of USH1C , USH2A or CLRN1 or by Arrayed Primer EXtension (APEX) method. Mutations in 12 individuals (7 USH1, 5 USH2) were found by targeted NGS of ten known USH genes. Five novel pathogenic variants were identified. We combined our data with previously published, and obtained an overview of the USH mutation spectrum in Denmark, including 100 unrelated individuals; 32 with USH1, 67 with USH2, and 1 with USH3. Macular edema was observed in 44 of 117 individuals. Olfactory function was tested in 12 individuals and found to be within normal range in all. Mutations that lead to USH1 were predominantly identified in MYO7A (75%), whereas all mutations in USH2 cases were identified in USH2A . The MYO7A mutation c.93C>A, p.(Cys31*) accounted for 33% of all USH1 mutations and the USH2A c.2299delG, p.(Glu767Serfs*21) variant accounted for 45% of all USH2 mutations in the Danish cohort.

Target gene analyses of 39 amelogenesis imperfecta kindreds

PubMed Central

Chan, Hui-Chen; Estrella, Ninna M. R. P.; Milkovich, Rachel N.; Kim, Jung-Wook; Simmer, James P.; Hu, Jan C-C.

2012-01-01

Previously, mutational analyses identified six disease-causing mutations in 24 amelogenesis imperfecta (AI) kindreds. We have since expanded the number of AI kindreds to 39, and performed mutation analyses covering the coding exons and adjoining intron sequences for the six proven AI candidate genes [amelogenin (AMELX), enamelin (ENAM), family with sequence similarity 83, member H (FAM83H), WD repeat containing domain 72 (WDR72), enamelysin (MMP20), and kallikrein-related peptidase 4 (KLK4)] and for ameloblastin (AMBN) (a suspected candidate gene). All four of the X-linked AI families (100%) had disease-causing mutations in AMELX, suggesting that AMELX is the only gene involved in the aetiology of X-linked AI. Eighteen families showed an autosomal-dominant pattern of inheritance. Disease-causing mutations were identified in 12 (67%): eight in FAM83H, and four in ENAM. No FAM83H coding-region or splice-junction mutations were identified in three probands with autosomal-dominant hypocalcification AI (ADHCAI), suggesting that a second gene may contribute to the aetiology of ADHCAI. Six families showed an autosomal-recessive pattern of inheritance, and disease-causing mutations were identified in three (50%): two in MMP20, and one in WDR72. No disease-causing mutations were found in 11 families with only one affected member. We conclude that mutation analyses of the current candidate genes for AI have about a 50% chance of identifying the disease-causing mutation in a given kindred. PMID:22243262

Novel TMEM98 mutations in pedigrees with autosomal dominant nanophthalmos

PubMed Central

Khorram, David; Choi, Michael; Roos, Ben R.; Stone, Edwin M.; Kopel, Teresa; Allen, Richard; Alward, Wallace L.M.; Scheetz, Todd E.

2015-01-01

Purpose Autosomal dominant nanophthalmos is an inherited eye disorder characterized by a structurally normal but smaller eye. Patients with nanophthalmos have high hyperopia (far-sightedness), a greater incidence of angle-closure glaucoma, and increased risk of surgical complications. In this study, the clinical features and the genetic basis of nanophthalmos were investigated in two large autosomal dominant nanophthalmos pedigrees. Methods Fourteen members of a Caucasian pedigree from the United States and 15 members of a pedigree from the Mariana Islands enrolled in a genetic study of nanophthalmos and contributed DNA samples. Twenty of 29 family members underwent eye examinations that included measurement of axial eye length and/or refractive error. The genetic basis of nanophthalmos in the pedigrees was studied with linkage analysis, whole exome sequencing, and candidate gene (i.e., TMEM98) sequencing to identify the nanophthalmos-causing gene. Results Nine members of the pedigree from the United States and 11 members of the pedigree from the Mariana Islands were diagnosed with nanophthalmos that is transmitted as an autosomal dominant trait. The patients with nanophthalmos had abnormally short axial eye lengths, which ranged from 15.9 to 18.4 mm. Linkage analysis of the nanophthalmos pedigree from the United States identified nine large regions of the genome (greater than 10 Mbp) that were coinherited with disease in this family. Genes within these “linked regions” were examined for disease-causing mutations using exome sequencing, and a His196Pro mutation was detected in the TMEM98 gene, which was recently reported to be a nanophthalmos gene. Sanger sequencing subsequently showed that all other members of this pedigree with nanophthalmos also carry the His196Pro TMEM98 mutation. Testing the Mariana Islands pedigree for TMEM98 mutations identified a 34 bp heterozygous deletion that spans the 3′ end of exon 4 in all affected family members. Neither TMEM98 mutation was detected in public exome sequence databases. Conclusions A recent report identified a single TMEM98 missense mutation in a nanophthalmos pedigree. Our discovery of two additional TMEM98 mutations confirms the important role of the gene in the pathogenesis of autosomal dominant nanophthalmos. PMID:26392740

Novel TMEM98 mutations in pedigrees with autosomal dominant nanophthalmos.

PubMed

Khorram, David; Choi, Michael; Roos, Ben R; Stone, Edwin M; Kopel, Teresa; Allen, Richard; Alward, Wallace L M; Scheetz, Todd E; Fingert, John H

2015-01-01

Autosomal dominant nanophthalmos is an inherited eye disorder characterized by a structurally normal but smaller eye. Patients with nanophthalmos have high hyperopia (far-sightedness), a greater incidence of angle-closure glaucoma, and increased risk of surgical complications. In this study, the clinical features and the genetic basis of nanophthalmos were investigated in two large autosomal dominant nanophthalmos pedigrees. Fourteen members of a Caucasian pedigree from the United States and 15 members of a pedigree from the Mariana Islands enrolled in a genetic study of nanophthalmos and contributed DNA samples. Twenty of 29 family members underwent eye examinations that included measurement of axial eye length and/or refractive error. The genetic basis of nanophthalmos in the pedigrees was studied with linkage analysis, whole exome sequencing, and candidate gene (i.e., TMEM98) sequencing to identify the nanophthalmos-causing gene. Nine members of the pedigree from the United States and 11 members of the pedigree from the Mariana Islands were diagnosed with nanophthalmos that is transmitted as an autosomal dominant trait. The patients with nanophthalmos had abnormally short axial eye lengths, which ranged from 15.9 to 18.4 mm. Linkage analysis of the nanophthalmos pedigree from the United States identified nine large regions of the genome (greater than 10 Mbp) that were coinherited with disease in this family. Genes within these "linked regions" were examined for disease-causing mutations using exome sequencing, and a His196Pro mutation was detected in the TMEM98 gene, which was recently reported to be a nanophthalmos gene. Sanger sequencing subsequently showed that all other members of this pedigree with nanophthalmos also carry the His196Pro TMEM98 mutation. Testing the Mariana Islands pedigree for TMEM98 mutations identified a 34 bp heterozygous deletion that spans the 3' end of exon 4 in all affected family members. Neither TMEM98 mutation was detected in public exome sequence databases. A recent report identified a single TMEM98 missense mutation in a nanophthalmos pedigree. Our discovery of two additional TMEM98 mutations confirms the important role of the gene in the pathogenesis of autosomal dominant nanophthalmos.

Microfluidic screening and whole-genome sequencing identifies mutations associated with improved protein secretion by yeast.

PubMed

Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L; Hallström, Björn M; Liu, Zihe; Petranovic, Dina; Uhlén, Mathias; Joensson, Haakan N; Andersson-Svahn, Helene; Nielsen, Jens

2015-08-25

There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant α-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330 mutations in total. Gene ontology analysis of mutated genes revealed many biological processes, including some that have not been identified before in the context of protein secretion. Mutated genes identified in this study can be potentially used for reverse metabolic engineering, with the objective to construct efficient cell factories for protein secretion. The combined use of microfluidics screening and whole-genome sequencing to map the mutations associated with the improved phenotype can easily be adapted for other products and cell types to identify novel engineering targets, and this approach could broadly facilitate design of novel cell factories.

Reality of Single Circulating Tumor Cell Sequencing for Molecular Diagnostics in Pancreatic Cancer.

PubMed

Court, Colin M; Ankeny, Jacob S; Sho, Shonan; Hou, Shuang; Li, Qingyu; Hsieh, Carolyn; Song, Min; Liao, Xinfang; Rochefort, Matthew M; Wainberg, Zev A; Graeber, Thomas G; Tseng, Hsian-Rong; Tomlinson, James S

2016-09-01

To understand the potential and limitations of circulating tumor cell (CTC) sequencing for molecular diagnostics, we investigated the feasibility of identifying the ubiquitous KRAS mutation in single CTCs from pancreatic cancer (PC) patients. We used the NanoVelcro/laser capture microdissection CTC platform, combined with whole genome amplification and KRAS Sanger sequencing. We assessed both KRAS codon-12 coverage and the degree that allele dropout during whole genome amplification affected the detection of KRAS mutations from single CTCs. We isolated 385 single cells, 163 from PC cell lines and 222 from the blood of 12 PC patients, and obtained KRAS sequence coverage in 218 of 385 single cells (56.6%). For PC cell lines with known KRAS mutations, single mutations were detected in 67% of homozygous cells but only 37.4% of heterozygous single cells, demonstrating that both coverage and allele dropout are important causes of mutation detection failure from single cells. We could detect KRAS mutations in CTCs from 11 of 12 patients (92%) and 33 of 119 single CTCs sequenced, resulting in a KRAS mutation detection rate of 27.7%. Importantly, KRAS mutations were never found in the 103 white blood cells sequenced. Sequencing of groups of cells containing between 1 and 100 cells determined that at least 10 CTCs are likely required to reliably assess KRAS mutation status from CTCs. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Mutation analysis of 272 Spanish families affected by autosomal recessive retinitis pigmentosa using a genotyping microarray.

PubMed

Ávila-Fernández, Almudena; Cantalapiedra, Diego; Aller, Elena; Vallespín, Elena; Aguirre-Lambán, Jana; Blanco-Kelly, Fiona; Corton, M; Riveiro-Álvarez, Rosa; Allikmets, Rando; Trujillo-Tiebas, María José; Millán, José M; Cremers, Frans P M; Ayuso, Carmen

2010-12-03

Retinitis pigmentosa (RP) is a genetically heterogeneous disorder characterized by progressive loss of vision. The aim of this study was to identify the causative mutations in 272 Spanish families using a genotyping microarray. 272 unrelated Spanish families, 107 with autosomal recessive RP (arRP) and 165 with sporadic RP (sRP), were studied using the APEX genotyping microarray. The families were also classified by clinical criteria: 86 juveniles and 186 typical RP families. Haplotype and sequence analysis were performed to identify the second mutated allele. At least one-gene variant was found in 14% and 16% of the juvenile and typical RP groups respectively. Further study identified four new mutations, providing both causative changes in 11% of the families. Retinol Dehydrogenase 12 (RDH12) was the most frequently mutated gene in the juvenile RP group, and Usher Syndrome 2A (USH2A) and Ceramide Kinase-Like (CERKL) were the most frequently mutated genes in the typical RP group. The only variant found in CERKL was p.Arg257Stop, the most frequent mutation. The genotyping microarray combined with segregation and sequence analysis allowed us to identify the causative mutations in 11% of the families. Due to the low number of characterized families, this approach should be used in tandem with other techniques.

Identification of mutations in the PI3K-AKT-mTOR signalling pathway in patients with macrocephaly and developmental delay and/or autism.

PubMed

Yeung, Kit San; Tso, Winnie Wan Yee; Ip, Janice Jing Kun; Mak, Christopher Chun Yu; Leung, Gordon Ka Chun; Tsang, Mandy Ho Yin; Ying, Dingge; Pei, Steven Lim Cho; Lee, So Lun; Yang, Wanling; Chung, Brian Hon-Yin

2017-01-01

Macrocephaly, which is defined as a head circumference greater than or equal to + 2 standard deviations, is a feature commonly observed in children with developmental delay and/or autism spectrum disorder. Although PTEN is a well-known gene identified in patients with this syndromic presentation, other genes in the PI3K-AKT-mTOR signalling pathway have also recently been suggested to have important roles. The aim of this study is to characterise the mutation spectrum of this group of patients. We performed whole-exome sequencing of 21 patients with macrocephaly and developmental delay/autism spectrum disorder. Sources of genomic DNA included blood, buccal mucosa and saliva. Germline mutations were validated by Sanger sequencing, whereas somatic mutations were validated by droplet digital PCR. We identified ten pathogenic/likely pathogenic mutations in PTEN ( n  = 4), PIK3CA ( n  = 3), MTOR ( n  = 1) and PPP2R5D ( n  = 2) in ten patients. An additional PTEN mutation, which was classified as variant of unknown significance, was identified in a patient with a pathogenic PTEN mutation, making him harbour bi-allelic germline PTEN mutations. Two patients harboured somatic PIK3CA mutations, and the level of somatic mosaicism in blood DNA was low. Patients who tested positive for mutations in the PI3K-AKT-mTOR pathway had a lower developmental quotient than the rest of the cohort (DQ = 62.8 vs. 76.1, p = 0.021). Their dysmorphic features were non-specific, except for macrocephaly. Among the ten patients with identified mutations, brain magnetic resonance imaging was performed in nine, all of whom showed megalencephaly. We identified mutations in the PI3K-AKT-mTOR signalling pathway in nearly half of our patients with macrocephaly and developmental delay/autism spectrum disorder. These patients have subtle dysmorphic features and mild developmental issues. Clinically, patients with germline mutations are difficult to distinguish from patients with somatic mutations, and therefore, sequencing of buccal or saliva DNA is important to identify somatic mosaicism. Given the high diagnostic yield and the management implications, we suggest implementing comprehensive genetic testing in the PI3K-AKT-mTOR pathway in the clinical evaluation of patients with macrocephaly and developmental delay and/or autism spectrum disorder.

Targeted therapy according to next generation sequencing-based panel sequencing.

PubMed

Saito, Motonobu; Momma, Tomoyuki; Kono, Koji

2018-04-17

Targeted therapy against actionable gene mutations shows a significantly higher response rate as well as longer survival compared to conventional chemotherapy, and has become a standard therapy for many cancers. Recent progress in next-generation sequencing (NGS) has enabled to identify huge number of genetic aberrations. Based on sequencing results, patients recommend to undergo targeted therapy or immunotherapy. In cases where there are no available approved drugs for the genetic mutations detected in the patients, it is recommended to be facilitate the registration for the clinical trials. For that purpose, a NGS-based sequencing panel that can simultaneously target multiple genes in a single investigation has been used in daily clinical practice. To date, various types of sequencing panels have been developed to investigate genetic aberrations with tumor somatic genome variants (gain-of-function or loss-of-function mutations, high-level copy number alterations, and gene fusions) through comprehensive bioinformatics. Because sequencing panels are efficient and cost-effective, they are quickly being adopted outside the lab, in hospitals and clinics, in order to identify personal targeted therapy for individual cancer patients.

Phenotypic spectrum associated with mutations of the mitochondrial polymerase gamma gene.

PubMed

Horvath, Rita; Hudson, Gavin; Ferrari, Gianfrancesco; Fütterer, Nancy; Ahola, Sofia; Lamantea, Eleonora; Prokisch, Holger; Lochmüller, Hanns; McFarland, Robert; Ramesh, V; Klopstock, Thomas; Freisinger, Peter; Salvi, Fabrizio; Mayr, Johannes A; Santer, Rene; Tesarova, Marketa; Zeman, Jiri; Udd, Bjarne; Taylor, Robert W; Turnbull, Douglass; Hanna, Michael; Fialho, Doreen; Suomalainen, Anu; Zeviani, Massimo; Chinnery, Patrick F

2006-07-01

Mutations in the gene coding for the catalytic subunit of the mitochondrial DNA (mtDNA) polymerase gamma (POLG1) have recently been described in patients with diverse clinical presentations, revealing a complex relationship between genotype and phenotype in patients and their families. POLG1 was sequenced in patients from different European diagnostic and research centres to define the phenotypic spectrum and advance understanding of the recurrence risks. Mutations were identified in 38 cases, with the majority being sporadic compound heterozygotes. Eighty-nine DNA sequence changes were identified, including 2 predicted to alter a splice site, 1 predicted to cause a premature stop codon and 13 predicted to cause novel amino acid substitutions. The majority of children had a mutation in the linker region, often 1399G-->A (A467T), and a mutation affecting the polymerase domain. Others had mutations throughout the gene, and 11 had 3 or more substitutions. The clinical presentation ranged from the neonatal period to late adult life, with an overlapping phenotypic spectrum from severe encephalopathy and liver failure to late-onset external ophthalmoplegia, ataxia, myopathy and isolated muscle pain or epilepsy. There was a strong gender bias in children, with evidence of an environmental interaction with sodium valproate. POLG1 mutations cause an overlapping clinical spectrum of disease with both dominant and recessive modes of inheritance. 1399G-->A (A467T) is common in children, but complete POLG1 sequencing is required to identify multiple mutations that can have complex implications for genetic counselling.

Targeted next-generation sequencing in steroid-resistant nephrotic syndrome: mutations in multiple glomerular genes may influence disease severity.

PubMed

Bullich, Gemma; Trujillano, Daniel; Santín, Sheila; Ossowski, Stephan; Mendizábal, Santiago; Fraga, Gloria; Madrid, Álvaro; Ariceta, Gema; Ballarín, José; Torra, Roser; Estivill, Xavier; Ars, Elisabet

2015-09-01

Genetic diagnosis of steroid-resistant nephrotic syndrome (SRNS) using Sanger sequencing is complicated by the high genetic heterogeneity and phenotypic variability of this disease. We aimed to improve the genetic diagnosis of SRNS by simultaneously sequencing 26 glomerular genes using massive parallel sequencing and to study whether mutations in multiple genes increase disease severity. High-throughput mutation analysis was performed in 50 SRNS and/or focal segmental glomerulosclerosis (FSGS) patients, a validation cohort of 25 patients with known pathogenic mutations, and a discovery cohort of 25 uncharacterized patients with probable genetic etiology. In the validation cohort, we identified the 42 previously known pathogenic mutations across NPHS1, NPHS2, WT1, TRPC6, and INF2 genes. In the discovery cohort, disease-causing mutations in SRNS/FSGS genes were found in nine patients. We detected three patients with mutations in an SRNS/FSGS gene and COL4A3. Two of them were familial cases and presented a more severe phenotype than family members with mutation in only one gene. In conclusion, our results show that massive parallel sequencing is feasible and robust for genetic diagnosis of SRNS/FSGS. Our results indicate that patients carrying mutations in an SRNS/FSGS gene and also in COL4A3 gene have increased disease severity.

Molecular defects identified by whole exome sequencing in a child with Fanconi anemia.

PubMed

Zheng, Zhaojing; Geng, Juan; Yao, Ru-En; Li, Caihua; Ying, Daming; Shen, Yongnian; Ying, Lei; Yu, Yongguo; Fu, Qihua

2013-11-10

Fanconi anemia is a rare genetic disease characterized by bone marrow failure, multiple congenital malformations, and an increased susceptibility to malignancy. At least 15 genes have been identified that are involved in the pathogenesis of Fanconi anemia. However, it is still a challenge to assign the complementation group and to characterize the molecular defects in patients with Fanconi anemia. In the current study, whole exome sequencing was used to identify the affected gene(s) in a boy with Fanconi anemia. A recurring, non-synonymous mutation was found (c.3971C>T, p.P1324L) as well as a novel frameshift mutation (c.989_995del, p.H330LfsX2) in FANCA gene. Our results indicate that whole exome sequencing may be useful in clinical settings for rapid identification of disease-causing mutations in rare genetic disorders such as Fanconi anemia. © 2013 Elsevier B.V. All rights reserved.

Whole Exome Sequencing of Patients with Steroid-Resistant Nephrotic Syndrome.

PubMed

Warejko, Jillian K; Tan, Weizhen; Daga, Ankana; Schapiro, David; Lawson, Jennifer A; Shril, Shirlee; Lovric, Svjetlana; Ashraf, Shazia; Rao, Jia; Hermle, Tobias; Jobst-Schwan, Tilman; Widmeier, Eugen; Majmundar, Amar J; Schneider, Ronen; Gee, Heon Yung; Schmidt, J Magdalena; Vivante, Asaf; van der Ven, Amelie T; Ityel, Hadas; Chen, Jing; Sadowski, Carolin E; Kohl, Stefan; Pabst, Werner L; Nakayama, Makiko; Somers, Michael J G; Rodig, Nancy M; Daouk, Ghaleb; Baum, Michelle; Stein, Deborah R; Ferguson, Michael A; Traum, Avram Z; Soliman, Neveen A; Kari, Jameela A; El Desoky, Sherif; Fathy, Hanan; Zenker, Martin; Bakkaloglu, Sevcan A; Müller, Dominik; Noyan, Aytul; Ozaltin, Fatih; Cadnapaphornchai, Melissa A; Hashmi, Seema; Hopcian, Jeffrey; Kopp, Jeffrey B; Benador, Nadine; Bockenhauer, Detlef; Bogdanovic, Radovan; Stajić, Nataša; Chernin, Gil; Ettenger, Robert; Fehrenbach, Henry; Kemper, Markus; Munarriz, Reyner Loza; Podracka, Ludmila; Büscher, Rainer; Serdaroglu, Erkin; Tasic, Velibor; Mane, Shrikant; Lifton, Richard P; Braun, Daniela A; Hildebrandt, Friedhelm

2018-01-06

Steroid-resistant nephrotic syndrome overwhelmingly progresses to ESRD. More than 30 monogenic genes have been identified to cause steroid-resistant nephrotic syndrome. We previously detected causative mutations using targeted panel sequencing in 30% of patients with steroid-resistant nephrotic syndrome. Panel sequencing has a number of limitations when compared with whole exome sequencing. We employed whole exome sequencing to detect monogenic causes of steroid-resistant nephrotic syndrome in an international cohort of 300 families. Three hundred thirty-five individuals with steroid-resistant nephrotic syndrome from 300 families were recruited from April of 1998 to June of 2016. Age of onset was restricted to <25 years of age. Exome data were evaluated for 33 known monogenic steroid-resistant nephrotic syndrome genes. In 74 of 300 families (25%), we identified a causative mutation in one of 20 genes known to cause steroid-resistant nephrotic syndrome. In 11 families (3.7%), we detected a mutation in a gene that causes a phenocopy of steroid-resistant nephrotic syndrome. This is consistent with our previously published identification of mutations using a panel approach. We detected a causative mutation in a known steroid-resistant nephrotic syndrome gene in 38% of consanguineous families and in 13% of nonconsanguineous families, and 48% of children with congenital nephrotic syndrome. A total of 68 different mutations were detected in 20 of 33 steroid-resistant nephrotic syndrome genes. Fifteen of these mutations were novel. NPHS1 , PLCE1 , NPHS2 , and SMARCAL1 were the most common genes in which we detected a mutation. In another 28% of families, we detected mutations in one or more candidate genes for steroid-resistant nephrotic syndrome. Whole exome sequencing is a sensitive approach toward diagnosis of monogenic causes of steroid-resistant nephrotic syndrome. A molecular genetic diagnosis of steroid-resistant nephrotic syndrome may have important consequences for the management of treatment and kidney transplantation in steroid-resistant nephrotic syndrome. Copyright © 2018 by the American Society of Nephrology.

Identifying EGFR-Expressed Cells and Detecting EGFR Multi-Mutations at Single-Cell Level by Microfluidic Chip

NASA Astrophysics Data System (ADS)

Li, Ren; Zhou, Mingxing; Li, Jine; Wang, Zihua; Zhang, Weikai; Yue, Chunyan; Ma, Yan; Peng, Hailin; Wei, Zewen; Hu, Zhiyuan

2018-03-01

EGFR mutations companion diagnostics have been proved to be crucial for the efficacy of tyrosine kinase inhibitor targeted cancer therapies. To uncover multiple mutations occurred in minority of EGFR-mutated cells, which may be covered by the noises from majority of un-mutated cells, is currently becoming an urgent clinical requirement. Here we present the validation of a microfluidic-chip-based method for detecting EGFR multi-mutations at single-cell level. By trapping and immunofluorescently imaging single cells in specifically designed silicon microwells, the EGFR-expressed cells were easily identified. By in situ lysing single cells, the cell lysates of EGFR-expressed cells were retrieved without cross-contamination. Benefited from excluding the noise from cells without EGFR expression, the simple and cost-effective Sanger's sequencing, but not the expensive deep sequencing of the whole cell population, was used to discover multi-mutations. We verified the new method with precisely discovering three most important EGFR drug-related mutations from a sample in which EGFR-mutated cells only account for a small percentage of whole cell population. The microfluidic chip is capable of discovering not only the existence of specific EGFR multi-mutations, but also other valuable single-cell-level information: on which specific cells the mutations occurred, or whether different mutations coexist on the same cells. This microfluidic chip constitutes a promising method to promote simple and cost-effective Sanger's sequencing to be a routine test before performing targeted cancer therapy.[Figure not available: see fulltext.

Exome sequencing in 32 patients with anophthalmia/microphthalmia and developmental eye defects.

PubMed

Slavotinek, A M; Garcia, S T; Chandratillake, G; Bardakjian, T; Ullah, E; Wu, D; Umeda, K; Lao, R; Tang, P L-F; Wan, E; Madireddy, L; Lyalina, S; Mendelsohn, B A; Dugan, S; Tirch, J; Tischler, R; Harris, J; Clark, M J; Chervitz, S; Patwardhan, A; West, J M; Ursell, P; de Alba Campomanes, A; Schneider, A; Kwok, P-Y; Baranzini, S; Chen, R O

2015-11-01

Anophthalmia/microphthalmia (A/M) is a genetically heterogeneous birth defect for which the etiology is unknown in more than 50% of patients. We used exome sequencing with the ACE Exome(TM) (Personalis, Inc; 18 cases) and UCSF Genomics Core (21 cases) to sequence 28 patients with A/M and four patients with varied developmental eye defects. In the 28 patients with A/M, we identified de novo mutations in three patients (OTX2, p.(Gln91His), RARB, p.Arg387Cys and GDF6, p.Ala249Glu) and inherited mutations in STRA6 in two patients. In patients with developmental eye defects, a female with cataracts and cardiomyopathy had a de novo COL4A1 mutation, p.(Gly773Arg), expanding the phenotype associated with COL4A1 to include cardiomyopathy. A male with a chorioretinal defect, microcephaly, seizures and sensorineural deafness had two PNPT1 mutations, p.(Ala507Ser) and c.401-1G>A, and we describe eye defects associated with this gene for the first time. Exome sequencing was efficient for identifying mutations in pathogenic genes for which there is no clinical testing available and for identifying cases that expand phenotypic spectra, such as the PNPT1 and COL4A1-associated disorders described here. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Rapid identification of lettuce seed germination mutants by bulked segregant analysis and whole genome sequencing.

PubMed

Huo, Heqiang; Henry, Isabelle M; Coppoolse, Eric R; Verhoef-Post, Miriam; Schut, Johan W; de Rooij, Han; Vogelaar, Aat; Joosen, Ronny V L; Woudenberg, Leo; Comai, Luca; Bradford, Kent J

2016-11-01

Lettuce (Lactuca sativa) seeds exhibit thermoinhibition, or failure to complete germination when imbibed at warm temperatures. Chemical mutagenesis was employed to develop lettuce lines that exhibit germination thermotolerance. Two independent thermotolerant lettuce seed mutant lines, TG01 and TG10, were generated through ethyl methanesulfonate mutagenesis. Genetic and physiological analyses indicated that these two mutations were allelic and recessive. To identify the causal gene(s), we applied bulked segregant analysis by whole genome sequencing. For each mutant, bulked DNA samples of segregating thermotolerant (mutant) seeds were sequenced and analyzed for homozygous single-nucleotide polymorphisms. Two independent candidate mutations were identified at different physical positions in the zeaxanthin epoxidase gene (ABSCISIC ACID DEFICIENT 1/ZEAXANTHIN EPOXIDASE, or ABA1/ZEP) in TG01 and TG10. The mutation in TG01 caused an amino acid replacement, whereas the mutation in TG10 resulted in alternative mRNA splicing. Endogenous abscisic acid contents were reduced in both mutants, and expression of the ABA1 gene from wild-type lettuce under its own promoter fully complemented the TG01 mutant. Conventional genetic mapping confirmed that the causal mutations were located near the ZEP/ABA1 gene, but the bulked segregant whole genome sequencing approach more efficiently identified the specific gene responsible for the phenotype. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

[Mutation analysis for a pedigree affected with keratitis-ichthyosis-deafness syndrome].

PubMed

Li, Lulu; Li, Yuan; Lin, Wei; Zhao, Xiuli

2017-10-10

To identify mutation of GJB2 gene and provide genetic counseling for a family affected with keratitis-ichthyosis-deafness (KID) syndrome. Genomic DNA was extracted from peripheral blood samples with a standard phenol-chloroform method. PCR and Sanger sequencing were used to analyze potential mutation in the proband. Suspected mutation was verified with a PCR-high-resolution melting (PCR-HRM) method. T-clone sequencing was applied to determine the parental origin of the mutation. A heterozygous mutation, c.148G>A (p.Asp50Asn), which is located in the exon 1 of the GJB2 gene, was found in the proband. The results was confirmed by HRM analysis. Cloning sequencing suggested that the mutation was derived from the father's germline. The hot-spot mutation c.148G>A (p.Asp50Asn) in the GJB2 gene probably underlies the KID syndrome in this Chinese family. A PCR-HRM method has been established to rapidly detect common mutations associated with this disease.

Mutations in LZTR1 add to the complex heterogeneity of schwannomatosis.

PubMed

Smith, Miriam J; Isidor, Bertand; Beetz, Christian; Williams, Simon G; Bhaskar, Sanjeev S; Richer, Wilfrid; O'Sullivan, James; Anderson, Beverly; Daly, Sarah B; Urquhart, Jill E; Fryer, Alan; Rustad, Cecilie F; Mills, Samantha J; Samii, Amir; du Plessis, Daniel; Halliday, Dorothy; Barbarot, Sebastien; Bourdeaut, Franck; Newman, William G; Evans, D Gareth

2015-01-13

We aimed to determine the proportion of individuals in our schwannomatosis cohort whose disease is associated with an LZTR1 mutation. We used exome sequencing, Sanger sequencing, and copy number analysis to screen 65 unrelated individuals with schwannomatosis who were negative for a germline NF2 or SMARCB1 mutation. We also screened samples from 39 patients with a unilateral vestibular schwannoma (UVS), plus at least one other schwannoma, but who did not have an identifiable germline or mosaic NF2 mutation. We identified germline LZTR1 mutations in 6 of 16 patients (37.5%) with schwannomatosis who had at least one affected relative, 11 of 49 (22%) sporadic patients, and 2 of 39 patients with UVS in our cohort. Three germline mutation-positive patients in total had developed a UVS. Mosaicism was excluded in 3 patients without germline mutation in NF2, SMARCB1, or LZTR1 by mutation screening in 2 tumors from each. Our data confirm the relationship between mutations in LZTR1 and schwannomatosis. They indicate that germline mutations in LZTR1 confer an increased risk of vestibular schwannoma, providing further overlap with NF2, and that further causative genes for schwannomatosis remain to be identified. © 2014 American Academy of Neurology.

On Statistical Modeling of Sequencing Noise in High Depth Data to Assess Tumor Evolution

NASA Astrophysics Data System (ADS)

Rabadan, Raul; Bhanot, Gyan; Marsilio, Sonia; Chiorazzi, Nicholas; Pasqualucci, Laura; Khiabanian, Hossein

2018-07-01

One cause of cancer mortality is tumor evolution to therapy-resistant disease. First line therapy often targets the dominant clone, and drug resistance can emerge from preexisting clones that gain fitness through therapy-induced natural selection. Such mutations may be identified using targeted sequencing assays by analysis of noise in high-depth data. Here, we develop a comprehensive, unbiased model for sequencing error background. We find that noise in sufficiently deep DNA sequencing data can be approximated by aggregating negative binomial distributions. Mutations with frequencies above noise may have prognostic value. We evaluate our model with simulated exponentially expanded populations as well as data from cell line and patient sample dilution experiments, demonstrating its utility in prognosticating tumor progression. Our results may have the potential to identify significant mutations that can cause recurrence. These results are relevant in the pretreatment clinical setting to determine appropriate therapy and prepare for potential recurrence pretreatment.

On Statistical Modeling of Sequencing Noise in High Depth Data to Assess Tumor Evolution

NASA Astrophysics Data System (ADS)

Rabadan, Raul; Bhanot, Gyan; Marsilio, Sonia; Chiorazzi, Nicholas; Pasqualucci, Laura; Khiabanian, Hossein

2017-12-01

One cause of cancer mortality is tumor evolution to therapy-resistant disease. First line therapy often targets the dominant clone, and drug resistance can emerge from preexisting clones that gain fitness through therapy-induced natural selection. Such mutations may be identified using targeted sequencing assays by analysis of noise in high-depth data. Here, we develop a comprehensive, unbiased model for sequencing error background. We find that noise in sufficiently deep DNA sequencing data can be approximated by aggregating negative binomial distributions. Mutations with frequencies above noise may have prognostic value. We evaluate our model with simulated exponentially expanded populations as well as data from cell line and patient sample dilution experiments, demonstrating its utility in prognosticating tumor progression. Our results may have the potential to identify significant mutations that can cause recurrence. These results are relevant in the pretreatment clinical setting to determine appropriate therapy and prepare for potential recurrence pretreatment.

Molecular profiling of appendiceal epithelial tumors using massively parallel sequencing to identify somatic mutations.

PubMed

Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J

2014-07-01

Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts have identified mutational spectra in several subtypes of these tumors that may suggest a phenotypic heterogeneity showing mutations that are relevant for targeted therapies. © 2014 The American Association for Clinical Chemistry.

Somatic mutation load of estrogen receptor-positive breast tumors predicts overall survival: an analysis of genome sequence data.

PubMed

Haricharan, Svasti; Bainbridge, Matthew N; Scheet, Paul; Brown, Powel H

2014-07-01

Breast cancer is one of the most commonly diagnosed cancers in women. While there are several effective therapies for breast cancer and important single gene prognostic/predictive markers, more than 40,000 women die from this disease every year. The increasing availability of large-scale genomic datasets provides opportunities for identifying factors that influence breast cancer survival in smaller, well-defined subsets. The purpose of this study was to investigate the genomic landscape of various breast cancer subtypes and its potential associations with clinical outcomes. We used statistical analysis of sequence data generated by the Cancer Genome Atlas initiative including somatic mutation load (SML) analysis, Kaplan-Meier survival curves, gene mutational frequency, and mutational enrichment evaluation to study the genomic landscape of breast cancer. We show that ER(+), but not ER(-), tumors with high SML associate with poor overall survival (HR = 2.02). Further, these high mutation load tumors are enriched for coincident mutations in both DNA damage repair and ER signature genes. While it is known that somatic mutations in specific genes affect breast cancer survival, this study is the first to identify that SML may constitute an important global signature for a subset of ER(+) tumors prone to high mortality. Moreover, although somatic mutations in individual DNA damage genes affect clinical outcome, our results indicate that coincident mutations in DNA damage response and signature ER genes may prove more informative for ER(+) breast cancer survival. Next generation sequencing may prove an essential tool for identifying pathways underlying poor outcomes and for tailoring therapeutic strategies.

Complete mtDNA sequencing reveals mutations m.9185T>C and m.13513G>A in three patients with Leigh syndrome.

PubMed

Pelnena, Dita; Burnyte, Birute; Jankevics, Eriks; Lace, Baiba; Dagyte, Evelina; Grigalioniene, Kristina; Utkus, Algirdas; Krumina, Zita; Rozentale, Jolanta; Adomaitiene, Irina; Stavusis, Janis; Pliss, Liana; Inashkina, Inna

2017-12-12

The most common mitochondrial disorder in children is Leigh syndrome, which is a progressive and genetically heterogeneous neurodegenerative disorder caused by mutations in nuclear genes or mitochondrial DNA (mtDNA). In the present study, a novel and robust method of complete mtDNA sequencing, which allows amplification of the whole mitochondrial genome, was tested. Complete mtDNA sequencing was performed in a cohort of patients with suspected mitochondrial mutations. Patients from Latvia and Lithuania (n = 92 and n = 57, respectively) referred by clinical geneticists were included. The de novo point mutations m.9185T>C and m.13513G>A, respectively, were detected in two patients with lactic acidosis and neurodegenerative lesions. In one patient with neurodegenerative lesions, the mutation m.9185T>C was identified. These mutations are associated with Leigh syndrome. The present data suggest that full-length mtDNA sequencing is recommended as a supplement to nuclear gene testing and enzymatic assays to enhance mitochondrial disease diagnostics.

Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.

PubMed

Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad

2016-09-01

Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.

CCR4 frameshift mutation identifies a distinct group of adult T cell leukaemia/lymphoma with poor prognosis.

PubMed

Yoshida, Noriaki; Miyoshi, Hiroaki; Kato, Takeharu; Sakata-Yanagimoto, Mamiko; Niino, Daisuke; Taniguchi, Hiroaki; Moriuchi, Yukiyoshi; Miyahara, Masaharu; Kurita, Daisuke; Sasaki, Yuya; Shimono, Joji; Kawamoto, Keisuke; Utsunomiya, Atae; Imaizumi, Yoshitaka; Seto, Masao; Ohshima, Koichi

2016-04-01

Adult T cell leukaemia/lymphoma (ATLL) is an intractable T cell neoplasm caused by human T cell leukaemia virus type 1. Next-generation sequencing-based comprehensive mutation studies have revealed recurrent somatic CCR4 mutations in ATLL, although clinicopathological findings associated with CCR4 mutations remain to be delineated. In the current study, 184 cases of peripheral T cell lymphoma, including 113 cases of ATLL, were subjected to CCR4 mutation analysis. This sequence analysis identified mutations in 27% (30/113) of cases of ATLL and 9% (4/44) of cases of peripheral T cell lymphoma not otherwise specified. Identified mutations included nonsense (NS) and frameshift (FS) mutations. No significant differences in clinicopathological findings were observed between ATLL cases stratified by presence of CCR4 mutation. All ATLL cases with CCR4 mutations exhibited cell-surface CCR4 positivity. Semi-quantitative CCR4 protein analysis of immunohistochemical sections revealed higher CCR4 expression in cases with NS mutations of CCR4 than in cases with wild-type (WT) CCR4. Furthermore, among ATLL cases, FS mutation was significantly associated with a poor prognosis, compared with NS mutation and WT CCR4. These results suggest that CCR4 mutation is an important determinant of the clinical course in ATLL cases, and that NS and FS mutations of CCR4 behave differently with respect to ATLL pathophysiology. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Whole-exome sequencing, without prior linkage, identifies a mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta.

PubMed

Poulter, James A; El-Sayed, Walid; Shore, Roger C; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J

2014-01-01

The conventional approach to identifying the defective gene in a family with an inherited disease is to find the disease locus through family studies. However, the rapid development and decreasing cost of next generation sequencing facilitates a more direct approach. Here, we report the identification of a frameshift mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta (AI). Whole-exome sequencing of three affected family members and subsequent filtering of shared variants, without prior genetic linkage, sufficed to identify the pathogenic variant. Simultaneous analysis of multiple family members confirms segregation, enhancing the power to filter the genetic variation found and leading to rapid identification of the pathogenic variant. LAMB3 encodes a subunit of Laminin-5, one of a family of basement membrane proteins with essential functions in cell growth, movement and adhesion. Homozygous LAMB3 mutations cause junctional epidermolysis bullosa (JEB) and enamel defects are seen in JEB cases. However, to our knowledge, this is the first report of dominant AI due to a LAMB3 mutation in the absence of JEB.

Targeted next generation sequencing identifies novel NOTCH3 gene mutations in CADASIL diagnostics patients.

PubMed

Maksemous, Neven; Smith, Robert A; Haupt, Larisa M; Griffiths, Lyn R

2016-11-24

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a monogenic, hereditary, small vessel disease of the brain causing stroke and vascular dementia in adults. CADASIL has previously been shown to be caused by varying mutations in the NOTCH3 gene. The disorder is often misdiagnosed due to its significant clinical heterogeneic manifestation with familial hemiplegic migraine and several ataxia disorders as well as the location of the currently identified causative mutations. The aim of this study was to develop a new, comprehensive and efficient single assay strategy for complete molecular diagnosis of NOTCH3 mutations through the use of a custom next-generation sequencing (NGS) panel for improved routine clinical molecular diagnostic testing. Our custom NGS panel identified nine genetic variants in NOTCH3 (p.D139V, p.C183R, p.R332C, p.Y465C, p.C597W, p.R607H, p.E813E, p.C977G and p.Y1106C). Six mutations were stereotypical CADASIL mutations leading to an odd number of cysteine residues in one of the 34 NOTCH3 gene epidermal growth factor (EGF)-like repeats, including three new typical cysteine mutations identified in exon 11 (p.C597W; c.1791C>G); exon 18 (p.C977G; c.2929T>G) and exon 20 (p.Y1106C; c.3317A>G). Interestingly, a novel missense mutation in the CACNA1A gene was also identified in one CADASIL patient. All variants identified (novel and known) were further investigated using in silico bioinformatic analyses and confirmed through Sanger sequencing. NGS provides an improved and effective methodology for the diagnosis of CADASIL. The NGS approach reduced time and cost for comprehensive genetic diagnosis, placing genetic diagnostic testing within reach of more patients.

Whole-exome sequencing identifies novel compound heterozygous mutations in USH2A in Spanish patients with autosomal recessive retinitis pigmentosa

PubMed Central

Méndez-Vidal, Cristina; González-del Pozo, María; Vela-Boza, Alicia; Santoyo-López, Javier; López-Domingo, Francisco J.; Vázquez-Marouschek, Carmen; Dopazo, Joaquin; Borrego, Salud

2013-01-01

Purpose Retinitis pigmentosa (RP) is an inherited retinal dystrophy characterized by extreme genetic and clinical heterogeneity. Thus, the diagnosis is not always easily performed due to phenotypic and genetic overlap. Current clinical practices have focused on the systematic evaluation of a set of known genes for each phenotype, but this approach may fail in patients with inaccurate diagnosis or infrequent genetic cause. In the present study, we investigated the genetic cause of autosomal recessive RP (arRP) in a Spanish family in which the causal mutation has not yet been identified with primer extension technology and resequencing. Methods We designed a whole-exome sequencing (WES)-based approach using NimbleGen SeqCap EZ Exome V3 sample preparation kit and the SOLiD 5500×l next-generation sequencing platform. We sequenced the exomes of both unaffected parents and two affected siblings. Exome analysis resulted in the identification of 43,204 variants in the index patient. All variants passing filter criteria were validated with Sanger sequencing to confirm familial segregation and absence in the control population. In silico prediction tools were used to determine mutational impact on protein function and the structure of the identified variants. Results Novel Usher syndrome type 2A (USH2A) compound heterozygous mutations, c.4325T>C (p.F1442S) and c.15188T>G (p.L5063R), located in exons 20 and 70, respectively, were identified as probable causative mutations for RP in this family. Family segregation of the variants showed the presence of both mutations in all affected members and in two siblings who were apparently asymptomatic at the time of family ascertainment. Clinical reassessment confirmed the diagnosis of RP in these patients. Conclusions Using WES, we identified two heterozygous novel mutations in USH2A as the most likely disease-causing variants in a Spanish family diagnosed with arRP in which the cause of the disease had not yet been identified with commonly used techniques. Our data reinforce the clinical role of WES in the molecular diagnosis of highly heterogeneous genetic diseases where conventional genetic approaches have previously failed in achieving a proper diagnosis. PMID:24227914

Frequent genes in rare diseases: panel-based next generation sequencing to disclose causal mutations in hereditary neuropathies.

PubMed

Dohrn, Maike F; Glöckle, Nicola; Mulahasanovic, Lejla; Heller, Corina; Mohr, Julia; Bauer, Christine; Riesch, Erik; Becker, Andrea; Battke, Florian; Hörtnagel, Konstanze; Hornemann, Thorsten; Suriyanarayanan, Saranya; Blankenburg, Markus; Schulz, Jörg B; Claeys, Kristl G; Gess, Burkhard; Katona, Istvan; Ferbert, Andreas; Vittore, Debora; Grimm, Alexander; Wolking, Stefan; Schöls, Ludger; Lerche, Holger; Korenke, G Christoph; Fischer, Dirk; Schrank, Bertold; Kotzaeridou, Urania; Kurlemann, Gerhard; Dräger, Bianca; Schirmacher, Anja; Young, Peter; Schlotter-Weigel, Beate; Biskup, Saskia

2017-12-01

Hereditary neuropathies comprise a wide variety of chronic diseases associated to more than 80 genes identified to date. We herein examined 612 index patients with either a Charcot-Marie-Tooth phenotype, hereditary sensory neuropathy, familial amyloid neuropathy, or small fiber neuropathy using a customized multigene panel based on the next generation sequencing technique. In 121 cases (19.8%), we identified at least one putative pathogenic mutation. Of these, 54.4% showed an autosomal dominant, 33.9% an autosomal recessive, and 11.6% an X-linked inheritance. The most frequently affected genes were PMP22 (16.4%), GJB1 (10.7%), MPZ, and SH3TC2 (both 9.9%), and MFN2 (8.3%). We further detected likely or known pathogenic variants in HINT1, HSPB1, NEFL, PRX, IGHMBP2, NDRG1, TTR, EGR2, FIG4, GDAP1, LMNA, LRSAM1, POLG, TRPV4, AARS, BIC2, DHTKD1, FGD4, HK1, INF2, KIF5A, PDK3, REEP1, SBF1, SBF2, SCN9A, and SPTLC2 with a declining frequency. Thirty-four novel variants were considered likely pathogenic not having previously been described in association with any disorder in the literature. In one patient, two homozygous mutations in HK1 were detected in the multigene panel, but not by whole exome sequencing. A novel missense mutation in KIF5A was considered pathogenic because of the highly compatible phenotype. In one patient, the plasma sphingolipid profile could functionally prove the pathogenicity of a mutation in SPTLC2. One pathogenic mutation in MPZ was identified after being previously missed by Sanger sequencing. We conclude that panel based next generation sequencing is a useful, time- and cost-effective approach to assist clinicians in identifying the correct diagnosis and enable causative treatment considerations. © 2017 International Society for Neurochemistry.

Identification of two novel pathogenic compound heterozygous MYO7A mutations in Usher syndrome by whole exome sequencing.

PubMed

Jia, Ying; Li, Xiaoge; Yang, Dong; Xu, Yi; Guo, Ying; Li, Xin

2018-01-01

The current study aims to identify the pathogenic sites in a core pedigree of Usher syndrome (USH). A core pedigree of USH was analyzed by whole exome sequencing (WES). Mutations were verified by polymerase chain reaction (PCR) amplification and Sanger sequencing. Two pathogenic variations (c.849+2T>C and c.5994G>A) in MYO7A were successfully identified and individually separated from parents. One variant (c.849+2T>C) was nonsense mutation, causing the protein terminated in advance, and the other one (c.5994G>A) located near the boundary of exon could cause aberrant splicing. This study provides a meaningful exploration for identification of clinical core genetic pedigrees. Copyright © 2017 Elsevier B.V. All rights reserved.

Novel compound heterozygous mutations in the OTOF Gene identified by whole-exome sequencing in auditory neuropathy spectrum disorder.

PubMed

Tang, Fengzhu; Ma, Dengke; Wang, Yulan; Qiu, Yuecai; Liu, Fei; Wang, Qingqing; Lu, Qiutian; Shi, Min; Xu, Liang; Liu, Min; Liang, Jianping

2017-03-23

Many hearing-loss diseases are demonstrated to have Mendelian inheritance caused by mutations in single gene. However, many deaf individuals have diseases that remain genetically unexplained. Auditory neuropathy is a sensorineural deafness in which sounds are able to be transferred into the inner ear normally but the transmission of the signals from inner ear to auditory nerve and brain is injured, also known as auditory neuropathy spectrum disorder (ANSD). The pathogenic mutations of the genes responsible for the Chinese ANSD population remain poorly understood. A total of 127 patients with non-syndromic hearing loss (NSHL) were enrolled in Guangxi Zhuang Autonomous Region. A hereditary deafness gene mutation screening was performed to identify the mutation sites in four deafness-related genes (GJB2, GJB3, 12S rRNA, and SLC26A4). In addition, whole-exome sequencing (WES) was applied to explore unappreciated mutation sites in the cases with the singularity of its phenotype. Well-characterized mutations were found in only 8.7% (11/127) of the patients. Interestingly, two mutations in the OTOF gene were identified in two affected siblings with ANSD from a Chinese family, including one nonsense mutation c.1273C > T (p.R425X) and one missense mutation c.4994 T > C (p.L1665P). Furthermore, we employed Sanger sequencing to confirm the mutations in each subject. Two compound heterozygous mutations in the OTOF gene were observed in the two affected siblings, whereas the two parents and unaffected sister were heterozygous carriers of c.1273C > T (father and sister) and c.4994 T > C (mother). The nonsense mutation p.R425X, contributes to a premature stop codon, may result in a truncated polypeptide, which strongly suggests its pathogenicity for ANSD. The missense mutation p.L1665P results in a single amino acid substitution in a highly conserved region. Two mutations in the OTOF gene in the Chinese deaf population were recognized for the first time. These findings not only extend the OTOF gene mutation spectrum for ANSD but also indicate that whole-exome sequencing is an effective approach to clarify the genetic characteristics in non-syndromic ANSD patients.

Identification of a novel splicing mutation within SLC17A8 in a Korean family with hearing loss by whole-exome sequencing.

PubMed

Ryu, Nari; Lee, Seokwon; Park, Hong-Joon; Lee, Byeonghyeon; Kwon, Tae-Jun; Bok, Jinwoong; Park, Chan Ik; Lee, Kyu-Yup; Baek, Jeong-In; Kim, Un-Kyung

2017-09-05

Hereditary hearing loss (HHL) is a common genetically heterogeneous disorder, which follows Mendelian inheritance in humans. Because of this heterogeneity, the identification of the causative gene of HHL by linkage analysis or Sanger sequencing have shown economic and temporal limitations. With recent advances in next-generation sequencing (NGS) techniques, rapid identification of a causative gene via massively parallel sequencing is now possible. We recruited a Korean family with three generations exhibiting autosomal dominant inheritance of hearing loss (HL), and the clinical information about this family revealed that there are no other symptoms accompanied with HL. To identify a causative mutation of HL in this family, we performed whole-exome sequencing of 4 family members, 3 affected and an unaffected. As the result, A novel splicing mutation, c.763+1G>T, in the solute carrier family 17, member 8 (SLC17A8) gene was identified in the patients, and the genotypes of the mutation were co-segregated with the phenotype of HL. Additionally, this mutation was not detected in 100 Koreans with normal hearing. Via NGS, we detected a novel splicing mutation that might influence the hearing ability within the patients with autosomal dominant non-syndromic HL. Our data suggests that this technique is a powerful tool to discover causative genetic factors of HL and facilitate diagnoses of the primary cause of HHL. Copyright © 2017 Elsevier B.V. All rights reserved.

Genome-wide annotation of mutations in a phenotyped mutant library provides an efficient platform for discovery of casual gene mutations

USDA-ARS?s Scientific Manuscript database

Ethyl methanesulfonate (EMS) efficiently generates high-density mutations in genomes. Conventionally, these mutations are identified by techniques that can detect single-nucleotide mismatches in heteroduplexes of individual PCR amplicons. We applied whole-genome sequencing to 256-phenotyped mutant l...

Candidate causative mutation on BTA18 associated with calving and conformation traits in Holstein bulls

USDA-ARS?s Scientific Manuscript database

Complementing quantitative methods with sequence data analysis is a major goal of the post-genome era of biology. In this study, we analyzed Illumina HiSeq sequence data derived from 11 US Holstein bulls in order to identify putative causal mutations associated with calving and conformation traits. ...

Targeted next-generation sequencing identification of mutations in disease resistance gene anologs (RGAs) in wild and cultivated beets

USDA-ARS?s Scientific Manuscript database

Resistance gene analogs (RGAs) were searched bioinformatically in the sugar beet (Beta vulgaris L.) genome as potential candidates for improving resistance against different diseases. In the present study, Ion Torrent sequencing technology was used to identify mutations in 21 RGAs. The DNA samples o...

Rapid BRAF mutation tests in patients with advanced melanoma: comparison of immunohistochemistry, Droplet Digital PCR, and the Idylla Mutation Platform

PubMed Central

Bisschop, Cornelis; ter Elst, Arja; Bosman, Lisette J.; Platteel, Inge; Jalving, Mathilde; van den Berg, Anke; Diepstra, Arjan; van Hemel, Bettien; Diercks, Gilles F.H.; Hospers, Geke A.P.

2018-01-01

BRAF mutational testing has become a common practice in the diagnostic process of patients with advanced melanoma. Although time-consuming, DNA sequencing techniques are the current gold standard for mutational testing. However, in certain clinical situations, a rapid test result is required. In this study, the performance of three rapid BRAF mutation tests was compared. Thirty-nine formalin-fixed paraffin-embedded melanoma tissue samples collected between 2007 and 2014 at a single center were included. These samples were analyzed by immunohistochemistry using the anti-BRAF-V600E (VE1) mouse monocolonal antibody (BRAF-VE1 IHC), a V600E-specific Droplet Digital PCR Test, and the Idylla BRAF- Mutation Test (Idylla). Results were compared with the results of conventional BRAF mutation testing, performed using high-resolution melting analysis followed by Sanger sequencing. Next-generation sequencing was performed on samples with discordant results. The Idylla test and Droplet Digital PCR Test correctly identified all mutated and wild-type samples. BRAF-VE1 IHC showed one discordant result. The Idylla test could identify BRAF-V600 mutations other than BRAF-V600E and was the fastest and least laborious test. The Idylla Mutation Test is the most suitable test for rapid BRAF testing in clinical situations on the basis of the broad coverage of treatment-responsive mutations and the fast procedure without the need to perform a DNA isolation step. PMID:29232304

De novo mutations in ATP1A3 cause alternating hemiplegia of childhood

PubMed Central

Heinzen, Erin L.; Swoboda, Kathryn J.; Hitomi, Yuki; Gurrieri, Fiorella; Nicole, Sophie; de Vries, Boukje; Tiziano, F. Danilo; Fontaine, Bertrand; Walley, Nicole M.; Heavin, Sinéad; Panagiotakaki, Eleni; Fiori, Stefania; Abiusi, Emanuela; Di Pietro, Lorena; Sweney, Matthew T.; Newcomb, Tara M.; Viollet, Louis; Huff, Chad; Jorde, Lynn B.; Reyna, Sandra P.; Murphy, Kelley J.; Shianna, Kevin V.; Gumbs, Curtis E.; Little, Latasha; Silver, Kenneth; Ptác̆ek, Louis J.; Haan, Joost; Ferrari, Michel D.; Bye, Ann M.; Herkes, Geoffrey K.; Whitelaw, Charlotte M.; Webb, David; Lynch, Bryan J.; Uldall, Peter; King, Mary D.; Scheffer, Ingrid E.; Neri, Giovanni; Arzimanoglou, Alexis; van den Maagdenberg, Arn M.J.M.; Sisodiya, Sanjay M.; Mikati, Mohamad A.; Goldstein, David B.; Nicole, Sophie; Gurrieri, Fiorella; Neri, Giovanni; de Vries, Boukje; Koelewijn, Stephany; Kamphorst, Jessica; Geilenkirchen, Marije; Pelzer, Nadine; Laan, Laura; Haan, Joost; Ferrari, Michel; van den Maagdenberg, Arn; Zucca, Claudio; Bassi, Maria Teresa; Franchini, Filippo; Vavassori, Rosaria; Giannotta, Melania; Gobbi, Giuseppe; Granata, Tiziana; Nardocci, Nardo; De Grandis, Elisa; Veneselli, Edvige; Stagnaro, Michela; Gurrieri, Fiorella; Neri, Giovanni; Vigevano, Federico; Panagiotakaki, Eleni; Oechsler, Claudia; Arzimanoglou, Alexis; Nicole, Sophie; Giannotta, Melania; Gobbi, Giuseppe; Ninan, Miriam; Neville, Brian; Ebinger, Friedrich; Fons, Carmen; Campistol, Jaume; Kemlink, David; Nevsimalova, Sona; Laan, Laura; Peeters-Scholte, Cacha; van den Maagdenberg, Arn; Casaer, Paul; Casari, Giorgio; Sange, Guenter; Spiel, Georg; Boneschi, Filippo Martinelli; Zucca, Claudio; Bassi, Maria Teresa; Schyns, Tsveta; Crawley, Francis; Poncelin, Dominique; Vavassori, Rosaria

2012-01-01

Alternating hemiplegia of childhood (AHC) is a rare, severe neurodevelopmental syndrome characterized by recurrent hemiplegic episodes and distinct neurologic manifestations. AHC is usually a sporadic disorder with unknown etiology. Using exome sequencing of seven patients with AHC, and their unaffected parents, we identified de novo nonsynonymous mutations in ATP1A3 in all seven AHC patients. Subsequent sequence analysis of ATP1A3 in 98 additional patients revealed that 78% of AHC cases have a likely causal ATP1A3 mutation, including one inherited mutation in a familial case of AHC. Remarkably, six ATP1A3 mutations explain the majority of patients, including one observed in 36 patients. Unlike ATP1A3 mutations that cause rapid-onset-dystonia-parkinsonism, AHC-causing mutations revealed consistent reductions in ATPase activity without effects on protein expression. This work identifies de novo ATP1A3 mutations as the primary cause of AHC, and offers insight into disease pathophysiology by expanding the spectrum of phenotypes associated with mutations in this gene. PMID:22842232

Analyses of MMP20 Missense Mutations in Two Families with Hypomaturation Amelogenesis Imperfecta.

PubMed

Kim, Youn Jung; Kang, Jenny; Seymen, Figen; Koruyucu, Mine; Gencay, Koray; Shin, Teo Jeon; Hyun, Hong-Keun; Lee, Zang Hee; Hu, Jan C-C; Simmer, James P; Kim, Jung-Wook

2017-01-01

Amelogenesis imperfecta is a group of rare inherited disorders that affect tooth enamel formation, quantitatively and/or qualitatively. The aim of this study was to identify the genetic etiologies of two families presenting with hypomaturation amelogenesis imperfecta. DNA was isolated from peripheral blood samples obtained from participating family members. Whole exome sequencing was performed using DNA samples from the two probands. Sequencing data was aligned to the NCBI human reference genome (NCBI build 37.2, hg19) and sequence variations were annotated with the dbSNP build 138. Mutations in MMP20 were identified in both probands. A homozygous missense mutation (c.678T>A; p.His226Gln) was identified in the consanguineous Family 1. Compound heterozygous MMP20 mutations (c.540T>A, p.Tyr180 * and c.389C>T, p.Thr130Ile) were identified in the non-consanguineous Family 2. Affected persons in Family 1 showed hypomaturation AI with dark brown discoloration, which is similar to the clinical phenotype in a previous report with the same mutation. However, the dentition of the Family 2 proband exhibited slight yellowish discoloration with reduced transparency. Functional analysis showed that the p.Thr130Ile mutant protein had reduced activity of MMP20, while there was no functional MMP20 in the Family 1 proband. These results expand the mutational spectrum of the MMP20 and broaden our understanding of genotype-phenotype correlations in amelogenesis imperfecta.

Landscape of somatic mutations and clonal evolution in mantle cell lymphoma.

PubMed

Beà, Sílvia; Valdés-Mas, Rafael; Navarro, Alba; Salaverria, Itziar; Martín-Garcia, David; Jares, Pedro; Giné, Eva; Pinyol, Magda; Royo, Cristina; Nadeu, Ferran; Conde, Laura; Juan, Manel; Clot, Guillem; Vizán, Pedro; Di Croce, Luciano; Puente, Diana A; López-Guerra, Mónica; Moros, Alexandra; Roue, Gael; Aymerich, Marta; Villamor, Neus; Colomo, Lluís; Martínez, Antonio; Valera, Alexandra; Martín-Subero, José I; Amador, Virginia; Hernández, Luis; Rozman, Maria; Enjuanes, Anna; Forcada, Pilar; Muntañola, Ana; Hartmann, Elena M; Calasanz, María J; Rosenwald, Andreas; Ott, German; Hernández-Rivas, Jesús M; Klapper, Wolfram; Siebert, Reiner; Wiestner, Adrian; Wilson, Wyndham H; Colomer, Dolors; López-Guillermo, Armando; López-Otín, Carlos; Puente, Xose S; Campo, Elías

2013-11-05

Mantle cell lymphoma (MCL) is an aggressive tumor, but a subset of patients may follow an indolent clinical course. To understand the mechanisms underlying this biological heterogeneity, we performed whole-genome and/or whole-exome sequencing on 29 MCL cases and their respective matched normal DNA, as well as 6 MCL cell lines. Recurrently mutated genes were investigated by targeted sequencing in an independent cohort of 172 MCL patients. We identified 25 significantly mutated genes, including known drivers such as ataxia-telangectasia mutated (ATM), cyclin D1 (CCND1), and the tumor suppressor TP53; mutated genes encoding the anti-apoptotic protein BIRC3 and Toll-like receptor 2 (TLR2); and the chromatin modifiers WHSC1, MLL2, and MEF2B. We also found NOTCH2 mutations as an alternative phenomenon to NOTCH1 mutations in aggressive tumors with a dismal prognosis. Analysis of two simultaneous or subsequent MCL samples by whole-genome/whole-exome (n = 8) or targeted (n = 19) sequencing revealed subclonal heterogeneity at diagnosis in samples from different topographic sites and modulation of the initial mutational profile at the progression of the disease. Some mutations were predominantly clonal or subclonal, indicating an early or late event in tumor evolution, respectively. Our study identifies molecular mechanisms contributing to MCL pathogenesis and offers potential targets for therapeutic intervention.

Whole exome sequencing identifies a POLRID mutation segregating in a father and two daughters with findings of Klippel-Feil and Treacher Collins syndromes.

PubMed

Giampietro, Philip F; Armstrong, Linlea; Stoddard, Alex; Blank, Robert D; Livingston, Janet; Raggio, Cathy L; Rasmussen, Kristen; Pickart, Michael; Lorier, Rachel; Turner, Amy; Sund, Sarah; Sobrera, Nara; Neptune, Enid; Sweetser, David; Santiago-Cornier, Alberto; Broeckel, Ulrich

2015-01-01

We report on a father and his two daughters diagnosed with Klippel-Feil syndrome (KFS) but with craniofacial differences (zygomatic and mandibular hypoplasia and cleft palate) and external ear abnormalities suggestive of Treacher Collins syndrome (TCS). The diagnosis of KFS was favored, given that the neck anomalies were the predominant manifestations, and that the diagnosis predated later recognition of the association between spinal segmentation abnormalities and TCS. Genetic heterogeneity and the rarity of large families with KFS have limited the ability to identify mutations by traditional methods. Whole exome sequencing identified a nonsynonymous mutation in POLR1D (subunit of RNA polymerase I and II): exon2:c.T332C:p.L111P. Mutations in POLR1D are present in about 5% of individuals diagnosed with TCS. We propose that this mutation is causal in this family, suggesting a pathogenetic link between KFS and TCS. © 2014 Wiley Periodicals, Inc.

EIF2AK4 Mutations in Pulmonary Capillary Hemangiomatosis

PubMed Central

Best, D. Hunter; Sumner, Kelli L.; Austin, Eric D.; Chung, Wendy K.; Brown, Lynette M.; Borczuk, Alain C.; Rosenzweig, Erika B.; Bayrak-Toydemir, Pinar; Mao, Rong; Cahill, Barbara C.; Tazelaar, Henry D.; Leslie, Kevin O.; Hemnes, Anna R.; Robbins, Ivan M.

2014-01-01

Background: Pulmonary capillary hemangiomatosis (PCH) is a rare disease of capillary proliferation of unknown cause and with a high mortality. Families with multiple affected individuals with PCH suggest a heritable cause although the genetic etiology remains unknown. Methods: We used exome sequencing to identify a candidate gene for PCH in a family with two affected brothers. We then screened 11 unrelated patients with familial (n = 1) or sporadic (n = 10) PCH for mutations. Results: Using exome sequencing, we identified compound mutations in eukaryotic translation initiation factor 2 α kinase 4 (EIF2AK4) (formerly known as GCN2) in both affected brothers. Both parents and an unaffected sister were heterozygous carriers. In addition, we identified two EIF2AK4 mutations in each of two of 10 unrelated individuals with sporadic PCH. EIF2AK4 belongs to a family of kinases that regulate angiogenesis in response to cellular stress. Conclusions: Mutations in EIF2AK4 are likely to cause autosomal-recessive PCH in familial and some nonfamilial cases. PMID:24135949

Identification of novel point mutations in splicing sites integrating whole-exome and RNA-seq data in myeloproliferative diseases.

PubMed

Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo

2013-11-01

Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC 3 (NM_003786.3:c.1783-1G>A), KLHDC 1 (NM_172193.1:c.568-2A>G), HOOK 1 (NM_015888.4:c.1662-1G>A), SMAD 9 (NM_001127217.2:c.1004-1C>T), and DNAH 9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC 3, HOOK 1. In ABCC 3 and HOOK 1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK 1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4-6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis.

Clinical presentations of X-linked retinoschisis in Taiwanese patients confirmed with genetic sequencing

PubMed Central

Liu, Laura; Chen, Ho-Min; Tsai, Shawn; Chang, Tsong-Chi; Tsai, Tzu-Hsun; Yang, Chung-May; Chao, An-Ning; Chen, Kuan-Jen; Kao, Ling-Yuh; Yeung, Ling; Yeh, Lung-Kun; Hwang, Yih-Shiou; Wu, Wei-Chi; Lai, Chi-Chun

2015-01-01

Purpose To investigate the clinical characteristics of X-linked retinoschisis (XLRS) and identify genetic mutations in Taiwanese patients with XLRS. Methods This study included 23 affected males from 16 families with XLRS. Fundus photography, spectral domain optical coherent tomography (SD-OCT), fundus autofluorescence (FAF), and full-field electroretinograms (ERGs) were performed. The coding regions of the RS1 gene that encodes retinoschisin were sequenced. Results The median age at diagnosis was 18 years (range 4–58 years). The best-corrected visual acuity ranged from no light perception to 20/25. The typical spoke-wheel pattern in the macula was present in 61% of the patients (14/23) while peripheral retinoschisis was present in 43% of the patients (10/23). Four eyes presented with vitreous hemorrhage, and two eyes presented with leukocoria that mimics Coats’ disease. Macular schisis was identified with SD-OCT in 82% of the eyes (31/38) while foveal atrophy was present in 18% of the eyes (7/38). Concentric area of high intensity was the most common FAF abnormality observed. Seven out of 12 patients (58%) showed electronegative ERG findings. Sequencing of the RS1 gene identified nine mutations, six of which were novel. The mutations are all located in exons 4–6, including six missense mutations, two nonsense mutations, and one deletion-caused frameshift mutation. Conclusions XLRS is a clinically heterogeneous disease with profound phenotypic inter- and intrafamiliar variability. Genetic sequencing is valuable as it allows a definite diagnosis of XLRS to be made without the classical clinical features and ERG findings. This study showed the variety of clinical features of XLRS and reported novel mutations. PMID:25999676

Low-level APC mutational mosaicism is the underlying cause in a substantial fraction of unexplained colorectal adenomatous polyposis cases.

PubMed

Spier, Isabel; Drichel, Dmitriy; Kerick, Martin; Kirfel, Jutta; Horpaopan, Sukanya; Laner, Andreas; Holzapfel, Stefanie; Peters, Sophia; Adam, Ronja; Zhao, Bixiao; Becker, Tim; Lifton, Richard P; Perner, Sven; Hoffmann, Per; Kristiansen, Glen; Timmermann, Bernd; Nöthen, Markus M; Holinski-Feder, Elke; Schweiger, Michal R; Aretz, Stefan

2016-03-01

In 30-50% of patients with colorectal adenomatous polyposis, no germline mutation in the known genes APC, causing familial adenomatous polyposis, MUTYH, causing MUTYH-associated polyposis, or POLE or POLD1, causing polymerase-proofreading-associated polyposis can be identified, although a hereditary aetiology is likely. This study aimed to explore the impact of APC mutational mosaicism in unexplained polyposis. To comprehensively screen for somatic low-level APC mosaicism, high-coverage next-generation sequencing of the APC gene was performed using DNA from leucocytes and a total of 53 colorectal tumours from 20 unrelated patients with unexplained sporadic adenomatous polyposis. APC mosaicism was assumed if the same loss-of-function APC mutation was present in ≥ 2 anatomically separated colorectal adenomas/carcinomas per patient. All mutations were validated using diverse methods. In 25% (5/20) of patients, somatic mosaicism of a pathogenic APC mutation was identified as underlying cause of the disease. In 2/5 cases, the mosaic level in leucocyte DNA was slightly below the sensitivity threshold of Sanger sequencing; while in 3/5 cases, the allelic fraction was either very low (0.1-1%) or no mutations were detectable. The majority of mosaic mutations were located outside the somatic mutation cluster region of the gene. The present data indicate a high prevalence of pathogenic mosaic APC mutations below the detection thresholds of routine diagnostics in adenomatous polyposis, even if high-coverage sequencing of leucocyte DNA alone is taken into account. This has important implications for both routine work-up and strategies to identify new causative genes in this patient group. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Exome sequencing identifies rare LDLR and APOA5 alleles conferring risk for myocardial infarction.

PubMed

Do, Ron; Stitziel, Nathan O; Won, Hong-Hee; Jørgensen, Anders Berg; Duga, Stefano; Angelica Merlini, Pier; Kiezun, Adam; Farrall, Martin; Goel, Anuj; Zuk, Or; Guella, Illaria; Asselta, Rosanna; Lange, Leslie A; Peloso, Gina M; Auer, Paul L; Girelli, Domenico; Martinelli, Nicola; Farlow, Deborah N; DePristo, Mark A; Roberts, Robert; Stewart, Alexander F R; Saleheen, Danish; Danesh, John; Epstein, Stephen E; Sivapalaratnam, Suthesh; Hovingh, G Kees; Kastelein, John J; Samani, Nilesh J; Schunkert, Heribert; Erdmann, Jeanette; Shah, Svati H; Kraus, William E; Davies, Robert; Nikpay, Majid; Johansen, Christopher T; Wang, Jian; Hegele, Robert A; Hechter, Eliana; Marz, Winfried; Kleber, Marcus E; Huang, Jie; Johnson, Andrew D; Li, Mingyao; Burke, Greg L; Gross, Myron; Liu, Yongmei; Assimes, Themistocles L; Heiss, Gerardo; Lange, Ethan M; Folsom, Aaron R; Taylor, Herman A; Olivieri, Oliviero; Hamsten, Anders; Clarke, Robert; Reilly, Dermot F; Yin, Wu; Rivas, Manuel A; Donnelly, Peter; Rossouw, Jacques E; Psaty, Bruce M; Herrington, David M; Wilson, James G; Rich, Stephen S; Bamshad, Michael J; Tracy, Russell P; Cupples, L Adrienne; Rader, Daniel J; Reilly, Muredach P; Spertus, John A; Cresci, Sharon; Hartiala, Jaana; Tang, W H Wilson; Hazen, Stanley L; Allayee, Hooman; Reiner, Alex P; Carlson, Christopher S; Kooperberg, Charles; Jackson, Rebecca D; Boerwinkle, Eric; Lander, Eric S; Schwartz, Stephen M; Siscovick, David S; McPherson, Ruth; Tybjaerg-Hansen, Anne; Abecasis, Goncalo R; Watkins, Hugh; Nickerson, Deborah A; Ardissino, Diego; Sunyaev, Shamil R; O'Donnell, Christopher J; Altshuler, David; Gabriel, Stacey; Kathiresan, Sekar

2015-02-05

Myocardial infarction (MI), a leading cause of death around the world, displays a complex pattern of inheritance. When MI occurs early in life, genetic inheritance is a major component to risk. Previously, rare mutations in low-density lipoprotein (LDL) genes have been shown to contribute to MI risk in individual families, whereas common variants at more than 45 loci have been associated with MI risk in the population. Here we evaluate how rare mutations contribute to early-onset MI risk in the population. We sequenced the protein-coding regions of 9,793 genomes from patients with MI at an early age (≤50 years in males and ≤60 years in females) along with MI-free controls. We identified two genes in which rare coding-sequence mutations were more frequent in MI cases versus controls at exome-wide significance. At low-density lipoprotein receptor (LDLR), carriers of rare non-synonymous mutations were at 4.2-fold increased risk for MI; carriers of null alleles at LDLR were at even higher risk (13-fold difference). Approximately 2% of early MI cases harbour a rare, damaging mutation in LDLR; this estimate is similar to one made more than 40 years ago using an analysis of total cholesterol. Among controls, about 1 in 217 carried an LDLR coding-sequence mutation and had plasma LDL cholesterol > 190 mg dl(-1). At apolipoprotein A-V (APOA5), carriers of rare non-synonymous mutations were at 2.2-fold increased risk for MI. When compared with non-carriers, LDLR mutation carriers had higher plasma LDL cholesterol, whereas APOA5 mutation carriers had higher plasma triglycerides. Recent evidence has connected MI risk with coding-sequence mutations at two genes functionally related to APOA5, namely lipoprotein lipase and apolipoprotein C-III (refs 18, 19). Combined, these observations suggest that, as well as LDL cholesterol, disordered metabolism of triglyceride-rich lipoproteins contributes to MI risk.

Identification and analysis of mutational hotspots in oncogenes and tumour suppressors.

PubMed

Baeissa, Hanadi; Benstead-Hume, Graeme; Richardson, Christopher J; Pearl, Frances M G

2017-03-28

The key to interpreting the contribution of a disease-associated mutation in the development and progression of cancer is an understanding of the consequences of that mutation both on the function of the affected protein and on the pathways in which that protein is involved. Protein domains encapsulate function and position-specific domain based analysis of mutations have been shown to help elucidate their phenotypes. In this paper we examine the domain biases in oncogenes and tumour suppressors, and find that their domain compositions substantially differ. Using data from over 30 different cancers from whole-exome sequencing cancer genomic projects we mapped over one million mutations to their respective Pfam domains to identify which domains are enriched in any of three different classes of mutation; missense, indels or truncations. Next, we identified the mutational hotspots within domain families by mapping small mutations to equivalent positions in multiple sequence alignments of protein domainsWe find that gain of function mutations from oncogenes and loss of function mutations from tumour suppressors are normally found in different domain families and when observed in the same domain families, hotspot mutations are located at different positions within the multiple sequence alignment of the domain. By considering hotspots in tumour suppressors and oncogenes independently, we find that there are different specific positions within domain families that are particularly suited to accommodate either a loss or a gain of function mutation. The position is also dependent on the class of mutation.We find rare mutations co-located with well-known functional mutation hotspots, in members of homologous domain superfamilies, and we detect novel mutation hotspots in domain families previously unconnected with cancer. The results of this analysis can be accessed through the MOKCa database (http://strubiol.icr.ac.uk/extra/MOKCa).

High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

PubMed

Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

2015-08-01

Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Mutations in LZTR1 add to the complex heterogeneity of schwannomatosis

PubMed Central

Smith, Miriam J.; Isidor, Bertand; Beetz, Christian; Williams, Simon G.; Bhaskar, Sanjeev S.; Richer, Wilfrid; O'Sullivan, James; Anderson, Beverly; Daly, Sarah B.; Urquhart, Jill E.; Fryer, Alan; Rustad, Cecilie F.; Mills, Samantha J.; Samii, Amir; du Plessis, Daniel; Halliday, Dorothy; Barbarot, Sebastien; Bourdeaut, Franck

2015-01-01

Objectives: We aimed to determine the proportion of individuals in our schwannomatosis cohort whose disease is associated with an LZTR1 mutation. Methods: We used exome sequencing, Sanger sequencing, and copy number analysis to screen 65 unrelated individuals with schwannomatosis who were negative for a germline NF2 or SMARCB1 mutation. We also screened samples from 39 patients with a unilateral vestibular schwannoma (UVS), plus at least one other schwannoma, but who did not have an identifiable germline or mosaic NF2 mutation. Results: We identified germline LZTR1 mutations in 6 of 16 patients (37.5%) with schwannomatosis who had at least one affected relative, 11 of 49 (22%) sporadic patients, and 2 of 39 patients with UVS in our cohort. Three germline mutation–positive patients in total had developed a UVS. Mosaicism was excluded in 3 patients without germline mutation in NF2, SMARCB1, or LZTR1 by mutation screening in 2 tumors from each. Conclusions: Our data confirm the relationship between mutations in LZTR1 and schwannomatosis. They indicate that germline mutations in LZTR1 confer an increased risk of vestibular schwannoma, providing further overlap with NF2, and that further causative genes for schwannomatosis remain to be identified. PMID:25480913

Polymorphisms and resistance mutations of hepatitis C virus on sequences in the European hepatitis C virus database

PubMed Central

Kliemann, Dimas Alexandre; Tovo, Cristiane Valle; da Veiga, Ana Beatriz Gorini; de Mattos, Angelo Alves; Wood, Charles

2016-01-01

AIM To evaluate the occurrence of resistant mutations in treatment-naïve hepatitis C virus (HCV) sequences deposited in the European hepatitis C virus database (euHCVdb). METHODS The sequences were downloaded from the euHCVdb (https://euhcvdb.ibcp.fr/euHCVdb/). The search was performed for full-length NS3 protease, NS5A and NS5B polymerase sequences of HCV, separated by genotypes 1a, 1b, 2a, 2b and 3a, and resulted in 798 NS3, 708 NS5A and 535 NS5B sequences from HCV genotypes 1a, 1b, 2a, 2b and 3a, after the exclusion of sequences containing errors and/or gaps or incomplete sequences, and sequences from patients previously treated with direct antiviral agents (DAA). The sequence alignment was performed with MEGA 6.06 MAC and the resulting protein sequences were then analyzed using the BioEdit 7.2.5. for mutations associated with resistance. Only positions that have been described as being associated with failure in treatment in in vivo studies, and/or as conferring a more than 2-fold change in replication in comparison to the wildtype reference strain in in vitro phenotypic assays were included in the analysis. RESULTS The Q80K variant in the NS3 gene was the most prevalent mutation, being found in 44.66% of subtype 1a and 0.25% of subtype 1b. Other frequent mutations observed in more than 2% of the NS3 sequences were: I170V (3.21%) in genotype 1a, and Y56F (15.93%), V132I (23.28%) and I170V (65.20%) in genotype 1b. For the NS5A, 2.21% of the genotype 1a sequences have the P58S mutation, 5.95% of genotype 1b sequences have the R30Q mutation, 15.79% of subtypes 2a sequences have the Q30R mutation, 23.08% of subtype 2b sequences have a L31M mutation, and in subtype 3a sequences, 23.08% have the M31L resistant variants. For the NS5B, the V321L RAV was identified in 0.60% of genotype 1a and in 0.32% of genotype 1b sequences, and the N142T variant was observed in 0.32% of subtype 1b sequences. The C316Y, S556G, D559N RAV were identified in 0.33%, 7.82% and 0.32% of genotype 1b sequences, respectively, and were not observed in other genotypes. CONCLUSION HCV mutants resistant to DAAs are found in low frequency, nevertheless they could be selected and therapy could fail due resistance substitutions in HCV genome. PMID:27833382

Polymorphisms and resistance mutations of hepatitis C virus on sequences in the European hepatitis C virus database.

PubMed

Kliemann, Dimas Alexandre; Tovo, Cristiane Valle; da Veiga, Ana Beatriz Gorini; de Mattos, Angelo Alves; Wood, Charles

2016-10-28

To evaluate the occurrence of resistant mutations in treatment-naïve hepatitis C virus (HCV) sequences deposited in the European hepatitis C virus database (euHCVdb). The sequences were downloaded from the euHCVdb (https://euhcvdb.ibcp.fr/euHCVdb/). The search was performed for full-length NS3 protease, NS5A and NS5B polymerase sequences of HCV, separated by genotypes 1a, 1b, 2a, 2b and 3a, and resulted in 798 NS3, 708 NS5A and 535 NS5B sequences from HCV genotypes 1a, 1b, 2a, 2b and 3a, after the exclusion of sequences containing errors and/or gaps or incomplete sequences, and sequences from patients previously treated with direct antiviral agents (DAA). The sequence alignment was performed with MEGA 6.06 MAC and the resulting protein sequences were then analyzed using the BioEdit 7.2.5. for mutations associated with resistance. Only positions that have been described as being associated with failure in treatment in in vivo studies, and/or as conferring a more than 2-fold change in replication in comparison to the wildtype reference strain in in vitro phenotypic assays were included in the analysis. The Q80K variant in the NS3 gene was the most prevalent mutation, being found in 44.66% of subtype 1a and 0.25% of subtype 1b. Other frequent mutations observed in more than 2% of the NS3 sequences were: I170V (3.21%) in genotype 1a, and Y56F (15.93%), V132I (23.28%) and I170V (65.20%) in genotype 1b. For the NS5A, 2.21% of the genotype 1a sequences have the P58S mutation, 5.95% of genotype 1b sequences have the R30Q mutation, 15.79% of subtypes 2a sequences have the Q30R mutation, 23.08% of subtype 2b sequences have a L31M mutation, and in subtype 3a sequences, 23.08% have the M31L resistant variants. For the NS5B, the V321L RAV was identified in 0.60% of genotype 1a and in 0.32% of genotype 1b sequences, and the N142T variant was observed in 0.32% of subtype 1b sequences. The C316Y, S556G, D559N RAV were identified in 0.33%, 7.82% and 0.32% of genotype 1b sequences, respectively, and were not observed in other genotypes. HCV mutants resistant to DAAs are found in low frequency, nevertheless they could be selected and therapy could fail due resistance substitutions in HCV genome.

Targeted next generation sequencing of endoscopic ultrasound acquired cytology from ampullary and pancreatic adenocarcinoma has the potential to aid patient stratification for optimal therapy selection

PubMed Central

Gleeson, Ferga C.; Kerr, Sarah E.; Kipp, Benjamin R.; Voss, Jesse S.; Minot, Douglas M.; Tu, Zheng Jin; Henry, Michael R.; Graham, Rondell P.; Vasmatzis, George; Cheville, John C.; Lazaridis, Konstantinos N.; Levy, Michael J.

2016-01-01

Background & Aims Less than 10% of registered drug intervention trials for pancreatic ductal adenocarcinoma (PDAC) include a biomarker stratification strategy. The ability to identify distinct mutation subsets via endoscopic ultrasound fine needle aspiration (EUS FNA) molecular cytology could greatly aid clinical trial patient stratification and offer predictive markers. We identified chemotherapy treatment naïve ampullary adenocarcinoma and PDAC patients who underwent EUS FNA to assess multigene mutational frequency and diversity with a surgical resection concordance assessment, where available. Methods Following strict cytology smear screening criteria, targeted next generation sequencing (NGS) using a 160 cancer gene panel was performed. Results Complete sequencing was achieved in 29 patients, whereby 83 pathogenic alterations were identified in 21 genes. Cytology genotyping revealed that the majority of mutations were identified in KRAS (93%), TP53 (72%), SMAD4 (31%), and GNAS (10%). There was 100% concordance for the following pathogenic alterations: KRAS, TP53, SMAD4, KMT2D, NOTCH2, MSH2, RB1, SMARCA4, PPP2R1A, PIK3R1, SCL7A8, ATM, and FANCD2. Absolute multigene mutational concordance was 83%. Incremental cytology smear mutations in GRIN2A, GATA3 and KDM6A were identified despite re-examination of raw sequence reads in the corresponding resection specimens. Conclusions EUS FNA cytology genotyping using a 160 cancer gene NGS panel revealed a broad spectrum of pathogenic alterations. The fidelity of cytology genotyping to that of paired surgical resection specimens suggests that EUS FNA represents a suitable surrogate and may complement the conventional stratification criteria in decision making for therapies and may guide future biomarker driven therapeutic development. PMID:27203738

Exome sequencing reveals riboflavin transporter mutations as a cause of motor neuron disease.

PubMed

Johnson, Janel O; Gibbs, J Raphael; Megarbane, Andre; Urtizberea, J Andoni; Hernandez, Dena G; Foley, A Reghan; Arepalli, Sampath; Pandraud, Amelie; Simón-Sánchez, Javier; Clayton, Peter; Reilly, Mary M; Muntoni, Francesco; Abramzon, Yevgeniya; Houlden, Henry; Singleton, Andrew B

2012-09-01

Brown-Vialetto-Van Laere syndrome was first described in 1894 as a rare neurodegenerative disorder characterized by progressive sensorineural deafness in combination with childhood amyotrophic lateral sclerosis. Mutations in the gene, SLC52A3 (formerly C20orf54), one of three known riboflavin transporter genes, have recently been shown to underlie a number of severe cases of Brown-Vialetto-Van Laere syndrome; however, cases and families with this disease exist that do not appear to be caused by SLC52A3 mutations. We used a combination of linkage and exome sequencing to identify the disease causing mutation in an extended Lebanese Brown-Vialetto-Van Laere kindred, whose affected members were negative for SLC52A3 mutations. We identified a novel mutation in a second member of the riboflavin transporter gene family (gene symbol: SLC52A2) as the cause of disease in this family. The same mutation was identified in one additional subject, from 44 screened. Within this group of 44 patients, we also identified two additional cases with SLC52A3 mutations, but none with mutations in the remaining member of this gene family, SLC52A1. We believe this strongly supports the notion that defective riboflavin transport plays an important role in Brown-Vialetto-Van Laere syndrome. Initial work has indicated that patients with SLC52A3 defects respond to riboflavin treatment clinically and biochemically. Clearly, this makes an excellent candidate therapy for the SLC52A2 mutation-positive patients identified here. Initial riboflavin treatment of one of these patients shows promising results.

Exome sequencing reveals riboflavin transporter mutations as a cause of motor neuron disease

PubMed Central

Johnson, Janel O.; Gibbs, J. Raphael; Megarbane, Andre; Urtizberea, J. Andoni; Hernandez, Dena G.; Foley, A. Reghan; Arepalli, Sampath; Pandraud, Amelie; Simón-Sánchez, Javier; Clayton, Peter; Reilly, Mary M.; Muntoni, Francesco; Abramzon, Yevgeniya; Houlden, Henry

2012-01-01

Brown–Vialetto–Van Laere syndrome was first described in 1894 as a rare neurodegenerative disorder characterized by progressive sensorineural deafness in combination with childhood amyotrophic lateral sclerosis. Mutations in the gene, SLC52A3 (formerly C20orf54), one of three known riboflavin transporter genes, have recently been shown to underlie a number of severe cases of Brown–Vialetto–Van Laere syndrome; however, cases and families with this disease exist that do not appear to be caused by SLC52A3 mutations. We used a combination of linkage and exome sequencing to identify the disease causing mutation in an extended Lebanese Brown–Vialetto–Van Laere kindred, whose affected members were negative for SLC52A3 mutations. We identified a novel mutation in a second member of the riboflavin transporter gene family (gene symbol: SLC52A2) as the cause of disease in this family. The same mutation was identified in one additional subject, from 44 screened. Within this group of 44 patients, we also identified two additional cases with SLC52A3 mutations, but none with mutations in the remaining member of this gene family, SLC52A1. We believe this strongly supports the notion that defective riboflavin transport plays an important role in Brown–Vialetto–Van Laere syndrome. Initial work has indicated that patients with SLC52A3 defects respond to riboflavin treatment clinically and biochemically. Clearly, this makes an excellent candidate therapy for the SLC52A2 mutation-positive patients identified here. Initial riboflavin treatment of one of these patients shows promising results. PMID:22740598

Exome and deep sequencing of clinically aggressive neuroblastoma reveal somatic mutations that affect key pathways involved in cancer progression

PubMed Central

Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D.; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario

2016-01-01

The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma. Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines. We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK. Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%. Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression. Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants. In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression. PMID:27009842

Exome and deep sequencing of clinically aggressive neuroblastoma reveal somatic mutations that affect key pathways involved in cancer progression.

PubMed

Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario

2016-04-19

The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma.Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines.We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK.Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%.Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression.Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants.In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression.

A novel NHS mutation causes Nance-Horan Syndrome in a Chinese family.

PubMed

Tian, Qi; Li, Yunping; Kousar, Rizwana; Guo, Hui; Peng, Fenglan; Zheng, Yu; Yang, Xiaohua; Long, Zhigao; Tian, Runyi; Xia, Kun; Lin, Haiying; Pan, Qian

2017-01-07

Nance-Horan Syndrome (NHS) (OMIM: 302350) is a rare X-linked developmental disorder characterized by bilateral congenital cataracts, with occasional dental anomalies, characteristic dysmorphic features, brachymetacarpia and mental retardation. Carrier females exhibit similar manifestations that are less severe than in affected males. Here, we report a four-generation Chinese family with multiple affected individuals presenting Nance-Horan Syndrome. Whole-exome sequencing combined with RT-PCR and Sanger sequencing was used to search for a genetic cause underlying the disease phenotype. Whole-exome sequencing identified in all affected individuals of the family a novel donor splicing site mutation (NM_198270: c.1045 + 2T > A) in intron 4 of the gene NHS, which maps to chromosome Xp22.13. The identified mutation results in an RNA processing defect causing a 416-nucleotide addition to exon 4 of the mRNA transcript, likely producing a truncated NHS protein. The donor splicing site mutation NM_198270: c.1045 + 2T > A of the NHS gene is the causative mutation in this Nance-Horan Syndrome family. This research broadens the spectrum of NHS gene mutations, contributing to our understanding of the molecular genetics of NHS.

A branch-migration based fluorescent probe for straightforward, sensitive and specific discrimination of DNA mutations

PubMed Central

Xiao, Xianjin; Wu, Tongbo; Xu, Lei; Chen, Wei

2017-01-01

Abstract Genetic mutations are important biomarkers for cancer diagnostics and surveillance. Preferably, the methods for mutation detection should be straightforward, highly specific and sensitive to low-level mutations within various sequence contexts, fast and applicable at room-temperature. Though some of the currently available methods have shown very encouraging results, their discrimination efficiency is still very low. Herein, we demonstrate a branch-migration based fluorescent probe (BM probe) which is able to identify the presence of known or unknown single-base variations at abundances down to 0.3%-1% within 5 min, even in highly GC-rich sequence regions. The discrimination factors between the perfect-match target and single-base mismatched target are determined to be 89–311 by measurement of their respective branch-migration products via polymerase elongation reactions. The BM probe not only enabled sensitive detection of two types of EGFR-associated point mutations located in GC-rich regions, but also successfully identified the BRAF V600E mutation in the serum from a thyroid cancer patient which could not be detected by the conventional sequencing method. The new method would be an ideal choice for high-throughput in vitro diagnostics and precise clinical treatment. PMID:28201758

Mutations in Splicing Factor Genes Are a Major Cause of Autosomal Dominant Retinitis Pigmentosa in Belgian Families

PubMed Central

Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy

2017-01-01

Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular spectrum of PRPH2, PRPF8, RHO, RP1, SNRNP200, and TOPORS-associated adRP by the identification of 17 novel mutations. PMID:28076437

Targeted exome sequencing reveals novel USH2A mutations in Chinese patients with simplex Usher syndrome.

PubMed

Shu, Hai-Rong; Bi, Huai; Pan, Yang-Chun; Xu, Hang-Yu; Song, Jian-Xin; Hu, Jie

2015-09-16

Usher syndrome (USH) is an autosomal recessive disorder characterized by hearing impairment and vision dysfunction due to retinitis pigmentosa. Phenotypic and genetic heterogeneities of this disease make it impractical to obtain a genetic diagnosis by conventional Sanger sequencing. In this study, we applied a next-generation sequencing approach to detect genetic abnormalities in patients with USH. Two unrelated Chinese families were recruited, consisting of two USH afflicted patients and four unaffected relatives. We selected 199 genes related to inherited retinal diseases as targets for deep exome sequencing. Through systematic data analysis using an established bioinformatics pipeline, all variants that passed filter criteria were validated by Sanger sequencing and co-segregation analysis. A homozygous frameshift mutation (c.4382delA, p.T1462Lfs*2) was revealed in exon20 of gene USH2A in the F1 family. Two compound heterozygous mutations, IVS47 + 1G > A and c.13156A > T (p.I4386F), located in intron 48 and exon 63 respectively, of USH2A, were identified as causative mutations for the F2 family. Of note, the missense mutation c.13156A > T has not been reported so far. In conclusion, targeted exome sequencing precisely and rapidly identified the genetic defects in two Chinese USH families and this technique can be applied as a routine examination for these disorders with significant clinical and genetic heterogeneity.

Parkin dosage mutations have greater pathogenicity in familial PD than simple sequence mutations

PubMed Central

Pankratz, N; Kissell, D K.; Pauciulo, M W.; Halter, C A.; Rudolph, A; Pfeiffer, R F.; Marder, K S.; Foroud, T; Nichols, W C.

2009-01-01

Objective: Mutations in both alleles of parkin have been shown to result in Parkinson disease (PD). However, it is unclear whether haploinsufficiency (presence of a mutation in only 1 of the 2 parkin alleles) increases the risk for PD. Methods: We performed comprehensive dosage and sequence analysis of all 12 exons of parkin in a sample of 520 independent patients with familial PD and 263 controls. We evaluated whether presence of a single parkin mutation, either a sequence (point mutation or small insertion/deletion) or dosage (whole exon deletion or duplication) mutation, was found at increased frequency in cases as compared with controls. We then compared the clinical characteristics of cases with 0, 1, or 2 parkin mutations. Results: We identified 55 independent patients with PD with at least 1 parkin mutation and 9 controls with a single sequence mutation. Cases and controls had a similar frequency of single sequence mutations (3.1% vs 3.4%, p = 0.83); however, the cases had a significantly higher rate of dosage mutations (2.6% vs 0%, p = 0.009). Cases with a single dosage mutation were more likely to have an earlier age at onset (50% with onset at ≤45 years) compared with those with no parkin mutations (10%, p = 0.00002); this was not true for cases with only a single sequence mutation (25% with onset at ≤45 years, p = 0.06). Conclusions: Parkin haploinsufficiency, specifically for a dosage mutation rather than a point mutation or small insertion/deletion, is a risk factor for familial PD and may be associated with earlier age at onset. GLOSSARY ADL = Activities of Daily Living; GDS = Geriatric Depression Scale; MLPA = multiplex ligation-dependent probe amplification; MMSE = Mini-Mental State Examination; PD = Parkinson disease; UPDRS = Unified Parkinson’s Disease Rating Scale. PMID:19636047

Retinitis Pigmentosa with EYS Mutations Is the Most Prevalent Inherited Retinal Dystrophy in Japanese Populations.

PubMed

Arai, Yuuki; Maeda, Akiko; Hirami, Yasuhiko; Ishigami, Chie; Kosugi, Shinji; Mandai, Michiko; Kurimoto, Yasuo; Takahashi, Masayo

2015-01-01

The aim of this study was to gain information about disease prevalence and to identify the responsible genes for inherited retinal dystrophies (IRD) in Japanese populations. Clinical and molecular evaluations were performed on 349 patients with IRD. For segregation analyses, 63 of their family members were employed. Bioinformatics data from 1,208 Japanese individuals were used as controls. Molecular diagnosis was obtained by direct sequencing in a stepwise fashion utilizing one or two panels of 15 and 27 genes for retinitis pigmentosa patients. If a specific clinical diagnosis was suspected, direct sequencing of disease-specific genes, that is, ABCA4 for Stargardt disease, was conducted. Limited availability of intrafamily information and decreasing family size hampered identifying inherited patterns. Differential disease profiles with lower prevalence of Stargardt disease from European and North American populations were obtained. We found 205 sequence variants in 159 of 349 probands with an identification rate of 45.6%. This study found 43 novel sequence variants. In silico analysis suggests that 20 of 25 novel missense variants are pathogenic. EYS mutations had the highest prevalence at 23.5%. c.4957_4958insA and c.8868C>A were the two major EYS mutations identified in this cohort. EYS mutations are the most prevalent among Japanese patients with IRD.

Screening strategies for a highly polymorphic gene: DHPLC analysis of the Fanconi anemia group A gene.

PubMed

Rischewski, J; Schneppenheim, R

2001-01-30

Patients with Fanconi anemia (Fanc) are at risk of developing leukemia. Mutations of the group A gene (FancA) are most common. A multitude of polymorphisms and mutations within the 43 exons of the gene are described. To examine the role of heterozygosity as a risk factor for malignancies, a partially automatized screening method to identify aberrations was needed. We report on our experience with DHPLC (WAVE (Transgenomic)). PCR amplification of all 43 exons from one individual was performed on one microtiter plate on a gradient thermocycler. DHPLC analysis conditions were established via melting curves, prediction software, and test runs with aberrant samples. PCR products were analyzed twice: native, and after adding a WT-PCR product. Retention patterns were compared with previously identified polymorphic PCR products or mutants. We have defined the mutation screening conditions for all 43 exons of FancA using DHPLC. So far, 40 different sequence variations have been detected in more than 100 individuals. The native analysis identifies heterozygous individuals, and the second run detects homozygous aberrations. Retention patterns are specific for the underlying sequence aberration, thus reducing sequencing demand and costs. DHPLC is a valuable tool for reproducible recognition of known sequence aberrations and screening for unknown mutations in the highly polymorphic FancA gene.

Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguineous families.

PubMed

Harripaul, R; Vasli, N; Mikhailov, A; Rafiq, M A; Mittal, K; Windpassinger, C; Sheikh, T I; Noor, A; Mahmood, H; Downey, S; Johnson, M; Vleuten, K; Bell, L; Ilyas, M; Khan, F S; Khan, V; Moradi, M; Ayaz, M; Naeem, F; Heidari, A; Ahmed, I; Ghadami, S; Agha, Z; Zeinali, S; Qamar, R; Mozhdehipanah, H; John, P; Mir, A; Ansar, M; French, L; Ayub, M; Vincent, J B

2018-04-01

Approximately 1% of the global population is affected by intellectual disability (ID), and the majority receive no molecular diagnosis. Previous studies have indicated high levels of genetic heterogeneity, with estimates of more than 2500 autosomal ID genes, the majority of which are autosomal recessive (AR). Here, we combined microarray genotyping, homozygosity-by-descent (HBD) mapping, copy number variation (CNV) analysis, and whole exome sequencing (WES) to identify disease genes/mutations in 192 multiplex Pakistani and Iranian consanguineous families with non-syndromic ID. We identified definite or candidate mutations (or CNVs) in 51% of families in 72 different genes, including 26 not previously reported for ARID. The new ARID genes include nine with loss-of-function mutations (ABI2, MAPK8, MPDZ, PIDD1, SLAIN1, TBC1D23, TRAPPC6B, UBA7 and USP44), and missense mutations include the first reports of variants in BDNF or TET1 associated with ID. The genes identified also showed overlap with de novo gene sets for other neuropsychiatric disorders. Transcriptional studies showed prominent expression in the prenatal brain. The high yield of AR mutations for ID indicated that this approach has excellent clinical potential and should inform clinical diagnostics, including clinical whole exome and genome sequencing, for populations in which consanguinity is common. As with other AR disorders, the relevance will also apply to outbred populations.

Comprehensive molecular diagnosis of 179 Leber congenital amaurosis and juvenile retinitis pigmentosa patients by targeted next generation sequencing

PubMed Central

Wang, Xia; Wang, Hui; Sun, Vincent; Tuan, Han-Fang; Keser, Vafa; Wang, Keqing; Ren, Huanan; Lopez, Irma; Zaneveld, Jacques E; Siddiqui, Sorath; Bowles, Stephanie; Khan, Ayesha; Salvo, Jason; Jacobson, Samuel G; Iannaccone, Alessandro; Wang, Feng; Birch, David; Heckenlively, John R; Fishman, Gerald A; Traboulsi, Elias I; Li, Yumei; Wheaton, Dianna; Koenekoop, Robert K; Chen, Rui

2014-01-01

Background Leber congenital amaurosis (LCA) and juvenile retinitis pigmentosa (RP) are inherited retinal diseases that cause early onset severe visual impairment. An accurate molecular diagnosis can refine the clinical diagnosis and allow gene specific treatments. Methods We developed a capture panel that enriches the exonic DNA of 163 known retinal disease genes. Using this panel, we performed targeted next generation sequencing (NGS) for a large cohort of 179 unrelated and prescreened patients with the clinical diagnosis of LCA or juvenile RP. Systematic NGS data analysis, Sanger sequencing validation, and segregation analysis were utilised to identify the pathogenic mutations. Patients were revisited to examine the potential phenotypic ambiguity at the time of initial diagnosis. Results Pathogenic mutations for 72 patients (40%) were identified, including 45 novel mutations. Of these 72 patients, 58 carried mutations in known LCA or juvenile RP genes and exhibited corresponding phenotypes, while 14 carried mutations in retinal disease genes that were not consistent with their initial clinical diagnosis. We revisited patients in the latter case and found that homozygous mutations in PRPH2 can cause LCA/juvenile RP. Guided by the molecular diagnosis, we reclassified the clinical diagnosis in two patients. Conclusions We have identified a novel gene and a large number of novel mutations that are associated with LCA/juvenile RP. Our results highlight the importance of molecular diagnosis as an integral part of clinical diagnosis. PMID:23847139

Germline whole exome sequencing and large-scale replication identifies FANCM as a likely high grade serous ovarian cancer susceptibility gene.

PubMed

Dicks, Ed; Song, Honglin; Ramus, Susan J; Oudenhove, Elke Van; Tyrer, Jonathan P; Intermaggio, Maria P; Kar, Siddhartha; Harrington, Patricia; Bowtell, David D; Group, Aocs Study; Cicek, Mine S; Cunningham, Julie M; Fridley, Brooke L; Alsop, Jennifer; Jimenez-Linan, Mercedes; Piskorz, Anna; Goranova, Teodora; Kent, Emma; Siddiqui, Nadeem; Paul, James; Crawford, Robin; Poblete, Samantha; Lele, Shashi; Sucheston-Campbell, Lara; Moysich, Kirsten B; Sieh, Weiva; McGuire, Valerie; Lester, Jenny; Odunsi, Kunle; Whittemore, Alice S; Bogdanova, Natalia; Dürst, Matthias; Hillemanns, Peter; Karlan, Beth Y; Gentry-Maharaj, Aleksandra; Menon, Usha; Tischkowitz, Marc; Levine, Douglas; Brenton, James D; Dörk, Thilo; Goode, Ellen L; Gayther, Simon A; Pharoah, D P Paul

2017-08-01

We analyzed whole exome sequencing data in germline DNA from 412 high grade serous ovarian cancer (HGSOC) cases from The Cancer Genome Atlas Project and identified 5,517 genes harboring a predicted deleterious germline coding mutation in at least one HGSOC case. Gene-set enrichment analysis showed enrichment for genes involved in DNA repair (p = 1.8×10 -3 ). Twelve DNA repair genes - APEX1, APLF, ATX, EME1, FANCL, FANCM, MAD2L2, PARP2, PARP3, POLN, RAD54L and SMUG1 - were prioritized for targeted sequencing in up to 3,107 HGSOC cases, 1,491 cases of other epithelial ovarian cancer (EOC) subtypes and 3,368 unaffected controls of European origin. We estimated mutation prevalence for each gene and tested for associations with disease risk. Mutations were identified in both cases and controls in all genes except MAD2L2 , where we found no evidence of mutations in controls. In FANCM we observed a higher mutation frequency in HGSOC cases compared to controls (29/3,107 cases, 0.96 percent; 13/3,368 controls, 0.38 percent; P=0.008) with little evidence for association with other subtypes (6/1,491, 0.40 percent; P=0.82). The relative risk of HGSOC associated with deleterious FANCM mutations was estimated to be 2.5 (95% CI 1.3 - 5.0; P=0.006). In summary, whole exome sequencing of EOC cases with large-scale replication in case-control studies has identified FANCM as a likely novel susceptibility gene for HGSOC, with mutations associated with a moderate increase in risk. These data may have clinical implications for risk prediction and prevention approaches for high-grade serous ovarian cancer in the future and a significant impact on reducing disease mortality.

The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity

PubMed Central

Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H.; Allen, Andrew S.; Goldstein, David B.

2015-01-01

Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene’s proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene’s regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen’s Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance, ncCADD and ncGWAVA, and find both scores are significantly predictive of human dosage sensitive genes and appear to carry information beyond conservation, as assessed by ncGERP. These results highlight that the intolerance of noncoding sequence stretches in the human genome can provide a critical complementary tool to other genome annotation approaches to help identify the parts of the human genome increasingly likely to harbor mutations that influence risk of disease. PMID:26332131

Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

PubMed Central

Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

1999-01-01

We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

Human Splicing Finder: an online bioinformatics tool to predict splicing signals.

PubMed

Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

2009-05-01

Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-beta Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5' and 3' splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project.

Human Splicing Finder: an online bioinformatics tool to predict splicing signals

PubMed Central

Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

2009-01-01

Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-β Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5′ and 3′ splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project. PMID:19339519

A Streamlined Protocol for Molecular Testing of the DMD Gene within a Diagnostic Laboratory: A Combination of Array Comparative Genomic Hybridization and Bidirectional Sequence Analysis

PubMed Central

Marquis-Nicholson, Renate; Lai, Daniel; Love, Jennifer M.; Love, Donald R.

2013-01-01

Purpose. The aim of this study was to develop a streamlined mutation screening protocol for the DMD gene in order to confirm a clinical diagnosis of Duchenne or Becker muscular dystrophy in affected males and to clarify the carrier status of female family members. Methods. Sequence analysis and array comparative genomic hybridization (aCGH) were used to identify mutations in the dystrophin DMD gene. We analysed genomic DNA from six individuals with a range of previously characterised mutations and from eight individuals who had not previously undergone any form of molecular analysis. Results. We successfully identified the known mutations in all six patients. A molecular diagnosis was also made in three of the four patients with a clinical diagnosis who had not undergone prior genetic screening, and testing for familial mutations was successfully completed for the remaining four patients. Conclusion. The mutation screening protocol described here meets best practice guidelines for molecular testing of the DMD gene in a diagnostic laboratory. The aCGH method is a superior alternative to more conventional assays such as multiplex ligation-dependent probe amplification (MLPA). The combination of aCGH and sequence analysis will detect mutations in 98% of patients with the Duchenne or Becker muscular dystrophy. PMID:23476807

A novel dominant GJB2 (DFNA3) mutation in a Chinese family

NASA Astrophysics Data System (ADS)

Wang, Hongyang; Wu, Kaiwen; Yu, Lan; Xie, Linyi; Xiong, Wenping; Wang, Dayong; Guan, Jing; Wang, Qiuju

2017-01-01

To decipher the phenotype and genotype of a Chinese family with autosomal dominant non-syndromic hearing loss (ADNSHL) and a novel dominant missense mutation in the GJB2 gene (DFNA3), mutation screening of GJB2 was performed on the propositus from a five-generation ADNSHL family through polymerase chain reaction amplification and Sanger sequencing. The candidate variation and the co-segregation of the phenotype were verified in all ascertained family members. Targeted genes capture and next-generation sequencing (NGS) were performed to explore additional genetic variations. We identified the novel GJB2 mutation c.524C > A (p.P175H), which segregated with high frequency and was involved in progressive sensorineural hearing loss. One subject with an additional c.235delC mutation showed a more severe phenotype than did the other members with single GJB2 dominant variations. Four patients diagnosed with noise-induced hearing loss did not carry this mutation. No other pathogenic variations or modifier genes were identified by NGS. In conclusion, a novel missense mutation in GJB2 (DFNA3), affecting the second extracellular domain of the protein, was identified in a family with ADNSHL.

Identification of novel BRCA founder mutations in Middle Eastern breast cancer patients using capture and Sanger sequencing analysis.

PubMed

Bu, Rong; Siraj, Abdul K; Al-Obaisi, Khadija A S; Beg, Shaham; Al Hazmi, Mohsen; Ajarim, Dahish; Tulbah, Asma; Al-Dayel, Fouad; Al-Kuraya, Khawla S

2016-09-01

Ethnic differences of breast cancer genomics have prompted us to investigate the spectra of BRCA1 and BRCA2 mutations in different populations. The prevalence and effect of BRCA 1 and BRCA 2 mutations in Middle Eastern population is not fully explored. To characterize the prevalence of BRCA mutations in Middle Eastern breast cancer patients, BRCA mutation screening was performed in 818 unselected breast cancer patients using Capture and/or Sanger sequencing. 19 short tandem repeat (STR) markers were used for founder mutation analysis. In our study, nine different types of deleterious mutation were identified in 28 (3.4%) cases, 25 (89.3%) cases in BRCA 1 and 3 (10.7%) cases in BRCA 2. Seven recurrent mutations identified accounted for 92.9% (26/28) of all the mutant cases. Haplotype analysis was performed to confirm c.1140 dupG and c.4136_4137delCT mutations as novel putative founder mutation, accounting for 46.4% (13/28) of all BRCA mutant cases and 1.6% (13/818) of all the breast cancer cases, respectively. Moreover, BRCA 1 mutation was significantly associated with BRCA 1 protein expression loss (p = 0.0005). Our finding revealed that a substantial number of BRCA mutations were identified in clinically high risk breast cancer from Middle East region. Identification of the mutation spectrum, prevalence and founder effect in Middle Eastern population facilitates genetic counseling, risk assessment and development of cost-effective screening strategy. © 2016 UICC.

The Prevalence of Gap Junction Protein Beta 2 (GJB2) Mutations in Non Syndromic Sensorineural Hearing Loss in Çukurova Region.

PubMed

Bozdoğan, Sevcan Tuğ; Kuran, Gökhan; Yüregir, Özge Özalp; Aslan, Hüseyin; Haytoğlu, Süheyl; Ayaz, Akif; Arıkan, Osman Kürşat

2015-08-01

To date, studies in all populations showed that mutations in the gene of Gap junction protein beta 2 (GJB2) play an important role in non-syndromic autosomal recessive congenital hearing loss. The aim of this study was to evaluate GJB2 gene of patients with hearing loss in our region using deoxyribonucleic acid (DNA) sequencing method and to demonstrate region-specific mutation and polymorphism distribution. Patients who had bilateral severe sensorineural non-syndromic hearing loss identified by audiologic evaluation were included. Peripheral blood samples were collected and the GJB2 gene exon1 and exon 2 regions were amplified by polymerase chain reaction (PCR). Obtained PCR products were sequenced by the DNA sequence analysis method (SeqFinder Sequencing System; ABI 3130; Foster City, CA, USA) and analyzed using the SeqScape software. Of the 77 patients, 16 had homozygous or heterozygous mutation. The mutation of 35delG, which is known as the most frequent mutation of GJB2 gene, was also the most frequently seen mutation at a ratio of 5.5% in patients with hearing loss in our region; this was followed by the V27I mutation. As this is the first study conducted by sequence analysis in our region, it was worth to be presented in terms of showing the distribution of mutation.

Spectrum of mutations in Glutaryl-CoA dehydrogenase gene in glutaric aciduria type I--Study from South India.

PubMed

Radha Rama Devi, A; Ramesh, Vakkalagadda A; Nagarajaram, H A; Satish, S P S; Jayanthi, U; Lingappa, Lokesh

2016-01-01

Glutaric aciduria type I is an autosomal recessive organic acid disorder. The primary defect is the deficiency of Glutaryl-CoA dehydrogenase (EC number 1.3.99.7) enzyme that is involved in the catabolic pathways of the amino acids l-lysine, l-hydroxylysine, and l-tryptophan. It is a treatable neuro-metabolic disorder. Early diagnosis and treatment helps in preventing brain damage. The Glutaryl-CoA dehydrogenase gene (GCDH) gene was sequenced to identify disease causing mutations by direct sequencing of all the exons in twelve patients who were biochemically confirmed with GA I. We identified eleven mutations of which nine are homozygous mutations, one heterozygous and two synonymous mutations. Among the eleven mutations, four mutations p.Q162R, p.P286S, p.W225X in two families and p.V410M are novel. A milder clinical presentation is observed in those families who are either heterozygous or with a benign synonymous SNP. Multiple sequence alignment (MSA) of GCDH with its homologues revealed that the observed novel mutations are not tolerated by protein structure and function. The present study indicates genetic heterogeneity in GCDH gene mutations among South Indian population. Genetic analysis is useful in prenatal diagnosis and prevention. Mutation analysis is a useful tool in the absence of non-availability of enzyme assay in GA I. Copyright © 2015 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Familial Mediterranean fever with a single MEFV mutation: Where is the second hit?

PubMed Central

Booty, Matthew G.; Chae, Jae Jin; Masters, Seth L.; Remmers, Elaine F.; Barham, Beverly; Lee, Julie M.; Barron, Karyl S.; Holland, Steve; Kastner, Daniel L.; Aksentijevich, Ivona

2009-01-01

Objective FMF has traditionally been considered an autosomal recessive disease; however, it has been observed that a substantial number of patients with clinical FMF possess only one demonstrable MEFV mutation. Here, an extensive search for a second MEFV mutation was performed in 46 patients clinically diagnosed with FMF and carrying only one high-penetrance FMF mutation. Methods MEFV and other candidate genes were sequenced by standard capillary electrophoresis. The entire 15 kb MEFV genomic region was re-sequenced in 10 patients using a hybridization-based chip technology. MEFV gene expression levels were determined by qRT-PCR and pyrin protein levels were examined by Western blotting. Results A second MEFV mutation was not identified in any of the screened patients. Haplotype analysis did not identify a common haplotype that might be associated with the transmission of a second FMF allele. Western blots did not demonstrate a significant difference in pyrin levels between single and double variant patients; however, FMF patients of both types showed higher protein expression compared to controls and non-FMF patients with active inflammation. Screening of genes encoding pyrin-interacting proteins identified rare variants in a small number of patients, suggesting the possibility of digenic inheritance. Conclusion Our data underscore the existence of a significant subset of FMF patients who are carriers of only one MEFV mutation and demonstrate that complete MEFV sequencing is not likely to yield a second mutation. Screening for the set of most common mutations appears sufficient in the presence of clinical symptoms to diagnose FMF and initiate a trial of colchicine. PMID:19479870

Exome sequencing identifies complex I NDUFV2 mutations as a novel cause of Leigh syndrome.

PubMed

Cameron, Jessie M; MacKay, Nevena; Feigenbaum, Annette; Tarnopolsky, Mark; Blaser, Susan; Robinson, Brian H; Schulze, Andreas

2015-09-01

Two siblings with hypertrophic cardiomyopathy and brain atrophy were diagnosed with Complex I deficiency based on low enzyme activity in muscle and high lactate/pyruvate ratio in fibroblasts. Whole exome sequencing results of fibroblast gDNA from one sibling was narrowed down to 190 SNPs or In/Dels in 185 candidate genes by selecting non-synonymous coding sequence base pair changes that were not present in the SNP database. Two compound heterozygous mutations were identified in both siblings in NDUFV2, encoding the 24 kDa subunit of Complex I. The intronic mutation (c.IVS2 + 1delGTAA) is disease causing and has been reported before. The other mutation is novel (c.669_670insG, p.Ser224Valfs*3) and predicted to cause a pathogenic frameshift in the protein. Subsequent investigation of 10 probands with complex I deficiency from different families revealed homozygosity for the intronic c.IVS2 + 1delGTAA mutation in a second, consanguineous family. In this family three of five siblings were affected. Interestingly, they presented with Leigh syndrome but no cardiac involvement. The same genotype had been reported previously in a two families but presenting with hypertrophic cardiomyopathy, trunk hypotonia and encephalopathy. We have identified NDUFV2 mutations in two families with Complex I deficiency, including a novel mutation. The diagnosis of Leigh syndrome expands the clinical phenotypes associated with the c.IVS2 + 1delGTAA mutation in this gene. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

Population-Scale Sequencing Data Enable Precise Estimates of Y-STR Mutation Rates

PubMed Central

Willems, Thomas; Gymrek, Melissa; Poznik, G. David; Tyler-Smith, Chris; Erlich, Yaniv

2016-01-01

Short tandem repeats (STRs) are mutation-prone loci that span nearly 1% of the human genome. Previous studies have estimated the mutation rates of highly polymorphic STRs by using capillary electrophoresis and pedigree-based designs. Although this work has provided insights into the mutational dynamics of highly mutable STRs, the mutation rates of most others remain unknown. Here, we harnessed whole-genome sequencing data to estimate the mutation rates of Y chromosome STRs (Y-STRs) with 2–6 bp repeat units that are accessible to Illumina sequencing. We genotyped 4,500 Y-STRs by using data from the 1000 Genomes Project and the Simons Genome Diversity Project. Next, we developed MUTEA, an algorithm that infers STR mutation rates from population-scale data by using a high-resolution SNP-based phylogeny. After extensive intrinsic and extrinsic validations, we harnessed MUTEA to derive mutation-rate estimates for 702 polymorphic STRs by tracing each locus over 222,000 meioses, resulting in the largest collection of Y-STR mutation rates to date. Using our estimates, we identified determinants of STR mutation rates and built a model to predict rates for STRs across the genome. These predictions indicate that the load of de novo STR mutations is at least 75 mutations per generation, rivaling the load of all other known variant types. Finally, we identified Y-STRs with potential applications in forensics and genetic genealogy, assessed the ability to differentiate between the Y chromosomes of father-son pairs, and imputed Y-STR genotypes. PMID:27126583

Targeted 'next-generation' sequencing in anophthalmia and microphthalmia patients confirms SOX2, OTX2 and FOXE3 mutations.

PubMed

Jimenez, Nelson Lopez; Flannick, Jason; Yahyavi, Mani; Li, Jiang; Bardakjian, Tanya; Tonkin, Leath; Schneider, Adele; Sherr, Elliott H; Slavotinek, Anne M

2011-12-28

Anophthalmia/microphthalmia (A/M) is caused by mutations in several different transcription factors, but mutations in each causative gene are relatively rare, emphasizing the need for a testing approach that screens multiple genes simultaneously. We used next-generation sequencing to screen 15 A/M patients for mutations in 9 pathogenic genes to evaluate this technology for screening in A/M. We used a pooled sequencing design, together with custom single nucleotide polymorphism (SNP) calling software. We verified predicted sequence alterations using Sanger sequencing. We verified three mutations - c.542delC in SOX2, resulting in p.Pro181Argfs*22, p.Glu105X in OTX2 and p.Cys240X in FOXE3. We found several novel sequence alterations and SNPs that were likely to be non-pathogenic - p.Glu42Lys in CRYBA4, p.Val201Met in FOXE3 and p.Asp291Asn in VSX2. Our analysis methodology gave one false positive result comprising a mutation in PAX6 (c.1268A > T, predicting p.X423LeuextX*15) that was not verified by Sanger sequencing. We also failed to detect one 20 base pair (bp) deletion and one 3 bp duplication in SOX2. Our results demonstrated the power of next-generation sequencing with pooled sample groups for the rapid screening of candidate genes for A/M as we were correctly able to identify disease-causing mutations. However, next-generation sequencing was less useful for small, intragenic deletions and duplications. We did not find mutations in 10/15 patients and conclude that there is a need for further gene discovery in A/M.

Targeted 'Next-Generation' sequencing in anophthalmia and microphthalmia patients confirms SOX2, OTX2 and FOXE3 mutations

PubMed Central

2011-01-01

Background Anophthalmia/microphthalmia (A/M) is caused by mutations in several different transcription factors, but mutations in each causative gene are relatively rare, emphasizing the need for a testing approach that screens multiple genes simultaneously. We used next-generation sequencing to screen 15 A/M patients for mutations in 9 pathogenic genes to evaluate this technology for screening in A/M. Methods We used a pooled sequencing design, together with custom single nucleotide polymorphism (SNP) calling software. We verified predicted sequence alterations using Sanger sequencing. Results We verified three mutations - c.542delC in SOX2, resulting in p.Pro181Argfs*22, p.Glu105X in OTX2 and p.Cys240X in FOXE3. We found several novel sequence alterations and SNPs that were likely to be non-pathogenic - p.Glu42Lys in CRYBA4, p.Val201Met in FOXE3 and p.Asp291Asn in VSX2. Our analysis methodology gave one false positive result comprising a mutation in PAX6 (c.1268A > T, predicting p.X423LeuextX*15) that was not verified by Sanger sequencing. We also failed to detect one 20 base pair (bp) deletion and one 3 bp duplication in SOX2. Conclusions Our results demonstrated the power of next-generation sequencing with pooled sample groups for the rapid screening of candidate genes for A/M as we were correctly able to identify disease-causing mutations. However, next-generation sequencing was less useful for small, intragenic deletions and duplications. We did not find mutations in 10/15 patients and conclude that there is a need for further gene discovery in A/M. PMID:22204637

GATA3 mutation in a family with hypoparathyroidism, deafness and renal dysplasia syndrome.

PubMed

Zhu, Zi-Yang; Zhou, Qiao-Li; Ni, Shi-Ning; Gu, Wei

2014-08-01

The hypoparathyroidism, deafness and renal dysplasia (HDR) syndrome is an autosomal dominant disorder primarily caused by GATA3 gene mutation. We report here a case that both of a Chinese boy and his father had HDR syndrome which caused by a novel mutation of GATA3. Polymerase chain reaction and DNA sequencing was performed to detect the exons of the GATA3 gene for mutation analysis. Sequence analysis of GATA3 revealed a heterozygous nonsense mutation in this family: a mutation of GATA3 at exon 2 (c.515C >A) that resulted in a premature stop at codon 172 (p.S172X) with a loss of two zinc finger domains. We identified a novel nonsense mutation which will expand the spectrum of HDR-associated GATA3 mutations.

Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

PubMed

Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

2018-04-16

In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

Multiplexed fragaria chloroplast genome sequencing

Treesearch

W. Njuguna; A. Liston; R. Cronn; N.V. Bassil

2010-01-01

A method to sequence multiple chloroplast genomes using ultra high throughput sequencing technologies was recently described. Complete chloroplast genome sequences can resolve phylogenetic relationships at low taxonomic levels and identify informative point mutations and indels. The objective of this research was to sequence multiple Fragaria...

Genetic heterogeneity of diffuse large B-cell lymphoma.

PubMed

Zhang, Jenny; Grubor, Vladimir; Love, Cassandra L; Banerjee, Anjishnu; Richards, Kristy L; Mieczkowski, Piotr A; Dunphy, Cherie; Choi, William; Au, Wing Yan; Srivastava, Gopesh; Lugar, Patricia L; Rizzieri, David A; Lagoo, Anand S; Bernal-Mizrachi, Leon; Mann, Karen P; Flowers, Christopher; Naresh, Kikkeri; Evens, Andrew; Gordon, Leo I; Czader, Magdalena; Gill, Javed I; Hsi, Eric D; Liu, Qingquan; Fan, Alice; Walsh, Katherine; Jima, Dereje; Smith, Lisa L; Johnson, Amy J; Byrd, John C; Luftig, Micah A; Ni, Ting; Zhu, Jun; Chadburn, Amy; Levy, Shawn; Dunson, David; Dave, Sandeep S

2013-01-22

Diffuse large B-cell lymphoma (DLBCL) is the most common form of lymphoma in adults. The disease exhibits a striking heterogeneity in gene expression profiles and clinical outcomes, but its genetic causes remain to be fully defined. Through whole genome and exome sequencing, we characterized the genetic diversity of DLBCL. In all, we sequenced 73 DLBCL primary tumors (34 with matched normal DNA). Separately, we sequenced the exomes of 21 DLBCL cell lines. We identified 322 DLBCL cancer genes that were recurrently mutated in primary DLBCLs. We identified recurrent mutations implicating a number of known and not previously identified genes and pathways in DLBCL including those related to chromatin modification (ARID1A and MEF2B), NF-κB (CARD11 and TNFAIP3), PI3 kinase (PIK3CD, PIK3R1, and MTOR), B-cell lineage (IRF8, POU2F2, and GNA13), and WNT signaling (WIF1). We also experimentally validated a mutation in PIK3CD, a gene not previously implicated in lymphomas. The patterns of mutation demonstrated a classic long tail distribution with substantial variation of mutated genes from patient to patient and also between published studies. Thus, our study reveals the tremendous genetic heterogeneity that underlies lymphomas and highlights the need for personalized medicine approaches to treating these patients.

Germline Mutations in PALB2, BRCA1, and RAD51C, Which Regulate DNA Recombination Repair, in Patients with Gastric Cancer

PubMed Central

Sahasrabudhe, Ruta; Lott, Paul; Bohorquez, Mabel; Toal, Ted; Estrada, Ana P.; Suarez, John J.; Brea-Fernández, Alejandro; Cameselle-Teijeiro, José; Pinto, Carla; Ramos, Irma; Mantilla, Alejandra; Prieto, Rodrigo; Corvalan, Alejandro; Norero, Enrique; Alvarez, Carolina; Tapia, Teresa; Carvallo, Pilar; Gonzalez, Luz M.; Cock-Rada, Alicia; Solano, Angela; Neffa, Florencia; Valle, Adriana Della; Yau, Chris; Soares, Gabriela; Borowsky, Alexander; Hu, Nan; He, Li-Ji; Han, Xiao-You; Taylor, Philip R.; Goldstein, Alisa M.; Torres, Javier; Echeverry, Magdalena; Ruiz-Ponte, Clara; Teixeira, Manuel R.; Carvajal Carmona, Luis G.

2016-01-01

Up to 10% of cases of gastric cancer are familial, but so far, only mutations in CDH1 have been associated with gastric cancer risk. To identify genetic variants that affect risk for gastric cancer, we collected blood samples from 28 patients with hereditary diffuse gastric cancer (HDGC) not associated with mutations in CDH1 and performed whole-exome sequence analysis. We then analyzed sequences of candidate genes in 333 independent HDGC and non-HDGC cases. We identified 11 cases with mutations in PALB2, BRCA1, or RAD51C genes, which regulate homologous DNA recombination. We found these mutations in 2 of 31 patients with HDGC (6.5%) and 9 of 331 patients with sporadic gastric cancer (2.8%). Most of these mutations had been previously associated with other types of tumors and partially co-segregated with gastric cancer in our study. Tumors that developed in patients with these mutations had a mutation signature associated with somatic homologous recombination deficiency. Our findings indicate that defects in homologous recombination increase risk for gastric cancer. PMID:28024868

Two novel disease-causing mutations in the CLRN1 gene in patients with Usher syndrome type 3

PubMed Central

García-García, Gema; Aparisi, María J.; Rodrigo, Regina; Sequedo, María D.; Espinós, Carmen; Rosell, Jordi; Olea, José L.; Mendívil, M. Paz; Ramos-Arroyo, María A; Ayuso, Carmen; Jaijo, Teresa; Aller, Elena

2012-01-01

Purpose To identify the genetic defect in Spanish families with Usher syndrome (USH) and probable involvement of the CLRN1 gene. Methods DNA samples of the affected members of our cohort of USH families were tested using an USH genotyping array, and/or genotyped with polymorphic markers specific for the USH3A locus. Based on these previous analyses and clinical findings, CLRN1 was directly sequenced in 17 patients susceptible to carrying mutations in this gene. Results Microarray analysis revealed the previously reported mutation p.Y63X in two unrelated patients, one of them homozygous for the mutation. After CLRN1 sequencing, we found two novel mutations, p.R207X and p.I168N. Both novel mutations segregated with the phenotype. Conclusions To date, 18 mutations in CLRN1 have been reported. In this work, we report two novel mutations and a third one previously identified in the Spanish USH sample. The prevalence of CLRN1 among our patients with USH is low. PMID:23304067

Identification of ribonucleotide reductase mutation causing temperature-sensitivity of herpes simplex virus isolates from whitlow by deep sequencing.

PubMed

Daikoku, Tohru; Oyama, Yukari; Yajima, Misako; Sekizuka, Tsuyoshi; Kuroda, Makoto; Shimada, Yuka; Takehara, Kazuhiko; Miwa, Naoko; Okuda, Tomoko; Sata, Tetsutaro; Shiraki, Kimiyasu

2015-06-01

Herpes simplex virus 2 caused a genital ulcer, and a secondary herpetic whitlow appeared during acyclovir therapy. The secondary and recurrent whitlow isolates were acyclovir-resistant and temperature-sensitive in contrast to a genital isolate. We identified the ribonucleotide reductase mutation responsible for temperature-sensitivity by deep-sequencing analysis.

[Detection and prenatal diagnosis for RS1 gene mutations in two Chinese families with X-linked juvenile retinoschisis].

PubMed

Chu, Yan; Fang, Dong; Hou, Qiao-fang; Wang, Li-ya; Guo, Xi-rang; Wang, Ying-tai; Liao, Shi-xiu

2013-04-01

To identify potential mutations of retinoschisis 1 (RS1) gene responsible for X-linked retinoschisis (XLRS) in two Chinese families. The 6 exons and flanking intronic regions were analyzed with PCR and direct sequencing. Two RS1 mutations were identified in the two families, which included 1 frameshift mutation (c.573delG, p.Pro192fs) and 1 missense mutation (c.626G>A, p.Arg209His). Two RS1 mutations have been identified, among which Pro192fs mutation is discovered for the first time in Chinese population. Above results may enrich our understanding of the clinical manifestations of XLRS and facilitated early diagnosis and genetic counseling for the disease.

hnRNPA2B1 and hnRNPA1 mutations are rare in patients with "multisystem proteinopathy" and frontotemporal lobar degeneration phenotypes.

PubMed

Le Ber, Isabelle; Van Bortel, Inge; Nicolas, Gael; Bouya-Ahmed, Kawtar; Camuzat, Agnès; Wallon, David; De Septenville, Anne; Latouche, Morwena; Lattante, Serena; Kabashi, Edor; Jornea, Ludmila; Hannequin, Didier; Brice, Alexis

2014-04-01

hnRNPA2B1 and hnRNPA1 mutations have been recently identified by exome sequencing in three families presenting with multisystem proteinopathy (MSP), a rare complex phenotype associating frontotemporal lobar degeneration (FTLD), Paget disease of bone (PDB), inclusion body myopathy (IBM), and amyotrophic lateral sclerosis (ALS). No study has evaluated the exact frequency of these genes in cohorts of MSP or FTD patients so far. We sequenced both genes in 17 patients with MSP phenotypes, and in 60 patients with FTLD and FTLD-ALS to test whether mutations could be implicated in the pathogenesis of these disorders. No disease-causing mutation was identified. We conclude that hnRNPA2B1 and hnRNPA1 mutations are rare in MSP and FTLD spectrum of diseases, although further investigations in larger populations are needed. Copyright © 2014 Elsevier Inc. All rights reserved.

A novel homozygous HOXB1 mutation in a Turkish family with hereditary congenital facial paresis.

PubMed

Sahin, Yavuz; Güngör, Olcay; Ayaz, Akif; Güngör, Gülay; Sahin, Bedia; Yaykasli, Kursad; Ceylaner, Serdar

2017-02-01

Hereditary congenital facial paresis (HCFP) is characterized by isolated dysfunction of the facial nerve (CN VII) due to congenital cranial dysinnervation disorders. HCFP has genetic heterogeneity and HOXB1 is the first identified gene. We report the clinical, radiologic and molecular investigations of three patients admitted for HCFP in a large consanguineous Turkish family. High-throughput sequencing and Sanger sequencing of all patients revealed a novel homozygous mutation p.Arg230Trp (c.688C>T) within the HOXB1 gene. The report of the mutation brings the total number of HOXB1 mutations identified in HCFP to four. The results of this study emphasize that in individuals with congenital facial palsy accompanied by hearing loss and dysmorphic facial features, HOXB1 mutation causing HCFP should be kept in mind. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Detection of cystic fibrosis mutations in a GeneChip{trademark} assay format

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyada, C.G.; Cronin, M.T.; Kim, S.M.

1994-09-01

We are developing assays for the detection of cystic fibrosis mutations based on DNA hybridization. A DNA sample is amplified by PCR, labeled by incorporating a fluorescein-tagged dNTP, enzymatically treated to produce smaller fragments and hybridized to a series of short (13-16 bases) oligonucleotides synthesized on a glass surface via photolithography. The hybrids are detected by eqifluorescence and mutations are identified by the specific pattern of hybridization. In a GeneChip assay, the chip surface is composed of a series of subarrays, each being specific for a particular mutation. Each subarray is further subdivided into a series of probes (40 total),more » half based on the mutant sequence and the remainder based on the wild-type sequence. For each of the subarrays, there is a redundancy in the number of probes that should hybridize to either a wild-type or a mutant target. The multiple probe strategy provides sequence information for a short five base region overlapping the mutation site. In addition, homozygous wild-type and mutant as well as heterozygous samples are each identified by a specific pattern of hybridization. The small size of each probe feature (250 x 250 {mu}m{sup 2}) permits the inclusion of additional probes required to generate sequence information by hybridization.« less

Whole-exome sequencing identifies recurrent AKT1 mutations in sclerosing hemangioma of lung

PubMed Central

Jung, Seung-Hyun; Kim, Min Sung; Lee, Sung-Hak; Park, Hyun-Chun; Choi, Hyun Joo; Maeng, Leeso; Min, Ki Ouk; Kim, Jeana; Park, Tae In; Shin, Ok Ran; Kim, Tae-Jung; Xu, Haidong; Lee, Kyo Young; Kim, Tae-Min; Song, Sang Yong; Lee, Charles; Chung, Yeun-Jun; Lee, Sug Hyung

2016-01-01

Pulmonary sclerosing hemangioma (PSH) is a benign tumor with two cell populations (epithelial and stromal cells), for which genomic profiles remain unknown. We conducted exome sequencing of 44 PSHs and identified recurrent somatic mutations of AKT1 (43.2%) and β-catenin (4.5%). We used a second subset of 24 PSHs to confirm the high frequency of AKT1 mutations (overall 31/68, 45.6%; p.E17K, 33.8%) and recurrent β-catenin mutations (overall 3 of 68, 4.4%). Of the PSHs without AKT1 mutations, two exhibited AKT1 copy gain. AKT1 mutations existed in both epithelial and stromal cells. In two separate PSHs from one patient, we observed two different AKT1 mutations, indicating they were not disseminated but independent arising tumors. Because the AKT1 mutations were not found to co-occur with β-catenin mutations (or any other known driver alterations) in any of the PSHs studied, we speculate that this may be the single-most common driver alteration to develop PSHs. Our study revealed genomic differences between PSHs and lung adenocarcinomas, including a high rate of AKT1 mutation in PSHs. These genomic features of PSH identified in the present study provide clues to understanding the biology of PSH and for differential genomic diagnosis of lung tumors. PMID:27601661

A novel large deletion mutation of FERMT1 gene in a Chinese patient with Kindler syndrome.

PubMed

Gao, Ying; Bai, Jin-li; Liu, Xiao-yan; Qu, Yu-jin; Cao, Yan-yan; Wang, Jian-cai; Jin, Yu-wei; Wang, Hong; Song, Fang

2015-11-01

Kindler syndrome (KS; OMIM 173650) is a rare autosomal recessive skin disorder, which results in symptoms including blistering, epidermal atrophy, increased risk of cancer, and poor wound healing. The majority of mutations of the disease-determining gene (FERMT1 gene) are single nucleotide substitutions, including missense mutations, nonsense mutations, etc. Large deletion mutations are seldom reported. To determine the mutation in the FERMT1 gene associated with a 7-year-old Chinese patient who presented clinical manifestation of KS, we performed direct sequencing of all the exons of FERMT1 gene. For the exons 2-6 without amplicons, we analyzed the copy numbers using quantitative real-time polymerase chain reaction (qRT-PCR) with specific primers. The deletion breakpoints were sublocalized and the range of deletion was confirmed by PCR and direct sequencing. In this study, we identified a new 17-kb deletion mutation spanning the introns 1-6 of FERMT1 gene in a Chinese patient with severe KS phenotypes. Her parents were carriers of the same mutation. Our study reported a newly identified large deletion mutation of FERMT1 gene involved in KS, which further enriched the mutation spectrum of the FERMT1 gene.

Novel splice mutation in microthalmia-associated transcription factor in Waardenburg Syndrome.

PubMed

Brenner, Laura; Burke, Kelly; Leduc, Charles A; Guha, Saurav; Guo, Jiancheng; Chung, Wendy K

2011-01-01

Waardenburg Syndrome (WS) is a syndromic form of hearing loss associated with mutations in six different genes. We identified a large family with WS that had previously undergone clinical testing, with no reported pathogenic mutation. Using linkage analysis, a region on 3p14.1 with an LOD score of 6.6 was identified. Microthalmia-Associated Transcription Factor, a gene known to cause WS, is located within this region of linkage. Sequencing of Microthalmia-Associated Transcription Factor demonstrated a c.1212 G>A synonymous variant that segregated with the WS in the family and was predicted to cause a novel splicing site that was confirmed with expression analysis of the mRNA. This case illustrates the need to computationally analyze novel synonymous sequence variants for possible effects on splicing to maximize the clinical sensitivity of sequence-based genetic testing.

Nuclear proteins that bind the human gamma-globin gene promoter: alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.

PubMed Central

Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S

1988-01-01

The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996

An innovative diagnostic technology for the codon mutation C580Y in kelch13 of Plasmodium falciparum with MinION nanopore sequencer.

PubMed

Imai, Kazuo; Tarumoto, Norihito; Runtuwene, Lucky Ronald; Sakai, Jun; Hayashida, Kyoko; Eshita, Yuki; Maeda, Ryuichiro; Tuda, Josef; Ohno, Hideaki; Murakami, Takashi; Maesaki, Shigefumi; Suzuki, Yutaka; Yamagishi, Junya; Maeda, Takuya

2018-05-29

The recent spread of artemisinin (ART)-resistant Plasmodium falciparum represents an emerging global threat to public health. In Southeast Asia, the C580Y mutation of kelch13 (k13) is the dominant mutation of ART-resistant P. falciparum. Therefore, a simple method for the detection of C580Y mutation is urgently needed to enable widespread routine surveillance in the field. The aim of this study is to develop a new diagnostic procedure for the C580Y mutation using loop-mediated isothermal amplification (LAMP) combined with the MinION nanopore sequencer. A LAMP assay for the k13 gene of P. falciparum to detect the C580Y mutation was successfully developed. The detection limit of this procedure was 10 copies of the reference plasmid harboring the k13 gene within 60 min. Thereafter, amplicon sequencing of the LAMP products using the MinION nanopore sequencer was performed to clarify the nucleotide sequences of the gene. The C580Y mutation was identified based on the sequence data collected from MinION reads 30 min after the start of sequencing. Further, clinical evaluation of the LAMP assay in 34 human blood samples collected from patients with P. falciparum malaria in Indonesia revealed a positive detection rate of 100%. All LAMP amplicons of up to 12 specimens were simultaneously sequenced using MinION. The results of sequencing were consistent with those of the conventional PCR and Sanger sequencing protocol. All procedures from DNA extraction to variant calling were completed within 3 h. The C580Y mutation was not found among these 34 P. falciparum isolates in Indonesia. An innovative method combining LAMP and MinION will enable simple, rapid, and high-sensitivity detection of the C580Y mutation of P. falciparum, even in resource-limited situations in developing countries.

Genetic analyses of isolated high-grade pancreatic intraepithelial neoplasia (HG-PanIN) reveal paucity of alterations in TP53 and SMAD4.

PubMed

Hosoda, Waki; Chianchiano, Peter; Griffin, James F; Pittman, Meredith E; Brosens, Lodewijk Aa; Noë, Michaël; Yu, Jun; Shindo, Koji; Suenaga, Masaya; Rezaee, Neda; Yonescu, Raluca; Ning, Yi; Albores-Saavedra, Jorge; Yoshizawa, Naohiko; Harada, Kenichi; Yoshizawa, Akihiko; Hanada, Keiji; Yonehara, Shuji; Shimizu, Michio; Uehara, Takeshi; Samra, Jaswinder S; Gill, Anthony J; Wolfgang, Christopher L; Goggins, Michael G; Hruban, Ralph H; Wood, Laura D

2017-05-01

High-grade pancreatic intraepithelial neoplasia (HG-PanIN) is the major precursor of pancreatic ductal adenocarcinoma (PDAC) and is an ideal target for early detection. To characterize pure HG-PanIN, we analysed 23 isolated HG-PanIN lesions occurring in the absence of PDAC. Whole-exome sequencing of five of these HG-PanIN lesions revealed a median of 33 somatic mutations per lesion, with a total of 318 mutated genes. Targeted next-generation sequencing of 17 HG-PanIN lesions identified KRAS mutations in 94% of the lesions. CDKN2A alterations occurred in six HG-PanIN lesions, and RNF43 alterations in five. Mutations in TP53, GNAS, ARID1A, PIK3CA, and TGFBR2 were limited to one or two HG-PanINs. No non-synonymous mutations in SMAD4 were detected. Immunohistochemistry for p53 and SMAD4 proteins in 18 HG-PanINs confirmed the paucity of alterations in these genes, with aberrant p53 labelling noted only in three lesions, two of which were found to be wild type in sequencing analyses. Sixteen adjacent LG-PanIN lesions from ten patients were also sequenced using targeted sequencing. LG-PanIN harboured KRAS mutations in 94% of the lesions; mutations in CDKN2A, TP53, and SMAD4 were not identified. These results suggest that inactivation of TP53 and SMAD4 are late genetic alterations, predominantly occurring in invasive PDAC. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Identification of a novel LMF1 nonsense mutation responsible for severe hypertriglyceridemia by targeted next-generation sequencing.

PubMed

Cefalù, Angelo B; Spina, Rossella; Noto, Davide; Ingrassia, Valeria; Valenti, Vincenza; Giammanco, Antonina; Fayer, Francesca; Misiano, Gabriella; Cocorullo, Gianfranco; Scrimali, Chiara; Palesano, Ornella; Altieri, Grazia I; Ganci, Antonina; Barbagallo, Carlo M; Averna, Maurizio R

Severe hypertriglyceridemia (HTG) may result from mutations in genes affecting the intravascular lipolysis of triglyceride (TG)-rich lipoproteins. The aim of this study was to develop a targeted next-generation sequencing panel for the molecular diagnosis of disorders characterized by severe HTG. We developed a targeted customized panel for next-generation sequencing Ion Torrent Personal Genome Machine to capture the coding exons and intron/exon boundaries of 18 genes affecting the main pathways of TG synthesis and metabolism. We sequenced 11 samples of patients with severe HTG (TG>885 mg/dL-10 mmol/L): 4 positive controls in whom pathogenic mutations had previously been identified by Sanger sequencing and 7 patients in whom the molecular defect was still unknown. The customized panel was accurate, and it allowed to confirm genetic variants previously identified in all positive controls with primary severe HTG. Only 1 patient of 7 with HTG was found to be carrier of a homozygous pathogenic mutation of the third novel mutation of LMF1 gene (c.1380C>G-p.Y460X). The clinical and molecular familial cascade screening allowed the identification of 2 additional affected siblings and 7 heterozygous carriers of the mutation. We showed that our targeted resequencing approach for genetic diagnosis of severe HTG appears to be accurate, less time consuming, and more economical compared with traditional Sanger resequencing. The identification of pathogenic mutations in candidate genes remains challenging and clinical resequencing should mainly intended for patients with strong clinical criteria for monogenic severe HTG. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Phenotypic Heterogeneity in a DFNA20/26 family segregating a novel ACTG1 mutation.

PubMed

Yuan, Yongyi; Gao, Xue; Huang, Bangqing; Lu, Jingqiao; Wang, Guojian; Lin, Xi; Qu, Yan; Dai, Pu

2016-02-01

Genetic factors play an important role in hearing loss, contributing to approximately 60% of cases of congenital hearing loss. Autosomal dominant deafness accounts for approximately 20% of cases of hereditary hearing loss. Diseases with autosomal dominant inheritance often show pleiotropy, different degrees of penetrance, and variable expressivity. A three-generation Chinese family with autosomal dominant nonsyndromic hearing impairment (ADNSHI) was enrolled in this study. Audiometric data and blood samples were collected from the family. In total, 129 known human deafness genes were sequenced using next-generation sequencing (NGS) to identify the responsible gene mutation in the family. Whole Exome Sequencing (WES) was performed to exclude any other variant that cosegregated with the phenotype. The age of onset of the affected family members was the second decade of life. The condition began with high-frequency hearing impairment in all family members excluding III:2. The novel ACTG1 c.638A > G (p.K213R) mutation was found in all affected family members and was not found in the unaffected family members. A heterozygous c.638A > G mutation in ACTG1 and homozygous c.109G > A (p.V37I) mutation in GJB2 were found in III:2, who was born with hearing loss. The WES result concurred with that of targeted sequencing of known deafness genes. The novel mutation p.K213R in ACTG1 was found to be co-segregated with hearing loss and the genetic cause of ADNSHI in this family. A homozygous mutation associated with recessive inheritance only rarely co-acts with a dominant mutation to result in hearing loss in a dominant family. In such cases, the mutations in the two genes, as in ACTG1 and GJB2 in the present study, may result in a more severe phenotype. Targeted sequencing of known deafness genes is one of the best choices to identify the genetic cause in hereditary hearing loss families.

[Analysis of genotype and phenotype correlation of MYH7-V878A mutation among ethnic Han Chinese pedigrees affected with hypertrophic cardiomyopathy].

PubMed

Wang, Bo; Guo, Ruiqi; Zuo, Lei; Shao, Hong; Liu, Ying; Wang, Yu; Ju, Yan; Sun, Chao; Wang, Lifeng; Zhang, Yanmin; Liu, Liwen

2017-08-10

To analyze the phenotype-genotype correlation of MYH7-V878A mutation. Exonic amplification and high-throughput sequencing of 96-cardiovascular disease-related genes were carried out on probands from 210 pedigrees affected with hypertrophic cardiomyopathy (HCM). For the probands, their family members, and 300 healthy volunteers, the identified MYH7-V878A mutation was verified by Sanger sequencing. Information of the HCM patients and their family members, including clinical data, physical examination, echocardiography (UCG), electrocardiography (ECG), and conserved sequence of the mutation among various species were analyzed. A MYH7-V878A mutation was detected in five HCM pedigrees containing 31 family members. Fourteen members have carried the mutation, among whom 11 were diagnosed with HCM, while 3 did not meet the diagnostic criteria. Some of the fourteen members also carried other mutations. Family members not carrying the mutation had normal UCG and ECG. No MYH7-V878A mutation was found among the 300 healthy volunteers. Analysis of sequence conservation showed that the amino acid is located in highly conserved regions among various species. MYH7-V878A is a hot spot among ethnic Han Chinese with a high penetrance. Functional analysis of the conserved sequences suggested that the mutation may cause significant alteration of the function. MYH7-V878A has a significant value for the early diagnosis of HCM.

[Analysis of MAT1A gene mutations in a child affected with simple hypermethioninemia].

PubMed

Sun, Yun; Ma, Dingyuan; Wang, Yanyun; Yang, Bin; Jiang, Tao

2017-02-10

To detect potential mutations of MAT1A gene in a child suspected with simple hypermethioninemia by MS/MS neonatal screening. Clinical data of the child was collected. Genomic DNA was extracted by a standard method and subjected to targeted sequencing using an Ion Ampliseq TM Inherited Disease Panel. Detected mutations were verified by Sanger sequencing. The child showed no clinical features except evaluated methionine. A novel compound mutation of the MAT1A gene, i.e., c.345delA and c.529C>T, was identified in the child. His father and mother were found to be heterozygous for the c.345delA mutation and c.529C>T mutation, respectively. The compound mutation c.345delA and c.529C>T of the MAT1A gene probably underlie the disease in the child. The semi-conductor sequencing has provided an important means for the diagnosis of hereditary diseases.

Clinical features of X linked juvenile retinoschisis associated with new mutations in the XLRS1 gene in Italian families.

PubMed

Simonelli, F; Cennamo, G; Ziviello, C; Testa, F; de Crecchio, G; Nesti, A; Manitto, M P; Ciccodicola, A; Banfi, S; Brancato, R; Rinaldi, E

2003-09-01

To describe the clinical phenotype of X linked juvenile retinoschisis in eight Italian families with six different mutations in the XLRS1 gene. Complete ophthalmic examinations, electroretinography and A and B-scan standardised echography were performed in 18 affected males. The coding sequences of the XLRS1 gene were amplified by polymerase chain reaction and directly sequenced on an automated sequencer. Six different XLRS1 mutations were identified; two of these mutations Ile81Asn and the Trp122Cys, have not been previously described. The affected males showed an electronegative response to the standard white scotopic stimulus and a prolonged implicit time of the 30 Hz flicker. In the families with Trp112Cys and Trp122Cys mutations we observed a more severe retinoschisis (RS) clinical picture compared with the other genotypes. The severe RS phenotypes associated with Trp112Cys and to Trp122Cys mutations suggest that these mutations determine a notable alteration in the function of the retinoschisin protein.

Mutation analysis of seven known glaucoma-associated genes in Chinese patients with glaucoma.

PubMed

Huang, Xiaobo; Li, Miaoling; Guo, Xiangming; Li, Shiqiang; Xiao, Xueshan; Jia, Xiaoyun; Liu, Xing; Zhang, Qingjiong

2014-05-13

To evaluate mutations in the MYOC, WDR36, OPTN, OPA1, NTF4, CYP1B1, and LTBP2 genes in a cohort of Chinese patients with primary glaucoma. Genomic DNA was prepared from 683 unrelated patients, including 50 with primary congenital glaucoma, 104 with juvenile open-angle glaucoma (JOAG), 186 with primary open-angle glaucoma (POAG), and 343 with primary angle-closure glaucoma (PACG). Mutations in the seven genes in 257 patients (36 with JOAG, 89 with POAG, and 132 with PACG) were initially analyzed by exome sequencing and then confirmed by Sanger sequencing. In addition, Sanger sequencing was used to detect MYOC mutations in the remaining 426 patients. Exome sequencing identified 19 mutations (6 in MYOC, 9 in WDR36, 3 in OPA1, and 1 in OPTN) in 20 of 257 patients, including 4 patients with JOAG, 8 patients with POAG, and 8 patients with PACG. No mutation was detected in the other three genes. In addition, Sanger sequencing detected additional MYOC mutations in 5 of the remaining 426 patients, including 3 patients with JOAG and 2 patients with POAG. Twenty-two mutations in MYOC, WDR36, OPA1, and OPTN were detected in 25 of the 683 patients with primary glaucoma, including nine MYOC mutations in 11 patients, nine WDR36 mutations in 11 patients, three OPA1 mutations in 3 patients, and one OPTN mutation in a patient who also carried a MYOC mutation. Eight mutations in MYOC, WDR36, and OPA1 in 8 of the 343 PACG patients are of uncertain significance and need to be analyzed further. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

Whole-exome sequencing identifies recurrent SF3B1 R625 mutation and comutation of NF1 and KIT in mucosal melanoma.

PubMed

Hintzsche, Jennifer D; Gorden, Nicholas T; Amato, Carol M; Kim, Jihye; Wuensch, Kelsey E; Robinson, Steven E; Applegate, Allison J; Couts, Kasey L; Medina, Theresa M; Wells, Keith R; Wisell, Joshua A; McCarter, Martin D; Box, Neil F; Shellman, Yiqun G; Gonzalez, Rene C; Lewis, Karl D; Tentler, John J; Tan, Aik Choon; Robinson, William A

2017-06-01

Mucosal melanomas are a rare subtype of melanoma, arising in mucosal tissues, which have a very poor prognosis due to the lack of effective targeted therapies. This study aimed to better understand the molecular landscape of these cancers and find potential new therapeutic targets. Whole-exome sequencing was performed on mucosal melanomas from 19 patients and 135 sun-exposed cutaneous melanomas, with matched peripheral blood samples when available. Mutational profiles were compared between mucosal subgroups and sun-exposed cutaneous melanomas. Comparisons of molecular profiles identified 161 genes enriched in mucosal melanoma (P<0.05). KIT and NF1 were frequently comutated (32%) in the mucosal subgroup, with a significantly higher incidence than that in cutaneous melanoma (4%). Recurrent SF3B1 R625H/S/C mutations were identified and validated in 7 of 19 (37%) mucosal melanoma patients. Mutations in the spliceosome pathway were found to be enriched in mucosal melanomas when compared with cutaneous melanomas. Alternative splicing in four genes were observed in SF3B1-mutant samples compared with the wild-type samples. This study identified potential new therapeutic targets for mucosal melanoma, including comutation of NF1 and KIT, and recurrent R625 mutations in SF3B1. This is the first report of SF3B1 R625 mutations in vulvovaginal mucosal melanoma, with the largest whole-exome sequencing project of mucosal melanomas to date. The results here also indicated that the mutations in SF3B1 lead to alternative splicing in multiple genes. These findings expand our knowledge of this rare disease.

Whole-exome sequencing identifies recurrent SF3B1 R625 mutation and comutation of NF1 and KIT in mucosal melanoma

PubMed Central

Hintzsche, Jennifer D.; Gorden, Nicholas T.; Amato, Carol M.; Kim, Jihye; Wuensch, Kelsey E.; Robinson, Steven E.; Applegate, Allison J.; Couts, Kasey L.; Medina, Theresa M.; Wells, Keith R.; Wisell, Joshua A.; McCarter, Martin D.; Box, Neil F.; Shellman, Yiqun G.; Gonzalez, Rene C.; Lewis, Karl D.; Tentler, John J.

2017-01-01

Mucosal melanomas are a rare subtype of melanoma, arising in mucosal tissues, which have a very poor prognosis due to the lack of effective targeted therapies. This study aimed to better understand the molecular landscape of these cancers and find potential new therapeutic targets. Whole-exome sequencing was performed on mucosal melanomas from 19 patients and 135 sun-exposed cutaneous melanomas, with matched peripheral blood samples when available. Mutational profiles were compared between mucosal subgroups and sun-exposed cutaneous melanomas. Comparisons of molecular profiles identified 161 genes enriched in mucosal melanoma (P<0.05). KIT and NF1 were frequently comutated (32%) in the mucosal subgroup, with a significantly higher incidence than that in cutaneous melanoma (4%). Recurrent SF3B1 R625H/S/C mutations were identified and validated in 7 of 19 (37%) mucosal melanoma patients. Mutations in the spliceosome pathway were found to be enriched in mucosal melanomas when compared with cutaneous melanomas. Alternative splicing in four genes were observed in SF3B1-mutant samples compared with the wild-type samples. This study identified potential new therapeutic targets for mucosal melanoma, including comutation of NF1 and KIT, and recurrent R625 mutations in SF3B1. This is the first report of SF3B1 R625 mutations in vulvovaginal mucosal melanoma, with the largest whole-exome sequencing project of mucosal melanomas to date. The results here also indicated that the mutations in SF3B1 lead to alternative splicing in multiple genes. These findings expand our knowledge of this rare disease. PMID:28296713

Structure of adenovirus bound to cellular receptor car

DOEpatents

Freimuth, Paul I.

2004-05-18

Disclosed is a mutant adenovirus which has a genome comprising one or more mutations in sequences which encode the fiber protein knob domain wherein the mutation causes the encoded viral particle to have significantly weakened binding affinity for CARD1 relative to wild-type adenovirus. Such mutations may be in sequences which encode either the AB loop, or the HI loop of the fiber protein knob domain. Specific residues and mutations are described. Also disclosed is a method for generating a mutant adenovirus which is characterized by a receptor binding affinity or specificity which differs substantially from wild type. In the method, residues of the adenovirus fiber protein knob domain which are predicted to alter D1 binding when mutated, are identified from the crystal structure coordinates of the AD12knob:CAR-D1 complex. A mutation which alters one or more of the identified residues is introduced into the genome of the adenovirus to generate a mutant adenovirus. Whether or not the mutant produced exhibits altered adenovirus-CAR binding properties is then determined.

Pitfalls and caveats in BRCA sequencing.

PubMed

Bellosillo, Beatriz; Tusquets, Ignacio

2006-01-01

Between 5 and 10% of breast cancer cases are considered to result from hereditary predisposition. Germ-line mutations in BRCA1 and BRCA2 are responsible for an inherited predisposition of breast and ovarian cancer. Direct nucleotide sequencing is considered the gold standard technique for mutation detection for genes such as BRCA1 and BRCA2. In many laboratories that analyze BRCA1 and BRCA2, previous to direct sequencing, screening techniques to identify sequence variants in the PCR amplicons are performed. The mutations detected in these genes may be frameshift mutations (insertions or deletions), nonsense mutations, or missense mutations. The clinical interpretation of the mutation as the cause of the disease may be difficult to establish in the case of missense mutations. Only in 30-70% of the families in which a hereditary component is suspected, a mutation in BRCA1 and/or BRCA2 is detected. Negative results may be due to: wrong selection of the proband; mutations in the regulatory portion of the genes; gene silencing due to epigenetic phenomena; or large genomic rearrangements that produce deletions of whole exons. Another possibility that explains the lack of detection of alterations in BRCA1 or BRCA2 is the presence of mutations in undiscovered genes or in genes that interact with BRCA1 and/or BRCA2, which may be low-penetrance genes, like CHEK2.

[Identification of a HPGD mutation in three families affected with primary hypertrophic osteoarthropathy].

PubMed

Zhang, Wanying; Wang, Tao; Huang, Shuaiwu; Zhao, Xiuli

2018-04-10

To detect mutation of HPGD gene among three pedigrees affected with primary hypertrophic osteoarthropathy (PHO) by DNA sequencing and high-resolution melting (HRM) analysis. Genomic DNA was extracted from peripheral blood samples collected from the pedigrees. PCR and direct sequencing were carried out to identify potential mutations of the HPGD gene. Amplicons containing the mutation spot were generated by nested PCR. The products were then subjected to HRM analysis using the HR-1 instrument. Direct sequencing was carried out in family members and healthy individuals to confirm the result of HRM analysis. A homozygous mutation c.310_311delCT was detected in 2 affected probands, while a heterozygous mutation c.310_311delCT was detected in the third proband. HRM analysis of the fragments encompassing HPGD exon 3 showed 3 curve patterns representing three different genotypes, i.e., the wild type, the c.310_311delCT homozygote, and the c.310_311delCT heterozygote. Result of DNA sequencing was consistent with that of the HRM analysis and phenotype of the subjects. The c.310_311delCT mutation may be the most prevalent mutation among Chinese population. HRM analysis has provided an optimized method for genetic testing of HPGD mutation for its simplicity, rapid turnover and high sensitivity.

A novel variant of FGFR3 causes proportionate short stature.

PubMed

Kant, Sarina G; Cervenkova, Iveta; Balek, Lukas; Trantirek, Lukas; Santen, Gijs W E; de Vries, Martine C; van Duyvenvoorde, Hermine A; van der Wielen, Michiel J R; Verkerk, Annemieke J M H; Uitterlinden, André G; Hannema, Sabine E; Wit, Jan M; Oostdijk, Wilma; Krejci, Pavel; Losekoot, Monique

2015-06-01

Mutations of the fibroblast growth factor receptor 3 (FGFR3) cause various forms of short stature, of which the least severe phenotype is hypochondroplasia, mainly characterized by disproportionate short stature. Testing for an FGFR3 mutation is currently not part of routine diagnostic testing in children with short stature without disproportion. A three-generation family A with dominantly transmitted proportionate short stature was studied by whole-exome sequencing to identify the causal gene mutation. Functional studies and protein modeling studies were performed to confirm the pathogenicity of the mutation found in FGFR3. We performed Sanger sequencing in a second family B with dominant proportionate short stature and identified a rare variant in FGFR3. Exome sequencing and/or Sanger sequencing was performed, followed by functional studies using transfection of the mutant FGFR3 into cultured cells; homology modeling was used to construct a three-dimensional model of the two FGFR3 variants. A novel p.M528I mutation in FGFR3 was detected in family A, which segregates with short stature and proved to be activating in vitro. In family B, a rare variant (p.F384L) was found in FGFR3, which did not segregate with short stature and showed normal functionality in vitro compared with WT. Proportionate short stature can be caused by a mutation in FGFR3. Sequencing of this gene can be considered in patients with short stature, especially when there is an autosomal dominant pattern of inheritance. However, functional studies and segregation studies should be performed before concluding that a variant is pathogenic. © 2015 European Society of Endocrinology.

Whole-exome sequencing identified a homozygous FNBP4 mutation in a family with a condition similar to microphthalmia with limb anomalies.

PubMed

Kondo, Yukiko; Koshimizu, Eriko; Megarbane, Andre; Hamanoue, Haruka; Okada, Ippei; Nishiyama, Kiyomi; Kodera, Hirofumi; Miyatake, Satoko; Tsurusaki, Yoshinori; Nakashima, Mitsuko; Doi, Hiroshi; Miyake, Noriko; Saitsu, Hirotomo; Matsumoto, Naomichi

2013-07-01

Microphthalmia with limb anomalies (MLA), also known as Waardenburg anophthalmia syndrome or ophthalmoacromelic syndrome, is a rare autosomal recessive disorder. Recently, we and others successfully identified SMOC1 as the causative gene for MLA. However, there are several MLA families without SMOC1 abnormality, suggesting locus heterogeneity in MLA. We aimed to identify a pathogenic mutation in one Lebanese family having an MLA-like condition without SMOC1 mutation by whole-exome sequencing (WES) combined with homozygosity mapping. A c.683C>T (p.Thr228Met) in FNBP4 was found as a primary candidate, drawing the attention that FNBP4 and SMOC1 may potentially modulate BMP signaling. Copyright © 2013 Wiley Periodicals, Inc.

Toward Universal Forward Genetics: Using a Draft Genome Sequence of the Nematode Oscheius tipulae To Identify Mutations Affecting Vulva Development

PubMed Central

Besnard, Fabrice; Koutsovoulos, Georgios; Dieudonné, Sana; Blaxter, Mark; Félix, Marie-Anne

2017-01-01

Mapping-by-sequencing has become a standard method to map and identify phenotype-causing mutations in model species. Here, we show that a fragmented draft assembly is sufficient to perform mapping-by-sequencing in nonmodel species. We generated a draft assembly and annotation of the genome of the free-living nematode Oscheius tipulae, a distant relative of the model Caenorhabditis elegans. We used this draft to identify the likely causative mutations at the O. tipulae cov-3 locus, which affect vulval development. The cov-3 locus encodes the O. tipulae ortholog of C. elegans mig-13, and we further show that Cel-mig-13 mutants also have an unsuspected vulval-development phenotype. In a virtuous circle, we were able to use the linkage information collected during mutant mapping to improve the genome assembly. These results showcase the promise of genome-enabled forward genetics in nonmodel species. PMID:28630114

Toward Universal Forward Genetics: Using a Draft Genome Sequence of the Nematode Oscheius tipulae To Identify Mutations Affecting Vulva Development.

PubMed

Besnard, Fabrice; Koutsovoulos, Georgios; Dieudonné, Sana; Blaxter, Mark; Félix, Marie-Anne

2017-08-01

Mapping-by-sequencing has become a standard method to map and identify phenotype-causing mutations in model species. Here, we show that a fragmented draft assembly is sufficient to perform mapping-by-sequencing in nonmodel species. We generated a draft assembly and annotation of the genome of the free-living nematode Oscheius tipulae , a distant relative of the model Caenorhabditis elegans We used this draft to identify the likely causative mutations at the O. tipulae cov -3 locus, which affect vulval development. The cov-3 locus encodes the O. tipulae ortholog of C. elegans mig-13 , and we further show that Cel-mig-13 mutants also have an unsuspected vulval-development phenotype. In a virtuous circle, we were able to use the linkage information collected during mutant mapping to improve the genome assembly. These results showcase the promise of genome-enabled forward genetics in nonmodel species. Copyright © 2017 by the Genetics Society of America.

A novel nonsense mutation in CRYBB1 associated with autosomal dominant congenital cataract

PubMed Central

Yang, Juhua; Zhu, Yihua; Gu, Feng; He, Xiang; Cao, Zongfu; Li, Xuexi; Tong, Yi

2008-01-01

Purpose To identify the molecular defect underlying an autosomal dominant congenital nuclear cataract in a Chinese family. Methods Twenty-two members of a three-generation pedigree were recruited, clinical examinations were performed, and genomic DNA was extracted from peripheral blood leukocytes. All members were genotyped with polymorphic microsatellite markers adjacent to each of the known cataract-related genes. Linkage analysis was performed after genotyping. Candidate genes were screened for mutation using direct sequencing. Individuals were screened for presence of a mutation by restriction fragment length polymorphism (RFLP) analysis. Results Linkage analysis identified a maximum LOD score of 3.31 (recombination fraction [θ]=0.0) with marker D22S1167 on chromosome 22, which flanks the β-crystallin gene cluster (CRYBB3, CRYBB2, CRYBB1, and CRYBA4). Sequencing the coding regions and the flanking intronic sequences of these four candidate genes identified a novel, heterozygous C→T transition in exon 6 of CRYBB1 in the affected individuals of the family. This single nucleotide change introduced a novel BfaI site and was predicted to result in a nonsense mutation at codon 223 that changed a phylogenetically conserved amino acid to a stop codon (p.Q223X). RFLP analysis confirmed that this mutation co-segregated with the disease phenotype in all available family members and was not found in 100 normal unrelated individuals from the same ethnic background. Conclusions This study has identified a novel nonsense mutation in CRYBB1 (p.Q223X) associated with autosomal dominant congenital nuclear cataract. PMID:18432316

A novel pathogenic splice acceptor site germline mutation in intron 14 of the APC gene in a Chinese family with familial adenomatous polyposis.

PubMed

Wang, Dan; Liang, Shengyun; Zhang, Zhao; Zhao, Guoru; Hu, Yuan; Liang, Shengran; Zhang, Xipeng; Banerjee, Santasree

2017-03-28

Familial adenomatous polyposis (FAP) is an autosomal dominant precancerous condition, clinically characterized by the presence of multiple colorectal adenomas or polyps. Patients with FAP has a high risk of developing colorectal cancer (CRC) from these colorectal adenomatous polyps by the mean age of diagnosis at 40 years. Germline mutations of the APC gene cause familial adenomatous polyposis (FAP). Colectomy has recommended for the FAP patients with significant polyposis. Here, we present a clinical molecular study of a four generation Chinese family with FAP. Clinical diagnosis of FAP has been done according to the phenotype, family history and medical records. Patient's blood samples were collected and genomic DNA was extracted. In order to identify the pathogenic mutation underlying the disease phenotype targeted next-generation sequencing and confirmatory sanger sequencing has undertaken. Targeted next generation sequencing identified a novel heterozygous splice-acceptor site mutation [c.1744-1G>A] in intron 14 of APC gene, which is co-segregated with the FAP phenotypes in the proband and amongst all the affected family members. This mutation is not present in unaffected family members and in normal healthy controls of same ethnic origin. According to the LOVD database for Chinese colorectal cancer patients, in Chinese population, 60% of the previously reported APC gene mutations causes FAP, are missense mutations. This novel splice-acceptor site mutation causing FAP in this Chinese family expands the germline mutation spectrum of the APC gene in the Chinese population.

Identification of autism-related MECP2 mutations by whole-exome sequencing and functional validation.

PubMed

Wen, Zhu; Cheng, Tian-Lin; Li, Gai-Zhi; Sun, Shi-Bang; Yu, Shun-Ying; Zhang, Yi; Du, Ya-Song; Qiu, Zilong

2017-01-01

Methyl-CpG-binding protein-2 (MeCP2) is a critical regulator for neural development. Either loss- or gain-of-function leads to severe neurodevelopmental disorders, such as Rett syndrome (RTT) and autism spectrum disorder (ASD). We set out to screen for MECP2 mutations in patients of ASD and determine whether these autism-related mutations may compromise the proper function of MeCP2. Whole-exome sequencing was performed to screen MECP2 and other ASD candidate genes for 120 patients diagnosed with ASD. The parents of patients who were identified with MECP2 mutation were selected for further Sanger sequencing. Each patient accomplished the case report form including general information and clinical scales applied to assess their clinical features. Mouse cortical neurons and HEK-293 cells were cultured and transfected with MeCP2 wild-type (WT) or mutant to examine the function of autism-associated MeCP2 mutants. HEK-293 cells were used to examine the expression of MeCP2 mutant constructs with Western blot. Mouse cortical neurons were used to analyze neurites and axon outgrowth by immunofluorescence experiments. We identified three missense mutations of MECP2 from three autism patients by whole-exome sequencing: p.P152L (c.455C>T), p.P376S (c.1162C>T), and p.R294X (c.880C>T). Among these mutations, p.P152L and p.R294X were de novo mutations, whereas p.P376S was inherited maternally. The diagnosis of RTT was excluded in all three autism patients. Abnormalities of dendritic and axonal growth were found after autism-related MeCP2 mutants were expressed in mouse cortical neurons; suggesting that autism-related MECP2 mutations impair the proper development of neurons. Our study identified genetic mutations of the MECP2 gene in autism patients, which were previously considered to be associated primarily with RTT. This finding suggests that loss-of-function mutations of MECP2 may also lead to autism spectrum disorders.

SEPT9 Mutations and a Conserved 17q25 Sequence in Sporadic and Hereditary Brachial Plexus Neuropathy

PubMed Central

Klein, Christopher J.; Wu, Yanhong; Cunningham, Julie M.; Windebank, Anthony J.; Dyck, P. James B.; Friedenberg, Scott M.; Klein, Diane M.; Dyck, Peter J.

2009-01-01

Background The clinical characteristics of sporadic brachial plexus neuropathy (S-BPN) and hereditary brachial plexus neuropathy (H-BPN) are similar. At times of attack inflammation in brachial plexus nerves has been identified in both conditions. SEPT-9 mutations (Arg88Trp, Ser93Phe, 5UTR-131G to C) occur in some families with H-BPN. These mutations were not found in American H-BPN kindreds with a conserved 500 Kb sequence of DNA at 17q25 (the location of SEPT-9) where a founder mutation has been suggested. Objective To study 17q25 and SEPT-9 in S-BPN (56 patients) and H-BPN (13 kindreds). Methods Allele analysis at 17q25, SEPT-9 DNA sequencing and mRNA analysis from lymphoblast cultures. Results A conserved 17q25 sequence was found in 5 of 13 H-BPN kindreds and one S-BPN patient. This conserved sequence was not found in the family with a SEPT-9 mutation (Arg88Trp) or controls (182). SEPT-9 mRNA expression did not differ between forms of H-BPN and controls. No known mutations of SEPT-9 were found in S-BPN. Conclusions/Relevance Rare S-BPN patients have the same conserved 17q25 sequence found in many American H-BPN kindreds. BPN patients with this conserved sequence do not appear to have SEPT-9 mutations or alterations of its mRNA expression levels in lymphoblast cultures. BPN patients with this conserved sequence may have the most common genetic cause in the Americas by a founder effect mutation. PMID:19204161

Identifying actionable variants using next generation sequencing in patients with a historical diagnosis of undifferentiated pleomorphic sarcoma.

PubMed

Lewin, Jeremy; Garg, Swati; Lau, Beatrice Y; Dickson, Brendan C; Traub, Frank; Gokgoz, Nalan; Griffin, Anthony M; Ferguson, Peter C; Andrulis, Irene L; Sim, Hao-Wen; Kamel-Reid, Suzanne; Stockley, Tracy L; Siu, Lillian L; Wunder, Jay S; Razak, Albiruni R A

2018-01-01

There are limited data regarding the molecular characterization of undifferentiated pleomorphic sarcomas (UPS; formerly malignant fibrous histiocytoma). This study aimed to investigate the utility of next generation sequencing (NGS) in UPS to identify subsets of patients who harbour actionable mutations. Patients diagnosed with UPS underwent pathological re-evaluation by a pathologist specializing in sarcoma. Tumor DNA was isolated from archived fresh frozen tissue samples and genotyped using NGS with the Illumina MiSeq TruSeq Amplicon Cancer Panel (48 genes, 212 amplicons). In total, 95 patients initially classified with UPS were identified. Following pathology re-review the histological subtypes were reclassified to include: Myxofibrosarcoma (MFS, N = 44); UPS(N = 18); and Others (N = 27; including undifferentiated spindle cell sarcoma (N = 15) and dedifferentiated liposarcoma (N = 6)). Seven cases were excluded from further analysis for other reasons. Baseline demographics of the finalized cohort (N = 88) showed a median age of 66 years (32-95), primarily with stage I-III disease (92%) and high-grade (86%) lesions. Somatic mutations were identified in 31 cases (35%)(Total mutations = 36: solitary mutation(n = 27); two mutations( =n = 3); three mutations(n = 1)). The most commonly identified mutations were in TP53 (n = 24), ATM (n = 3) and PIK3CA (n = 2). Three of 43 patients with MFS and one of 18 patients with UPS had clinically relevant mutations, mainly related to biomarkers of prediction of response; however few had targetable driver mutations. Somatic mutation status did not influence disease free or overall survival. Based on the small number of clinically relevant mutations, these data do not support the routine use of targeted NGS panels outside of research protocols in UPS. © 2017 UICC.

Targeted next generation sequencing identifies functionally deleterious germline mutations in novel genes in early-onset/familial prostate cancer.

PubMed

Paulo, Paula; Maia, Sofia; Pinto, Carla; Pinto, Pedro; Monteiro, Augusta; Peixoto, Ana; Teixeira, Manuel R

2018-04-01

Considering that mutations in known prostate cancer (PrCa) predisposition genes, including those responsible for hereditary breast/ovarian cancer and Lynch syndromes, explain less than 5% of early-onset/familial PrCa, we have sequenced 94 genes associated with cancer predisposition using next generation sequencing (NGS) in a series of 121 PrCa patients. We found monoallelic truncating/functionally deleterious mutations in seven genes, including ATM and CHEK2, which have previously been associated with PrCa predisposition, and five new candidate PrCa associated genes involved in cancer predisposing recessive disorders, namely RAD51C, FANCD2, FANCI, CEP57 and RECQL4. Furthermore, using in silico pathogenicity prediction of missense variants among 18 genes associated with breast/ovarian cancer and/or Lynch syndrome, followed by KASP genotyping in 710 healthy controls, we identified "likely pathogenic" missense variants in ATM, BRIP1, CHEK2 and TP53. In conclusion, this study has identified putative PrCa predisposing germline mutations in 14.9% of early-onset/familial PrCa patients. Further data will be necessary to confirm the genetic heterogeneity of inherited PrCa predisposition hinted in this study.

Characterisation of mutations of the phosphoinositide-3-kinase regulatory subunit, PIK3R2, in perisylvian polymicrogyria: a next-generation sequencing study.

PubMed

Mirzaa, Ghayda M; Conti, Valerio; Timms, Andrew E; Smyser, Christopher D; Ahmed, Sarah; Carter, Melissa; Barnett, Sarah; Hufnagel, Robert B; Goldstein, Amy; Narumi-Kishimoto, Yoko; Olds, Carissa; Collins, Sarah; Johnston, Kathreen; Deleuze, Jean-François; Nitschké, Patrick; Friend, Kathryn; Harris, Catharine; Goetsch, Allison; Martin, Beth; Boyle, Evan August; Parrini, Elena; Mei, Davide; Tattini, Lorenzo; Slavotinek, Anne; Blair, Ed; Barnett, Christopher; Shendure, Jay; Chelly, Jamel; Dobyns, William B; Guerrini, Renzo

2015-12-01

Bilateral perisylvian polymicrogyria (BPP), the most common form of regional polymicrogyria, causes the congenital bilateral perisylvian syndrome, featuring oromotor dysfunction, cognitive impairment, and epilepsy. The causes of BPP are heterogeneous, but only a few genetic causes have been reported. The aim of this study was to identify additional genetic causes of BPP and characterise their frequency in this population. Children (aged ≤18 years) with polymicrogyria were enrolled into our research programme from July, 1980, to October, 2015, at two centres (Florence, Italy, and Seattle, WA, USA). We obtained samples (blood and saliva) throughout this period at both centres and did whole-exome sequencing on DNA from eight trios (two parents and one affected child) with BPP in 2014. After the identification of mosaic PIK3R2 mutations in two of these eight children, we performed targeted screening of PIK3R2 by two methods in a cohort of 118 children with BPP. First, we performed targeted sequencing of the entire PIK3R2 gene by single molecule molecular inversion probes (smMIPs) on 38 patients with BPP with normal to large head size. Second, we did amplicon sequencing of the recurrent PIK3R2 mutation (Gly373Arg) in 80 children with various types of polymicrogyria including BPP. One additional patient had clinical whole-exome sequencing done independently, and was included in this study because of the phenotypic similarity to our cohort. We identified a mosaic mutation (Gly373Arg) in a regulatory subunit of the PI3K-AKT-mTOR pathway, PIK3R2, in two children with BPP. Of the 38 patients with BPP and normal to large head size who underwent targeted next-generation sequencing by smMIPs, we identified constitutional and mosaic PIK3R2 mutations in 17 additional children. In parallel, one patient had the recurrent PIK3R2 mutation identified by clinical whole-exome sequencing. Seven of these 20 patients had BPP alone, and 13 had BPP in association with features of the megalencephaly-polymicrogyria-polydactyly-hydrocephalus (MPPH) syndrome. 19 patients had the same mutation (Gly373Arg), and one had a nearby missense mutation (Lys376Glu). Mutations were constitutional in 12 patients and mosaic in eight patients. In patients with mosaic mutations, we noted substantial variation in alternate (mutant) allele levels, ranging from ten (3%) of 377 reads to 39 (37%) of 106 reads, equivalent to 5-73% of cells analysed. Levels of mosaicism varied from undetectable to 37 (17%) of 216 reads in blood-derived DNA compared with 2030 (29%) of 6889 reads to 275 (43%) of 634 reads in saliva-derived DNA. Constitutional and mosaic mutations in the PIK3R2 gene are associated with developmental brain disorders ranging from BPP with a normal head size to the MPPH syndrome. The phenotypic variability and low-level mosaicism, which challenge conventional molecular methods, have important implications for genetic testing and counselling. US National Institutes of Health. Copyright © 2015 Elsevier Ltd. All rights reserved.

A Dominant Mutation in Hexokinase 1 (HK1) Causes Retinitis Pigmentosa

PubMed Central

Sullivan, Lori S.; Koboldt, Daniel C.; Bowne, Sara J.; Lang, Steven; Blanton, Susan H.; Cadena, Elizabeth; Avery, Cheryl E.; Lewis, Richard A.; Webb-Jones, Kaylie; Wheaton, Dianna H.; Birch, David G.; Coussa, Razck; Ren, Huanan; Lopez, Irma; Chakarova, Christina; Koenekoop, Robert K.; Garcia, Charles A.; Fulton, Robert S.; Wilson, Richard K.; Weinstock, George M.; Daiger, Stephen P.

2014-01-01

Purpose. To identify the cause of retinitis pigmentosa (RP) in UTAD003, a large, six-generation Louisiana family with autosomal dominant retinitis pigmentosa (adRP). Methods. A series of strategies, including candidate gene screening, linkage exclusion, genome-wide linkage mapping, and whole-exome next-generation sequencing, was used to identify a mutation in a novel disease gene on chromosome 10q22.1. Probands from an additional 404 retinal degeneration families were subsequently screened for mutations in this gene. Results. Exome sequencing in UTAD003 led to identification of a single, novel coding variant (c.2539G>A, p.Glu847Lys) in hexokinase 1 (HK1) present in all affected individuals and absent from normal controls. One affected family member carries two copies of the mutation and has an unusually severe form of disease, consistent with homozygosity for this mutation. Screening of additional adRP probands identified four other families (American, Canadian, and Sicilian) with the same mutation and a similar range of phenotypes. The families share a rare 450-kilobase haplotype containing the mutation, suggesting a founder mutation among otherwise unrelated families. Conclusions. We identified an HK1 mutation in five adRP families. Hexokinase 1 catalyzes phosphorylation of glucose to glucose-6-phosphate. HK1 is expressed in retina, with two abundant isoforms expressed at similar levels. The Glu847Lys mutation is located at a highly conserved position in the protein, outside the catalytic domains. We hypothesize that the effect of this mutation is limited to the retina, as no systemic abnormalities in glycolysis were detected. Prevalence of the HK1 mutation in our cohort of RP families is 1%. PMID:25190649

Highly sensitive detection of mutations in CHO cell recombinant DNA using multi-parallel single molecule real-time DNA sequencing.

PubMed

Cartwright, Joseph F; Anderson, Karin; Longworth, Joseph; Lobb, Philip; James, David C

2018-06-01

High-fidelity replication of biologic-encoding recombinant DNA sequences by engineered mammalian cell cultures is an essential pre-requisite for the development of stable cell lines for the production of biotherapeutics. However, immortalized mammalian cells characteristically exhibit an increased point mutation frequency compared to mammalian cells in vivo, both across their genomes and at specific loci (hotspots). Thus unforeseen mutations in recombinant DNA sequences can arise and be maintained within producer cell populations. These may affect both the stability of recombinant gene expression and give rise to protein sequence variants with variable bioactivity and immunogenicity. Rigorous quantitative assessment of recombinant DNA integrity should therefore form part of the cell line development process and be an essential quality assurance metric for instances where synthetic/multi-component assemblies are utilized to engineer mammalian cells, such as the assessment of recombinant DNA fidelity or the mutability of single-site integration target loci. Based on Pacific Biosciences (Menlo Park, CA) single molecule real-time (SMRT™) circular consensus sequencing (CCS) technology we developed a rDNA sequence analysis tool to process the multi-parallel sequencing of ∼40,000 single recombinant DNA molecules. After statistical filtering of raw sequencing data, we show that this analytical method is capable of detecting single point mutations in rDNA to a minimum single mutation frequency of 0.0042% (<1/24,000 bases). Using a stable CHO transfectant pool harboring a randomly integrated 5 kB plasmid construct encoding GFP we found that 28% of recombinant plasmid copies contained at least one low frequency (<0.3%) point mutation. These mutations were predominantly found in GC base pairs (85%) and that there was no positional bias in mutation across the plasmid sequence. There was no discernable difference between the mutation frequencies of coding and non-coding DNA. The putative ratio of non-synonymous and synonymous changes within the open reading frames (ORFs) in the plasmid sequence indicates that natural selection does not impact upon the prevalence of these mutations. Here we have demonstrated the abundance of mutations that fall outside of the reported range of detection of next generation sequencing (NGS) and second generation sequencing (SGS) platforms, providing a methodology capable of being utilized in cell line development platforms to identify the fidelity of recombinant genes throughout the production process. © 2018 Wiley Periodicals, Inc.

Acquired mutations associated with ibrutinib resistance in Waldenström macroglobulinemia.

PubMed

Xu, Lian; Tsakmaklis, Nicholas; Yang, Guang; Chen, Jiaji G; Liu, Xia; Demos, Maria; Kofides, Amanda; Patterson, Christopher J; Meid, Kirsten; Gustine, Joshua; Dubeau, Toni; Palomba, M Lia; Advani, Ranjana; Castillo, Jorge J; Furman, Richard R; Hunter, Zachary R; Treon, Steven P

2017-05-04

Ibrutinib produces high response rates and durable remissions in Waldenström macroglobulinemia (WM) that are impacted by MYD88 and CXCR4 WHIM mutations. Disease progression can develop on ibrutinib, although the molecular basis remains to be clarified. We sequenced sorted CD19 + lymphoplasmacytic cells from 6 WM patients who progressed after achieving major responses on ibrutinib using Sanger, TA cloning and sequencing, and highly sensitive and allele-specific polymerase chain reaction (AS-PCR) assays that we developed for Bruton tyrosine kinase ( BTK ) mutations. AS-PCR assays were used to screen patients with and without progressive disease on ibrutinib, and ibrutinib-naïve disease. Targeted next-generation sequencing was used to validate AS-PCR findings, assess for other BTK mutations, and other targets in B-cell receptor and MYD88 signaling. Among the 6 progressing patients, 3 had BTK Cys481 variants that included BTK Cys481Ser(c.1635G>C and c.1634T>A) and BTK Cys481Arg(c.1634T>C) Two of these patients had multiple BTK mutations. Screening of 38 additional patients on ibrutinib without clinical progression identified BTK Cys481 mutations in 2 (5.1%) individuals, both of whom subsequently progressed. BTK Cys481 mutations were not detected in baseline samples or in 100 ibrutinib-naive WM patients. Using mutated MYD88 as a tumor marker, BTK Cys481 mutations were subclonal, with a highly variable clonal distribution. Targeted deep-sequencing confirmed AS-PCR findings, and identified an additional BTK Cys481Tyr(c.1634G>A) mutation in the 2 patients with multiple other BTK Cys481 mutations, as well as CARD11 Leu878Phe(c.2632C>T) and PLCγ2 Tyr495His(c.1483T>C) mutations. Four of the 5 patients with BTK C481 variants were CXCR4 mutated. BTK Cys481 mutations are common in WM patients with clinical progression on ibrutinib, and are associated with mutated CXCR4 . © 2017 by The American Society of Hematology.

Observation of c.260A > G mutation in superoxide dismutase 1 that causes p.Asn86Ser in Iranian amyotrophic lateral sclerosis patient and absence of genotype/phenotype correlation.

PubMed

Khani, Marzieh; Alavi, Afagh; Nafissi, Shahriar; Elahi, Elahe

2015-07-06

Amyotrophic lateral sclerosis (ALS) is the most common motor neuron disorder in European populations. ALS can be sporadic ALS (SALS) or familial ALS (FALS). Among 20 known ALS genes, mutations in C9orf72 and superoxide dismutase 1 (SOD1) are the most common genetic causes of the disease. Whereas C9orf72 mutations are more common in Western populations, the contribution of SOD1 to ALS in Iran is more than C9orf72. At present, a clear genotype/phenotype correlation for ALS has not been identified. We aimed to perform mutation screening of SOD1 in a newly identified Iranian FALS patient and to assess whether a genotype/phenotype correlation for the identified mutation exists. The five exons of SOD1 and flanking intronic sequences of a FALS proband were screened for mutations by direct sequencing. The clinical features of the proband were assessed by a neuromuscular specialist (SN). The phenotypic presentations were compared to previously reported patients with the same mutation. Heterozygous c.260A > G mutation in SOD1 that causes Asn86Ser was identified in the proband. Age at onset was 34 years and site of the first presentation was in the lower extremities. Comparisons of clinical features of different ALS patients with the same mutation evidenced variable presentations. The c.260A > G mutation in SOD1 that causes Asn86Ser appears to cause ALS with variable clinical presentations.

Discovery and prioritization of somatic mutations in diffuse large B-cell lymphoma (DLBCL) by whole-exome sequencing

PubMed Central

Lohr, Jens G.; Stojanov, Petar; Lawrence, Michael S.; Auclair, Daniel; Chapuy, Bjoern; Sougnez, Carrie; Cruz-Gordillo, Peter; Knoechel, Birgit; Asmann, Yan W.; Slager, Susan L.; Novak, Anne J.; Dogan, Ahmet; Ansell, Stephen M.; Zou, Lihua; Gould, Joshua; Saksena, Gordon; Stransky, Nicolas; Rangel-Escareño, Claudia; Fernandez-Lopez, Juan Carlos; Hidalgo-Miranda, Alfredo; Melendez-Zajgla, Jorge; Hernández-Lemus, Enrique; Schwarz-Cruz y Celis, Angela; Imaz-Rosshandler, Ivan; Ojesina, Akinyemi I.; Jung, Joonil; Pedamallu, Chandra S.; Lander, Eric S.; Habermann, Thomas M.; Cerhan, James R.; Shipp, Margaret A.; Getz, Gad; Golub, Todd R.

2012-01-01

To gain insight into the genomic basis of diffuse large B-cell lymphoma (DLBCL), we performed massively parallel whole-exome sequencing of 55 primary tumor samples from patients with DLBCL and matched normal tissue. We identified recurrent mutations in genes that are well known to be functionally relevant in DLBCL, including MYD88, CARD11, EZH2, and CREBBP. We also identified somatic mutations in genes for which a functional role in DLBCL has not been previously suspected. These genes include MEF2B, MLL2, BTG1, GNA13, ACTB, P2RY8, PCLO, and TNFRSF14. Further, we show that BCL2 mutations commonly occur in patients with BCL2/IgH rearrangements as a result of somatic hypermutation normally occurring at the IgH locus. The BCL2 point mutations are primarily synonymous, and likely caused by activation-induced cytidine deaminase–mediated somatic hypermutation, as shown by comprehensive analysis of enrichment of mutations in WRCY target motifs. Those nonsynonymous mutations that are observed tend to be found outside of the functionally important BH domains of the protein, suggesting that strong negative selection against BCL2 loss-of-function mutations is at play. Last, by using an algorithm designed to identify likely functionally relevant but infrequent mutations, we identify KRAS, BRAF, and NOTCH1 as likely drivers of DLBCL pathogenesis in some patients. Our data provide an unbiased view of the landscape of mutations in DLBCL, and this in turn may point toward new therapeutic strategies for the disease. PMID:22343534

Somatic mutations in histiocytic sarcoma identified by next generation sequencing.

PubMed

Liu, Qingqing; Tomaszewicz, Keith; Hutchinson, Lloyd; Hornick, Jason L; Woda, Bruce; Yu, Hongbo

2016-08-01

Histiocytic sarcoma is a rare malignant neoplasm of presumed hematopoietic origin showing morphologic and immunophenotypic evidence of histiocytic differentiation. Somatic mutation importance in the pathogenesis or disease progression of histiocytic sarcoma was largely unknown. To identify somatic mutations in histiocytic sarcoma, we studied 5 histiocytic sarcomas [3 female and 2 male patients; mean age 54.8 (20-72), anatomic sites include lymph node, uterus, and pleura] and matched normal tissues from each patient as germ line controls. Somatic mutations in 50 "Hotspot" oncogenes and tumor suppressor genes were examined using next generation sequencing. Three (out of five) histiocytic sarcoma cases carried somatic mutations in BRAF. Among them, G464V [variant frequency (VF) of 43.6 %] and G466R (VF of 29.6 %) located at the P loop potentially interfere with the hydrophobic interaction between P and activating loops and ultimately activation of BRAF. Also detected was BRAF somatic mutation N581S (VF of 7.4 %), which was located at the catalytic loop of BRAF kinase domain: its role in modifying kinase activity was unclear. A similar mutational analysis was also performed on nine acute monocytic/monoblastic leukemia cases, which did not identify any BRAF somatic mutations. Our study detected several BRAF mutations in histiocytic sarcomas, which may be important in understanding the tumorigenesis of this rare neoplasm and providing mechanisms for potential therapeutical opportunities.

Multi-layered mutation in hedgehog-related genes in Gorlin syndrome may affect the phenotype.

PubMed

Onodera, Shoko; Saito, Akiko; Hasegawa, Daigo; Morita, Nana; Watanabe, Katsuhito; Nomura, Takeshi; Shibahara, Takahiko; Ohba, Shinsuke; Yamaguchi, Akira; Azuma, Toshifumi

2017-01-01

Gorlin syndrome is a genetic disorder of autosomal dominant inheritance that predisposes the affected individual to a variety of disorders that are attributed largely to heterozygous germline patched1 (PTCH1) mutations. PTCH1 is a hedgehog (Hh) receptor as well as a repressor, mutation of which leads to constitutive activation of Hh pathway. Hh pathway encompasses a wide variety of cellular signaling cascades, which involve several molecules; however, no associated genotype-phenotype correlations have been reported. Recently, mutations in Suppressor of fused homolog (SUFU) or PTCH2 were reported in patients with Gorlin syndrome. These facts suggest that multi-layered mutations in Hh pathway may contribute to the development of Gorlin syndrome. We demonstrated multiple mutations of Hh-related genes in addition to PTCH1, which possibly act in an additive or multiplicative manner and lead to Gorlin syndrome. High-throughput sequencing was performed to analyze exome sequences in four unrelated Gorlin syndrome patient genomes. Mutations in PTCH1 gene were detected in all four patients. Specific nucleotide variations or frameshift variations of PTCH1 were identified along with the inferred amino acid changes in all patients. We further filtered 84 different genes which are closely related to Hh signaling. Fifty three of these had enough coverage of over ×30. The sequencing results were filtered and compared to reduce the number of sequence variants identified in each of the affected individuals. We discovered three genes, PTCH2, BOC, and WNT9b, with mutations with a predicted functional impact assessed by MutationTaster2 or PolyPhen-2 (Polymorphism Phenotyping v2) analysis. It is noticeable that PTCH2 and BOC are Hh receptor molecules. No significant mutations were observed in SUFU. Multi-layered mutations in Hh pathway may change the activation level of the Hh signals, which may explain the wide phenotypic variability of Gorlin syndrome.

Functional Analysis of Somatic Mutations in Lung Cancer

DTIC Science & Technology

2015-10-01

antibody cetuximab [11]. Finally, we have developed novel single cell sequencing approaches to uncover EGFR mutational variants in glioblastoma and their...assessed which mutations are epistatic to EGFR or capable of initiating xenograft tumor formation in vivo. Using eVIP, we identified 69% of mutations...analyzed as impactful whereas 31% appear functionally neutral. A subset of the impactful mutations induce xenograft tumor formation in mice and/or

Rapid identification of kidney cyst mutations by whole exome sequencing in zebrafish

PubMed Central

Ryan, Sean; Willer, Jason; Marjoram, Lindsay; Bagwell, Jennifer; Mankiewicz, Jamie; Leshchiner, Ignaty; Goessling, Wolfram; Bagnat, Michel; Katsanis, Nicholas

2013-01-01

Forward genetic approaches in zebrafish have provided invaluable information about developmental processes. However, the relative difficulty of mapping and isolating mutations has limited the number of new genetic screens. Recent improvements in the annotation of the zebrafish genome coupled to a reduction in sequencing costs prompted the development of whole genome and RNA sequencing approaches for gene discovery. Here we describe a whole exome sequencing (WES) approach that allows rapid and cost-effective identification of mutations. We used our WES methodology to isolate four mutations that cause kidney cysts; we identified novel alleles in two ciliary genes as well as two novel mutants. The WES approach described here does not require specialized infrastructure or training and is therefore widely accessible. This methodology should thus help facilitate genetic screens and expedite the identification of mutants that can inform basic biological processes and the causality of genetic disorders in humans. PMID:24130329

Identification of somatic mutations in non-small cell lung carcinomas using whole-exome sequencing

PubMed Central

Liu, Pengyuan; Morrison, Carl; Wang, Liang; Xiong, Donghai; Vedell, Peter; Cui, Peng; Hua, Xing; Ding, Feng; Lu, Yan; James, Michael; Ebben, John D.; Xu, Haiming; Adjei, Alex A.; Head, Karen; Andrae, Jaime W.; Tschannen, Michael R.; Jacob, Howard; Pan, Jing; Zhang, Qi; Van den Bergh, Francoise; Xiao, Haijie; Lo, Ken C.; Patel, Jigar; Richmond, Todd; Watt, Mary-Anne; Albert, Thomas; Selzer, Rebecca; Anderson, Marshall; Wang, Jiang; Wang, Yian; Starnes, Sandra; Yang, Ping; You, Ming

2012-01-01

Lung cancer is the leading cause of cancer-related death, with non-small cell lung cancer (NSCLC) being the predominant form of the disease. Most lung cancer is caused by the accumulation of genomic alterations due to tobacco exposure. To uncover its mutational landscape, we performed whole-exome sequencing in 31 NSCLCs and their matched normal tissue samples. We identified both common and unique mutation spectra and pathway activation in lung adenocarcinomas and squamous cell carcinomas, two major histologies in NSCLC. In addition to identifying previously known lung cancer genes (TP53, KRAS, EGFR, CDKN2A and RB1), the analysis revealed many genes not previously implicated in this malignancy. Notably, a novel gene CSMD3 was identified as the second most frequently mutated gene (next to TP53) in lung cancer. We further demonstrated that loss of CSMD3 results in increased proliferation of airway epithelial cells. The study provides unprecedented insights into mutational processes, cellular pathways and gene networks associated with lung cancer. Of potential immediate clinical relevance, several highly mutated genes identified in our study are promising druggable targets in cancer therapy including ALK, CTNNA3, DCC, MLL3, PCDHIIX, PIK3C2B, PIK3CG and ROCK2. PMID:22510280

Selective 2'-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis.

PubMed

Smola, Matthew J; Rice, Greggory M; Busan, Steven; Siegfried, Nathan A; Weeks, Kevin M

2015-11-01

Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistries exploit small electrophilic reagents that react with 2'-hydroxyl groups to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues by using reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as can be done for simple model RNAs. This protocol describes the experimental steps, implemented over 3 d, that are required to perform SHAPE probing and to construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots and provides useful troubleshooting information. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures and visualize probable and alternative helices, often in under 1 d. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles and entire transcriptomes.

Non-exomic and synonymous variants in ABCA4 are an important cause of Stargardt disease

PubMed Central

Braun, Terry A.; Mullins, Robert F.; Wagner, Alex H.; Andorf, Jeaneen L.; Johnston, Rebecca M.; Bakall, Benjamin B.; Deluca, Adam P.; Fishman, Gerald A.; Lam, Byron L.; Weleber, Richard G.; Cideciyan, Artur V.; Jacobson, Samuel G.; Sheffield, Val C.; Tucker, Budd A.; Stone, Edwin M.

2013-01-01

Mutations in ABCA4 cause Stargardt disease and other blinding autosomal recessive retinal disorders. However, sequencing of the complete coding sequence in patients with clinical features of Stargardt disease sometimes fails to detect one or both mutations. For example, among 208 individuals with clear clinical evidence of ABCA4 disease ascertained at a single institution, 28 had only one disease-causing allele identified in the exons and splice junctions of the primary retinal transcript of the gene. Haplotype analysis of these 28 probands revealed 3 haplotypes shared among ten families, suggesting that 18 of the 28 missing alleles were rare enough to be present only once in the cohort. We hypothesized that mutations near rare alternate splice junctions in ABCA4 might cause disease by increasing the probability of mis-splicing at these sites. Next-generation sequencing of RNA extracted from human donor eyes revealed more than a dozen alternate exons that are occasionally incorporated into the ABCA4 transcript in normal human retina. We sequenced the genomic DNA containing 15 of these minor exons in the 28 one-allele subjects and observed five instances of two different variations in the splice signals of exon 36.1 that were not present in normal individuals (P < 10−6). Analysis of RNA obtained from the keratinocytes of patients with these mutations revealed the predicted alternate transcript. This study illustrates the utility of RNA sequence analysis of human donor tissue and patient-derived cell lines to identify mutations that would be undetectable by exome sequencing. PMID:23918662

Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

PubMed Central

Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

2014-01-01

Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

Mutations in the DNA methyltransferase gene DNMT3A cause an overgrowth syndrome with intellectual disability.

PubMed

Tatton-Brown, Katrina; Seal, Sheila; Ruark, Elise; Harmer, Jenny; Ramsay, Emma; Del Vecchio Duarte, Silvana; Zachariou, Anna; Hanks, Sandra; O'Brien, Eleanor; Aksglaede, Lise; Baralle, Diana; Dabir, Tabib; Gener, Blanca; Goudie, David; Homfray, Tessa; Kumar, Ajith; Pilz, Daniela T; Selicorni, Angelo; Temple, I Karen; Van Maldergem, Lionel; Yachelevich, Naomi; van Montfort, Robert; Rahman, Nazneen

2014-04-01

Overgrowth disorders are a heterogeneous group of conditions characterized by increased growth parameters and other variable clinical features such as intellectual disability and facial dysmorphism. To identify new causes of human overgrowth, we performed exome sequencing in ten proband-parent trios and detected two de novo DNMT3A mutations. We identified 11 additional de novo mutations by sequencing DNMT3A in a further 142 individuals with overgrowth. The mutations alter residues in functional DNMT3A domains, and protein modeling suggests that they interfere with domain-domain interactions and histone binding. Similar mutations were not present in 1,000 UK population controls (13/152 cases versus 0/1,000 controls; P < 0.0001). Mutation carriers had a distinctive facial appearance, intellectual disability and greater height. DNMT3A encodes a DNA methyltransferase essential for establishing methylation during embryogenesis and is commonly somatically mutated in acute myeloid leukemia. Thus, DNMT3A joins an emerging group of epigenetic DNA- and histone-modifying genes associated with both developmental growth disorders and hematological malignancies.

Mutations in the DNA methyltransferase gene, DNMT3A, cause an overgrowth syndrome with intellectual disability

PubMed Central

Tatton-Brown, Katrina; Seal, Sheila; Ruark, Elise; Harmer, Jenny; Ramsay, Emma; del Vecchio Duarte, Silvana; Zachariou, Anna; Hanks, Sandra; O’Brien, Eleanor; Aksglaede, Lise; Baralle, Diana; Dabir, Tabib; Gener, Blanca; Goudie, David; Homfray, Tessa; Kumar, Ajith; Pilz, Daniela T; Selicorni, Angelo; Temple, I Karen; Van Maldergem, Lionel; Yachelevich, Naomi; van Montfort, Robert; Rahman, Nazneen

2014-01-01

Overgrowth disorders are a heterogeneous group of conditions characterised by increased growth parameters and variable other clinical features, such as intellectual disability and facial dysmorphism1. To identify novel causes of human overgrowth we performed exome sequencing in 10 proband-parent trios and detected two de novo DNMT3A mutations. We identified 11 additional de novo mutations through DNMT3A sequencing of a further 142 individuals with overgrowth. The mutations were all located in functional DNMT3A domains and protein modelling suggests they interfere with domain-domain interactions and histone binding. No similar mutations were present in 1000 UK population controls (13/152 vs 0/1000; P<0.0001). Mutation carriers had a distinctive facial appearance, intellectual disability and increased height. DNMT3A encodes a key methyltransferase essential for establishing the methylation imprint in embryogenesis and is commonly somatically mutated in acute myeloid leukaemia2-4. Thus DNMT3A joins an emerging group of epigenetic DNA and histone modifying genes associated with both developmental growth disorders and haematological malignancies5. PMID:24614070

TGFB2 mutations cause familial thoracic aortic aneurysms and dissections associated with mild systemic features of Marfan syndrome.

PubMed

Boileau, Catherine; Guo, Dong-Chuan; Hanna, Nadine; Regalado, Ellen S; Detaint, Delphine; Gong, Limin; Varret, Mathilde; Prakash, Siddharth K; Li, Alexander H; d'Indy, Hyacintha; Braverman, Alan C; Grandchamp, Bernard; Kwartler, Callie S; Gouya, Laurent; Santos-Cortez, Regie Lyn P; Abifadel, Marianne; Leal, Suzanne M; Muti, Christine; Shendure, Jay; Gross, Marie-Sylvie; Rieder, Mark J; Vahanian, Alec; Nickerson, Deborah A; Michel, Jean Baptiste; Jondeau, Guillaume; Milewicz, Dianna M

2012-07-08

A predisposition for thoracic aortic aneurysms leading to acute aortic dissections can be inherited in families in an autosomal dominant manner. Genome-wide linkage analysis of two large unrelated families with thoracic aortic disease followed by whole-exome sequencing of affected relatives identified causative mutations in TGFB2. These mutations-a frameshift mutation in exon 6 and a nonsense mutation in exon 4-segregated with disease with a combined logarithm of odds (LOD) score of 7.7. Sanger sequencing of 276 probands from families with inherited thoracic aortic disease identified 2 additional TGFB2 mutations. TGFB2 encodes transforming growth factor (TGF)-β2, and the mutations are predicted to cause haploinsufficiency for TGFB2; however, aortic tissue from cases paradoxically shows increased TGF-β2 expression and immunostaining. Thus, haploinsufficiency for TGFB2 predisposes to thoracic aortic disease, suggesting that the initial pathway driving disease is decreased cellular TGF-β2 levels leading to a secondary increase in TGF-β2 production in the diseased aorta.

Amplicon Resequencing Identified Parental Mosaicism for Approximately 10% of “de novo” SCN1A Mutations in Children with Dravet Syndrome

PubMed Central

Xu, Xiaojing; Yang, Xiaoxu; Wu, Qixi; Liu, Aijie; Yang, Xiaoling; Ye, Adam Yongxin; Huang, August Yue; Li, Jiarui; Wang, Meng; Yu, Zhe; Wang, Sheng; Zhang, Zhichao; Wu, Xiru

2015-01-01

ABSTRACT The majority of children with Dravet syndrome (DS) are caused by de novo SCN1A mutations. To investigate the origin of the mutations, we developed and applied a new method that combined deep amplicon resequencing with a Bayesian model to detect and quantify allelic fractions with improved sensitivity. Of 174 SCN1A mutations in DS probands which were considered “de novo” by Sanger sequencing, we identified 15 cases (8.6%) of parental mosaicism. We identified another five cases of parental mosaicism that were also detectable by Sanger sequencing. Fraction of mutant alleles in the 20 cases of parental mosaicism ranged from 1.1% to 32.6%. Thirteen (65% of 20) mutations originated paternally and seven (35% of 20) maternally. Twelve (60% of 20) mosaic parents did not have any epileptic symptoms. Their mutant allelic fractions were significantly lower than those in mosaic parents with epileptic symptoms (P = 0.016). We identified mosaicism with varied allelic fractions in blood, saliva, urine, hair follicle, oral epithelium, and semen, demonstrating that postzygotic mutations could affect multiple somatic cells as well as germ cells. Our results suggest that more sensitive tools for detecting low‐level mosaicism in parents of families with seemingly “de novo” mutations will allow for better informed genetic counseling. PMID:26096185

Molecular diagnosis of maturity-onset diabetes of the young (MODY) in Turkish children by using targeted next-generation sequencing.

PubMed

Anık, Ahmet; Çatlı, Gönül; Abacı, Ayhan; Sarı, Erkan; Yeşilkaya, Ediz; Korkmaz, Hüseyin Anıl; Demir, Korcan; Altıncık, Ayça; Tuhan, Hale Ünver; Kızıldağ, Sefa; Özkan, Behzat; Ceylaner, Serdar; Böber, Ece

2015-11-01

To perform molecular analysis of pediatric maturity onset diabetes of the young (MODY) patients by next-generation sequencing, which enables simultaneous analysis of multiple genes in a single test, to determine the genetic etiology of a group of Turkish children clinically diagnosed as MODY, and to assess genotype-phenotype relationship. Forty-two children diagnosed with MODY and their parents were enrolled in the study. Clinical and laboratory characteristics of the patients at the time of diagnosis were obtained from hospital records. Molecular analyses of GCK, HNF1A, HNF4A, HNF1B, PDX1, NEUROD1, KLF11, CEL, PAX4, INS, and BLK genes were performed on genomic DNA by using next-generation sequencing. Pathogenicity for novel mutations was assessed by bioinformatics prediction software programs and segregation analyses. A mutation in MODY genes was identified in 12 (29%) of the cases. GCK mutations were detected in eight cases, and HNF1B, HNF1A, PDX1, and BLK mutations in the others. We identified five novel missense mutations - three in GCK (p.Val338Met, p.Cys252Ser, and p.Val86Ala), one in HNF1A (p.Cys241Ter), and one in PDX1 (p.Gly55Asp), which we believe to be pathogenic. The results of this study showed that mutations in the GCK gene are the leading cause of MODY in our population. Moreover, genetic diagnosis could be made in 29% of Turkish patients, and five novel mutations were identified.

Sequencing of intraductal biopsies is feasible and potentially impacts clinical management of patients with indeterminate biliary stricture and cholangiocarcinoma.

PubMed

Bankov, Katrin; Döring, Claudia; Schneider, Markus; Hartmann, Sylvia; Winkelmann, Ria; Albert, Joerg G; Bechstein, Wolf Otto; Zeuzem, Stefan; Hansmann, Martin Leo; Peveling-Oberhag, Jan; Walter, Dirk

2018-04-30

Definite diagnosis and therapeutic management of cholangiocarcinoma (CCA) remains a challenge. The aim of the current study was to investigate feasibility and potential impact on clinical management of targeted sequencing of intraductal biopsies. Intraductal biopsies with suspicious findings from 16 patients with CCA in later clinical course were analyzed with targeted sequencing including tumor and control benign tissue (n = 55 samples). A CCA-specific sequencing panel containing 41 genes was designed and a dual strand targeted enrichment was applied. Sequencing was successfully performed for all samples. In total, 79 mutations were identified and a mean of 1.7 mutations per tumor sample (range 0-4) as well as 2.3 per biopsy (0-6) were detected and potentially therapeutically relevant genes were identified in 6/16 cases. In 14/18 (78%) biopsies with dysplasia or inconclusive findings at least one mutation was detected. The majority of mutations were found in both surgical specimen and biopsy (68%), while 28% were only present in biopsies in contrast to 4% being only present in the surgical tumor specimen. Targeted sequencing from intraductal biopsies is feasible and potentially improves the diagnostic yield. A profound genetic heterogeneity in biliary dysplasia needs to be considered in clinical management and warrants further investigation. The current study is the first to demonstrate the feasibility of sequencing of intraductal biopsies which holds the potential to impact diagnostic and therapeutical management of patients with biliary dysplasia and neoplasia.

Mutation Detection with Next-Generation Resequencing through a Mediator Genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wurtzel, Omri; Dori-Bachash, Mally; Pietrokovski, Shmuel

2010-12-31

The affordability of next generation sequencing (NGS) is transforming the field of mutation analysis in bacteria. The genetic basis for phenotype alteration can be identified directly by sequencing the entire genome of the mutant and comparing it to the wild-type (WT) genome, thus identifying acquired mutations. A major limitation for this approach is the need for an a-priori sequenced reference genome for the WT organism, as the short reads of most current NGS approaches usually prohibit de-novo genome assembly. To overcome this limitation we propose a general framework that utilizes the genome of relative organisms as mediators for comparing WTmore » and mutant bacteria. Under this framework, both mutant and WT genomes are sequenced with NGS, and the short sequencing reads are mapped to the mediator genome. Variations between the mutant and the mediator that recur in the WT are ignored, thus pinpointing the differences between the mutant and the WT. To validate this approach we sequenced the genome of Bdellovibrio bacteriovorus 109J, an obligatory bacterial predator, and its prey-independent mutant, and compared both to the mediator species Bdellovibrio bacteriovorus HD100. Although the mutant and the mediator sequences differed in more than 28,000 nucleotide positions, our approach enabled pinpointing the single causative mutation. Experimental validation in 53 additional mutants further established the implicated gene. Our approach extends the applicability of NGS-based mutant analyses beyond the domain of available reference genomes.« less

Mutation Detection in Patients With Advanced Cancer by Universal Sequencing of Cancer-Related Genes in Tumor and Normal DNA vs Guideline-Based Germline Testing.

PubMed

Mandelker, Diana; Zhang, Liying; Kemel, Yelena; Stadler, Zsofia K; Joseph, Vijai; Zehir, Ahmet; Pradhan, Nisha; Arnold, Angela; Walsh, Michael F; Li, Yirong; Balakrishnan, Anoop R; Syed, Aijazuddin; Prasad, Meera; Nafa, Khedoudja; Carlo, Maria I; Cadoo, Karen A; Sheehan, Meg; Fleischut, Megan H; Salo-Mullen, Erin; Trottier, Magan; Lipkin, Steven M; Lincoln, Anne; Mukherjee, Semanti; Ravichandran, Vignesh; Cambria, Roy; Galle, Jesse; Abida, Wassim; Arcila, Marcia E; Benayed, Ryma; Shah, Ronak; Yu, Kenneth; Bajorin, Dean F; Coleman, Jonathan A; Leach, Steven D; Lowery, Maeve A; Garcia-Aguilar, Julio; Kantoff, Philip W; Sawyers, Charles L; Dickler, Maura N; Saltz, Leonard; Motzer, Robert J; O'Reilly, Eileen M; Scher, Howard I; Baselga, Jose; Klimstra, David S; Solit, David B; Hyman, David M; Berger, Michael F; Ladanyi, Marc; Robson, Mark E; Offit, Kenneth

2017-09-05

Guidelines for cancer genetic testing based on family history may miss clinically actionable genetic changes with established implications for cancer screening or prevention. To determine the proportion and potential clinical implications of inherited variants detected using simultaneous sequencing of the tumor and normal tissue ("tumor-normal sequencing") compared with genetic test results based on current guidelines. From January 2014 until May 2016 at Memorial Sloan Kettering Cancer Center, 10 336 patients consented to tumor DNA sequencing. Since May 2015, 1040 of these patients with advanced cancer were referred by their oncologists for germline analysis of 76 cancer predisposition genes. Patients with clinically actionable inherited mutations whose genetic test results would not have been predicted by published decision rules were identified. Follow-up for potential clinical implications of mutation detection was through May 2017. Tumor and germline sequencing compared with the predicted yield of targeted germline sequencing based on clinical guidelines. Proportion of clinically actionable germline mutations detected by universal tumor-normal sequencing that would not have been detected by guideline-directed testing. Of 1040 patients, the median age was 58 years (interquartile range, 50.5-66 years), 65.3% were male, and 81.3% had stage IV disease at the time of genomic analysis, with prostate, renal, pancreatic, breast, and colon cancer as the most common diagnoses. Of the 1040 patients, 182 (17.5%; 95% CI, 15.3%-19.9%) had clinically actionable mutations conferring cancer susceptibility, including 149 with moderate- to high-penetrance mutations; 101 patients tested (9.7%; 95% CI, 8.1%-11.7%) would not have had these mutations detected using clinical guidelines, including 65 with moderate- to high-penetrance mutations. Frequency of inherited mutations was related to case mix, stage, and founder mutations. Germline findings led to discussion or initiation of change to targeted therapy in 38 patients tested (3.7%) and predictive testing in the families of 13 individuals (1.3%), including 6 for whom genetic evaluation would not have been initiated by guideline-based testing. In this referral population with selected advanced cancers, universal sequencing of a broad panel of cancer-related genes in paired germline and tumor DNA samples was associated with increased detection of individuals with potentially clinically significant heritable mutations over the predicted yield of targeted germline testing based on current clinical guidelines. Knowledge of these additional mutations can help guide therapeutic and preventive interventions, but whether all of these interventions would improve outcomes for patients with cancer or their family members requires further study. clinicaltrials.gov Identifier: NCT01775072.

Emerging patterns of somatic mutations in cancer

PubMed Central

Watson, Ian R.; Takahashi, Koichi; Futreal, P. Andrew; Chin, Lynda

2014-01-01

The advance in technological tools for massively parallel, high-throughput sequencing of DNA has enabled the comprehensive characterization of somatic mutations in large number of tumor samples. Here, we review recent cancer genomic studies that have assembled emerging views of the landscapes of somatic mutations through deep sequencing analyses of the coding exomes and whole genomes in various cancer types. We discuss the comparative genomics of different cancers, including mutation rates, spectrums, and roles of environmental insults that influence these processes. We highlight the developing statistical approaches used to identify significantly mutated genes, and discuss the emerging biological and clinical insights from such analyses as well as the challenges ahead translating these genomic data into clinical impacts. PMID:24022702

Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

PubMed

Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

2013-01-01

Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

Whole-Exome Sequencing Study of Thyrotropin-Secreting Pituitary Adenomas.

PubMed

Sapkota, Santosh; Horiguchi, Kazuhiko; Tosaka, Masahiko; Yamada, Syozo; Yamada, Masanobu

2017-02-01

Thyrotropin (TSH)-secreting pituitary adenomas (TSHomas) are a rare cause of hyperthyroidism, and the genetic aberrations responsible remain unknown. To identify somatic genetic abnormalities in TSHomas. A single-nucleotide polymorphism (SNP) array analysis was performed on 8 TSHomas. Four tumors with no allelic losses or limited loss of heterozygosity were selected, and whole-exome sequencing was performed, including their corresponding blood samples. Somatic variants were confirmed by Sanger sequencing. A set of 8 tumors was also assessed to validate candidate genes. Twelve patients with sporadic TSHomas were examined. The overall performance of whole-exome sequencing was good, with an average coverage of each base in the targeted region of 97.6%. Six DNA variants were confirmed as candidate driver mutations, with an average of 1.5 somatic mutations per tumor. No mutations were recurrent. Two of these mutations were found in genes with an established role in malignant tumorigenesis (SMOX and SYTL3), and 4 had unknown roles (ZSCAN23, ASTN2, R3HDM2, and CWH43). Similarly, an SNP array analysis revealed frequent chromosomal regions of copy number gains, including recurrent gains at loci harboring 4 of these 6 genes. Several candidate somatic mutations and changes in copy numbers for TSHomas were identified. The results showed no recurrence of mutations in the tumors studied but a low number of mutations, thereby highlighting their benign nature. Further studies on a larger cohort of TSHomas, along with the use of epigenetic and transcriptomic approaches, may reveal the underlying genetic lesions. Copyright © 2017 by the Endocrine Society

High-throughput sequencing of the entire genomic regions of CCM1/KRIT1, CCM2 and CCM3/PDCD10 to search for pathogenic deep-intronic splice mutations in cerebral cavernous malformations.

PubMed

Rath, Matthias; Jenssen, Sönke E; Schwefel, Konrad; Spiegler, Stefanie; Kleimeier, Dana; Sperling, Christian; Kaderali, Lars; Felbor, Ute

2017-09-01

Cerebral cavernous malformations (CCM) are vascular lesions of the central nervous system that can cause headaches, seizures and hemorrhagic stroke. Disease-associated mutations have been identified in three genes: CCM1/KRIT1, CCM2 and CCM3/PDCD10. The precise proportion of deep-intronic variants in these genes and their clinical relevance is yet unknown. Here, a long-range PCR (LR-PCR) approach for target enrichment of the entire genomic regions of the three genes was combined with next generation sequencing (NGS) to screen for coding and non-coding variants. NGS detected all six CCM1/KRIT1, two CCM2 and four CCM3/PDCD10 mutations that had previously been identified by Sanger sequencing. Two of the pathogenic variants presented here are novel. Additionally, 20 stringently selected CCM index cases that had remained mutation-negative after conventional sequencing and exclusion of copy number variations were screened for deep-intronic mutations. The combination of bioinformatics filtering and transcript analyses did not reveal any deep-intronic splice mutations in these cases. Our results demonstrate that target enrichment by LR-PCR combined with NGS can be used for a comprehensive analysis of the entire genomic regions of the CCM genes in a research context. However, its clinical utility is limited as deep-intronic splice mutations in CCM1/KRIT1, CCM2 and CCM3/PDCD10 seem to be rather rare. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Potential ligand-binding residues in rat olfactory receptors identified by correlated mutation analysis

NASA Technical Reports Server (NTRS)

Singer, M. S.; Oliveira, L.; Vriend, G.; Shepherd, G. M.

1995-01-01

A family of G-protein-coupled receptors is believed to mediate the recognition of odor molecules. In order to identify potential ligand-binding residues, we have applied correlated mutation analysis to receptor sequences from the rat. This method identifies pairs of sequence positions where residues remain conserved or mutate in tandem, thereby suggesting structural or functional importance. The analysis supported molecular modeling studies in suggesting several residues in positions that were consistent with ligand-binding function. Two of these positions, dominated by histidine residues, may play important roles in ligand binding and could confer broad specificity to mammalian odor receptors. The presence of positive (overdominant) selection at some of the identified positions provides additional evidence for roles in ligand binding. Higher-order groups of correlated residues were also observed. Each group may interact with an individual ligand determinant, and combinations of these groups may provide a multi-dimensional mechanism for receptor diversity.

Germline mutations in SUFU cause Gorlin syndrome-associated childhood medulloblastoma and redefine the risk associated with PTCH1 mutations.

PubMed

Smith, Miriam J; Beetz, Christian; Williams, Simon G; Bhaskar, Sanjeev S; O'Sullivan, James; Anderson, Beverley; Daly, Sarah B; Urquhart, Jill E; Bholah, Zaynab; Oudit, Deemesh; Cheesman, Edmund; Kelsey, Anna; McCabe, Martin G; Newman, William G; Evans, D Gareth R

2014-12-20

Heterozygous germline PTCH1 mutations are causative of Gorlin syndrome (naevoid basal cell carcinoma), but detection rates > 70% have rarely been reported. We aimed to define the causative mutations in individuals with Gorlin syndrome without PTCH1 mutations. We undertook exome sequencing on lymphocyte DNA from four unrelated individuals from families with Gorlin syndrome with no PTCH1 mutations found by Sanger sequencing, multiplex ligation-dependent probe amplification (MLPA), or RNA analysis. A germline heterozygous nonsense mutation in SUFU was identified in one of four exomes. Sanger sequencing of SUFU in 23 additional PTCH1-negative Gorlin syndrome families identified a SUFU mutation in a second family. Copy-number analysis of SUFU by MLPA revealed a large heterozygous deletion in a third family. All three SUFU-positive families fulfilled diagnostic criteria for Gorlin syndrome, although none had odontogenic jaw keratocysts. Each SUFU-positive family included a single case of medulloblastoma, whereas only two (1.7%) of 115 individuals with Gorlin syndrome and a PTCH1 mutation developed medulloblastoma. We demonstrate convincing evidence that SUFU mutations can cause classical Gorlin syndrome. Our study redefines the risk of medulloblastoma in Gorlin syndrome, dependent on the underlying causative gene. Previous reports have found a 5% risk of medulloblastoma in Gorlin syndrome. We found a < 2% risk in PTCH1 mutation-positive individuals, with a risk up to 20× higher in SUFU mutation-positive individuals. Our data suggest childhood brain magnetic resonance imaging surveillance is justified in SUFU-related, but not PTCH1-related, Gorlin syndrome. © 2014 by American Society of Clinical Oncology.

Rare deleterious mutations are associated with disease in bipolar disorder families.

PubMed

Rao, A R; Yourshaw, M; Christensen, B; Nelson, S F; Kerner, B

2017-07-01

Bipolar disorder (BD) is a common, complex and heritable psychiatric disorder characterized by episodes of severe mood swings. The identification of rare, damaging genomic mutations in families with BD could inform about disease mechanisms and lead to new therapeutic interventions. To determine whether rare, damaging mutations shared identity-by-descent in families with BD could be associated with disease, exome sequencing was performed in multigenerational families of the NIMH BD Family Study followed by in silico functional prediction. Disease association and disease specificity was determined using 5090 exomes from the Sweden-Schizophrenia (SZ) Population-Based Case-Control Exome Sequencing study. We identified 14 rare and likely deleterious mutations in 14 genes that were shared identity-by-descent among affected family members. The variants were associated with BD (P<0.05 after Bonferroni's correction) and disease specificity was supported by the absence of the mutations in patients with SZ. In addition, we found rare, functional mutations in known causal genes for neuropsychiatric disorders including holoprosencephaly and epilepsy. Our results demonstrate that exome sequencing in multigenerational families with BD is effective in identifying rare genomic variants of potential clinical relevance and also disease modifiers related to coexisting medical conditions. Replication of our results and experimental validation are required before disease causation could be assumed.

Development and validation of a whole-exome sequencing test for simultaneous detection of point mutations, indels and copy-number alterations for precision cancer care

PubMed Central

Rennert, Hanna; Eng, Kenneth; Zhang, Tuo; Tan, Adrian; Xiang, Jenny; Romanel, Alessandro; Kim, Robert; Tam, Wayne; Liu, Yen-Chun; Bhinder, Bhavneet; Cyrta, Joanna; Beltran, Himisha; Robinson, Brian; Mosquera, Juan Miguel; Fernandes, Helen; Demichelis, Francesca; Sboner, Andrea; Kluk, Michael; Rubin, Mark A; Elemento, Olivier

2016-01-01

We describe Exome Cancer Test v1.0 (EXaCT-1), the first New York State-Department of Health-approved whole-exome sequencing (WES)-based test for precision cancer care. EXaCT-1 uses HaloPlex (Agilent) target enrichment followed by next-generation sequencing (Illumina) of tumour and matched constitutional control DNA. We present a detailed clinical development and validation pipeline suitable for simultaneous detection of somatic point/indel mutations and copy-number alterations (CNAs). A computational framework for data analysis, reporting and sign-out is also presented. For the validation, we tested EXaCT-1 on 57 tumours covering five distinct clinically relevant mutations. Results demonstrated elevated and uniform coverage compatible with clinical testing as well as complete concordance in variant quality metrics between formalin-fixed paraffin embedded and fresh-frozen tumours. Extensive sensitivity studies identified limits of detection threshold for point/indel mutations and CNAs. Prospective analysis of 337 cancer cases revealed mutations in clinically relevant genes in 82% of tumours, demonstrating that EXaCT-1 is an accurate and sensitive method for identifying actionable mutations, with reasonable costs and time, greatly expanding its utility for advanced cancer care. PMID:28781886

Next-Generation Sequencing-based genomic profiling of brain metastases of primary ovarian cancer identifies high number of BRCA-mutations.

PubMed

Balendran, S; Liebmann-Reindl, S; Berghoff, A S; Reischer, T; Popitsch, N; Geier, C B; Kenner, L; Birner, P; Streubel, B; Preusser, M

2017-07-01

Ovarian cancer represents the most common gynaecological malignancy and has the highest mortality of all female reproductive cancers. It has a rare predilection to develop brain metastases (BM). In this study, we evaluated the mutational profile of ovarian cancer metastases through Next-Generation Sequencing (NGS) with the aim of identifying potential clinically actionable genetic alterations with options for small molecule targeted therapy. Library preparation was conducted using Illumina TruSight Rapid Capture Kit in combination with a cancer specific enrichment kit covering 94 genes. BRCA-mutations were confirmed by using TruSeq Custom Amplicon Low Input Kit in combination with a custom-designed BRCA gene panel. In our cohort all eight sequenced BM samples exhibited a multitude of variant alterations, each with unique molecular profiles. The 37 identified variants were distributed over 22 cancer-related genes (23.4%). The number of mutated genes per sample ranged from 3 to 7 with a median of 4.5. The most commonly altered genes were BRCA1/2, TP53, and ATM. In total, 7 out of 8 samples revealed either a BRCA1 or a BRCA2 pathogenic mutation. Furthermore, all eight BM samples showed mutations in at least one DNA repair gene. Our NGS study of BM of ovarian carcinoma revealed a significant number of BRCA-mutations beside TP53, ATM and CHEK2 mutations. These findings strongly suggest the implication of BRCA and DNA repair malfunction in ovarian cancer metastasizing to the brain. Based on these findings, pharmacological PARP inhibition could be one potential targeted therapeutic for brain metastatic ovarian cancer patients.

Exome Sequencing Identifies Mitochondrial Alanyl-tRNA Synthetase Mutations in Infantile Mitochondrial Cardiomyopathy

PubMed Central

Götz, Alexandra; Tyynismaa, Henna; Euro, Liliya; Ellonen, Pekka; Hyötyläinen, Tuulia; Ojala, Tiina; Hämäläinen, Riikka H.; Tommiska, Johanna; Raivio, Taneli; Oresic, Matej; Karikoski, Riitta; Tammela, Outi; Simola, Kalle O.J.; Paetau, Anders; Tyni, Tiina; Suomalainen, Anu

2011-01-01

Infantile cardiomyopathies are devastating fatal disorders of the neonatal period or the first year of life. Mitochondrial dysfunction is a common cause of this group of diseases, but the underlying gene defects have been characterized in only a minority of cases, because tissue specificity of the manifestation hampers functional cloning and the heterogeneity of causative factors hinders collection of informative family materials. We sequenced the exome of a patient who died at the age of 10 months of hypertrophic mitochondrial cardiomyopathy with combined cardiac respiratory chain complex I and IV deficiency. Rigorous data analysis allowed us to identify a homozygous missense mutation in AARS2, which we showed to encode the mitochondrial alanyl-tRNA synthetase (mtAlaRS). Two siblings from another family, both of whom died perinatally of hypertrophic cardiomyopathy, had the same mutation, compound heterozygous with another missense mutation. Protein structure modeling of mtAlaRS suggested that one of the mutations affected a unique tRNA recognition site in the editing domain, leading to incorrect tRNA aminoacylation, whereas the second mutation severely disturbed the catalytic function, preventing tRNA aminoacylation. We show here that mutations in AARS2 cause perinatal or infantile cardiomyopathy with near-total combined mitochondrial respiratory chain deficiency in the heart. Our results indicate that exome sequencing is a powerful tool for identifying mutations in single patients and allows recognition of the genetic background in single-gene disorders of variable clinical manifestation and tissue-specific disease. Furthermore, we show that mitochondrial disorders extend to prenatal life and are an important cause of early infantile cardiac failure. PMID:21549344

Nephrocalcinosis (Enamel Renal Syndrome) Caused by Autosomal Recessive FAM20A Mutations

PubMed Central

Jaureguiberry, Graciana; De la Dure-Molla, Muriel; Parry, David; Quentric, Mickael; Himmerkus, Nina; Koike, Toshiyasu; Poulter, James; Klootwijk, Enriko; Robinette, Steven L.; Howie, Alexander J.; Patel, Vaksha; Figueres, Marie-Lucile; Stanescu, Horia C.; Issler, Naomi; Nicholson, Jeremy K.; Bockenhauer, Detlef; Laing, Christopher; Walsh, Stephen B.; McCredie, David A.; Povey, Sue; Asselin, Audrey; Picard, Arnaud; Coulomb, Aurore; Medlar, Alan J.; Bailleul-Forestier, Isabelle; Verloes, Alain; Le Caignec, Cedric; Roussey, Gwenaelle; Guiol, Julien; Isidor, Bertrand; Logan, Clare; Shore, Roger; Johnson, Colin; Inglehearn, Christopher; Al-Bahlani, Suhaila; Schmittbuhl, Matthieu; Clauss, François; Huckert, Mathilde; Laugel, Virginie; Ginglinger, Emmanuelle; Pajarola, Sandra; Spartà, Giuseppina; Bartholdi, Deborah; Rauch, Anita; Addor, Marie-Claude; Yamaguti, Paulo M.; Safatle, Heloisa P.; Acevedo, Ana Carolina; Martelli-Júnior, Hercílio; dos Santos Netos, Pedro E.; Coletta, Ricardo D.; Gruessel, Sandra; Sandmann, Carolin; Ruehmann, Denise; Langman, Craig B.; Scheinman, Steven J.; Ozdemir-Ozenen, Didem; Hart, Thomas C.; Hart, P. Suzanne; Neugebauer, Ute; Schlatter, Eberhard; Houillier, Pascal; Gahl, William A.; Vikkula, Miikka; Bloch-Zupan, Agnès; Bleich, Markus; Kitagawa, Hiroshi; Unwin, Robert J.; Mighell, Alan; Berdal, Ariane; Kleta, Robert

2013-01-01

Background/Aims Calcium homeostasis requires regulated cellular and interstitial systems interacting to modulate the activity and movement of this ion. Disruption of these systems in the kidney results in nephrocalcinosis and nephrolithiasis, important medical problems whose pathogenesis is incompletely understood. Methods We investigated 25 patients from 16 families with unexplained nephrocalcinosis and characteristic dental defects (amelogenesis imperfecta, gingival hyperplasia, impaired tooth eruption). To identify the causative gene, we performed genome-wide linkage analysis, exome capture, next-generation sequencing, and Sanger sequencing. Results All patients had bi-allelic FAM20A mutations segregating with the disease; 20 different mutations were identified. Conclusions This au-tosomal recessive disorder, also known as enamel renal syndrome, of FAM20A causes nephrocalcinosis and amelogenesis imperfecta. We speculate that all individuals with biallelic FAM20A mutations will eventually show nephrocalcinosis. PMID:23434854

Identification of an alternative knockdown resistance (kdr)-like mutation, M918L, and a novel mutation, V1010A, in the Thrips tabaci voltage-gated sodium channel gene.

PubMed

Wu, Meixiang; Gotoh, Hiroki; Waters, Timothy; Walsh, Douglas B; Lavine, Laura Corley

2014-06-01

Knockdown resistance (kdr) has been identified as a main mechanism against pyrethroid insecticides in many arthropod pests including in the onion thrips, Thrips tabaci. To characterize and identify pyrethroid-resistance in onion thrips in Washington state, we conducted insecticide bioassays and sequenced a region of the voltage gated sodium channel gene from several different T. tabaci populations. Field collected Thrips tabaci were found to have large variations in resistance to the pyrethroid insecticide lambda-cyhalothrin. We identified two single nucleotide substitutions in our analysis of a partial sequence of the T. tabaci voltage-gated sodium channel gene. One mutation resulted in the non-synonymous substitution of methionine with leucine (M918L), which is well known to be responsible for super knockdown resistance in some pest species. Another non-synonymous substitution, a valine (GTT) to alanine (GCT) replacement at amino acid 1010 (V1010A) was identified in our study and was associated with lambda-cyhalothrin resistance. We have characterized a known kdr mutation and identified a novel mutation in the voltage-gated sodium channel gene of Thrips tabaci associated with resistance to lambda-cyhalothrin. This gene region and these mutations are expected to be useful in the development of a diagnostic test to detect kdr resistance in many onion thrips populations. © 2013 Society of Chemical Industry.

Whole-exome sequencing and digital PCR identified a novel compound heterozygous mutation in the NPHP1 gene in a case of Joubert syndrome and related disorders.

PubMed

Koyama, Shingo; Sato, Hidenori; Wada, Manabu; Kawanami, Toru; Emi, Mitsuru; Kato, Takeo

2017-03-27

Joubert syndrome and related disorders (JSRD) is a clinically and genetically heterogeneous condition with autosomal recessive or X-linked inheritance, which share a distinctive neuroradiological hallmark, the so-called molar tooth sign. JSRD is classified into six clinical subtypes based on associated variable multiorgan involvement. To date, 21 causative genes have been identified in JSRD, which makes genetic diagnosis difficult. We report here a case of a 28-year-old Japanese woman diagnosed with JS with oculorenal defects with a novel compound heterozygous mutation (p.Ser219*/deletion) in the NPHP1 gene. Whole-exome sequencing (WES) of the patient identified the novel nonsense mutation in an apparently homozygous state. However, it was absent in her mother and heterozygous in her father. A read depth-based copy number variation (CNV) detection algorithm using WES data of the family predicted a large heterozygous deletion mutation in the patient and her mother, which was validated by digital polymerase chain reaction, indicating that the patient was compound heterozygous for the paternal nonsense mutation and the maternal deletion mutation spanning the site of the single nucleotide change. It should be noted that analytical pipelines that focus purely on sequence information cannot distinguish homozygosity from hemizygosity because of its inability to detect large deletions. The ability to detect CNVs in addition to single nucleotide variants and small insertion/deletions makes WES an attractive diagnostic tool for genetically heterogeneous disorders.

A case report and literature review of Fanconi Anemia (FA) diagnosed by genetic testing.

PubMed

Solomon, Ponnumony John; Margaret, Priya; Rajendran, Ramya; Ramalingam, Revathy; Menezes, Godfred A; Shirley, Alph S; Lee, Seung Jun; Seong, Moon-Woo; Park, Sung Sup; Seol, Dodam; Seo, Soo Hyun

2015-05-08

Fanconi anemia (FA) is a genetically heterogeneous rare autosomal recessive disorder characterized by congenital malformations, hematological problems and predisposition to malignancies. The genes that have been found to be mutated in FA patients are called FANC. To date 16 distinct FANC genes have been reported. Among these, mutations in FANCA are the most frequent among FA patients worldwide which account for 60- 65%. In this study, a nine years old male child was brought to our hospital one year ago for opinion and advice. He was the third child born to consanguineous parents. The mutation analyses were performed for proband, parents, elder sibling and the relatives [maternal aunt and maternal aunt's son (cousin)]. Molecular genetic testing [targeted next-generation sequencing (MiSeq, Illumina method)] was performed by mutation analysis in 15 genes involved. Entire coding exons and their flanking regions of the genes were analysed. Sanger sequencing [(ABI 3730 analyzer by Applied Biosystems)] was performed using primers specific for 43 coding exons of the FANCA gene. A novel splice site mutation, c.3066 + 1G > T, (IVS31 + 1G > T), homozygote was detected by sequencing in the patient. The above sequence variant was identified in heterozygous state in his parents. Further, the above sequence variant was not identified in other family members (elder sibling, maternal aunt and cousin). It is concluded that genetic study should be done if possible in all the cases of suspected FA, including siblings, parents and close blood relatives. It will help us to plan appropriate treatment and also to select suitable donor for hematopoietic stem cell transplantation and to plan for genetic counseling. In addition to the case report, the main focus of this manuscript was to review literature on role of FANCA gene in FA since large number of FANCA mutations and polymorphisms have been identified.

Ion Torrent sequencing as a tool for mutation discovery in the flax (Linum usitatissimum L.) genome.

PubMed

Galindo-González, Leonardo; Pinzón-Latorre, David; Bergen, Erik A; Jensen, Dustin C; Deyholos, Michael K

2015-01-01

Detection of induced mutations is valuable for inferring gene function and for developing novel germplasm for crop improvement. Many reverse genetics approaches have been developed to identify mutations in genes of interest within a mutagenized population, including some approaches that rely on next-generation sequencing (e.g. exome capture, whole genome resequencing). As an alternative to these genome or exome-scale methods, we sought to develop a scalable and efficient method for detection of induced mutations that could be applied to a small number of target genes, using Ion Torrent technology. We developed this method in flax (Linum usitatissimum), to demonstrate its utility in a crop species. We used an amplicon-based approach in which DNA samples from an ethyl methanesulfonate (EMS)-mutagenized population were pooled and used as template in PCR reactions to amplify a region of each gene of interest. Barcodes were incorporated during PCR, and the pooled amplicons were sequenced using an Ion Torrent PGM. A pilot experiment with known SNPs showed that they could be detected at a frequency > 0.3% within the pools. We then selected eight genes for which we wanted to discover novel mutations, and applied our approach to screen 768 individuals from the EMS population, using either the Ion 314 or Ion 316 chips. Out of 29 potential mutations identified after processing the NGS reads, 16 mutations were confirmed using Sanger sequencing. The methodology presented here demonstrates the utility of Ion Torrent technology in detecting mutation variants in specific genome regions for large populations of a species such as flax. The methodology could be scaled-up to test >100 genes using the higher capacity chips now available from Ion Torrent.

Identification of a Comprehensive Spectrum of Genetic Factors for Hereditary Breast Cancer in a Chinese Population by Next-Generation Sequencing

PubMed Central

Yang, Xiaochen; Wu, Jiong; Lu, Jingsong; Liu, Guangyu; Di, Genhong; Chen, Canming; Hou, Yifeng; Sun, Menghong; Yang, Wentao; Xu, Xiaojing; Zhao, Ying; Hu, Xin; Li, Daqiang; Cao, Zhigang; Zhou, Xiaoyan; Huang, Xiaoyan; Liu, Zhebin; Chen, Huan; Gu, Yanzi; Chi, Yayun; Yan, Xia; Han, Qixia; Shen, Zhenzhou; Shao, Zhimin; Hu, Zhen

2015-01-01

The genetic etiology of hereditary breast cancer has not been fully elucidated. Although germline mutations of high-penetrance genes such as BRCA1/2 are implicated in development of hereditary breast cancers, at least half of all breast cancer families are not linked to these genes. To identify a comprehensive spectrum of genetic factors for hereditary breast cancer in a Chinese population, we performed an analysis of germline mutations in 2,165 coding exons of 152 genes associated with hereditary cancer using next-generation sequencing (NGS) in 99 breast cancer patients from families of cancer patients regardless of cancer types. Forty-two deleterious germline mutations were identified in 21 genes of 34 patients, including 18 (18.2%) BRCA1 or BRCA2 mutations, 3 (3%) TP53 mutations, 5 (5.1%) DNA mismatch repair gene mutations, 1 (1%) CDH1 mutation, 6 (6.1%) Fanconi anemia pathway gene mutations, and 9 (9.1%) mutations in other genes. Of seven patients who carried mutations in more than one gene, 4 were BRCA1/2 mutation carriers, and their average onset age was much younger than patients with only BRCA1/2 mutations. Almost all identified high-penetrance gene mutations in those families fulfill the typical phenotypes of hereditary cancer syndromes listed in the National Comprehensive Cancer Network (NCCN) guidelines, except two TP53 and three mismatch repair gene mutations. Furthermore, functional studies of MSH3 germline mutations confirmed the association between MSH3 mutation and tumorigenesis, and segregation analysis suggested antagonism between BRCA1 and MSH3. We also identified a lot of low-penetrance gene mutations. Although the clinical significance of those newly identified low-penetrance gene mutations has not been fully appreciated yet, these new findings do provide valuable epidemiological information for the future studies. Together, these findings highlight the importance of genetic testing based on NCCN guidelines and a multi-gene analysis using NGS may be a supplement to traditional genetic counseling. PMID:25927356

Peripheral immunophenotype and viral promoter variants during the asymptomatic phase of feline immunodeficiency virus infection.

PubMed

Murphy, B; Hillman, C; McDonnel, S

2014-01-22

Feline immunodeficiency virus (FIV)-infected cats enter a clinically asymptomatic phase during chronic infection. Despite the lack of overt clinical disease, the asymptomatic phase is characterized by persistent immunologic impairment. In the peripheral blood obtained from cats experimentally infected with FIV-C for approximately 5 years, we identified a persistent inversion of the CD4/CD8 ratio. We cloned and sequenced the FIV-C long terminal repeat containing the viral promoter from cells infected with the inoculating virus and from in vivo-derived peripheral blood mononuclear cells and CD4 T cells isolated at multiple time points throughout the asymptomatic phase. Relative to the inoculating virus, viral sequences amplified from cells isolated from all of the infected animals demonstrated multiple single nucleotide mutations and a short deletion within the viral U3, R and U5 regions. A transcriptionally inactivating proviral mutation in the U3 promoter AP-1 site was identified at multiple time points from all of the infected animals but not within cell-associated viral RNA. In contrast, no mutations were identified within the sequence of the viral dUTPase gene amplified from PBMC isolated at approximately 5 years post-infection relative to the inoculating sequence. The possible implications of these mutations to viral pathogenesis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

Exome Sequencing Identifies a Novel CEACAM16 Mutation Associated with Autosomal Dominant Nonsyndromic Hearing Loss DFNA4B in a Chinese Family

PubMed Central

He, Chufeng; Li, Haibo; Qing, Jie; Grati, Mhamed; Hu, Zhengmao; Li, Jiada; Hu, Yiqiao; Xia, Kun; Mei, Lingyun; Wang, Xingwei; Yu, Jianjun; Chen, Hongsheng; Jiang, Lu; Liu, Yalan; Men, Meichao; Zhang, Hailin; Guan, Liping; Xiao, Jingjing; Zhang, Jianguo; Liu, Xuezhong; Feng, Yong

2014-01-01

Autosomal dominant nonsyndromic hearing loss (ADNSHL/DFNA) is a highly genetically heterogeneous disorder. Hitherto only about 30 ADNSHL-causing genes have been identified and many unknown genes remain to be discovered. In this research, genome-wide linkage analysis mapped the disease locus to a 4.3 Mb region on chromosome 19q13 in SY-026, a five-generation nonconsanguineous Chinese family affected by late-onset and progressive ADNSHL. This linkage region showed partial overlap with the previously reported DFNA4. Simultaneously, probands were analyzed using exome capture followed by next generation sequencing. Encouragingly, a heterozygous missense mutation, c.505G>A (p.G169R) in exon 3 of the CEACAM16 gene (carcinoembryonic antigen-related cell adhesion molecule 16), was identified via this combined strategy. Sanger sequencing verified that the mutation co-segregated with hearing loss in the family and that it was not present in 200 unrelated control subjects with matched ancestry. This is the second report in the literature of a family with ADNSHL caused by CEACAM16 mutation. Immunofluorescence staining and Western blots also prove CEACAM16 to be a secreted protein. Furthermore, our studies in transfected HEK293T cells show that the secretion efficacy of the mutant CEACAM16 is much lower than that of the wild-type, suggesting a deleterious effect of the sequence variant. PMID:25589040

Exome sequencing identifies a novel CEACAM16 mutation associated with autosomal dominant nonsyndromic hearing loss DFNA4B in a Chinese family.

PubMed

Wang, Honghan; Wang, Xinwei; He, Chufeng; Li, Haibo; Qing, Jie; Grati, Mhamed; Hu, Zhengmao; Li, Jiada; Hu, Yiqiao; Xia, Kun; Mei, Lingyun; Wang, Xingwei; Yu, Jianjun; Chen, Hongsheng; Jiang, Lu; Liu, Yalan; Men, Meichao; Zhang, Hailin; Guan, Liping; Xiao, Jingjing; Zhang, Jianguo; Liu, Xuezhong; Feng, Yong

2015-03-01

Autosomal dominant nonsyndromic hearing loss (ADNSHL/DFNA) is a highly genetically heterogeneous disorder. Hitherto only about 30 ADNSHL-causing genes have been identified and many unknown genes remain to be discovered. In this research, genome-wide linkage analysis mapped the disease locus to a 4.3 Mb region on chromosome 19q13 in SY-026, a five-generation nonconsanguineous Chinese family affected by late-onset and progressive ADNSHL. This linkage region showed partial overlap with the previously reported DFNA4. Simultaneously, probands were analyzed using exome capture followed by next-generation sequencing. Encouragingly, a heterozygous missense mutation, c.505G>A (p.G169R) in exon 3 of the CEACAM16 gene (carcinoembryonic antigen-related cell adhesion molecule 16), was identified via this combined strategy. Sanger sequencing verified that the mutation co-segregated with hearing loss in the family and that it was not present in 200 unrelated control subjects with matched ancestry. This is the second report in the literature of a family with ADNSHL caused by CEACAM16 mutation. Immunofluorescence staining and western blots also prove CEACAM16 to be a secreted protein. Furthermore, our studies in transfected HEK293T cells show that the secretion efficacy of the mutant CEACAM16 is much lower than that of the wild type, suggesting a deleterious effect of the sequence variant.

Identification of TCT, a novel knockdown resistance allele mutation and analysis of resistance detection methods in the voltage-gated Na⁺ channel of Culex pipiens pallens from Shandong Province, China.

PubMed

Liu, Hong-Mei; Cheng, Peng; Huang, Xiaodan; Dai, Yu-Hua; Wang, Hai-Fang; Liu, Li-Juan; Zhao, Yu-Qiang; Wang, Huai-Wei; Gong, Mao-Qing

2013-02-01

The present study aimed to investigate deltamethrin resistance in Culex pipiens pallens (C. pipiens pallens) mosquitoes and its correlation with knockdown resistance (kdr) mutations. In addition, mosquito‑resistance testing methods were analyzed. Using specific primers in polymerase chain reaction (PCR) and allele-specific (AS)-PCR, kdr gene sequences isolated from wild C. pipiens pallens mosquitoes were sequenced. Linear regression analysis was used to determine the correlation between the mutations and deltamethrin resistance. A kdr allelic gene was cloned and sequenced. Analysis of the DNA sequences revealed the presence of two point mutations at the L1014 residue in the IIS6 transmembrane segment of the voltage‑gated sodium channel (VGSC): L1014F, TTA→TTT, replacing a leucine (L) with a phenylalanine (F); L1014S, TTA→TCA, replacing leucine (L) with serine (S). Two alternative kdr-like mutations, L1014F and L1014S, were identified to be positively correlated with the deltamethrin-resistant phenotype. In addition a novel mutation, TCT, was identified in the VGSC of C. pipiens pallens. PCR and AS-PCR yielded consistent results with respect to mosquito resistance. However, the detection rate of PCR was higher than that of AS-PCR. Further studies are required to determine the specific resistance mechanism. PCR and AS-PCR demonstrated suitability for mosquito resistance field tests, however, the former method may be superior to the latter.

Bovine exome sequence analysis and targeted SNP genotyping of recessive fertility defects BH1, HH2, and HH3 reveal a putative causative mutation in SMC2 for HH3.

PubMed

McClure, Matthew C; Bickhart, Derek; Null, Dan; Vanraden, Paul; Xu, Lingyang; Wiggans, George; Liu, George; Schroeder, Steve; Glasscock, Jarret; Armstrong, Jon; Cole, John B; Van Tassell, Curtis P; Sonstegard, Tad S

2014-01-01

The recent discovery of bovine haplotypes with negative effects on fertility in the Brown Swiss, Holstein, and Jersey breeds has allowed producers to identify carrier animals using commercial single nucleotide polymorphism (SNP) genotyping assays. This study was devised to identify the causative mutations underlying defective bovine embryo development contained within three of these haplotypes (Brown Swiss haplotype 1 and Holstein haplotypes 2 and 3) by combining exome capture with next generation sequencing. Of the 68,476,640 sequence variations (SV) identified, only 1,311 genome-wide SNP were concordant with the haplotype status of 21 sequenced carriers. Validation genotyping of 36 candidate SNP identified only 1 variant that was concordant to Holstein haplotype 3 (HH3), while no variants located within the refined intervals for HH2 or BH1 were concordant. The variant strictly associated with HH3 is a non-synonymous SNP (T/C) within exon 24 of the Structural Maintenance of Chromosomes 2 (SMC2) on Chromosome 8 at position 95,410,507 (UMD3.1). This polymorphism changes amino acid 1135 from phenylalanine to serine and causes a non-neutral, non-tolerated, and evolutionarily unlikely substitution within the NTPase domain of the encoded protein. Because only exome capture sequencing was used, we could not rule out the possibility that the true causative mutation for HH3 might lie in a non-exonic genomic location. Given the essential role of SMC2 in DNA repair, chromosome condensation and segregation during cell division, our findings strongly support the non-synonymous SNP (T/C) in SMC2 as the likely causative mutation. The absence of concordant variations for HH2 or BH1 suggests either the underlying causative mutations lie within a non-exomic region or in exome regions not covered by the capture array.

Bovine Exome Sequence Analysis and Targeted SNP Genotyping of Recessive Fertility Defects BH1, HH2, and HH3 Reveal a Putative Causative Mutation in SMC2 for HH3

PubMed Central

McClure, Matthew C.; Bickhart, Derek; Null, Dan; VanRaden, Paul; Xu, Lingyang; Wiggans, George; Liu, George; Schroeder, Steve; Glasscock, Jarret; Armstrong, Jon; Cole, John B.; Van Tassell, Curtis P.; Sonstegard, Tad S.

2014-01-01

The recent discovery of bovine haplotypes with negative effects on fertility in the Brown Swiss, Holstein, and Jersey breeds has allowed producers to identify carrier animals using commercial single nucleotide polymorphism (SNP) genotyping assays. This study was devised to identify the causative mutations underlying defective bovine embryo development contained within three of these haplotypes (Brown Swiss haplotype 1 and Holstein haplotypes 2 and 3) by combining exome capture with next generation sequencing. Of the 68,476,640 sequence variations (SV) identified, only 1,311 genome-wide SNP were concordant with the haplotype status of 21 sequenced carriers. Validation genotyping of 36 candidate SNP identified only 1 variant that was concordant to Holstein haplotype 3 (HH3), while no variants located within the refined intervals for HH2 or BH1 were concordant. The variant strictly associated with HH3 is a non-synonymous SNP (T/C) within exon 24 of the Structural Maintenance of Chromosomes 2 (SMC2) on Chromosome 8 at position 95,410,507 (UMD3.1). This polymorphism changes amino acid 1135 from phenylalanine to serine and causes a non-neutral, non-tolerated, and evolutionarily unlikely substitution within the NTPase domain of the encoded protein. Because only exome capture sequencing was used, we could not rule out the possibility that the true causative mutation for HH3 might lie in a non-exonic genomic location. Given the essential role of SMC2 in DNA repair, chromosome condensation and segregation during cell division, our findings strongly support the non-synonymous SNP (T/C) in SMC2 as the likely causative mutation. The absence of concordant variations for HH2 or BH1 suggests either the underlying causative mutations lie within a non-exomic region or in exome regions not covered by the capture array. PMID:24667746

Clinical characteristics of severe congenital neutropenia caused by novel ELANE gene mutations.

PubMed

Shu, Zhou; Li, Xiao-Hui; Bai, Xiao-Ming; Zhang, Zhi-Yong; Jiang, Li-ping; Tang, Xue-Mei; Zhao, Xiao-dong

2015-02-01

Mutations within the ELANE gene, which encodes human neutrophil elastase, are the most common genetic causes of severe congenital neutropenia (SCN). No cases of SCN have been previously described from a Chinese population. Herein, we describe the clinical, hematologic and molecular characteristics of 7 Chinese SCN cases with novel ELANE mutations. Seven Chinese pediatric patients (4 males and 3 females) with suspected SCN were enrolled in this study. Clinical data, peripheral blood, bone marrow and immune function were evaluated for SCN. ELANE genomic DNA and cDNA sequences from patients and potential carriers were analyzed using polymerase chain reaction (PCR) and direct sequencing. All the7 patients experienced recurrent infection (soft tissue, lung, oral cavity) during a period of 120 days. Noninfectious conditions such as anemia and osteopenia were found in most patients, and absolute peripheral neutrophil counts varied. DNA and cDNA sequencing demonstrated that the patients harbored a range of heterozygous ELANE gene mutations, including substitution, deletion, insertion and frame shift alterations. All the mutations had not been reported previously; however, no mutation carriers were identified among the parents or siblings, even in a family with 2 affected offspring. SCN cases were identified for the first time in China, and all patients carried novel ELANE mutations. Granulocyte-colony stimulating factor (G-CSF) was an effective treatment for most of the SCN patients and prevented life-threatening bacterial infections.

Targeted cancer exome sequencing reveals recurrent mutations in myeloproliferative neoplasms

PubMed Central

Tenedini, E; Bernardis, I; Artusi, V; Artuso, L; Roncaglia, E; Guglielmelli, P; Pieri, L; Bogani, C; Biamonte, F; Rotunno, G; Mannarelli, C; Bianchi, E; Pancrazzi, A; Fanelli, T; Malagoli Tagliazucchi, G; Ferrari, S; Manfredini, R; Vannucchi, A M; Tagliafico, E

2014-01-01

With the intent of dissecting the molecular complexity of Philadelphia-negative myeloproliferative neoplasms (MPN), we designed a target enrichment panel to explore, using next-generation sequencing (NGS), the mutational status of an extensive list of 2000 cancer-associated genes and microRNAs. The genomic DNA of granulocytes and in vitro-expanded CD3+T-lymphocytes, as a germline control, was target-enriched and sequenced in a learning cohort of 20 MPN patients using Roche 454 technology. We identified 141 genuine somatic mutations, most of which were not previously described. To test the frequency of the identified variants, a larger validation cohort of 189 MPN patients was additionally screened for these mutations using Ion Torrent AmpliSeq NGS. Excluding the genes already described in MPN, for 8 genes (SCRIB, MIR662, BARD1, TCF12, FAT4, DAP3, POLG and NRAS), we demonstrated a mutation frequency between 3 and 8%. We also found that mutations at codon 12 of NRAS (NRASG12V and NRASG12D) were significantly associated, for primary myelofibrosis (PMF), with highest dynamic international prognostic scoring system (DIPSS)-plus score categories. This association was then confirmed in 66 additional PMF patients composing a final dataset of 168 PMF showing a NRAS mutation frequency of 4.7%, which was associated with a worse outcome, as defined by the DIPSS plus score. PMID:24150215

[The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

PubMed

Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

2014-12-01

To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

MUBII-TB-DB: a database of mutations associated with antibiotic resistance in Mycobacterium tuberculosis.

PubMed

Flandrois, Jean-Pierre; Lina, Gérard; Dumitrescu, Oana

2014-04-14

Tuberculosis is an infectious bacterial disease caused by Mycobacterium tuberculosis. It remains a major health threat, killing over one million people every year worldwide. An early antibiotic therapy is the basis of the treatment, and the emergence and spread of multidrug and extensively drug-resistant mutant strains raise significant challenges. As these bacteria grow very slowly, drug resistance mutations are currently detected using molecular biology techniques. Resistance mutations are identified by sequencing the resistance-linked genes followed by a comparison with the literature data. The only online database is the TB Drug Resistance Mutation database (TBDReaM database); however, it requires mutation detection before use, and its interrogation is complex due to its loose syntax and grammar. The MUBII-TB-DB database is a simple, highly structured text-based database that contains a set of Mycobacterium tuberculosis mutations (DNA and proteins) occurring at seven loci: rpoB, pncA, katG; mabA(fabG1)-inhA, gyrA, gyrB, and rrs. Resistance mutation data were extracted after the systematic review of MEDLINE referenced publications before March 2013. MUBII analyzes the query sequence obtained by PCR-sequencing using two parallel strategies: i) a BLAST search against a set of previously reconstructed mutated sequences and ii) the alignment of the query sequences (DNA and its protein translation) with the wild-type sequences. The post-treatment includes the extraction of the aligned sequences together with their descriptors (position and nature of mutations). The whole procedure is performed using the internet. The results are graphs (alignments) and text (description of the mutation, therapeutic significance). The system is quick and easy to use, even for technicians without bioinformatics training. MUBII-TB-DB is a structured database of the mutations occurring at seven loci of major therapeutic value in tuberculosis management. Moreover, the system provides interpretation of the mutations in biological and therapeutic terms and can evolve by the addition of newly described mutations. Its goal is to provide easy and comprehensive access through a client-server model over the Web to an up-to-date database of mutations that lead to the resistance of M. tuberculosis to antibiotics.

Exome sequencing reveals FAM20c mutations associated with fibroblast growth factor 23-related hypophosphatemia, dental anomalies, and ectopic calcification.

PubMed

Rafaelsen, Silje Hjorth; Raeder, Helge; Fagerheim, Anne Kristine; Knappskog, Per; Carpenter, Thomas O; Johansson, Stefan; Bjerknes, Robert

2013-06-01

Fibroblast growth factor 23 (FGF23) plays a crucial role in renal phosphate regulation, exemplified by the causal role of PHEX and DMP1 mutations in X-linked hypophosphatemic rickets and autosomal recessive rickets type 1, respectively. Using whole exome sequencing we identified compound heterozygous mutations in family with sequence similarity 20, member C (FAM20C) in two siblings referred for hypophosphatemia and severe dental demineralization disease. FAM20C mutations were not found in other undiagnosed probands of a national Norwegian population of familial hypophosphatemia. Our results demonstrate that mutations in FAM20C provide a putative new mechanism in human subjects leading to dysregulated FGF23 levels, hypophosphatemia, hyperphosphaturia, dental anomalies, intracerebral calcifications and osteosclerosis of the long bones in the absence of rickets. Copyright © 2013 American Society for Bone and Mineral Research.

Spectrum of mutations in leiomyosarcomas identified by clinical targeted next-generation sequencing.

PubMed

Lee, Paul J; Yoo, Naomi S; Hagemann, Ian S; Pfeifer, John D; Cottrell, Catherine E; Abel, Haley J; Duncavage, Eric J

2017-02-01

Recurrent genomic mutations in uterine and non-uterine leiomyosarcomas have not been well established. Using a next generation sequencing (NGS) panel of common cancer-associated genes, 25 leiomyosarcomas arising from multiple sites were examined to explore genetic alterations, including single nucleotide variants (SNV), small insertions/deletions (indels), and copy number alterations (CNA). Sequencing showed 86 non-synonymous, coding region somatic variants within 151 gene targets in 21 cases, with a mean of 4.1 variants per case; 4 cases had no putative mutations in the panel of genes assayed. The most frequently altered genes were TP53 (36%), ATM and ATRX (16%), and EGFR and RB1 (12%). CNA were identified in 85% of cases, with the most frequent copy number losses observed in chromosomes 10 and 13 including PTEN and RB1; the most frequent gains were seen in chromosomes 7 and 17. Our data show that deletions in canonical cancer-related genes are common in leiomyosarcomas. Further, the spectrum of gene mutations observed shows that defects in DNA repair and chromosomal maintenance are central to the biology of leiomyosarcomas, and that activating mutations observed in other common cancer types are rare in leiomyosarcomas. Copyright © 2017 Elsevier Inc. All rights reserved.

GNE missense mutation in recessive familial amyotrophic lateral sclerosis.

PubMed

Köroğlu, Çiğdem; Yılmaz, Rezzak; Sorgun, Mine Hayriye; Solakoğlu, Seyhun; Şener, Özden

2017-12-01

Amyotrophic lateral sclerosis (ALS) is a motor neuron disease eventually leading to death from respiratory failure. Recessive inheritance is very rare. Here, we describe the clinical findings in a consanguineous family with five men afflicted with recessive ALS and the identification of the homozygous mutation responsible for the disorder. The onset of the disease ranged from 12 to 35 years of age, with variable disease progressions. We performed clinical investigations including metabolic and paraneoplastic screening, cranial and cervical imaging, and electrophysiology. We mapped the disease gene to 9p21.1-p12 with a LOD score of 5.2 via linkage mapping using genotype data for single-nucleotide polymorphism markers and performed exome sequence analysis to identify the disease-causing gene variant. We also Sanger sequenced all coding sequences of SIGMAR1, a gene reported as responsible for juvenile ALS in a family. We did not find any mutation in SIGMAR1. Instead, we identified a novel homozygous missense mutation p.(His705Arg) in GNE which was predicted as damaging by online tools. GNE has been associated with inclusion body myopathy and is expressed in many tissues. We propose that the GNE mutation underlies the pathology in the family.

Identification of a Novel Missense FBN2 Mutation in a Chinese Family with Congenital Contractural Arachnodactyly Using Exome Sequencing

PubMed Central

Deng, Hao; Lu, Qian; Xu, Hongbo; Deng, Xiong; Yuan, Lamei; Yang, Zhijian; Guo, Yi; Lin, Qiongfen; Xiao, Jingjing; Guan, Liping; Song, Zhi

2016-01-01

Congenital contractural arachnodactyly (CCA, OMIM 121050), also known as Beals-Hecht syndrome, is an autosomal dominant disorder of connective tissue. CCA is characterized by arachnodactyly, dolichostenomelia, pectus deformities, kyphoscoliosis, congenital contractures and a crumpled appearance of the helix of the ear. The aim of this study is to identify the genetic cause of a 4-generation Chinese family of Tujia ethnicity with congenital contractural arachnodactyly by exome sequencing. The clinical features of patients in this family are consistent with CCA. A novel missense mutation, c.3769T>C (p.C1257R), in the fibrillin 2 gene (FBN2) was identified responsible for the genetic cause of our family with CCA. The p.C1257R mutation occurs in the 19th calcium-binding epidermal growth factor-like (cbEGF) domain. The amino acid residue cysteine in this domain is conserved among different species. Our findings suggest that exome sequencing is a powerful tool to discover mutation(s) in CCA. Our results may also provide new insights into the cause and diagnosis of CCA, and may have implications for genetic counseling and clinical management. PMID:27196565

Identification of three novel mutations by studying the molecular genetics of Maple Syrup Urine Disease (MSUD) in the Lebanese population.

PubMed

Tabbouche, Omar; Saker, Amer; Mountain, Harry

2014-01-01

Maple Syrup Urine Disease (MSUD) is a genetically heterogeneous metabolic disorder that is transmitted in an autosomal recessive manner. According to clinical data, MSUD prevalence in Lebanon is expected to be higher than the International prevalence because of consanguineous marriage. Novel mutations are still getting detected by using DNA sequencing for mutation analysis in MSUD patients. In the current study, we have extracted DNA from Lebanese MSUD patients in order to amplify the exonic and flanking intronic regions of the genes implicated in MSUD ( BCKDHA , BCKDHB , and DBT ) and sequenced the resultant amplified products to assess the molecular genetics of MSUD in the Lebanese population studied. All of the mutations identified occurred in the homozygous state, which reflects the high rate of consanguineous marriage in Lebanon. In the current study, we have identified one previously cited mutation and three novel mutations not previously described in the scientific literature. The identified mutations were distributed as follows: three patients (60%) had two nucleotide substitutions in the DBT gene (c.224G>A and c.1430T>G), one patient (20%) had a gross deletion in the BCKDHA gene (c.488_1167+3del), and one patient (20%) had a small deletion in the BCKDHB gene (c.92_102del). The majority of the mutations identified in the Lebanese MSUD patients occurred in the DBT gene. Consanguineous marriage is a major risk factor for the prevalence of MSUD in Lebanon.

Cancer-Associated Mutations in Endometriosis without Cancer

PubMed Central

Anglesio, M.S.; Papadopoulos, N.; Ayhan, A.; Nazeran, T.M.; Noë, M.; Horlings, H.M.; Lum, A.; Jones, S.; Senz, J.; Seckin, T.; Ho, J.; Wu, R.-C.; Lac, V.; Ogawa, H.; Tessier-Cloutier, B.; Alhassan, R.; Wang, A.; Wang, Y.; Cohen, J.D.; Wong, F.; Hasanovic, A.; Orr, N.; Zhang, M.; Popoli, M.; McMahon, W.; Wood, L.D.; Mattox, A.; Allaire, C.; Segars, J.; Williams, C.; Tomasetti, C.; Boyd, N.; Kinzler, K.W.; Gilks, C.B.; Diaz, L.; Wang, T.-L.; Vogelstein, B.; Yong, P.J.; Huntsman, D.G.; Shih, I.-M.

2017-01-01

BACKGROUND Endometriosis, defined as the presence of ectopic endometrial stroma and epithelium, affects approximately 10% of reproductive-age women and can cause pelvic pain and infertility. Endometriotic lesions are considered to be benign inflammatory lesions but have cancerlike features such as local invasion and resistance to apoptosis. METHODS We analyzed deeply infiltrating endometriotic lesions from 27 patients by means of exomewide sequencing (24 patients) or cancer-driver targeted sequencing (3 patients). Mutations were validated with the use of digital genomic methods in micro-dissected epithelium and stroma. Epithelial and stromal components of lesions from an additional 12 patients were analyzed by means of a droplet digital polymerase-chain-reaction (PCR) assay for recurrent activating KRAS mutations. RESULTS Exome sequencing revealed somatic mutations in 19 of 24 patients (79%). Five patients harbored known cancer driver mutations in ARID1A, PIK3CA, KRAS, or PPP2R1A, which were validated by Safe-Sequencing System or immunohistochemical analysis. The likelihood of driver genes being affected at this rate in the absence of selection was estimated at P = 0.001 (binomial test). Targeted sequencing and a droplet digital PCR assay identified KRAS mutations in 2 of 3 patients and 3 of 12 patients, respectively, with mutations in the epithelium but not the stroma. One patient harbored two different KRAS mutations, c.35G→T and c.35G→C, and another carried identical KRAS c.35G→A mutations in three distinct lesions. CONCLUSIONS We found that lesions in deep infiltrating endometriosis, which are associated with virtually no risk of malignant transformation, harbor somatic cancer driver mutations. Ten of 39 deep infiltrating lesions (26%) carried driver mutations; all the tested somatic mutations appeared to be confined to the epithelial compartment of endometriotic lesions. PMID:28489996

Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krauthammer, Michael; Kong, Yong; Ha, Byung Hak

We characterized the mutational landscape of melanoma, the form of skin cancer with the highest mortality rate, by sequencing the exomes of 147 melanomas. Sun-exposed melanomas had markedly more ultraviolet (UV)-like C>T somatic mutations compared to sun-shielded acral, mucosal and uveal melanomas. Among the newly identified cancer genes was PPP6C, encoding a serine/threonine phosphatase, which harbored mutations that clustered in the active site in 12% of sun-exposed melanomas, exclusively in tumors with mutations in BRAF or NRAS. Notably, we identified a recurrent UV-signature, an activating mutation in RAC1 in 9.2% of sun-exposed melanomas. This activating mutation, the third most frequentmore » in our cohort of sun-exposed melanoma after those of BRAF and NRAS, changes Pro29 to serine (RAC1{sup P29S}) in the highly conserved switch I domain. Crystal structures, and biochemical and functional studies of RAC1{sup P29S} showed that the alteration releases the conformational restraint conferred by the conserved proline, causes an increased binding of the protein to downstream effectors, and promotes melanocyte proliferation and migration. These findings raise the possibility that pharmacological inhibition of downstream effectors of RAC1 signaling could be of therapeutic benefit.« less

CREBBP mutations in relapsed acute lymphoblastic leukaemia

PubMed Central

Mullighan, Charles G.; Zhang, Jinghui; Kasper, Lawryn H.; Lerach, Stephanie; Payne-Turner, Debbie; Phillips, Letha A.; Heatley, Sue L.; Holmfeldt, Linda; Collins-Underwood, J. Racquel; Ma, Jing; Buetow, Kenneth H.; Pui, Ching-Hon; Baker, Sharyn D.; Brindle, Paul K.; Downing, James R.

2010-01-01

Relapsed acute lymphoblastic leukaemia (ALL) is a leading cause of death due to disease in young people, but the biologic determinants of treatment failure remain poorly understood. Recent genome-wide profiling of structural DNA alterations in ALL have identified multiple submicroscopic somatic mutations targeting key cellular pathways1,2, and have demonstrated substantial evolution in genetic alterations from diagnosis to relapse3. However, detailed analysis of sequence mutations in ALL has not been performed. To identify novel mutations in relapsed ALL, we resequenced 300 genes in matched diagnosis and relapse samples from 23 patients with ALL. This identified 52 somatic non-synonymous mutations in 32 genes, many of which were novel, including the transcriptional coactivators CREBBP and NCOR1, the transcription factors ERG, SPI1, TCF4 and TCF7L2, components of the Ras signalling pathway, histone genes, genes involved in histone modification (CREBBP and CTCF), and genes previously shown to be targets of recurring DNA copy number alteration in ALL. Analysis of an extended cohort of 71 diagnosis-relapse cases and 270 acute leukaemia cases that did not relapse found that 18.3% of relapse cases had sequence or deletion mutations of CREBBP, which encodes the transcriptional coactivator and histone acetyltransferase (HAT) CREB-binding protein (CBP)4. The mutations were either present at diagnosis or acquired at relapse, and resulted in truncated alleles or deleterious substitutions in conserved residues of the HAT domain. Functionally, the mutations impaired histone acetylation and transcriptional regulation of CREBBP targets, including glucocorticoid responsive genes. Several mutations acquired at relapse were detected in subclones at diagnosis, suggesting that the mutations may confer resistance to therapy. These results extend the landscape of genetic alterations in leukaemia, and identify mutations targeting transcriptional and epigenetic regulation as a mechanism of resistance in ALL. PMID:21390130

PEST domain mutations in Notch receptors comprise an oncogenic driver segment in triple-negative breast cancer sensitive to a γ-secretase inhibitor.

PubMed

Wang, Kai; Zhang, Qin; Li, Danan; Ching, Keith; Zhang, Cathy; Zheng, Xianxian; Ozeck, Mark; Shi, Stephanie; Li, Xiaorong; Wang, Hui; Rejto, Paul; Christensen, James; Olson, Peter

2015-03-15

To identify and characterize novel, activating mutations in Notch receptors in breast cancer and to determine response to the gamma secretase inhibitor (GSI) PF-03084014. We used several computational approaches, including novel algorithms, to analyze next-generation sequencing data and related omic datasets from The Cancer Genome Atlas (TCGA) breast cancer cohort. Patient-derived xenograft (PDX) models were sequenced, and Notch-mutant models were treated with PF-03084014. Gene-expression and functional analyses were performed to study the mechanism of activation through mutation and inhibition by PF-03084014. We identified mutations within and upstream of the PEST domains of NOTCH1, NOTCH2, and NOTCH3 in the TCGA dataset. Mutations occurred via several genetic mechanisms and compromised the function of the PEST domain, a negative regulatory domain commonly mutated in other cancers. Focal amplifications of NOTCH2 and NOTCH3 were also observed, as were heterodimerization or extracellular domain mutations at lower incidence. Mutations and amplifications often activated the Notch pathway as evidenced by increased expression of canonical Notch target genes, and functional mutations were significantly enriched in the triple-negative breast cancer subtype (TNBC). PDX models were also identified that harbored PEST domain mutations, and these models were highly sensitive to PF-03084014. This work suggests that Notch-altered breast cancer constitutes a bona fide oncogenic driver segment with the most common alteration being PEST domain mutations present in multiple Notch receptors. Importantly, functional studies suggest that this newly identified class can be targeted with Notch inhibitors, including GSIs. ©2015 American Association for Cancer Research.

The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.

PubMed

Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena

2015-11-01

Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.

Incorporating molecular and functional context into the analysis and prioritization of human variants associated with cancer

PubMed Central

Peterson, Thomas A; Nehrt, Nathan L; Park, DoHwan

2012-01-01

Background and objective With recent breakthroughs in high-throughput sequencing, identifying deleterious mutations is one of the key challenges for personalized medicine. At the gene and protein level, it has proven difficult to determine the impact of previously unknown variants. A statistical method has been developed to assess the significance of disease mutation clusters on protein domains by incorporating domain functional annotations to assist in the functional characterization of novel variants. Methods Disease mutations aggregated from multiple databases were mapped to domains, and were classified as either cancer- or non-cancer-related. The statistical method for identifying significantly disease-associated domain positions was applied to both sets of mutations and to randomly generated mutation sets for comparison. To leverage the known function of protein domain regions, the method optionally distributes significant scores to associated functional feature positions. Results Most disease mutations are localized within protein domains and display a tendency to cluster at individual domain positions. The method identified significant disease mutation hotspots in both the cancer and non-cancer datasets. The domain significance scores (DS-scores) for cancer form a bimodal distribution with hotspots in oncogenes forming a second peak at higher DS-scores than non-cancer, and hotspots in tumor suppressors have scores more similar to non-cancers. In addition, on an independent mutation benchmarking set, the DS-score method identified mutations known to alter protein function with very high precision. Conclusion By aggregating mutations with known disease association at the domain level, the method was able to discover domain positions enriched with multiple occurrences of deleterious mutations while incorporating relevant functional annotations. The method can be incorporated into translational bioinformatics tools to characterize rare and novel variants within large-scale sequencing studies. PMID:22319177

Identification of novel mutations and sequence variants in the SOX2 and CHX10 genes in patients with anophthalmia/microphthalmia

PubMed Central

Zhou, Jie; Kherani, Femida; Bardakjian, Tanya M.; Katowitz, James; Hughes, Nkecha; Schimmenti, Lisa A.; Schneider, Adele

2008-01-01

Purpose Mutations in the SOX2 and CHX10 genes have been reported in patients with anophthalmia and/or microphthalmia. In this study, we evaluated 34 anophthalmic/microphthalmic patient DNA samples (two sets of siblings included) for mutations and sequence variants in SOX2 and CHX10. Methods Conformational sensitive gel electrophoresis (CSGE) was used for the initial SOX2 and CHX10 screening of 34 affected individuals (two sets of siblings), five unaffected family members, and 80 healthy controls. Patient samples containing heteroduplexes were selected for sequence analysis. Base pair changes in SOX2 and CHX10 were confirmed by sequencing bidirectionally in patient samples. Results Two novel heterozygous mutations and two sequence variants (one known) in SOX2 were identified in this cohort. Mutation c.310 G>T (p. Glu104X), found in one patient, was in the region encoding the high mobility group (HMG) DNA-binding domain and resulted in a change from glutamic acid to a stop codon. The second mutation, noted in two affected siblings, was a single nucleotide deletion c.549delC (p. Pro184ArgfsX19) in the region encoding the activation domain, resulting in a frameshift and premature termination of the coding sequence. The shortened protein products may result in the loss of function. In addition, a novel nucleotide substitution c.*557G>A was identified in the 3′-untranslated region in one patient. The relationship between the nucleotide change and the protein function is indeterminate. A known single nucleotide polymorphism (c. *469 C>A, SNP rs11915160) was also detected in 2 of the 34 patients. Screening of CHX10 identified two synonymous sequence variants, c.471 C>T (p.Ser157Ser, rs35435463) and c.579 G>A (p. Gln193Gln, novel SNP), and one non-synonymous sequence variant, c.871 G>A (p. Asp291Asn, novel SNP). The non-synonymous polymorphism was also present in healthy controls, suggesting non-causality. Conclusions These results support the role of SOX2 in ocular development. Loss of SOX2 function results in severe eye malformation. CHX10 was not implicated with microphthalmia/anophthalmia in our patient cohort. PMID:18385794

A deep intronic CLRN1 (USH3A) founder mutation generates an aberrant exon and underlies severe Usher syndrome on the Arabian Peninsula.

PubMed

Khan, Arif O; Becirovic, Elvir; Betz, Christian; Neuhaus, Christine; Altmüller, Janine; Maria Riedmayr, Lisa; Motameny, Susanne; Nürnberg, Gudrun; Nürnberg, Peter; Bolz, Hanno J

2017-05-03

Deafblindness is mostly due to Usher syndrome caused by recessive mutations in the known genes. Mutation-negative patients therefore either have distinct diseases, mutations in yet unknown Usher genes or in extra-exonic parts of the known genes - to date a largely unexplored possibility. In a consanguineous Saudi family segregating Usher syndrome type 1 (USH1), NGS of genes for Usher syndrome, deafness and retinal dystrophy and subsequent whole-exome sequencing each failed to identify a mutation. Genome-wide linkage analysis revealed two small candidate regions on chromosome 3, one containing the USH3A gene CLRN1, which has never been associated with Usher syndrome in Saudi Arabia. Whole-genome sequencing (WGS) identified a homozygous deep intronic mutation, c.254-649T > G, predicted to generate a novel donor splice site. CLRN1 minigene-based analysis confirmed the splicing of an aberrant exon due to usage of this novel motif, resulting in a frameshift and a premature termination codon. We identified this mutation in an additional two of seven unrelated mutation-negative Saudi USH1 patients. Locus-specific markers indicated that c.254-649T > G CLRN1 represents a founder allele that may significantly contribute to deafblindness in this population. Our finding underlines the potential of WGS to uncover atypically localized, hidden mutations in patients who lack exonic mutations in the known disease genes.

Targeted sequencing identifies associations between IL7R-JAK mutations and epigenetic modulators in T-cell acute lymphoblastic leukemia

PubMed Central

Vicente, Carmen; Schwab, Claire; Broux, Michaël; Geerdens, Ellen; Degryse, Sandrine; Demeyer, Sofie; Lahortiga, Idoya; Elliott, Alannah; Chilton, Lucy; La Starza, Roberta; Mecucci, Cristina; Vandenberghe, Peter; Goulden, Nicholas; Vora, Ajay; Moorman, Anthony V.; Soulier, Jean; Harrison, Christine J.; Clappier, Emmanuelle; Cools, Jan

2015-01-01

T-cell acute lymphoblastic leukemia is caused by the accumulation of multiple oncogenic lesions, including chromosomal rearrangements and mutations. To determine the frequency and co-occurrence of mutations in T-cell acute lymphoblastic leukemia, we performed targeted re-sequencing of 115 genes across 155 diagnostic samples (44 adult and 111 childhood cases). NOTCH1 and CDKN2A/B were mutated/deleted in more than half of the cases, while an additional 37 genes were mutated/deleted in 4% to 20% of cases. We found that IL7R-JAK pathway genes were mutated in 27.7% of cases, with JAK3 mutations being the most frequent event in this group. Copy number variations were also detected, including deletions of CREBBP or CTCF and duplication of MYB. FLT3 mutations were rare, but a novel extracellular mutation in FLT3 was detected and confirmed to be transforming. Furthermore, we identified complex patterns of pairwise associations, including a significant association between mutations in IL7R-JAK genes and epigenetic regulators (WT1, PRC2, PHF6). Our analyses showed that IL7R-JAK genetic lesions did not confer adverse prognosis in T-cell acute lymphoblastic leukemia cases enrolled in the UK ALL2003 trial. Overall, these results identify interconnections between the T-cell acute lymphoblastic leukemia genome and disease biology, and suggest a potential clinical application for JAK inhibitors in a significant proportion of patients with T-cell acute lymphoblastic leukemia. PMID:26206799

SQSTM1 mutations in French patients with frontotemporal dementia or frontotemporal dementia with amyotrophic lateral sclerosis.

PubMed

Le Ber, Isabelle; Camuzat, Agnès; Guerreiro, Rita; Bouya-Ahmed, Kawtar; Bras, Jose; Nicolas, Gael; Gabelle, Audrey; Didic, Mira; De Septenville, Anne; Millecamps, Stéphanie; Lenglet, Timothée; Latouche, Morwena; Kabashi, Edor; Campion, Dominique; Hannequin, Didier; Hardy, John; Brice, Alexis

2013-11-01

Mutations in the SQSTM1 gene, coding for p62, are a cause of Paget disease of bone and amyotrophic lateral sclerosis (ALS). Recently, SQSTM1 mutations were confirmed in ALS, and mutations were also identified in 3 patients with frontotemporal dementia (FTD), suggesting a role for SQSTM1 in FTD. To evaluate the exact contribution of SQSTM1 to FTD and FTD with ALS (FTD-ALS) in an independent cohort of patients. A SQSTM1 mutation was first identified in a multiplex family with FTD by use of whole-exome sequencing. To evaluate the frequency of SQSTM1 mutations, we sequenced this gene in a cohort of patients with FTD or FTD-ALS, with no mutations in known FTD and ALS genes. Primary care or referral center. An overall cohort of 188 French patients, including 132 probands with FTD and 56 probands with FTD-ALS. Frequency of SQSTM1 mutations in patients with FTD or FTD-ALS; description of associated phenotypes. We identified 4 heterozygous missense mutations in 4 unrelated families with FTD; only 1 family had clinical symptoms of Paget disease of bone, and only 1 family had clinical symptoms of FTD-ALS, possibly owing to the low penetrance of some of the clinical manifestations. Although the frequency of the mutations is low in our series (4 of 188 patients [2%]), our results, similar to those already reported, support a direct pathogenic role of p62 in different types of FTD.

Familial Cortical Myoclonus with a Mutation in NOL3

PubMed Central

Russell, Jonathan F.; Steckley, Jamie L.; Coppola, Giovanni; Hahn, Angelika F.G.; Howard, MacKenzie A.; Kornberg, Zachary; Huang, Alden; Mirsattari, Seyed M.; Merriman, Barry; Klein, Eric; Choi, Murim; Lee, Hsien-Yang; Kirk, Andrew; Nelson-Williams, Carol; Gibson, Gillian; Baraban, Scott C.; Lifton, Richard P.; Geschwind, Daniel H.; Fu, Ying-Hui; Ptáček, Louis J.

2012-01-01

Objective Myoclonus is characterized by sudden, brief involuntary movements and its presence is debilitating. We identified a family suffering from adult-onset, cortical myoclonus without associated seizures. We performed clinical, electrophysiological, and genetic studies to define this phenotype. Methods A large, four-generation family with history of myoclonus underwent careful questioning, examination, and electrophysiological testing. Thirty-five family members donated blood samples for genetic analysis, which included SNP mapping, microsatellite linkage, targeted massively parallel sequencing, and Sanger sequencing. In silico and in vitro experiments were performed to investigate functional significance of the mutation. Results We identified 11 members of a Canadian Mennonite family suffering from adult-onset, slowly progressive, disabling, multifocal myoclonus. Somatosensory evoked potentials indicated a cortical origin of the myoclonus. There were no associated seizures. Some severely affected individuals developed signs of progressive cerebellar ataxia of variable severity late in the course of their illness. The phenotype was inherited in an autosomal dominant fashion. We demonstrated linkage to chromosome 16q21-22.1. We then sequenced all coding sequence in the critical region, identifying only a single co-segregating, novel, nonsynonymous mutation, which resides in the gene NOL3. Furthermore, this mutation was found to alter post-translational modification of NOL3 protein in vitro. Interpretation We propose that Familial Cortical Myoclonus (FCM) is a novel movement disorder that may be caused by mutation in NOL3. Further investigation of the role of NOL3 in neuronal physiology may shed light on neuronal membrane hyperexcitability and pathophysiology of myoclonus and related disorders. PMID:22926851

Identification of a novel NHS mutation in a Chinese family with Nance-Horan syndrome.

PubMed

Li, Aijun; Li, Bingzhen; Wu, Lemeng; Yang, Liping; Chen, Ningning; Ma, Zhizhong

2015-04-01

To identiy the disease causing mutation in a Chinese family presenting with early-onset cataract and dental anomalies. A specific Hereditary Eye Disease Enrichment Panel (HEDEP) (personalized customization by MyGenostics, Baltimore, MD) based on targeted exome capture technology was used to collect the protein coding regions of 30 early-onset cataract associated genes, and high throughput sequencing was done with Illumina HiSeq 2000 platform. The identified variant was confirmed with Sanger sequencing. A novel deletion in exon 4 (c.852delG) of NHS gene was identified; the identified 1 bp deletion altered the reading frame and was predicted to result in a premature stop codon after the addition of twelve novel amino acid (p.S285PfsX13). This mutation co-segregated in affected males and obligate female carriers, but was absent in 100 matched controls. Our findings broaden the spectrum of NHS mutations causing Nance-Horan syndrome and phenotypic spectrum of the disease in Chinese patients.

Recurrent somatic alterations of FGFR1 and NTRK2 in pilocytic astrocytoma

PubMed Central

Jones, David T.W.; Hutter, Barbara; Jäger, Natalie; Korshunov, Andrey; Kool, Marcel; Warnatz, Hans-Jörg; Zichner, Thomas; Lambert, Sally R.; Ryzhova, Marina; Quang, Dong Anh Khuong; Fontebasso, Adam M.; Stütz, Adrian M.; Hutter, Sonja; Zuckermann, Marc; Sturm, Dominik; Gronych, Jan; Lasitschka, Bärbel; Schmidt, Sabine; Şeker-Cin, Huriye; Witt, Hendrik; Sultan, Marc; Ralser, Meryem; Northcott, Paul A.; Hovestadt, Volker; Bender, Sebastian; Pfaff, Elke; Stark, Sebastian; Faury, Damien; Schwartzentruber, Jeremy; Majewski, Jacek; Weber, Ursula D.; Zapatka, Marc; Raeder, Benjamin; Schlesner, Matthias; Worth, Catherine L.; Bartholomae, Cynthia C.; von Kalle, Christof; Imbusch, Charles D.; Radomski, Sylwester; Lawerenz, Chris; van Sluis, Peter; Koster, Jan; Volckmann, Richard; Versteeg, Rogier; Lehrach, Hans; Monoranu, Camelia; Winkler, Beate; Unterberg, Andreas; Herold-Mende, Christel; Milde, Till; Kulozik, Andreas E.; Ebinger, Martin; Schuhmann, Martin U.; Cho, Yoon-Jae; Pomeroy, Scott L.; von Deimling, Andreas; Witt, Olaf; Taylor, Michael D.; Wolf, Stephan; Karajannis, Matthias A.; Eberhart, Charles G.; Scheurlen, Wolfram; Hasselblatt, Martin; Ligon, Keith L.; Kieran, Mark W.; Korbel, Jan O.; Yaspo, Marie-Laure; Brors, Benedikt; Felsberg, Jörg; Reifenberger, Guido; Collins, V. Peter; Jabado, Nada; Eils, Roland; Lichter, Peter; Pfister, Stefan M.

2014-01-01

Pilocytic astrocytoma, the most common childhood brain tumor1, is typically associated with mitogen-activated protein kinase (MAPK) pathway alterations2. Surgically inaccessible midline tumors are therapeutically challenging, showing sustained tendency for progression3 and often becoming a chronic disease with substantial morbidities4. Here we describe whole-genome sequencing of 96 pilocytic astrocytomas, with matched RNA sequencing (n=73), conducted by the International Cancer Genome Consortium (ICGC) PedBrain Tumor Project. We identified recurrent activating mutations in FGFR1 and PTPN11 and novel NTRK2 fusion genes in non-cerebellar tumors. New BRAF activating changes were also observed. MAPK pathway alterations affected 100% of tumors analyzed, with no other significant mutations, indicating pilocytic astrocytoma as predominantly a single-pathway disease. Notably, we identified the same FGFR1 mutations in a subset of H3F3A-mutated pediatric glioblastoma with additional alterations in NF15. Our findings thus identify new potential therapeutic targets in distinct subsets of pilocytic astrocytoma and childhood glioblastoma. PMID:23817572

SigniSite: Identification of residue-level genotype-phenotype correlations in protein multiple sequence alignments.

PubMed

Jessen, Leon Eyrich; Hoof, Ilka; Lund, Ole; Nielsen, Morten

2013-07-01

Identifying which mutation(s) within a given genotype is responsible for an observable phenotype is important in many aspects of molecular biology. Here, we present SigniSite, an online application for subgroup-free residue-level genotype-phenotype correlation. In contrast to similar methods, SigniSite does not require any pre-definition of subgroups or binary classification. Input is a set of protein sequences where each sequence has an associated real number, quantifying a given phenotype. SigniSite will then identify which amino acid residues are significantly associated with the data set phenotype. As output, SigniSite displays a sequence logo, depicting the strength of the phenotype association of each residue and a heat-map identifying 'hot' or 'cold' regions. SigniSite was benchmarked against SPEER, a state-of-the-art method for the prediction of specificity determining positions (SDP) using a set of human immunodeficiency virus protease-inhibitor genotype-phenotype data and corresponding resistance mutation scores from the Stanford University HIV Drug Resistance Database, and a data set of protein families with experimentally annotated SDPs. For both data sets, SigniSite was found to outperform SPEER. SigniSite is available at: http://www.cbs.dtu.dk/services/SigniSite/.

Personalized genomic analyses for cancer mutation discovery and interpretation

PubMed Central

Jones, Siân; Anagnostou, Valsamo; Lytle, Karli; Parpart-Li, Sonya; Nesselbush, Monica; Riley, David R.; Shukla, Manish; Chesnick, Bryan; Kadan, Maura; Papp, Eniko; Galens, Kevin G.; Murphy, Derek; Zhang, Theresa; Kann, Lisa; Sausen, Mark; Angiuoli, Samuel V.; Diaz, Luis A.; Velculescu, Victor E.

2015-01-01

Massively parallel sequencing approaches are beginning to be used clinically to characterize individual patient tumors and to select therapies based on the identified mutations. A major question in these analyses is the extent to which these methods identify clinically actionable alterations and whether the examination of the tumor tissue alone is sufficient or whether matched normal DNA should also be analyzed to accurately identify tumor-specific (somatic) alterations. To address these issues, we comprehensively evaluated 815 tumor-normal paired samples from patients of 15 tumor types. We identified genomic alterations using next-generation sequencing of whole exomes or 111 targeted genes that were validated with sensitivities >95% and >99%, respectively, and specificities >99.99%. These analyses revealed an average of 140 and 4.3 somatic mutations per exome and targeted analysis, respectively. More than 75% of cases had somatic alterations in genes associated with known therapies or current clinical trials. Analyses of matched normal DNA identified germline alterations in cancer-predisposing genes in 3% of patients with apparently sporadic cancers. In contrast, a tumor-only sequencing approach could not definitively identify germline changes in cancer-predisposing genes and led to additional false-positive findings comprising 31% and 65% of alterations identified in targeted and exome analyses, respectively, including in potentially actionable genes. These data suggest that matched tumor-normal sequencing analyses are essential for precise identification and interpretation of somatic and germline alterations and have important implications for the diagnostic and therapeutic management of cancer patients. PMID:25877891

Identification of HIV Mutation as Diagnostic Biomarker through Next Generation Sequencing.

PubMed

Shaw, Wen Hui; Lin, Qianqian; Muhammad, Zikry Zhiwei Bin Roslee; Lee, Jia Jun; Khong, Wei Xin; Ng, Oon Tek; Tan, Eng Lee; Li, Peng

2016-07-01

Current clinical detection of Human immunodeficiency virus 1 (HIV-1) is used to target viral genes and proteins. However, the immunoassay, such as viral culture or Polymerase Chain Reaction (PCR), lacks accuracy in the diagnosis, as these conventional assays rely on the stable genome and HIV-1 is a highly-mutated virus. Next generation sequencing (NGS) promises to be transformative for the practice of infectious disease, and the rapidly reducing cost and processing time mean that this will become a feasible technology in diagnostic and research laboratories in the near future. The technology offers the superior sensitivity to detect the pathogenic viruses, including unknown and unexpected strains. To leverage the NGS technology in order to improve current HIV-1 diagnosis and genotyping methods. Ten blood samples were collected from HIV-1 infected patients which were diagnosed by RT PCR at Singapore Communicable Disease Centre, Tan Tock Seng Hospital from October 2014 to March 2015. Viral RNAs were extracted from blood plasma and reversed into cDNA. The HIV-1 cDNA samples were cleaned up using a PCR purification kit and the sequencing library was prepared and identified through MiSeq. Two common mutations were observed in all ten samples. The common mutations were identified at genome locations 1908 and 2104 as missense and silent mutations respectively, conferring S37N and S3S found on aspartic protease and reverse transcriptase subunits. The common mutations identified in this study were not previously reported, therefore suggesting the potential for them to be used for identification of viral infection, disease transmission and drug resistance. This was especially the case for, missense mutation S37N which could cause an amino acid change in viral proteases thus reducing the binding affinity of some protease inhibitors. Thus, the unique common mutations identified in this study could be used as diagnostic biomarkers to indicate the origin of infection as being from Singapore.

Biochip-Based Detection of KRAS Mutation in Non-Small Cell Lung Cancer

PubMed Central

Kriegshäuser, Gernot; Fabjani, Gerhild; Ziegler, Barbara; Zöchbauer-Müller, Sabine; End, Adelheid; Zeillinger, Robert

2011-01-01

This study is aimed at evaluating the potential of a biochip assay to sensitively detect KRAS mutation in DNA from non-small cell lung cancer (NSCLC) tissue samples. The assay covers 10 mutations in codons 12 and 13 of the KRAS gene, and is based on mutant-enriched PCR followed by reverse-hybridization of biotinylated amplification products to an array of sequence-specific probes immobilized on the tip of a rectangular plastic stick (biochip). Biochip hybridization identified 17 (21%) samples to carry a KRAS mutation of which 16 (33%) were adenocarcinomas and 1 (3%) was a squamous cell carcinoma. All mutations were confirmed by DNA sequencing. Using 10 ng of starting DNA, the biochip assay demonstrated a detection limit of 1% mutant sequence in a background of wild-type DNA. Our results suggest that the biochip assay is a sensitive alternative to protocols currently in use for KRAS mutation testing on limited quantity samples. PMID:22272089

Mutation allele burden remains unchanged in chronic myelomonocytic leukaemia responding to hypomethylating agents

DOE PAGES

Merlevede, Jane; Droin, Nathalie; Qin, Tingting; ...

2016-02-24

The cytidine analogues azacytidine and 5-aza-2’-deoxycytidine (decitabine) are commonly used to treat myelodysplastic syndromes, with or without a myeloproliferative component. It remains unclear whether the response to these hypomethylating agents results from a cytotoxic or an epigenetic effect. In this study, we address this question in chronic myelomonocytic leukaemia. We describe a comprehensive analysis of the mutational landscape of these tumours, combining whole-exome and whole-genome sequencing. We identify an average of 14 ± 5 somatic mutations in coding sequences of sorted monocyte DNA and the signatures of three mutational processes. Serial sequencing demonstrates that the response to hypomethylating agents ismore » associated with changes in DNA methylation and gene expression, without any decrease in the mutation allele burden, nor prevention of new genetic alteration occurence. Lastly, our findings indicate that cytosine analogues restore a balanced haematopoiesis without decreasing the size of the mutated clone, arguing for a predominantly epigenetic effect.« less

Homozygous nonsense mutation in SGCA is a common cause of limb-girdle muscular dystrophy in Assiut, Egypt.

PubMed

Reddy, Hemakumar M; Hamed, Sherifa A; Lek, Monkol; Mitsuhashi, Satomi; Estrella, Elicia; Jones, Michael D; Mahoney, Lane J; Duncan, Anna R; Cho, Kyung-Ah; Macarthur, Daniel G; Kunkel, Louis M; Kang, Peter B

2016-10-01

The genetic causes of limb-girdle muscular dystrophy (LGMD) have been studied in numerous countries, but such investigations have been limited in Egypt. A cohort of 30 families with suspected LGMD from Assiut, Egypt, was studied using immunohistochemistry, homozygosity mapping, Sanger sequencing, and whole exome sequencing. Six families were confirmed to have pathogenic mutations, 4 in SGCA and 2 in DMD. Of these, 3 families harbored a single nonsense mutation in SGCA, suggesting that this may be a common mutation in Assiut, Egypt, originating from a founder effect. The Assiut region in Egypt appears to share at least several of the common LGMD genes found in other parts of the world. It is notable that 4 of the 6 mutations were ascertained by means of whole exome sequencing, even though it was the last approach adopted. This illustrates the power of this technique for identifying causative mutations for muscular dystrophies. Muscle Nerve 54: 690-695, 2016. © 2016 Wiley Periodicals, Inc.

Mutation allele burden remains unchanged in chronic myelomonocytic leukaemia responding to hypomethylating agents

PubMed Central

Merlevede, Jane; Droin, Nathalie; Qin, Tingting; Meldi, Kristen; Yoshida, Kenichi; Morabito, Margot; Chautard, Emilie; Auboeuf, Didier; Fenaux, Pierre; Braun, Thorsten; Itzykson, Raphael; de Botton, Stéphane; Quesnel, Bruno; Commes, Thérèse; Jourdan, Eric; Vainchenker, William; Bernard, Olivier; Pata-Merci, Noemie; Solier, Stéphanie; Gayevskiy, Velimir; Dinger, Marcel E.; Cowley, Mark J.; Selimoglu-Buet, Dorothée; Meyer, Vincent; Artiguenave, François; Deleuze, Jean-François; Preudhomme, Claude; Stratton, Michael R.; Alexandrov, Ludmil B.; Padron, Eric; Ogawa, Seishi; Koscielny, Serge; Figueroa, Maria; Solary, Eric

2016-01-01

The cytidine analogues azacytidine and 5-aza-2'-deoxycytidine (decitabine) are commonly used to treat myelodysplastic syndromes, with or without a myeloproliferative component. It remains unclear whether the response to these hypomethylating agents results from a cytotoxic or an epigenetic effect. In this study, we address this question in chronic myelomonocytic leukaemia. We describe a comprehensive analysis of the mutational landscape of these tumours, combining whole-exome and whole-genome sequencing. We identify an average of 14±5 somatic mutations in coding sequences of sorted monocyte DNA and the signatures of three mutational processes. Serial sequencing demonstrates that the response to hypomethylating agents is associated with changes in DNA methylation and gene expression, without any decrease in the mutation allele burden, nor prevention of new genetic alteration occurence. Our findings indicate that cytosine analogues restore a balanced haematopoiesis without decreasing the size of the mutated clone, arguing for a predominantly epigenetic effect. PMID:26908133

IRS2 mutations linked to invasion in pleomorphic invasive lobular carcinoma

PubMed Central

Zhu, Sha; Ward, B. Marie; Yu, Jun; Matthew-Onabanjo, Asia N.; Janusis, Jenny; Hsieh, Chung-Cheng; Tomaszewicz, Keith; Hutchinson, Lloyd; Zhu, Lihua Julie; Kandil, Dina; Shaw, Leslie M.

2018-01-01

Pleomorphic invasive lobular carcinoma (PILC) is an aggressive variant of invasive lobular breast cancer that is associated with poor clinical outcomes. Limited molecular data are available to explain the mechanistic basis for PILC behavior. To address this issue, targeted sequencing was performed to identify molecular alterations that define PILC. This sequencing analysis identified genes that distinguish PILC from classic ILC and invasive ductal carcinoma by the incidence of their genomic changes. In particular, insulin receptor substrate 2 (IRS2) is recurrently mutated in PILC, and pathway analysis reveals a role for the insulin receptor (IR)/insulin-like growth factor-1 receptor (IGF1R)/IRS2 signaling pathway in PILC. IRS2 mutations identified in PILC enhance invasion, revealing a role for this signaling adaptor in the aggressive nature of PILC. PMID:29669935

Germline Mutations in PALB2, BRCA1, and RAD51C, Which Regulate DNA Recombination Repair, in Patients With Gastric Cancer.

PubMed

Sahasrabudhe, Ruta; Lott, Paul; Bohorquez, Mabel; Toal, Ted; Estrada, Ana P; Suarez, John J; Brea-Fernández, Alejandro; Cameselle-Teijeiro, José; Pinto, Carla; Ramos, Irma; Mantilla, Alejandra; Prieto, Rodrigo; Corvalan, Alejandro; Norero, Enrique; Alvarez, Carolina; Tapia, Teresa; Carvallo, Pilar; Gonzalez, Luz M; Cock-Rada, Alicia; Solano, Angela; Neffa, Florencia; Della Valle, Adriana; Yau, Chris; Soares, Gabriela; Borowsky, Alexander; Hu, Nan; He, Li-Ji; Han, Xiao-You; Taylor, Philip R; Goldstein, Alisa M; Torres, Javier; Echeverry, Magdalena; Ruiz-Ponte, Clara; Teixeira, Manuel R; Carvajal-Carmona, Luis G

2017-04-01

Up to 10% of cases of gastric cancer are familial, but so far, only mutations in CDH1 have been associated with gastric cancer risk. To identify genetic variants that affect risk for gastric cancer, we collected blood samples from 28 patients with hereditary diffuse gastric cancer (HDGC) not associated with mutations in CDH1 and performed whole-exome sequence analysis. We then analyzed sequences of candidate genes in 333 independent HDGC and non-HDGC cases. We identified 11 cases with mutations in PALB2, BRCA1, or RAD51C genes, which regulate homologous DNA recombination. We found these mutations in 2 of 31 patients with HDGC (6.5%) and 9 of 331 patients with sporadic gastric cancer (2.8%). Most of these mutations had been previously associated with other types of tumors and partially co-segregated with gastric cancer in our study. Tumors that developed in patients with these mutations had a mutation signature associated with somatic homologous recombination deficiency. Our findings indicate that defects in homologous recombination increase risk for gastric cancer. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

Novel GABRG2 mutations cause familial febrile seizures

PubMed Central

Boillot, Morgane; Morin-Brureau, Mélanie; Picard, Fabienne; Weckhuysen, Sarah; Lambrecq, Virginie; Minetti, Carlo; Striano, Pasquale; Zara, Federico; Iacomino, Michele; Ishida, Saeko; An-Gourfinkel, Isabelle; Daniau, Mailys; Hardies, Katia; Baulac, Michel; Dulac, Olivier; Leguern, Eric; Nabbout, Rima

2015-01-01

Objective: To identify the genetic cause in a large family with febrile seizures (FS) and temporal lobe epilepsy (TLE) and subsequently search for additional mutations in a cohort of 107 families with FS, with or without epilepsy. Methods: The cohort consisted of 1 large family with FS and TLE, 64 smaller French families recruited through a national French campaign, and 43 Italian families. Molecular analyses consisted of whole-exome sequencing and mutational screening. Results: Exome sequencing revealed a p.Glu402fs*3 mutation in the γ2 subunit of the GABAA receptor gene (GABRG2) in the large family with FS and TLE. Three additional nonsense and frameshift GABRG2 mutations (p.Arg136*, p.Val462fs*33, and p.Pro59fs*12), 1 missense mutation (p.Met199Val), and 1 exonic deletion were subsequently identified in 5 families of the follow-up cohort. Conclusions: We report GABRG2 mutations in 5.6% (6/108) of families with FS, with or without associated epilepsy. This study provides evidence that GABRG2 mutations are linked to the FS phenotype, rather than epilepsy, and that loss-of-function of GABAA receptor γ2 subunit is the probable underlying pathogenic mechanism. PMID:27066572

A novel mutation of the Keratin 12 gene responsible for a severe phenotype of Meesmann's corneal dystrophy

PubMed Central

Sullivan, Lori S.; Baylin, Eric B.; Font, Ramon; Daiger, Stephen P.; Pepose, Jay S.; Clinch, Thomas E.; Nakamura, Hisashi; Zhao, Xinping C.

2007-01-01

Purpose To determine if a mutation within the coding region of the keratin 12 gene (KRT12) is responsible for a severe form of Meesmann's corneal dystrophy. Methods A family with clinically identified Meesmann's corneal dystrophy was recruited and studied. Electron microscopy was performed on scrapings of corneal epithelial cells from the proband. Mutations in the KRT12 gene were sought using direct genomic sequencing of leukocyte DNA from two affected and two unaffected family members. Subsequently, the observed mutation was screened in all available family members using polymerase chain reaction and direct sequencing. Results A heterozygous missense mutation (Arg430Pro) was found in exon 6 of KRT12 in all 14 affected individuals studied. Unaffected family members and 100 normal controls were negative for this mutation. Conclusions We have identified a novel mutation in the KRT12 gene that is associated with a symptomatic phenotype of Meesmann's corneal dystrophy. This mutation results in a substitution of proline for arginine in the helix termination motif that may disrupt the normal helix, leading to a dramatic structural change of the keratin 12 protein. PMID:17653038

Novel GABRG2 mutations cause familial febrile seizures.

PubMed

Boillot, Morgane; Morin-Brureau, Mélanie; Picard, Fabienne; Weckhuysen, Sarah; Lambrecq, Virginie; Minetti, Carlo; Striano, Pasquale; Zara, Federico; Iacomino, Michele; Ishida, Saeko; An-Gourfinkel, Isabelle; Daniau, Mailys; Hardies, Katia; Baulac, Michel; Dulac, Olivier; Leguern, Eric; Nabbout, Rima; Baulac, Stéphanie

2015-12-01

To identify the genetic cause in a large family with febrile seizures (FS) and temporal lobe epilepsy (TLE) and subsequently search for additional mutations in a cohort of 107 families with FS, with or without epilepsy. The cohort consisted of 1 large family with FS and TLE, 64 smaller French families recruited through a national French campaign, and 43 Italian families. Molecular analyses consisted of whole-exome sequencing and mutational screening. Exome sequencing revealed a p.Glu402fs*3 mutation in the γ2 subunit of the GABAA receptor gene (GABRG2) in the large family with FS and TLE. Three additional nonsense and frameshift GABRG2 mutations (p.Arg136*, p.Val462fs*33, and p.Pro59fs*12), 1 missense mutation (p.Met199Val), and 1 exonic deletion were subsequently identified in 5 families of the follow-up cohort. We report GABRG2 mutations in 5.6% (6/108) of families with FS, with or without associated epilepsy. This study provides evidence that GABRG2 mutations are linked to the FS phenotype, rather than epilepsy, and that loss-of-function of GABAA receptor γ2 subunit is the probable underlying pathogenic mechanism.

Bioinformatics analysis and genetic diversity of the poliovirus.

PubMed

Liu, Yanhan; Ma, Tengfei; Liu, Jianzhu; Zhao, Xiaona; Cheng, Ziqiang; Guo, Huijun; Wang, Shujing; Xu, Ruixue

2014-12-01

Poliomyelitis, a disease which can manifest as muscle paralysis, is caused by the poliovirus, which is a human enterovirus and member of the family Picornaviridae that usually transmits by the faecal-oral route. The viruses of the OPV (oral poliovirus attenuated-live vaccine) strains can mutate in the human intestine during replication and some of these mutations can lead to the recovery of serious neurovirulence. Informatics research of the poliovirus genome can be used to explain further the characteristics of this virus. In this study, sequences from 100 poliovirus isolates were acquired from GenBank. To determine the evolutionary relationship between the strains, we compared and analysed the sequences of the complete poliovirus genome and the VP1 region. The reconstructed phylogenetic trees for the complete sequences and the VP1 sequences were both divided into two branches, indicating that the genetic relationships of the whole poliovirus genome and the VP1 sequences are very similar. This branching indicates that the virulence and pathogenicity of poliomyelitis may be associated with the VP1 region. Sequence alignment of the VP1 region revealed numerous mutation sites in which mutation rates of >30 % were detected. In a group of strains recorded in the USA, mutation sites and mutation types were the same and this may be associated with their distribution in the evolutionary tree and their genetic relationship. In conclusion, the genetic evolutionary relationships of poliovirus isolate sequences are determined to a great extent by the VP1 protein, and poliovirus strains located on the same branch of the phylogenetic tree contain the same mutation spots and mutation types. Hence, the genetic characteristics of the VP1 region in the poliovirus genome should be analysed to identify the transmission route of poliovirus and provide the basis of viral immunity development. © 2014 The Authors.

Screening Mutations of MYBPC3 in 114 Unrelated Patients with Hypertrophic Cardiomyopathy by Targeted Capture and Next-generation Sequencing.

PubMed

Liu, Xuxia; Jiang, Tengyong; Piao, Chunmei; Li, Xiaoyan; Guo, Jun; Zheng, Shuai; Zhang, Xiaoping; Cai, Tao; Du, Jie

2015-06-19

Hypertrophic cardiomyopathy (HCM) is a major cause of sudden cardiac death. Mutations in the MYBPC3 gene represent the cause of HCM in ~35% of patients with HCM. However, genetic testing in clinic setting has been limited due to the cost and relatively time-consuming by Sanger sequencing. Here, we developed a HCM Molecular Diagnostic Kit enabling ultra-low-cost targeted gene resequencing in a large cohort and investigated the mutation spectrum of MYBPC3. In a cohort of 114 patients with HCM, a total of 20 different mutations (8 novel and 12 known mutations) of MYBPC3 were identified from 25 patients (21.9%). We demonstrated that the power of targeted resequencing in a cohort of HCM patients, and found that MYBPC3 is a common HCM-causing gene in Chinese patients. Phenotype-genotype analyses showed that the patients with double mutations (n = 2) or premature termination codon mutations (n = 12) showed more severe manifestations, compared with patients with missense mutations (n = 11). Particularly, we identified a recurrent truncation mutation (p.Y842X) in four unrelated cases (4/25, 16%), who showed severe phenotypes, and suggest that the p.Y842X is a frequent mutation in Chinese HCM patients with severe phenotypes.

Loss of function mutations in RPL27 and RPS27 identified by whole-exome sequencing in Diamond-Blackfan anaemia.

PubMed

Wang, RuNan; Yoshida, Kenichi; Toki, Tsutomu; Sawada, Takafumi; Uechi, Tamayo; Okuno, Yusuke; Sato-Otsubo, Aiko; Kudo, Kazuko; Kamimaki, Isamu; Kanezaki, Rika; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Terui, Kiminori; Sato, Tomohiko; Iribe, Yuji; Ohga, Shouichi; Kuramitsu, Madoka; Hamaguchi, Isao; Ohara, Akira; Hara, Junichi; Goi, Kumiko; Matsubara, Kousaku; Koike, Kenichi; Ishiguro, Akira; Okamoto, Yasuhiro; Watanabe, Kenichiro; Kanno, Hitoshi; Kojima, Seiji; Miyano, Satoru; Kenmochi, Naoya; Ogawa, Seishi; Ito, Etsuro

2015-03-01

Diamond-Blackfan anaemia is a congenital bone marrow failure syndrome that is characterized by red blood cell aplasia. The disease has been associated with mutations or large deletions in 11 ribosomal protein genes including RPS7, RPS10, RPS17, RPS19, RPS24, RPS26, RPS29, RPL5, RPL11, RPL26 and RPL35A as well as GATA1 in more than 50% of patients. However, the molecular aetiology of many Diamond-Blackfan anaemia cases remains to be uncovered. To identify new mutations responsible for Diamond-Blackfan anaemia, we performed whole-exome sequencing analysis of 48 patients with no documented mutations/deletions involving known Diamond-Blackfan anaemia genes except for RPS7, RPL26, RPS29 and GATA1. Here, we identified a de novo splicing error mutation in RPL27 and frameshift deletion in RPS27 in sporadic patients with Diamond-Blackfan anaemia. In vitro knockdown of gene expression disturbed pre-ribosomal RNA processing. Zebrafish models of rpl27 and rps27 mutations showed impairments of erythrocyte production and tail and/or brain development. Additional novel mutations were found in eight patients, including RPL3L, RPL6, RPL7L1T, RPL8, RPL13, RPL14, RPL18A and RPL31. In conclusion, we identified novel germline mutations of two ribosomal protein genes responsible for Diamond-Blackfan anaemia, further confirming the concept that mutations in ribosomal protein genes lead to Diamond-Blackfan anaemia. © 2014 John Wiley & Sons Ltd.

Brief Report: "SETD2" Mutation in a Child with Autism, Intellectual Disabilities and Epilepsy

ERIC Educational Resources Information Center

Lumish, Heidi S.; Wynn, Julia; Devinsky, Orrin; Chung, Wendy K.

2015-01-01

Whole exome sequencing (WES) has been utilized with increasing frequency to identify mutations underlying rare diseases. Autism spectrum disorders (ASD) and intellectual disability (ID) are genetically heterogeneous, and novel genes for these disorders are rapidly being identified, making these disorders ideal candidates for WES. Here we report a…

Identification of novel point mutations in splicing sites integrating whole-exome and RNA-seq data in myeloproliferative diseases

PubMed Central

Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo

2013-01-01

Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC3 (NM_003786.3:c.1783-1G>A), KLHDC1 (NM_172193.1:c.568-2A>G), HOOK1 (NM_015888.4:c.1662-1G>A), SMAD9 (NM_001127217.2:c.1004-1C>T), and DNAH9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC3, HOOK1. In ABCC3 and HOOK1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4–6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis. PMID:24498620

Identifying structural variation in haploid microbial genomes from short-read resequencing data using breseq.

PubMed

Barrick, Jeffrey E; Colburn, Geoffrey; Deatherage, Daniel E; Traverse, Charles C; Strand, Matthew D; Borges, Jordan J; Knoester, David B; Reba, Aaron; Meyer, Austin G

2014-11-29

Mutations that alter chromosomal structure play critical roles in evolution and disease, including in the origin of new lifestyles and pathogenic traits in microbes. Large-scale rearrangements in genomes are often mediated by recombination events involving new or existing copies of mobile genetic elements, recently duplicated genes, or other repetitive sequences. Most current software programs for predicting structural variation from short-read DNA resequencing data are intended primarily for use on human genomes. They typically disregard information in reads mapping to repeat sequences, and significant post-processing and manual examination of their output is often required to rule out false-positive predictions and precisely describe mutational events. We have implemented an algorithm for identifying structural variation from DNA resequencing data as part of the breseq computational pipeline for predicting mutations in haploid microbial genomes. Our method evaluates the support for new sequence junctions present in a clonal sample from split-read alignments to a reference genome, including matches to repeat sequences. Then, it uses a statistical model of read coverage evenness to accept or reject these predictions. Finally, breseq combines predictions of new junctions and deleted chromosomal regions to output biologically relevant descriptions of mutations and their effects on genes. We demonstrate the performance of breseq on simulated Escherichia coli genomes with deletions generating unique breakpoint sequences, new insertions of mobile genetic elements, and deletions mediated by mobile elements. Then, we reanalyze data from an E. coli K-12 mutation accumulation evolution experiment in which structural variation was not previously identified. Transposon insertions and large-scale chromosomal changes detected by breseq account for ~25% of spontaneous mutations in this strain. In all cases, we find that breseq is able to reliably predict structural variation with modest read-depth coverage of the reference genome (>40-fold). Using breseq to predict structural variation should be useful for studies of microbial epidemiology, experimental evolution, synthetic biology, and genetics when a reference genome for a closely related strain is available. In these cases, breseq can discover mutations that may be responsible for important or unintended changes in genomes that might otherwise go undetected.

A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.

PubMed

Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

2007-04-17

The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.

A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice

PubMed Central

Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, HongBin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

2007-01-01

Background The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia. PMID:17439653

Exome Sequencing Identifies Truncating Mutations in Human SERPINF1 in Autosomal-Recessive Osteogenesis Imperfecta

PubMed Central

Becker, Jutta; Semler, Oliver; Gilissen, Christian; Li, Yun; Bolz, Hanno Jörn; Giunta, Cecilia; Bergmann, Carsten; Rohrbach, Marianne; Koerber, Friederike; Zimmermann, Katharina; de Vries, Petra; Wirth, Brunhilde; Schoenau, Eckhard; Wollnik, Bernd; Veltman, Joris A.; Hoischen, Alexander; Netzer, Christian

2011-01-01

Osteogenesis imperfecta (OI) is a heterogeneous genetic disorder characterized by bone fragility and susceptibility to fractures after minimal trauma. After mutations in all known OI genes had been excluded by Sanger sequencing, we applied next-generation sequencing to analyze the exome of a single individual who has a severe form of the disease and whose parents are second cousins. A total of 26,922 variations from the human reference genome sequence were subjected to several filtering steps. In addition, we extracted the genotypes of all dbSNP130-annotated SNPs from the exome sequencing data and used these 299,494 genotypes as markers for the genome-wide identification of homozygous regions. A single homozygous truncating mutation, affecting SERPINF1 on chromosome 17p13.3, that was embedded into a homozygous stretch of 2.99 Mb remained. The mutation was also homozygous in the affected brother of the index patient. Subsequently, we identified homozygosity for two different truncating SERPINF1 mutations in two unrelated patients with OI and parental consanguinity. All four individuals with SERPINF1 mutations have severe OI. Fractures of long bones and severe vertebral compression fractures with resulting deformities were observed as early as the first year of life in these individuals. Collagen analyses with cultured dermal fibroblasts displayed no evidence for impaired collagen folding, posttranslational modification, or secretion. SERPINF1 encodes pigment epithelium-derived factor (PEDF), a secreted glycoprotein of the serpin superfamily. PEDF is a multifunctional protein and one of the strongest inhibitors of angiogenesis currently known in humans. Our data provide genetic evidence for PEDF involvement in human bone homeostasis. PMID:21353196

Short communication: novel truncating mutations in the CFTR gene causing a severe form of cystic fibrosis in Italian patients.

PubMed

Lenarduzzi, S; Morgutti, M; Crovella, S; Coiana, A; Rosatelli, M C

2014-11-14

Cystic fibrosis (CF) is a common recessive genetic disease caused by mutations in the gene encoding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein. More than 1800 different mutations have been described to date. Here, we report 3 novel mutations in CFTR in 3 Italian CF patients. To detect and identify 36 frequent mutations in Caucasians, we used the INNO-LiPA CFTR19 and INNO-LiPA CFTR17+Tn Update kits (Innogenetics; Ghent, Belgium). Our first analysis did not reveal both of the responsible mutations; thus, direct sequencing of the CFTR gene coding region was performed. The 3 patients were compound heterozygous. In one allele, the F508del (c.1521_1523delCTT, p.PHE508del) mutation in exon 11 was observed in each case. For the second allele, in patient No.1, direct sequencing revealed an 11-base pair deletion (GAGGCGATACT) in exon 14 (c.2236_2246del; pGlu746Alafs*29). In patient No. 2, direct sequencing revealed a nonsense mutation at nucleotide 3892 (c.3892G>T) in exon 24. In patient No. 3, direct sequencing revealed a deletion of cytosine in exon 27 (c.4296delC; p.Asn1432Lysfs*16). These 3 novel mutations indicate the production of a truncated protein, which consequently results in a non-functional polypeptide.

Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.

PubMed

Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A

2018-05-14

The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.

Whole-genome sequencing for comparative genomics and de novo genome assembly.

PubMed

Benjak, Andrej; Sala, Claudia; Hartkoorn, Ruben C

2015-01-01

Next-generation sequencing technologies for whole-genome sequencing of mycobacteria are rapidly becoming an attractive alternative to more traditional sequencing methods. In particular this technology is proving useful for genome-wide identification of mutations in mycobacteria (comparative genomics) as well as for de novo assembly of whole genomes. Next-generation sequencing however generates a vast quantity of data that can only be transformed into a usable and comprehensible form using bioinformatics. Here we describe the methodology one would use to prepare libraries for whole-genome sequencing, and the basic bioinformatics to identify mutations in a genome following Illumina HiSeq or MiSeq sequencing, as well as de novo genome assembly following sequencing using Pacific Biosciences (PacBio).

Study of base pair mutations in proline-rich homeodomain (PRH)-DNA complexes using molecular dynamics.

PubMed

Jalili, Seifollah; Karami, Leila; Schofield, Jeremy

2013-06-01

Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.

Maturity onset diabetes of youth (MODY) in Turkish children: sequence analysis of 11 causative genes by next generation sequencing.

PubMed

Ağladıoğlu, Sebahat Yılmaz; Aycan, Zehra; Çetinkaya, Semra; Baş, Veysel Nijat; Önder, Aşan; Peltek Kendirci, Havva Nur; Doğan, Haldun; Ceylaner, Serdar

2016-04-01

Maturity-onset diabetes of the youth (MODY), is a genetically and clinically heterogeneous group of diseasesand is often misdiagnosed as type 1 or type 2 diabetes. The aim of this study is to investigate both novel and proven mutations of 11 MODY genes in Turkish children by using targeted next generation sequencing. A panel of 11 MODY genes were screened in 43 children with MODY diagnosed by clinical criterias. Studies of index cases was done with MISEQ-ILLUMINA, and family screenings and confirmation studies of mutations was done by Sanger sequencing. We identified 28 (65%) point mutations among 43 patients. Eighteen patients have GCK mutations, four have HNF1A, one has HNF4A, one has HNF1B, two have NEUROD1, one has PDX1 gene variations and one patient has both HNF1A and HNF4A heterozygote mutations. This is the first study including molecular studies of 11 MODY genes in Turkish children. GCK is the most frequent type of MODY in our study population. Very high frequency of novel mutations (42%) in our study population, supports that in heterogenous disorders like MODY sequence analysis provides rapid, cost effective and accurate genetic diagnosis.

Mutational Analysis of Extranodal NK/T-Cell Lymphoma Using Targeted Sequencing with a Comprehensive Cancer Panel.

PubMed

Choi, Seungkyu; Go, Jai Hyang; Kim, Eun Kyung; Lee, Hojung; Lee, Won Mi; Cho, Chun-Sung; Han, Kyudong

2016-09-01

Extranodal natural killer (NK)/T-cell lymphoma, nasal type (NKTCL), is a malignant disorder of cytotoxic lymphocytes of NK or T cells. It is an aggressive neoplasm with a very poor prognosis. Although extranodal NKTCL reportedly has a strong association with Epstein-Barr virus, the molecular pathogenesis of NKTCL has been unexplored. The recent technological advancements in next-generation sequencing (NGS) have made DNA sequencing cost- and time-effective, with more reliable results. Using the Ion Proton Comprehensive Cancer Panel, we sequenced 409 cancer-related genes to identify somatic mutations in five NKTCL tissue samples. The sequencing analysis detected 25 mutations in 21 genes. Among them, KMT2D , a histone modification-related gene, was the most frequently mutated gene (four of the five cases). This result was consistent with recent NGS studies that have suggested KMT2D as a novel driver gene in NKTCL. Mutations were also found in ARID1A , a chromatin remodeling gene, and TP53 , which also recurred in recent NGS studies. We also found mutations in 18 novel candidate genes, with molecular functions that were potentially implicated in cancer development. We suggest that these genes may result in multiple oncogenic events and may be used as potential bio-markers of NKTCL in the future.

Recurrent TERT promoter mutations identified in a large-scale study of multiple tumour types are associated with increased TERT expression and telomerase activation.

PubMed

Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H; Yang, Rui; Killela, Patrick J; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Liang, Junbo; Wang, Sizhen; Jiao, Yuchen; Yan, Hai; Tao, Hou-Quan

2015-05-01

Several somatic mutation hotspots were recently identified in the telomerase reverse transcriptase (TERT) promoter region in human cancers. Large scale studies of these mutations in multiple tumour types are limited, in particular in Asian populations. This study aimed to: analyse TERT promoter mutations in multiple tumour types in a large Chinese patient cohort, investigate novel tumour types and assess the functional significance of the mutations. TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumour types and 799 tumour tissues from Chinese cancer patients. Thymic epithelial tumours, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR), telomerase activity by the telomeric repeat amplification protocol (TRAP) assay and promoter activity by the luciferase reporter assay. TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%) and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in gastrointestinal stromal tumour (GIST), thymic epithelial tumours, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. TERT promoter mutations are frequent in multiple tumour types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumourigenesis, making them potential therapeutic targets. Copyright © 2015 Elsevier Ltd. All rights reserved.

Recurrent TERT promoter mutations identified in a large-scale study of multiple tumor types are associated with increased TERT expression and telomerase activation

PubMed Central

Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H.; Yang, Rui; Killela, Patrick J.; Liang, Junbo; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Wang, Si-Zhen; Jiao, Yu-Chen; Yan, Hai; Tao, Hou-Quan

2015-01-01

Background Several somatic mutation hotspots were recently identified in the TERT promoter region in human cancers. Large scale studies of these mutations in multiple tumor types are limited, in particular in Asian populations. This study aimed to: analyze TERT promoter mutations in multiple tumor types in a large Chinese patient cohort, investigate novel tumor types and assess the functional significance of the mutations. Methods TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumor types and 799 tumor tissues from Chinese cancer patients. Thymic epithelial tumors, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by RT-qPCR, telomerase activity by the TRAP assay, and promoter activity by the luciferase reporter assay. Results TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%), and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in GIST, thymic epithelial tumors, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. Conclusions TERT promoter mutations are frequent in multiple tumor types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumorigenesis, making them potential therapeutic targets. PMID:25843513

Natural and Unanticipated Modifiers of RNAi Activity in Caenorhabditis elegans

PubMed Central

Asad, Nadeem; Aw, Wen Yih; Timmons, Lisa

2012-01-01

Organisms used as model genomics systems are maintained as isogenic strains, yet evidence of sequence differences between independently maintained wild-type stocks has been substantiated by whole-genome resequencing data and strain-specific phenotypes. Sequence differences may arise from replication errors, transposon mobilization, meiotic gene conversion, or environmental or chemical assault on the genome. Low frequency alleles or mutations with modest effects on phenotypes can contribute to natural variation, and it has proven possible for such sequences to become fixed by adapted evolutionary enrichment and identified by resequencing. Our objective was to identify and analyze single locus genetic defects leading to RNAi resistance in isogenic strains of Caenorhabditis elegans. In so doing, we uncovered a mutation that arose de novo in an existing strain, which initially frustrated our phenotypic analysis. We also report experimental, environmental, and genetic conditions that can complicate phenotypic analysis of RNAi pathway defects. These observations highlight the potential for unanticipated mutations, coupled with genetic and environmental phenomena, to enhance or suppress the effects of known mutations and cause variation between wild-type strains. PMID:23209671

Efficient mutation identification in zebrafish by microarray capturing and next generation sequencing.

PubMed

Bontems, Franck; Baerlocher, Loic; Mehenni, Sabrina; Bahechar, Ilham; Farinelli, Laurent; Dosch, Roland

2011-02-18

Fish models like medaka, stickleback or zebrafish provide a valuable resource to study vertebrate genes. However, finding genetic variants e.g. mutations in the genome is still arduous. Here we used a combination of microarray capturing and next generation sequencing to identify the affected gene in the mozartkugelp11cv (mzlp11cv) mutant zebrafish. We discovered a 31-bp deletion in macf1 demonstrating the potential of this technique to efficiently isolate mutations in a vertebrate genome. Copyright © 2011 Elsevier Inc. All rights reserved.

Targeted sequencing identifies 91 neurodevelopmental disorder risk genes with autism and developmental disability biases

PubMed Central

Stessman, Holly A. F.; Xiong, Bo; Coe, Bradley P.; Wang, Tianyun; Hoekzema, Kendra; Fenckova, Michaela; Kvarnung, Malin; Gerdts, Jennifer; Trinh, Sandy; Cosemans, Nele; Vives, Laura; Lin, Janice; Turner, Tychele N.; Santen, Gijs; Ruivenkamp, Claudia; Kriek, Marjolein; van Haeringen, Arie; Aten, Emmelien; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Haan, Eric; Shaw, Marie; Gecz, Jozef; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Schwartz, Charles; Kooy, R. Frank; Vandeweyer, Geert; Helsmoortel, Celine; Romano, Corrado; Alberti, Antonino; Vinci, Mirella; Avola, Emanuela; Giusto, Stefania; Courchesne, Eric; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Amaral, David; Scheffer, Ingrid E.; Delatycki, Martin B.; Lockhart, Paul J.; Hormozdiari, Fereydoun; Harich, Benjamin; Castells-Nobau, Anna; Xia, Kun; Peeters, Hilde; Nordenskjöld, Magnus; Schenck, Annette; Bernier, Raphael A.; Eichler, Evan E.

2017-01-01

Gene-disruptive mutations contribute to the biology of neurodevelopmental disorders (NDDs), but most pathogenic genes are not known. We sequenced 208 candidate genes from >11,730 patients and >2,867 controls. We report 91 genes with an excess of de novo mutations or private disruptive mutations in 5.7% of patients, including 38 novel NDD genes. Drosophila functional assays of a subset bolster their involvement in NDDs. We identify 25 genes that show a bias for autism versus intellectual disability and highlight a network associated with high-functioning autism (FSIQ>100). Clinical follow-up for NAA15, KMT5B, and ASH1L reveals novel syndromic and non-syndromic forms of disease. PMID:28191889

Intragenic SNP haplotypes associated with 84dup18 mutation in TNFRSF11A in four FEO pedigrees suggest three independent origins for this mutation.

PubMed

Elahi, Elahe; Shafaghati, Yousef; Asadi, Sareh; Absalan, Farnaz; Goodarzi, Hani; Gharaii, Nava; Karimi-Nejad, Mohammad Hassan; Shahram, Farhad; Hughes, Anne E

2007-01-01

Familial expansile osteolysis (FEO) is a rare disorder causing bone dysplasia. The clinical features of FEO include early-onset hearing loss, tooth destruction, and progressive lytic expansion within limb bones causing pain, fracture, and deformity. An 18-bp duplication in the first exon of the TNFRSF11A gene encoding RANK has been previously identified in four FEO pedigrees. Despite having the identical mutation, phenotypic variations among affected individuals of the same and different pedigrees were noted. Another 18-bp duplication, one base proximal to the duplication previously reported, was subsequently found in two unrelated FEO patients. Finally, mutations overlapping with the mutations found in the FEO pedigrees have been found in ESH and early-onset PDB pedigrees. An Iranian FEO pedigree that contains six affected individuals dispersed in three generations has previously been introduced; here, the clinical features of the proband are reported in greater detail, and the genetic defect of the pedigree is presented. Direct sequencing of the entire coding region and upstream and downstream noncoding regions of TNFRSF11A in her DNA revealed the same 18-bp duplication mutation as previously found in the four FEO pedigrees. Additionally, eight sequence variations as compared to the TNFRSF11A reference sequence were identified, and a haplotype linked to the mutation based on these variations was defined. Although the mutation in the Iranian and four of the previously described FEO pedigrees was the same, haplotypes based on the intragenic SNPs suggest that the mutations do not share a common descent.

Molecular genetics of Leber congenital amaurosis in Chinese: New data from 66 probands and mutation overview of 159 probands.

PubMed

Xu, Yan; Xiao, Xueshan; Li, Shiqiang; Jia, Xiaoyun; Xin, Wei; Wang, Panfeng; Sun, Wenmin; Huang, Li; Guo, Xiangming; Zhang, Qingjiong

2016-08-01

Leber congenital amaurosis (LCA) is the most severe form of inherited retinal dystrophy. We have previously performed a mutational analysis of the known LCA-associated genes in probands with LCA by both Sanger and whole exome sequencing. In this study, whole exome sequencing was carried out on 66 new probabds with LCA. In conjunction with these data, the present study provides a comprehensive analysis of the spectrum and frequency of all known genes associated with retinal dystrophy in a total of 159 Chinese probands with LCA. The known genes responsible for all forms hereditary retinal dystrophy were included based on information from RetNet. The candidate variants were filtered by bioinformatics analysis and confirmed by Sanger sequencing. Potentially causative mutations were further validated in available family members. Overall, a total of 118 putative pathogenic mutations from 23 genes were identified in 56.6% (90/159) of probands. These mutations were harbored in 13 LCA-associated genes and in ten genes related to other forms of retinal dystrophy. The most frequently mutated gene in probands with LCA was GUCY2D (10.7%, 17/159). A series of mutational analyses suggests that all known genes associated with retinal dystrophy account for 56.6% of Chinese patients with LCA. A comprehensive molecular genetic analysis of Chinese patients with LCA provides an overview of the spectrum and frequency of ethno-specific mutations of all known genes, as well as indications about other unknown genes in the remaining probands who lacked identified mutations. Copyright © 2016 Elsevier Ltd. All rights reserved.

Fragment analysis represents a suitable approach for the detection of hotspot c.7541_7542delCT NOTCH1 mutation in chronic lymphocytic leukemia.

PubMed

Vavrova, Eva; Kantorova, Barbara; Vonkova, Barbara; Kabathova, Jitka; Skuhrova-Francova, Hana; Diviskova, Eva; Letocha, Ondrej; Kotaskova, Jana; Brychtova, Yvona; Doubek, Michael; Mayer, Jiri; Pospisilova, Sarka

2017-09-01

The hotspot c.7541_7542delCT NOTCH1 mutation has been proven to have a negative clinical impact in chronic lymphocytic leukemia (CLL). However, an optimal method for its detection has not yet been specified. The aim of our study was to examine the presence of the NOTCH1 mutation in CLL using three commonly used molecular methods. Sanger sequencing, fragment analysis and allele-specific PCR were compared in the detection of the c.7541_7542delCT NOTCH1 mutation in 201 CLL patients. In 7 patients with inconclusive mutational analysis results, the presence of the NOTCH1 mutation was also confirmed using ultra-deep next generation sequencing. The NOTCH1 mutation was detected in 15% (30/201) of examined patients. Only fragment analysis was able to identify all 30 NOTCH1-mutated patients. Sanger sequencing and allele-specific PCR showed a lower detection efficiency, determining 93% (28/30) and 80% (24/30) of the present NOTCH1 mutations, respectively. Considering these three most commonly used methodologies for c.7541_7542delCT NOTCH1 mutation screening in CLL, we defined fragment analysis as the most suitable approach for detecting the hotspot NOTCH1 mutation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mutation analysis of Leber congenital amaurosis‑associated genes in patients with retinitis pigmentosa.

PubMed

Shen, Tao; Guan, Liping; Li, Shiqiang; Zhang, Jianguo; Xiao, Xueshan; Jiang, Hui; Yang, Jianhua; Guo, Xiangming; Wang, Jun; Zhang, Qingjiong

2015-03-01

The genetic defects underlying approximately half of all retinitis pigmentosa (RP) cases are unknown. A number of genes responsible for Leber congenital amaurosis (LCA) may also cause RP when they are mutated. Our previous study revealed that variants in the most frequently mutated nine exons accounted for approximately half of the mutations detected in a cohort of patients with LCA. The aim of the present study was to detect mutations in LCA-associated genes in patients with RP using two different strategies. Sanger sequencing was used to screen mutations in the nine exons in 293 patients with RP and exome sequencing was used to detect variants in 12 LCA-associated genes in 157 of the 293 patients with RP and then to validate the variants by Sanger sequencing. Potential pathogenic mutations were identified in four patients with early onset RP, including homozygous CRB1 mutations in two patients, compound heterozygous CRB1 mutations in one patient and compound heterozygous CEP290 mutations in one patient. The present study indicated that mutations in CEP290 may also be associated with RP but not with LCA. With the exception of CEP290, the remaining 11 genes known to be associated with LCA but not with RP are unlikely to be a common cause of RP.

Exome Sequencing of 18 Chinese Families with Congenital Cataracts: A New Sight of the NHS Gene

PubMed Central

Sun, Wenmin; Xiao, Xueshan; Li, Shiqiang; Guo, Xiangming; Zhang, Qingjiong

2014-01-01

Purpose The aim of this study was to investigate the mutation spectrum and frequency of 34 known genes in 18 Chinese families with congenital cataracts. Methods Genomic DNA and clinical data was collected from 18 families with congenital cataracts. Variations in 34 cataract-associated genes were screened by whole exome sequencing and then validated by Sanger sequencing. Results Eleven candidate variants in seven of the 34 genes were detected by exome sequencing and then confirmed by Sanger sequencing, including two variants predicted to be benign and the other pathogenic mutations. The nine mutations were present in 9 of the 18 (50%) families with congenital cataracts. Of the four families with mutations in the X-linked NHS gene, no other abnormalities were recorded except for cataract, in which a pseudo-dominant inheritance form was suggested, as female carriers also had different forms of cataracts. Conclusion This study expands the mutation spectrum and frequency of genes responsible for congenital cataract. Mutation in NHS is a common cause of nonsyndromic congenital cataract with pseudo-autosomal dominant inheritance. Combined with our previous studies, a genetic basis could be identified in 67.6% of families with congenital cataracts in our case series, in which mutations in genes encoding crystallins, genes encoding connexins, and NHS are responsible for 29.4%, 14.7%, and 11.8% of families, respectively. Our results suggest that mutations in NHS are the common cause of congenital cataract, both syndromic and nonsyndromic. PMID:24968223

Identifcation of a Novel Mutation p.I240T in the FRMD7 gene in a Family with Congenital Nystagmus

NASA Astrophysics Data System (ADS)

Zhu, Yihua; Zhuang, Jianfu; Ge, Xianglian; Zhang, Xiao; Wang, Zheng; Sun, Ji; Yang, Juhua; Gu, Feng

2013-10-01

Congenital Nystagmus (CN) is a genetically heterogeneous ocular disease, which causes a significant proportion of childhood visual impairment. To identify the underlying genetic defect of a CN family, twenty-two members were recruited. Genotype analysis showed that affected individuals shared a common haplotype with markers flanking FRMD7 locus. Sequencing FRMD7 revealed a T > C transition in exon 8, causing a conservative substitution of Isoleucine to Tyrosine at codon 240. By protein structural modeling, we found the mutation may disrupt the hydrophobic core and destabilize the protein structure. We reviewed the literature and found that exons 2, 8, and 9 (11.4% of the sequence of FRMD7 mRNA) represent the majority (55.3%) of the reported FRMD7 mutations. In summary, we identified a novel mutation in FRMD7, showed its molecular consequence, and revealed the mutation-rich exons of the FRMD7 gene. Collectively, this provides molecular insights for future CN clinical genetic diagnosis and treatment.

Identifcation of a novel mutation p.I240T in the FRMD7 gene in a family with congenital nystagmus.

PubMed

Zhu, Yihua; Zhuang, Jianfu; Ge, Xianglian; Zhang, Xiao; Wang, Zheng; Sun, Ji; Yang, Juhua; Gu, Feng

2013-10-30

Congenital Nystagmus (CN) is a genetically heterogeneous ocular disease, which causes a significant proportion of childhood visual impairment. To identify the underlying genetic defect of a CN family, twenty-two members were recruited. Genotype analysis showed that affected individuals shared a common haplotype with markers flanking FRMD7 locus. Sequencing FRMD7 revealed a T > C transition in exon 8, causing a conservative substitution of Isoleucine to Tyrosine at codon 240. By protein structural modeling, we found the mutation may disrupt the hydrophobic core and destabilize the protein structure. We reviewed the literature and found that exons 2, 8, and 9 (11.4% of the sequence of FRMD7 mRNA) represent the majority (55.3%) of the reported FRMD7 mutations. In summary, we identified a novel mutation in FRMD7, showed its molecular consequence, and revealed the mutation-rich exons of the FRMD7 gene. Collectively, this provides molecular insights for future CN clinical genetic diagnosis and treatment.

Identifcation of a Novel Mutation p.I240T in the FRMD7 gene in a Family with Congenital Nystagmus

PubMed Central

Zhu, Yihua; Zhuang, Jianfu; Ge, Xianglian; Zhang, Xiao; Wang, Zheng; Sun, Ji; Yang, Juhua; Gu, Feng

2013-01-01

Congenital Nystagmus (CN) is a genetically heterogeneous ocular disease, which causes a significant proportion of childhood visual impairment. To identify the underlying genetic defect of a CN family, twenty-two members were recruited. Genotype analysis showed that affected individuals shared a common haplotype with markers flanking FRMD7 locus. Sequencing FRMD7 revealed a T > C transition in exon 8, causing a conservative substitution of Isoleucine to Tyrosine at codon 240. By protein structural modeling, we found the mutation may disrupt the hydrophobic core and destabilize the protein structure. We reviewed the literature and found that exons 2, 8, and 9 (11.4% of the sequence of FRMD7 mRNA) represent the majority (55.3%) of the reported FRMD7 mutations. In summary, we identified a novel mutation in FRMD7, showed its molecular consequence, and revealed the mutation-rich exons of the FRMD7 gene. Collectively, this provides molecular insights for future CN clinical genetic diagnosis and treatment. PMID:24169426

Whole-exome sequencing revealed two novel mutations in Usher syndrome.

PubMed

Koparir, Asuman; Karatas, Omer Faruk; Atayoglu, Ali Timucin; Yuksel, Bayram; Sagiroglu, Mahmut Samil; Seven, Mehmet; Ulucan, Hakan; Yuksel, Adnan; Ozen, Mustafa

2015-06-01

Usher syndrome is a clinically and genetically heterogeneous autosomal recessive inherited disorder accompanied by hearing loss and retinitis pigmentosa (RP). Since the associated genes are various and quite large, we utilized whole-exome sequencing (WES) as a diagnostic tool to identify the molecular basis of Usher syndrome. DNA from a 12-year-old male diagnosed with Usher syndrome was analyzed by WES. Mutations detected were confirmed by Sanger sequencing. The pathogenicity of these mutations was determined by in silico analysis. A maternally inherited deleterious frameshift mutation, c.14439_14454del in exon 66 and a paternally inherited non-sense c.10830G>A stop-gain SNV in exon 55 of USH2A were found as two novel compound heterozygous mutations. Both of these mutations disrupt the C terminal of USH2A protein. As a result, WES revealed two novel compound heterozygous mutations in a Turkish USH2A patient. This approach gave us an opportunity to have an appropriate diagnosis and provide genetic counseling to the family within a reasonable time. Copyright © 2015 Elsevier B.V. All rights reserved.

Sequence variants in four genes underlying Bardet-Biedl syndrome in consanguineous families

PubMed Central

Ullah, Asmat; Umair, Muhammad; Yousaf, Maryam; Khan, Sher Alam; Nazim-ud-din, Muhammad; Shah, Khadim; Ahmad, Farooq; Azeem, Zahid; Ali, Ghazanfar; Alhaddad, Bader; Rafique, Afzal; Jan, Abid; Haack, Tobias B.; Strom, Tim M.; Meitinger, Thomas; Ghous, Tahseen

2017-01-01

Purpose To investigate the molecular basis of Bardet-Biedl syndrome (BBS) in five consanguineous families of Pakistani origin. Methods Linkage in two families (A and B) was established to BBS7 on chromosome 4q27, in family C to BBS8 on chromosome 14q32.1, and in family D to BBS10 on chromosome 12q21.2. Family E was investigated directly with exome sequence analysis. Results Sanger sequencing revealed two novel mutations and three previously reported mutations in the BBS genes. These mutations include two deletions (c.580_582delGCA, c.1592_1597delTTCCAG) in the BBS7 gene, a missense mutation (p.Gln449His) in the BBS8 gene, a frameshift mutation (c.271_272insT) in the BBS10 gene, and a nonsense mutation (p.Ser40*) in the MKKS (BBS6) gene. Conclusions Two novel mutations and three previously reported variants, identified in the present study, further extend the body of evidence implicating BBS6, BBS7, BBS8, and BBS10 in causing BBS. PMID:28761321

Clinical features of X linked juvenile retinoschisis associated with new mutations in the XLRS1 gene in Italian families

PubMed Central

Simonelli, F; Cennamo, G; Ziviello, C; Testa, F; de Crecchio, G; Nesti, A; Manitto, M P; Ciccodicola, A; Banfi, S; Brancato, R; Rinaldi, E

2003-01-01

Aims: To describe the clinical phenotype of X linked juvenile retinoschisis in eight Italian families with six different mutations in the XLRS1 gene. Methods: Complete ophthalmic examinations, electroretinography and A and B-scan standardised echography were performed in 18 affected males. The coding sequences of the XLRS1 gene were amplified by polymerase chain reaction and directly sequenced on an automated sequencer. Results: Six different XLRS1 mutations were identified; two of these mutations Ile81Asn and the Trp122Cys, have not been previously described. The affected males showed an electronegative response to the standard white scotopic stimulus and a prolonged implicit time of the 30 Hz flicker. In the families with Trp112Cys and Trp122Cys mutations we observed a more severe retinoschisis (RS) clinical picture compared with the other genotypes. Conclusion: The severe RS phenotypes associated with Trp112Cys and to Trp122Cys mutations suggest that these mutations determine a notable alteration in the function of the retinoschisin protein. PMID:12928282

Molecular analysis of congenital goitres with hypothyroidism caused by defective thyroglobulin synthesis. Identification of a novel c.7006C>T [p.R2317X] mutation and expression of minigenes containing nonsense mutations in exon 7.

PubMed

Machiavelli, Gloria A; Caputo, Mariela; Rivolta, Carina M; Olcese, María C; Gruñeiro-Papendieck, Laura; Chiesa, Ana; González-Sarmiento, Rogelio; Targovnik, Héctor M

2010-01-01

Thyroglobulin (TG) deficiency is an autosomal-recessive disorder that results in thyroid dyshormonogenesis. A number of distinct mutations have been identified as causing human hypothyroid goitre. The purpose of this study was to identify and characterize new mutations in the TG gene in an attempt to increase the understanding of the genetic mechanism responsible for this disorder. A total of six patients from four nonconsanguineous families with marked impairment of TG synthesis were studied. Single-strand conformation polymorphism (SSCP) analysis, sequencing of DNA, genotyping, expression of chimeric minigenes and bioinformatic analysis were performed. Four different inactivating TG mutations were identified: one novel mutation (c.7006C>T [p.R2317X]) and three previously reported (c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.6725G>A [p.R2223H]). Consequently, one patient carried a compound heterozygous for p.R2223H/p.R2317X mutations; two brothers showed a homozygous p.A2215D substitution and the remaining three patients, from two families with typical phenotype, had a single p.R277X mutated allele. We also showed functional evidences that premature stop codons inserted at different positions in exon 7, which disrupt exonic splicing enhancer (ESE) sequences, do not interfere with exon definition and processing. In this study, we have identified a novel nonsense mutation p.R2317X in the acetylcholinesterase homology domain of TG. We have also observed that nonsense mutations do not interfere with the pre-mRNA splicing of exon 7. The results are in accordance with previous observations confirming the genetic heterogeneity of TG defects.

PI3K/AKT pathway mutations cause a spectrum of brain malformations from megalencephaly to focal cortical dysplasia

PubMed Central

Mirzaa, Ghayda M.; Ishak, Gisele E.; O'Roak, Brian J.; Hiatt, Joseph B.; Roden, William H.; Gunter, Sonya A.; Christian, Susan L.; Collins, Sarah; Adams, Carissa; Rivière, Jean-Baptiste; St-Onge, Judith; Ojemann, Jeffrey G.; Shendure, Jay; Hevner, Robert F.; Dobyns, William B.

2015-01-01

Malformations of cortical development containing dysplastic neuronal and glial elements, including hemimegalencephaly and focal cortical dysplasia, are common causes of intractable paediatric epilepsy. In this study we performed multiplex targeted sequencing of 10 genes in the PI3K/AKT pathway on brain tissue from 33 children who underwent surgical resection of dysplastic cortex for the treatment of intractable epilepsy. Sequencing results were correlated with clinical, imaging, pathological and immunohistological phenotypes. We identified mosaic activating mutations in PIK3CA and AKT3 in this cohort, including cancer-associated hotspot PIK3CA mutations in dysplastic megalencephaly, hemimegalencephaly, and focal cortical dysplasia type IIa. In addition, a germline PTEN mutation was identified in a male with hemimegalencephaly but no peripheral manifestations of the PTEN hamartoma tumour syndrome. A spectrum of clinical, imaging and pathological abnormalities was found in this cohort. While patients with more severe brain imaging abnormalities and systemic manifestations were more likely to have detected mutations, routine histopathological studies did not predict mutation status. In addition, elevated levels of phosphorylated S6 ribosomal protein were identified in both neurons and astrocytes of all hemimegalencephaly and focal cortical dysplasia type II specimens, regardless of the presence or absence of detected PI3K/AKT pathway mutations. In contrast, expression patterns of the T308 and S473 phosphorylated forms of AKT and in vitro AKT kinase activities discriminated between mutation-positive dysplasia cortex, mutation-negative dysplasia cortex, and non-dysplasia epilepsy cortex. Our findings identify PI3K/AKT pathway mutations as an important cause of epileptogenic brain malformations and establish megalencephaly, hemimegalencephaly, and focal cortical dysplasia as part of a single pathogenic spectrum. PMID:25722288

ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism

PubMed Central

Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry

2012-01-01

Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617

Mutational signature analysis identifies MUTYH deficiency in colorectal cancers and adrenocortical carcinomas: Mutational signature associated with MUTYH deficiency in cancers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pilati, Camilla; Shinde, Jayendra; Alexandrov, Ludmil B.

Germline alterations in DNA repair genes are implicated in cancer predisposition and can result in characteristic mutational signatures. However, specific mutational signatures associated with base excision repair (BER) defects remain to be characterized. Here, by analysing a series of colorectal cancers (CRCs) using exome sequencing, we identified a particular spectrum of somatic mutations characterized by an enrichment of C > A transversions in NpCpA or NpCpT contexts in three tumours from a MUTYH-associated polyposis (MAP) patient and in two cases harbouring pathogenic germline MUTYH mutations. In two series of adrenocortical carcinomas (ACCs), we identified four tumours with a similar signaturemore » also presenting germline MUTYH mutations. Altogether, these findings demonstrate that MUTYH inactivation results in a particular mutational signature, which may serve as a useful marker of BER-related genomic instability in new cancer types.« less

Mutational signature analysis identifies MUTYH deficiency in colorectal cancers and adrenocortical carcinomas: Mutational signature associated with MUTYH deficiency in cancers

DOE PAGES

Pilati, Camilla; Shinde, Jayendra; Alexandrov, Ludmil B.; ...

2017-03-29

Germline alterations in DNA repair genes are implicated in cancer predisposition and can result in characteristic mutational signatures. However, specific mutational signatures associated with base excision repair (BER) defects remain to be characterized. Here, by analysing a series of colorectal cancers (CRCs) using exome sequencing, we identified a particular spectrum of somatic mutations characterized by an enrichment of C > A transversions in NpCpA or NpCpT contexts in three tumours from a MUTYH-associated polyposis (MAP) patient and in two cases harbouring pathogenic germline MUTYH mutations. In two series of adrenocortical carcinomas (ACCs), we identified four tumours with a similar signaturemore » also presenting germline MUTYH mutations. Altogether, these findings demonstrate that MUTYH inactivation results in a particular mutational signature, which may serve as a useful marker of BER-related genomic instability in new cancer types.« less

Detection of Emerging Vaccine-Related Polioviruses by Deep Sequencing.

PubMed

Sahoo, Malaya K; Holubar, Marisa; Huang, ChunHong; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Waggoner, Jesse J; Troy, Stephanie B; Garcia-Garcia, Lourdes; Ferreyra-Reyes, Leticia; Maldonado, Yvonne; Pinsky, Benjamin A

2017-07-01

Oral poliovirus vaccine can mutate to regain neurovirulence. To date, evaluation of these mutations has been performed primarily on culture-enriched isolates by using conventional Sanger sequencing. We therefore developed a culture-independent, deep-sequencing method targeting the 5' untranslated region (UTR) and P1 genomic region to characterize vaccine-related poliovirus variants. Error analysis of the deep-sequencing method demonstrated reliable detection of poliovirus mutations at levels of <1%, depending on read depth. Sequencing of viral nucleic acids from the stool of vaccinated, asymptomatic children and their close contacts collected during a prospective cohort study in Veracruz, Mexico, revealed no vaccine-derived polioviruses. This was expected given that the longest duration between sequenced sample collection and the end of the most recent national immunization week was 66 days. However, we identified many low-level variants (<5%) distributed across the 5' UTR and P1 genomic region in all three Sabin serotypes, as well as vaccine-related viruses with multiple canonical mutations associated with phenotypic reversion present at high levels (>90%). These results suggest that monitoring emerging vaccine-related poliovirus variants by deep sequencing may aid in the poliovirus endgame and efforts to ensure global polio eradication. Copyright © 2017 Sahoo et al.

PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

PubMed

Wimmer, Katharina; Wernstedt, Annekatrin

2014-01-01

The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

Establishment and rapid detection of a heterozygous missense mutation in the CACNA1F gene by ARMS technique with double-base mismatched primers.

PubMed

Yang, W C; Zhu, L; Zhou, B X; Tania, S; Zhou, Q; Khan, M A; Fu, X L; Cheng, J L; Lv, H B; Fu, J J

2015-09-25

Retinitis pigmentosa (RP) is a retinal degenerative disorder that often causes complete blindness. Mutations of more than 50 genes have been identified as associated with RP, including the CACNA1F gene. In a recent study, by employing next-generation sequencing, we identified a novel mutation in the CACNA1F gene. In this study, we used the amplification refractory mutation system (ARMS) and identified a single nucleotide change c.1555C>T in exon 13 of the CACNA1F gene, leading to the substitution of arginine by tryptophan (p.R519W) in a Chinese individual affected by RP. This study actually confirms this novel mutation, and establishes the ARMS technique for the detection of mutations in RP.

Compound mutations in BCR-ABL1 are not major drivers of primary or secondary resistance to ponatinib in CP-CML patients

PubMed Central

Hodgson, J. Graeme; Shah, Neil P.; Cortes, Jorge E.; Kim, Dong-Wook; Nicolini, Franck E.; Talpaz, Moshe; Baccarani, Michele; Müller, Martin C.; Li, Jin; Parker, Wendy T.; Lustgarten, Stephanie; Clackson, Tim; Haluska, Frank G.; Guilhot, Francois; Kantarjian, Hagop M.; Soverini, Simona; Hochhaus, Andreas; Hughes, Timothy P.; Rivera, Victor M.; Branford, Susan

2016-01-01

BCR-ABL1 kinase domain mutations can confer resistance to first- and second-generation tyrosine kinase inhibitors (TKIs) in chronic myeloid leukemia (CML). In preclinical studies, clinically achievable concentrations of the third-generation BCR-ABL1 TKI ponatinib inhibit T315I and all other single BCR-ABL1 mutants except T315M, which generates a single amino acid exchange, but requires 2 sequential nucleotide exchanges. In addition, certain compound mutants (containing ≥2 mutations in cis) confer resistance. Initial analyses based largely on conventional Sanger sequencing (SS) have suggested that the preclinical relationship between BCR-ABL1 mutation status and ponatinib efficacy is generally recapitulated in patients receiving therapy. Thus far, however, such analyses have been limited by the inability of SS to definitively identify compound mutations or mutations representing less than ∼20% of total alleles (referred to as “low-level mutations”), as well as limited patient follow-up. Here we used next-generation sequencing (NGS) to define the baseline BCR-ABL1 mutation status of 267 heavily pretreated chronic phase (CP)-CML patients from the PACE trial, and used SS to identify clonally dominant mutants that may have developed on ponatinib therapy (30.1 months median follow-up). Durable cytogenetic and molecular responses were observed irrespective of baseline mutation status and included patients with compound mutations. No single or compound mutation was identified that consistently conferred primary and/or secondary resistance to ponatinib in CP-CML patients. Ponatinib is effective in CP-CML irrespective of baseline mutation status. PMID:26603839

Whole-Exome Sequencing to Decipher the Genetic Heterogeneity of Hearing Loss in a Chinese Family with Deaf by Deaf Mating

PubMed Central

Qing, Jie; Yan, Denise; Zhou, Yuan; Liu, Qiong; Wu, Weijing; Xiao, Zian; Liu, Yuyuan; Liu, Jia; Du, Lilin; Xie, Dinghua; Liu, Xue Zhong

2014-01-01

Inherited deafness has been shown to have high genetic heterogeneity. For many decades, linkage analysis and candidate gene approaches have been the main tools to elucidate the genetics of hearing loss. However, this associated study design is costly, time-consuming, and unsuitable for small families. This is mainly due to the inadequate numbers of available affected individuals, locus heterogeneity, and assortative mating. Exome sequencing has now become technically feasible and a cost-effective method for detection of disease variants underlying Mendelian disorders due to the recent advances in next-generation sequencing (NGS) technologies. In the present study, we have combined both the Deafness Gene Mutation Detection Array and exome sequencing to identify deafness causative variants in a large Chinese composite family with deaf by deaf mating. The simultaneous screening of the 9 common deafness mutations using the allele-specific PCR based universal array, resulted in the identification of the 1555A>G in the mitochondrial DNA (mtDNA) 12S rRNA in affected individuals in one branch of the family. We then subjected the mutation-negative cases to exome sequencing and identified novel causative variants in the MYH14 and WFS1 genes. This report confirms the effective use of a NGS technique to detect pathogenic mutations in affected individuals who were not candidates for classical genetic studies. PMID:25289672

Absence of mutations in HCRT, HCRTR1 and HCRTR2 in patients with ROHHAD.

PubMed

Barclay, Sarah F; Rand, Casey M; Gray, Paul A; Gibson, William T; Wilson, Richard J A; Berry-Kravis, Elizabeth M; Ize-Ludlow, Diego; Bech-Hansen, N Torben; Weese-Mayer, Debra E

2016-01-15

Rapid-onset obesity with hypothalamic dysfunction, hypoventilation, and autonomic dysregulation (ROHHAD) is a rare pediatric disease of unknown cause. Here, in response to a recent case report describing a ROHHAD patient who suffered from secondary narcolepsy confirmed by an absence of hypocretin-1 in the cerebrospinal fluid, we consider whether the ROHHAD phenotype is owing to one or more mutations in genes specific to hypocretin protein signalling. DNA samples from 16 ROHHAD patients were analyzed using a combination of next-generation and Sanger sequencing to identify exonic sequence variations in three genes: HCRT, HCRTR1, and HCRTR2. No rare or novel mutations were identified in the exons of HCRT, HCRTR1, or HCRTR2 genes in a set of 16 ROHHAD patients. ROHHAD is highly unlikely to be caused by mutations in the exons of the genes for hypocretin and its two receptors. Copyright © 2015 Elsevier B.V. All rights reserved.

Accurate and exact CNV identification from targeted high-throughput sequence data.

PubMed

Nord, Alex S; Lee, Ming; King, Mary-Claire; Walsh, Tom

2011-04-12

Massively parallel sequencing of barcoded DNA samples significantly increases screening efficiency for clinically important genes. Short read aligners are well suited to single nucleotide and indel detection. However, methods for CNV detection from targeted enrichment are lacking. We present a method combining coverage with map information for the identification of deletions and duplications in targeted sequence data. Sequencing data is first scanned for gains and losses using a comparison of normalized coverage data between samples. CNV calls are confirmed by testing for a signature of sequences that span the CNV breakpoint. With our method, CNVs can be identified regardless of whether breakpoints are within regions targeted for sequencing. For CNVs where at least one breakpoint is within targeted sequence, exact CNV breakpoints can be identified. In a test data set of 96 subjects sequenced across ~1 Mb genomic sequence using multiplexing technology, our method detected mutations as small as 31 bp, predicted quantitative copy count, and had a low false-positive rate. Application of this method allows for identification of gains and losses in targeted sequence data, providing comprehensive mutation screening when combined with a short read aligner.

Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

PubMed

Al-sbou, Mohammed

2012-06-01

This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

Phenotype–genotype correlation in Hirschsprung disease is illuminated by comparative analysis of the RET protein sequence

PubMed Central

Kashuk, Carl S.; Stone, Eric A.; Grice, Elizabeth A.; Portnoy, Matthew E.; Green, Eric D.; Sidow, Arend; Chakravarti, Aravinda; McCallion, Andrew S.

2005-01-01

The ability to discriminate between deleterious and neutral amino acid substitutions in the genes of patients remains a significant challenge in human genetics. The increasing availability of genomic sequence data from multiple vertebrate species allows inclusion of sequence conservation and physicochemical properties of residues to be used for functional prediction. In this study, the RET receptor tyrosine kinase serves as a model disease gene in which a broad spectrum (≥116) of disease-associated mutations has been identified among patients with Hirschsprung disease and multiple endocrine neoplasia type 2. We report the alignment of the human RET protein sequence with the orthologous sequences of 12 non-human vertebrates (eight mammalian, one avian, and three teleost species), their comparative analysis, the evolutionary topology of the RET protein, and predicted tolerance for all published missense mutations. We show that, although evolutionary conservation alone provides significant information to predict the effect of a RET mutation, a model that combines comparative sequence data with analysis of physiochemical properties in a quantitative framework provides far greater accuracy. Although the ability to discern the impact of a mutation is imperfect, our analyses permit substantial discrimination between predicted functional classes of RET mutations and disease severity even for a multigenic disease such as Hirschsprung disease. PMID:15956201

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Mutation detection in the human HSP70B′ gene by denaturing high-performance liquid chromatography

PubMed Central

Hecker, Karl H.; Asea, Alexzander; Kobayashi, Kaoru; Green, Stacy; Tang, Dan; Calderwood, Stuart K.

2000-01-01

Variances, particularly single nucleotide polymorphisms (SNP), in the genomic sequence of individuals are the primary key to understanding gene function as it relates to differences in the susceptibility to disease, environmental influences, and therapy. In this report, the HSP70B′ gene is the target sequence for mutation detection in biopsy samples from human prostate cancer patients undergoing combined hyperthermia and radiation therapy at the Dana-Farber Cancer Institute, using temperature-modulated heteroduplex analysis (TMHA). The underlying principles of TMHA for mutation detection using DHPLC technology are discussed. The procedures involved in amplicon design for mutation analysis by DHPLC are detailed. The melting behavior of the complete coding sequence of the target gene is characterized using WAVEMAKERTM software. Four overlapping amplicons, which span the complete coding region of the HSP70B′ gene, amenable to mutation detection by DHPLC were identified based on the software-predicted melting profile of the target sequence. TMHA was performed on PCR products of individual amplicons of the HSP70B′ gene on the WAVE® Nucleic Acid Fragment Analysis System. The criteria for mutation calling by comparing wild-type and mutant chromatographic patterns are discussed. PMID:11189446

Mutation detection in the human HSP7OB' gene by denaturing high-performance liquid chromatography.

PubMed

Hecker, K H; Asea, A; Kobayashi, K; Green, S; Tang, D; Calderwood, S K

2000-11-01

Variances, particularly single nucleotide polymorphisms (SNP), in the genomic sequence of individuals are the primary key to understanding gene function as it relates to differences in the susceptibility to disease, environmental influences, and therapy. In this report, the HSP70B' gene is the target sequence for mutation detection in biopsy samples from human prostate cancer patients undergoing combined hyperthermia and radiation therapy at the Dana-Farber Cancer Institute, using temperature-modulated heteroduplex analysis (TMHA). The underlying principles of TMHA for mutation detection using DHPLC technology are discussed. The procedures involved in amplicon design for mutation analysis by DHPLC are detailed. The melting behavior of the complete coding sequence of the target gene is characterized using WAVEMAKER software. Four overlapping amplicons, which span the complete coding region of the HSP70B' gene, amenable to mutation detection by DHPLC were identified based on the software-predicted melting profile of the target sequence. TMHA was performed on PCR products of individual amplicons of the HSP70B' gene on the WAVE Nucleic Acid Fragment Analysis System. The criteria for mutation calling by comparing wild-type and mutant chromatographic patterns are discussed.

Molecular analysis of rice plant mutated after space flight

NASA Astrophysics Data System (ADS)

Cheng, Z.; Li, C.; Wei, L.; Xu, D.; Gu, D.; Guan, S.; Zhao, H.; Xin, P.; Sun, Y.

We have obtained several rice mutants planted from seeds flown on recoverable satellites. Some new traits, such as good yields, diseases resistances and higher nutrient values, have been identified, putatively as consequences of the space environment. Radiation inside the Chinese recoverable satellite was composed of low flux of high energy particles (>40 Mev/u). To study the mechanisms of plant mutations induced by the space environment, we used dry rice seeds as a model to identify the phenotype of mutations, and used the wealth of the rice genome to identify the mutated genes in the mutants. The research included collecting rice plant mutants in the seeds flown on the satellites, identifying the nature of genomic and proteomic alterations, modifications and identifying the functional changes of the specific genes. The study showed that the rice seeds are a good model for exploring biological effect of space environment since 1) it is easy fly the seeds without specific hardware and crew work, 2) it is easy to obtain pure mutant breed lines for cloning DNA sequence in order to compare with the sequence in the wild type, and 3) it is easy to quantitatively analyze genetics using advanced molecular techniques.

Characterization of immune cells and perforin mutations in familiar venous thromboembolism.

PubMed

Duan, Qianglin; Lv, Wei; Yang, Minjun; Yang, Fan; Zhu, Yongqiang; Kang, Hui; Song, Haoming; Wang, Shengyue; Dong, Hui; Wang, Lemin

2015-01-01

This study was to carry out exome sequencing in a Han Chinese family with venous thromboembolism. Three venous thromboembolism (VTE) patients and five members from a Han Chinese family were evaluated by exome sequencing. Among the 3 VTE patients, mutations of 2 genes including PRF1 and HTR2A were identified and predicted to be functionally damaged to their encoded proteins. In addition, the PRF1 mutation and the HTR2A mutation identified in our study were absent in 100 non-related controls, indicating that venous thromboembolism has a genetic component. The R357W mutation is located in the membrane attack complex/perforin domain of PRF1 protein, which exists in both the perforin. The steps of killing foreign or pathological antigen cells by NK cells, CD8 (+)T cells and the membrane attack complex include membrane perforation and release of the granzyme, either of which is abnormal can lead to immune dysfunction. The mutations of immune related genes in familial VTE might provide new understanding of the pathogenesis of familial venous thromboembolism.

PPM1D Mosaic Truncating Variants in Ovarian Cancer Cases May Be Treatment-Related Somatic Mutations

PubMed Central

Pharoah, Paul D. P.; Song, Honglin; Dicks, Ed; Intermaggio, Maria P.; Harrington, Patricia; Baynes, Caroline; Alsop, Kathryn; Bogdanova, Natalia; Cicek, Mine S.; Cunningham, Julie M.; Fridley, Brooke L.; Gentry-Maharaj, Aleksandra; Hillemanns, Peter; Lele, Shashi; Lester, Jenny; McGuire, Valerie; Moysich, Kirsten B.; Poblete, Samantha; Sieh, Weiva; Sucheston-Campbell, Lara; Widschwendter, Martin; Whittemore, Alice S.; Dörk, Thilo; Menon, Usha; Odunsi, Kunle; Goode, Ellen L.; Karlan, Beth Y.; Bowtell, David D.; Gayther, Simon A.; Ramus, Susan J.

2016-01-01

Mosaic truncating mutations in the protein phosphatase, Mg2+/Mn2+-dependent, 1D (PPM1D) gene have recently been reported with a statistically significantly greater frequency in lymphocyte DNA from ovarian cancer case patients compared with unaffected control patients. Using massively parallel sequencing (MPS) we identified truncating PPM1D mutations in 12 of 3236 epithelial ovarian cancer (EOC) case patients (0.37%) but in only one of 3431 unaffected control patients (0.03%) (P = .001). All statistical tests were two-sided. A combination of Sanger sequencing, pyrosequencing, and MPS data suggested that 12 of the 13 mutations were mosaic. All mutations were identified in post-chemotherapy treatment blood samples from case patients (n = 1827) (average 1234 days post-treatment in carriers) rather than from cases collected pretreatment (less than 14 days after diagnosis, n = 1384) (P = .002). These data suggest that PPM1D variants in EOC cases are primarily somatic mosaic mutations caused by treatment and are not associated with germline predisposition to EOC. PMID:26823519

Novel mutations target distinct subgroups of medulloblastoma

PubMed Central

Robinson, Giles; Parker, Matthew; Kranenburg, Tanya A.; Lu, Charles; Chen, Xiang; Ding, Li; Phoenix, Timothy N.; Hedlund, Erin; Wei, Lei; Zhu, Xiaoyan; Chalhoub, Nader; Baker, Suzanne J.; Huether, Robert; Kriwacki, Richard; Curley, Natasha; Thiruvenkatam, Radhika; Wang, Jianmin; Wu, Gang; Rusch, Michael; Hong, Xin; Beckford, Jared; Gupta, Pankaj; Ma, Jing; Easton, John; Vadodaria, Bhavin; Onar-Thomas, Arzu; Lin, Tong; Li, Shaoyi; Pounds, Stanley; Paugh, Steven; Zhao, David; Kawauchi, Daisuke; Roussel, Martine F.; Finkelstein, David; Ellison, David W.; Lau, Ching C.; Bouffet, Eric; Hassall, Tim; Gururangan, Sridharan; Cohn, Richard; Fulton, Robert S.; Fulton, Lucinda L.; Dooling, David J.; Ochoa, Kerri; Gajjar, Amar; Mardis, Elaine R.; Wilson, Richard K.; Downing, James R.; Zhang, Jinghui; Gilbertson, Richard J.

2012-01-01

Summary Medulloblastoma is a malignant childhood brain tumour comprising four discrete subgroups. To identify mutations that drive medulloblastoma we sequenced the entire genomes of 37 tumours and matched normal blood. One hundred and thirty-six genes harbouring somatic mutations in this discovery set were sequenced in an additional 56 medulloblastomas. Recurrent mutations were detected in 41 genes not yet implicated in medulloblastoma: several target distinct components of the epigenetic machinery in different disease subgroups, e.g., regulators of H3K27 and H3K4 trimethylation in subgroup-3 and 4 (e.g., KDM6A and ZMYM3), and CTNNB1-associated chromatin remodellers in WNT-subgroup tumours (e.g., SMARCA4 and CREBBP). Modelling of mutations in mouse lower rhombic lip progenitors that generate WNT-subgroup tumours, identified genes that maintain this cell lineage (DDX3X) as well as mutated genes that initiate (CDH1) or cooperate (PIK3CA) in tumourigenesis. These data provide important new insights into the pathogenesis of medulloblastoma subgroups and highlight targets for therapeutic development. PMID:22722829

Whole-exome analysis to detect congenital hemolytic anemia mimicking congenital dyserythropoietic anemia.

PubMed

Hamada, Motoharu; Doisaki, Sayoko; Okuno, Yusuke; Muramatsu, Hideki; Hama, Asahito; Kawashima, Nozomu; Narita, Atsushi; Nishio, Nobuhiro; Yoshida, Kenichi; Kanno, Hitoshi; Manabe, Atsushi; Taga, Takashi; Takahashi, Yoshiyuki; Miyano, Satoru; Ogawa, Seishi; Kojima, Seiji

2018-06-23

Congenital dyserythropoietic anemia (CDA) is a heterogeneous group of rare congenital disorders characterized by ineffective erythropoiesis and dysplastic changes in erythroblasts. Diagnosis of CDA is based primarily on the morphology of bone marrow erythroblasts; however, genetic tests have recently become more important. Here, we performed genetic analysis of 10 Japanese patients who had been diagnosed with CDA based on laboratory findings and morphological characteristics. We examined 10 CDA patients via central review of bone marrow morphology and genetic analysis for congenital bone marrow failure syndromes. Sanger sequencing for CDAN1, SEC23B, and KLF1 was performed for all patients. We performed whole-exome sequencing in patients without mutation in these genes. Three patients carried pathogenic CDAN1 mutations, whereas no SEC23B mutations were identified in our cohort. WES unexpectedly identified gene mutations known to cause congenital hemolytic anemia in two patients: canonical G6PD p.Val394Leu mutation and SPTA1 p.Arg28His mutation. Comprehensive genetic analysis is warranted for more effective diagnosis of patients with suspected CDA.

A novel mutation of the MITF gene in a family with Waardenburg syndrome type 2: A case report

PubMed Central

SHI, YUNFANG; LI, XIAOZHOU; JU, DUAN; LI, YAN; ZHANG, XIULING; ZHANG, YING

2016-01-01

Waardenburg syndrome (WS) is an autosomal dominant disorder with varying degrees of sensorineural hearing loss, and accumulation of pigmentation in hair, skin and iris. There are four types of WS (WS1–4) with differing characteristics. Mutations in six genes [paired box gene 3 (PAX3), microphthalmia-associated transcription factor (MITF), endothelin 3 (END3), endothelin receptor type B (EDNRB), SRY (sex determining region Y)-box 10 (SOX10) and snail homolog 2 (SNAI2)] have been identified to be associated with the various types. This case report describes the investigation of genetic mutations in three patients with WS2 from a single family. Genomic DNA was extracted, and the six WS-related genes were sequenced using next-generation sequencing technology. In addition to mutations in PAX3, EDNRB and SOX10, a novel heterozygous MITF mutation, p.Δ315Arg (c.944_946delGAA) on exon 8 was identified. This is predicted to be a candidate disease-causing mutation that may affect the structure and function of the enzyme. PMID:27073475

A novel mutation of the MITF gene in a family with Waardenburg syndrome type 2: A case report.

PubMed

Shi, Yunfang; Li, Xiaozhou; Ju, Duan; Li, Yan; Zhang, Xiuling; Zhang, Ying

2016-04-01

Waardenburg syndrome (WS) is an autosomal dominant disorder with varying degrees of sensorineural hearing loss, and accumulation of pigmentation in hair, skin and iris. There are four types of WS (WS1-4) with differing characteristics. Mutations in six genes [paired box gene 3 ( PAX3 ), microphthalmia-associated transcription factor ( MITF ), endothelin 3 ( END3 ), endothelin receptor type B ( EDNRB ), SRY (sex determining region Y)-box 10 ( SOX10 ) and snail homolog 2 ( SNAI2 )] have been identified to be associated with the various types. This case report describes the investigation of genetic mutations in three patients with WS2 from a single family. Genomic DNA was extracted, and the six WS-related genes were sequenced using next-generation sequencing technology. In addition to mutations in PAX3, EDNRB and SOX10, a novel heterozygous MITF mutation, p.Δ315Arg (c.944_946delGAA) on exon 8 was identified. This is predicted to be a candidate disease-causing mutation that may affect the structure and function of the enzyme.

Mutation screening of Chinese Treacher Collins syndrome patients identified novel TCOF1 mutations.

PubMed

Chen, Ying; Guo, Luo; Li, Chen-Long; Shan, Jing; Xu, Hai-Song; Li, Jie-Ying; Sun, Shan; Hao, Shao-Juan; Jin, Lei; Chai, Gang; Zhang, Tian-Yu

2018-04-01

Treacher Collins syndrome (TCS) (OMIM 154500) is a rare congenital craniofacial disorder with an autosomal dominant manner of inheritance in most cases. To date, three pathogenic genes (TCOF1, POLR1D and POLR1C) have been identified. In this study, we conducted mutational analysis on Chinese TCS patients to reveal a mutational spectrum of known causative genes and show phenotype-genotype data to provide more information for gene counselling and future studies on the pathogenesis of TCS. Twenty-two TCS patients were recruited from two tertiary referral centres, and Sanger sequencing for the coding exons and exon-intron boundaries of TCOF1, POLR1D and POLR1C was performed. For patients without small variants, further copy number variations (CNVs) analysis was conducted using high-density SNP array platforms. The Sanger sequencing overall mutation detection rate was as high as 86.3% (19/22) for our cohort. Fifteen TCOF1 pathogenic variants, including ten novel mutations, were identified in nineteen patients. No causative mutations in POLR1D and POLR1C genes and no CNVs mutations were detected. A suspected autosomal dominant inheritance case that implies germinal mosaicism was described. Our study confirmed that TCOF1 was the main disease-causing gene for the Chinese TCS population and revealed its mutation spectrum. We also addressed the need for more studies of mosaicism in TCS cases, which could explain the mechanism of autosomal dominant inheritance in TCS cases and benefit the prevention of TCS.

Genetic alterations in seborrheic keratoses

PubMed Central

Heidenreich, Barbara; Denisova, Evygenia; Rachakonda, Sivaramakrishna; Sanmartin, Onofre; Dereani, Timo; Hosen, Ismail; Nagore, Eduardo; Kumar, Rajiv

2017-01-01

Seborrheic keratoses are common benign epidermal lesions that are associated with increased age and sun-exposure. Those lesions despite harboring multiple somatic alterations in contrast to malignant tumors appear to be genetically stable. In order to investigate and characterize the presence of recurrent mutations, we performed exome sequencing on DNA from one seborrheic keratosis lesion and corresponding blood cells from the same patients with follow up investigation of alterations identified by exome sequencing in 24 additional lesions from as many patients. In addition we investigated alterations in all lesions at specific genes loci that included FGFR3, PIK3CA, HRAS, BRAF, CDKN2A and TERT and DHPH3 promoters. The exome sequencing data indicated three mutations per Mb of the targeted sequence. The mutational pattern depicted typical UV signature with majority of alterations being C>T and CC>TT base changes at dipyrimidinic sites. The FGFR3 mutations were the most frequent, detected in 12 of 25 (48%) lesions, followed by the PIK3CA (32%), TERT promoter (24%) and DPH3 promoter mutations (24%). TERT promoter mutations associated with increased age and were present mainly in the lesions excised from head and neck. Three lesions also carried alterations in CDKN2A. FGFR3, TERT and DPH3 expression did not correlate with mutations in the respective genes and promoters; however, increased FGFR3 transcript levels were associated with increased FOXN1 levels, a suggested positive feedback loop that stalls malignant progression. Thus, in this study we report overall mutation rate through exome sequencing and show the most frequent mutations seborrheic keratosis. PMID:28410231

Exome Sequencing Identifies Biallelic MSH3 Germline Mutations as a Recessive Subtype of Colorectal Adenomatous Polyposis.

PubMed

Adam, Ronja; Spier, Isabel; Zhao, Bixiao; Kloth, Michael; Marquez, Jonathan; Hinrichsen, Inga; Kirfel, Jutta; Tafazzoli, Aylar; Horpaopan, Sukanya; Uhlhaas, Siegfried; Stienen, Dietlinde; Friedrichs, Nicolaus; Altmüller, Janine; Laner, Andreas; Holzapfel, Stefanie; Peters, Sophia; Kayser, Katrin; Thiele, Holger; Holinski-Feder, Elke; Marra, Giancarlo; Kristiansen, Glen; Nöthen, Markus M; Büttner, Reinhard; Möslein, Gabriela; Betz, Regina C; Brieger, Angela; Lifton, Richard P; Aretz, Stefan

2016-08-04

In ∼30% of families affected by colorectal adenomatous polyposis, no germline mutations have been identified in the previously implicated genes APC, MUTYH, POLE, POLD1, and NTHL1, although a hereditary etiology is likely. To uncover further genes with high-penetrance causative mutations, we performed exome sequencing of leukocyte DNA from 102 unrelated individuals with unexplained adenomatous polyposis. We identified two unrelated individuals with differing compound-heterozygous loss-of-function (LoF) germline mutations in the mismatch-repair gene MSH3. The impact of the MSH3 mutations (c.1148delA, c.2319-1G>A, c.2760delC, and c.3001-2A>C) was indicated at the RNA and protein levels. Analysis of the diseased individuals' tumor tissue demonstrated high microsatellite instability of di- and tetranucleotides (EMAST), and immunohistochemical staining illustrated a complete loss of nuclear MSH3 in normal and tumor tissue, confirming the LoF effect and causal relevance of the mutations. The pedigrees, genotypes, and frequency of MSH3 mutations in the general population are consistent with an autosomal-recessive mode of inheritance. Both index persons have an affected sibling carrying the same mutations. The tumor spectrum in these four persons comprised colorectal and duodenal adenomas, colorectal cancer, gastric cancer, and an early-onset astrocytoma. Additionally, we detected one unrelated individual with biallelic PMS2 germline mutations, representing constitutional mismatch-repair deficiency. Potentially causative variants in 14 more candidate genes identified in 26 other individuals require further workup. In the present study, we identified biallelic germline MSH3 mutations in individuals with a suspected hereditary tumor syndrome. Our data suggest that MSH3 mutations represent an additional recessive subtype of colorectal adenomatous polyposis. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes

PubMed Central

Rivière, Jean-Baptiste; Mirzaa, Ghayda M.; O’Roak, Brian J.; Beddaoui, Margaret; Alcantara, Diana; Conway, Robert L.; St-Onge, Judith; Schwartzentruber, Jeremy A.; Gripp, Karen W.; Nikkel, Sarah M.; Worthylake, Thea; Sullivan, Christopher T.; Ward, Thomas R.; Butler, Hailly E.; Kramer, Nancy A.; Albrecht, Beate; Armour, Christine M.; Armstrong, Linlea; Caluseriu, Oana; Cytrynbaum, Cheryl; Drolet, Beth A.; Innes, A. Micheil; Lauzon, Julie L.; Lin, Angela E.; Mancini, Grazia M. S.; Meschino, Wendy S.; Reggin, James D.; Saggar, Anand K.; Lerman-Sagie, Tally; Uyanik, Gökhan; Weksberg, Rosanna; Zirn, Birgit; Beaulieu, Chandree L.; Majewski, Jacek; Bulman, Dennis E.; O’Driscoll, Mark; Shendure, Jay; Graham, John M.; Boycott, Kym M.; Dobyns, William B.

2012-01-01

Megalencephaly-capillary malformation (MCAP) and megalencephaly-polymicrogyria-polydactyly-hydrocephalus (MPPH) syndromes are sporadic overgrowth disorders associated with markedly enlarged brain size and other recognizable features1-5. We performed exome sequencing in three families with MCAP or MPPH and confirmed our initial observations in exomes from 7 MCAP and 174 control individuals, as well as in 40 additional megalencephaly subjects using a combination of Sanger sequencing, restriction-enzyme assays, and targeted deep sequencing. We identified de novo germline or postzygotic mutations in three core components of the phosphatidylinositol-3-kinase (PI3K)/AKT pathway. These include two mutations of AKT3, one recurrent mutation of PIK3R2 in 11 unrelated MPPH families, and 15 mostly postzygotic mutations of PIK3CA in 23 MCAP and one MPPH patients. Our data highlight the central role of PI3K/AKT signaling in vascular, limb and brain development, and emphasize the power of massively parallel sequencing in a challenging context of phenotypic and genetic heterogeneity combined with postzygotic mosaicism. PMID:22729224

The determination of complete human mitochondrial DNA sequences in single cells: implications for the study of somatic mitochondrial DNA point mutations

PubMed Central

Taylor, Robert W.; Taylor, Geoffrey A.; Durham, Steve E.; Turnbull, Douglass M.

2001-01-01

Studies of single cells have previously shown intracellular clonal expansion of mitochondrial DNA (mtDNA) mutations to levels that can cause a focal cytochrome c oxidase (COX) defect. Whilst techniques are available to study mtDNA rearrangements at the level of the single cell, recent interest has focused on the possible role of somatic mtDNA point mutations in ageing, neurodegenerative disease and cancer. We have therefore developed a method that permits the reliable determination of the entire mtDNA sequence from single cells without amplifying contaminating, nuclear-embedded pseudogenes. Sequencing and PCR–RFLP analyses of individual COX-negative muscle fibres from a patient with a previously described heteroplasmic COX II (T7587C) mutation indicate that mutant loads as low as 30% can be reliably detected by sequencing. This technique will be particularly useful in identifying the mtDNA mutational spectra in age-related COX-negative cells and will increase our understanding of the pathogenetic mechanisms by which they occur. PMID:11470889

De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes.

PubMed

Rivière, Jean-Baptiste; Mirzaa, Ghayda M; O'Roak, Brian J; Beddaoui, Margaret; Alcantara, Diana; Conway, Robert L; St-Onge, Judith; Schwartzentruber, Jeremy A; Gripp, Karen W; Nikkel, Sarah M; Worthylake, Thea; Sullivan, Christopher T; Ward, Thomas R; Butler, Hailly E; Kramer, Nancy A; Albrecht, Beate; Armour, Christine M; Armstrong, Linlea; Caluseriu, Oana; Cytrynbaum, Cheryl; Drolet, Beth A; Innes, A Micheil; Lauzon, Julie L; Lin, Angela E; Mancini, Grazia M S; Meschino, Wendy S; Reggin, James D; Saggar, Anand K; Lerman-Sagie, Tally; Uyanik, Gökhan; Weksberg, Rosanna; Zirn, Birgit; Beaulieu, Chandree L; Majewski, Jacek; Bulman, Dennis E; O'Driscoll, Mark; Shendure, Jay; Graham, John M; Boycott, Kym M; Dobyns, William B

2012-06-24

Megalencephaly-capillary malformation (MCAP) and megalencephaly-polymicrogyria-polydactyly-hydrocephalus (MPPH) syndromes are sporadic overgrowth disorders associated with markedly enlarged brain size and other recognizable features. We performed exome sequencing in 3 families with MCAP or MPPH, and our initial observations were confirmed in exomes from 7 individuals with MCAP and 174 control individuals, as well as in 40 additional subjects with megalencephaly, using a combination of Sanger sequencing, restriction enzyme assays and targeted deep sequencing. We identified de novo germline or postzygotic mutations in three core components of the phosphatidylinositol 3-kinase (PI3K)-AKT pathway. These include 2 mutations in AKT3, 1 recurrent mutation in PIK3R2 in 11 unrelated families with MPPH and 15 mostly postzygotic mutations in PIK3CA in 23 individuals with MCAP and 1 with MPPH. Our data highlight the central role of PI3K-AKT signaling in vascular, limb and brain development and emphasize the power of massively parallel sequencing in a challenging context of phenotypic and genetic heterogeneity combined with postzygotic mosaicism.

Molecular Pathology of Anaplastic Thyroid Carcinomas: A Retrospective Study of 144 Cases.

PubMed

Bonhomme, Benjamin; Godbert, Yann; Perot, Gaelle; Al Ghuzlan, Abir; Bardet, Stéphane; Belleannée, Geneviève; Crinière, Lise; Do Cao, Christine; Fouilloux, Geneviève; Guyetant, Serge; Kelly, Antony; Leboulleux, Sophie; Buffet, Camille; Leteurtre, Emmanuelle; Michels, Jean-Jacques; Tissier, Frédérique; Toubert, Marie-Elisabeth; Wassef, Michel; Pinard, Clémence; Hostein, Isabelle; Soubeyran, Isabelle

2017-05-01

Anaplastic thyroid carcinoma (ATC) is a rare tumor, with poorly defined oncogenic molecular mechanisms and limited therapeutic options contributing to its poor prognosis. The aims of this retrospective study were to determine the frequency of anaplastic lymphoma kinase (ALK) translocations and to identify the mutational profile of ATC including TERT promoter mutations. One hundred and forty-four ATC cases were collected from 10 centers that are a part of the national French network for management of refractory thyroid tumors. Fluorescence in situ hybridization analysis for ALK rearrangement was performed on tissue microarrays. A panel of 50 genes using next-generation sequencing and TERT promoter mutations using Sanger sequencing were also screened. Fluorescence in situ hybridization was interpretable for 90 (62.5%) cases. One (1.1%) case was positive for an ALK rearrangement with a borderline threshold (15% positive cells). Next-generation sequencing results were interpretable for 94 (65.3%) cases, and Sanger sequencing (TERT) for 98 (68.1%) cases. A total of 210 mutations (intronic and exonic) were identified. TP53 alterations were the most frequent (54.4%). Forty-three percent harbored a mutation in the (H-K-N)RAS genes, 13.8% a mutation in the BRAF gene (essentially p.V600E), 17% a PI3K-AKT pathway mutation, 6.4% both RAS and PI3K pathway mutations, and 4.3% both TP53 and PTEN mutations. Nearly 10% of the cases showed no mutations of the RAS, PI3K-AKT pathways, or TP53, with mutations of ALK, ATM, APC, CDKN2A, ERBB2, RET, or SMAD4, including mutations not yet described in thyroid tumors. Genes encoding potentially druggable targets included: mutations in the ATM gene in four (4.3%) cases, in ERBB2 in one (1.1%) case, in MET in one (1.1%) case, and in ALK in one (1.1%) case. A TERT promoter alteration was found in 53 (54.0%) cases, including 43 C228T and 10 C250T mutations. Three out of our cases did not harbor mutations in the panel of genes with therapeutic interest. This study confirms that ALK rearrangements in ATC are rare and that the mutational landscape of ATC is heterogeneous, with many genes implicated in the follicular epithelial cell dedifferentiation process. This may explain the limited effectiveness of targeted therapeutic options tested so far.

Mutational spectrum in breast cancer associated BRCA1 and BRCA2 genes in Colombia

PubMed Central

Gómez-Gutiérrez, Alberto; Díaz-Dussán, Natalia Andrea; Noguera-Santamaría, María Claudia; Díaz-Rincón, Diego; Casas-Gómez, María Consuelo

2017-01-01

Abstract Introduction: The risk of developing breast and ovarian cancer is higher in families that carry mutations in BRCA1 or BRCA2 genes, and timely mutation detection is critical. Objective: To identify the presence of mutations in the Colombian population and evaluate two testing strategies. Methods: From a total universe of 853 individual blood samples referred for BRCA1 and BRCA2 typing, 256 cases were analyzed by complete direct sequencing of both genes in Myriad Genetics, and the remaining 597 cases were studied by partial sequencing based on founder mutations in a PCR test designed by ourselves ("Profile Colombia"). Results: We found 107 patients carrying deleterious mutations in this group of patients, 69 (64.5%) located in BRCA1, and 38 (35.5%) in BRCA2. Overall, we detected 39 previously unreported mutations in Colombia (22 in BRCA1 and 17 in BRCA2) and only 4 out of the 6 previously reported founder mutations. Sixty four out of 597 patients (10.7%) studied by "Profile Colombia" showed mutations in BRCA1 or BRCA2, and 41/256 patients (16%) showed mutations by complete BRCA1-BRCA2 sequencing. Conclusions: The spectrum of 44 different mutations in Colombia as detected in our study is broader than the one previously reported for this country. "Profile Colombia" is a useful screening test to establish both founder and new mutations (detection rate of 10.7%) in cases with family history of breast cancer. Complete sequencing shows a detection rate of 16.0%, and should complement the study of the genetic basis of this disease. PMID:29021639

CFTR gene mutations in isolated chronic obstructive pulmonary disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pignatti, P.F.; Bombien, C.; Marigo, C.

1994-09-01

In order to identify a possible hereditary predisposition to the development of chronic obstructive pulmonary disease (COPD), we have looked for the presence of cystic fibrosis transmembrane regulator (CFTR) gene DNA sequence modifications in 28 unrelated patients with no signs of cystic fibrosis. The known mutations in Italian CF patients, as well as the most frequent worldwide CF mutations, were investigated. In addition, a denaturing gradient gel electrophoresis analysis of about half of the coding sequence of the gene in 56 chromosomes from the patients and in 102 chromosomes from control individuals affected by other pulmonary diseases and from normalmore » controls was performed. Nine different CFTR gene mutations and polymorphisms were found in seven patients, a highly significant increase over controls. Two of the patients were compound heterozygotes. Two frequent CF mutations were detected: deletion F508 and R117H; two rare CF mutations: R1066C and 3667ins4; and five CF sequence variants: R75Q (which was also described as a disease-causing mutation in male sterility cases due to the absence of the vasa deferentia), G576A, 2736 A{r_arrow}G, L997F, and 3271+18C{r_arrow}T. Seven (78%) of the mutations are localized in transmembrane domains. Six (86%) of the patients with defined mutations and polymorphisms had bronchiectasis. These results indicate that CFTR gene mutations and sequence alterations may be involved in the etiopathogenesis of some cases of COPD.« less

Comparison of immunohistochemistry, DNA sequencing and allele-specific PCR for the detection of IDH1 mutations in gliomas.

PubMed

Loussouarn, Delphine; Le Loupp, Anne-Gaëlle; Frenel, Jean-Sébastien; Leclair, François; Von Deimling, Andreas; Aumont, Maud; Martin, Stéphane; Campone, Mario; Denis, Marc G

2012-06-01

Previous studies have identified mutations of the isocitrate dehydrogenase 1 (IDH1) gene in more than 70% of World Health Organization (WHO) grade II and III gliomas. The most frequent mutation leads to a specific amino acid change from arginine to histidine at codon 132 (c.395G>A, p.R132H). IDH1 mutated tumors have a better prognosis than IDH1 non-mutated tumors. The aim of our study was to evaluate and compare the methods of mIDH1 R132H immunohistochemistry, allele-specific PCR and DNA sequencing for determination of IDH1 status. We performed a retrospective study of 91 patients with WHO grade II (n=43) and III (n=48) oligodendrogliomas. A fragment of exon 4 spanning the sequence encoding the catalytic domain of IDH1, including codon 132, was amplified and sequenced using standard conditions. Allele-specific amplification was performed using two forward primers with variations in their 3' nucleotides such that each was specific for the wild-type or the mutated variant, and one reverse primer. Immunohistochemistry was performed with mouse monoclonal mIDH1 R132H. DNA was extracted from FFPE sections following macrodissection. IDH1 mutations were found in 55/90 patients (61.1%) by direct sequencing. R132H mutations were found in 47/55 patients (85.4%). The results of the allele-specific PCR positively correlated with those from DNA sequencing. Other mutations (p.R132C, p.R132S and pR132G) were found by DNA sequencing in 3, 3 and 2 tumors, respectively (8/55 patients, 14.6%). mIDH1 R132H immunostaining was found in the 47 patients presenting the R132H mutation (sensitivity 47/47, 100% for this mutation). None of the tumors presenting a wild-type IDH1 gene were stained (specificity 35/35, 100%). Our results demonstrate that immunohistochemistry using the mIDH1 R132H antibody and allele-specific amplification are highly sensitive techniques to detect the most frequent mutation of the IDH1 gene.

A Proteomic Workflow Using High-Throughput De Novo Sequencing Towards Complementation of Genome Information for Improved Comparative Crop Science.

PubMed

Turetschek, Reinhard; Lyon, David; Desalegn, Getinet; Kaul, Hans-Peter; Wienkoop, Stefanie

2016-01-01

The proteomic study of non-model organisms, such as many crop plants, is challenging due to the lack of comprehensive genome information. Changing environmental conditions require the study and selection of adapted cultivars. Mutations, inherent to cultivars, hamper protein identification and thus considerably complicate the qualitative and quantitative comparison in large-scale systems biology approaches. With this workflow, cultivar-specific mutations are detected from high-throughput comparative MS analyses, by extracting sequence polymorphisms with de novo sequencing. Stringent criteria are suggested to filter for confidential mutations. Subsequently, these polymorphisms complement the initially used database, which is ready to use with any preferred database search algorithm. In our example, we thereby identified 26 specific mutations in two cultivars of Pisum sativum and achieved an increased number (17 %) of peptide spectrum matches.

RHO Mutations (p.W126L and p.A346P) in Two Japanese Families with Autosomal Dominant Retinitis Pigmentosa

PubMed Central

Akahori, Masakazu; Itabashi, Takeshi; Nishino, Jo; Yoshitake, Kazutoshi; Ikeo, Kazuho; Tsuneoka, Hiroshi

2014-01-01

Purpose. To investigate genetic and clinical features of patients with rhodopsin (RHO) mutations in two Japanese families with autosomal dominant retinitis pigmentosa (adRP). Methods. Whole-exome sequence analysis was performed in ten adRP families. Identified RHO mutations for the cosegregation analysis were confirmed by Sanger sequencing. Ophthalmic examinations were performed to evaluate the RP phenotypes. The impact of the RHO mutation on the rhodopsin conformation was examined by molecular modeling analysis. Results. In two adRP families, we identified two RHO mutations (c.377G>T (p.W126L) and c.1036G>C (p.A346P)), one of which was novel. Complete cosegregation was confirmed for each mutation exhibiting the RP phenotype in both families. Molecular modeling predicted that the novel mutation (p.W126L) might impair rhodopsin function by affecting its conformational transition in the light-adapted form. Clinical phenotypes showed that patients with p.W126L exhibited sector RP, whereas patients with p.A346P exhibited classic RP. Conclusions. Our findings demonstrated that the novel mutation (p.W126L) may be associated with the phenotype of sector RP. Identification of RHO mutations is a very useful tool for predicting disease severity and providing precise genetic counseling. PMID:25485142

Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.

PubMed

Baker, Mei W; Atkins, Anne E; Cordovado, Suzanne K; Hendrix, Miyono; Earley, Marie C; Farrell, Philip M

2016-03-01

Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology. An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation. The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified. The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.

Almost 2% of Spanish breast cancer families are associated to germline pathogenic mutations in the ATM gene.

PubMed

Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A

2017-02-01

There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.

Bias-Corrected Targeted Next-Generation Sequencing for Rapid, Multiplexed Detection of Actionable Alterations in Cell-Free DNA from Advanced Lung Cancer Patients.

PubMed

Paweletz, Cloud P; Sacher, Adrian G; Raymond, Chris K; Alden, Ryan S; O'Connell, Allison; Mach, Stacy L; Kuang, Yanan; Gandhi, Leena; Kirschmeier, Paul; English, Jessie M; Lim, Lee P; Jänne, Pasi A; Oxnard, Geoffrey R

2016-02-15

Tumor genotyping is a powerful tool for guiding non-small cell lung cancer (NSCLC) care; however, comprehensive tumor genotyping can be logistically cumbersome. To facilitate genotyping, we developed a next-generation sequencing (NGS) assay using a desktop sequencer to detect actionable mutations and rearrangements in cell-free plasma DNA (cfDNA). An NGS panel was developed targeting 11 driver oncogenes found in NSCLC. Targeted NGS was performed using a novel methodology that maximizes on-target reads, and minimizes artifact, and was validated on DNA dilutions derived from cell lines. Plasma NGS was then blindly performed on 48 patients with advanced, progressive NSCLC and a known tumor genotype, and explored in two patients with incomplete tumor genotyping. NGS could identify mutations present in DNA dilutions at ≥ 0.4% allelic frequency with 100% sensitivity/specificity. Plasma NGS detected a broad range of driver and resistance mutations, including ALK, ROS1, and RET rearrangements, HER2 insertions, and MET amplification, with 100% specificity. Sensitivity was 77% across 62 known driver and resistance mutations from the 48 cases; in 29 cases with common EGFR and KRAS mutations, sensitivity was similar to droplet digital PCR. In two cases with incomplete tumor genotyping, plasma NGS rapidly identified a novel EGFR exon 19 deletion and a missed case of MET amplification. Blinded to tumor genotype, this plasma NGS approach detected a broad range of targetable genomic alterations in NSCLC with no false positives including complex mutations like rearrangements and unexpected resistance mutations such as EGFR C797S. Through use of widely available vacutainers and a desktop sequencing platform, this assay has the potential to be implemented broadly for patient care and translational research. ©2015 American Association for Cancer Research.

Bias-corrected targeted next-generation sequencing for rapid, multiplexed detection of actionable alterations in cell-free DNA from advanced lung cancer patients

PubMed Central

Paweletz, Cloud P.; Sacher, Adrian G.; Raymond, Chris K.; Alden, Ryan S.; O'Connell, Allison; Mach, Stacy L.; Kuang, Yanan; Gandhi, Leena; Kirschmeier, Paul; English, Jessie M.; Lim, Lee P.; Jänne, Pasi A.; Oxnard, Geoffrey R.

2015-01-01

Purpose Tumor genotyping is a powerful tool for guiding non-small cell lung cancer (NSCLC) care, however comprehensive tumor genotyping can be logistically cumbersome. To facilitate genotyping, we developed a next-generation sequencing (NGS) assay using a desktop sequencer to detect actionable mutations and rearrangements in cell-free plasma DNA (cfDNA). Experimental Design An NGS panel was developed targeting 11 driver oncogenes found in NSCLC. Targeted NGS was performed using a novel methodology that maximizes on-target reads, and minimizes artifact, and was validated on DNA dilutions derived from cell lines. Plasma NGS was then blindly performed on 48 patients with advanced, progressive NSCLC and a known tumor genotype, and explored in two patients with incomplete tumor genotyping. Results NGS could identify mutations present in DNA dilutions at ≥0.4% allelic frequency with 100% sensitivity/specificity. Plasma NGS detected a broad range of driver and resistance mutations, including ALK, ROS1, and RET rearrangements, HER2 insertions, and MET amplification, with 100% specificity. Sensitivity was 77% across 62 known driver and resistance mutations from the 48 cases; in 29 cases with common EGFR and KRAS mutations, sensitivity was similar to droplet digital PCR. In two cases with incomplete tumor genotyping, plasma NGS rapidly identified a novel EGFR exon 19 deletion and a missed case of MET amplification. Conclusion Blinded to tumor genotype, this plasma NGS approach detected a broad range of targetable genomic alterations in NSCLC with no false positives including complex mutations like rearrangements and unexpected resistance mutations such as EGFR C797S. Through use of widely available vacutainers and a desktop sequencing platform, this assay has the potential to be implemented broadly for patient care and translational research. PMID:26459174

New MCM8 mutation associated with premature ovarian insufficiency and chromosomal instability in a highly consanguineous Tunisian family.

PubMed

Bouali, Nouha; Francou, Bruno; Bouligand, Jérôme; Imanci, Dilek; Dimassi, Sarra; Tosca, Lucie; Zaouali, Monia; Mougou, Soumaya; Young, Jacques; Saad, Ali; Guiochon-Mantel, Anne

2017-10-01

To identify the gene(s) involved in the etiology of premature ovarian insufficiency in a highly consanguineous Tunisian family. Genetic analysis of a large consanguineous family with several affected siblings. University hospital-based cytogenetics and molecular genetics laboratories. A highly consanguineous Tunisian family with several affected siblings born to healthy second-degree cousins. None. Targeted exome sequencing was performed by next-generation sequencing for affected family members. Mutations were validated by Sanger sequencing. Functional experiments were performed to explore the deleterious effects of the identified mutation. DNA damage was induced by increasing mitomycin C (MMC) concentrations on cultured peripheral lymphocytes. Analysis of the next-generation sequencing data revealed a new homozygous missense mutation in the minichromosome maintenance 8 gene (MCM8).This homozygous mutation (c. 482A>C; p.His161Pro) was predicted to be deleterious and segregated with the disease in the family. MCM8 participates in homologous recombination during meiosis and DNA double-stranded break repair by dimerizing with MCM9. Mcm8 knock out results in an early block in follicle development and small gonads. Given this, we tested the chromosomal breakage repair capacity of homozygous and heterozygous MCM8 p.His161Pro mutation on cultured peripheral lymphocytes exposed to increasing MMC concentrations. We found that chromosomal breakage after MMC exposure was significantly higher in cells from homozygously affected individuals than in those from a healthy control. Our findings provide additional support to the view that MCM8 mutations are involved in the primary ovarian insufficiency phenotype. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Human pluripotent stem cells recurrently acquire and expand dominant negative P53 mutations

PubMed Central

Kamitaki, Nolan; Mitchell, Jana; Avior, Yishai; Mello, Curtis; Kashin, Seva; Mekhoubad, Shila; Ilic, Dusko; Charlton, Maura; Saphier, Genevieve; Handsaker, Robert E.; Genovese, Giulio; Bar, Shiran; Benvenisty, Nissim; McCarroll, Steven A.; Eggan, Kevin

2017-01-01

Human pluripotent stem cells (hPSCs) can self-renew indefinitely, making them an attractive source for regenerative therapies. This expansion potential has been linked with acquisition of large copy number variants (CNVs) that provide mutant cells with a growth advantage in culture1–3. However, the nature, extent, and functional impact of other acquired genome sequence mutations in cultured hPSCs is not known. Here, we sequenced the protein-coding genes (exomes) of 140 independent human embryonic stem cell (hESC) lines, including 26 lines prepared for potential clinical use4. We then applied computational strategies for identifying mutations present in a subset of cells5. Though such mosaic mutations were generally rare, we identified five unrelated hESC lines that carried six mutations in the TP53 gene that encodes the tumor suppressor P53. Notably, the TP53 mutations we observed are dominant negative and are the mutations most commonly seen in human cancers. We used droplet digital PCR to demonstrate that the TP53 mutant allelic fraction increased with passage number under standard culture conditions, suggesting that P53 mutation confers selective advantage. When we then mined published RNA sequencing data from 117 hPSC lines, we observed another nine TP53 mutations, all resulting in coding changes in the DNA binding domain of P53. Strikingly, in three lines, the allelic fraction exceeded 50%, suggesting additional selective advantage resulting from loss of heterozygosity at the TP53 locus. As the acquisition and favored expansion of cancer-associated mutations in hPSCs may go unnoticed during most applications, we suggest that careful genetic characterization of hPSCs and their differentiated derivatives should be carried out prior to clinical use. PMID:28445466

The PCBP1 gene encoding poly(rC) binding protein I is recurrently mutated in Burkitt lymphoma.

PubMed

Wagener, Rabea; Aukema, Sietse M; Schlesner, Matthias; Haake, Andrea; Burkhardt, Birgit; Claviez, Alexander; Drexler, Hans G; Hummel, Michael; Kreuz, Markus; Loeffler, Markus; Rosolowski, Maciej; López, Cristina; Möller, Peter; Richter, Julia; Rohde, Marius; Betts, Matthew J; Russell, Robert B; Bernhart, Stephan H; Hoffmann, Steve; Rosenstiel, Philip; Schilhabel, Markus; Szczepanowski, Monika; Trümper, Lorenz; Klapper, Wolfram; Siebert, Reiner

2015-09-01

The genetic hallmark of Burkitt lymphoma is the translocation t(8;14)(q24;q32), or one of its light chain variants, resulting in IG-MYC juxtaposition. However, these translocations alone are insufficient to drive lymphomagenesis, which requires additional genetic changes for malignant transformation. Recent studies of Burkitt lymphoma using next generation sequencing approaches have identified various recurrently mutated genes including ID3, TCF3, CCND3, and TP53. Here, by using similar approaches, we show that PCBP1 is a recurrently mutated gene in Burkitt lymphoma. By whole-genome sequencing, we identified somatic mutations in PCBP1 in 3/17 (18%) Burkitt lymphomas. We confirmed the recurrence of PCBP1 mutations by Sanger sequencing in an independent validation cohort, finding mutations in 3/28 (11%) Burkitt lymphomas and in 6/16 (38%) Burkitt lymphoma cell lines. PCBP1 is an intron-less gene encoding the 356 amino acid poly(rC) binding protein 1, which contains three K-Homology (KH) domains and two nuclear localization signals. The mutations predominantly (10/12, 83%) affect the KH III domain, either by complete domain loss or amino acid changes. Thus, these changes are predicted to alter the various functions of PCBP1, including nuclear trafficking and pre-mRNA splicing. Remarkably, all six primary Burkitt lymphomas with a PCBP1 mutation expressed MUM1/IRF4, which is otherwise detected in around 20-40% of Burkitt lymphomas. We conclude that PCBP1 mutations are recurrent in Burkitt lymphomas and might contribute, in cooperation with other mutations, to its pathogenesis. © 2015 Wiley Periodicals, Inc.

Linkage Study Revealed Complex Haplotypes in a Multifamily due to Different Mutations in CAPN3 Gene in an Iranian Ethnic Group.

PubMed

Mojbafan, Marzieh; Tonekaboni, Seyed Hassan; Abiri, Maryam; Kianfar, Soudeh; Sarhadi, Ameneh; Nilipour, Yalda; Tavakkoly-Bazzaz, Javad; Zeinali, Sirous

2016-07-01

Calpainopathy is an autosomal recessive form of limb girdle muscular dystrophies which is caused by mutation in CAPN3 gene. In the present study, co-segregation of this disorder was analyzed with four short tandem repeat markers linked to the CAPN3 gene. Three apparently unrelated Iranian families with same ethnicity were investigated. Haplotype analysis and sequencing of the CAPN3 gene were performed. DNA sample from one of the patients was simultaneously sent for next-generation sequencing. DNA sequencing identified two mutations. It was seen as a homozygous c.2105C>T in exon 19 in one family, a homozygous novel mutation c.380G>A in exon 3 in another family, and a compound heterozygote form of these two mutations in the third family. Next-generation sequencing also confirmed our results. It was expected that, due to the rare nature of limb girdle muscular dystrophies, affected individuals from the same ethnic group share similar mutations. Haplotype analysis showed two different homozygote patterns in two families, yet a compound heterozygote pattern in the third family as seen in the mutation analysis. This study shows that haplotype analysis would help in determining presence of different founders.

Two novel mutations of CLCN7 gene in Chinese families with autosomal dominant osteopetrosis (type II).

PubMed

Zheng, Hui; Shao, Chong; Zheng, Yan; He, Jin-Wei; Fu, Wen-Zhen; Wang, Chun; Zhang, Zhen-Lin

2016-07-01

Autosomal dominant osteopetrosis type II (ADO-II) is a heritable bone disorder characterized by osteosclerosis, predominantly involving the spine (vertebral end-plate thickening, or rugger-jersey spine), the pelvis ("bone-within-bone" structures) and the skull base. Chloride channel 7 (CLCN7) has been reported to be the causative gene. In this study, we aimed to identify the pathogenic mutation in four Chinese families with ADO-II. All 25 exons of the CLCN7 gene, including the exon-intron boundaries, were amplified and sequenced directly in four probands from the Chinese families with ADO-II. The mutation site was then identified in other family members and 250 healthy controls. In family 1, a known missense mutation c.296A>G in exon 4 of CLCN7 was identified in the proband, resulting in a tyrosine (UAU) to cysteine (UGU) substitution at p.99 (Y99C); the mutation was also identified in his affected father. In family 2, a novel missense mutation c.865G>C in exon 10 was identified in the proband, resulting in a valine (GUC) to leucine (CUC) substitution at p.289 (V289L); the mutation was also identified in her healthy mother and sister. In family 3, a novel missense mutation c.1625C>T in exon 17 of CLCN7 was identified in the proband, resulting in an alanine (GCG) to valine (GUG) substitution at p.542 (A542V); the mutation was also identified in her father. In family 4, a hot spot, R767W (c.2299C>T, CGG>TGG), in exon 24 was found in the proband which once again proved the susceptibility of the site or the similar genetic background in different races. Moreover, two novel mutations, V289L and A542V, occurred at a highly conserved position, found by a comparison of the protein sequences from eight vertebrates, and were predicted to have a pathogenic effect by PolyPhen-2 software, which showed "probably damaging" with a score of approximately 1. These mutation sites were not identified in 250 healthy controls. Our present findings suggest that the novel missense mutations V289L and A542V in the CLCN7 gene were responsible for ADO-II in the two Chinese families.

A gradient-boosting approach for filtering de novo mutations in parent-offspring trios.

PubMed

Liu, Yongzhuang; Li, Bingshan; Tan, Renjie; Zhu, Xiaolin; Wang, Yadong

2014-07-01

Whole-genome and -exome sequencing on parent-offspring trios is a powerful approach to identifying disease-associated genes by detecting de novo mutations in patients. Accurate detection of de novo mutations from sequencing data is a critical step in trio-based genetic studies. Existing bioinformatic approaches usually yield high error rates due to sequencing artifacts and alignment issues, which may either miss true de novo mutations or call too many false ones, making downstream validation and analysis difficult. In particular, current approaches have much worse specificity than sensitivity, and developing effective filters to discriminate genuine from spurious de novo mutations remains an unsolved challenge. In this article, we curated 59 sequence features in whole genome and exome alignment context which are considered to be relevant to discriminating true de novo mutations from artifacts, and then employed a machine-learning approach to classify candidates as true or false de novo mutations. Specifically, we built a classifier, named De Novo Mutation Filter (DNMFilter), using gradient boosting as the classification algorithm. We built the training set using experimentally validated true and false de novo mutations as well as collected false de novo mutations from an in-house large-scale exome-sequencing project. We evaluated DNMFilter's theoretical performance and investigated relative importance of different sequence features on the classification accuracy. Finally, we applied DNMFilter on our in-house whole exome trios and one CEU trio from the 1000 Genomes Project and found that DNMFilter could be coupled with commonly used de novo mutation detection approaches as an effective filtering approach to significantly reduce false discovery rate without sacrificing sensitivity. The software DNMFilter implemented using a combination of Java and R is freely available from the website at http://humangenome.duke.edu/software. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Rapid-Onset Obesity with Hypothalamic Dysfunction, Hypoventilation, and Autonomic Dysregulation (ROHHAD): exome sequencing of trios, monozygotic twins and tumours.

PubMed

Barclay, Sarah F; Rand, Casey M; Borch, Lauren A; Nguyen, Lisa; Gray, Paul A; Gibson, William T; Wilson, Richard J A; Gordon, Paul M K; Aung, Zaw; Berry-Kravis, Elizabeth M; Ize-Ludlow, Diego; Weese-Mayer, Debra E; Bech-Hansen, N Torben

2015-08-25

Rapid-onset Obesity with Hypothalamic Dysfunction, Hypoventilation, and Autonomic Dysregulation (ROHHAD) is thought to be a genetic disease caused by de novo mutations, though causative mutations have yet to be identified. We searched for de novo coding mutations among a carefully-diagnosed and clinically homogeneous cohort of 35 ROHHAD patients. We sequenced the exomes of seven ROHHAD trios, plus tumours from four of these patients and the unaffected monozygotic (MZ) twin of one (discovery cohort), to identify constitutional and somatic de novo sequence variants. We further analyzed this exome data to search for candidate genes under autosomal dominant and recessive models, and to identify structural variations. Candidate genes were tested by exome or Sanger sequencing in a replication cohort of 28 ROHHAD singletons. The analysis of the trio-based exomes found 13 de novo variants. However, no two patients had de novo variants in the same gene, and additional patient exomes and mutation analysis in the replication cohort did not provide strong genetic evidence to implicate any of these sequence variants in ROHHAD. Somatic comparisons revealed no coding differences between any blood and tumour samples, or between the two discordant MZ twins. Neither autosomal dominant nor recessive analysis yielded candidate genes for ROHHAD, and we did not identify any potentially causative structural variations. Clinical exome sequencing is highly unlikely to be a useful diagnostic test in patients with true ROHHAD. As ROHHAD has a high risk for fatality if not properly managed, it remains imperative to expand the search for non-exomic genetic risk factors, as well as to investigate other possible mechanisms of disease. In so doing, we will be able to confirm objectively the ROHHAD diagnosis and to contribute to our understanding of obesity, respiratory control, hypothalamic function, and autonomic regulation.

Missense variants in plakophilin-2 in arrhythmogenic right ventricular cardiomyopathy patients--disease-causing or innocent bystanders?

PubMed

Christensen, Alex Hørby; Benn, Marianne; Tybjaerg-Hansen, Anne; Haunso, Stig; Svendsen, Jesper Hastrup

2010-01-01

Mutations in genes encoding desmosomal proteins have been linked to arrhythmogenic right ventricular cardiomyopathy/dysplasia (ARVC/D). We hypothesized that a Scandinavian ARVC/D population would have a different spectrum of plakophilin-2 (PKP2) mutations and that some of the reported missense mutations may not be pathogenic. We screened 53 unrelated patients fulfilling Task Force criteria for ARVC/D for mutations in PKP2 by direct sequencing. Seven different mutations were identified: two insertion/deletions (E329fsX352, P401fsX406), 1 splice site (2146-2A>T), 1 non-sense (R79X) and 4 missense mutations (Q62K in 2 patients, G489R, G673V) of undeterminable pathogeneity. None of these mutations was present in 650 controls. Five of the mutations were novel. Seven patients carried reported missense mutations (D26N, S140F, V587I); however, these mutations were identified in our healthy controls, although at a lower frequency. Evaluation of all reported missense mutations in PKP2 showed unclear pathogeneity of several reported mutations. Fifteen percent of Danish ARVC/D patients carried PKP2 mutations. Our finding of reported disease-causing mutations at a low frequency among healthy controls suggests that these variants are disease modifying but not directly disease causing. We recommend conservative interpretation of missense variants in PKP2, functional characterization and large-scale sequencing to clarify normal variation in the gene.

[Mutational frequencies in usherin(USH2A gene) in 26 Colombian individuals with Usher syndrome type II].

PubMed

López, Greizy; Gelvez, Nancy Yaneth; Tamayo, Martalucía

2011-03-01

Usher syndrome is a disorder characterized by progressive retinitis pigmentosa, prelingual sensory hearing loss and vestibular dysfunction. It is the most frequent cause of deaf-blindness in humans. Three clinical types and twelve genetic subtypes have been characterized. Type II is the most common, and among these cases, nearly 80% have mutations in the USH2A gene. The aim of the study was to establish the mutational frequencies for the short isoform of USH2A gene in Usher syndrome type II. Twenty-six Colombian individuals with Usher syndrome type II were included. SSCP analysis for 20 exons of the short isoform was performed and abnormal patterns were sequenced. Sequencing of exon 13 of the USH2A gene was performed for all the individuals because the most frequent mutation is located in this exon. The most frequent mutation was c.2299delG, identified in the 27% (n=8) of the sample. The second mutation, p.R334W, showed a frequency of 15%. A new variant identified in the 5’UTR region, g.129G>T, was present in 1 individual (4%). Four polymorphisms were identified; one of them is a new deletion in exon 20, first reported in this study. Mutations in the usherin short isoform were identified in 38% of a sample of 26 USH2 cases. Molecular diagnosis was established in 7 of the 26.

Selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile, and accurate RNA structure analysis

PubMed Central

Smola, Matthew J.; Rice, Greggory M.; Busan, Steven; Siegfried, Nathan A.; Weeks, Kevin M.

2016-01-01

SHAPE chemistries exploit small electrophilic reagents that react with the 2′-hydroxyl group to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues based on the ability of reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as for simple model RNAs. This protocol describes the experimental steps, implemented over three days, required to perform SHAPE probing and construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. These steps include RNA folding and SHAPE structure probing, mutational profiling by reverse transcription, library construction, and sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots, and provides useful troubleshooting information, often within an hour. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures, and visualize probable and alternative helices, often in under a day. We illustrate these algorithms with the E. coli thiamine pyrophosphate riboswitch, E. coli 16S rRNA, and HIV-1 genomic RNAs. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles, and entire transcriptomes. The straightforward MaP strategy greatly expands the number, length, and complexity of analyzable RNA structures. PMID:26426499

Actionable mutations in canine hemangiosarcoma

PubMed Central

Wang, Guannan; Wu, Ming; Maloneyhuss, Martha A.; Wojcik, John; Durham, Amy C.; Mason, Nicola J.

2017-01-01

Background Angiosarcomas (AS) are rare in humans, but they are a deadly subtype of soft tissue sarcoma. Discovery sequencing in AS, especially the visceral form, is hampered by the rarity of cases. Most diagnostic material exists as archival formalin fixed, paraffin embedded tissue which serves as a poor source of high quality DNA for genome-wide sequencing. We approached this problem through comparative genomics. We hypothesized that exome sequencing a histologically similar tumor, hemangiosarcoma (HSA), that occurs in approximately 50,000 dogs per year, may lead to the identification of potential oncogenic drivers and druggable targets that could also occur in angiosarcoma. Methods Splenic hemangiosarcomas are common in dogs, which allowed us to collect a cohort of archived matched tumor and normal tissue samples suitable for whole exome sequencing. Mapping of the reads to the latest canine reference genome (Canfam3) demonstrated that >99% of the targeted exomal regions were covered, with >80% at 20X coverage and >90% at 10X coverage. Results and conclusions Sequence analysis of 20 samples identified somatic mutations in PIK3CA, TP53, PTEN, and PLCG1, all of which correspond to well-known tumor drivers in human cancer, in more than half of the cases. In one case, we identified a mutation in PLCG1 identical to a mutation observed previously in this gene in human visceral AS. Activating PIK3CA mutations present novel therapeutic targets, and clinical trials of targeted inhibitors are underway in human cancers. Our results lay a foundation for similar clinical trials in canine HSA, enabling a precision medicine approach to this disease. PMID:29190660

Actionable mutations in canine hemangiosarcoma.

PubMed

Wang, Guannan; Wu, Ming; Maloneyhuss, Martha A; Wojcik, John; Durham, Amy C; Mason, Nicola J; Roth, David B

2017-01-01

Angiosarcomas (AS) are rare in humans, but they are a deadly subtype of soft tissue sarcoma. Discovery sequencing in AS, especially the visceral form, is hampered by the rarity of cases. Most diagnostic material exists as archival formalin fixed, paraffin embedded tissue which serves as a poor source of high quality DNA for genome-wide sequencing. We approached this problem through comparative genomics. We hypothesized that exome sequencing a histologically similar tumor, hemangiosarcoma (HSA), that occurs in approximately 50,000 dogs per year, may lead to the identification of potential oncogenic drivers and druggable targets that could also occur in angiosarcoma. Splenic hemangiosarcomas are common in dogs, which allowed us to collect a cohort of archived matched tumor and normal tissue samples suitable for whole exome sequencing. Mapping of the reads to the latest canine reference genome (Canfam3) demonstrated that >99% of the targeted exomal regions were covered, with >80% at 20X coverage and >90% at 10X coverage. Sequence analysis of 20 samples identified somatic mutations in PIK3CA, TP53, PTEN, and PLCG1, all of which correspond to well-known tumor drivers in human cancer, in more than half of the cases. In one case, we identified a mutation in PLCG1 identical to a mutation observed previously in this gene in human visceral AS. Activating PIK3CA mutations present novel therapeutic targets, and clinical trials of targeted inhibitors are underway in human cancers. Our results lay a foundation for similar clinical trials in canine HSA, enabling a precision medicine approach to this disease.

Comparative Genomic Analysis of Two Clonally Related Multidrug Resistant Mycobacterium tuberculosis by Single Molecule Real Time Sequencing.

PubMed

Leung, Kenneth Siu-Sing; Siu, Gilman Kit-Hang; Tam, Kingsley King-Gee; To, Sabrina Wai-Chi; Rajwani, Rahim; Ho, Pak-Leung; Wong, Samson Sai-Yin; Zhao, Wei W; Ma, Oliver Chiu-Kit; Yam, Wing-Cheong

2017-01-01

Background: Multidrug-resistant tuberculosis (MDR-TB) is posing a major threat to global TB control. In this study, we focused on two consecutive MDR-TB isolated from the same patient before and after the initiation of anti-TB treatment. To better understand the genomic characteristics of MDR-TB, Single Molecule Real-Time (SMRT) Sequencing and comparative genomic analyses was performed to identify mutations that contributed to the stepwise development of drug resistance and growth fitness in MDR-TB under in vivo challenge of anti-TB drugs. Result: Both pre-treatment and post-treatment strain demonstrated concordant phenotypic and genotypic susceptibility profiles toward rifampicin, pyrazinamide, streptomycin, fluoroquinolones, aminoglycosides, cycloserine, ethionamide, and para-aminosalicylic acid. However, although both strains carried identical missense mutations at rpoB S531L, inhA C-15T, and embB M306V, MYCOTB Sensititre assay showed that the post-treatment strain had 16-, 8-, and 4-fold elevation in the minimum inhibitory concentrations (MICs) toward rifabutin, isoniazid, and ethambutol respectively. The results have indicated the presence of additional resistant-related mutations governing the stepwise development of MDR-TB. Further comparative genomic analyses have identified three additional polymorphisms between the clinical isolates. These include a single nucleotide deletion at nucleotide position 360 of rv0888 in pre-treatment strain, and a missense mutation at rv3303c ( lpdA) V44I and a 6-bp inframe deletion at codon 67-68 in rv2071c ( cobM) in the post-treatment strain. Multiple sequence alignment showed that these mutations were occurring at highly conserved regions among pathogenic mycobacteria. Using structural-based and sequence-based algorithms, we further predicted that the mutations potentially have deleterious effect on protein function. Conclusion: This is the first study that compared the full genomes of two clonally-related MDR-TB clinical isolates during the course of anti-TB treatment. Our work has demonstrated the robustness of SMRT Sequencing in identifying mutations among MDR-TB clinical isolates. Comparative genome analysis also suggested novel mutations at rv0888, lpdA , and cobM that might explain the difference in antibiotic resistance and growth pattern between the two MDR-TB strains.

Exome Sequencing and Linkage Analysis Identified Novel Candidate Genes in Recessive Intellectual Disability Associated with Ataxia.

PubMed

Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia

2015-10-01

Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).

Mutations in the novel gene FOPV are associated with familial autosomal dominant and non-familial obliterative portal venopathy.

PubMed

Besmond, Claude; Valla, Dominique; Hubert, Laurence; Poirier, Karine; Grosse, Brigitte; Guettier, Catherine; Bernard, Olivier; Gonzales, Emmanuel; Jacquemin, Emmanuel

2018-02-01

Obliterative portal venopathy (OPV) is characterized by lesions of portal vein intrahepatic branches and is thought to be responsible for many cases of portal hypertension in the absence of cirrhosis or obstruction of large portal or hepatic veins. In most cases the cause of OPV remains unknown. The aim was to identify a candidate gene of OPV. Whole exome sequencing was performed in two families, including 6 patients with OPV. Identified mutations were confirmed by Sanger sequencing and expression of candidate gene transcript was studied by real time qPCR in human tissues. In both families, no mutations were identified in genes previously reported to be associated with OPV. In each family, we identified a heterozygous mutation (c.1783G>A, p.Gly595Arg and c.4895C>T, p.Thr1632Ile) in a novel gene located on chromosome 4, that we called FOPV (Familial Obliterative Portal Venopathy), and having a cDNA coding for 1793 amino acids. The FOPV mutations segregated with the disease in families and the pattern of inheritance was suggestive of autosomal dominant inherited OPV, with incomplete penetrance and variable expressivity. In silico analysis predicted a deleterious effect of each mutant and mutations concerned highly conserved amino acids in mammals. A deleterious heterozygous FOPV missense mutation (c.4244T>C, p.Phe1415Ser) was also identified in a patient with non-familial OPV. Expression study in liver veins showed that FOPV transcript was mainly expressed in intrahepatic portal vein. This report suggests that FOPV mutations may have a pathogenic role in some cases of familial and non-familial OPV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

EZH2 mutations and promoter hypermethylation in childhood acute lymphoblastic leukemia.

PubMed

Schäfer, Vivien; Ernst, Jana; Rinke, Jenny; Winkelmann, Nils; Beck, James F; Hochhaus, Andreas; Gruhn, Bernd; Ernst, Thomas

2016-07-01

Acute lymphoblastic leukemia (ALL) is the most common malignancy in children and young adults. The polycomb repressive complex 2 (PRC2) has been identified as one of the most frequently mutated epigenetic protein complexes in hematologic cancers. PRC2 acts as an epigenetic repressor through histone H3 lysine 27 trimethylation (H3K27me3), catalyzed by the histone methyltransferase enhancer of zeste homolog 2 protein (EZH2). To study the prevalence and clinical impact of PRC2 aberrations in an unselected childhood ALL cohort (n = 152), we performed PRC2 mutational screenings by Sanger sequencing and promoter methylation analyses by quantitative pyrosequencing for the three PRC2 core component genes EZH2, suppressor of zeste 12 (SUZ12), and embryonic ectoderm development (EED). Targeted deep next-generation sequencing of 30 frequently mutated genes in leukemia was performed to search for cooperating mutations in patients harboring PRC2 aberrations. Finally, the functional consequence of EZH2 promoter hypermethylation on H3K27me3 was studied by Western blot analyses of primary cells. Loss-of-function EZH2 mutations were detected in 2/152 (1.3 %) patients with common-ALL and early T-cell precursor (ETP)-ALL, respectively. In one patient, targeted deep sequencing identified cooperating mutations in ASXL1 and TET2. EZH2 promoter hypermethylation was found in one patient with ETP-ALL which led to reduced H3K27me3. In comparison with healthy children, the EZH2 promoter was significantly higher methylated in T-ALL patients. No mutations or promoter methylation changes were identified for SUZ12 or EED genes, respectively. Although PRC2 aberrations seem to be rare in childhood ALL, our findings indicate that EZH2 aberrations might contribute to the disease in specific cases. Hereby, EZH2 promoter hypermethylation might have functionally similar consequences as loss-of-function mutations.

Juvenile retinoschisis: a model for molecular diagnostic testing of X-linked ophthalmic disease.

PubMed

Sieving, P A; Yashar, B M; Ayyagari, R

1999-01-01

X-linked juvenile retinoschisis (RS) provides a starting point to define clinical paradigms and understand the limitations of diagnostic molecular testing. The RS phenotype is specific, but the broad severity range is clinically confusing. Molecular diagnostic testing obviates unnecessary examinations for boys at-risk and identifies carrier females who otherwise show no clinical signs. The XLRS1 gene has 6 exons of 26-196 base-pair size. Each exon is amplified by a single polymerase chain reaction and then sequenced, starting with exons 4 through 6, which contain mutation "hot spots." The 6 XLRS1 exons are sequenced serially. If alterations are found, they are compared with mutations in our > 120 XLRS families and with the > 300 mutations reported worldwide. Point mutations, small deletions, or rearrangements are identified in nearly 90% of males with a clinical diagnosis of RS. XLRS1 has very few sequence polymorphisms. Carrier-state testing produces 1 of 3 results: (1) positive, in which the woman has the same mutation as an affected male relative or known in other RS families; (2) negative, in which she lacks the mutation of her affected male relative; and (3) uninformative, in which no known mutation is identified or no information exists about the familial mutation. Molecular RS screening is an effective diagnostic tool that complements the clinician's skills for early detection of at-risk males. Useful outcomes of carrier testing depend on several factors: (1) a male relative with a clear clinical diagnosis; (2) a well-defined inheritance pattern; (3) high disease penetrance; (4) size and organization of the gene; and (5) the types of disease-associated mutations. Ethical questions include molecular diagnostic testing of young at-risk females before the age of consent, the impact of this information on the emotional health of the patient and family, and issues of employability and insurance coverage.

Juvenile retinoschisis: a model for molecular diagnostic testing of X-linked ophthalmic disease.

PubMed Central

Sieving, P A; Yashar, B M; Ayyagari, R

1999-01-01

BACKGROUND AND PURPOSE: X-linked juvenile retinoschisis (RS) provides a starting point to define clinical paradigms and understand the limitations of diagnostic molecular testing. The RS phenotype is specific, but the broad severity range is clinically confusing. Molecular diagnostic testing obviates unnecessary examinations for boys at-risk and identifies carrier females who otherwise show no clinical signs. METHODS: The XLRS1 gene has 6 exons of 26-196 base-pair size. Each exon is amplified by a single polymerase chain reaction and then sequenced, starting with exons 4 through 6, which contain mutation "hot spots." RESULTS: The 6 XLRS1 exons are sequenced serially. If alterations are found, they are compared with mutations in our > 120 XLRS families and with the > 300 mutations reported worldwide. Point mutations, small deletions, or rearrangements are identified in nearly 90% of males with a clinical diagnosis of RS. XLRS1 has very few sequence polymorphisms. Carrier-state testing produces 1 of 3 results: (1) positive, in which the woman has the same mutation as an affected male relative or known in other RS families; (2) negative, in which she lacks the mutation of her affected male relative; and (3) uninformative, in which no known mutation is identified or no information exists about the familial mutation. CONCLUSIONS: Molecular RS screening is an effective diagnostic tool that complements the clinician's skills for early detection of at-risk males. Useful outcomes of carrier testing depend on several factors: (1) a male relative with a clear clinical diagnosis; (2) a well-defined inheritance pattern; (3) high disease penetrance; (4) size and organization of the gene; and (5) the types of disease-associated mutations. Ethical questions include molecular diagnostic testing of young at-risk females before the age of consent, the impact of this information on the emotional health of the patient and family, and issues of employability and insurance coverage. Images FIGURE 2A FIGURE 2B PMID:10703138

Clinical and molecular characterization of a novel INS mutation identified in patients with MODY phenotype.

PubMed

Piccini, Barbara; Artuso, Rosangela; Lenzi, Lorenzo; Guasti, Monica; Braccesi, Giulia; Barni, Federica; Casalini, Emilio; Giglio, Sabrina; Toni, Sonia

2016-11-01

Correct diagnosis of Maturity-Onset Diabetes of the Young (MODY) is based on genetic tests requiring an appropriate subject selection by clinicians. Mutations in the insulin (INS) gene rarely occur in patients with MODY. This study is aimed at determining the genetic background and clinical phenotype in patients with suspected MODY. 34 patients with suspected MODY, negative for mutations in the GCK, HNF1α, HNF4α, HNF1β and PDX1 genes, were screened by next generation sequencing (NGS). A heterozygous INS mutation was identified in 4 members of the same family. First genetic tests performed identified two heterozygous silent nucleotide substitutions in MODY3/HNF1α gene. An ineffective attempt to suspend insulin therapy, administering repaglinide and sulphonylureas, was made. DNA was re-sequenced by NGS investigating a set of 102 genes. Genes implicated in the pathway of pancreatic β-cells, candidate genes for type 2 diabetes mellitus and genes causative of diabetes in mice were selected. A novel heterozygous variant in human preproinsulin INS gene (c.125T > C) was found in the affected family members. The new INS mutation broadens the spectrum of possible INS phenotypes. Screening for INS mutations is warranted not only in neonatal diabetes but also in MODYx patients and in selected patients with type 1 diabetes mellitus negative for autoantibodies. Subjects with complex diseases without a specific phenotype should be studied by NGS because Sanger sequencing is ineffective and time consuming in detecting rare variants. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

The molecular genetic makeup of acute lymphoblastic leukemia.

PubMed

Mullighan, Charles G

2012-01-01

Genomic profiling has transformed our understanding of the genetic basis of acute lymphoblastic leukemia (ALL). Recent years have seen a shift from microarray analysis and candidate gene sequencing to next-generation sequencing. Together, these approaches have shown that many ALL subtypes are characterized by constellations of structural rearrangements, submicroscopic DNA copy number alterations, and sequence mutations, several of which have clear implications for risk stratification and targeted therapeutic intervention. Mutations in genes regulating lymphoid development are a hallmark of ALL, and alterations of the lymphoid transcription factor gene IKZF1 (IKAROS) are associated with a high risk of treatment failure in B-ALL. Approximately 20% of B-ALL cases harbor genetic alterations that activate kinase signaling that may be amenable to treatment with tyrosine kinase inhibitors, including rearrangements of the cytokine receptor gene CRLF2; rearrangements of ABL1, JAK2, and PDGFRB; and mutations of JAK1 and JAK2. Whole-genome sequencing has also identified novel targets of mutation in aggressive T-lineage ALL, including hematopoietic regulators (ETV6 and RUNX1), tyrosine kinases, and epigenetic regulators. Challenges for the future are to comprehensively identify and experimentally validate all genetic alterations driving leukemogenesis and treatment failure in childhood and adult ALL and to implement genomic profiling into the clinical setting to guide risk stratification and targeted therapy.

Whole-exome sequencing of primary plasma cell leukemia discloses heterogeneous mutational patterns.

PubMed

Cifola, Ingrid; Lionetti, Marta; Pinatel, Eva; Todoerti, Katia; Mangano, Eleonora; Pietrelli, Alessandro; Fabris, Sonia; Mosca, Laura; Simeon, Vittorio; Petrucci, Maria Teresa; Morabito, Fortunato; Offidani, Massimo; Di Raimondo, Francesco; Falcone, Antonietta; Caravita, Tommaso; Battaglia, Cristina; De Bellis, Gianluca; Palumbo, Antonio; Musto, Pellegrino; Neri, Antonino

2015-07-10

Primary plasma cell leukemia (pPCL) is a rare and aggressive form of plasma cell dyscrasia and may represent a valid model for high-risk multiple myeloma (MM). To provide novel information concerning the mutational profile of this disease, we performed the whole-exome sequencing of a prospective series of 12 pPCL cases included in a Phase II multicenter clinical trial and previously characterized at clinical and molecular levels. We identified 1, 928 coding somatic non-silent variants on 1, 643 genes, with a mean of 166 variants per sample, and only few variants and genes recurrent in two or more samples. An excess of C > T transitions and the presence of two main mutational signatures (related to APOBEC over-activity and aging) occurring in different translocation groups were observed. We identified 14 candidate cancer driver genes, mainly involved in cell-matrix adhesion, cell cycle, genome stability, RNA metabolism and protein folding. Furthermore, integration of mutation data with copy number alteration profiles evidenced biallelically disrupted genes with potential tumor suppressor functions. Globally, cadherin/Wnt signaling, extracellular matrix and cell cycle checkpoint resulted the most affected functional pathways. Sequencing results were finally combined with gene expression data to better elucidate the biological relevance of mutated genes. This study represents the first whole-exome sequencing screen of pPCL and evidenced a remarkable genetic heterogeneity of mutational patterns. This may provide a contribution to the comprehension of the pathogenetic mechanisms associated with this aggressive form of PC dyscrasia and potentially with high-risk MM.

Aggrecan Mutations in Nonfamilial Short Stature and Short Stature Without Accelerated Skeletal Maturation.

PubMed

Tatsi, Christina; Gkourogianni, Alexandra; Mohnike, Klaus; DeArment, Diana; Witchel, Selma; Andrade, Anenisia C; Markello, Thomas C; Baron, Jeffrey; Nilsson, Ola; Jee, Youn Hee

2017-08-01

Aggrecan, a proteoglycan, is an important component of cartilage extracellular matrix, including that of the growth plate. Heterozygous mutations in ACAN , the gene encoding aggrecan, cause autosomal dominant short stature, accelerated skeletal maturation, and joint disease. The inheritance pattern and the presence of bone age equal to or greater than chronological age have been consistent features, serving as diagnostic clues. From family 1, a 6-year-old boy presented with short stature [height standard deviation score (SDS), -1.75] and bone age advanced by 3 years. There was no family history of short stature (height SDS: father, -0.76; mother, 0.7). Exome sequencing followed by Sanger sequencing identified a de novo novel heterozygous frameshift mutation in ACAN (c.6404delC: p.A2135Dfs). From family 2, a 12-year-old boy was evaluated for short stature (height SDS, -3.9). His bone age at the time of genetic evaluation was approximately 1 year less than his chronological age. Family history was consistent with an autosomal dominant inheritance of short stature, with several affected members also showing early-onset osteoarthritis. Exome sequencing, confirmed by Sanger sequencing, identified a novel nonsense mutation in ACAN (c.4852C>T: p.Q1618X), which cosegregated with the phenotype. In conclusion, patients with ACAN mutations may present with nonfamilial short stature and with bone age less than chronological age. These findings expand the known phenotypic spectrum of heterozygous ACAN mutations and indicate that this diagnosis should be considered in children without a family history of short stature and in children without accelerated skeletal maturation.

A family with the Arg103Pro mutation in the NEUROD1 gene detected by next-generation sequencing - Clinical characteristics of mutation carriers.

PubMed

Szopa, Magdalena; Ludwig-Galezowska, Agnieszka H; Radkowski, Piotr; Skupien, Jan; Machlowska, Julita; Klupa, Tomasz; Wolkow, Pawel; Borowiec, Maciej; Mlynarski, Wojciech; Malecki, Maciej T

2016-02-01

Until now only a few families with early onset autosomal diabetes due to the NEUROD1 gene mutations have been identified. Moreover, only some of them meet strict MODY (maturity-onset diabetes of the young) criteria. Next-generation sequencing (NGS) provides an opportunity to detect more pathogenic mutations in this gene. Here, we evaluated the segregation of the Arg103Pro mutation in the NEUROD1 gene in a pedigree in which it was detected, and described the clinical characteristics of the mutation carriers. We included 156 diabetic probands of MODY families, among them 52 patients earlier tested for GCK-MODY and/or HNF1A-MODY by Sanger sequencing with negative results. Genetic testing was performed by targeted NGS sequencing using a panel of 28 monogenic diabetes genes. As detected by NGS, one patient had the missense Arg103Pro (CGC/CCC) mutation in the gene NEUROD1 changing the amino-acid structure of the DNA binding domain of this transcription factor. We confirmed this sequence difference by Sanger sequencing. This family had previously been tested with negative results for HNF1A gene mutations. 17 additional members of this family were invited for further testing. We confirmed the presence of the mutation in 11 subjects. Seven adult mutation carriers (all but one) from three generations had been already diagnosed with diabetes. There were 3 individuals with the Arg103Pro mutation diagnosed before the age of 30 years in the family. The range of age of the four unaffected mutation carriers (3 minors and 1 adult) was 3-48 years. Interestingly, one mutation carrier had a history of transient neonatal hypoglycemia, of which the clinical course resembled episodes typical for HNF4A-MODY. We report a family with autosomal dominant diabetes related to a new NEUROD1 mutation, one of very few meeting MODY criteria. The use of the NGS method will facilitate identification of more families with rare forms of MODY. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

A rapid NGS strategy for comprehensive molecular diagnosis of Birt-Hogg-Dubé syndrome in patients with primary spontaneous pneumothorax.

PubMed

Zhang, Xinxin; Ma, Dehua; Zou, Wei; Ding, Yibing; Zhu, Chengchu; Min, Haiyan; Zhang, Bin; Wang, Wei; Chen, Baofu; Ye, Minhua; Cai, Minghui; Pan, Yanqing; Cao, Lei; Wan, Yueming; Jin, Yu; Gao, Qian; Yi, Long

2016-05-27

Primary spontaneous pneumothorax (PSP) or pulmonary cysts is one of the manifestations of Birt-Hogg-Dube syndrome (BHDS) that is caused by heterozygous mutations in FLCN gene. Most of the mutations are SNVs and small indels, and there are also approximately 10 % large intragenic deletions and duplications of the mutations. These molecular findings are generally obtained by disparate methods including Sanger sequencing and Multiple Ligation-dependent Probe Amplification in the clinical laboratory. In addition, as a genetically heterogeneous disorder, PSP may be caused by mutations in multiple genes include FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 genes. For differential diagnosis, these genes should also be screened which makes the diagnostic procedure more time-consuming and labor-intensive. Forty PSP patients were divided into 2 groups. Nineteen patients with different pathogenic mutations of FLCN previously identified by conventional Sanger sequencing and MLPA were included in test group, 21 random PSP patients without any genetic screening were included in blinded sample group. 7 PSP genes including FLCN, FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 were designed and enriched by Haloplex system, sequenced on a Miseq platform and analyzed in the 40 patients to evaluate the performance of the targeted-NGS method. We demonstrated that the full spectrum of genes associated with pneumothorax including FLCN gene mutations can be identified simultaneously in multiplexed sequence data. Noteworthy, by our in-house copy number analysis of the sequence data, we could not only detect intragenic deletions, but also determine approximate deletion junctions simultaneously. NGS based Haloplex target enrichment technology is proved to be a rapid and cost-effective screening strategy for the comprehensive molecular diagnosis of BHDS in PSP patients, as it can replace Sanger sequencing and MLPA by simultaneously detecting exonic and intronic SNVs, small indels, large intragenic deletions and determining deletion junctions in PSP-related genes.

Ultra-deep sequencing reveals high prevalence and broad structural diversity of hepatitis B surface antigen mutations in a global population

PubMed Central

Gencay, Mikael; Hübner, Kirsten; Gohl, Peter; Seffner, Anja; Weizenegger, Michael; Neofytos, Dionysios; Batrla, Richard; Woeste, Andreas; Kim, Hyon-suk; Westergaard, Gaston; Reinsch, Christine; Brill, Eva; Thu Thuy, Pham Thi; Hoang, Bui Huu; Sonderup, Mark; Spearman, C. Wendy; Pabinger, Stephan; Gautier, Jérémie; Brancaccio, Giuseppina; Fasano, Massimo; Santantonio, Teresa; Gaeta, Giovanni B.; Nauck, Markus; Kaminski, Wolfgang E.

2017-01-01

The diversity of the hepatitis B surface antigen (HBsAg) has a significant impact on the performance of diagnostic screening tests and the clinical outcome of hepatitis B infection. Neutralizing or diagnostic antibodies against the HBsAg are directed towards its highly conserved major hydrophilic region (MHR), in particular towards its “a” determinant subdomain. Here, we explored, on a global scale, the genetic diversity of the HBsAg MHR in a large, multi-ethnic cohort of randomly selected subjects with HBV infection from four continents. A total of 1553 HBsAg positive blood samples of subjects originating from 20 different countries across Africa, America, Asia and central Europe were characterized for amino acid variation in the MHR. Using highly sensitive ultra-deep sequencing, we found 72.8% of the successfully sequenced subjects (n = 1391) demonstrated amino acid sequence variation in the HBsAg MHR. This indicates that the global variation frequency in the HBsAg MHR is threefold higher than previously reported. The majority of the amino acid mutations were found in the HBV genotypes B (28.9%) and C (25.4%). Collectively, we identified 345 distinct amino acid mutations in the MHR. Among these, we report 62 previously unknown mutations, which extends the worldwide pool of currently known HBsAg MHR mutations by 22%. Importantly, topological analysis identified the “a” determinant upstream flanking region as the structurally most diverse subdomain of the HBsAg MHR. The highest prevalence of “a” determinant region mutations was observed in subjects from Asia, followed by the African, American and European cohorts, respectively. Finally, we found that more than half (59.3%) of all HBV subjects investigated carried multiple MHR mutations. Together, this worldwide ultra-deep sequencing based genotyping study reveals that the global prevalence and structural complexity of variation in the hepatitis B surface antigen have, to date, been significantly underappreciated. PMID:28472040

Ultra-deep sequencing reveals high prevalence and broad structural diversity of hepatitis B surface antigen mutations in a global population.

PubMed

Gencay, Mikael; Hübner, Kirsten; Gohl, Peter; Seffner, Anja; Weizenegger, Michael; Neofytos, Dionysios; Batrla, Richard; Woeste, Andreas; Kim, Hyon-Suk; Westergaard, Gaston; Reinsch, Christine; Brill, Eva; Thu Thuy, Pham Thi; Hoang, Bui Huu; Sonderup, Mark; Spearman, C Wendy; Pabinger, Stephan; Gautier, Jérémie; Brancaccio, Giuseppina; Fasano, Massimo; Santantonio, Teresa; Gaeta, Giovanni B; Nauck, Markus; Kaminski, Wolfgang E

2017-01-01

The diversity of the hepatitis B surface antigen (HBsAg) has a significant impact on the performance of diagnostic screening tests and the clinical outcome of hepatitis B infection. Neutralizing or diagnostic antibodies against the HBsAg are directed towards its highly conserved major hydrophilic region (MHR), in particular towards its "a" determinant subdomain. Here, we explored, on a global scale, the genetic diversity of the HBsAg MHR in a large, multi-ethnic cohort of randomly selected subjects with HBV infection from four continents. A total of 1553 HBsAg positive blood samples of subjects originating from 20 different countries across Africa, America, Asia and central Europe were characterized for amino acid variation in the MHR. Using highly sensitive ultra-deep sequencing, we found 72.8% of the successfully sequenced subjects (n = 1391) demonstrated amino acid sequence variation in the HBsAg MHR. This indicates that the global variation frequency in the HBsAg MHR is threefold higher than previously reported. The majority of the amino acid mutations were found in the HBV genotypes B (28.9%) and C (25.4%). Collectively, we identified 345 distinct amino acid mutations in the MHR. Among these, we report 62 previously unknown mutations, which extends the worldwide pool of currently known HBsAg MHR mutations by 22%. Importantly, topological analysis identified the "a" determinant upstream flanking region as the structurally most diverse subdomain of the HBsAg MHR. The highest prevalence of "a" determinant region mutations was observed in subjects from Asia, followed by the African, American and European cohorts, respectively. Finally, we found that more than half (59.3%) of all HBV subjects investigated carried multiple MHR mutations. Together, this worldwide ultra-deep sequencing based genotyping study reveals that the global prevalence and structural complexity of variation in the hepatitis B surface antigen have, to date, been significantly underappreciated.

Dubinett - Targeted Sequencing 2012 — EDRN Public Portal

Cancer.gov

we propose to use targeted massively parallel DNA sequencing to identify somatic alterations within mutational hotspots in matched sets of primary lung tumors, premalignant lesions, and adjacent,histologically normal lung tissue.

The role of the RAS pathway in iAMP21-ALL

PubMed Central

Ryan, S L; Matheson, E; Grossmann, V; Sinclair, P; Bashton, M; Schwab, C; Towers, W; Partington, M; Elliott, A; Minto, L; Richardson, S; Rahman, T; Keavney, B; Skinner, R; Bown, N; Haferlach, T; Vandenberghe, P; Haferlach, C; Santibanez-Koref, M; Moorman, A V; Kohlmann, A; Irving, J A E; Harrison, C J

2016-01-01

Intrachromosomal amplification of chromosome 21 (iAMP21) identifies a high-risk subtype of acute lymphoblastic leukaemia (ALL), requiring intensive treatment to reduce their relapse risk. Improved understanding of the genomic landscape of iAMP21-ALL will ascertain whether these patients may benefit from targeted therapy. We performed whole-exome sequencing of eight iAMP21-ALL samples. The mutation rate was dramatically disparate between cases (average 24.9, range 5–51) and a large number of novel variants were identified, including frequent mutation of the RAS/MEK/ERK pathway. Targeted sequencing of a larger cohort revealed that 60% (25/42) of diagnostic iAMP21-ALL samples harboured 42 distinct RAS pathway mutations. High sequencing coverage demonstrated heterogeneity in the form of multiple RAS pathway mutations within the same sample and diverse variant allele frequencies (VAFs) (2–52%), similar to other subtypes of ALL. Constitutive RAS pathway activation was observed in iAMP21 samples that harboured mutations in the predominant clone (⩾35% VAF). Viable iAMP21 cells from primary xenografts showed reduced viability in response to the MEK1/2 inhibitor, selumetinib, in vitro. As clonal (⩾35% VAF) mutations were detected in 26% (11/42) of iAMP21-ALL, this evidence of response to RAS pathway inhibitors may offer the possibility to introduce targeted therapy to improve therapeutic efficacy in these high-risk patients. PMID:27168466

Phenotype-genotype analysis of cryopyrin-associated periodic syndromes (CAPS): description of a rare non-exon 3 and a novel CIAS1 missense mutation.

PubMed

Jesus, Adriana A; Silva, Clovis A; Segundo, Gesmar R; Aksentijevich, Ivona; Fujihira, Erika; Watanabe, Mônica; Carneiro-Sampaio, Magda; Duarte, Alberto J S; Oliveira, João B

2008-03-01

We describe in this paper the phenotype-genotype analysis of a Brazilian cohort of patients with cryopyrin-associated periodic syndromes (CAPS). Patient 1 presented with an urticarial rash and recurrent fever exacerbated by cold weather, arthritis, and anterior uveitis, thus, receiving a clinical diagnosis of familial cold autoinflammatory syndrome. CIAS1 sequencing identified the T436I mutation, previously associated to a clinical phenotype of chronic infantile neurological cutaneous and articular/neonatal onset multisystem inflammatory disease. Patient 2 developed a papular exanthema with daily fever shortly after birth, frontal bossing, patellae enlargement, and cognitive and motor impairments. Sequencing identified the exceedingly rare G755R CIAS1 mutation in exon 4. Patient 3 developed skin rash and articular symptoms 6 h after birth, followed by aseptic meningitis. He was found to have the novel C148Y missense mutation in CIAS1. This report expands the spectrum of CIAS1 mutations associated to clinical disease, suggests that the same mutation can be associated with different clinical syndromes, and supports the evidence that CAPS patients should always be screened for mutations outside exon 3.

[Identification of novel compound heterozygous mutations of USH2A gene in a family with Usher syndrome type II].

PubMed

Jiang, Haiou; Ge, Chuanqin; Wang, Yiwang; Tang, Genyun; Quan, Qingli

2015-06-01

To identify potential mutations in a Chinese family with Usher syndrome type II. Genomic DNA was obtained from two affected and four unaffected members of the family and subjected to amplification of the entire coding sequence and splicing sites of USH2A gene. Mutation detection was conducted by direct sequencing of the PCR products. A total of 100 normal unrelated individuals were used as controls. The patients were identified to be a compound heterozygote for two mutations: c.8272G>T (p.E2758X) in exon 42 from his mother and c.12376-12378ACT>TAA(p.T4126X) in exon 63 of the USH2A gene from his father. Both mutations were not found in either of the two unaffected family members or 100 unrelated controls, and had completely co-segregated with the disease phenotype in the family. Neither mutation has been reported in the HGMD database. The novel compound heterozygous mutations c.8272G>T and c.12376-12378ACT>TAA within the USH2A gene may be responsible for the disease. This result may provide new clues for molecular diagnosis of this disease.

A de novo mutation in the AGXT gene causing primary hyperoxaluria type 1.

PubMed

Williams, Emma L; Kemper, Markus J; Rumsby, Gill

2006-09-01

Primary hyperoxaluria type 1 is caused by mutations in the alanine-glyoxylate aminotransferase (AGXT) gene. In cases in which no mutation was identified, linkage analysis can be used to confirm or exclude the diagnosis in other siblings. We present a family in which a sibling of the index case predicted to have primary hyperoxaluria type 1 by means of linkage analysis failed to show hyperoxaluria during the following 7 years, putting the diagnosis into question. Whole-gene sequence analysis identified 2 causative mutations in the index case, of which only 1, c.646A (Gly216Arg), was inherited. The other sequence change, c.33_34insC, was a de novo mutation occurring on the paternal allele. This particular mutation is a relatively common cause of primary hyperoxaluria type 1. It occurs in a run of 8 cytosines and therefore potentially is susceptible to polymerase slippage. This case illustrates 2 important points. First, biochemical confirmation of a genetic diagnosis should always be made in siblings diagnosed by using genetic tests. Second, de novo mutations should be considered as a potential, albeit rare, cause of primary hyperoxaluria type 1.

Identification a nonsense mutation of APC gene in Chinese patients with familial adenomatous polyposis.

PubMed

Li, Haishan; Zhang, Lingling; Jiang, Quan; Shi, Zhenwang; Tong, Hanxing

2017-04-01

Familial adenomatous polyposis (FAP; Mendelian of Inherintance in Man ID, 175100) is a rare autosomal dominant disorder characterized by the development of numerous adenomatous polyps throughout the colon and rectum associated with an increased risk of colorectal cancer. FAP is at time accompanied with certain extraintestinal manifestations such as congenital hypertrophy of the retinal pigment epithelium, dental disorders and desmoid tumors. It is caused by mutations in the adenomatous polyposis coli ( APC ) gene. The present study reported on a Chinese family with FAP. Polymerase chain reaction and direct sequencing of the full coding sequence of the APC gene were performed to identify the mutation in this family. A nonsense mutation of the APC gene was identified in this pedigree. It is a heterozygous G>T substitution at position 2,971 in exon 15 of the APC gene, which formed a premature stop codon at amino acid residue 991 (p.Glu991*). The resulting truncated protein lacked 1,853 amino acids. The present study expanded the database on APC gene mutations in FAP and enriched the spectrum of known germline mutations of the APC gene. Prophylactic proctocolectomy may be considered as a possible treatment for carriers of the mutation.

LMX1B Mutations Cause Hereditary FSGS without Extrarenal Involvement

PubMed Central

Boyer, Olivia; Woerner, Stéphanie; Yang, Fan; Oakeley, Edward J.; Linghu, Bolan; Gribouval, Olivier; Tête, Marie-Josèphe; Duca, José S.; Klickstein, Lloyd; Damask, Amy J.; Szustakowski, Joseph D.; Heibel, Françoise; Matignon, Marie; Baudouin, Véronique; Chantrel, François; Champigneulle, Jacqueline; Martin, Laurent; Nitschké, Patrick; Gubler, Marie-Claire; Johnson, Keith J.; Chibout, Salah-Dine

2013-01-01

LMX1B encodes a homeodomain-containing transcription factor that is essential during development. Mutations in LMX1B cause nail-patella syndrome, characterized by dysplasia of the patellae, nails, and elbows and FSGS with specific ultrastructural lesions of the glomerular basement membrane (GBM). By linkage analysis and exome sequencing, we unexpectedly identified an LMX1B mutation segregating with disease in a pedigree of five patients with autosomal dominant FSGS but without either extrarenal features or ultrastructural abnormalities of the GBM suggestive of nail-patella–like renal disease. Subsequently, we screened 73 additional unrelated families with FSGS and found mutations involving the same amino acid (R246) in 2 families. An LMX1B in silico homology model suggested that the mutated residue plays an important role in strengthening the interaction between the LMX1B homeodomain and DNA; both identified mutations would be expected to diminish such interactions. In summary, these results suggest that isolated FSGS could result from mutations in genes that are also involved in syndromic forms of FSGS. This highlights the need to include these genes in all diagnostic approaches to FSGS that involve next-generation sequencing. PMID:23687361

mRNA-based detection of rare CFTR mutations improves genetic diagnosis of cystic fibrosis in populations with high genetic heterogeneity.

PubMed

Felício, V; Ramalho, A S; Igreja, S; Amaral, M D

2017-03-01

Even with advent of next generation sequencing complete sequencing of large disease-associated genes and intronic regions is economically not feasible. This is the case of cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible for cystic fibrosis (CF). Yet, to confirm a CF diagnosis, proof of CFTR dysfunction needs to be obtained, namely by the identification of two disease-causing mutations. Moreover, with the advent of mutation-based therapies, genotyping is an essential tool for CF disease management. There is, however, still an unmet need to genotype CF patients by fast, comprehensive and cost-effective approaches, especially in populations with high genetic heterogeneity (and low p.F508del incidence), where CF is now emerging with new diagnosis dilemmas (Brazil, Asia, etc). Herein, we report an innovative mRNA-based approach to identify CFTR mutations in the complete coding and intronic regions. We applied this protocol to genotype individuals with a suspicion of CF and only one or no CFTR mutations identified by routine methods. It successfully detected multiple intronic mutations unlikely to be detected by CFTR exon sequencing. We conclude that this is a rapid, robust and inexpensive method to detect any CFTR coding/intronic mutation (including rare ones) that can be easily used either as primary approach or after routine DNA analysis. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.