A hybrid MD-kMC algorithm for folding proteins in explicit solvent.
Peter, Emanuel Karl; Shea, Joan-Emma
2014-04-14
We present a novel hybrid MD-kMC algorithm that is capable of efficiently folding proteins in explicit solvent. We apply this algorithm to the folding of a small protein, Trp-Cage. Different kMC move sets that capture different possible rate limiting steps are implemented. The first uses secondary structure formation as a relevant rate event (a combination of dihedral rotations and hydrogen-bonding formation and breakage). The second uses tertiary structure formation events through formation of contacts via translational moves. Both methods fold the protein, but via different mechanisms and with different folding kinetics. The first method leads to folding via a structured helical state, with kinetics fit by a single exponential. The second method leads to folding via a collapsed loop, with kinetics poorly fit by single or double exponentials. In both cases, folding times are faster than experimentally reported values, The secondary and tertiary move sets are integrated in a third MD-kMC implementation, which now leads to folding of the protein via both pathways, with single and double-exponential fits to the rates, and to folding rates in good agreement with experimental values. The competition between secondary and tertiary structure leads to a longer search for the helix-rich intermediate in the case of the first pathway, and to the emergence of a kinetically trapped long-lived molten-globule collapsed state in the case of the second pathway. The algorithm presented not only captures experimentally observed folding intermediates and kinetics, but yields insights into the relative roles of local and global interactions in determining folding mechanisms and rates.
ERIC Educational Resources Information Center
Kazi, Rehan; Prasad, Vyas M. N.; Kanagalingam, Jeeve; Georgalas, Christos; Venkitaraman, Ramachandran; Nutting, Christopher M.; Clarke, Peter; Rhys-Evans, Peter; Harrington, Kevin J.
2007-01-01
Aims: To compare voice quality as defined by formant analysis using a sustained vowel in patients who have undergone a partial glossectomy with a group of normal subjects. Methods & Procedures: The design consisted of a single centre, cross-sectional cohort study. The setting was an Adult Tertiary Referral Unit. A total of 26 patients (19…
Manickchund, Yashoda; Hadley, G P
2017-10-01
Paediatric surgical disease is a neglected health problem. Patients travel great distances to tertiary level care for management. This study aimed at analysing referral patterns to design an outreach programme for paediatric surgery in KwaZulu Natal. Data forms of patients referred to the service between January and July 2016 were correlated with the clinical record. Delays in management were compared to morbidity and mortality. Out of 781, 158 referrals were accepted as emergencies. The majority (62%) were children aged < 1 year. Gastro-intestinal problems (38.4%) and congenital anomalies (26.9%) formed the majority. Patients who died had a significantly longer delay in transfer. Longer total delay was associated with statistically significant greater morbidity. In a setting where a large rural population is served by single-centre tertiary care, delays exist and contribute to morbidity. The authors advocate the establishment of an outreach programme to address these issues.
An Amino Acid Code to Define a Protein’s Tertiary Packing Surface
Fraga, Keith J.; Joo, Hyun; Tsai, Jerry
2015-01-01
One difficult aspect of the protein-folding problem is characterizing the non-specific interactions that define packing in protein tertiary structure. To better understand tertiary structure, this work extends the knob-socket model by classifying the interactions of a single knob residue packed into a set of contiguous sockets, or a pocket made up of 4 or more residues. The knob-socket construct allows for a symbolic two-dimensional mapping of pockets. The two-dimensional mapping of pockets provides a simple method to investigate the variety of pocket shapes in order to understand the geometry of protein tertiary surfaces. The diversity of pocket geometries can be organized into groups of pockets that share a common core, which suggests that some interactions in pockets are ancillary to packing. Further analysis of pocket geometries displays a preferred configuration that is right-handed in α-helices and left-handed in β-sheets. The amino acid composition of pockets illustrates the importance of non-polar amino acids in packing as well as position specificity. As expected, all pocket shapes prefer to pack with hydrophobic knobs; however, knobs are not selective for the pockets they pack. Investigating side-chain rotamer preferences for certain pocket shapes uncovers no strong correlations. These findings allow a simple vocabulary based on knobs and sockets to describe protein tertiary packing that supports improved analysis, design and prediction of protein structure. PMID:26575337
van Engelenburg-van Lonkhuyzen, Marieke L; Bols, Esther M J; Benninga, Marc A; Verwijs, Wim A; de Bie, Rob A
2017-02-01
The aims of this study are to evaluate in a pragmatic cross-sectional study, the clinical characteristics of childhood bladder and/or bowel dysfunctions (CBBD) and locomotor problems in the primary through tertiary health care setting. It was hypothesized that problems would increase, going from primary to tertiary healthcare. Data were retrieved from patient-records of children (1-16 years) presenting with CBBD and visiting pelvic physiotherapists. Prevalence's of dysfunctions were compared between healthcare settings and gender using ANOVA and chi-square test. Agreement between physicians' diagnoses and parent-reported symptoms was evaluated (Cohen's Kappa). One thousand seventy hundred forty-eight children (mean age 7.7 years [SD 2.9], 48.9% boys) were included. Daytime urinary incontinence (P = 0.039) and enuresis (P < 0.001) were more diagnosed in primary healthcare, whereas constipation (P < 0.001) and abdominal pain (P = 0.009) increased from primary to tertiary healthcare. All parent-reported symptoms occurred more frequently than indicated by the physicians. Poor agreement between physicians' diagnoses and parent-reported symptoms was found (k = 0.16). Locomotor problems prevailed in all healthcare settings, motor skills (P = 0.041) and core stability (P = 0.015) significantly more in tertiary healthcare. Constipation and abdominal pain (physicians' diagnoses) and the parent-reported symptoms hard stools and bloating increased from primary to tertiary healthcare. Discrepancies exist between the prevalence's of physicians' diagnoses and parent-reported symptoms. Locomotor problems predominate in all healthcare settings. What is Known: • Childhood bladder and/or bowel dysfunctions (CCBD) are common. • Particularly tertiary healthcare characteristics of CBBD are available What is New: • Characteristics of CBBD referred to pelvic physiotherapy are comparable in primary, secondary, and tertiary healthcare settings. • Concomitant CBBD appeared to be more prevalent than earlier reported. • Discrepancies exist between referring physicians' diagnoses and parent-reported symptoms.
VizieR Online Data Catalog: SNLS and SDSS SN surveys photometric calibration (Betoule+, 2013)
NASA Astrophysics Data System (ADS)
Betoule, M.; Marriner, J.; Regnault, N.; Cuillandre, J.-C.; Astier, P.; Guy, J.; Balland, C.; El, Hage P.; Hardin, D.; Kessler, R.; Le Guillou, L.; Mosher, J.; Pain, R.; Rocci, P.-F.; Sako, M.; Schahmaneche, K.
2012-11-01
We present a joined photometric calibration for the SNLS and the SDSS supernova surveys. Our main delivery are catalogs of natural AB magnitudes for a large set of selected tertiary standard stars covering the science field of both surveys. Those catalogs are calibrated to the AB flux scale through observations of 5 primary spectrophotometric standard stars, for which HST-STIS spectra are available in the CALSPEC database. The estimate of the uncertainties associated to this calibration are delivered as a single covariance matrix. We also provide a model of the transmission efficiency of the SNLS photometric instrument MegaCam. Those transmission functions are required for the interpretation of MegaCam natural magnitudes in term of physical fluxes. Similar curves for the SDSS photometric instrument have been published in Doi et al. (2010AJ....139.1628D). Last, we release the measured magnitudes of the five CALSPEC standard stars in the magnitude system of the tertiary catalogs. This makes it possible to update the calibration of the tertiary catalogs if CALSPEC spectra for the primary standards are revised. (11 data files).
Reducing inpatient heritable thrombophilia testing using a clinical decision-making tool.
Smith, Tyler W; Pi, David; Hudoba, Monika; Lee, Agnes Y Y
2014-04-01
To evaluate the impact of a clinical decision-making tool, designed to educate physicians regarding heritable thrombophilia (HT) testing, on the volume of testing in hospitalised patients in the tertiary care setting. We performed a retrospective cohort study over a 6-year period (2007-2012) at a single tertiary care centre intervention site and two regional control sites. In January 2010, the intervention site instituted a policy change whereby physicians ordering HT testing on inpatients needed to complete a pre-preprinted order (PPO) form that outlined the limitations of HT testing in the hospitalised setting. Failure to complete the PPO within 24 h resulted in test cancellation. Our main outcome measure was the volume of HT testing performed at the three study sites. Introduction of the PPO resulted in a 79.4% (95% CI 71.2% to 87.6%) reduction in factor V Leiden (FVL) testing at the intervention site. This decrease was significantly greater compared with those in the two control teaching hospitals over the same time periods (33.7% and 43.6%; both p<0.001). Reductions in FVL testing postintervention were observed among all ordering specialists. Similar postintervention reductions in testing volumes were observed for antithrombin (57.4%), protein C (61.9%) and protein S (62.2%) activity assays. In a large tertiary care hospital, the introduction of a clinical decision-making tool significantly reduced HT testing in inpatients across clinical specialties. The impact on patient outcome should be assessed in further studies.
Tertiary network in mammalian mitochondrial tRNAAsp revealed by solution probing and phylogeny
Messmer, Marie; Pütz, Joern; Suzuki, Takeo; Suzuki, Tsutomu; Sauter, Claude; Sissler, Marie; Catherine, Florentz
2009-01-01
Primary and secondary structures of mammalian mitochondrial (mt) tRNAs are divergent from canonical tRNA structures due to highly skewed nucleotide content and large size variability of D- and T-loops. The nonconservation of nucleotides involved in the expected network of tertiary interactions calls into question the rules governing a functional L-shaped three-dimensional (3D) structure. Here, we report the solution structure of human mt-tRNAAsp in its native post-transcriptionally modified form and as an in vitro transcript. Probing performed with nuclease S1, ribonuclease V1, dimethylsulfate, diethylpyrocarbonate and lead, revealed several secondary structures for the in vitro transcribed mt-tRNAAsp including predominantly the cloverleaf. On the contrary, the native tRNAAsp folds into a single cloverleaf structure, highlighting the contribution of the four newly identified post-transcriptional modifications to correct folding. Reactivities of nucleotides and phosphodiester bonds in the native tRNA favor existence of a full set of six classical tertiary interactions between the D-domain and the variable region, forming the core of the 3D structure. Reactivities of D- and T-loop nucleotides support an absence of interactions between these domains. According to multiple sequence alignments and search for conservation of Leontis–Westhof interactions, the tertiary network core building rules apply to all tRNAAsp from mammalian mitochondria. PMID:19767615
ProTSAV: A protein tertiary structure analysis and validation server.
Singh, Ankita; Kaushik, Rahul; Mishra, Avinash; Shanker, Asheesh; Jayaram, B
2016-01-01
Quality assessment of predicted model structures of proteins is as important as the protein tertiary structure prediction. A highly efficient quality assessment of predicted model structures directs further research on function. Here we present a new server ProTSAV, capable of evaluating predicted model structures based on some popular online servers and standalone tools. ProTSAV furnishes the user with a single quality score in case of individual protein structure along with a graphical representation and ranking in case of multiple protein structure assessment. The server is validated on ~64,446 protein structures including experimental structures from RCSB and predicted model structures for CASP targets and from public decoy sets. ProTSAV succeeds in predicting quality of protein structures with a specificity of 100% and a sensitivity of 98% on experimentally solved structures and achieves a specificity of 88%and a sensitivity of 91% on predicted protein structures of CASP11 targets under 2Å.The server overcomes the limitations of any single server/method and is seen to be robust in helping in quality assessment. ProTSAV is freely available at http://www.scfbio-iitd.res.in/software/proteomics/protsav.jsp. Copyright © 2015 Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
Hore, Terry, Ed.; And Others
Proceedings are presented of a conference that examined the purposes and setting of tertiary education in Australia in the changing social order of the 1980s, the future roles for tertiary education in Australia, and the pattern and form of accountability appropriate to Australian tertiary education in the late twentieth century. Papers and…
ERIC Educational Resources Information Center
Jayaprakash, R.
2012-01-01
Background: There are limited studies on the clinical profile of children attending child guidance clinic under Paediatric background. Aims: To study clinical profile of Children & adolescents attending the Behavioural Paediatrics Unit (BPU) OPD under department of Paediatrics in a tertiary care set up. Methods: Monthly average turnover in the…
Shiferaw, Netsanet; Salvador-Davila, Graciela; Kassahun, Konjit; Brooks, Mohamad I; Weldegebreal, Teklu; Tilahun, Yewondwossen; Zerihun, Habtamu; Nigatu, Tariku; Lulu, Kidest; Ahmed, Ismael; Blumenthal, Paul D; Asnake, Mengistu
2016-03-01
Cervical cancer is the second most common form of cancer for women in Ethiopia. Using a single-visit approach to prevent cervical cancer, the Addis Tesfa (New Hope) project in Ethiopia tested women with HIV through visual inspection of the cervix with acetic acid wash (VIA) and, if tests results were positive, offered immediate cryotherapy of the precancerous lesion or referral for loop electrosurgical excision procedure (LEEP). The objective of this article is to review screening and treatment outcomes over nearly 4 years of project implementation and to identify lessons learned to improve cervical cancer prevention programs in Ethiopia and other resource-constrained settings. We analyzed aggregate client data from August 2010 to March 2014 to obtain the number of women with HIV who were counseled, screened, and treated, as well as the number of annual follow-up visits made, from the 14 tertiary- and secondary-level health facilities implementing the single-visit approach. A health facility assessment (HFA) was also implemented from August to December 2013 to examine the effects of the single-visit approach on client flow, staff workload, and facility infrastructure 3 years after initiating the approach. Almost all (99%) of the 16,632 women with HIV counseled about the single-visit approach were screened with VIA during the study period; 1,656 (10%) of them tested VIA positive (VIA+) for precancerous lesions. Among those who tested VIA+ and were thus eligible for cryotherapy, 1,481 (97%) received cryotherapy treatment, but only 80 (63%) women eligible for LEEP actually received the treatment. The HFA results showed frequent staff turnover, some shortage of essential supplies, and rooms that were judged by providers to be too small for delivery of cervical cancer prevention services. The high proportions of VIA screening and cryotherapy treatment in the Addis Tesfa project suggest high acceptance of such services by women with HIV and feasibility of implementation in secondary- and tertiary-level health facilities. However, success of cervical cancer prevention programming must address wider health system challenges to ensure sustainability and appropriate scale-up to the general population of Ethiopia and other resource-constrained settings. © Shiferaw et al.
Problem-Based Learning in Tertiary Education: Teaching Old "Dogs" New Tricks?
ERIC Educational Resources Information Center
Yeo, Roland K.
2005-01-01
Purpose--The paper sets out to explore the challenges of problem-based learning (PBL) in tertiary education and to propose a framework with implications for practice and learning. Design/Methodology/Approach--A total of 18 tertiary students divided into three groups participated in the focus group discussions. A quantitative instrument was used as…
ERIC Educational Resources Information Center
Burden, Peter
2008-01-01
This paper considers both how the mandatory introduction of student evaluation of teaching surveys (SETs) fits into the social and political context of tertiary education in Japan, and the assumptions about teaching underlying SETs. Through interviews with English teachers, a technical-rational perspective whereby teaching is a profession only to…
Chessman, Julia C; Bowen, Jennifer R; Ford, Jane B
2017-05-01
To describe neonatal exchange transfusions in New South Wales (NSW) before and after release in January 2007 of a NSW Health guideline regarding exchange transfusions in tertiary and non-tertiary hospitals. The study population included neonates receiving exchange transfusion in NSW hospitals, 2001-2012. Linked birth and hospital data for mothers and babies were used to describe birth characteristics and maternal and neonatal conditions. Exchange transfusions were identified in hospital data and compared for 2001-2006 and 2007-2012. Maternal and neonatal characteristics were compared with χ 2 and Wilcoxon signed-rank tests. Between 2001 and 2012, there were 286 exchange transfusions performed for 281 neonates in NSW hospitals. The number of exchange transfusions decreased from 187 in 184 neonates for 2001-2006 to 99 in 97 neonates 2007-2012 (P < 0.001). The percentage of exchange transfusions performed at tertiary hospitals increased from 85% in 2001-2006 to 91% in 2007-2012, although this was not statistically significant (P = 0.16). Most neonates requiring exchange transfusion were born in tertiary hospitals: 62% for 2001-2006 and 69% for 2007-2012. Among those born in a non-tertiary hospital, the percentage transferred or admitted to a tertiary hospital for exchange transfusion was 63% in 2001-2006 and 77% in 2007-2012. Between 2001 and 2012, there was a decrease in neonatal exchange transfusions in NSW. After the 2007 guideline there was a non-significant increase in the proportion of exchange transfusions performed at tertiary hospitals. Although rare, exchange transfusions are still expected to occur occasionally in non-tertiary hospitals, requiring continuing support for this procedure in these settings. © 2017 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).
Characterization of Three-Stream Jet Flow Fields
NASA Technical Reports Server (NTRS)
Henderson, Brenda S.; Wernet, Mark P.
2016-01-01
Flow-field measurements were conducted on single-, dual- and three-stream jets using two-component and stereo Particle Image Velocimetry (PIV). The flow-field measurements complimented previous acoustic measurements. The exhaust system consisted of externally-plugged, externally-mixed, convergent nozzles. The study used bypass-to-core area ratios equal to 1.0 and 2.5 and tertiary-to-core area ratios equal to 0.6 and 1.0. Axisymmetric and offset tertiary nozzles were investigated for heated and unheated high-subsonic conditions. Centerline velocity decay rates for the single-, dual- and three-stream axisymmetric jets compared well when axial distance was normalized by an equivalent diameter based on the nozzle system total exit area. The tertiary stream had a greater impact on the mean axial velocity for the small bypass-to-core area ratio nozzles than for large bypass-to-core area ratio nozzles. Normalized turbulence intensities were similar for the single-, dual-, and three-stream unheated jets due to the small difference (10 percent) in the core and bypass velocities for the dual-stream jets and the low tertiary velocity (50 percent of the core stream) for the three-stream jets. For heated jet conditions where the bypass velocity was 65 percent of the core velocity, additional regions of high turbulence intensity occurred near the plug tip which were not present for the unheated jets. Offsetting the tertiary stream moved the peak turbulence intensity levels upstream relative to those for all axisymmetric jets investigated.
Characterization of Three-Stream Jet Flow Fields
NASA Technical Reports Server (NTRS)
Henderson, Brenda S.; Wernet, Mark P.
2016-01-01
Flow-field measurements were conducted on single-, dual- and three-stream jets using two-component and stereo Particle Image Velocimetry (PIV). The flow-field measurements complimented previous acoustic measurements. The exhaust system consisted of externally-plugged, externally-mixed, convergent nozzles. The study used bypass-to-core area ratios equal to 1.0 and 2.5 and tertiary-to-core area ratios equal to 0.6 and 1.0. Axisymmetric and offset tertiary nozzles were investigated for heated and unheated high-subsonic conditions. Centerline velocity decay rates for the single-, dual- and three-stream axisymmetric jets compared well when axial distance was normalized by an equivalent diameter based on the nozzle system total exit area. The tertiary stream had a greater impact on the mean axial velocity for the small bypass-to-core area ratio nozzles than for large bypass-to-core area ratio nozzles. Normalized turbulence intensities were similar for the single-, dual-, and three-stream unheated jets due to the small difference (10%) in the core and bypass velocities for the dual-stream jets and the low tertiary velocity (50% of the core stream) for the three-stream jets. For heated jet conditions where the bypass velocity was 65% of the core velocity, additional regions of high turbulence intensity occurred near the plug tip which were not present for the unheated jets. Offsetting the tertiary stream moved the peak turbulence intensity levels upstream relative to those for all axisymmetric jets investigated.
Educational Marketing: A Review and Implications for Supporting Practice in Tertiary Education
ERIC Educational Resources Information Center
Stachowski, Christopher Allen
2011-01-01
This article reviews the existing educational marketing literature in the leading tertiary educational management journals. A discussion of the implications for supporting practitioners in non-university settings is presented. (Contains 1 table.)
ERIC Educational Resources Information Center
Franklin, Sue; Peat, Mary; Lewis, Alison
2002-01-01
Describes a study that investigates both the use and usefulness of laboratory dissections and computer-based dissections in a tertiary, first-year human biology course. Explores attitudes toward dissection. (DDR)
Striped tertiary storage arrays
NASA Technical Reports Server (NTRS)
Drapeau, Ann L.
1993-01-01
Data stripping is a technique for increasing the throughput and reducing the response time of large access to a storage system. In striped magnetic or optical disk arrays, a single file is striped or interleaved across several disks; in a striped tape system, files are interleaved across tape cartridges. Because a striped file can be accessed by several disk drives or tape recorders in parallel, the sustained bandwidth to the file is greater than in non-striped systems, where access to the file are restricted to a single device. It is argued that applying striping to tertiary storage systems will provide needed performance and reliability benefits. The performance benefits of striping for applications using large tertiary storage systems is discussed. It will introduce commonly available tape drives and libraries, and discuss their performance limitations, especially focusing on the long latency of tape accesses. This section will also describe an event-driven tertiary storage array simulator that is being used to understand the best ways of configuring these storage arrays. The reliability problems of magnetic tape devices are discussed, and plans for modeling the overall reliability of striped tertiary storage arrays to identify the amount of error correction required are described. Finally, work being done by other members of the Sequoia group to address latency of accesses, optimizing tertiary storage arrays that perform mostly writes, and compression is discussed.
Managing patient pathways to achieve lung cancer waiting time targets: mixed methods study
Ip, Hugh; Amer, Tarik; Dangoor, Michael; Zamir, Affan; Gibbings-Isaac, Darryl; Kochhar, Ranjeev; Heymann, Timothy
2012-01-01
Objectives England's National Health Service (NHS) introduced a 62-day target, from referral to treatment, to make lung cancer patient pathways more efficient. This study aims to understand pathway delays that lead to breaches of the target when patients need care in both secondary and tertiary setting, so more than one institution is involved. Design Mixed methods cross case analysis. Setting Two tertiary referral hospitals in London. Participants Database records of 53 patients were analysed. Nineteen sets of patient notes were used for pathway mapping. Seventeen doctors, four nurses, eight managers and administrators were interviewed. Main outcome measures Qualitative methods include pathway mapping and semi-structured interviews. Quantitative analysis of patient pathway times from cancer services records. Results The majority of the patient pathway (68.4%) is spent in secondary centres. There is more variability in the processes of secondary centres but tertiary centres do not have perfect processes either. Three themes emerged from discussions: information flows, pathway performance and the role of the multidisciplinary approach. Conclusions The actions of secondary centres have a greater influence on whether a patient breaches the 62-day target, compared with tertiary centres. Nevertheless variability exists in both, with potential for improvement. PMID:23162682
The Development of Adult and Community Education Policy in New Zealand: Insights from Popper
ERIC Educational Resources Information Center
Slater, Gloria
2009-01-01
This paper examines the process by which all post-compulsory education in New Zealand has become integrated under one administrative structure, the Tertiary Education Commission (TEC), with the intention of developing a single coordinated system of tertiary education. In particular, adult and community education (ACE), the least formal and…
NASA Astrophysics Data System (ADS)
Li, Bao-Sheng; Wang, Yuhuang; Proctor, Rupert S. J.; Zhang, Yuexia; Webster, Richard D.; Yang, Song; Song, Baoan; Chi, Yonggui Robin
2016-09-01
Benzyl bromides and related molecules are among the most common substrates in organic synthesis. They are typically used as electrophiles in nucleophilic substitution reactions. These molecules can also be activated via single-electron-transfer (SET) process for radical reactions. Representative recent progress includes α-carbon benzylation of ketones and aldehydes via photoredox catalysis. Here we disclose the generation of (nitro)benzyl radicals via N-heterocyclic carbene (NHC) catalysis under reductive conditions. The radical intermediates generated via NHC catalysis undergo formal 1,2-addition with ketones to eventually afford tertiary alcohol products. The overall process constitutes a formal polarity-inversion of benzyl bromide, allowing a direct coupling of two initially electrophilic carbons. Our study provides a new carbene-catalysed reaction mode that should enable unconventional transformation of (nitro)benzyl bromides under mild organocatalytic conditions.
Shiferaw, Netsanet; Salvador-Davila, Graciela; Kassahun, Konjit; Brooks, Mohamad I; Weldegebreal, Teklu; Tilahun, Yewondwossen; Zerihun, Habtamu; Nigatu, Tariku; Lulu, Kidest; Ahmed, Ismael; Blumenthal, Paul D; Asnake, Mengistu
2016-01-01
ABSTRACT Introduction: Cervical cancer is the second most common form of cancer for women in Ethiopia. Using a single-visit approach to prevent cervical cancer, the Addis Tesfa (New Hope) project in Ethiopia tested women with HIV through visual inspection of the cervix with acetic acid wash (VIA) and, if tests results were positive, offered immediate cryotherapy of the precancerous lesion or referral for loop electrosurgical excision procedure (LEEP). The objective of this article is to review screening and treatment outcomes over nearly 4 years of project implementation and to identify lessons learned to improve cervical cancer prevention programs in Ethiopia and other resource-constrained settings. Methods: We analyzed aggregate client data from August 2010 to March 2014 to obtain the number of women with HIV who were counseled, screened, and treated, as well as the number of annual follow-up visits made, from the 14 tertiary- and secondary-level health facilities implementing the single-visit approach. A health facility assessment (HFA) was also implemented from August to December 2013 to examine the effects of the single-visit approach on client flow, staff workload, and facility infrastructure 3 years after initiating the approach. Results: Almost all (99%) of the 16,632 women with HIV counseled about the single-visit approach were screened with VIA during the study period; 1,656 (10%) of them tested VIA positive (VIA+) for precancerous lesions. Among those who tested VIA+ and were thus eligible for cryotherapy, 1,481 (97%) received cryotherapy treatment, but only 80 (63%) women eligible for LEEP actually received the treatment. The HFA results showed frequent staff turnover, some shortage of essential supplies, and rooms that were judged by providers to be too small for delivery of cervical cancer prevention services. Conclusion: The high proportions of VIA screening and cryotherapy treatment in the Addis Tesfa project suggest high acceptance of such services by women with HIV and feasibility of implementation in secondary- and tertiary-level health facilities. However, success of cervical cancer prevention programming must address wider health system challenges to ensure sustainability and appropriate scale-up to the general population of Ethiopia and other resource-constrained settings. PMID:27016546
Al-Yassin, Amina; Long, Andrew; Sharma, Sanjiv; May, Joanne
2017-01-01
Both general and subspecialty paediatric trainees undertake attachments in highly specialised tertiary hospitals. Trainee feedback suggests that mismatches in expectations between trainees and supervisors and a perceived lack of educational opportunities may lead to trainee dissatisfaction in such settings. With the 'Shape of Training' review (reshaping postgraduate training in the UK to focus on more general themes), this issue is likely to become more apparent. We wished to explore the factors that contribute to a positive educational environment and training experience and identify how this may be improved in highly specialised settings. General paediatric trainees working at all levels in subspecialty teams at a tertiary hospital were recruited (n=12). Semistructured interviews were undertaken to explore the strengths and weaknesses of training in such a setting and how this could be optimised. Appreciative inquiry methodology was used to identify areas of perceived best practice and consider how these could be promoted and disseminated. Twelve best practice themes were identified: (1) managing expectations by acknowledging the challenges; (2) educational contracting to identify learning needs and opportunities; (3) creative educational supervision; (4) centralised teaching events; (5) signposting learning opportunities; (6) curriculum-mapped pan-hospital teaching programmes; (7) local faculty groups with trainee representation; (8) interprofessional learning; (9) pastoral support systems; (10) crossover weeks to increase clinical exposure; (11) adequate clinical supervision; and (12) rota design to include teaching and clinic time. Tertiary settings have strengths, as well as challenges, for general paediatric training. Twelve trainee-generated tips have been identified to capitalise on the educational potential within these settings. Trainee feedback is essential to diagnose and improve educational environments and appreciative inquiry is a useful tool for this purpose.
Al-Yassin, Amina; Long, Andrew; Sharma, Sanjiv; May, Joanne
2017-01-01
Objectives Both general and subspecialty paediatric trainees undertake attachments in highly specialised tertiary hospitals. Trainee feedback suggests that mismatches in expectations between trainees and supervisors and a perceived lack of educational opportunities may lead to trainee dissatisfaction in such settings. With the ‘Shape of Training’ review (reshaping postgraduate training in the UK to focus on more general themes), this issue is likely to become more apparent. We wished to explore the factors that contribute to a positive educational environment and training experience and identify how this may be improved in highly specialised settings. Methods General paediatric trainees working at all levels in subspecialty teams at a tertiary hospital were recruited (n=12). Semistructured interviews were undertaken to explore the strengths and weaknesses of training in such a setting and how this could be optimised. Appreciative inquiry methodology was used to identify areas of perceived best practice and consider how these could be promoted and disseminated. Results Twelve best practice themes were identified: (1) managing expectations by acknowledging the challenges; (2) educational contracting to identify learning needs and opportunities; (3) creative educational supervision; (4) centralised teaching events; (5) signposting learning opportunities; (6) curriculum-mapped pan-hospital teaching programmes; (7) local faculty groups with trainee representation; (8) interprofessional learning; (9) pastoral support systems; (10) crossover weeks to increase clinical exposure; (11) adequate clinical supervision; and (12) rota design to include teaching and clinic time. Conclusions Tertiary settings have strengths, as well as challenges, for general paediatric training. Twelve trainee-generated tips have been identified to capitalise on the educational potential within these settings. Trainee feedback is essential to diagnose and improve educational environments and appreciative inquiry is a useful tool for this purpose. PMID:29637130
Alfinito, Eleonora; Reggiani, Lino
2016-10-01
Current-voltage characteristics of metal-protein-metal structures made of proteorhodopsin and bacteriorhodopsin are modeled by using a percolation-like approach. Starting from the tertiary structure pertaining to the single protein, an analogous resistance network is created. Charge transfer inside the network is described as a sequential tunneling mechanism and the current is calculated for each value of the given voltage. The theory is validated with available experiments, in dark and light. The role of the tertiary structure of the single protein and of the mechanisms responsible for the photo-activity is discussed.
[Decomposition model of energy-related carbon emissions in tertiary industry for China].
Lu, Yuan-Qing; Shi, Jun
2012-07-01
Tertiary industry has been developed in recent years. And it is very important to find the factors influenced the energy-related carbon emissions in tertiary industry. A decomposition model of energy-related carbon emissions for China is set up by adopting logarithmic mean weight Divisia method based on the identity of carbon emissions. The model is adopted to analyze the influence of energy structure, energy efficiency, tertiary industry structure and economic output to energy-related carbon emissions in China from 2000 to 2009. Results show that the contribution rate of economic output and energy structure to energy-related carbon emissions increases year by year. Either is the contribution rate of energy efficiency or the tertiary industry restraining to energy-related carbon emissions. However, the restrain effect is weakening.
Deterministic Demographic Characteristics in Tertiary Education: An Exploratory Study
ERIC Educational Resources Information Center
Morton, Lisa; Lamb, Charles
2006-01-01
This paper reports the responses of 235 tertiary commerce students to a questionnaire in relation to their learning and assessment experiences. Significant correlations between measures were used to identify underlying constructs within the overall set of variable measures. Logistic regression incorporating the factors was then used to further…
Acyl carrier protein structural classification and normal mode analysis
Cantu, David C; Forrester, Michael J; Charov, Katherine; Reilly, Peter J
2012-01-01
All acyl carrier protein primary and tertiary structures were gathered into the ThYme database. They are classified into 16 families by amino acid sequence similarity, with members of the different families having sequences with statistically highly significant differences. These classifications are supported by tertiary structure superposition analysis. Tertiary structures from a number of families are very similar, suggesting that these families may come from a single distant ancestor. Normal vibrational mode analysis was conducted on experimentally determined freestanding structures, showing greater fluctuations at chain termini and loops than in most helices. Their modes overlap more so within families than between different families. The tertiary structures of three acyl carrier protein families that lacked any known structures were predicted as well. PMID:22374859
Li, Bao-Sheng; Wang, Yuhuang; Proctor, Rupert S. J.; Zhang, Yuexia; Webster, Richard D.; Yang, Song; Song, Baoan; Chi, Yonggui Robin
2016-01-01
Benzyl bromides and related molecules are among the most common substrates in organic synthesis. They are typically used as electrophiles in nucleophilic substitution reactions. These molecules can also be activated via single-electron-transfer (SET) process for radical reactions. Representative recent progress includes α-carbon benzylation of ketones and aldehydes via photoredox catalysis. Here we disclose the generation of (nitro)benzyl radicals via N-heterocyclic carbene (NHC) catalysis under reductive conditions. The radical intermediates generated via NHC catalysis undergo formal 1,2-addition with ketones to eventually afford tertiary alcohol products. The overall process constitutes a formal polarity-inversion of benzyl bromide, allowing a direct coupling of two initially electrophilic carbons. Our study provides a new carbene-catalysed reaction mode that should enable unconventional transformation of (nitro)benzyl bromides under mild organocatalytic conditions. PMID:27671606
What proportion of congenital abnormalities can be prevented?
Czeizel, A E; Intôdy, Z; Modell, B
1993-01-01
OBJECTIVE--To estimate the proportion of preventable congenital abnormalities in Hungary. DESIGN--Analysis of available Hungarian data-bases and of the effectiveness of primary, secondary, and tertiary preventive methods. SETTING--Databases of ad hoc epidemiological studies and of the Hungarian congenital abnormality registry. MAIN OUTCOME MEASURES--Prevalence at birth and prevalence after prevention in 73 congenital abnormality types or groups. RESULTS--Preventive methods are available for 51 (70%) of the 73 congenital abnormality types or groups evaluated. The birth prevalence of all congenital abnormalities could be reduced from 65 to 26 per 1000; thus 39 per 1000 (60%) are preventable. Without congenital dislocation of the hip, which is unusually common in Hungary, the preventable proportion of congenital abnormalities is 52%. CONCLUSION--Many congenital abnormalities can be prevented, but as they do not represent a single pathological category there is no single strategy for their prevention. Images p502-a p503-a PMID:8448464
Detritus in K/T boundary clays of western North America - Evidence against a single oceanic impact
NASA Technical Reports Server (NTRS)
Sharpton, V. L.; Schuraytz, B. C.; Burke, K.; Murali, A. V.; Ryder, G.
1990-01-01
Understanding the crustal signature of impact ejecta contained in the Cretaceous/Tertiary (K/T) boundary layer is crucial to constraining the possible site(s) of the postulated K/T impact event. The relatively unaltered clastic constituents of the boundary layer at widely separated outcrops within the western interior of North America are not compatible with a single oceanic impact but require instead an impact site on a continent or continental margin. On the other hand, chemical compositions of highly altered K/T boundary layer components in some marine sections have suggested to others an impact into oceanic crust. We suspect that post-depositional alteration within the marine setting accounts for this apparent oceanic affinity. If, however, this is not the case, multiple simultaneous impacts, striking continent as well as ocean floor, would seem to be required.
Trock, Bruce J; Guo, Charles C; Gonzalgo, Mark L; Magheli, Ahmed; Loeb, Stacy; Epstein, Jonathan I
2009-10-01
We investigated the relationship between the tertiary Gleason component in radical prostatectomy specimens and biochemical recurrence in what is to our knowledge the largest single institution cohort to date. We evaluated data on 3,230 men who underwent radical prostatectomy at our institution from 2000 to 2005. Tertiary Gleason component was defined as Gleason grade pattern 4 or greater for Gleason score 6 and Gleason grade pattern 5 for Gleason score 7 or 8. Biochemical recurrence curves for cancer with tertiary Gleason component were intermediate between those of cancer without a tertiary Gleason component in the same Gleason score category and cancer in the next higher Gleason score category. The only exception was that Gleason score 4 + 3 = 7 with a tertiary Gleason component behaved like Gleason score 8. The tertiary Gleason component independently predicted recurrence when factoring in radical prostatectomy Gleason score, radical prostatectomy stage and prostate specific antigen (HR 1.45, p = 0.029). Furthermore, the magnitude of the tertiary Gleason component effect on recurrence did not differ by Gleason score category (p = 0.593). Although the tertiary Gleason component is frequently included in pathology reports, it is routinely omitted in other situations, such as predictive nomograms, research studies and patient counseling. The current study adds to a growing body of evidence highlighting the importance of the tertiary Gleason component in radical prostatectomy specimens. Accordingly consideration should be given to a modified radical prostatectomy Gleason scoring system that incorporates tertiary Gleason component in intuitive fashion, including Gleason score 6, 6.5 (Gleason score 6 with tertiary Gleason component), 7 (Gleason score 3 + 4 = 7), 7.25 (Gleason score 3 + 4 = 7 with tertiary Gleason component), 7.5 (Gleason score 4 + 3), 8 (Gleason score 4 + 3 with tertiary Gleason component or Gleason score 8), 8.5 (Gleason score 8 with tertiary Gleason component), 9 (Gleason score 4 + 5 or 5 + 4) and 10.
Student Learning Approaches in the UAE: The Case for the Achieving Domain
ERIC Educational Resources Information Center
McLaughlin, James; Durrant, Philip
2017-01-01
The deep versus surface learning approach dichotomy has dominated recent research in student learning approach dimensions. However, the achievement dimension may differ in importance in non-Western and vocational tertiary settings. The aim was to assess how Emirati tertiary students could be characterized in terms of their learning approaches. The…
Incorporating Online Tools in Tertiary Education
ERIC Educational Resources Information Center
Steenkamp, Leon P.; Rudman, Riaan J.
2013-01-01
Students currently studying at tertiary institutions have developed a set of attitudes and aptitudes as a result of growing up in an IT and media-rich environment. These attitudes and aptitudes influence how they learn and in order to be effective, lecturers must adapt to address their learning preferences and use the online teaching tools that…
Understanding Australian Aboriginal Tertiary Student Needs
ERIC Educational Resources Information Center
Oliver, Rhonda; Rochecouste, Judith; Bennell, Debra; Anderson, Roz; Cooper, Inala; Forrest, Simon; Exell, Mike
2013-01-01
Drawing from a study of the experiences of Australian Aboriginal and Torres Strait Islander university students, this paper presents an overview of the specific needs of these students as they enter and progress through their tertiary education. Extracts from a set of case studies developed from both staff and student interviews and an online…
NASA Astrophysics Data System (ADS)
Płotek, Michał; Starosta, Radosław; Komarnicka, Urszula K.; Skórska-Stania, Agnieszka; Kołoczek, Przemysław; Dudek, Karol; Kyzioł, Agnieszka
2016-10-01
Introduction of tertiary aminomethylphosphane P{CH2N(CH2CH2)2NCH2CH3}3 (B; tris{1-[4-ethyl(tetrahydro-1,4-diazino)]methyl}phosphane) to methanolic solution of [Ru(η5-C5H5)Cl(PPh3)2] (1) and NaBF4, instead of straightforward substitution of the chloride leads to concomitant cleavage of aminomethylphosphane's Psbnd CH2 bond. The obtained complex [Ru(η5-C5H5)PH{CH2N(CH2CH2)2NCH2CH3}2(PPh3)2]BF4 (2B‧) was fully characterized by spectroscopic methods ((NMR, IR, ESI-MS) and its solid state structure was determined with single crystal X-ray diffraction method. It was proven that the structure of 2B‧ is similar to the previously synthesized morpholine counterpart [Ru(η5-C5H5)PH{CH2N(CH2CH2)2O}2(PPh3)2]BF4 (2A‧). DFT calculations (B3LYP with the D95V(d,p) basis set for C, N, H and O and LanL2DZ with Los Alamos ECPs for Ru, P and Cl) revealed that the binding of aminomethylphosphanes to the ruthenium centre leads to the Psbnd C bonds elongation, which may finally result in breaking one of them and phosphane's reduction from tertiary to secondary ones.
Tertiary Excess of Fibroblast Growth Factor 23 and Hypophosphatemia Following Kidney Transplantation
Seeherunvong, Wacharee; Wolf, Myles
2010-01-01
Hypophosphatemia due to inappropriate urinary phosphate wasting is a frequent metabolic complication of the early period following kidney transplantation. Although previously considered to be caused by tertiary hyperparathyroidism, recent evidence suggests a primary role for persistently elevated circulating levels of the phosphorus-regulating hormone, fibroblast growth factors 23 (FGF23). In the setting of a healthy renal allograft, markedly increased FGF23 levels from the dialysis period induce renal phosphate wasting and inhibition of calcitriol production, which contribute to hypophosphatemia. While such tertiary FGF23 excess and resultant hypophosphatemia typically abates within the first few weeks to months post-transplant, some recipients manifest persistent renal phosphate wasting. Furthermore, increased FGF23 levels have been associated with increased risk of kidney disease progression, cardiovascular disease and death outside of the transplant setting. Whether tertiary FGF23 excess is associated with adverse transplant outcomes is unknown. In this article, we review the physiology of FGF23, summarize its relationship with hypophosphatemia after kidney transplantation, and speculate on its potential impact on long term outcomes of renal allograft recipients. PMID:20946192
Ng, Yen Ping; Balasubramanian, Ganesh Pandian; Heng, Yi Ping; Kalaiselvan, Meera; Teh, Yu Wen; Cheong, Kin Man; Hadi, Muhammad Faiz Bin Abdul; Othman, Rosmaliza Bt
2018-05-01
Recent data showed an alarming rise of new dialysis cases secondary to diabetic nephropathy despite the growing usage of RAAS blockers. Primary objective of this study is to explore the prevalence of RAAS blockers usage among type II diabetic patients, secondary objectives are to compare the prescribing pattern of RAAS blocker between primary and tertiary care center and to explore if the dose of RAAS blocker prescribed was at optimal dose as suggested by trials. This is a retrospective study conducted at one public tertiary referral hospital and one public health clinic in Sungai Petani, Kedah, Malaysia. RAAS blockers in T2DM patients was found to be 65%. In primary care, 14.3% of the RAAS blockers prescribed was ARB. Tertiary care had higher utilization of ARB, which was 42.9%. In primary care setting, the most commonly used ACEI were perindopril (92.4%) followed by enalapril (7.6%), meanwhile perindopril was the only ACEI being prescribed in tertiary care. The most prescribed ARB was irbesartan (63.6%) and telmisartan (54.2%) respectively in primary and tertiary care. Overall, 64.9% of RAAS blockers prescribed by both levels of care were found to be achieving the target dose as recommended in landmark trials. Crude odd ratio of prescribing RAAS blocker in primary care versus tertiary care was reported as 2.70 (95% CI: 1.49 to 4.91). RAAS blockers usage among T2DM patients was higher in primary care versus tertiary care settings. Majority of the patients did not receive optimal dose of RAAS blockers. Copyright © 2017 Diabetes India. Published by Elsevier Ltd. All rights reserved.
Vélez-Juarbe, Jorge; Brochu, Christopher A; Santos, Hernán
2007-01-01
The Indian gharial (Gavialis gangeticus) is not found in saltwater, but the geographical distribution of fossil relatives suggests a derivation from ancestors that lived in, or were at least able to withstand, saline conditions. Here, we describe a new Oligocene gharial, Aktiogavialis puertoricensis, from deltaic–coastal deposits of northern Puerto Rico. It is related to a clade of Neogene gharials otherwise restricted to South America. Its geological and geographical settings, along with its phylogenetic relationships, are consistent with two scenarios: (i) that a single trans-Atlantic dispersal event during the Tertiary explains the South American Neogene gharial assemblage and (ii) that stem gharials were coastal animals and their current restriction to freshwater settings is a comparatively recent environmental shift for the group. This discovery highlights the importance of including fossil information in a phylogenetic context when assessing the ecological history of modern organisms. PMID:17341454
Afshar, Mehran; Hamilton, Patrick; Seligmann, Jenny; Lord, Simon; Baxter, Paul; Marples, Maria; Stark, Dan; Hall, Peter S
2015-01-01
Imatinib therapy has improved outcomes in advanced GISTs. Current guidelines suggest monitoring with CT scanning every 12 weeks. There are no validated biomarkers to assist disease evaluation. We identified 50 patients treated with imatinib for GIST in a single tertiary center. We assessed the prognostic value of D-dimers by Cox regression, and the utility as a biomarker for radiological progression (rPD) using receiver-operator curve (ROC) analysis. In asymptomatic patients with D-dimer levels <1,000 and falling levels, the negative predictive value for rPD was 92%. D-dimers may reduce the burden of CT scanning in a proportion of patients in this setting.
Bisaria, Namita; Greenfeld, Max; Limouse, Charles; Pavlichin, Dmitri S.; Mabuchi, Hideo; Herschlag, Daniel
2016-01-01
The past decade has seen a wealth of 3D structural information about complex structured RNAs and identification of functional intermediates. Nevertheless, developing a complete and predictive understanding of the folding and function of these RNAs in biology will require connection of individual rate and equilibrium constants to structural changes that occur in individual folding steps and further relating these steps to the properties and behavior of isolated, simplified systems. To accomplish these goals we used the considerable structural knowledge of the folded, unfolded, and intermediate states of P4-P6 RNA. We enumerated structural states and possible folding transitions and determined rate and equilibrium constants for the transitions between these states using single-molecule FRET with a series of mutant P4-P6 variants. Comparisons with simplified constructs containing an isolated tertiary contact suggest that a given tertiary interaction has a stereotyped rate for breaking that may help identify structural transitions within complex RNAs and simplify the prediction of folding kinetics and thermodynamics for structured RNAs from their parts. The preferred folding pathway involves initial formation of the proximal tertiary contact. However, this preference was only ∼10 fold and could be reversed by a single point mutation, indicating that a model akin to a protein-folding contact order model will not suffice to describe RNA folding. Instead, our results suggest a strong analogy with a modified RNA diffusion-collision model in which tertiary elements within preformed secondary structures collide, with the success of these collisions dependent on whether the tertiary elements are in their rare binding-competent conformations. PMID:27493222
Bao, Le; Gu, Hong; Dunn, Katherine A; Bielawski, Joseph P
2007-02-08
Models of codon evolution have proven useful for investigating the strength and direction of natural selection. In some cases, a priori biological knowledge has been used successfully to model heterogeneous evolutionary dynamics among codon sites. These are called fixed-effect models, and they require that all codon sites are assigned to one of several partitions which are permitted to have independent parameters for selection pressure, evolutionary rate, transition to transversion ratio or codon frequencies. For single gene analysis, partitions might be defined according to protein tertiary structure, and for multiple gene analysis partitions might be defined according to a gene's functional category. Given a set of related fixed-effect models, the task of selecting the model that best fits the data is not trivial. In this study, we implement a set of fixed-effect codon models which allow for different levels of heterogeneity among partitions in the substitution process. We describe strategies for selecting among these models by a backward elimination procedure, Akaike information criterion (AIC) or a corrected Akaike information criterion (AICc). We evaluate the performance of these model selection methods via a simulation study, and make several recommendations for real data analysis. Our simulation study indicates that the backward elimination procedure can provide a reliable method for model selection in this setting. We also demonstrate the utility of these models by application to a single-gene dataset partitioned according to tertiary structure (abalone sperm lysin), and a multi-gene dataset partitioned according to the functional category of the gene (flagellar-related proteins of Listeria). Fixed-effect models have advantages and disadvantages. Fixed-effect models are desirable when data partitions are known to exhibit significant heterogeneity or when a statistical test of such heterogeneity is desired. They have the disadvantage of requiring a priori knowledge for partitioning sites. We recommend: (i) selection of models by using backward elimination rather than AIC or AICc, (ii) use a stringent cut-off, e.g., p = 0.0001, and (iii) conduct sensitivity analysis of results. With thoughtful application, fixed-effect codon models should provide a useful tool for large scale multi-gene analyses.
Prevalence, Causes and Effects of Bullying in Tertiary Institutions in Cross River State, Nigeria
ERIC Educational Resources Information Center
Ada, Mary Juliana; Okoli, Georgina; Obeten, Okoi Okorn; Akeke, M. N. G.
2016-01-01
This research is an evaluation of the impact of causes, consequences and effects of bullying in academic setting on student academic performance in tertiary institutions in Cross River State, Nigeria. The research made use of purposive and random sampling techniques made up of 302 students. Questionnaire served as the data collection instrument.…
Co-Construction of Knowledge in Tertiary Online Settings: An Ecology of Resources Perspective
ERIC Educational Resources Information Center
Westberry, Nicola; Franken, Margaret
2013-01-01
Tertiary education has seen a shift toward pedagogies that make use of social interaction. As part of the shift, teachers have considered re-framing their role in the teaching process, and giving more attention to ways in which knowledge construction amongst students can be supported. While many online technologies are well positioned to support…
Direct Enrollments at Twenty-two Colleges and Universities Test Society's Confidence
ERIC Educational Resources Information Center
Chunlin, Yuan
2005-01-01
This article examines the direct admission process and the selection criteria set by the tertiary institutions in China. As the name suggests, "direct admissions" means that it is up to the institution to decide which students to enroll. Tertiary institutions also have the right to decide the number of admissions, and not all schools are…
Power to the paediatricians: the Australian Paediatric Research Network is born.
Hiscock, Harriet; Efron, Daryl; Wasserman, Richard; Wake, Melissa
2012-01-01
In late 2007, we established the Australian Paediatric Research Network (APRN) - a 350 member strong research network - which aims to facilitate high quality research into common, child health conditions seen in secondary care settings. Through this network we hope to engage paediatricians working at 'the coal face' to generate research ideas, take part in projects and ultimately contribute to better health care and policy for Australian children. As for adults, tertiary institutions remain the predominant site of paediatric research. Tertiary research however, is biased towards severe illness, isolated conditions, highly selected patients and single interventions. This is not always relevant to the real world that paediatricians confront every day. The APRN is off to a strong start. We have worked with members to establish their research priorities and conducted a prospective audit of their caseload to inform the relevance, feasibility and design of future APRN studies. We have developed a website (http://www.aprn.org.au) which will house useful tools for conducting research including child health measures and project design needs. We plan to call for member-initiated research proposals on an annual basis and to conduct a 'multi-topic' survey addressing up to six research topics at any one time. Although conducting research in secondary care settings poses time, cost and process challenges, all of these are firmly within the APRN's sights. © 2010 The Authors. Journal compilation © 2010 Paediatrics and Child Health Division (Royal Australasian College of Physicians).
Global fire at the Cretaceous-Tertiary boundary
NASA Technical Reports Server (NTRS)
Wolbach, Wendy S.; Gilmour, Iain; Anders, Edward; Orth, Charles J.; Brooks, Robert R.
1988-01-01
Cretaceous-Tertiary boundary clays rich in iridium from five sites in Europe and New Zealand were investigated. The clays are found to be 100-10,000-fold-enriched in elemental carbon (mainly soot), which is isotopically uniform and apparently comes from a single global fire. The soot layer coincides with the iridium layer, suggesting that the fire was triggered by meteorite impact and began before the ejecta had settled.
McDowell, S. Elizabeth; Jun, Jesse M.; Walter, Nils G.
2010-01-01
Enzymes generally are thought to derive their functional activity from conformational motions. The limited chemical variation in RNA suggests that such structural dynamics may play a particularly important role in RNA function. Minimal hammerhead ribozymes are known to cleave efficiently only in ∼10-fold higher than physiologic concentrations of Mg2+ ions. Extended versions containing native loop–loop interactions, however, show greatly enhanced catalytic activity at physiologically relevant Mg2+ concentrations, for reasons that are still ill-understood. Here, we use Mg2+ titrations, activity assays, ensemble, and single molecule fluorescence resonance energy transfer (FRET) approaches, combined with molecular dynamics (MD) simulations, to ask what influence the spatially distant tertiary loop–loop interactions of an extended hammerhead ribozyme have on its structural dynamics. By comparing hammerhead variants with wild-type, partially disrupted, and fully disrupted loop–loop interaction sequences we find that the tertiary interactions lead to a dynamic motional sampling that increasingly populates catalytically active conformations. At the global level the wild-type tertiary interactions lead to more frequent, if transient, encounters of the loop-carrying stems, whereas at the local level they lead to an enrichment in favorable in-line attack angles at the cleavage site. These results invoke a linkage between RNA structural dynamics and function and suggest that loop–loop interactions in extended hammerhead ribozymes—and Mg2+ ions that bind to minimal ribozymes—may generally allow more frequent access to a catalytically relevant conformation(s), rather than simply locking the ribozyme into a single active state. PMID:20921269
ERIC Educational Resources Information Center
Suddaby, Gordon; Milne, John
2008-01-01
Purpose: The paper aims to discusses two complementary initiatives focussed on developing and implementing e-learning guidelines to support good pedagogy in e-learning practice. Design/methodology/approach: The first initiative is the development of a coherent set of open access e-learning guidelines for the New Zealand tertiary sector. The second…
DYNAMICAL MEASUREMENTS OF THE YOUNG UPPER SCORPIUS TRIPLE NTTS 155808-2219
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mace, G. N.; McLean, I. S.; Prato, L.
2012-08-15
The young, low-mass, triple system NTTS 155808-2219 (ScoPMS 20) was previously identified as a {approx}17 day period single-lined spectroscopic binary (SB) with a tertiary component at 0.21 arcsec. Using high-resolution infrared spectra, acquired with NIRSPEC on Keck II, both with and without adaptive optics (AO), we measured radial velocities (RVs) of all three components. Reanalysis of the single-lined visible light observations, made from 1987 to 1993, also yielded RV detections of the three stars. Combining visible light and infrared data to compute the orbital solution produces orbital parameters consistent with the single-lined solution and a mass ratio of q =more » 0.78 {+-} 0.01 for the SB. We discuss the consistency between our results and previously published data on this system, our RV analysis with both observed and synthetic templates, and the possibility that this system is eclipsing, providing a potential method for the determination of the stars' absolute masses. Over the {approx}20 year baseline of our observations, we have measured the acceleration of the SB's center of mass in its orbit with the tertiary. Long-term, AO imaging of the tertiary will eventually yield dynamical data useful for component mass estimates.« less
Cooperative Tertiary Interaction Network Guides RNA Folding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Behrouzi, Reza; Roh, Joon Ho; Kilburn, Duncan
2013-04-08
Noncoding RNAs form unique 3D structures, which perform many regulatory functions. To understand how RNAs fold uniquely despite a small number of tertiary interaction motifs, we mutated the major tertiary interactions in a group I ribozyme by single-base substitutions. The resulting perturbations to the folding energy landscape were measured using SAXS, ribozyme activity, hydroxyl radical footprinting, and native PAGE. Double- and triple-mutant cycles show that most tertiary interactions have a small effect on the stability of the native state. Instead, the formation of core and peripheral structural motifs is cooperatively linked in near-native folding intermediates, and this cooperativity depends onmore » the native helix orientation. The emergence of a cooperative interaction network at an early stage of folding suppresses nonnative structures and guides the search for the native state. We suggest that cooperativity in noncoding RNAs arose from natural selection of architectures conducive to forming a unique, stable fold.« less
Manufacture of a combined primary and tertiary mirror for the Large Synoptic Survey Telescope
NASA Astrophysics Data System (ADS)
Martin, H. M.; Burge, J. H.; Cuerden, B.; Davison, W. B.; Kingsley, J. S.; Lutz, R. D.; Miller, S. M.; Tuell, M.
2008-07-01
The Large Synoptic Survey Telescope uses a unique optomechanical design that places the primary and tertiary mirrors on a single glass substrate. The honeycomb sandwich mirror blank was formed in March 2008 by spin-casting. The surface is currently a paraboloid with a 9.9 m focal length matching the primary. The deeper curve of the tertiary mirror will be produced when the surfaces are generated. Both mirrors will be lapped and polished using stressed laps and other tools on an 8.4 m polishing machine. The highly aspheric primary mirror will be measured through a refractive null lens, and a computer-generated hologram will be used to validate the null lens. The tertiary mirror will be measured through a diffractive null corrector, also validated with a separate hologram. The holograms for the two tests provide alignment references that will be used to make the axes of the two surfaces coincide.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berry, J.L.; Nishidai, T.
1996-08-01
Remotely sensed imagery and various other published regional data sets (gravity, magnetics, earthquake data) were integrated in order to interpret the structural style, both at deep crustal levels and at the relatively shallow levels of interest to explorationists, of the Tien Shan. Cross-sections through the range were systematically prepared, and then palinspastically restored, constrained by the remote sensing interpretation, potential fields data, and published microplate movement vectors. Since large portions of the area are covered by late Tertiary orogenic sediments, the resulting interpretation focused on these areas, and what and how much geology lies concealed beneath them. We were ablemore » to demonstrate the likely consumption in the late Tertiary of over 100 km of Tarim Basin west along a broad front south of the Tien Shan, as well as within the Kuruktag area, where basins are compressional rather than extensional. There are also local areas of extension within the orogenic zone, and these can be explained using the known microplate boundaries, backward extrapolation of present microplate motions, and the type and extent of late Tertiary deformation within the plates as constraints. Relative and absolute microplate motions have to change greatly through Tertiary time in order to comply with these constraints. The results of this work allow one to infer the affinities, and hence something of the hydrocarbon potential, of fragmentary plates by reconstructing their motions. They also allow one to infer the nature of the stratigraphy, the likely depth of burial, and something of the maturation history of pre-Tertiary rocks buried by Tertiary sediments deposited in both compressional and extensional regimes.« less
Rocky Mountain Tertiary coal-basin models and their applicability to some world basins
Flores, R.M.
1989-01-01
Tertiary intermontane basins in the Rocky Mountain region of the United States contain large amounts of coal resources. The first major type of Tertiary coal basin is closed and lake-dominated, either mud-rich (e.g., North Park Basin, Colorado) or mud plus carbonate (e.g., Medicine Lodge Basin, Montana), which are both infilled by deltas. The second major type of Tertiary coal basin is open and characterized by a preponderance of sediments that were deposited by flow-through fluvial systems (e.g., Raton Basin, Colorado and New Mexico, and Powder River Basin, Wyoming and Montana). The setting for the formation of these coals varies with the type of basin sedimentation, paleotectonism, and paleoclimate. The mud-rich lake-dominated closed basin (transpressional paleotectonism and warm, humid paleoclimate), where infilled by sandy "Gilbert-type" deltas, contains thick coals (low ash and low sulfur) formed in swamps of the prograding fluvial systems. The mud- and carbonate-rich lake-dominated closed basin is infilled by carbonate precipitates plus coarse-grained fan deltas and fine-grained deltas. Here, thin coals (high ash and high sulfur) formed in swamps of the fine-grained deltas. The coarse-clastic, open basins (compressional paleotectonism and warm, paratropical paleoclimate) associated with flow-through fluvial systems contain moderately to anomalously thick coals (high to low ash and low sulfur) formed in swamps developed in intermittently abandoned portions of the fluvial systems. These coal development patterns from the Tertiary Rocky Mountain basins, although occurring in completely different paleotectonic settings, are similar to that found in the Tertiary, Cretaceous, and Permian intermontane coal basins in China, New Zealand, and India. ?? 1989.
ERIC Educational Resources Information Center
Winterhager, Nicolas; Krücken, Georg
2015-01-01
We analyse recruitment of recent tertiary education graduates drawing on a rich set of interviews with human resource managers of 46 large- and medium-sized firms in different regions across Germany. Specifically, we address the question of which higher education institutions' managers choose for campus recruiting and which criteria managers use…
ERIC Educational Resources Information Center
Eady, Michelle J.; Woodcock, Stuart; Sisco, Ashley
2017-01-01
As e-learning maintains its popularity worldwide, and university enrolments continue to rise, online tertiary level coursework is increasingly being designed for groups of distributed learners, as opposed to individual students. Many institutions struggle with incorporating all facets of online learning and teaching capabilities with the range and…
Determinants of career satisfaction among pediatric hospitalists: a qualitative exploration
Leyenaar, JoAnna K.; Capra, Lisa A.; O'Brien, Emily R.; Leslie, Laurel K.; Mackie, Thomas I.
2014-01-01
Objectives To characterize determinants of career satisfaction among pediatric hospitalists working in diverse practice settings, and to develop a framework to conceptualize factors influencing career satisfaction. Methods Semi-structured interviews were conducted with community and tertiary care hospitalists, using purposeful sampling to attain maximum response diversity. We employed close- and open-ended questions to assess levels of career satisfaction and its determinants. Interviews were conducted by telephone, recorded, and transcribed verbatim. Emergent themes were identified and analyzed using an inductive approach to qualitative analysis. Results A total of 30 interviews were conducted with community and tertiary care hospitalists, representing 20 hospital medicine programs and 7 Northeastern states. Qualitative analysis yielded 657 excerpts which were coded and categorized into four domains and associated determinants of career satisfaction: (i) professional responsibilities; (ii) hospital medicine program administration; (iii) hospital and healthcare systems; and (iv) career development. While community and tertiary care hospitalists reported similar levels of career satisfaction, they expressed variation in perspectives across these four domains. While the role of hospital medicine program administration was consistently emphasized by all hospitalists, community hospitalists prioritized resource availability, work schedule and clinical responsibilities while tertiary care hospitalists prioritized diversity in non-clinical responsibilities and career development. Conclusions We illustrate how hospitalists in different organizational settings prioritize both consistent and unique determinants of career satisfaction. Given associations between physician satisfaction and healthcare quality, efforts to optimize modifiable factors within this framework, at both community and tertiary care hospitals, may have broad impacts. PMID:24976348
Nonmelanoma skin cancer in Saudi Arabia: single center experience.
AlSalman, Sarah Abdullah; Alkaff, Tuqa Morad; Alzaid, Tariq; Binamer, Yousef
2018-01-01
Skin cancer is the most common cancer worldwide; one in every three diagnosed malignancies is a skin cancer. However, skin cancer is rarely reported in Saudi Arabia so we conducted this study to highlight these underreported neoplasms. Determine the prevalence and patterns of basal cell carcinoma (BCC) and primary squamous cell carcinoma (SCC), the most common types of nonmelanoma skin cancer (NMSC) with respect to age, sex, and anatomic location and to identify potentially associated risk factors. Retrospective, descriptive medical record review. A tertiary care centre. We did a retrospective chart review of all patients diagnosed with basal cell carcinoma and primary squamous cell carcinoma between 2003-2016. Prevalence and pattern of BCC and SCC with respect to age, sex, and anatomic location. Of 593 cases reviewed, 279 had NMSC. Most (95%) were diagnosed with BCC or SCC or both in a few cases. The mean age at diagnosis was 59 (19.5) years. Sixty-two percent of the patients were males. However, 24.3% (n=68) of skin cancers occurred in patients younger than 50 years. The frequency of BCC and SCC was 50.2% and 44.8%, respectively. The head and neck was the most common location (79.6%). In patients younger than 50 years, xeroderma pigmentosum and previously treated solid malignancies were the major factors. BCC and SCC are uncommon but not rare. However, skin cancers are underreported in our population. NMSC in individuals younger than 50 years of age requires more careful evaluation of possible risk factors. Retrospective in a single tertiary care setting.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, X.; Wilcox, G.L.
1993-12-31
We have implemented large scale back-propagation neural networks on a 544 node Connection Machine, CM-5, using the C language in MIMD mode. The program running on 512 processors performs backpropagation learning at 0.53 Gflops, which provides 76 million connection updates per second. We have applied the network to the prediction of protein tertiary structure from sequence information alone. A neural network with one hidden layer and 40 million connections is trained to learn the relationship between sequence and tertiary structure. The trained network yields predicted structures of some proteins on which it has not been trained given only their sequences.more » Presentation of the Fourier transform of the sequences accentuates periodicity in the sequence and yields good generalization with greatly increased training efficiency. Training simulations with a large, heterologous set of protein structures (111 proteins from CM-5 time) to solutions with under 2% RMS residual error within the training set (random responses give an RMS error of about 20%). Presentation of 15 sequences of related proteins in a testing set of 24 proteins yields predicted structures with less than 8% RMS residual error, indicating good apparent generalization.« less
Cranwell, Kate; Polacsek, Meg
2016-01-01
Abstract Medical comorbidity in people with long‐term mental illness is common and often undetected; however, these consumers frequently experience problems accessing and receiving appropriate treatment in public health‐care services. The aim of the present study was to understand the lived experience of mental health consumers with medical comorbidity and their carers transitioning through tertiary medical to primary care services. An interpretative, phenomenological analysis approach was used, and semistructured, video‐recorded, qualitative interviews were used with 12 consumers and four primary caregivers. Four main themes and related subthemes were abstracted from the data, highlighting consumer's and carers’ experience of transition through tertiary medical to primary care services: (i) accessing tertiary services is difficult and time consuming; (ii) contrasting experiences of clinician engagement and support; (iii) lack of continuity between tertiary medical and primary care services; and (iv) Mental Health Hospital Admission Reduction Programme (MH HARP) clinicians facilitating transition. Our findings have implications for organisational change, expanding the role of MH HARP clinicians (whose primary role is to provide consumers with intensive support and care coordination to prevent avoidable tertiary medical hospital use), and the employment of consumer and carer consultants in tertiary medical settings, especially emergency departments. PMID:26735771
Error, Marc; Ashby, Shaelene; Orlandi, Richard R; Alt, Jeremiah A
2018-01-01
Objective To determine if the introduction of a systematic preoperative sinus computed tomography (CT) checklist improves identification of critical anatomic variations in sinus anatomy among patients undergoing endoscopic sinus surgery. Study Design Single-blinded prospective cohort study. Setting Tertiary care hospital. Subjects and Methods Otolaryngology residents were asked to identify critical surgical sinus anatomy on preoperative CT scans before and after introduction of a systematic approach to reviewing sinus CT scans. The percentage of correctly identified structures was documented and compared with a 2-sample t test. Results A total of 57 scans were reviewed: 28 preimplementation and 29 postimplementation. Implementation of the sinus CT checklist improved identification of critical sinus anatomy from 24% to 84% correct ( P < .001). All residents, junior and senior, demonstrated significant improvement in identification of sinus anatomic variants, including those not directly included in the systematic review implemented. Conclusion The implementation of a preoperative endoscopic sinus surgery radiographic checklist improves identification of critical anatomic sinus variations in a training population.
Plotnikoff, Ronald; Collins, Clare E; Williams, Rebecca; Germov, John; Callister, Robin
2015-01-01
Evaluate the literature on interventions targeting tertiary education staff within colleges and universities for improvements in health behaviors such as physical activity, dietary intake, and weight loss. One online database, Medline, was searched for literature published between January 1970 and February 2013. All quantitative study designs, including but not limited to randomized controlled trials, quasi-experimental studies, nonrandomized experimental trials, cohort studies, and case-control studies, were eligible. Data extraction was performed by one reviewer using a standardized form developed by the researchers. Extraction was checked for accuracy and consistency by a second reviewer. Data in relation to the above objective were extracted and described in a narrative synthesis. Seventeen studies were identified that focused on staff within the tertiary education setting. The review yielded overall positive results with 13 reporting significant health-related improvements. Weight loss, physical activity and fitness, and/or nutrition were the focus in more than half (n = 9) of the studies. This appears to be the first review to examine health interventions for tertiary education staff. There is scope to enhance cross-disciplinary collaboration in the development and implementation of a "Healthy University" settings-based approach to health promotion in tertiary education workplaces. Universities or colleges could serve as a research platform to evaluate such intervention strategies.
McGann, Patrick; Bunin, Jessica L; Snesrud, Erik; Singh, Seema; Maybank, Rosslyn; Ong, Ana C; Kwak, Yoon I; Seronello, Scott; Clifford, Robert J; Hinkle, Mary; Yamada, Stephen; Barnhill, Jason; Lesho, Emil
2016-07-01
Whole genome sequencing (WGS) is increasingly employed in clinical settings, though few assessments of turnaround times (TAT) have been performed in real-time. In this study, WGS was used to investigate an unfolding outbreak of vancomycin resistant Enterococcus faecium (VRE) among 3 patients in the ICU of a tertiary care hospital. Including overnight culturing, a TAT of just 48.5 h for a comprehensive report was achievable using an Illumina Miseq benchtop sequencer. WGS revealed that isolates from patient 2 and 3 differed from that of patient 1 by a single nucleotide polymorphism (SNP), indicating nosocomial transmission. However, the unparalleled resolution provided by WGS suggested that nosocomial transmission involved two separate events from patient 1 to patient 2 and 3, and not a linear transmission suspected by the time line. Rapid TAT's are achievable using WGS in the clinical setting and can provide an unprecedented level of resolution for outbreak investigations. Published by Elsevier Inc.
Roy, Rajshri; Kelly, Bridget; Rangan, Anna; Allman-Farinelli, Margaret
2015-10-01
The current obesity-promoting food environment, typified by highly accessible unhealthy foods and drinks, may lead to an increased risk of chronic disease, particularly within young adults. A number of university-based intervention trials have been conducted in the United States and Europe to improve the food environment in this setting. However, there are no systematic reviews focusing on these interventions conducted exclusively in tertiary education settings. Our objective was to conduct a systematic literature review evaluating food environment interventions targeting dietary behavior in young adults in college and university settings. Eight databases were searched for randomized controlled trials, pre- and postintervention studies, quasiexperimental studies, cross-sectional studies, and other nonexperimental studies from 1998 to December 2014 that were conducted in tertiary education settings (ie, colleges and universities). Studies that evaluated a food environment intervention and reported healthier food choices, reductions in unhealthy food choices, nutrition knowledge, and/or food and drink sales as primary outcomes were included. Fifteen studies of high (n=5), medium (n=7), and poor quality (n=3) met the inclusion criteria, 13 of which showed positive improvements in outcome measures. Information relating to healthy foods through signage and nutrition labels (n=10) showed improvements in outcomes of interest. Increasing the availability of healthy foods (n=1) and decreasing the portion size of unhealthy foods (n=2) improved dietary intake. Price incentives and increased availability of healthy foods combined with nutrition information to increase purchases of healthy foods (n=2) were identified as having a positive effect on nutrition-related outcomes. Potentially useful interventions in tertiary education settings were nutrition messages/nutrient labeling, providing healthy options, and portion size control of unhealthy foods. Price decreases for and the increased availability of healthy options combined with nutrition information resulted in improvements in dietary habits. Additional research comparing the long-term effectiveness of environmental and combinations of environmental interventions on improving health outcomes is warranted. Copyright © 2015 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.
Quantitative tests of a reconstitution model for RNA folding thermodynamics and kinetics.
Bisaria, Namita; Greenfeld, Max; Limouse, Charles; Mabuchi, Hideo; Herschlag, Daniel
2017-09-12
Decades of study of the architecture and function of structured RNAs have led to the perspective that RNA tertiary structure is modular, made of locally stable domains that retain their structure across RNAs. We formalize a hypothesis inspired by this modularity-that RNA folding thermodynamics and kinetics can be quantitatively predicted from separable energetic contributions of the individual components of a complex RNA. This reconstitution hypothesis considers RNA tertiary folding in terms of ΔG align , the probability of aligning tertiary contact partners, and ΔG tert , the favorable energetic contribution from the formation of tertiary contacts in an aligned state. This hypothesis predicts that changes in the alignment of tertiary contacts from different connecting helices and junctions (ΔG HJH ) or from changes in the electrostatic environment (ΔG +/- ) will not affect the energetic perturbation from a mutation in a tertiary contact (ΔΔG tert ). Consistent with these predictions, single-molecule FRET measurements of folding of model RNAs revealed constant ΔΔG tert values for mutations in a tertiary contact embedded in different structural contexts and under different electrostatic conditions. The kinetic effects of these mutations provide further support for modular behavior of RNA elements and suggest that tertiary mutations may be used to identify rate-limiting steps and dissect folding and assembly pathways for complex RNAs. Overall, our model and results are foundational for a predictive understanding of RNA folding that will allow manipulation of RNA folding thermodynamics and kinetics. Conversely, the approaches herein can identify cases where an independent, additive model cannot be applied and so require additional investigation.
Ji, Yue; Shi, Lei; Chen, Mu-Wang; Feng, Guang-Shou; Zhou, Yong-Gui
2015-08-26
A concise deracemization of racemic secondary and tertiary amines with a tetrahydroisoquinoline core has been successfully realized by orchestrating a redox process consisted of N-bromosuccinimide oxidation and iridum-catalyzed asymmetric hydrogenation. This compatible redox combination enables one-pot, single-operation deracemization to generate chiral 1-substituted 1,2,3,4-tetrahydroisoquinolines with up to 98% ee in 93% yield, offering a simple and scalable synthetic technique for chiral amines directly from racemic starting materials.
De Graaff, A A; Dirksen, C D; Simoens, S; De Bie, B; Hummelshoj, L; D'Hooghe, T M; Dunselman, G A J
2015-06-01
To what extent are outcome measures in endometriosis-related quality of life studies influenced by the setting in which patient recruitment is performed? Quality of life outcomes in women with endometriosis are highly influenced by recruitment strategies. Most studies on quality of life in women with endometriosis are conducted in tertiary care centres or patient associations. It is conceivable that the setting in which patient recruitment is performed influences the quality of life results. This has not been investigated before. Retrospective questionnaire based cohort study (part of the World Endometriosis Research Foundation (WERF) EndoCost study). The investigated women were recruited in three settings: a tertiary care centre for endometriosis (n = 135); five secondary care centres (n = 63); an endometriosis patient association (n = 291). The secondary and tertiary care population included women with a laparoscopic and/or histological diagnosis of endometriosis. The patient association population consisted of women with a self-reported diagnosis of surgically confirmed endometriosis. The populations did not differ in terms of age, co-morbidities and education level. Delay of diagnosis was the longest in the patient association (median 7 years) (tertiary care 2 years; secondary care 1.5 years) (P < 0.001). The tertiary care population reported more laparotomies (64%) than the other populations (secondary care 43%; patient association 47%) (P = 0.002). Affected job was least prevalent in the secondary care setting (35%) (patient association 64%; tertiary care 56%) (P < 0.001). Affected relationships were most prevalent in the patient association setting (52%) (tertiary care 38%; secondary care 22%) (P < 0.001). Chronic pain was least prevalent in patients in secondary care (44%) (tertiary care 65%; patient association 61%) (P = 0.009). Substantial differences in quality of life were detected between secondary care (median physical component 50.4, mental component 49.6); tertiary care (physical component 46.2, mental component 46.2) and the patient association (physical component 45.0, mental component 44.6) (P < 0.001, P = 0.018). The response rate was relatively low (35%). Analysis of the hospital populations revealed that non-responders and responders did not differ with respect to age or revised American Fertility Society classification, indicating that the non-responder bias is limited. However, other factors, such as social and marital status or symptomatology, might be different for non-responders. Missing values were analysed as if the symptom was not present. Missing values never exceeded 10%, except for one value. Therefore, it can be expected that the effect of missing data on the outcome is negligible. Twenty-five patients belonged to more than one category. A sensitivity analysis showed that the influence of assigning patients to another category was limited. Outcomes regarding quality of life are highly influenced by recruitment strategy. None of the groups appeared to be a representative selection of the total population of women with endometriosis. An alternative strategy for creating a representative population for cost and quality of life studies is probably to recruit women who live in a specific geographic area rather than women that visit a specific hospital or are a member of a patient association. The WERF EndoCost study was funded by the World Endometriosis Research Foundation. The sponsors did not have a role in the design and conduct of this study: collection, management, analysis, interpretation of the data; preparation, review, approval of the manuscript. L.H. is the chief executive and T.M.D. was a board member of WERF at the time of funding. T.M.D holds the Merck-Serono Chair and the Ferring Chair in Reproductive Medicine in Leuven, Belgium and has served as consultant for Merck-Serono, Schering-Plough, Astellas, and Arresto. Not applicable. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
ERIC Educational Resources Information Center
Scott, Terrance M.; Cooper, Justin
2013-01-01
Students in alternative, residential, and correctional settings present challenges in the classroom and facility due to the complexity and intensity of their behaviors. In addition, the factors typically associated with these settings including crowding, inconsistency, and conflicting staff perspectives on education and discipline present…
Aamir, Muhammad; Khan, Jamshaid Ali; Shakeel, Faisal; Asim, Syed Muhammad
2017-08-01
Background Unlicensed and off-label prescribing practice is global dilemma around the world. This pioneering study was designed to determine unlicensed and off-label use of drug in surgical wards of tertiary care hospitals of Pakistan. Objective To assess unlicensed and off-label use of drugs in pediatric surgical unit at three tertiary care hospitals in Peshawar, Pakistan. Setting Two government and one private tertiary care hospitals in Pakistan. Method Drug profiles of 895 patients from three different clinical settings were evaluated for unlicensed and off-label use of drugs using Micromedex DRUGDEX. Main outcome measure Characteristics of the unlicensed and off-label drug prescriptions. Result Total of 3168 prescribed drugs were analyzed in this study. Indication (38.7%) and dose (34.8%) were the most frequent off-label categories. In comparison with the corresponding reference categories, infants and children, male patients and having less than five prescribed drugs were significant predictors of unlicensed prescriptions. In comparison with the corresponding reference categories, significant predictors of off-label drug prescribing were children younger than two year, children between 2-12 years, patient staying at hospital less than 5 days and patients having less than five prescribed drugs. Conclusion The prevalence of unlicensed and off-label drug prescriptions are high at pediatric surgical ward of tertiary care hospitals. More awareness of the efficacy and safety of drugs are required in pediatrics. In addition, new formulations with advanced dosing for children are also required to minimize the risk of adverse outcomes.
Efficacy of sequential three-step empirical therapy for chronic cough.
Yu, Li; Xu, Xianghuai; Hang, Jingqing; Cheng, Kewen; Jin, Xiaoyan; Chen, Qiang; Lv, Hanjing; Qiu, Zhongmin
2017-06-01
Empirical three-step therapy has been proved in just one hospital. This study aimed to demonstrate applicability of the sequential empirical three-step therapy for chronic cough in different clinical settings. Sequential empirical three-step therapy was given to patients with chronic cough in one tertiary and three secondary care respiratory clinics. Recruiters were initially treated with methoxyphenamine compound as the first-step therapy, followed by corticosteroids as the second-step therapy and the combination of a proton-pump inhibitor and a prokinetic agent as the third-step therapy. The efficacy of the therapy was verified according to the changes in cough symptom score between pre- and post-treatment, and compared among the different clinics. In total 155 patients in one tertiary clinic and 193 patients in secondary care clinics were recruited. The total dropout ratio is significantly higher in the secondary care clinics than that in the tertiary clinic (9.3% versus 3.2%, p = 0.023). The therapeutic success rate for cough was 38.7% at first-step therapy, 32.3% at second-step therapy and 20.0% at third-step therapy in the tertiary clinic, and comparable to corresponding 49.7%, 31.1% and 4.1% in secondary care clinics. Furthermore, the overall cough resolution rate was not significantly different (91.0% versus 85.0%, p = 0.091). However, the efficacy of the third-step therapy is much higher (20.0% versus 4.1%, p = 0.001) in the tertiary clinic than in the secondary care clinics. Sequential empirical three-step therapy is universally efficacious and useful for management of chronic cough in different clinical settings.
Nichols, D.J.
1990-01-01
Palynologically defined Cretaceous-Tertiary boundary sites in nonmarine rocks in western North America exhibit similar characteristics. All are marked by abrupt disappearance of the regional uppermost Cretaceous palynoflora at the level of an iridium anomaly; most also yeild shock-metamorphosed minerals. All are in coal-bearing, fluvial or paludal depositional settings, although the boundary horizon may be below, within, above, or at some stratigraphic distance from coal seams. At many sites the lowermost Tertiary beds contain assemblages overwhelmed by fern spores that, together with extinctions of some groups of angiosperms, are taken as evidence of regional devastation of terrestrial plant communities and subsequent recolonization by pioneer species. ?? 1990.
Structural specificity of Rn nuclease I as probed on yeast tRNA(Phe) and tRNA(Asp).
Przykorska, A; el Adlouni, C; Keith, G; Szarkowski, J W; Dirheimer, G
1992-01-01
A single-strand-specific nuclease from rye germ (Rn nuclease I) was characterized as a tool for secondary and tertiary structure investigation of RNAs. To test the procedure, yeast tRNA(Phe) and tRNA(Asp) for which the tertiary structures are known, as well as the 3'-half of tRNA(Asp) were used as substrates. In tRNA(Phe) the nuclease introduced main primary cuts at positions U33 and A35 of the anticodon loop and G18 and G19 of the D loop. No primary cuts were observed within the double stranded stems. In tRNA(Asp) the main cuts occurred at positions U33, G34, U35, C36 of the anticodon loop and G18 and C20:1 positions in the D loop. No cuts were observed in the T loop in intact tRNA(Asp) but strong primary cleavages occurred at positions psi 55, C56, A57 within that loop in the absence of the tertiary interactions between T and D loops (use of 3'-half tRNA(Asp)). These results show that Rn nuclease I is specific for exposed single-stranded regions. Images PMID:1542562
Freitag, Frederick G; Lyss, Heidi; Nissan, George R
2013-10-01
Headache is among the most common disabling pain complaints. While many patients are managed in primary care or referral neurology practices, some patients have refractive situations that necessitate referral to a tertiary headache center. Increasing frequency of headache is strongly associated with increasing disability and workplace absenteeism as well as increased healthcare utilization. Previous studies have demonstrated that headache care in a dedicated tertiary center is associated with a decrease in headache frequency and improvement in other characteristics that persist over extended periods of time. Previous studies have not examined the impact of this treatment on subsequent healthcare utilization and associated expenditures. In this study we examined the changes in healthcare utilization and expenditures as well as the impact on disability and workplace productivity with treatment in a tertiary headache care center that used initial treatment settings of inpatient and outpatient care and considered the difference between those with episodic migraine and those with chronic migraine and its complications. Tertiary care was found to produce positive reductions in disability, healthcare utilization, and expenditures. These results suggest that earlier tertiary-level intervention may avoid the complications of migraine that occur in some patients and the increasing costs and utilization of care associated with higher disability.
Lyss, Heidi; Nissan, George R.
2013-01-01
Headache is among the most common disabling pain complaints. While many patients are managed in primary care or referral neurology practices, some patients have refractive situations that necessitate referral to a tertiary headache center. Increasing frequency of headache is strongly associated with increasing disability and workplace absenteeism as well as increased healthcare utilization. Previous studies have demonstrated that headache care in a dedicated tertiary center is associated with a decrease in headache frequency and improvement in other characteristics that persist over extended periods of time. Previous studies have not examined the impact of this treatment on subsequent healthcare utilization and associated expenditures. In this study we examined the changes in healthcare utilization and expenditures as well as the impact on disability and workplace productivity with treatment in a tertiary headache care center that used initial treatment settings of inpatient and outpatient care and considered the difference between those with episodic migraine and those with chronic migraine and its complications. Tertiary care was found to produce positive reductions in disability, healthcare utilization, and expenditures. These results suggest that earlier tertiary-level intervention may avoid the complications of migraine that occur in some patients and the increasing costs and utilization of care associated with higher disability. PMID:24082410
Kim, Michael E; Orth, Robert C; Fallon, Sara C; Lopez, Monica E; Brandt, Mary L; Zhang, Wei; Bisset, George S
2015-04-01
Despite a recent focus on the preferential use of ultrasound over CT for pediatric appendicitis, most children transferred from community hospitals still undergo diagnostic CT scans. The purpose of this study was to evaluate CT techniques performed for children with acute appendicitis at nonpediatric treatment centers. All patients treated for acute appendicitis at our tertiary-care pediatric hospital from July 1, 2011, through June 30, 2012, were identified. Patient demographics, imaging modality used to diagnoses appendicitis (CT or ultrasound), location (home or referral institution), and CT technique parameters were collected. The estimated mean organ radiation dose, number of imaging phases, and use of contrast media were evaluated at home and referral institutions. During the study period, 1215 patients underwent appendectomies after imaging, with 442 (36.4%) imaged at referral facilities. Most referral patients received a diagnosis by CT (n=384, 87%), compared with 73 of 773 (9.4%) who received a diagnosis by CT at the home institution. The estimated mean (±SD) organ radiation dose was not statistically significantly different between home and referral institutions (13.5±7.3 vs 12.9±6.4 mGy; p=0.58) for single-phase examinations. Of 384 referral patients, 344 had images available for review. In total, 40% (138/344) of patients from referral centers were imaged with suboptimal CT techniques: 50 delayed phase only, 52 dual phase (eight of which were imaged twice in delayed phase), eight triple phase, and 36 without IV contrast agent. CT parameters and radiation doses from single-phase examinations in children with appendicitis were similar at nonpediatric treatment centers and a tertiary care children's hospital. Future educational outreach should focus on optimizing other technical parameters.
ERIC Educational Resources Information Center
Manalo, Emmanuel, Ed.; Bartlett-Trafford, Julie, Ed.; Crozier, Susan, Ed.
2008-01-01
This volume comprises the refereed proceedings of the 2007 ATLAANZ (Association of Tertiary Learning Advisors of Aotearoa/New Zealand) conference. The first three chapters set the scene well for the breadth and depth of issues addressed by the authors. In Chapter 1, Andy Begg refers to his own educational journey in discussing the inseparability…
Hong, Zhiheng; Ni, Daxin; Cao, Yang; Meng, Ling; Tu, Wenxiao; Li, Leilei; Li, Qun; Jin, Lianmei
2015-06-01
To establish a comprehensive evaluation index system for the China Public Health Emergency Events Surveillance System (CPHEESS). A draft index system was built through literature review and under the consideration of the characteristics on CPHEESS. Delphi method was adapted to determine the final index system. The index system was divided into primary, secondary and tertiary levels. There were 4 primary indicators: System structure, Network platform, Surveillance implementation reports with Data analysis and utilization. There were 16 secondary and 70 tertiary indicators being set, with System structure including 14 tertiary indicators (accounted for 20.00%), 21 Network platforms (accounted for 30.00%). Twenty-four Surveillance implementation reports (accounted for 34.29%), 11 Data analysis and utilization (accounted for 15.71%). The average score of importance of each indicators was 4.29 (3.77-4.94), with an average coefficient variation as 0.14 (0.12-0.16). The mean Chronbach's α index was 0.84 (0.81-0.89). The adaptability of each related facilities indicator was specified. The primary indicators were set in accordance with the characteristics and goals of the surveillance systems. Secondary indicators provided key elements in the management and control of the system while the tertiary indicators were available and operative. The agreement rate of experts was high with good validity and reliability. This index system could be used for CPHEESS in future.
Zhou, Kaina; Wang, Duolao; He, Xiaole; Huo, Lanting; An, Jinghua; Li, Minjie; Wang, Wen; Li, Xiaomei
2016-08-31
Breast cancer and its treatment-related adverse effects are harmful to physical, psychological, and social functioning, leading to health-related quality of life (HRQoL) impairment in patients. Many programs have been used with this population for HRQoL improvement; however, few studies have considered the physical, psychological, and social health domains comprehensively, and few have constructed multimodal standard nursing interventions based on specific theories. The purpose of this trial is to examine the effect of a health belief model (HBM)-based multimodal standard nursing program (MSNP) on HRQoL in female patients with breast cancer. This is a two-arm single-blind cluster randomized controlled trial (cRCT) in clinical settings. Twelve tertiary hospitals will be randomly selected from the 24 tertiary hospitals in Xi'an, China, and allocated to the intervention arm and control arm using a computer-generated random numbers table. Inpatient female patients with breast cancer from each hospital will receive either MSNP plus routine nursing care immediately after recruitment (intervention arm), or only routine nursing care (control arm). The intervention will be conducted by trained nurses for 12 months. All recruited female patients with breast cancer, participating clinical staff, and trained data collectors from the 12 hospitals will be blind with respect to group allocation. Patients of the control arm will not be offered any information about the MSNP during the study period to prevent bias. The primary outcome is HRQoL measured through the Functional Assessment of Cancer Therapy-Breast version 4.0 at 12 months. Secondary outcomes include pain, fatigue, sleep, breast cancer-related lymphedema, and upper limb function, which are evaluated by a visual analogue scale, the circumference method, and the Constant-Murley Score. This trial will provide important evidence on the effectiveness of multimodal nursing interventions delivered by nurses in clinical settings. Study findings will inform strategies for scaling up comprehensive standard intervention programs on health management in the population of female patients with breast cancer. Chictr.org.cn ChiCTR-IOR-16008253 (April 9, 2016).
Assessment of directionality performances: comparison between Freedom and CP810 sound processors.
Razza, Sergio; Albanese, Greta; Ermoli, Lucilla; Zaccone, Monica; Cristofari, Eliana
2013-10-01
To compare speech recognition in noise for the Nucleus Freedom and CP810 sound processors using different directional settings among those available in the SmartSound portfolio. Single-subject, repeated measures study. Tertiary care referral center. Thirty-one monoaurally and binaurally implanted subjects (24 children and 7 adults) were enrolled. They were all experienced Nucleus Freedom sound processor users and achieved a 100% open set word recognition score in quiet listening conditions. Each patient was fitted with the Freedom and the CP810 processor. The program setting incorporated Adaptive Dynamic Range Optimization (ADRO) and adopted the directional algorithm BEAM (both devices) and ZOOM (only on CP810). Speech reception threshold (SRT) was assessed in a free-field layout, with disyllabic word list and interfering multilevel babble noise in the 3 different pre-processing configurations. On average, CP810 improved significantly patients' SRTs as compared to Freedom SP after 1 hour of use. Instead, no significant difference was observed in patients' SRT between the BEAM and the ZOOM algorithm fitted in the CP810 processor. The results suggest that hardware developments achieved in the design of CP810 allow an immediate and relevant directional advantage as compared to the previous-generation Freedom device.
Yadav, Ram P.; Singh, Ajay
2014-01-01
The effect of sub-lethal doses (40% and 80% of LC50/24h) of plant derived molluscicides of singly, binary (1:1) and tertiary (1:1:1) combinations of the Rutin, Ellagic acid, Betulin and taraxerol with J. gossypifolia latex, leaf and stem bark powder extracts and their active component on the reproduction of freshwater snail Lymnaea acuminata have been studied. It was observed that the J. gossypifolia latex, stem bark, individual leaf and their combinations with other plant derived active molluscicidal components caused a significant reduction in fecundity, hatchability and survival of young snails. It is believed that sub-lethal exposure of these molluscicides on snail reproduction is a complex process involving more than one factor in reducing the reproductive capacity. PMID:25229223
Intestinal parasitoses in a tertiary-care hospital located in a non-endemic setting during 2006–2010
2014-01-01
Background The aim of this study was to assess the epidemiology of intestinal parasitoses during a 5-year period in patients attending a tertiary-care hospital in a non-endemic setting. Methods In the period 2006–2010, 15,752 samples from 8,886 patients with clinically suspected parasitosis were subjected to macroscopic and microscopic examination, to parasitic antigen detection assays, and to cultures for protozoa and nematodes. Real-time PCR assays for the differentiation of Entamoeba histolytica and E. dispar and for the detection of Dientamoeba fragilis were also used. A statistical analysis evaluating the demographic data of the patients with intestinal parasitic infections was performed. Results Intestinal parasitic infections were diagnosed in 1,477 patients (16.6% prevalence), mainly adults and immigrants from endemic areas for faecal-oral infections; protozoa were detected in 93.4% and helminths in 6.6% of the cases, the latter especially in immigrants. Blastocystis hominis was the most common intestinal protozoan, and G. intestinalis was the most frequently detected among pathogenic protozoa, prevalent in immigrants, males, and pediatric patients. Both single (77.9%) and mixed (22.1%) parasitic infections were observed, the latter prevalent in immigrants. Conclusions Despite the importance of the knowledge about the epidemiology of intestinal parasitoses in order to adopt appropriate control measures and adequate patient care all over the world, data regarding industrialized countries are rarely reported in the literature. The data presented in this study indicate that intestinal parasitic infections are frequently diagnosed in our laboratory and could make a contribution to stimulate the attention by physicians working in non-endemic areas on the importance of suspecting intestinal parasitoses. PMID:24886502
Calderaro, Adriana; Montecchini, Sara; Rossi, Sabina; Gorrini, Chiara; De Conto, Flora; Medici, Maria Cristina; Chezzi, Carlo; Arcangeletti, Maria Cristina
2014-05-16
The aim of this study was to assess the epidemiology of intestinal parasitoses during a 5-year period in patients attending a tertiary-care hospital in a non-endemic setting. In the period 2006-2010, 15,752 samples from 8,886 patients with clinically suspected parasitosis were subjected to macroscopic and microscopic examination, to parasitic antigen detection assays, and to cultures for protozoa and nematodes. Real-time PCR assays for the differentiation of Entamoeba histolytica and E. dispar and for the detection of Dientamoeba fragilis were also used.A statistical analysis evaluating the demographic data of the patients with intestinal parasitic infections was performed. Intestinal parasitic infections were diagnosed in 1,477 patients (16.6% prevalence), mainly adults and immigrants from endemic areas for faecal-oral infections; protozoa were detected in 93.4% and helminths in 6.6% of the cases, the latter especially in immigrants. Blastocystis hominis was the most common intestinal protozoan, and G. intestinalis was the most frequently detected among pathogenic protozoa, prevalent in immigrants, males, and pediatric patients. Both single (77.9%) and mixed (22.1%) parasitic infections were observed, the latter prevalent in immigrants. Despite the importance of the knowledge about the epidemiology of intestinal parasitoses in order to adopt appropriate control measures and adequate patient care all over the world, data regarding industrialized countries are rarely reported in the literature. The data presented in this study indicate that intestinal parasitic infections are frequently diagnosed in our laboratory and could make a contribution to stimulate the attention by physicians working in non-endemic areas on the importance of suspecting intestinal parasitoses.
Eportfolios as Evidence of Standards and Outcomes in Work-Integrated Learning
ERIC Educational Resources Information Center
Ferns, Sonia; Comfort, Jude
2014-01-01
Electronic portfolios (ePortfolios) are a student focused tool which support and evidence work-integrated learning (WIL) experiences and capabilities in a tertiary education setting. Such settings are increasingly faced by a regulatory framework requiring evidence of student competency and skill acquisition. The commitment of educational…
Király, László; Tamás, Csaba
2015-06-21
Outcome of arterial switch operation for transposition of the great arteries with/without ventricular septal defect is a service key-performance-indicator. The aim of the authors was to assess patient characteristics and parameters in the perioperative course. In the setting of a newly-established, comprehensive tertiary-care center, primary complete repair was performed including associated anomalies, e.g. transverse arch repairs. Patients with d-transposition were grouped according to coexistence of ventricular septal defect. 118 arterial switch operations were performed between 2007 and 2014 with 96.62% survival (114/118). Ventricular septal defect and repair of associated anomalies did not yield worse outcome. Left ventricular re-training with late presentation necessitated mechanical circulatory support for 4.5±1.5 days. D-transposition is suitable for standardization of clinical algorithm and surgical technique. Quality standards contribute to excellent outcomes, minimize complications, and serve as blueprint for other neonatal open-heart procedures. Availability of mechanical circulatory support is key for single-stage left ventricular re-training beyond the neonatal period.
Changing personnel behavior to promote quality care practices in an intensive care unit
Cooper, Dominic; Farmery, Keith; Johnson, Martin; Harper, Christine; Clarke, Fiona L; Holton, Phillip; Wilson, Susan; Rayson, Paul; Bence, Hugh
2005-01-01
The delivery of safe high quality patient care is a major issue in clinical settings. However, the implementation of evidence-based practice and educational interventions are not always effective at improving performance. A staff-led behavioral management process was implemented in a large single-site acute (secondary and tertiary) hospital in the North of England for 26 weeks. A quasi-experimental, repeated-measures, within-groups design was used. Measurement focused on quality care behaviors (ie, documentation, charting, hand washing). The results demonstrate the efficacy of a staff-led behavioral management approach for improving quality-care practices. Significant behavioral change (F [6, 19] = 5.37, p < 0.01) was observed. Correspondingly, statistically significant (t-test [t] = 3.49, df = 25, p < 0.01) reductions in methicillin-resistant Staphylococcus aureus (MRSA) were obtained. Discussion focuses on implementation issues. PMID:18360574
Haustein, Silke V; Mack, Eberhard; Starling, James R; Chen, Herbert
2005-12-01
Intraoperative parathyroid hormone (PTH) testing has been shown to accurately define adequacy of parathyroid resection in patients with primary hyperparathyroidism (HPT) and alters the operative management in 10% to 15% of cases. However, the benefit of this technique in patients with tertiary HPT after renal transplantation undergoing parathyroidectomy is unclear. Intraoperative PTH was measured in 32 consecutive patients undergoing parathyroidectomy for tertiary HPT after renal transplantation between March 2001 and November 2004 by using the Elecsys assay at baseline and, subsequently, 5, 10, and 15 minutes after curative resection. The outcomes of these patients were evaluated. All patients were cured after surgery. Of the 32 patients, 29 were found to have parathyroid hyperplasia, while 1 had a single adenoma and 2 had double adenomas. The average drop in intraoperative PTH levels after curative resection was 69 +/- 3.5% at 5 min., 77 +/- 2.3% at 10 minutes, and 83 +/- 3.4% at 15 minutes. PTH testing changed the intraoperative management in 5 (16%) patients. One patient with a single adenoma and 2 patients with double adenomas had a >50% drop at 10 minutes. after excision; therefore, the operation was terminated without further resection. Two patients did not have a >50% drop at 10 minutes after 3.5 gland resection. These patients were explored further, and additional supernumerary parathyroid glands were identified and resected. After resection of these additional glands, the PTH fell by >50%, indicating cure. In patients undergoing parathyroidectomy for tertiary HPT after renal transplantation, a decrease in intraoperative PTH levels >50% at 10 minutes after completion of the operation indicated adequate resection. Furthermore, intraoperative PTH testing altered the operative management in 16% of patients. Therefore, similar to its role in patients with primary HPT, intraoperative PTH testing appears to play an equally important role in the management of patients with tertiary HPT undergoing parathyroidectomy.
Bove, Dana J.; Knepper, Daniel H.
2000-01-01
This data set covering the western part of Colorado includes water quality data from eight different sources (points), nine U.S. Geological Survey Digital Raster Graph (DRG) files for topographic bases, a compilation of Tertiary age intrusions (polygons and lines), and two geotiff files showing areas of hydrothermally altered rock. These data were compiled for use with an ongoing mineral resource assessment of theGrand Mesa, Uncompahgre, and Gunnison National Forests (GMUG) and intervening Bureau of Land Management(BLM) lands. This compilation was assembled to give federal land managers a preliminary view of water within sub-basinal areas, and to show possible relationships to Tertiary age intrusion and areas of hydrothermal alteration.
Stern, Gretchen; Rimsans, Jessica; Qamar, Arman; Vaduganathan, Muthiah; Bhatt, Deepak L
2018-03-13
Oral antiplatelet therapy may require interruption soon after percutaneous coronary intervention (PCI) or acute coronary syndrome. The optimal parenteral antiplatelet bridge strategy with glycoprotein IIb/IIIa inhibitors or cangrelor, a P2Y12 inhibitor, is unclear. We explore real-world use of cangrelor or eptifibatide for antiplatelet bridging at a large tertiary-care center. Thirty-one patients (9 eptifibatide, 20 cangrelor, and 2 both) received bridge therapy from October 2015 to June 2017. Primary bridge therapy indications included surgery (68%), limited enteral access/absorption (16%), and high-perceived bleed risk (16%). Median duration of bridge therapy was 61 (20-100) hours for cangrelor and 83 (19-98) hours for eptifibatide. Severe/life-threatening bleeding or stent thrombosis was not observed. GUSTO-defined bleeding occurred in 30% (cangrelor) and 27% (eptifibatide). Initial dosing errors occurred in 23% of patients. Death during hospitalization occurred in 16% of patients. Parenteral antiplatelet bridging was used for ~3 days in this single-center, tertiary care experience, commonly for unplanned surgery following PCI. Despite high-risk presentations with >15% in-hospital mortality, efficacy profiles were reassuring with no identified stent thrombosis, but bleeding and dosing errors were common. Antiplatelet bridging should only be used in well-selected patients at the appropriate dose for the minimal necessary duration.
What Predicts Health Students' Self-Reported Preparedness to Work in Indigenous Health Settings?
ERIC Educational Resources Information Center
Bullen, Jonathan; Roberts, Lynne; Hoffman, Julie
2017-01-01
Australian undergraduate programs are implementing curriculum aimed at better preparing graduates to work in culturally diverse settings, but there remains uncertainty over the role of extant student attitudes towards Indigenous Australians. To begin to address this, we obtained baseline data on student attitudes upon entry to tertiary education.…
Wraparound: As a Tertiary Level Intervention for Students with Emotional/Behavioral Needs
ERIC Educational Resources Information Center
Eber, Lucille; Breen, Kimberli; Rose, Jennifer; Unizycki, Renee M.; London, Tasha H.
2008-01-01
If a student has multiple behavior problems that escalate over time and across different settings, school-based problem-solving teams can become quickly overwhelmed, especially when educators identify "setting events" for problem behaviors that have occurred outside of school and are beyond the control of school personnel. Instead of resorting to…
Panchal, Dhara Antani
2014-01-01
Objective. To explore the psychosocial problems faced by the parents of children with cerebral palsy (CP) in rural and urban settings. Design. Qualitative research design using focus group discussions (FGDs) was used for the study. Setting. Two FGDs comprising one at a rural tertiary level care hospital and the other at an urban tertiary level care hospital were conducted. Participants. A total of thirteen parents participated in the two FGDs. Main Outcome Measured. Psychosocial problems experienced by the parents of children suffering from CP were measured. Results. The problems experienced by the mothers were associated with common themes such as disturbed social relationships, health problems, financial problems, moments of happiness, worries about future of the child, need for more support services, and lack of adequate number of trained physiotherapists. All the parents had children with problems since birth and most had approached various health care providers for a cure for their child. Conclusions. A wide range of psychosocial problems are experienced by the parents of children with CP. Studies like this can provide valuable information for designing a family centered care programme for children with CP. PMID:24967331
Endosymbiotic gene transfer in tertiary plastid-containing dinoflagellates.
Burki, Fabien; Imanian, Behzad; Hehenberger, Elisabeth; Hirakawa, Yoshihisa; Maruyama, Shinichiro; Keeling, Patrick J
2014-02-01
Plastid establishment involves the transfer of endosymbiotic genes to the host nucleus, a process known as endosymbiotic gene transfer (EGT). Large amounts of EGT have been shown in several photosynthetic lineages but also in present-day plastid-lacking organisms, supporting the notion that endosymbiotic genes leave a substantial genetic footprint in the host nucleus. Yet the extent of this genetic relocation remains debated, largely because the long period that has passed since most plastids originated has erased many of the clues to how this process unfolded. Among the dinoflagellates, however, the ancestral peridinin-containing plastid has been replaced by tertiary plastids on several more recent occasions, giving us a less ancient window to examine plastid origins. In this study, we evaluated the endosymbiotic contribution to the host genome in two dinoflagellate lineages with tertiary plastids. We generated the first nuclear transcriptome data sets for the "dinotoms," which harbor diatom-derived plastids, and analyzed these data in combination with the available transcriptomes for kareniaceans, which harbor haptophyte-derived plastids. We found low level of detectable EGT in both dinoflagellate lineages, with only 9 genes and 90 genes of possible tertiary endosymbiotic origin in dinotoms and kareniaceans, respectively, suggesting that tertiary endosymbioses did not heavily impact the host dinoflagellate genomes.
Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki
2016-05-26
Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes.
Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A.; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki
2016-01-01
Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes. PMID:27225414
Nicol, Pam; Chapman, Rose; Watkins, Rochelle; Young, Jeanine; Shields, Linda
2013-12-01
To ascertain health professionals' knowledge, attitudes and beliefs towards lesbian, gay, bisexual and transgender parents seeking health care for their children in a paediatric tertiary hospital setting which practises family-centred care. Lesbian, gay, bisexual and transgender parents are often reluctant to disclose their sexual orientation to health professionals for fear of discrimination and compromised quality of care. Staff knowledge, attitudes and beliefs can influence disclosure by parents, but little is known about knowledge, attitudes and beliefs in paediatric tertiary hospital staff towards lesbian, gay, bisexual and transgender parents accessing care for their children. Descriptive comparative study of health staff using a cross-sectional survey. A set of validated anonymous questionnaires was used to assess knowledge about homosexuality, attitudes towards lesbians and gay men, and gay affirmative practice. Three open-ended questions were also used to assess beliefs about encouraging disclosure of lesbian, gay, bisexual and transgender parenting roles and how this may impact on care. Of the 646 staff surveyed, 212 (32.8%) responded. Knowledge and attitudes were significantly associated with professional group, gender, Caucasian race, political voting behaviour, presence of religious beliefs, the frequency of attendance at religious services, the frequency of praying, and having a friend who was openly lesbian, gay, bisexual and transgender. This study highlighted that staff working in a tertiary paediatric hospital setting, with family-centred care models in place, held attitudes and beliefs that may impact on the experience of hospitalisation for lesbian, gay, bisexual and transgender parents, and the quality of care received by their children. To promote equitable care to all families, organisations should ensure that family-centred care policies and guidelines are adopted and appropriately implemented. In addition to formal education, affirmative health service action and innovative methods may be required. © 2013 John Wiley & Sons Ltd.
ERIC Educational Resources Information Center
Bohanon, Hank; Flannery, K. Brigid; Malloy, JoAnne; Fenning, Pamela
2009-01-01
The integration of primary, secondary, and tertiary interventions through positive behavior supports (PBS) can provide benefit for students, staff, and families (Bohanon et al., 2006; Turnbull et al., 2002). However, there is limited application of PBS to high schools settings (Sugai, Flannery, & Bohanon, 2004). However, preliminary data is…
ERIC Educational Resources Information Center
Dafouz, Emma; Smit, Ute
2016-01-01
At a time of increasing internationalization in tertiary education, English-Medium Education in Multilingual University Settings (EMEMUS) has become a common practice. While there is already ample research describing this phenomenon at a local level (Smit and Dafouz 2012a), the theoretical side needs to be elaborated. This article thus aims to…
General mechanism of two-state protein folding kinetics.
Rollins, Geoffrey C; Dill, Ken A
2014-08-13
We describe here a general model of the kinetic mechanism of protein folding. In the Foldon Funnel Model, proteins fold in units of secondary structures, which form sequentially along the folding pathway, stabilized by tertiary interactions. The model predicts that the free energy landscape has a volcano shape, rather than a simple funnel, that folding is two-state (single-exponential) when secondary structures are intrinsically unstable, and that each structure along the folding path is a transition state for the previous structure. It shows how sequential pathways are consistent with multiple stochastic routes on funnel landscapes, and it gives good agreement with the 9 order of magnitude dependence of folding rates on protein size for a set of 93 proteins, at the same time it is consistent with the near independence of folding equilibrium constant on size. This model gives estimates of folding rates of proteomes, leading to a median folding time in Escherichia coli of about 5 s.
Tertiary paediatric emergency department use in children and young people with cerebral palsy.
Meehan, Elaine; Reid, Susan M; Williams, Katrina; Freed, Gary L; Babl, Franz E; Sewell, Jillian R; Rawicki, Barry; Reddihough, Dinah S
2015-10-01
The aim of this study was to describe the pattern of tertiary paediatric emergency department (ED) use in children and young people with cerebral palsy (CP). A retrospective analysis of ED data routinely collected at the two tertiary paediatric hospitals in Victoria, Australia, cross-matched with the Victorian Cerebral Palsy Register. Data pertaining to the ED presentations of 2183 registered individuals born 1993-2008 were obtained. Between 2008 and 2012, 37% (n = 814) of the CP cohort had 3631 tertiary paediatric ED presentations. Overall, 40% (n = 332) of presenters were residing in inner metropolitan Melbourne; 44% (n = 356) in outer Melbourne; and 13% (n = 108) in regional Victoria. Presenters were more likely than non-presenters to be younger, non-ambulant and have epilepsy. In total, 71% of presentations were triaged as Australasian Triage Scale 1-3 (urgent), and 44% resulted in a hospital admission. Disorders of the respiratory, neurological and gastrointestinal systems, and medical device problems were responsible for 72% of presentations. Many of the tertiary paediatric ED presentations in this group were appropriate based on the high admission rate and the large proportion triaged as urgent. However, there is evidence that some families are bypassing local services and travelling long distances to attend the tertiary paediatric ED, even for less urgent complaints that do not require hospital admission. Alternative pathways of care delivery, and strategies to promote the management of common problems experienced by children and young people with CP in non-paediatric EDs or primary care settings, may go some way towards reducing unnecessary tertiary paediatric ED use in this group. © 2015 The Authors. Journal of Paediatrics and Child Health © 2015 Paediatrics and Child Health Division (Royal Australasian College of Physicians).
Micelles for the self-assembly of "off-on-off" fluorescent sensors for pH windows.
Diaz-Fernandez, Yuri; Foti, Francesco; Mangano, Carlo; Pallavicini, Piersandro; Patroni, Stefano; Perez-Gramatges, Aurora; Rodriguez-Calvo, Simon
2006-01-11
A micellar approach is proposed to build a series of systems featuring an "off-on-off" fluorescent window response with changes in pH. The solubilizing properties of micelles are used to self-assemble, in water, plain pyrene with lipophilized pyridine and tertiary amine moieties. Since these components are contained in the small volume of the same micelle, pyrene fluorescence is influenced by the basic moieties: protonated pyridines and free tertiary amines behave as quenchers. Accordingly, fluorescence transitions from the "off" to the "on" state, and viceversa, take place when the pH crosses the pK(a) values of the amine and pyridine fragments. To obtain an "off-on-off" fluorescent response in this investigation we use either a set of dibasic lipophilic molecules (containing covalently linked pyridine and tertiary amine groups) or combinations of separate, lipophilic pyridines and tertiary amines. The use of combinations of dibasic and monobasic lipophilic molecules also gives a window-shaped fluorescence response with changes in pH: it is the highest pyridine pK(a) and the lowest tertiary amine pK(a) that determine the window limits. The pK(a) values of all the examined lipophilic molecules were determined in micelles, and compared with the values found for the same molecules in solvent mixtures in which they are molecularly dispersed. The effect of micellization is to significantly lower the observed protonation constants of the lipophilized species. Moreover, the more lipophilic a molecule is, the lower the observed logK value is. Accordingly, changing the substituents on the basic moieties or modifying their structure, tuning the lipophilicity of the mono- or dibases, and choosing among a large set of possible combination of lipophilized mono- and dibases have allowed us to tune, almost at will, both the width and the position along the pH axis of the obtained fluorescent window.
Julian, Samuel; Burnham, Carey-Ann D.; Sellenriek, Patricia; Shannon, William D.; Hamvas, Aaron; Tarr, Phillip I.; Warner, Barbara B.
2016-01-01
Objectives Infections cause significant morbidity and mortality in neonatal intensive care units (NICUs). The association between nursery design and nosocomial infections has not been delineated. We hypothesized that rates of colonization by methicillin-resistant Staphylococcus aureus (MRSA), late-onset sepsis, and mortality are reduced in single-patient rooms. Design Retrospective cohort study. Setting NICU in a tertiary referral center. Methods Our NICU is organized into single-patient and open-unit rooms. Clinical datasets including bed location and microbiology results were examined over a 29-month period. Differences in outcomes between bed configurations were determined by Chi-square and Cox regression. Patients All NICU patients. Results Among 1823 patients representing 55,166 patient-days, single-patient and open-unit models had similar incidences of MRSA colonization and MRSA colonization-free survival times. Average daily census was associated with MRSA colonization rates only in single-patient rooms (hazard ratio 1.31, p=0.039), while hand hygiene compliance on room entry and exit was associated with lower colonization rates independent of bed configuration (hazard ratios 0.834 and 0.719 per 1% higher compliance, respectively). Late-onset sepsis rates were similar in single-patient and open-unit models as were sepsis-free survival and the combined outcome of sepsis or death. After controlling for demographic, clinical and unit-based variables, multivariate Cox regression demonstrated that bed configuration had no effect on MRSA colonization, late-onset sepsis, or mortality. Conclusions MRSA colonization rate was impacted by hand hygiene compliance, regardless of room configuration, while average daily census only affected infants in single-patient rooms. Single-patient rooms did not reduce the rates of MRSA colonization, late-onset sepsis or death. PMID:26108888
Tan, She Hui; Kng, Kwee Keng; Lim, Sze Mian; Chan, Alexandre; Loh, Jason Kwok Kong; Lee, Joyce Yu-Chia
2017-12-01
Few studies have determined the benefits of pharmacist-run clinics within a tertiary institution, and specifically on their capability to improve clinical outcomes as well as reduce the cost of illness. This study was designed to investigate the effectiveness of a pharmacist-managed risk factor management clinic (RFMP) in an acute care setting through the comparison of clinical (improvement in glycosylated hemoglobin level) and cost outcomes with patients receiving usual care. This single-center, observational study included patients aged ≥21 years old and diagnosed with type 2 diabetes mellitus (DM) who received care within the cardiology department of a tertiary institution between January 1, 2014, and December 31, 2015. The intervention group comprised patients who attended the RFMP for 3 to 6 months, and the usual-care group comprised patients who received standard cardiologist care. Univariate analysis and multiple linear regression were conducted to analyze the clinical and cost outcomes. A total of 142 patients with DM (71 patients in the intervention group and 71 patients in the usual-care group) with similar baseline characteristics were included. After adjusting for differences in baseline systolic blood pressure and triglyceride levels, the mean reduction in glycosylated hemoglobin level at 6 months from baseline in the intervention group was significantly lower by 0.78% compared with the usual-care group. Patients in the usual-care group had a significantly higher risk of hospital admissions within the 12 months from baseline compared with the intervention group (odds ratio, 3.84 [95% CI, 1.17-12.57]; P = 0.026). Significantly lower mean annual direct medical costs were also observed in the intervention group (US $8667.03 [$17,416.20] vs US $56,665.02 [$127,250.10]; P = 0.001). The pharmacist-managed RFMP exhibited improved clinical outcomes and reduced health care costs compared with usual care within a tertiary institute. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Marrugat, J; Sanz, G; Masiá, R; Valle, V; Molina, L; Cardona, M; Sala, J; Serés, L; Szescielinski, L; Albert, X; Lupón, J; Alonso, J
1997-11-01
The aim of the present study was to ascertain whether the degree of accessibility to coronary angiography and revascularization results in differing usages or outcomes, or both, in the setting of a high coverage national health system. The selective use of coronary angiography and revascularization procedures in the management of acute myocardial infarction (MI) remains controversial. A cohort of 1,460 consecutive patients with a first MI admitted to four referral teaching hospitals (one with tertiary facilities) were followed up for 6 months after admission. Only patients initially admitted to each of the study hospitals were retained for analysis in the original hospital's cohort. End points were 6-month mortality and readmission for reinfarction, unstable angina, heart failure or severe ventricular arrhythmia. Patients admitted to the tertiary hospital were more likely to undergo coronary angiography (adjusted relative risk 4.22, 95% confidence interval [CI] 3.37 to 5.45) than those admitted to the nontertiary sites (use rate: 22.1% for nontertiary care, 55.5% for tertiary care). Revascularization procedures were performed in 21.2% of patients in the tertiary hospital and in 8.3% in the nontertiary hospitals (p < 0.0001). Median delay for emergency coronary angiography was shorter in the tertiary hospital (within 1 vs. 2 days, p < 0.0001). Six-month mortality or readmission rates were similar (23.7% and 24.7% for tertiary and nontertiary care, respectively). After adjustment for comorbidity and disease severity, the relative risk of death or readmission for the tertiary hospital was 1.03 (95% CI 0.69 to 1.53) times that of the nontertiary hospitals. Selective use of coronary angiography and revascularization procedures may be as effective as less restricted use in the management of acute MI.
Too attractive: the growing problem of magnet ingestions in children.
Brown, Julie C; Otjen, Jeffrey P; Drugas, George T
2013-11-01
Small, powerful magnets are increasingly available in toys and other products and pose a health risk. Small spherical neodymium magnets marketed since 2008 are of particular concern. The objective of this study was to determine the incidence, characteristics, and management of single and multiple-magnet ingestions over time. Magnet ingestion cases at a tertiary children's hospital were identified using radiology reports from June 2002 to December 2012. Cases were verified by chart and imaging review. Relative risk regressions were used to determine changes in the incidence of ingestions and interventions over time. Of 56 cases of magnet ingestion, 98% occurred in 2006 or later, and 57% involved multiple magnets. Median age was 8 years (range, 0-18 years). Overall, 21% of single and 88% of multiple ingestions had 2 or more imaging series obtained, whereas no single and 56.3% of multiple ingestions required intervention (25.0% endoscopy, 18.8% surgery, 12.5% both). Magnet ingestions increased in 2010 to 2012 compared with 2007 to 2009 (relative risk, 1.9; 95% confidence interval, 1.2-3.0). Small, spherical magnets likely from magnet sets comprised 27% of ingestions, all ingested 2010 or later: 86% involved multiple magnets, 50% of which required intervention. Excluding these cases, ingestions of other magnets did not increase in 2010 to 2012 compared with 2007 to 2009 (relative risk, 0.94; 95% confidence interval, 0.6-1.4). The incidence of pediatric magnet ingestions and subsequent interventions has increased over time. Multiple-magnet ingestions result in high utilization of radiological imaging and surgical interventions. Recent increases parallel the increased availability of small, spherical magnet sets. Young and at-risk children should not have access to these and other small magnets. Improved regulation and magnet safety standards are needed.
Neoadjuvant Therapy for Esophageal Adenocarcinoma in the Community Setting—Practice and Outcomes
Abdo, Joe; Bertellotti, Carrie A.; Cornell, David L.; Agrawal, Devendra K.; Mittal, Sumeet K.
2017-01-01
There has been an alarming rise in the incidence of esophageal adenocarcinoma which continues to have poor survival rates primarily due to lack of effective chemotherapy and presentation at advanced stages. Over a dozen chemotherapeutic agents are FDA approved for esophageal cancer (EC), and a two or three-drug combination is typically prescribed as first-line therapy for the majority of EC patients, administered either pre or post-operatively with esophageal resection. We have noticed significant variability in adjuvant and neoadjuvant regimens used in the community setting. The aim of this study was to review the various drug regimens used in the neoadjuvant setting for EC patients with adenocarcinoma undergoing resection at a single tertiary referral center in the Midwest. A total of 123 patients (stage II–III) underwent esophageal resection after neoadjuvant treatment at the center. Overall, 18 distinct drug regimens were used in 123 patients including two patients who received targeted therapy. Median survival post-surgery for this group was 11.2 months with no single regimen offering a survival advantage. These results reveal an unclear algorithm of how accepted regimens are prescribed in the community setting as well as a dire need for agents that are more effective. Additionally, it was noted that although proteomic markers have been found to predict drug response to 92% of the FDA-approved drugs in EC (12 of 13), according to pathology reports, molecular diagnostic testing was not used to direct treatment in this cohort. We therefore propose potential strategies to improve clinical outcomes including the use of a robust molecular oncology diagnostic panel and discuss the potential role for targeted chemotherapy and/or immunotherapy in the management of EC patients. PMID:28770168
Abbass, Allan; Kisely, Steve; Rasic, Daniel; Town, Joel M; Johansson, Robert
2015-05-01
To evaluate whether a mixed population of patients treated with Intensive Short-term Dynamic Psychotherapy (ISTDP) would exhibit reduced healthcare costs in long-term follow-up. A quasi-experimental design was employed in which data on pre- and post-treatment healthcare cost were compared for all ISTDP cases treated in a tertiary care service over a nine year period. Observed cost changes were compared with those of a control group of patients referred but never treated. Physician and hospital costs were compared to treatment cost estimates and normal population cost figures. 1082 patients were included; 890 treated cases for a broad range of somatic and psychiatric disorders and 192 controls. The treatment averaged 7.3 sessions and measures of symptoms and interpersonal problems significantly improved. The average cost reduction per treated case was $12,628 over 3 follow-up years: this compared favorably with the estimated treatment cost of $708 per patient. Significant differences were seen between groups for follow-up hospital costs. ISTDP in this setting appears to facilitate reductions in healthcare costs, supporting the notion that brief dynamic psychotherapy provided in a tertiary setting can be beneficial to health care systems overall. CLINICALTRIALS. NCT01924715. Copyright © 2015 Elsevier Ltd. All rights reserved.
Towards a rational antimicrobial testing policy in the laboratory.
Banaji, N; Oommen, S
2011-01-01
Antimicrobial policy for prophylactic and therapeutic use of antimicrobials in a tertiary care setting has gained importance. A hospital's antimicrobial policy as laid down by its hospital infection control team needs to include inputs from the microbiology laboratory, besides the pharmacy and therapeutic committee. Therefore, it is of utmost importance that clinical microbiologists across India follow international guidelines and also take into account local settings, especially detection and presence of resistance enzymes. This article draws a framework for rational antimicrobial testing in our laboratories in tertiary care centers, from the Clinical and Laboratory Standards Institute guidelines. It does not address testing methodologies but suggests ways and means by which antimicrobial susceptibility reporting can be rendered meaningful not only to the treating physician but also to the resistance monitoring epidemiologist. It hopes to initiate some standardization in rational choice of antimicrobial testing in laboratories in the country pertaining to nonfastidious bacteria.
Utilization of arterial blood gas measurements in a large tertiary care hospital.
Melanson, Stacy E F; Szymanski, Trevor; Rogers, Selwyn O; Jarolim, Petr; Frendl, Gyorgy; Rawn, James D; Cooper, Zara; Ferrigno, Massimo
2007-04-01
We describe the patterns of utilization of arterial blood gas (ABG) tests in a large tertiary care hospital. To our knowledge, no hospital-wide analysis of ABG test utilization has been published. We analyzed 491 ABG tests performed during 24 two-hour intervals, representative of different staff shifts throughout the 7-day week. The clinician ordering each ABG test was asked to fill out a utilization survey. The most common reasons for requesting an ABG test were changes in ventilator settings (27.6%), respiratory events (26.4%), and routine (25.7%). Of the results, approximately 79% were expected, and a change in patient management (eg, a change in ventilator settings) occurred in 42% of cases. Many ABG tests were ordered as part of a clinical routine or to monitor parameters that can be assessed clinically or through less invasive testing. Implementation of practice guidelines may prove useful in controlling test utilization and in decreasing costs.
DiPiro, Pamela J; Krajewski, Katherine M; Giardino, Angela A; Braschi-Amirfarzan, Marta; Ramaiya, Nikhil H
2017-01-01
The purpose of the article is to describe the various radiology consultation models in the Era of Precision Medicine. Since the inception of our specialty, radiologists have served as consultants to physicians of various disciplines. A variety of radiology consultation services have been described in the literature, including clinical decision support, patient-centric, subspecialty interpretation, and/or some combination of these. In oncology care in particular, case complexity often merits open dialogue with clinical providers. To explore the utility and impact of radiology consultation services in the academic setting, this article will further describe existing consultation models and the circumstances that precipitated their development. The hybrid model successful at our tertiary cancer center is discussed. In addition, the contributions of a consultant radiologist in breast cancer care are reviewed as the archetype of radiology consultation services provided to oncology practitioners.
Sathe, Prachee M; Bapat, Sharda N
2014-01-01
To assess the performance and utility of two mortality prediction models viz. Acute Physiology and Chronic Health Evaluation II (APACHE II) and Simplified Acute Physiology Score II (SAPS II) in a single Indian mixed tertiary intensive care unit (ICU). Secondary objectives were bench-marking and setting a base line for research. In this observational cohort, data needed for calculation of both scores were prospectively collected for all consecutive admissions to 28-bedded ICU in the year 2011. After excluding readmissions, discharges within 24 h and age <18 years, the records of 1543 patients were analyzed using appropriate statistical methods. Both models overpredicted mortality in this cohort [standardized mortality ratio (SMR) 0.88 ± 0.05 and 0.95 ± 0.06 using APACHE II and SAPS II respectively]. Patterns of predicted mortality had strong association with true mortality (R (2) = 0.98 for APACHE II and R (2) = 0.99 for SAPS II). Both models performed poorly in formal Hosmer-Lemeshow goodness-of-fit testing (Chi-square = 12.8 (P = 0.03) for APACHE II, Chi-square = 26.6 (P = 0.001) for SAPS II) but showed good discrimination (area under receiver operating characteristic curve 0.86 ± 0.013 SE (P < 0.001) and 0.83 ± 0.013 SE (P < 0.001) for APACHE II and SAPS II, respectively). There were wide variations in SMRs calculated for subgroups based on International Classification of Disease, 10(th) edition (standard deviation ± 0.27 for APACHE II and 0.30 for SAPS II). Lack of fit of data to the models and wide variation in SMRs in subgroups put a limitation on utility of these models as tools for assessing quality of care and comparing performances of different units without customization. Considering comparable performance and simplicity of use, efforts should be made to adapt SAPS II.
Epilepsy in Ireland: towards the primary-tertiary care continuum.
Varley, Jarlath; Delanty, Norman; Normand, Charles; Coyne, Imelda; McQuaid, Louise; Collins, Claire; Boland, Michael; Grimson, Jane; Fitzsimons, Mary
2010-01-01
Epilepsy is a chronic neurological disease affecting people of every age, gender, race and socio-economic background. The diagnosis and optimal management relies on contribution from a number of healthcare disciplines in a variety of healthcare settings. To explore the interface between primary care and specialist epilepsy services in Ireland. Using appreciative inquiry, focus groups were held with healthcare professionals (n=33) from both primary and tertiary epilepsy specialist services in Ireland. There are significant challenges to delivering a consistent high standard of epilepsy care in Ireland. The barriers that were identified are: the stigma of epilepsy, unequal access to care services, insufficient human resources, unclear communication between primary-tertiary services and lack of knowledge. Improving the management of people with epilepsy requires reconfiguration of the primary-tertiary interface and establishing clearly defined roles and formalised clinical pathways. Such initiatives require resources in the form of further education and training and increased usage of information communication technology (ICT). Epilepsy services across the primary-tertiary interface can be significantly enhanced through the implementation of a shared model of care underpinned by an electronic patient record (EPR) system and information communication technology (ICT). Better chronic disease management has the potential to halt the progression of epilepsy with ensuing benefits for patients and the healthcare system. Copyright 2009 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.
Agriculture Canada Central Saskatchewan Vector Soils Data
NASA Technical Reports Server (NTRS)
Knapp, David; Hall, Forrest G. (Editor); Rostad, Harold
2000-01-01
This data set consists of GIS layers that describe the soils of the BOREAS SSA. These original data layers were submitted as vector data in ARC/INFO EXPORT format. These data also include the soil name and soil layer files, which provide additional information about the soils. There are three sets of attributes that include information on the primary, secondary, and tertiary soil type within each polygon. Thus, there is a total of nine main attributes in this data set.
Nanosecond Absorption Spectroscopy of Hemoglobin: Elementary Processes in Kinetic Cooperativity
NASA Astrophysics Data System (ADS)
Hofrichter, James; Sommer, Joseph H.; Henry, Eric R.; Eaton, William A.
1983-04-01
A nanosecond absorption spectrometer has been used to measure the optical spectra of hemoglobin between 3 ns and 100 ms after photolysis of the CO complex. The data from a single experiment comprise a surface, defined by the time-ordered set of 50-100 spectra. Singular value decomposition is used to represent the observed spectra in terms of a minimal set of basis spectra and the time course of their amplitudes. Both CO rebinding and conformational changes are found to be multiphasic. Prior to the quaternary structural change, two relaxations are observed that are assigned to geminate recombination followed by a tertiary structural change. These relaxations are interpreted in terms of a kinetic model that points out their potential role in kinetic cooperativity. The rapid escape of CO from the heme pocket compared with the rate of rebinding observed for both R and T quaternary states shows that the quaternary structure controls the overall dissociation rate by changing the rate at which the Fe--CO bond is broken. A comparable description of the control of the overall association rates must await a more complete experimental description of the kinetics of the quaternary T state.
Hotaling, James M; Leddy, Laura S; Haider, Mahum A; Mossanen, Matthew; Bailey, Michael R; MacConaghy, Brian; Olson, Francis; Krieger, John N
2014-01-01
Objective To conduct a proof-of-concept study to determine the potential utility of a novel, adjustable single-visit, disposable device to facilitate rapid adult circumcision. Design Prospective pilot trial of a novel surgical device Setting Tertiary care Veterans Administration medical center Patients 5 adult males Interventions Circumcisions performed by junior trainees using an adjustable, single-size surgical-assist device constructed by the University of Washington Applied Physics Laboratory. Main Outcome Measure(s) The attending surgeon and trainees completed standardized forms after each procedure to assess technical problems and ease of use. Follow-up visits were scheduled to evaluate adverse events, post-operative pain, cosmetic outcomes and participant satisfaction at 3, 8, 30 and 90 days post-operatively. Results The average operative time was 16.4 minutes. All cases were performed with local anesthesia and no case required electrocautery or conversion to standard surgery. At the post-operative day 3 visit all subjects were happy with their results and would recommend the procedure to another patient. One participant had a minor wound separation noted at the 30-day visit that resolved during follow-up. There were no wound infections, hematomas or other adverse events. Conclusions This proof-of-study suggests that the Simple Circumcision Device (SCD) may facilitate delivery of safe adult male circumcision services. PMID:24613534
Diversification of Tertiary Education in Sweden.
ERIC Educational Resources Information Center
Sandgren, Lennart
Following a brief description of primary and secondary education in Sweden, the aims and contents of the reform of higher education implemented in July 1977 are summarized. Basic higher studies (undergraduate courses), organized partly as education programs and partly as single course, are described, including admission requirements and the…
Wangkheimayum, Jayalaxmi; Paul, Deepjyoti; Dhar, Debadatta; Nepram, Rajlakshmi; Chetri, Shiela; Bhowmik, Deepshikha; Chakravarty, Atanu
2017-01-01
ABSTRACT The methylation of a ribosomal target leads to a high level of resistance to all clinically relevant aminoglycoside antibiotics, so early detection of these resistance determinants will help to reduce the incidence of treatment failures as well as lessen the dissemination rate. Here, we characterized different 16S rRNA methyltransferases responsible for aminoglycoside resistance and their epidemiological background in clinical isolates of Enterobacteriaceae in a tertiary referral hospital in India. All aminoglycoside-resistant isolates were screened for different 16S rRNA methyltransferases by PCR assay, and incompatibility typing of the conjugable plasmid harboring resistance genes was performed by PCR-based replicon typing. An assay for the stability and elimination of these resistance plasmids was performed. The coexistence of extended-spectrum β-lactamases and metallo-β-lactamases was also detected, and the heterogeneity of these isolates was determined by enterobacterial repetitive intergenic consensus PCR. The PCR assay revealed the presence of armA, rmtA, rmtB, rmtC, and rmtD in single and multiple combinations, and these were carried by a diverse group of Inc plasmids. Plasmids harboring these resistance determinants were highly stable and maintained until the 55th serial passage, but SDS treatment could easily eliminate the plasmids harboring the resistance determinants. The coexistence of blaTEM, blaPER, blaGES, and blaSHV, as well as blaVIM and blaNDM, within these isolates was also detected. Strains with different clonal patterns of aminoglycoside resistance were found to spread in this hospital setting. We observed that the 16S rRNA methyltransferase genes were encoded within different Inc plasmid types, suggesting diverse origins and sources of acquisition. Therefore, the present study is of epidemiological importance and can have a role in infection control policy in hospital settings. PMID:28320725
The Globular State of the Single-Stranded RNA: Effect of the Secondary Structure Rearrangements
Grigoryan, Zareh A.; Karapetian, Armen T.
2015-01-01
The mutual influence of the slow rearrangements of secondary structure and fast collapse of the long single-stranded RNA (ssRNA) in approximation of coarse-grained model is studied with analytic calculations. It is assumed that the characteristic time of the secondary structure rearrangement is much longer than that for the formation of the tertiary structure. A nonequilibrium phase transition of the 2nd order has been observed. PMID:26345143
Efficient Ligation of the Schistosoma Hammerhead Ribozyme †
Canny, Marella D.; Jucker, Fiona M.; Pardi, Arthur
2011-01-01
The hammerhead ribozyme from Schistosoma mansoni is the best characterized of the natural hammerhead ribozymes. Biophysical, biochemical, and structural studies have shown that the formation of the loop-loop tertiary interaction between stems I and II alters the global folding, cleavage kinetics, and conformation of the catalytic core of this hammerhead, leading to a ribozyme that is readily cleaved under physiological conditions. This study investigates the ligation kinetics and the internal equilibrium between cleavage and ligation for the Schistosoma hammerhead. Single turnover kinetic studies on a construct where the ribozyme cleaves and ligates substrate(s) in trans showed up to 23% ligation when starting from fully cleaved products. This was achieved by a ~2,000-fold increase in the rate of ligation compared to a minimal hammerhead without the loop-loop tertiary interaction, yielding an internal equilibrium that ranges from 2–3 at physiological Mg2+ ion concentrations (0.1 –1 mM). Thus, the natural Schistosoma hammerhead ribozyme is almost as efficient at ligation as it is at cleavage. The results here are consistent with a model where formation of the loop-loop tertiary interaction leads to a higher population of catalytically active molecules, and where formation of this tertiary interaction has a much larger effect on the ligation than the cleavage activity of the Schistosoma hammerhead ribozyme. PMID:17319693
Medication Adherence in Kidney Transplant Recipients in an Urban Indian Setting.
Adhikari, U R; Taraphder, A; Hazra, A; Das, T
2017-01-01
Medication nonadherence is a known problem after renal transplantation and can vary from one setting to another. Since it can lead to negative outcomes, it is important to develop intervention strategies to enhance adherence in a given setting using determinants identified through exploratory studies. We explored nonadherence in renal transplant recipients. A longitudinal survey was done with adult renal transplant recipients at a tertiary care public and two private hospitals of Kolkata. Subjects were followed-up for 1 year. After screening for medication adherence status by the four-item Morisky Medication Adherence Scale, those admitting to potential nonadherence were probed further. A patient was deemed to be nonadherent if failing to take medicines on appointed time (doses missed or delayed by more than 2 h) more than three times in any month during the observation period. A pretested questionnaire was used to explore potential determinants of nonadherence. Data of 153 patients recruited over a 2-year were analyzed. The extent of nonadherence with immunosuppressant regimens was about 31% overall; 44% in the public sector and 19% in the private sector ( P < 0.001). Nonadherence with other medication was around 19% in both the sectors. Several potential demographic, socioeconomic and psychosocial determinants of nonadherence were identified on univariate analysis. However, logistic regression analysis singled out only the economic status. This study had updated the issue of nonadherence in renal transplant recipients in the Indian setting. Strategies to improve medication adherence can be planned by relevant stakeholders on the basis of these findings.
Antibiotic use in acute pancreatitis: An audit of current practice in a tertiary centre.
Baltatzis, Minas; Mason, J M; Chandrabalan, Vishnu; Stathakis, Panagiotis; McIntyre, Ben; Jegatheeswaran, Santhalingam; Jamdar, Saurabh; O'Reilly, Derek A; Siriwardena, Ajith K
Intravenous antibiotic prophylaxis is not recommended in acute pancreatitis. According to current international guidelines antibiotics together with further intervention should be considered in the setting of infected necrosis. Appropriate antibiotic therapy particularly avoiding over-prescription is important. This study examines antibiotic use in acute pancreatitis in a tertiary centre using the current IAP/APA guidelines for reference. Data were collected on a consecutive series of patients admitted with acute pancreatitis over a 12 month period. Data were dichotomized by patients admitted directly to the centre and tertiary transfers. Information was collected on clinical course with specific reference to antibiotic use, episode severity, intervention and outcome. 111 consecutive episodes of acute pancreatitis constitute the reported population. 31 (28%) were tertiary transfers. Overall 65 (58.5%) patients received antibiotics. Significantly more tertiary transfer patients received antibiotics. Mean person-days of antibiotic use was 23.9 (sd 29.7) days in the overall study group but there was significantly more use in the tertiary transfer group as compared to patients having their index admission to the centre (40.9 sd 37.1 vs 10.2 sd 8.9; P < 0.005). Thirty four (44%) of patients with clinically mild acute pancreatitis received antibiotics. There is substantial use of antibiotics in acute pancreatitis, in particular in patients with severe disease. Over-use is seen in mild acute pancreatitis. Better consideration must be given to identification of prophylaxis or therapy as indication. In relation to repeated courses of antibiotics in severe disease there must be clear indications for use. Copyright © 2016 IAP and EPC. Published by Elsevier B.V. All rights reserved.
Factors contributing to nursing team work in an acute care tertiary hospital.
Polis, Suzanne; Higgs, Megan; Manning, Vicki; Netto, Gayle; Fernandez, Ritin
Effective nursing teamwork is an essential component of quality health care and patient safety. Understanding which factors foster team work ensures teamwork qualities are cultivated and sustained. This study aims to investigate which factors are associated with team work in an Australian acute care tertiary hospital across all inpatient and outpatient settings. All nurses and midwives rostered to inpatient and outpatient wards in an acute care 600 bed hospital in Sydney Australia were invited to participate in a cross sectional survey between September to October 2013. Data were collected, collated, checked and analysed using Statistical Package for the Social Sciences (SPSS) Version 21. Factors reporting a significant correlation with where p < 0.05 were analysed in a multiple regression model. A total of 501 surveys were returned. Nursing teamwork scores ranged between 3.32 and 4.08. Teamwork subscale Shared Mental Model consistently rated the highest. Mean scores for overall communication between nurses and team leadership were 3.6 (S.D. 0.57) and 3.8 (SD 0.6) respectively. Leadership and communication between nurses were significant predictors of team work p < 0.001. Our findings describe factors predictive of teamwork in an acute care tertiary based hospital setting across inpatient and outpatient specialty units. Our findings are of particular relevance in identifying areas of nurse education and workforce planning to improve nursing team work.
A Biome map for Modelling Global Mid-Pliocene Climate Change
NASA Astrophysics Data System (ADS)
Salzmann, U.; Haywood, A. M.
2006-12-01
The importance of vegetation-climate feedbacks was highlighted by several paleo-climate modelling exercises but their role as a boundary condition in Tertiary modelling has not been fully recognised or explored. Several paleo-vegetation datasets and maps have been produced for specific time slabs or regions for the Tertiary, but the vegetation classifications that have been used differ, thus making meaningful comparisons difficult. In order to facilitate further investigations into Tertiary climate and environmental change we are presently implementing the comprehensive GIS database TEVIS (Tertiary Environment and Vegetation Information System). TEVIS integrates marine and terrestrial vegetation data, taken from fossil pollen, leaf or wood, into an internally consistent classification scheme to produce for different time slabs global Tertiary Biome and Mega- Biome maps (Harrison & Prentice, 2003). In the frame of our ongoing 5-year programme we present a first global vegetation map for the mid-Pliocene time slab, a period of sustained global warmth. Data were synthesised from the PRISM data set (Thompson and Fleming 1996) after translating them to the Biome classification scheme and from new literature. The outcomes of the Biome map are compared with modelling results using an advanced numerical general circulation model (HadAM3) and the BIOME 4 vegetation model. Our combined proxy data and modelling approach will provide new palaeoclimate datasets to test models that are used to predict future climate change, and provide a more rigorous picture of climate and environmental changes during the Neogene.
ERIC Educational Resources Information Center
Szili, Gertrude; Sobels, Jonathan
2011-01-01
The dynamism of Environmental Management in the 21st century has predicted the need for students to emerge from tertiary programmes with a set of skills that are functional and more widely applicable in the contemporary workplace. To foster the development of such tools and skill sets, there has been an increasing trend amongst teaching…
Yang, Lanlin; Cai, Sufen; Zhang, Shuoping; Kong, Xiangyi; Gu, Yifan; Lu, Changfu; Dai, Jing; Gong, Fei; Lu, Guangxiu; Lin, Ge
2018-05-01
Does single cleavage-stage (Day 3) embryo transfer using a time-lapse (TL) hierarchical classification model achieve comparable ongoing pregnancy rates (OPR) to single blastocyst (Day 5) transfer by conventional morphological (CM) selection? Day 3 single embryo transfer (SET) with a hierarchical classification model had a significantly lower OPR compared with Day 5 SET with CM selection. Cleavage-stage SET is an alternative to blastocyst SET. Time-lapse imaging assists better embryo selection, based on studies of pregnancy outcomes when adding time-lapse imaging to CM selection at the cleavage or blastocyst stage. This single-centre, randomized, open-label, active-controlled, non-inferiority study included 600 women between October 2015 and April 2017. Eligible patients were Chinese females, aged ≤36 years, who were undergoing their first or second fresh IVF cycle using their own oocytes, and who had FSH levels ≤12 IU/mL on Day 3 of the cycle and 10 or more oocytes retrieved. Patients who had underlying uterine conditions, oocyte donation, recurrent pregnancy loss, abnormal oocytes or <6 normally fertilized embryos (2PN) were excluded from the study participation. Patients were randomized 1:1 to either the cleavage-stage SET with a time-lapse hierarchical classification model for selection (D3 + TL) or blastocyst SET with CM selection (D5 + CM). All normally fertilized zygotes were cultured in Primo Vision. The study was conducted at a tertiary IVF centre (CITIC-Xiangya) and OPR was the primary outcome. A total of 600 patients were randomized to the two groups, among which 585 (D3 + TL = 290, D5 + CM = 295) were included in the Modified-intention-to-treat (mITT) population and 517 (D3 + TL = 261, D5 + CM = 256) were included in the PP population. In the per protocol (PP) population, OPR was significantly lower in the D3 group (59.4%, 155/261) than in the D5 group (68.4%, 175/256) (difference: -9.0%, 95% CI: -17.1%, -0.7%, P = 0.03). Analysis in mITT population showed a marginally significant difference in the OPR between the D3 + TL and D5 + CM groups (56.6 versus 64.1%, difference: -7.5%, 95% CI: -15.4%, 0.4%, P = 0.06). The D3 + TL group resulted in a markedly lower implantation rate than the D5 + CM group (64.4 versus 77.0%; P = 0.002) in the PP analysis, however, the early miscarriage rate did not significantly differ between the two groups. The study lacked a direct comparison between time-lapse and CM selections at cleavage-stage SET and was statistically underpowered to detect non-inferiority. The subject's eligibility criteria favouring women with a good prognosis for IVF weakened the generalizability of the results. The OPR from Day 3 cleavage-stage SET using hierarchical classification time-lapse selection was significantly lower compared with that from Day 5 blastocyst SET using conventional morphology, yet it appeared to be clinically acceptable in women underwent IVF. This study is supported by grants from Ferring Pharmaceuticals and the Program for New Century Excellent Talents in University, China. ChiCTR-ICR-15006600. 16 June 2015. 1 October 2015.
NASA Astrophysics Data System (ADS)
Pavanetto, Pamela; Funedda, Antonio; Matteini, Massimo; Loi, Alfredo
2013-04-01
Geodynamic models and palinspastic reconstructions of pery-Thyrrenian terranes in the Western Mediterranean area are still extremely complex and speculative (Stampfly & Borel 2002, Trombetta et al., 2004; Alvarez & Shimabukuro, 2009; Carminati et al., 2012).A contribute can be done by considering the relationships between Sardinia-Corsica Block (SCB) and Calabria-Peloritain Arc (CPA). They shared a similar Variscan evolution and were the western part of the Briançonnais plate until the opening of the Algero-Provençal Basin during Burdigalian and then were separated in Late Tertiary during the spreading of South-Tyrrhenian Basin. During this period the CPA moved southeastward, with respect to the SCB, driven by a progressive roll-back of the subducted slab. However, is still ambiguous if the CPA was a single terrane during the Middle and Late Tertiary (Amodio Morelli et alii, 1976) or formed by the amalgamation of two or more continental "terranes" that collided during the Tertiary (Bonardi et al., 1980; Scandone, 1982; Alvarez & Shimabukuro, 2009). The data about the paleo-tectonic linkages, the terranes derivations, and the tectonic setting of the SCB and CPA as peri-Tyrrhenian blocks during Tertiary are still poor. Some evidence of their early evolution could be found in coeval Tertiary deposits cropping out both in the SCB and CPA. These deposits represent the early stage of the estensional event developed in the Tyrrhenian region during late Oligocene-Lower Miocene in a broader regional context dominated by the opening of Atlantic Ocean and the resulting convergence of Europe and Apulia microplate (Oggiano et al., 2009). To improve the knowledge on this topic, combined U-Pb and Lu-Hf analyses on zircons from Tertiary detrital sediments from Sardinia, Corsica, and both North and South Calabria have been performed using a Thermo-Fisher Neptune MC-ICP-MS coupled with a Nd:YAG UP213 New Wave laser ablation system, at the Laboratory of Geochronology of the University of Brasilia. In this way the source areas of these terranes can be compared. The sampled formations are: in Eastern Sardinia, the Cuccuru 'e Flores Conglomerate (CFC); in the Eastern Corsica, the Solaro Flysch (SF); in the Southern Calabria (Aspromonte sub-region), the Stilo Capo d'Orlando Fm. (SCOF) and in the Northern Calabria (Sila subregion), the Paludi Fm. (PF). The data about Northern CPA (NCPA) and SCB show similar zircons population inputs suggesting an analogous source areas. Zircons from the Southern CPA (SCPA) show different input spectra. In SCPA lack at all the Grenvillian ages (0.9-1.8 Ga) and an important crustal signature. These data suggest a different position during the tectonic evolution of the Gondwana margin of SCPA respect of NCPA and SCB. Following these data is it possible to infer the SCPA a North Africa derivation, well fitting with the Gondwanan European Variscan terranes, characterized by the lacking of mesoproterozoic age (KOBER et alii, 2004).
Steutel, Nina F; Benninga, Marc A; Langendam, Miranda W; Korterink, Judith J; Indrio, Flavia; Szajewska, Hania; Tabbers, Merit M
2017-05-29
Infant colic (IC) is defined as recurrent and prolonged crying without an obvious cause or evidence of failure to thrive or illness. It is a common problem with a prevalence of 5%-25%. The unknown aetiology results in a wide variety in interventions and use of heterogeneous outcome measures across therapeutic trials. Our aim was to develop a core outcome set (COS) for IC to facilitate and improve evidence synthesis. Prospective study design; primary, secondary and tertiary care. The COS was developed using a modified Delphi technique. First, healthcare professionals (HCPs) and parents of infants with IC were asked to list up to five outcomes they considered relevant in the treatment of IC. Outcomes mentioned by >10% of participants were forwarded to a shortlist. In the second round, outcomes on this shortlist were rated and prioritised. The final COS was defined in a face-to-face expert meeting of paediatricians. F of invited stakeholders (133 HCPs and 55 parents of infants with IC) completed both Delphi rounds. Duration of crying, family stress, sleeping time of infant, quality of life (of family), discomfort of infant and hospital admission/duration were rated as most important outcomes in IC, framing the final COS. The use of this COS should serve as a minimum of outcomes to be measured and reported. This will benefit evidence synthesis, by enhancing homogeneity of outcomes, and enable evaluation of success in therapeutic trials on IC. Researchers are strongly encouraged to use this COS when setting up a clinical trial in primary, secondary and/or tertiary care or performing a systematic review on IC. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Analysis of colonoscopic perforations at a local clinic and a tertiary hospital.
Sagawa, Toshihiko; Kakizaki, Satoru; Iizuka, Haruhisa; Onozato, Yasuhiro; Sohara, Naondo; Okamura, Shinichi; Mori, Masatomo
2012-09-21
To define the clinical characteristics, and to assess the management of colonoscopic complications at a local clinic. A retrospective review of the medical records was performed for the patients with iatrogenic colon perforations after endoscopy at a local clinic between April 2006 and December 2010. Data obtained from a tertiary hospital in the same region were also analyzed. The underlying conditions, clinical presentations, perforation locations, treatment types (operative or conservative) and outcome data for patients at the local clinic and the tertiary hospital were compared. A total of 10 826 colonoscopies, and 2625 therapeutic procedures were performed at a local clinic and 32 148 colonoscopies, and 7787 therapeutic procedures were performed at the tertiary hospital. The clinic had no perforations during diagnostic colonoscopy and 8 (0.3%) perforations were determined to be related to therapeutic procedures. The perforation rates in each therapeutic procedure were 0.06% (1/1609) in polypectomy, 0.2% (2/885) in endoscopic mucosal resection (EMR), and 3.8% (5/131) in endoscopic submucosal dissection (ESD). Perforation rates for ESD were significantly higher than those for polypectomy or EMR (P < 0.01). All of these patients were treated conservatively. On the other hand, three (0.01%) perforation cases were observed among the 24 361 diagnostic procedures performed, and these cases were treated with surgery in a tertiary hospital. Six perforations occurred with therapeutic endoscopy (perforation rate, 0.08%; 1 per 1298 procedures). Perforation rates for specific procedure types were 0.02% (1 per 5500) for polypectomy, 0.17% (1 per 561) for EMR, 2.3% (1 per 43) for ESD in the tertiary hospital. There were no differences in the perforation rates for each therapeutic procedure between the clinic and the tertiary hospital. The incidence of iatrogenic perforation requiring surgical treatment was quite low in both the clinic and the tertiary hospital. No procedure-related mortalities occurred. Performing closure with endoscopic clipping reduced the C-reactive protein (CRP) titers. The mean maximum CRP titer was 2.9 ± 1.6 mg/dL with clipping and 9.7 ± 6.2 mg/dL without clipping, respectively (P < 0.05). An operation is indicated in the presence of a large perforation, and in the setting of generalized peritonitis or ongoing sepsis. Although we did not experience such case in the clinic, patients with large perforations should be immediately transferred to a tertiary hospital. Good relationships between local clinics and nearby tertiary hospitals should therefore be maintained. It was therefore found to be possible to perform endoscopic treatment at a local clinic when sufficient back up was available at a nearby tertiary hospital.
Efficient synthesis of anacardic acid analogues and their antibacterial activities.
Mamidyala, Sreeman K; Ramu, Soumya; Huang, Johnny X; Robertson, Avril A B; Cooper, Matthew A
2013-03-15
Anacardic acid derivatives exhibit a broad range of biological activities. In this report, an efficient method for the synthesis of anacardic acid derivatives was explored, and a small set of salicylic acid variants synthesised retaining a constant hydrophobic element (a naphthyl tail). The naphthyl side chain was introduced via Wittig reaction and the aldehyde installed using directed ortho-metalation reaction of the substituted o-anisic acids. The failure of ortho-metalation using unprotected carboxylic acid group compelled us to use directed ortho-metalation in which a tertiary amide was used as a strong ortho-directing group. In the initial route, tertiary amide cleavage during final step was challenging, but cleaving the tertiary amide before Wittig reaction was beneficial. The Wittig reaction with protected carboxylic group (methyl ester) resulted in side-products whereas using sodium salt resulted in higher yields. The novel compounds were screened for antibacterial activity and cytotoxicity. Although substitution on the salicylic head group enhanced antibacterial activities they also enhanced cytotoxicity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Cretaceous-Tertiary findings, paradigms and problems
NASA Technical Reports Server (NTRS)
Officer, C. B.; Drake, C. L.
1988-01-01
The asteroid hypothesis has stimulated numerous studies of the paleontological record at Cretaceous/Tertiary time as well as of geological indicators of environmental crisis preserved in the rock record. Both extinctions and geological anomalies often occur at times that do not appear to be synchronous or instantaneous. The record includes paleontological indicators of dinosaurs, terrestrial flora, marine planktonic organisms, and shallow water marine macrofauna and geological phenomena include occurrences of iridium and other platinum metals, trace elements, clay mineralogy, shocked minerals, soot, microspherules, and isotopes of osmium, strontium and carbon. These findings are reviewed in the context of the alternate hypotheses of an exogenic cause, involving either a single asteroid impact or multiple commentary impacts, and an endogenic cause, involving intense global volcanism and major sea level regression.
DeepQA: improving the estimation of single protein model quality with deep belief networks.
Cao, Renzhi; Bhattacharya, Debswapna; Hou, Jie; Cheng, Jianlin
2016-12-05
Protein quality assessment (QA) useful for ranking and selecting protein models has long been viewed as one of the major challenges for protein tertiary structure prediction. Especially, estimating the quality of a single protein model, which is important for selecting a few good models out of a large model pool consisting of mostly low-quality models, is still a largely unsolved problem. We introduce a novel single-model quality assessment method DeepQA based on deep belief network that utilizes a number of selected features describing the quality of a model from different perspectives, such as energy, physio-chemical characteristics, and structural information. The deep belief network is trained on several large datasets consisting of models from the Critical Assessment of Protein Structure Prediction (CASP) experiments, several publicly available datasets, and models generated by our in-house ab initio method. Our experiments demonstrate that deep belief network has better performance compared to Support Vector Machines and Neural Networks on the protein model quality assessment problem, and our method DeepQA achieves the state-of-the-art performance on CASP11 dataset. It also outperformed two well-established methods in selecting good outlier models from a large set of models of mostly low quality generated by ab initio modeling methods. DeepQA is a useful deep learning tool for protein single model quality assessment and protein structure prediction. The source code, executable, document and training/test datasets of DeepQA for Linux is freely available to non-commercial users at http://cactus.rnet.missouri.edu/DeepQA/ .
National Trends in Year 12 Course Completions. Policy Note. Number 6
ERIC Educational Resources Information Center
Falkiner, Alice
2012-01-01
Current Year 12 students form the largest single group of Australian university admissions, comprising approximately half of all admissions at Australian universities. For those Year 12 students who continue to tertiary study at Australian universities, the courses studied in Year 12 play an important role in preparing them for that further…
White, Christopher R H; Doherty, Dorota A; Cannon, Jeffrey W; Kohan, Rolland; Newnham, John P; Pennell, Craig E
2016-07-01
There is an increasing body of literature supporting universal umbilical cord blood gas analysis (UCBGA) into all maternity units. A significant impediment to UCBGA's introduction is the perceived expense of the introduction and associated ongoing costs. Consequently, this study set out to conduct the first cost-effectiveness analysis of introducing universal UCBGA. Analysis was based on 42,100 consecutive deliveries ≥23 weeks of gestation at a single tertiary obstetric unit. Within 4 years of UCBGA's introduction there was a 45% reduction in term special care nursery (SCN) admissions >2499 g. Incurred costs included initial and ongoing costs associated with universal UCBGA. Averted costs were based on local diagnosis-related grouping costs for reduction in term SCN admissions. Incremental cost-effectiveness ratio (ICER) and sensitivity analysis results were reported. Under the base-case scenario, the adoption of universal UCBGA was less costly and more effective than selective UCBGA over 4 years and resulted in saving of AU$641,532 while adverting 376 SCN admissions. Sensitivity analysis showed that UCBGA was cost-effective in 51.8%, 83.3%, 99.6% and 100% of simulations in years 1, 2, 3 and 4. These conclusions were not sensitive to wide, clinically possible variations in parameter values for neonatal intensive care unit and SCN admissions, magnitude of averted SCN admissions, cumulative delivery numbers, and SCN admission costs. Universal UCBGA is associated with significant initial and ongoing costs; however, potential averted costs (due to reduced SCN admissions) exceed incurred costs in most scenarios.
Effect of Overlapping Operations on Outcomes in Microvascular Reconstructions of the Head and Neck.
Sweeny, Larissa; Rosenthal, Eben L; Light, Tyler; Grayson, Jessica; Petrisor, Daniel; Troob, Scott H; Greene, Benjamin J; Carroll, William R; Wax, Mark K
2017-04-01
Objective To compare outcomes after microvascular reconstructions of head and neck defects between overlapping and nonoverlapping operations. Study Design Retrospective cohort study. Setting Tertiary care center. Subjects and Methods Patients undergoing microvascular free tissue transfer operations between January 2010 and February 2015 at 2 tertiary care institutions were included (n = 1315). Patients were divided into 2 cohorts by whether the senior authors performed a single or consecutive microvascular reconstruction (nonoverlapping; n = 773, 59%) vs performing overlapping microvascular reconstructions (overlapping; n = 542, 41%). Variables reviewed were as follows: defect location, indication, T classification, surgical details, duration of the operation and hospitalization, and complications (major, minor, medical). Results Microvascular free tissue transfers performed included radial forearm (49%, n = 639), osteocutaneous radial forearm (14%, n = 182), anterior lateral thigh (12%, n = 153), fibula (10%, n = 135), rectus abdominis (7%, n = 92), latissimus dorsi (6%, n = 78), and scapula (<1%, n = 4). The mean duration of the overlapping operations was 21 minutes longer than nonoverlapping operations ( P = .003). Mean duration of hospitalization was similar for nonoverlapping (9.5 days) and overlapping (9.1 days) cohorts ( P = .39). There was no difference in complication rates when stratified by overlapping (45%, n = 241) and nonoverlapping (45%, n = 344) ( P = .99). Subset analysis yielded similar results when minor, major, and medical complications between groups were assessed. The overall survival rate of free tissue transfers was 96%, and this was same for overlapping (96%) and nonoverlapping (96%) operations ( P = .71). Conclusions Patients had similar complication rates and durations of hospitalization for overlapping and nonoverlapping operations.
Lal, Sweta; Singh, Alpana; Vaid, Neelam Bala; Behera, Sanjeeta
2014-09-01
Rape and abuse of women are common occurrences, which, many a times go unspoken due to social stigma or fear of retribution. Rape is a crime not against a single human being but against the entire humanity. For granting justice to the rape survivor it becomes necessary that such matters are properly presented before the Courts of Law. Healthcare workers play an important role in this regard because they are the first person who examine the rape victims. They prepare a documented record of medical condition of rape victim and do relevant sample collection. The objective of this study is to analyse demographic and event characteristics of rape victims who presented to the Emergency Department in tertiary care, Delhi after sexual assault. Data was retrospectively collected from the medico legal register of the Department of Obstetrics and Gynecology between June 2010 to December 2013. We noted a marked increase in the number of cases. Mean age of victims was 17 and most belonged to the lower socio-economic strata of the society. Use of sedatives and physical trauma was not common. Victims often knew the perpetrator of the event. Most (58%) of them reported within one day of the incident. Major degrees of perineal tears were seen in young victims. By understanding the demography of the sexual assault victims, we need to train our doctors for proper evidence collection not just in a government set up but also in private clinics, to help rape victims get justice and proper medical treatment.
Bush, Matthew L.; Burton, Mary; Loan, Ashley; Shinn, Jennifer B.
2013-01-01
Objective The purpose of this study was to examine the timing of early intervention diagnostic and therapeutic services in cochlear implant recipients from rural and urban areas. Study design Retrospective case series review Setting Tertiary referral center Patients Cochlear implant recipients from a single comprehensive hearing institute born with severe congenital sensorineural hearing loss were examined. Timing of diagnostic and therapeutic services was examined. Intervention(s) Diagnosis, amplification, and eventual cochlear implantation for all patients in the study Main outcome measure(s) Time points of definitive diagnosis, amplification, and cochlear implantation for children from urban and rural regions were examined. Correlation analysis of distance to testing center and timing of services was also assessed. Results 40 children born with congenital hearing loss were included in the study and were diagnosed at a median age of 13 weeks after birth. Children from rural regions obtained amplification at a median age of 47.7 weeks after birth, while urban children were amplified at 26 weeks after birth. Cochlear implantation was performed at a median age of 182 weeks after birth in those from rural areas and at 104 weeks after birth in urban-dwelling patients. A linear relationship was identified between distance to the implant center and timing of hearing aid amplification (r=0.5, p=0.033) and cochlear implantation (r=0.5, p=0.016). Conclusions Children residing outside of metro areas may be at higher risk of delayed rehabilitative services and cochlear implantation than those residing in urban areas that may be closer in proximity to tertiary care centers. PMID:24136305
Pain following Spinal Cord Injury: The Impact on Community Reintegration
Donnelly, Catherine; Eng, Janice J
2011-01-01
Study Design Prospective, correlational Objectives 1) describe how pain changes over recovery from admission to spinal cord injury (SCI) rehabilitation, discharge and after 6 months of community living and 2) examine the relationship between pain and community integration at 6 months of community living. Setting Tertiary rehabilitation centre, spinal cord injury unit, Vancouver, Canada. Methods Subjects from 66 consecutive admissions to the Spinal Cord Injury Program of a tertiary rehabilitation centre for the treatment of a traumatic spinal cord injury during the years 2000 to 2002 were followed using data from the National Rehabilitation Reporting System (NRRS). Information was obtained from NRRS standardized assessments performed on admission, discharge and 6 month community living. Early community living was defined as 6-months post-discharge. Community re-integration was assessed by the Reintegration to Normal Living Index (RNL). Pain presence, pain impact and pain intensity were assessed using single item Likhert type scales. Results 86% of individuals with a SCI reported pain at 6-months post discharge, with 27% of these individuals reporting pain that impacted on many or most activities. Pain impact and pain intensity were related to the community re-integration (r=−0.39 and r=−0.55, p<.001), with pain intensity accounting for 25% of the variance in RNL scores. Conclusions Pain is a major consequence of a SCI, impacting on an individual’s activities and perception of how well they are integrated into the community. The results of this study highlight the need to address pain during both the rehabilitation phase of treatment and the early transition into the community. PMID:15570317
Integrating GDM management in primary care: Gulf Cooperation Council (GCC) perspective.
Anjum, Qudsia; Mumtaz, Shadma
2016-09-01
Diabetes is prevailing universally and Gulf Cooperation Council (GCC) is no exception. Pregnancies associated with gestational diabetes place women at high risk of natal complications. Statistics from GCC gives variable figures for GDM. Family Physicians are the first level health care providers and their role in management of GDM can be promising. This has been evident from a focused group study where patients prefer screening for GDM in primary care settings. Strengthening of primary care is important universally. Government should have mandatory primary care registration to be referred to secondary level for obstetric follow up and management. An important issue needing attention is presence of multiple criteria for diagnosing and screening GDM. There is need for a single guideline globally to avoid confusion for primary care providers.10 Primary care centers can better be utilized to screen for GDM at early stages. This will decrease the load on secondary and tertiary care centers and can also maintain continuity of care.
Processing Satellite Images on Tertiary Storage: A Study of the Impact of Tile Size on Performance
NASA Technical Reports Server (NTRS)
Yu, JieBing; DeWitt, David J.
1996-01-01
Before raw data from a satellite can be used by an Earth scientist, it must first undergo a number of processing steps including basic processing, cleansing, and geo-registration. Processing actually expands the volume of data collected by a factor of 2 or 3 and the original data is never deleted. Thus processing and storage requirements can exceed 2 terrabytes/day. Once processed data is ready for analysis, a series of algorithms (typically developed by the Earth scientists) is applied to a large number of images in a data set. The focus of this paper is how best to handle such images stored on tape using the following assumptions: (1) all images of interest to a scientist are stored on a single tape, (2) images are accessed and processed in the order that they are stored on tape, and (3) the analysis requires access to only a portion of each image and not the entire image.
General Mechanism of Two-State Protein Folding Kinetics
Rollins, Geoffrey C.; Dill, Ken A.
2016-01-01
We describe here a general model of the kinetic mechanism of protein folding. In the Foldon Funnel Model, proteins fold in units of secondary structures, which form sequentially along the folding pathway, stabilized by tertiary interactions. The model predicts that the free energy landscape has a volcano shape, rather than a simple funnel, that folding is two-state (single-exponential) when secondary structures are intrinsically unstable, and that each structure along the folding path is a transition state for the previous structure. It shows how sequential pathways are consistent with multiple stochastic routes on funnel landscapes, and it gives good agreement with the 9 order of magnitude dependence of folding rates on protein size for a set of 93 proteins, at the same time it is consistent with the near independence of folding equilibrium constant on size. This model gives estimates of folding rates of proteomes, leading to a median folding time in Escherichia coli of about 5 s. PMID:25056406
Goldberg, Jason F; Jensen, Craig L; Krishnamurthy, Rajesh; Varghese, Nidhy P; Justino, Henri
2018-01-01
We describe the long-term follow-up of a child with recurrent hemoptysis due to severe pulmonary vein stenosis decompressing via collaterals to esophageal varices. Case report SETTING: Tertiary children's hospital PATIENT: Single child through ages 2- to 11-year old INTERVENTIONS: The child underwent cutting balloon angioplasty, bare metal stenting, and implantation of a PTFE-covered stent, all of which failed rapidly. Only after placement of a paclitaxel drug eluting stent did he have prolonged relief from hemoptysis and long-term patency of the treated vein. The stents were serially dilated to keep up with somatic growth of the child, eventually culminating in the need to induce intentional stent fracture. We highlight novel transcatheter techniques to treat this vexing condition, discuss mechanisms of disease treatment and progression, and present the only patient with this rare combination of lesions to have achieved both longstanding pulmonary vein patency and resolution of esophageal varices. © 2017 Wiley Periodicals, Inc.
Smibert, O C; Aung, A K; Woolnough, E; Carter, G P; Schultz, M B; Howden, B P; Seemann, T; Spelman, D; McGloughlin, S; Peleg, A Y
2018-03-02
Few studies have used molecular epidemiological methods to study transmission links to clinical isolates in intensive care units. Ninety-four multidrug-resistant organisms (MDROs) cultured from routine specimens from intensive care unit (ICU) patients over 13 weeks were stored (11 meticillin-resistant Staphylococcus aureus (MRSA), two vancomycin-resistant enterococci and 81 Gram-negative bacteria). Medical staff personal mobile phones, departmental phones, and ICU keyboards were swabbed and cultured for MDROs; MRSA was isolated from two phones. Environmental and patient isolates of the same genus were selected for whole genome sequencing. On whole genome sequencing, the mobile phone isolates had a pairwise single nucleotide polymorphism (SNP) distance of 183. However, >15,000 core genome SNPs separated the mobile phone and clinical isolates. In a low-endemic setting, mobile phones and keyboards appear unlikely to contribute to hospital-acquired MDROs. Copyright © 2018 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
Liver transplantation in the treatment of severe iatrogenic liver injuries
Lauterio, Andrea; De Carlis, Riccardo; Di Sandro, Stefano; Ferla, Fabio; Buscemi, Vincenzo; De Carlis, Luciano
2017-01-01
The place of liver transplantation in the treatment of severe iatrogenic liver injuries has not yet been widely discussed in the literature. Bile duct injuries during cholecystectomy represent the leading cause of liver transplantation in this setting, while other indications after abdominal surgery are less common. Urgent liver transplantation for the treatment of severe iatrogenic liver injury may-represent a surgical challenge requiring technically difficult and time consuming procedures. A debate is ongoing on the need for centralization of complex surgery in tertiary referral centers. The early referral of patients with severe iatrogenic liver injuries to a tertiary center with experienced hepato-pancreato-biliary and transplant surgery has emerged as the best treatment of care. Despite widespread interest in the use of liver transplantation as a treatment option for severe iatrogenic injuries, reported experiences indicate few liver transplants are performed. This review analyzes the literature on liver transplantation after hepatic injury and discusses our own experience along with surgical advances and future prospects in this uncommon transplant setting. PMID:28932348
Rhodamine Inhibitors of P-glycoprotein: An Amide/Thioamide “Switch” for ATPase Activity
Gannon, Michael K.; Holt, Jason J.; Bennett, Stephanie M.; Wetzel, Bryan R.; Loo, Tip W.; Bartlett, M. Claire; Clarke, David M.; Sawada, Geri A.; Higgins, J. William; Tombline, Gregory; Raub, Thomas J.; Detty, Michael R.
2012-01-01
We have examined 46 tetramethylrosamine/rhodamine derivatives with structural diversity in the heteroatom of the xanthylium core, the amino substituents of the 3- and 6-positions, and the alkyl, aryl, or heteroaryl group at the 9-substituent. These compounds were examined for affinity and ATPase stimulation in isolated MDR3 CL P-gp and human P-gp-His10, for their ability to promote uptake of calcein AM and vinblastine in multidrug-resistant MDCKII-MDR1 cells, and for transport in monolayers of MDCKII-MDR1 cells. Thioamide 31-S gave KM of 0.087 μM in human P-gp. Small changes in structure among this set of compounds affected affinity as well as transport rate (or flux) even though all derivatives examined were substrates for P-gp. With isolated protein, tertiary amide groups dictate high affinity and high stimulation while tertiary thioamide groups give high affinity and inhibition of ATPase activity. In MDCKII-MDR1 cells, the tertiary thioamide-containing derivatives promote uptake of calcein AM and have very slow passive, absorptive, and secretory rates of transport relative to transport rates for tertiary amide-containing derivatives. Thioamide 31-S promoted uptake of calcein AM and inhibited efflux of vinblastine with IC50’s of ~2 μM in MDCKII-MDR1 cells. PMID:19402665
Use of terbium as a probe of tRNA tertiary structure and folding.
Hargittai, M R; Musier-Forsyth, K
2000-01-01
Lanthanide metals such as terbium have previously been shown to be useful for mapping metal-binding sites in RNA. Terbium binds to the same sites on RNA as magnesium, however, with a much higher affinity. Thus, low concentrations of terbium ions can easily displace magnesium and promote phosphodiester backbone scission. At higher concentrations, terbium cleaves RNA in a sequence-independent manner, with a preference for single-stranded, non-Watson-Crick base-paired regions. Here, we show that terbium is a sensitive probe of human tRNALys,3 tertiary structure and folding. When 1 microM tRNA is used, the optimal terbium ion concentration for detecting Mg2+-induced tertiary structural changes is 50-60 microM. Using these concentrations of RNA and terbium, a magnesium-dependent folding transition with a midpoint (KMg) of 2.6 mM is observed for unmodified human tRNALys,3. At lower Tb3+ concentrations, cleavage is restricted to nucleotides that constitute specific metal-binding pockets. This small chemical probe should also be useful for detecting protein induced structural changes in RNA. PMID:11105765
NASA Technical Reports Server (NTRS)
Young, R. A.; Mckee, E. H.; Hartman, J. H.; Simmons, A. M.
1985-01-01
The overall temporal and spatial relations between middle Tertiary volcanism and tectonism from the Basin and Range province onto the edge of the Colorado Plateaus province suggest that a single magnetic-tectonic episode affected the entire region more or less simultaneously during this period. The episode followed a post-Laramide (late Eocene through Oligocene) period of 25 million years of relative stability. Middle Tertiary volcanism did not migrate gradually eastward in a simple fashion onto the Colorado Plateau. In fact, late Oligocene volcanism appears to be more voluminous near the Aquarius Mountains than throughout the adjacent Basin and Range province westward to the Colorado River. Any model proposed to explain the cause of extension and detachment faulting in the eastern part of the Basin and Range province must consider that the onset of volcanism appears to have been approximately synchronous from the Colorado River region of the Basin and Range across the transition zone and onto the edge of the Colorado Plateaus.
Janahiraman, Sivakami; Aziz, Muhammad Nazri; Hoo, Fan Kee; P’ng, Hon Shen; Boo, Yang Liang; Ramachandran, Vasudevan; Shamsuddin, Ahmad Fuad
2015-01-01
Backgrounds & Objective: Antimicrobial resistance is a major health problem worldwide in hospitals. The main contributing factors are exposures to broad-spectrum antimicrobials and cross-infections. Understanding the extent and type of antimicrobial use in tertiary care hospitals will aid in developing national antimicrobial stewardship priorities. Methods: In this study, we have analyzed the antimicrobial agents’ usage for acquisition of multidrug resistant using retrospective, cross-sectional, single-centre study in a multidisciplinary ICU at tertiary care hospital. Results: Acinetobacter baumannii (ACB) was isolated in various specimens from 662 patients. From these, 136 patients who were diagnosed with Ventilator-associated pneumonia (VAP) caused by ACB were included into the study. In our study, MDR strain accounts for 51% of all VAP cases caused by ACB. The development of ACB VAP were 10.5 + 6.4 days for MDR strains compared to susceptible organism (7.8 + 4.5 days) and had significantly longer ICU stay. Conclusion: The study concludes that prudent use of antimicrobial agents is important to reduce acquisition of MDR ACB. PMID:26870101
Ethiopian Tertiary dike swarms
NASA Technical Reports Server (NTRS)
Mohr, P. A.
1971-01-01
Mapping of the Ethiopian rift and Afar margins revealed the existence of Tertiary dike swarms. The structural relations of these swarms and the fed lava pile to monoclinal warping of the margins partly reflect a style of continental margin tectonics found in other parts of the world. In Ethiopia, however, conjugate dike trends appear to be unusually strongly developed. Relation of dikes to subsequent margin faulting is ambiguous, and there are instances where the two phenomena are spatially separate and of differing trends. There is no evidence for lateral migration with time of dike injection toward the rift zone. No separate impingement of Red Sea, Gulf of Aden, and African rift system stress fields on the Ethiopian region can be demonstrated from the Tertiary dike swarms. Rather, a single, regional paleostress field existed, suggestive of a focus beneath the central Ethiopian plateau. This stress field was dominated by tension: there is no cogent evidence for shearing along the rift margins. A gentle compression along the rift floor is indicated. A peculiar sympathy of dike hade directions at given localities is evident.
Klett, T.R.
2001-01-01
Undiscovered conventional oil and gas resources were assessed within total petroleum systems of the Pelagian Province (2048) as part of the U.S. Geological Survey World Petroleum Assessment 2000. The Pelagian Province is located mainly in eastern Tunisia and northwestern Libya. Small portions of the province extend into Malta and offshore Italy. Although several petroleum systems may exist, only two ?composite? total petroleum systems were identified. Each total petroleum system comprises a single assessment unit. These total petroleum systems are called the Bou Dabbous?Tertiary and Jurassic-Cretaceous Composite, named after the source-rock intervals and reservoir-rock ages. The main source rocks include mudstone of the Eocene Bou Dabbous Formation; Cretaceous Bahloul, Lower Fahdene, and M?Cherga Formations; and Jurassic Nara Formation. Known reservoirs are in carbonate rocks and sandstone intervals throughout the Upper Jurassic, Cretaceous, and Tertiary sections. Traps for known accumulations include fault blocks, low-amplitude anticlines, high-amplitude anticlines associated with reverse faults, wrench fault structures, and stratigraphic traps. The estimated means of the undiscovered conventional petroleum volumes in total petroleum systems of the Pelagian Province are as follows: [MMBO, million barrels of oil; BCFG, billion cubic feet of gas; MMBNGL, million barrels of natural gas liquids] Total Petroleum System MMBO BCFG MMBNGL Bou Dabbous?Tertiary 667 2,746 64 Jurassic-Cretaceous Composite 403 2,280 27
Leprosy: diagnosis and management in a developed setting.
Turner, D; McGuinness, S L; McGuiness, S; Leder, K
2015-01-01
Leprosy remains an important global health concern, but little has been published about its diagnosis and management in developed settings. It has been postulated that delay in diagnosis is common in developed settings. We reviewed all the cases of leprosy seen at a major tertiary referral centre between 1999 and 2013 and demonstrated that delay in diagnosis is common, especially when patients present with symptoms of leprosy reactions rather than classical symptoms, such as hypo-pigmented hypo-aesthetic skin lesions and neuropathy. © 2015 Royal Australasian College of Physicians.
Causes of chronic orthostatic hypotension
NASA Technical Reports Server (NTRS)
Robertson, D.; Robertson, R. M.
1994-01-01
OBJECTIVE: To determine the frequency of various causes of orthostatic hypotension. DESIGN: Survey. SETTING: Tertiary referral center. PATIENTS: One hundred patients with moderate to severe orthostatic hypotension. RESULTS: Twenty-seven percent of the patients had primary autonomic failure, 35% had secondary autonomic failure, and 38% had hypotension without evidence of generalized autonomic degeneration. CONCLUSIONS: In a tertiary referral center, only a minority of patients with severe orthostatic hypotension will have Shy-Drager syndrome or Bradbury-Eggleston syndrome as their primary disease. Occasional patients who initially appear to have Bradbury-Eggleston syndrome ultimately prove to have Shy-Drager syndrome or paraneoplastic autonomic failure. Antidepressant drugs, even in low doses, remain a major overlooked cause of orthostatic hypotension.
Pitman, Janet K.; Fouch, T.D.; Goldhaber, M.B.
1982-01-01
The Douglas Creek Member of the Tertiary Green River Formation underlies much of the Uinta basin, Utah, and contains large volumes of oil and gas trapped in a complex of fractured low-permeability sandstone reservoirs. In the SE part of the basin at Pariette Bench, the Eocene Douglas Creek Member is a thick sequence of fine- grained alluvial sandstone complexly intercalated with lacustrine claystone and carbonate rock. Sediments were deposited in a subsiding intermontane basin along the shallow fluctuating margin of ancient Lake Uinta. Although the Uinta basin has undergone postdepositional uplift and erosion, the deepest cored rocks at Pariette Bench have never been buried more than 3000m.-from Authors
Cassia Amaral, Rita; Inacio, Marlene; Brito, Vinicius N; Bachega, Tania A S S; Oliveira, Ari A; Domenice, Sorahia; Denes, Francisco T; Sircili, Maria Helena; Arnhold, Ivo J P; Madureira, Guiomar; Gomes, Larissa; Costa, Elaine M F; Mendonca, Berenice B
2015-02-01
Few studies have focused on the quality of life (QoL) of patients with disorders of sex development (DSD). Our aim was to evaluate QoL in DSD patients with defined diagnoses followed until adulthood in a single tertiary centre. Adult patients with DSD (56 patients with 46,XX DSD - 49 with female social sex and 7 with male social sex as well as 88 patients with 46,XY DSD - 54 with female social sex and 34 with male social sex). QoL using WHOQOL-Bref questionnaire. Both patients with 46,XX DSD and patients with 46,XY DSD had similar QoL scores on the WHOQOL-Bref, comparable to the scores of the Brazilian general population. The chronological age at the start of treatment was negatively and significantly associated with general QoL score. Patients with male social sex DSD had better scores on the psychological domain than patients with female social sex DSD, as found in the Brazilian general population. In addition, among the 46,XY DSD group, the male social sex patients had better QoL compared with the female social sex patients. There was a positive and significant correlation between sexual performance and general QoL, although it explained only 4% of the variability of the general QoL score. The most influencing variables were general health, positive feelings and spirituality, religion and personal beliefs, each of them contributing with 18% of the variability of the general QoL score. Our large cohort of adult patients with DSD, which was followed by a multidisciplinary team in a single tertiary centre, had good QoL in adulthood; in addition, late treatment compromised the QoL of patients with DSD, whereas sexual performance has little influence on QoL. © 2014 John Wiley & Sons Ltd.
GeneSilico protein structure prediction meta-server.
Kurowski, Michal A; Bujnicki, Janusz M
2003-07-01
Rigorous assessments of protein structure prediction have demonstrated that fold recognition methods can identify remote similarities between proteins when standard sequence search methods fail. It has been shown that the accuracy of predictions is improved when refined multiple sequence alignments are used instead of single sequences and if different methods are combined to generate a consensus model. There are several meta-servers available that integrate protein structure predictions performed by various methods, but they do not allow for submission of user-defined multiple sequence alignments and they seldom offer confidentiality of the results. We developed a novel WWW gateway for protein structure prediction, which combines the useful features of other meta-servers available, but with much greater flexibility of the input. The user may submit an amino acid sequence or a multiple sequence alignment to a set of methods for primary, secondary and tertiary structure prediction. Fold-recognition results (target-template alignments) are converted into full-atom 3D models and the quality of these models is uniformly assessed. A consensus between different FR methods is also inferred. The results are conveniently presented on-line on a single web page over a secure, password-protected connection. The GeneSilico protein structure prediction meta-server is freely available for academic users at http://genesilico.pl/meta.
GeneSilico protein structure prediction meta-server
Kurowski, Michal A.; Bujnicki, Janusz M.
2003-01-01
Rigorous assessments of protein structure prediction have demonstrated that fold recognition methods can identify remote similarities between proteins when standard sequence search methods fail. It has been shown that the accuracy of predictions is improved when refined multiple sequence alignments are used instead of single sequences and if different methods are combined to generate a consensus model. There are several meta-servers available that integrate protein structure predictions performed by various methods, but they do not allow for submission of user-defined multiple sequence alignments and they seldom offer confidentiality of the results. We developed a novel WWW gateway for protein structure prediction, which combines the useful features of other meta-servers available, but with much greater flexibility of the input. The user may submit an amino acid sequence or a multiple sequence alignment to a set of methods for primary, secondary and tertiary structure prediction. Fold-recognition results (target-template alignments) are converted into full-atom 3D models and the quality of these models is uniformly assessed. A consensus between different FR methods is also inferred. The results are conveniently presented on-line on a single web page over a secure, password-protected connection. The GeneSilico protein structure prediction meta-server is freely available for academic users at http://genesilico.pl/meta. PMID:12824313
Industrial paramedics, out on site but not out of mind.
Acker, Joseph J; Johnston, Tania M; Lazarsfeld-Jensen, Ann
2014-01-01
Australian natural resource exploration and production companies are employing paramedics to provide emergency medical response, primary health care, injury prevention, and health promotion services in remote locations nationally and internationally. Although Australian paramedic practice has steadily evolved to include increasingly complex medical interventions in the prehospital setting, paramedics are not yet registered health professionals, and in many states and territories their title is not protected. Similarly, tertiary-level education is becoming the entry to practice standard for traditional ambulance paramedics; however, certificate- and diploma-level paramedic courses remain an acceptable pathway to private and industrial paramedic jobs. To ensure acceptable patient safety standards are maintained and to protect all related stakeholders, the role, skills, training, and professional capacity of industrial paramedics must be defined. The study objective was to explore the published literature for a definition for the discipline of industrial paramedicine. A comprehensive systematic analysis was conducted using the EBSCOhost (health), MEDLINE, SCOPUS, and CINAHL electronic databases. The primary search terms "remote", "offshore", "mining", and "oil" were combined with the secondary search terms "paramedic" and "emergency medical services". An initial search using the combined two-term sets identified 870 citations. After application of the inclusion and exclusion criteria to a title and abstract review, 69 citations met the criteria including those discovered by searching the reference lists. Of these, nine citations were excluded because full-text papers could not be found and eight citations were excluded based on review of the full article. The result was 40 articles that discuss the role of paramedics in the remote or offshore environment (ROP) and 12 articles that discuss the provision of emergency medical services in the mining or oil and gas sectors (MOEMS). There is no single definition or comprehensive role description for industrial paramedic practice within the literature. Worldwide, there is little high-quality published evidence to adequately reflect all aspects of industrial paramedic practice. However, based on the literature available, this definition is offered: 'An industrial paramedic is an advanced clinical practitioner in paramedicine with an expanded scope of practice. The industrial paramedic provides emergency response, primary health care, chronic disease management, injury prevention, health promotion, medical referral, and repatriation coordination at remote mining sites, offshore installations, and other isolated industry settings. The industrial paramedic is resourceful, adaptable, and comfortable working independently. Industrial paramedics practice on site with limited resources, remotely located from tertiary care, and use telemedicine to consult with other health professionals as required. Industrial paramedics are experts at rapidly assessing, prioritising, and establishing control in their unpredictable workspace to reduce risks and create an environment conducive to quality patient care. The industrial paramedic preferably holds a specialised tertiary qualification and is committed to maintaining their clinical competency through continuing professional development.' Further research is required to validate, refute, or expand this proposed definition.
The Antecedents of Organizational Commitment: The Case of Australian Casual Academics
ERIC Educational Resources Information Center
Joiner, Therese A.; Bakalis, Steve
2006-01-01
Purpose: Despite the increasing attention of organizational commitment in the management literature, most studies predominantly focus on full-time workers in traditional work settings. This paper examined the antecedents of organizational commitment among casual academics working in the tertiary education sector in Australia.…
Patient-appropriate health literacy educational materials in ophthalmology.
Mikhail, David; Visscher, Kari L; Chen, Nancy; Wang, Joy; Emara, Barry Y; Hutnik, Cindy M
2015-02-01
To evaluate the literacy level of patients with glaucoma in a tertiary care teaching centre compared with a rural community centre and to assess comprehension of and preference for educational material written at different reading levels. Prospective, randomized, double-blinded study. Patients with glaucoma presenting for routine examination or referral at a tertiary care academic centre in southwestern Ontario and a single general ophthalmology clinic located in a moderately sized suburban community in Ontario, Canada, were invited to participate in this study. Patients aged 19 to 90 with sufficient visual acuity to read the pamphlets were recruited. Eligible and consenting participants underwent a validated literacy study, and their literacy levels were classified as adequate, barely adequate, marginal, or inadequate. They were then randomized to receive educational pamphlets written at either a grade 5 (intervention group) or grade 10 (control group) reading level. Comprehension of and preference for the material were determined by analysis of cloze testing and a feedback questionnaire. Of 199 participants, 179 were included in the analysis. The literacy testing found that 35% of patients in the community practice and 30% in the tertiary care academic centre had "marginal" or "inadequate" literacy skills, but there was no significant difference between sites (p = 0.77). Comprehension of the educational material was higher in the intervention group versus the control group (p = 0.0057), with a mean cloze score of 57.9% in the intervention group and 48.3% in the control group. The intervention group spent significantly less time reading the pamphlets (p < 0.0001), with an average of 2.52 minutes compared with 4.51 minutes. The feedback survey indicated that patients found the pamphlet with the lower reading level easier to read (p = 0.02), which was reflected in their comments as well. In both academic and community practice settings, about 30% of patients with glaucoma have marginal or inadequate literacy skills. However, regardless of practice, all patients better comprehend, and were more receptive to, educational material written at grade 5 reading level with illustrations, regardless of initial literacy level. Copyright © 2015 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.
National Rules for Drug–Drug Interactions: Are They Appropriate for Tertiary Hospitals?
2016-01-01
The application of appropriate rules for drug–drug interactions (DDIs) could substantially reduce the number of adverse drug events. However, current implementations of such rules in tertiary hospitals are problematic as physicians are receiving too many alerts, causing high override rates and alert fatigue. We investigated the potential impact of Korean national DDI rules in a drug utilization review program in terms of their severity coverage and the clinical efficiency of how physicians respond to them. Using lists of high-priority DDIs developed with the support of the U.S. government, we evaluated 706 contraindicated DDI pairs released in May 2015. We evaluated clinical log data from one tertiary hospital and prescription data from two other tertiary hospitals. The measured parameters were national DDI rule coverage for high-priority DDIs, alert override rate, and number of prescription pairs. The coverage rates of national DDI rules were 80% and 3.0% at the class and drug levels, respectively. The analysis of the system log data showed an overall override rate of 79.6%. Only 0.3% of all of the alerts (n = 66) were high-priority DDI rules. These showed a lower override rate of 51.5%, which was much lower than for the overall DDI rules. We also found 342 and 80 unmatched high-priority DDI pairs which were absent in national rules in inpatient orders from the other two hospitals. The national DDI rules are not complete in terms of their coverage of severe DDIs. They also lack clinical efficiency in tertiary settings, suggesting improved systematic approaches are needed. PMID:27822925
A multifaceted strategy for implementation of the Ottawa ankle rules in two emergency departments
Clark, Robyn; Shakib, Sepehr; Hughes, Geoffrey
2009-01-01
Problem Despite widespread acceptance of the Ottawa ankle rules for assessment of acute ankle injuries, their application varies considerably. Design Before and after study. Background and setting Emergency departments of a tertiary teaching hospital and a community hospital in Australia. Key measures for improvement Documentation of the Ottawa ankle rules, proportion of patients referred for radiography, proportion of radiographs showing a fracture. Strategies for change Education, a problem specific radiography request form, reminders, audit and feedback, and using radiographers as “gatekeepers.” Effects of change Documentation of the Ottawa ankle rules improved from 57.5% to 94.7% at the tertiary hospital, and 51.6% to 80.8% at the community hospital (P<0.001 for both). The proportion of patients undergoing radiography fell from 95.8% to 87.2% at the tertiary hospital, and from 91.4% to 78.9% at the community hospital (P<0.001 for both). The proportion of radiographs showing a fracture increased from 20.4% to 27.1% at the tertiary hospital (P=0.069), and 15.2% to 27.2% (P=0.002) at the community hospital. The missed fracture rate increased from 0% to 2.9% at the tertiary hospital and from 0% to 1.6% at the community hospital compared with baseline (P=0.783 and P=0.747). Lessons learnt Assessment of case note documentation has limitations. Clinician groups seem to differ in their capacity and willingness to change their practice. A multifaceted change strategy including a problem specific radiography request form can improve the selection of patients for radiography. PMID:19675080
Borghoff, Susan J; Ring, Caroline; Banton, Marcy I; Leavens, Teresa L
2017-05-01
In cancer bioassays, inhalation, but not drinking water exposure to ethyl tertiary-butyl ether (ETBE), caused liver tumors in male rats, while tertiary-butyl alcohol (TBA), an ETBE metabolite, caused kidney tumors in male rats following exposure via drinking water. To understand the contribution of ETBE and TBA kinetics under varying exposure scenarios to these tumor responses, a physiologically based pharmacokinetic model was developed based on a previously published model for methyl tertiary-butyl ether, a structurally similar chemical, and verified against the literature and study report data. The model included ETBE and TBA binding to the male rat-specific protein α2u-globulin, which plays a role in the ETBE and TBA kidney response observed in male rats. Metabolism of ETBE and TBA was described as a single, saturable pathway in the liver. The model predicted similar kidney AUC 0-∞ for TBA for various exposure scenarios from ETBE and TBA cancer bioassays, supporting a male-rat-specific mode of action for TBA-induced kidney tumors. The model also predicted nonlinear kinetics at ETBE inhalation exposure concentrations above ~2000 ppm, based on blood AUC 0-∞ for ETBE and TBA. The shift from linear to nonlinear kinetics at exposure concentrations below the concentration associated with liver tumors in rats (5000 ppm) suggests the mode of action for liver tumors operates under nonlinear kinetics following chronic exposure and is not relevant for assessing human risk. Copyright © 2016 The Authors Journal of Applied Toxicology Published by John Wiley & Sons Ltd. Copyright © 2016 The Authors Journal of Applied Toxicology Published by John Wiley & Sons Ltd.
Disaster content in Australian tertiary postgraduate emergency nursing courses: a survey.
Ranse, Jamie; Shaban, Ramon Z; Considine, Julie; Hammad, Karen; Arbon, Paul; Mitchell, Belinda; Lenson, Shane
2013-05-01
Emergency nurses play a pivotal role in disaster relief during the response to, and recovery of both in-hospital and out-of-hospital disasters. Postgraduate education is important in preparing and enhancing emergency nurses' preparation for disaster nursing practice. The disaster nursing content of Australian tertiary postgraduate emergency nursing courses has not been compared across courses and the level of agreement about suitable content is not known. To explore and describe the disaster content in Australian tertiary postgraduate emergency nursing courses. A retrospective, exploratory and descriptive study of the disaster content of Australian tertiary postgraduate emergency nursing courses conducted in 2009. Course convenors from 12 universities were invited to participate in a single structured telephone survey. Data was analysed using descriptive statistics. Ten of the twelve course convenors from Australian tertiary postgraduate emergency nursing courses participated in this study. The content related to disasters was varied, both in terms of the topics covered and duration of disaster content. Seven of these courses included some content relating to disaster health, including types of disasters, hospital response, nurses' roles in disasters and triage. The management of the dead and dying, and practical application of disaster response skills featured in only one course. Three courses had learning objectives specific to disasters. The majority of courses had some disaster content but there were considerable differences in the content chosen for inclusion across courses. The incorporation of core competencies such as those from the International Council of Nurses and the World Health Organisation, may enhance content consistency in curriculum. Additionally, this content could be embedded within a proposed national education framework for disaster health. Copyright © 2013 College of Emergency Nursing Australasia Ltd. Published by Elsevier Ltd. All rights reserved.
Liddy, Clare; Keely, Erin; Afkham, Amir; Kurzawa, Julia; Abdeen, Nishard; Audcent, Tobey; Bromwich, Matthew; Brophy, Jason; Carsen, Sasha; Fournier, Annick; Fraser-Roberts, Leigh; Gandy, Hazen; Hui, Charles; Johnston, Donna; Keely, Kathryn; Kontio, Ken; Lamontagne, Christine; Major, Nathalie; O’Connor, Michael; Radhakrishnan, Dhenuka; Reisman, Joe; Robb, Marjorie; Samson, Lindy; Sell, Erick; Splinter, William; van Stralen, Judy; Venkateswaran, Sunita; Murto, Kimmo
2018-01-01
Background Champlain BASE™ (Building Access to Specialists through eConsultation) is a web-based asynchronous electronic communication service that allows primary-care- practitioners (PCPs) to submit “elective” clinical questions to a specialist. For adults, PCPs have reported improved access and timeliness to specialist advice, averted face-to-face specialist referrals in up to 40% of cases and high provider satisfaction. Objective To determine whether the expansion of eConsult to a pediatric setting would result in similar measures of improved healthcare system process and high provider acceptance reported in adults. Design Prospective observational cohort study. Setting Single Canadian tertiary-care academic pediatric hospital (June 2014–16) servicing 1.2 million people. Participants 1. PCPs already using eConsult. 2.Volunteer pediatric specialists provided services in addition to their regular workload. 3.Pediatric patients (< 18 years-old) referred for none-acute care conditions. Main outcomes and measures Specialty service utilization and access, impact on PCP course-of-action and referral-patterns and survey-based provider satisfaction data were collected. Results 1064 eConsult requests from 367 PCPs were answered by 23 pediatric specialists representing 14 specialty-services. The top three specialties represented were: General Pediatrics 393 cases (36.9%), Orthopedics 162 (15.2%) and Psychiatry 123 (11.6%). Median specialist response time was 0.9 days (range <1 hour-27 days), most consults (63.2%) required <10minutes to complete and 21/21(100%) specialist survey-respondents reported minimal workload burden. For 515/1064(48.4%) referrals, PCPs received advice for a new or additional course of action; 391/1064(36.7%) referrals resulted in an averted face-to-face specialist visit. In 9 specialties with complete data, the median wait-time was significantly less (p<0.001) for an eConsult (1 day, 95%CI:0.9–1.2) compared with a face-to-face referral (132 days; 95%CI:127–136). The majority (>93.3%) of PCPs rated eConsult as very good/excellent value for both patients and themselves. All specialist survey-respondents indicated eConsult should be a continued service. Conclusions and relevance Similar to adults, eConsult improves PCP access and timeliness to elective pediatric specialist advice and influences their care decisions, while reporting high end-user satisfaction. Further study is warranted to assess impact on resource utilization and clinical outcomes. PMID:29320539
Kallam, Brianne; Pettitt-Schieber, Christie; Owen, Medge; Agyare Asante, Rebecca; Darko, Elizabeth; Ramaswamy, Rohit
2018-05-19
Low-resource clinical settings often face obstacles that challenge the implementation of recommended evidence-based practices (EBPs). Implementation science approaches are useful in identifying barriers and developing strategies to address them. Ridge Regional Hospital (RRH), a tertiary referral hospital in Accra, Ghana experienced a spike in rates of neonatal sepsis and launched a quality improvement (QI) initiative that identified poor adherence to hand hygiene in the neonatal intensive care unit as a potential source of infections. A multi-modal change package of World Health Organization-recommended solutions was created to address this issue. To ensure that the outputs of the QI effort were adopted within the organization, leaders at RRH and Kybele, Inc. used an implementation science framework called the 'Interactive Systems Framework for Dissemination and Implementation' (ISF) to create a package of locally acceptable implementation strategies. The ISF has never been used before to guide implementation in low-resource settings. Hand hygiene compliance rose from 67% to 92% overall, including a 36% increase during the night shifts-a group of healthcare workers with typically very low levels of compliance. The drastic improvement in adherence to hand hygiene suggests the potential value of the joint use of QI and implementation science to promote the creation and application of contextually appropriate EBPs in low-resource settings. Our results also suggest that using an implementation framework such as the ISF could rapidly increase the uptake of other evidence-based interventions in low-resource settings.
Revealing the global map of protein folding space by large-scale simulations
NASA Astrophysics Data System (ADS)
Sinner, Claude; Lutz, Benjamin; Verma, Abhinav; Schug, Alexander
2015-12-01
The full characterization of protein folding is a remarkable long-standing challenge both for experiment and simulation. Working towards a complete understanding of this process, one needs to cover the full diversity of existing folds and identify the general principles driving the process. Here, we want to understand and quantify the diversity in folding routes for a large and representative set of protein topologies covering the full range from all alpha helical topologies towards beta barrels guided by the key question: Does the majority of the observed routes contribute to the folding process or only a particular route? We identified a set of two-state folders among non-homologous proteins with a sequence length of 40-120 residues. For each of these proteins, we ran native-structure based simulations both with homogeneous and heterogeneous contact potentials. For each protein, we simulated dozens of folding transitions in continuous uninterrupted simulations and constructed a large database of kinetic parameters. We investigate folding routes by tracking the formation of tertiary structure interfaces and discuss whether a single specific route exists for a topology or if all routes are equiprobable. These results permit us to characterize the complete folding space for small proteins in terms of folding barrier ΔG‡, number of routes, and the route specificity RT.
Shivalli, Siddharudha; Sowmyashree, H
2015-11-01
Occupational exposure to infection is an important public health concern. Such accidents are associated with a few, but pose significant risk to worker's health, family and the community. 1) To assess the knowledge and attitude of waste handlers regarding healthcare waste management in tertiary care hospital of Mangalore. 2) To assess the occupational risk of exposure to infection in their work setting. A cross-sectional study was conducted among healthcare waste handlers (involved in collection, storage and safe disposal) in a tertiary care hospital of Mangalore, India. A semi-structured and pre-tested proforma was used to assess respondents' knowledge and percentage score was calculated based on a scoring system. Chi square and independent sample t tests were applied to judge the association of study variables with knowledge and occupational risk of infection. A total of 43 healthcare waste handlers participated in the study and all were females. Almost half of them had poor knowledge (< 50% score) about healthcare waste management. As much as 41.8% of them had exposure to healthcare waste and 'needle stick injury' was the most common type. Age, literacy and experience did not significantly (p>0.05) influence the knowledge and occupational risk of infection. Respondents' knowledge regarding healthcare waste management was unsatisfactory. They were at high risk of occupational exposure to infection. It emphasizes the need of refresher training and reinforcement of personal protection measures in their work setting. © Journal of the Association of Physicians of India 2011.
Medication Adherence in Kidney Transplant Recipients in an Urban Indian Setting
Adhikari, U. R.; Taraphder, A.; Hazra, A.; Das, T.
2017-01-01
Medication nonadherence is a known problem after renal transplantation and can vary from one setting to another. Since it can lead to negative outcomes, it is important to develop intervention strategies to enhance adherence in a given setting using determinants identified through exploratory studies. We explored nonadherence in renal transplant recipients. A longitudinal survey was done with adult renal transplant recipients at a tertiary care public and two private hospitals of Kolkata. Subjects were followed-up for 1 year. After screening for medication adherence status by the four-item Morisky Medication Adherence Scale, those admitting to potential nonadherence were probed further. A patient was deemed to be nonadherent if failing to take medicines on appointed time (doses missed or delayed by more than 2 h) more than three times in any month during the observation period. A pretested questionnaire was used to explore potential determinants of nonadherence. Data of 153 patients recruited over a 2-year were analyzed. The extent of nonadherence with immunosuppressant regimens was about 31% overall; 44% in the public sector and 19% in the private sector (P < 0.001). Nonadherence with other medication was around 19% in both the sectors. Several potential demographic, socioeconomic and psychosocial determinants of nonadherence were identified on univariate analysis. However, logistic regression analysis singled out only the economic status. This study had updated the issue of nonadherence in renal transplant recipients in the Indian setting. Strategies to improve medication adherence can be planned by relevant stakeholders on the basis of these findings. PMID:28761232
Self Assessment and Student-Centred Learning
ERIC Educational Resources Information Center
McDonald, Betty
2012-01-01
This paper seeks to show how self assessment facilitates student-centred learning (SCL) and fills a gap in the literature. Two groups of students were selected from a single class in a tertiary educational institution. The control group of 25 was selected randomly by the tossing of an unbiased coin (heads = control group). They were trained in the…
NASA Astrophysics Data System (ADS)
Petrasso, Richard D.
1997-01-01
Tertiary protons with birth energies from ˜27 to 30.8 MeV result from the implosion of ignition-scale inertial confinement fusion targets, such as those planned for the National Ignition Facility (NIF). Measurement of the tertiaries' slowing can provide a determination of the imploded areal density of the fuel capsule, as well as implosion asymmetry that results from anisotropy of the areal density and plasma temperature. In order to determine the utility of tertiaries for all phases of the NIF, we analyze three representative cases: a gas capsule (0.7 kJ yield); a cryogenic fuel capsule that fails to ignite (15 kJ); and a cryogenic fuel capsule that ignites and burns (13 000 kJ). In each case, tertiaries escape from the capsule and convey critical information about implosion dynamics. In addition, we show that for some gas-capsule implosions anticipated on OMEGA, tertiaries may be the only species of energetic charged particles that can determine the fuel areal density. Presently, we are building a charge-coupled device (CCD)-based charged particle spectrometer for OMEGA and for NOVA. In addition to the tertiaries, the spectrometers are sensitive to a variety of the energetic charged particles, such as knock-on protons, deuterons, and tritons, and 3He-burnup protons. In fact the latter set of charged particles will usually be the dominant signal. We will describe the basic features of the spectrometers and the measured response of the CCDs to 1-5 MeV protons, 1-5 MeV alphas, and 14 MeV neutrons (and associated gammas), the latter constitute the principal source of noise. This work is done in collaboration with C. K. Li, D. Hicks, and F. Seguin of MIT; with B. Burke of LL/MIT; with M. Cable, S. Pollaine, S. Haan, T. Bernat, T. Phillips, and J. Kilkenny of LLNL; with J, Knauer, S. Cremer, C. Verdon, and B. Kremens of University of Rochester; and with C. Ruiz and R. Leeper of SNL. This work is supported in part by LLNL Subcontract B313875 and University of Rochester Subcontract 410025-G.
Medical tourism in India: perceptions of physicians in tertiary care hospitals.
Qadeer, Imrana; Reddy, Sunita
2013-12-17
Senior physicians of modern medicine in India play a key role in shaping policies and public opinion and institutional management. This paper explores their perceptions of medical tourism (MT) within India which is a complex process involving international demands and policy shifts from service to commercialisation of health care for trade, gross domestic profit, and foreign exchange. Through interviews of 91 physicians in tertiary care hospitals in three cities of India, this paper explores four areas of concern: their understanding of MT, their views of the hospitals they work in, perceptions of the value and place of MT in their hospital and their views on the implications of MT for medical care in the country. An overwhelming majority (90%) of physicians in the private tertiary sector and 74.3 percent in the public tertiary sector see huge scope for MT in the private tertiary sector in India. The private tertiary sector physicians were concerned about their patients alone and felt that health of the poor was the responsibility of the state. The public tertiary sector physicians' however, were sensitive to the problems of the common man and felt responsible. Even though the glamour of hi-tech associated with MT dazzled them, only 35.8 percent wanted MT in their hospitals and a total of 56 percent of them said MT cannot be a public sector priority. 10 percent in the private sector expressed reservations towards MT while the rest demanded state subsidies for MT. The disconnect between their concern for the common man and professionals views on MT was due to the lack of appreciation of the continuum between commercialisation, the denial of resources to public hospitals and shift of subsidies to the private sector. The paper highlights the differences and similarities in the perceptions and context of the two sets of physicians, presents evidence, that questions the support for MT and finally analyzes some key implications of MT on Indian health services, ethical issues emerging out of that and the need for understanding the linkages between public and private sectors for a more effective intervention for an equitable medical care policy.
Medical tourism in india: perceptions of physicians in tertiary care hospitals
2013-01-01
Senior physicians of modern medicine in India play a key role in shaping policies and public opinion and institutional management. This paper explores their perceptions of medical tourism (MT) within India which is a complex process involving international demands and policy shifts from service to commercialisation of health care for trade, gross domestic profit, and foreign exchange. Through interviews of 91 physicians in tertiary care hospitals in three cities of India, this paper explores four areas of concern: their understanding of MT, their views of the hospitals they work in, perceptions of the value and place of MT in their hospital and their views on the implications of MT for medical care in the country. An overwhelming majority (90%) of physicians in the private tertiary sector and 74.3 percent in the public tertiary sector see huge scope for MT in the private tertiary sector in India. The private tertiary sector physicians were concerned about their patients alone and felt that health of the poor was the responsibility of the state. The public tertiary sector physicians’ however, were sensitive to the problems of the common man and felt responsible. Even though the glamour of hi-tech associated with MT dazzled them, only 35.8 percent wanted MT in their hospitals and a total of 56 percent of them said MT cannot be a public sector priority. 10 percent in the private sector expressed reservations towards MT while the rest demanded state subsidies for MT. The disconnect between their concern for the common man and professionals views on MT was due to the lack of appreciation of the continuum between commercialisation, the denial of resources to public hospitals and shift of subsidies to the private sector. The paper highlights the differences and similarities in the perceptions and context of the two sets of physicians, presents evidence, that questions the support for MT and finally analyzes some key implications of MT on Indian health services, ethical issues emerging out of that and the need for understanding the linkages between public and private sectors for a more effective intervention for an equitable medical care policy. PMID:24345280
Unpredictable Feelings: Academic Women under Research Audit
ERIC Educational Resources Information Center
Grant, Barbara M.; Elizabeth, Vivienne
2015-01-01
Academic research is subject to audit in many national settings. In Aotearoa/New Zealand, the government regulates the flow of publicly funded research income into tertiary institutions through the Performance-Based Research Fund (PBRF). This article enquires into the effects of the PBRF by exploring data collected from 16 academic women of…
Chinese Students' Perception of Out-of-Class Groupwork in Australia
ERIC Educational Resources Information Center
Li, Dongmei; Remedios, Louisa; Clarke, David
2010-01-01
Despite increasing number of mainland Chinese students studying in western tertiary settings, there is limited information available on their learning experiences and responses to popular educational practices in these contexts. There is an assumption in the literature that Chinese students respond well to the collaborative demands of groupwork…
The Quest for Powerful Learning Environments in Higher Education
ERIC Educational Resources Information Center
Slabbert, J. A.; Gouws, D. G.
2006-01-01
An introductory course in on tertiary level inadvertently sets the scene for the demands of the corresponding profession. Unfortunately, it seems as though these courses do not prepare learners adequately to acquire the demanding professional competences required for professional success. This problem has been a subject of contention especially in…
Self-Employment among Italian Female Graduates
ERIC Educational Resources Information Center
Rosti, Luisa; Chelli, Francesco
2009-01-01
Purpose: The purpose of this paper is to investigate the gender impact of tertiary education on the probability of entering and remaining in self-employment. Design/methodology/approach: A data set on labour market flows produced by the Italian National Statistical Office is exploited by interviewing about 62,000 graduate and non-graduate…
Calculus Students' and Instructors' Conceptualizations of Slope: A Comparison across Academic Levels
ERIC Educational Resources Information Center
Nagle, Courtney; Moore-Russo, Deborah; Viglietti, Janine; Martin, Kristi
2013-01-01
This study considers tertiary calculus students' and instructors' conceptualizations of slope. Qualitative techniques were employed to classify responses to 5 items using conceptualizations of slope identified across various research settings. Students' responses suggest that they rely on procedurally based conceptualizations of…
Predictive Role of Personality Traits on Internet Addiction
ERIC Educational Resources Information Center
Celik, Serkan; Atak, Hasan; Basal, Ahmet
2012-01-01
Aiming to develop a model seeking to investigate the direct effects of personality types on internet addiction, this study was set and tested on tertiary level students receiving education within two learning modes: face to face and distance education. The participants of the study, selected through maximum variety method within purposive…
ERIC Educational Resources Information Center
Yorke, Nada J.; Friedman, Bruce D.; Hurt, Pat
2010-01-01
This study discusses the pretest and posttest results of a batterer's intervention program (BIP) implemented within a California state prison substance abuse program (SAP), with a recommendation for further programs to be implemented within correctional institutions. The efficacy of utilizing correctional facilities to reach offenders who…
Social Ecology as Innovative Tertiary Environmental Education.
ERIC Educational Resources Information Center
White, Lesley
1992-01-01
This paper explains the origin of the University of West Sidney's Bachelor of Applied Science in Social Ecology degree, and describes underlying philosophical framework, the major course organizing principles, and the proposed structure of the course. Highlights the problematic nature of setting up a dialectical, nondisciplinary-based program.…
Downey, Christopher D.; Fiore, Julie L.; Stoddard, Colby D.; Hodak, Jose H.; Nesbitt, David J.; Pardi, Arthur
2008-01-01
The GAAA tetraloop-receptor is a commonly occurring tertiary interaction motif in RNA. This motif usually occurs in combination with other tertiary interactions in complex RNA structures. Thus, it is difficult to measure directly the contribution that a single GAAA tetraloop-receptor interaction makes to the folding properties of an RNA. To investigate the kinetics and thermodynamics for the isolated interaction, a GAAA tetraloop domain and receptor domain were connected by a single-stranded A7 linker. Fluorescence resonance energy transfer (FRET) experiments were used to probe intramolecular docking of the GAAA tetraloop and receptor. Docking was induced using a variety of metal ions, where the charge of the ion was the most important factor in determining the concentration of the ion required to promote docking ([Co(NH3)63+] ≪ [Ca2+], [Mg2+], [Mn2+] ≪ [Na+], [K+]). Analysis of metal ion cooperativity yielded Hill coefficients of ≈ 2 for Na+- or K+-dependent docking versus ≈ 1 for the divalent ions and Co(NH3)63+. Ensemble stopped-flow FRET kinetic measurements yielded an apparent activation energy of 12.7 kcal/mol for GAAA tetraloop-receptor docking. RNA constructs with U7 and A14 single-stranded linkers were investigated by single-molecule and ensemble FRET techniques to determine how linker length and composition affect docking. These studies showed that the single-stranded region functions primarily as a flexible tether. Inhibition of docking by oligonucleotides complementary to the linker was also investigated. The influence of flexible versus rigid linkers on GAAA tetraloop-receptor docking is discussed. PMID:16533049
Precut cornea for Descemet's stripping endothelial keratoplasty: experience at a single eye bank.
Mohamed, Ashik; Chaurasia, Sunita; Chandragiri, Venkataswamy; Kandhibanda, Srinivas; Gunnam, Srinivas; Garg, Prashant
2017-06-01
The aim of the study is to describe the experience with precut facility for endothelial keratoplasty at a single eye bank affiliated to a tertiary eye care center in India. Data on precut tissues from Nov 2012 to Dec 2014 were retrospectively reviewed from the electronic database of the eye bank of a tertiary eye care center in South India. Donor characteristic data including donor age, precut and postcut endothelial cell density (ECD), recipient age, and thickness of graft were collected. The number of precuts increased from 42 in 2012 (Nov and Dec) and 422 in 2013 to 584 in 2014. Of the total of 1048 precuts, seven (0.67 %) were miscut and could not be utilized for transplants. The donor age ranged from 2 to 89 years. A mean change of 43.6 ± 325.2 cells/mm 2 in ECD was noted after cut, proportional increase in mean being 1.9 %. The change in ECD after cut was negatively correlated with ECD before cut. The recipient age ranged from 1 to 89 years. The median thickness of donor lenticule after cut was 148 µm (interquartile range 131-166 µm). Analysis of precut donor corneas from a single eye bank shows that the ECD of the processed tissues was excellent for transplantation. The tissue wastage in the hands of eye bank personal was minimal.
NASA Astrophysics Data System (ADS)
Craddock, John P.; Kennedy, Bryan C.; Cook, Avery L.; Pawlisch, Melissa S.; Johnston, Stephen T.; Jackson, Mike
2008-02-01
Mafic dykes of different ages were collected from three different tectonic settings and analyzed using anisotropy of magnetic susceptibility (AMS) as a proxy for magmatic flow during intrusion. In Iceland, ridge-parallel basaltic dykes were sampled on each side of the active tectonic boundary. The dykes are < 10 m wide along a 1-2 km strike, and are the result of a single intrusion from 1-2 km deep magma chambers in oceanic crust. Thirteen samples were collected (7 N. American plate; 6 European) and 153 cores were analyzed by AMS and preserve a vertical Kmax orientation indicating vertical emplacement. The Eocene Aishihik dyke swarm intrudes the Yukon-Tanana terrane in the Yukon province, Canada over an area ~ 200 by 60 km. These dykes were intruded normal to the accretionary margin, are porphyritic andesites, and have an intermediate geochemical signature based on major and trace element analyses. Ten dykes were sampled and 111 cores analyzed using AMS, and the dykes preserve a vertical Kmax orientation, indicating intrusion was vertical through ~ 30 km of continental crust. The 2.06 Ga Kenora-Kabetogama dykes in northern Minnesota and western Ontario crosscut a variety of Archean terranes (thickness ~ 50 km) in a radiating pattern. The unmetamorphosed basaltic dykes are 1-120 m wide, 10-110 km in length, are vertical in orientation and can be grouped as either being single intrusion or multiple intrusion (composite) dykes. AMS data preserve a vertical Kmax orientation for the southerly locations (2 dykes, n = 53) and horizontal Kmax for the remainder to the northwest (15 dykes, n = 194). Maximum magnetic susceptibility axes (4 dykes, n = 92) for composite dykes are scattered and yield inconsistent flow directions with regard to the dyke margin. Almost all of our results are "normal" in that, the magnetic foliation (the plane containing Kmax and Kint, normal to Kmin) is parallel to the dyke planes, which gives us confidence that the magnetic lineations (i.e., Kmax orientations) are parallel to magmatic flow.
Freitas, Isabela Ribeiro; Castro, Marta; Sarmento, Sofia Lourenço; Moura, Cláudia; Viana, Victor; Areias, José Carlos; Areias, Maria Emília Guimarães
2013-01-01
Objectives Our purpose was to study psychosocial adjustment and psychiatric morbidity of adolescents and young adults with congenital heart disease (CHD). Design All assessment measures were obtained on a single occasion. Clinical data was obtained through the patient's clinical records. Setting A teaching and tertiary care facility in Porto, Portugal. Participants We evaluated 110 CHD patients (62 male) aged from 12 to 26 years (mean=18.00±3.617), 58 cyanotic. All assessment measures were obtained on a single occasion in a tertiary hospital. Demographic information and clinical history were collected. Primary and secondary outcome measures Questionnaires regarded topics such as social support, family educational style, self-image and physical limitations, a standardised psychiatric interview Schedule for Affective Disorders and Schizophrenia—Lifetime version (SADS-L), and a self-report questionnaire on psychosocial adjustment, youth self-report or adult self-report. One of the relatives completed an observational version of the same questionnaire (child behaviour checklist (CBCL) or ABCL (adult behaviour checklist)). Results We found a 21.8% lifetime prevalence of psychopathology, 31.3%, in females, 14.5% in males, showing a somewhat increased proneness in CHD patients. Females also showed worse psychosocial adjustment, with more somatic complaints (u=260 000; p=0.011), anxiety/depression (u=984 000; p=0.002), aggressive behaviour (u=920 500; p=0.001), attention problems (u=1123 500; p=0.027), thought problems (u=1069 500; p=0.010), internalisation (u=869 000; p=0.0) and externalisation (u=1163 000; p=0.05). Patients with severe CHD (u=939 000; p=0.03) and surgical repair (u=719 000; p=0.037) showed worse psychosocial adjustment. Those with poor social support showed more withdrawal (u=557 500; p=0.0) and social problems (u=748 500; p=0.023), and patients with unsatisfactory school performance revealed more anxiety/depression (u=916 000; p=0.02) and attention problems (u=861 500; p=0.007). Conclusions CHD males with good social support and good academic performance have a better psychosocial adjustment. PMID:23358561
Dembkowski, D.J.; Miranda, L.E.
2012-01-01
River-floodplain ecosystems offer some of the most diverse and dynamic environments in the world. Accordingly, floodplain habitats harbor diverse fish assemblages. Fish biodiversity in floodplain lakes may be influenced by multiple variables operating on disparate scales, and these variables may exhibit a hierarchical organization depending on whether one variable governs another. In this study, we examined the interaction between primary variables descriptive of floodplain lake large-scale features, suites of secondary variables descriptive of water quality and primary productivity, and a set of tertiary variables descriptive of fish biodiversity across a range of floodplain lakes in the Mississippi Alluvial Valley of Mississippi and Arkansas (USA). Lakes varied considerably in their representation of primary, secondary, and tertiary variables. Multivariate direct gradient analyses indicated that lake maximum depth and the percentage of agricultural land surrounding a lake were the most important factors controlling variation in suites of secondary and tertiary variables, followed to a lesser extent by lake surface area. Fish biodiversity was generally greatest in large, deep lakes with lower proportions of watershed agricultural land. Our results may help foster a holistic approach to floodplain lake management and suggest the framework for a feedback model wherein primary variables can be manipulated for conservation and restoration purposes and secondary and tertiary variables can be used to monitor the success of such efforts. ?? 2011 Springer Science+Business Media B.V.
Factors affecting fish biodiversity in floodplain lakes of the Mississippi Alluvial Valley
Miranda, Leandro E.; Dembkowski, Daniel J.
2012-01-01
River-floodplain ecosystems offer some of the most diverse and dynamic environments in the world. Accordingly, floodplain habitats harbor diverse fish assemblages. Fish biodiversity in floodplain lakes may be influenced by multiple variables operating on disparate scales, and these variables may exhibit a hierarchical organization depending on whether one variable governs another. In this study, we examined the interaction between primary variables descriptive of floodplain lake large-scale features, suites of secondary variables descriptive of water quality and primary productivity, and a set of tertiary variables descriptive of fish biodiversity across a range of floodplain lakes in the Mississippi Alluvial Valley of Mississippi and Arkansas (USA). Lakes varied considerably in their representation of primary, secondary, and tertiary variables. Multivariate direct gradient analyses indicated that lake maximum depth and the percentage of agricultural land surrounding a lake were the most important factors controlling variation in suites of secondary and tertiary variables, followed to a lesser extent by lake surface area. Fish biodiversity was generally greatest in large, deep lakes with lower proportions of watershed agricultural land. Our results may help foster a holistic approach to floodplain lake management and suggest the framework for a feedback model wherein primary variables can be manipulated for conservation and restoration purposes and secondary and tertiary variables can be used to monitor the success of such efforts.
NASA Technical Reports Server (NTRS)
Bechtold, I. C.; Liggett, M. A.; Childs, J. F.
1973-01-01
Research based on ERTS-1 MSS imagery and field work in the southern Basin-Range Province of California, Nevada and Arizona has shown regional tectonic control of volcanism, plutonism, mineralization and faulting. This paper covers an area centered on the Colorado River between 34 15' N and 36 45' N. During the mid-Tertiary, the area was the site of plutonism and genetically related volcanism fed by fissure systems now exposed as dike swarms. Dikes, elongate plutons, and coeval normal faults trend generally northward and are believed to have resulted from east-west crustal extension. In the extensional province, gold silver mineralization is closely related to Tertiary igneous activity. Similarities in ore, structural setting, and rock types define a metallogenic district of high potential for exploration. The ERTS imagery also provides a basis for regional inventory of small faults which cut alluvium. This capability for efficient regional surveys of Recent faulting should be considered in land use planning, geologic hazards study, civil engineering and hydrology.
A case study of pedagogy of mathematics support tutors without a background in mathematics education
NASA Astrophysics Data System (ADS)
Walsh, Richard
2017-01-01
This study investigates the pedagogical skills and knowledge of three tertiary-level mathematics support tutors in a large group classroom setting. This is achieved through the use of video analysis and a theoretical framework comprising Rowland's Knowledge Quartet and general pedagogical knowledge. The study reports on the findings in relation to these tutors' provision of mathematics support to first and second year undergraduate engineering students and second year undergraduate science students. It was found that tutors are lacking in various pedagogical skills which are needed for high-quality learning amongst service mathematics students (e.g. engineering/science/technology students), a demographic which have low levels of mathematics upon entering university. Tutors teach their support classes in a very fast didactic way with minimal opportunities for students to ask questions or to attempt problems. It was also found that this teaching method is even more so exaggerated in mandatory departmental mathematics tutorials that students take as part of their mathematics studies at tertiary level. The implications of the findings on mathematics tutor training at tertiary level are also discussed.
Tringali, Andrea; Lemmers, Arnaud; Meves, Volker; Terheggen, Grischa; Pohl, Jürgen; Manfredi, Guido; Häfner, Michael; Costamagna, Guido; Devière, Jacques; Neuhaus, Horst; Caillol, Fabrice; Giovannini, Marc; Hassan, Cesare; Dumonceau, Jean-Marc
2015-08-01
This technology review expresses the current view of the European Society of Gastrointestinal Endoscopy (ESGE) on the available techniques for intraductal biliopancreatic imaging. The three cholangioscopy techniques are described: the "dual-operator" and " single-operator" mother-baby approaches using dedicated instruments, and the "direct" technique using currently available ultrathin gastroscopes. The mother-baby method is standardized and reproducible, while direct cholangioscopy is technically demanding and its safety requires further evaluation. As well as direct visualization of the bile ducts, cholangioscopy has the further advantage of allowing targeted biopsy. Image quality is still suboptimal for single-operator cholangioscopy, while the other techniques have achieved adequately detailed imaging. The costs of mother-baby cholangioscopy are high and its application in clinical practice should be restricted to selected cases (i.e. indeterminate biliary strictures/intraluminal lesions, difficult biliary stones) and to the setting of tertiary care centers. Peroral pancreatoscopy may find an indication in situations where other imaging modalities (mainly EUS) are inconclusive (i.e. delineation of main duct intraductal papillary mucinous neoplasia extension, sampling of indeterminate main pancreatic duct strictures). Intraductal ultrasonography (IDUS) has a poorer performance than EUS in the staging of pancreatic malignancies and can increase the risk of pancreatitis. A promising indication for IDUS could be the evaluation of indeterminate biliary strictures and ampullary tumors. Probe-based confocal laser endomicroscopy (pCLE) of the bile ducts is a difficult and expensive technique. Appropriate training needs to be established, since interpretation of images is challenging. pCLE can be an important diagnostic tool in the setting of indeterminate biliary strictures. © Georg Thieme Verlag KG Stuttgart · New York.
New Mexico structural zone - An analogue of the Colorado mineral belt
Sims, P.K.; Stein, H.J.; Finn, C.A.
2002-01-01
Updated aeromagnetic maps of New Mexico together with current knowledge of the basement geology in the northern part of the state (Sangre de Cristo and Sandia-Manzano Mountains)-where basement rocks were exposed in Precambrian-cored uplifts-indicate that the northeast-trending Proterozoic shear zones that controlled localization of ore deposits in the Colorado mineral belt extend laterally into New Mexico. The shear zones in New Mexico coincide spatially with known epigenetic precious- and base-metal ore deposits; thus, the mineralized belts in the two states share a common inherited basement tectonic setting. Reactivation of the basement structures in Late Cretaceous-Eocene and Mid-Tertiary times provided zones of weakness for emplacement of magmas and conduits for ore-forming solutions. Ore deposits in the Colorado mineral belt are of both Late Cretaceous-Eocene and Mid-Tertiary age; those in New Mexico are predominantly Mid-Tertiary in age, but include Late Cretaceous porphyry-copper deposits in southwestern New Mexico. The mineralized belt in New Mexico, named the New Mexico structural zone, is 250-km wide. The northwest boundary is the Jemez subzone (or the approximately equivalent Globe belt), and the southeastern boundary was approximately marked by the Santa Rita belt. Three groups (subzones) of mineral deposits characterize the structural zone: (1) Mid-Tertiary porphyry molybdenite and alkaline-precious-metal deposits, in the northeast segment of the Jemez zone; (2) Mid-Tertiary epithermal precious-metal deposits in the Tijeras (intermediate) zone; and (3) Late Cretaceous porphyry-copper deposits in the Santa Rita zone. The structural zone was inferred to extend from New Mexico into adjacent Arizona. The structural zone provides favorable sites for exploration, particularly those parts of the Jemez subzone covered by Neogene volcanic and sedimentary rocks. ?? 2002 Published by Elsevier Science B.V.
Alcohol consumption in tertiary education students.
Reavley, Nicola J; Jorm, Anthony F; McCann, Terence V; Lubman, Dan I
2011-07-09
Heavy alcohol consumption among adolescents and young adults is an issue of significant public concern. With approximately 50% of young people aged 18-24 attending tertiary education, there is an opportunity within these settings to implement programs that target risky drinking. The aim of the current study was to survey students and staff within a tertiary education institution to investigate patterns of alcohol use, alcohol-related problems, knowledge of current National Health and Medical Research Council (NHMRC) guidelines for alcohol consumption and intentions to seek help for alcohol problems. Students of an Australian metropolitan university (with staff as a comparison group) participated in a telephone interview. Questions related to knowledge of NHMRC guidelines, drinking behaviour, alcohol-related problems and help-seeking intentions for alcohol problems. Level of psychological distress was also assessed. Of the completed interviews, 774 (65%) were students and 422 (35%) were staff. While staff were more likely to drink regularly, students were more likely to drink heavily. Alcohol consumption was significantly higher in students, in males and in those with a history of earlier onset drinking. In most cases, alcohol-related problems were more likely to occur in students. The majority of students and staff had accurate knowledge of the current NHMRC guidelines, but this was not associated with lower levels of risky drinking. Psychological distress was associated with patterns of risky drinking in students. Our findings are consistent with previous studies of tertiary student populations, and highlight the disconnect between knowledge of relevant guidelines and actual behaviour. There is a clear need for interventions within tertiary education institutions that promote more effective means of coping with psychological distress and improve help-seeking for alcohol problems, particularly among young men.
Halitosis amongst students in tertiary institutions in Lagos state.
Arinola, J E; Olukoju, O O
2012-12-01
Halitosis is defined as a noticeable unpleasant odor from the mouth. It is a medico-social problem that affects a significant number of people around the world. Research reveals that nearly 50% of the adult population has halitosis. To determine level of awareness of halitosis and prevalence of the condition amongst students in tertiary institutions as a baseline survey. For this project, 100 students from three tertiary institutions in Lagos state were chosen: University of Lagos, Lagos State University, Ojo campus and Yaba College of Technology. A semi-structured questionnaire and practical testing/diagnostic tool were utilized. Data collected was collated and analyzed using Microsoft Excel 2007 and SPSS statistical software. Most of the respondents were single and Christian. Level of awareness of halitosis was high. Results showed that 15%, 2% and 22% from UNILAG, LASU and YCT respectively said they had halitosis. Using the diagnostic tool, 6%, 8% and 2% respectively were positive for halitosis. There is high level of awareness of halitosis among the respondents. The prevalence of the disorder is low, however, it is recommended that enlightenment campaigns be mounted in schools to improve level of awareness and treatment seeking.
NASA Astrophysics Data System (ADS)
Ancipink, Windy; McCoy, John; Clarkson, Caitlyn; Kropka, Jamie; Celina, Mathias; Giron, Nicholas; Hailesilassie, Lebelo; Fredj, Narjes
The curing of a diglycidyl ether of bisphenol-A (DGEBA) epoxy with diethanolamine (DEA) involves a well understood fast amine-epoxide reaction followed by a more complicated slower hydroxyl-epoxide reaction. The time scale of these two reactions are well separated and can be studied independently from one another. The initial amine-epoxide reaction results in a tertiary amine adduct which is a product of the direct reaction of a secondary amine from the DEA reacting with a single DGEBA epoxide. The second hydroxyl-epoxide reaction results in a highly crosslinked glassy epoxy resin. The deviation in the mechanisms between high and low temperatures are discerned through the use of differential scanning calorimetry (DSC), infrared spectroscopy (IR), and isothermal microcalorimetry (IMC) data. Observations of reaction rates at temperatures ranging from 30° C to 110° C have led to the determination that the hydroxyl-epoxide reaction is temperature sensitive. The hydroxyl-epoxide reaction occurs through two different mechanisms: at low temperatures, the reaction is catalyzed by the tertiary amine adduct; at higher temperatures, the reaction does not appear to be catalyzed. Sandia National Laboratories, Albuquerque, NM.
ERIC Educational Resources Information Center
Cheung, Lewis Ting On; Fok, Lincoln; Gou, Gloria Rui
2016-01-01
The Hong Kong education system has undergone a dramatic change in its secondary and tertiary level of education. A single public examination for senior secondary education namely Hong Kong Diploma of Secondary Education (HKDSE) was adopted to replace two previously used examinations in 2012. As a result, all higher education institutes in Hong…
ERIC Educational Resources Information Center
Dune, Tinashe; Bidewell, John; Firdaus, Rubab; Kirwan, Morwenna
2016-01-01
Bringing popular culture to tertiary education can potentially increase student engagement with learning tasks and content, especially when the learning task has students producing the content. Using a single-group intervention plus post-test design, this study implemented and evaluated a purposely developed learning and teaching innovation…
From Romance to Rocket Science: Speed Dating in Higher Education
ERIC Educational Resources Information Center
Muurlink, Olav; Poyatos Matas, Cristina
2011-01-01
This article is the first comprehensive review of speed dating in the tertiary sector. While speed dating has its origins as a networking technique to connect singles, it has only more recently made its way into the academy. Since 2005 universities world-wide have begun to adopt speed dating protocols as a tool for building research culture. An…
Causes of prolonged jaundice in infancy: 3-year experience in a tertiary paediatric centre.
Andre, Margaret; Day, Andrew S
2016-01-29
Although prolonged jaundice (PJ) commonly occurs in infancy, there is not yet agreement as to the appropriate extent of investigations, particularly in otherwise well children. Significant pathologies may present with PJ in this age group and need to be considered. The aim of this retrospective study was to ascertain the causes of PJ in infants referred to a single tertiary paediatric centre. Infants referred with PJ over a 3-year period were identified. Clinical documentation, electronic notes and results of investigations performed prior to and after referral were reviewed. One hundred and sixty-seven infants with PJ were seen. Fifty-eight percent were over 28 days of age. Four patients had conjugated hyperbilirubinaemia. Eighteen percent of patients were found to have a specific medical diagnosis causing or contributing to PJ, almost half of whom had normal clinical examination. The single most common pathological cause for PJ was hypothyroidism found in six patients. This study demonstrates that normal clinical examination and exclusion of conjugated hyperbilirubinaemia are insufficient to exclude pathological causes of PJ. Overall, these children were referred late. Guidelines, in conjunction with education initiatives, are required to optimise the management of prolonged jaundice in infancy.
Reflections and New Directions
ERIC Educational Resources Information Center
Black, Paul; McCormick, Robert
2010-01-01
In introducing the articles in this issue, Black and McCormick are struck by two features. The first is that they comprise a rich set of resources for stimulating further thinking about tertiary education. The second, which follows from the first, is that they raise possibilities for further development of this field. They draw attention, in…
E-learning Constructive Role Plays for EFL Learners in China's Tertiary Education
ERIC Educational Resources Information Center
Shen, Lin; Suwanthep, Jitpanat
2011-01-01
Recently, speaking has played an increasingly important role in second/foreign language settings. However, in many Chinese universities, EFL students rarely communicate in English with other people effectively. The existing behavioristic role plays on New Horizon College English (NHCE) e-learning do not function successfully in supplementing EFL…
ERIC Educational Resources Information Center
Wright, Hazel A.; Ironside, Joseph E.; Gwynn-Jones, Dylan
2008-01-01
Purpose: This study aims to identify the current barriers to sustainability in the bioscience laboratory setting and to determine which mechanisms are likely to increase sustainable behaviours in this specialised environment. Design/methodology/approach: The study gathers qualitative data from a sample of laboratory researchers presently…
New Technology, Changing Pedagogies? Exploring the Concept of Remote Teaching Placement Supervision
ERIC Educational Resources Information Center
Chilton, Helen; McCracken, Wendy
2017-01-01
Mobile technologies continue to have a growing influence on contemporary society, are becoming more commonplace within tertiary educational settings and hold the potential to impact on the learning process. This project evaluation considers the perspectives of participants who trialled the use of new technology to enable remote supervision and…
ERIC Educational Resources Information Center
Gan, Chin Lay; Balakrishnan, Vimala
2017-01-01
The current study sets out to identify determinants affecting tertiary students' behavioural intentions to use mobile technology in lectures. The study emphasises that the reason for using mobile technology in classrooms with large numbers of students is to facilitate interactions among students and lecturers. The proposed conceptual framework has…
ICT in EMI Programmes at Tertiary Level in Spain: A Holistic Model
ERIC Educational Resources Information Center
Hernandez-Nanclares, Nuria; Jimenez-Munoz, Antonio
2016-01-01
The European Higher Education Area (EHEA) in Spain has increased the number of degrees taught through English, although secondary schools do not ensure an appropriate set of linguistic skills for bilingual degrees. A holistic, accountable model for Information and Communications Technology (ICT)-supported learning can give students the adequate…
ERIC Educational Resources Information Center
Katz, M.; Adar Levine, A.; Kol-Degani, H.; Kav-Venaki, L.
2010-01-01
Objective: Evaluation of the efficacy of a patented, compound herbal preparation (CHP) in improving attention, cognition, and impulse control in children with ADHD. Method: Design: A randomized, double-blind, placebo-controlled trial. Setting: University-affiliated tertiary medical center. Participants: 120 children newly diagnosed with ADHD,…
Tertiary Education in Australia: Part II
ERIC Educational Resources Information Center
Berends, Willem
2012-01-01
Australia has no Christian universities or Christian liberal arts colleges other than Australian Catholic University, which has six campuses in five cities. This paper examines one long-term attempt to set up such an institution, which ended in the project being abandoned for lack of progress. Some likely reasons for failure are identified in the…
Profiles of Opportunities to Learn for TEDS-M Future Secondary Mathematics Teachers
ERIC Educational Resources Information Center
Wang, Ting-Ying; Tang, Shu-Jyh
2013-01-01
This study used the data set from the Teacher Education and Development Study in Mathematics to identify the profiles of opportunities to learn (OTL) regarding topics studied in teacher preparation programs by future secondary mathematics teachers from 15 participating countries. The topics of inquiry covered tertiary-level mathematics,…
The Challenge of Writing Remediation: Can Composition Research Inform Higher Education Policy?
ERIC Educational Resources Information Center
Relles, Stefani R.; Tierney, William G.
2013-01-01
Background/Context: This article presents a review of research relevant to postsecondary writing remediation. The purpose of the review is to assess empirical support for policy aimed at improving the degree completion rates of students who arrive at tertiary settings underprepared to write. Purpose/Objective/Research Question/Focus of Study: Our…
Torane, V; Kuyare, S; Nataraj, G; Mehta, P; Dutta, S; Sarkar, B
2016-01-01
Objectives Cholera is a major gastroenteric disease with reports on fluctuation and resistance. Hence, the objective is to determine the trend in seasonality, resistance pattern, prevalent biotypes, serotypes and phage types between 2004 and 2013 among Vibrio cholerae isolates. Design A retrospective cross-sectional study. Settings A single-centre study was carried out at a tertiary care hospital in a metropolitan city (Mumbai) of a developing country (India). Methods Records of stool specimen cultures of patients with suspected cholera from January 2004 to December 2013 were analysed. The organisms were identified as per standard protocol. Antimicrobial susceptibility testing was performed as per Clinical Laboratory Standard Institute. Biotyping, serotyping and phage typing were carried out. From the confirmed cases of cholera, demographic and laboratory details were noted. Descriptive analysis was used and the data were presented in the form of percentages. Results Vibrio cholerae was predominant in males and was isolated from 9.41% (439/4664) of stool specimens. Variability was found in terms of the gross appearance of stool specimens, seasonal trend and antibiotic resistance pattern. The antimicrobial susceptibility showed a waxing and waning pattern for most of the antibiotics (ampicillin, cefuroxime, chloramphenicol, tetracycline) tested, while for a few others the strains were either uniformly sensitive (gentamicin, norfloxacin) or resistant (trimethoprim-sulfamethoxazole, nalidixic acid). All isolates belonged to subgroup O1 and biotype El Tor. The most common serotype was Ogawa. The predominant phage type was T2 (old scheme) and T27 (new scheme). Conclusions The predominant biotype, serotype and phage type were El Tor, Ogawa and T27 phage, respectively. The changing trends in antimicrobial resistance pattern over the years necessitate continued epidemiological and microbiological surveillance of the disease. PMID:27888174
How do repeat suicide attempters differ from first timers? An exploratory record based analysis
Menon, Vikas; Kattimani, Shivanand; Sarkar, Siddharth; Mathan, Kaliaperumal
2016-01-01
Background: Evidence indicates that repeat suicide attempters, as a group, may differ from 1st time attempters. The identification of repeat attempters is a powerful but underutilized clinical variable. Aims: In this research, we aimed to compare individuals with lifetime histories of multiple attempts with 1st time attempters to identify factors predictive of repeat attempts. Setting and Design: This was a retrospective record based study carried out at a teaching cum Tertiary Care Hospital in South India. Methods: Relevant data was extracted from the clinical records of 1st time attempters (n = 362) and repeat attempters (n = 61) presenting to a single Tertiary Care Center over a 4½ year period. They were compared on various sociodemographic and clinical parameters. The clinical measures included Presumptive Stressful Life Events Scale, Beck Hopelessness Scale, Coping Strategies Inventory – Short Form, and the Global Assessment of Functioning Scale. Statistical Analysis Used: First time attempters and repeaters were compared using appropriate inferential statistics. Logistic regression was used to identify independent predictors of repeat attempts. Results: The two groups did not significantly differ on sociodemographic characteristics. Repeat attempters were more likely to have given prior hints about their act (χ2 = 4.500, P = 0.034). In the final regression model, beck hopelessness score emerged as a significant predictor of repeat suicide attempts (odds ratio = 1.064, P = 0.020). Conclusion: Among suicide attempters presenting to the hospital, the presence of hopelessness is a predictor of repeat suicide attempts, independent of clinical depression. This highlights the importance of considering hopelessness in the assessment of suicidality with a view to minimize the risk of future attempts. PMID:26933353
Wu, Johnny C; Gardner, David P; Ozer, Stuart; Gutell, Robin R; Ren, Pengyu
2009-08-28
The accurate prediction of the secondary and tertiary structure of an RNA with different folding algorithms is dependent on several factors, including the energy functions. However, an RNA higher-order structure cannot be predicted accurately from its sequence based on a limited set of energy parameters. The inter- and intramolecular forces between this RNA and other small molecules and macromolecules, in addition to other factors in the cell such as pH, ionic strength, and temperature, influence the complex dynamics associated with transition of a single stranded RNA to its secondary and tertiary structure. Since all of the factors that affect the formation of an RNAs 3D structure cannot be determined experimentally, statistically derived potential energy has been used in the prediction of protein structure. In the current work, we evaluate the statistical free energy of various secondary structure motifs, including base-pair stacks, hairpin loops, and internal loops, using their statistical frequency obtained from the comparative analysis of more than 50,000 RNA sequences stored in the RNA Comparative Analysis Database (rCAD) at the Comparative RNA Web (CRW) Site. Statistical energy was computed from the structural statistics for several datasets. While the statistical energy for a base-pair stack correlates with experimentally derived free energy values, suggesting a Boltzmann-like distribution, variation is observed between different molecules and their location on the phylogenetic tree of life. Our statistical energy values calculated for several structural elements were utilized in the Mfold RNA-folding algorithm. The combined statistical energy values for base-pair stacks, hairpins and internal loop flanks result in a significant improvement in the accuracy of secondary structure prediction; the hairpin flanks contribute the most.
Evaluation of risk factors for vancomycin-induced nephrotoxicity.
Park, So Jin; Lim, Na Ri; Park, Hyo Jung; Yang, Jae Wook; Kim, Min-Ji; Kim, Kyunga; In, Yong Won; Lee, Young Mee
2018-05-09
Background Vancomycin is a glycopeptide antibiotic of choice for the treatment of serious infections caused by multi-resistant Gram-positive bacteria. However, vancomycin-associated nephrotoxicity (VAN) often limits its use. Previous data suggested a few risk factors of VAN, including higher mean vancomycin trough level, higher daily doses, old age, long duration of vancomycin therapy, and concomitant nephrotoxins. Objective To evaluate the incidence and risk factors of VAN and determine whether higher vancomycin trough concentrations were associated with a greater risk for VAN. Settings A retrospective, observational, single-center study at the 1960-bed university-affiliated tertiary care hospital (Samsung Medical Center), Seoul, Korea. Method A retrospective analysis of adult patients who received vancomycin parenterally in a tertiary care medical center from March 1, 2013 to June 30, 2013 was performed. We excluded patients with a baseline serum creatinine level > 2 mg/dL and those who had a history of end-stage renal disease and dialysis at baseline. The clinical characteristics were compared between patients with nephrotoxicity and those without nephrotoxicity to identify the risk factors associated with VAN. Main outcome measure Incidence of VAN and VAN-associated risk factors were analyzed. Results Of the 315 vancomycin-treated patients, nephrotoxicity occurred in 15.2% of the patients. In multivariate analysis, higher vancomycin trough concentrations of > 20 mg∕L (OR 9.57, 95% CI 2.49-36.83, p < 0.01) and intensive care unit (ICU) residence (OR 2.86, 95% CI 1.41-5.82, p < 0.01) were independently associated with VAN. Conclusion Our findings suggest that higher vancomycin trough levels and ICU residence might be associated with a greater risk for VAN. More careful monitoring of vancomycin serum trough levels and patient status might facilitate the timely prevention of VAN.
Fiore, Julie L.; Kraemer, Benedikt; Koberling, Felix; Edmann, Rainer; Nesbitt, David J.
2010-01-01
RNA folding thermodynamics are crucial for structure prediction, which requires characterization of both enthalpic and entropic contributions of tertiary motifs to conformational stability. We explore the temperature dependence of RNA folding due to the ubiquitous GAAA tetraloop–receptor docking interaction, exploiting immobilized and freely diffusing single-molecule fluorescence resonance energy transfer (smFRET) methods. The equilibrium constant for intramolecular docking is obtained as a function of temperature (T = 21–47 °C), from which a van’t Hoff analysis yields the enthalpy (ΔH°) and entropy (ΔS°) of docking. Tetraloop–receptor docking is significantly exothermic and entropically unfavorable in 1 mM MgCl2 and 100 mM NaCl, with excellent agreement between immobilized (ΔH° = −17.4 ± 1.6 kcal/mol, and ΔS° = −56.2 ± 5.4 cal mol−1 K−1) and freely diffusing (ΔH° = −17.2 ± 1.6 kcal/mol, and ΔS° = −55.9 ± 5.2 cal mol−1 K−1) species. Kinetic heterogeneity in the tetraloop–receptor construct is unaffected over the temperature range investigated, indicating a large energy barrier for interconversion between the actively docking and nondocking subpopulations. Formation of the tetraloop–receptor interaction can account for ~60% of the ΔH° and ΔS° of P4–P6 domain folding in the Tetrahymena ribozyme, suggesting that it may act as a thermodynamic clamp for the domain. Comparison of the isolated tetraloop–receptor and other tertiary folding thermodynamics supports a theme that enthalpy- versus entropy-driven folding is determined by the number of hydrogen bonding and base stacking interactions. PMID:19186984
KISSELEVA, NATALIA; KHVOROVA, ANASTASIA; WESTHOF, ERIC; SCHIEMANN, OLAV
2005-01-01
Electron paramagnetic resonance (EPR) spectroscopy is used to study the binding of MnII ions to a tertiary stabilized hammer-head ribozyme (tsHHRz) and to compare it with the binding to the minimal hammerhead ribozyme (mHHRz). Continuous wave EPR measurements show that the tsHHRz possesses a single high-affinity MnII binding site with a KD of ≤10 nM at an NaCl concentration of 0.1 M. This dissociation constant is at least two orders of magnitude smaller than the KD determined previously for the single high-affinity MnII site in the mHHRz. In addition, whereas the high-affinity MnII is displaced from the mHHRz upon binding of the aminoglycoside antibiotic neomycin B, it is not from the tsHHRz. Despite these pronounced differences in binding, a comparison between the electron spin echo envelope modulation and hyperfine sublevel correlation spectra of the minimal and tertiary stabilized HHRz demonstrates that the structure of both binding sites is very similar. This suggests that the MnII is located in both ribozymes between the bases A9 and G10.1 of the sheared G · A tandem base pair, as shown previously and in detail for the mHHRz. Thus, the much stronger MnII binding in the tsHHRz is attributed to the interaction between the two external loops, which locks in the RNA fold, trapping the MnII in the tightly bound conformation, whereas the absence of long-range loop–loop interactions in the mHHRz leads to more dynamical and open conformations, decreasing MnII binding. PMID:15611296
Burke, Teresa A.; Doyle Brackley, Allison; Jeske, Nathaniel A.; Cleland, Jeffery M.; Lund, Brian J.
2017-01-01
Blast-associated sensory and cognitive trauma sustained by military service members is an area of extensively studied research. Recent studies in our laboratory have revealed that low-level blast exposure increased expression of transient receptor potential vanilloid 1 (TRPV1) and endothelin-1 (ET-1), proteins well characterized for their role in mediating pain transmission, in the cornea. Determining the functional consequences of these alterations in protein expression is critical to understanding blast-related sensory trauma. Thus, the purpose of this study was to examine TRPV1 and ET-1 expression in ocular associated sensory tissues following primary and tertiary blast. A rodent model of blast injury was used in which anesthetized animals, unrestrained or restrained, received a single or repeat blast (73.8 ± 5.5 kPa) from a compressed air shock tube once or daily for five consecutive days, respectively. Behavioral and functional analyses were conducted to assess blast effects on nocifensive behavior and TRPV1 activity. Immunohistochemistry and Western Blot were also performed with trigeminal ganglia (TG) to determine TRPV1, ET-1 and glial fibrillary associated protein (GFAP) expression following blast. Increased TRPV1, ET-1 and GFAP were detected in the TG of animals exposed to repeat blast. Increased nocifensive responses were also observed in animals exposed to repeat, tertiary blast as compared to single blast and control. Moreover, decreased TRPV1 desensitization was observed in TG neurons exposed to repeat blast. Repeat, tertiary blast resulted in increased TRPV1, ET-1 and GFAP expression in the TG, enhanced nociception and decreased TRPV1 desensitization. PMID:28797041
Reducing preterm birth by a statewide multifaceted program: an implementation study.
Newnham, John P; White, Scott W; Meharry, Suzanne; Lee, Han-Shin; Pedretti, Michelle K; Arrese, Catherine A; Keelan, Jeffrey A; Kemp, Matthew W; Dickinson, Jan E; Doherty, Dorota A
2017-05-01
A comprehensive preterm birth prevention program was introduced in the state of Western Australia encompassing new clinical guidelines, an outreach program for health care practitioners, a public health program for women and their families based on print and social media, and a new clinic at the state's sole tertiary level perinatal center for referral of those pregnant women at highest risk. The initiative had the single aim of safely lowering the rate of preterm birth. The objective of the study was to evaluate the outcomes of the initiative on the rates of preterm birth both statewide and in the single tertiary level perinatal referral center. This was a prospective population-based cohort study of perinatal outcomes before and after 1 full year of implementation of the preterm birth prevention program. In the state overall, the rate of singleton preterm birth was reduced by 7.6% and was lower than in any of the preceding 6 years. This reduction amounted to 196 cases relative to the year before the introduction of the initiative and the effect extended from the 28-31 week gestational age group onward. Within the tertiary level center, the rate of preterm birth in 2015 was also significantly lower than in the preceding years. A comprehensive and multifaceted preterm birth prevention program aimed at both health care practitioners and the general public, operating within the environment of a government-funded universal health care system can significantly lower the rate of early birth. Further research is now required to increase the effect and to determine the relative contributions of each of the interventions. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Lambert, Dominic; Draper, David E.
2012-01-01
To investigate the mechanism by which urea destabilizes RNA structure, urea-induced unfolding of four different RNA secondary and tertiary structures was quantified in terms of an m-value, the rate at which the free energy of unfolding changes with urea molality. From literature data and our osmometric study of a backbone analog, we derived average interaction potentials (per Å2 of solvent accessible surface) between urea and three kinds of RNA surfaces: phosphate, ribose, and base. Estimates of the increases in solvent accessible surface areas upon RNA denaturation were based on a simple model of unfolded RNA as a combination of helical and single strand segments. These estimates, combined with the three interaction potentials and a term to account for urea interactions with released ions, yield calculated m-values in good agreement with experimental values (200 mm monovalent salt). Agreement was obtained only if single-stranded RNAs were modeled in a highly stacked, A form conformation. The primary driving force for urea induced denaturation is the strong interaction of urea with the large surface areas of bases that become exposed upon denaturation of either RNA secondary or tertiary structure, though urea interactions with backbone and released ions may account for up to a third of the m-value. Urea m-values for all four RNA are salt-dependent, which we attribute to an increased extension (or decreased charge density) of unfolded RNAs with increased urea concentration. The sensitivity of the urea m-value to base surface exposure makes it a potentially useful probe of the conformations of RNA unfolded states. PMID:23088364
Jha, Sunil K; Hayashi, Kenshi
2015-03-01
In present work, a novel quartz crystal microbalance (QCM) sensor array has been developed for prompt identification of primary aldehydes in human body odor. Molecularly imprinted polymers (MIP) are prepared using the polyacrylic acid (PAA) polymer matrix and three organic acids (propenoic acid, hexanoic acid and octanoic acid) as template molecules, and utilized as QCM surface coating layer. The performance of MIP films is characterized by 4-element QCM sensor array (three coated with MIP layers and one with pure PAA for reference) dynamic and static responses to target aldehydes: hexanal, heptanal, and nonanal in single, binary, and tertiary mixtures at distinct concentrations. The target aldehydes were selected subsequent to characterization of body odor samples with solid phase-micro extraction gas chromatography mass spectrometer (SPME-GC-MS). The hexanoic acid and octanoic acid imprinted PAA exhibit fast response, and better sensitivity, selectivity and reproducibility than the propenoic acid, and non-imprinted PAA in array. The response time and recovery time for hexanoic acid imprinted PAA are obtained as 5 s and 12 s respectively to typical concentrations of binary and tertiary mixtures of aldehydes using the static response. Dynamic sensor array response matrix has been processed with principal component analysis (PCA) for visual, and support vector machine (SVM) classifier for quantitative identification of target odors. Aldehyde odors were identified successfully in principal component (PC) space. SVM classifier results maximum recognition rate 79% for three classes of binary odors and 83% including single, binary, and tertiary odor classes in 3-fold cross validation. Copyright © 2014 Elsevier B.V. All rights reserved.
Comparison of Clostridium difficile Ribotypes Circulating in Australian Hospitals and Communities.
Furuya-Kanamori, Luis; Riley, Thomas V; Paterson, David L; Foster, Niki F; Huber, Charlotte A; Hong, Stacey; Harris-Brown, Tiffany; Robson, Jenny; Clements, Archie C A
2017-01-01
Clostridium difficile infection (CDI) is becoming less exclusively a health care-associated CDI (HA-CDI). The incidence of community-associated CDI (CA-CDI) has increased over the past few decades. It has been postulated that asymptomatic toxigenic C. difficile (TCD)-colonized patients may play a role in the transfer of C. difficile between the hospital setting and the community. Thus, to investigate the relatedness of C. difficile across the hospital and community settings, we compared the characteristics of symptomatic and asymptomatic host patients and the pathogens from these patients in these two settings over a 3-year period. Two studies were simultaneously conducted; the first study enrolled symptomatic CDI patients from two tertiary care hospitals and the community in two Australian states, while the second study enrolled asymptomatic TCD-colonized patients from the same tertiary care hospitals. A total of 324 patients (96 with HA-CDI, 152 with CA-CDI, and 76 colonized with TCD) were enrolled. The predominant C. difficile ribotypes isolated in the hospital setting corresponded with those isolated in the community, as it was found that for 79% of the C. difficile isolates from hospitals, an isolate with a matching ribotype was isolated in the community, suggesting that transmission between these two settings is occurring. The toxigenic C. difficile strains causing symptomatic infection were similar to those causing asymptomatic infection, and patients exposed to antimicrobials prior to admission were more likely to develop a symptomatic infection (odds ratio, 2.94; 95% confidence interval, 1.20 to 7.14). Our findings suggest that the development of CDI symptoms in a setting without establishment of hospital epidemics with binary toxin-producing C. difficile strains may be driven mainly by host susceptibility and exposure to antimicrobials, rather than by C. difficile strain characteristics. Copyright © 2016 American Society for Microbiology.
Prabhakaran, Lathy; Earnest, Arul; Abisheganaden, John; Chee, Jane
2009-12-01
The Asthma Control Test (ACT) is a 5-item self-administered tool designed to assess asthma control. It is said to be simple, easy and can be administered quickly by patients in the clinical practice setting. This stated benefit has yet to be demonstrated in our local clinical practice setting. The aim was to identify factors associated with difficulty in the administration of the ACT in different clinical practice settings in a tertiary hospital in Singapore. This is a prospective study performed from April to June 2008. All patients diagnosed with asthma and referred to an asthma nurse from the in-patient and out-patient clinical practice setting in Tan Tock Seng Hospital were enrolled. Four hundred and thirty-four patients were asked to complete the ACT tool. In the univariate model, we found that age, clinical setting and medical history to be significantly associated with the completion of the ACT. The odds of completion decreased by a factor of 0.92 (95% CI, 0.89 to 0.94) for every year's increase in age, and this was statistically significant (P <0.001). Similarly, the odds ratio of completion for those with more than 3 medical conditions by history were 0.59 (95% CI, 0.48 to 0.71) as compared to those with less than 3 medical conditions by history, and this was also significant (P <0.001). In the multivariate model, we only found age to be an independent and significant factor. After adjusting for age, none of the other variables initially significant in the univariate model remained significant. The results show that the ACT was simple and easy to be administered in younger-aged patients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
M'Gonigle, J.W.; Dalrymple, G.B.
1993-10-01
[sup 40]Ar/[sup 39]Ar ages on single sanidine crystals from rhyolitic tuffs and ash flow tuffs within the uppermost and lowermost parts of the volcanic sequence of the Horse Prairie and Medicine Lodge topographic basins, southwestern Montana, show that these volcanic rocks were emplaced between about 48.8[+-]0.2 Ma and 45.9[+-]0.2 Ma, and are correlative with the Eocene Challis Volcanic Group of central Idaho. Sanidine ages on tuffs at the base of the Tertiary lacustrine, paludal, and fluvial sedimentary sequence, which unconformably overlies the volcanic sequence, suggest that sedimentation within an ancestral sedimentary basin that predated the development of the modern Horsemore » Prairie and Medicine Lodge basins began in the middle Eocene. 22 refs., 3 figs., 2 tabs.« less
Tertiary alphabet for the observable protein structural universe.
Mackenzie, Craig O; Zhou, Jianfu; Grigoryan, Gevorg
2016-11-22
Here, we systematically decompose the known protein structural universe into its basic elements, which we dub tertiary structural motifs (TERMs). A TERM is a compact backbone fragment that captures the secondary, tertiary, and quaternary environments around a given residue, comprising one or more disjoint segments (three on average). We seek the set of universal TERMs that capture all structure in the Protein Data Bank (PDB), finding remarkable degeneracy. Only ∼600 TERMs are sufficient to describe 50% of the PDB at sub-Angstrom resolution. However, more rare geometries also exist, and the overall structural coverage grows logarithmically with the number of TERMs. We go on to show that universal TERMs provide an effective mapping between sequence and structure. We demonstrate that TERM-based statistics alone are sufficient to recapitulate close-to-native sequences given either NMR or X-ray backbones. Furthermore, sequence variability predicted from TERM data agrees closely with evolutionary variation. Finally, locations of TERMs in protein chains can be predicted from sequence alone based on sequence signatures emergent from TERM instances in the PDB. For multisegment motifs, this method identifies spatially adjacent fragments that are not contiguous in sequence-a major bottleneck in structure prediction. Although all TERMs recur in diverse proteins, some appear specialized for certain functions, such as interface formation, metal coordination, or even water binding. Structural biology has benefited greatly from previously observed degeneracies in structure. The decomposition of the known structural universe into a finite set of compact TERMs offers exciting opportunities toward better understanding, design, and prediction of protein structure.
Tertiary alphabet for the observable protein structural universe
Mackenzie, Craig O.; Zhou, Jianfu; Grigoryan, Gevorg
2016-01-01
Here, we systematically decompose the known protein structural universe into its basic elements, which we dub tertiary structural motifs (TERMs). A TERM is a compact backbone fragment that captures the secondary, tertiary, and quaternary environments around a given residue, comprising one or more disjoint segments (three on average). We seek the set of universal TERMs that capture all structure in the Protein Data Bank (PDB), finding remarkable degeneracy. Only ∼600 TERMs are sufficient to describe 50% of the PDB at sub-Angstrom resolution. However, more rare geometries also exist, and the overall structural coverage grows logarithmically with the number of TERMs. We go on to show that universal TERMs provide an effective mapping between sequence and structure. We demonstrate that TERM-based statistics alone are sufficient to recapitulate close-to-native sequences given either NMR or X-ray backbones. Furthermore, sequence variability predicted from TERM data agrees closely with evolutionary variation. Finally, locations of TERMs in protein chains can be predicted from sequence alone based on sequence signatures emergent from TERM instances in the PDB. For multisegment motifs, this method identifies spatially adjacent fragments that are not contiguous in sequence—a major bottleneck in structure prediction. Although all TERMs recur in diverse proteins, some appear specialized for certain functions, such as interface formation, metal coordination, or even water binding. Structural biology has benefited greatly from previously observed degeneracies in structure. The decomposition of the known structural universe into a finite set of compact TERMs offers exciting opportunities toward better understanding, design, and prediction of protein structure. PMID:27810958
Outcomes of antiretroviral therapy in a northern Indian urban clinic
Dhooria, Sahajal; Prasad, KT; George, Ninoo; Ranjan, Sanjay; Gupta, Deepak; Sreenivas, Vishnubhatla; Kadhiravan, Tamilarasu; Miglani, Sunita; Sinha, Sanjeev; Wig, Naveet; Biswas, Ashutosh; Vajpayee, Madhu
2010-01-01
Abstract Problem Antiretroviral therapy (ART) programmes have been successful in several countries. However, whether they would succeed as part of a national programme in a resource-constrained setting such as India is not clear. The outcomes and specific problems encountered in such a setting have not been adequately studied. Approach We assessed the efficacy and functioning of India’s national ART programme in a tertiary care centre in northern India. All ART-naive patients started on ART between May 2005 and October 2006 were included in the study and were followed until 31 April 2008. Periodic clinical and laboratory evaluations were carried out in accordance with national guidelines. Changes in CD4+ lymphocyte count, body weight and body mass index were assessed at follow-up, and the operational problems analysed. Local setting The setting was a tertiary care centre in northern India with a mixed population of patients, mostly of low socioeconomic status. The centre is reasonably well resourced but faces constraints in health-care delivery, such as lack of adequate human resources and a high patient load. Relevant changes The response to ART in the cohort studied was comparable to that reported from other countries. However, the programme had a high attrition rate, possibly due to patient-related factors and operational constraints. Lessons learnt A high rate of attrition can affect the overall efficacy and functioning of an ART programme. Addressing the issues causing attrition might improve patient outcomes in India and in other resource-constrained countries. PMID:20428391
DOE Office of Scientific and Technical Information (OSTI.GOV)
David Dzombak; Radisav Vidic; Amy Landis
Treated municipal wastewater is a common, widely available alternative source of cooling water for thermoelectric power plants across the U.S. However, the biodegradable organic matter, ammonia-nitrogen, carbonate and phosphates in the treated wastewater pose challenges with respect to enhanced biofouling, corrosion, and scaling, respectively. The overall objective of this study was to evaluate the benefits and life cycle costs of implementing tertiary treatment of secondary treated municipal wastewater prior to use in recirculating cooling systems. The study comprised bench- and pilot-scale experimental studies with three different tertiary treated municipal wastewaters, and life cycle costing and environmental analyses of various tertiarymore » treatment schemes. Sustainability factors and metrics for reuse of treated wastewater in power plant cooling systems were also evaluated. The three tertiary treated wastewaters studied were: secondary treated municipal wastewater subjected to acid addition for pH control (MWW_pH); secondary treated municipal wastewater subjected to nitrification and sand filtration (MWW_NF); and secondary treated municipal wastewater subjected nitrification, sand filtration, and GAC adsorption (MWW_NFG). Tertiary treatment was determined to be essential to achieve appropriate corrosion, scaling, and biofouling control for use of secondary treated municipal wastewater in power plant cooling systems. The ability to control scaling, in particular, was found to be significantly enhanced with tertiary treated wastewater compared to secondary treated wastewater. MWW_pH treated water (adjustment to pH 7.8) was effective in reducing scale formation, but increased corrosion and the amount of biocide required to achieve appropriate biofouling control. Corrosion could be adequately controlled with tolytriazole addition (4-5 ppm TTA), however, which was the case for all of the tertiary treated waters. For MWW_NF treated water, the removal of ammonia by nitrification helped to reduce the corrosivity and biocide demand. Also, the lower pH and alkalinity resulting from nitrification reduced the scaling to an acceptable level, without the addition of anti-scalant chemicals. Additional GAC adsorption treatment, MWW_NFG, yielded no net benefit. Removal of organic matter resulted in pitting corrosion in copper and cupronickel alloys. Negligible improvement was observed in scaling control and biofouling control. For all of the tertiary treatments, biofouling control was achievable, and most effectively with pre-formed monochloramine (2-3 ppm) in comparison with NaOCl and ClO2. Life cycle cost (LCC) analyses were performed for the tertiary treatment systems studied experimentally and for several other treatment options. A public domain conceptual costing tool (LC3 model) was developed for this purpose. MWW_SF (lime softening and sand filtration) and MWW_NF were the most cost-effective treatment options among the tertiary treatment alternatives considered because of the higher effluent quality with moderate infrastructure costs and the relatively low doses of conditioning chemicals required. Life cycle inventory (LCI) analysis along with integration of external costs of emissions with direct costs was performed to evaluate relative emissions to the environment and external costs associated with construction and operation of tertiary treatment alternatives. Integrated LCI and LCC analysis indicated that three-tiered treatment alternatives such as MWW_NSF and MWW_NFG, with regular chemical addition for treatment and conditioning and/or regeneration, tend to increase the impact costs and in turn the overall costs of tertiary treatment. River water supply and MWW_F alternatives with a single step of tertiary treatment were associated with lower impact costs, but the contribution of impact costs to overall annual costs was higher than all other treatment alternatives. MWW_NF and MWW_SF alternatives exhibited moderate external impact costs with moderate infrastructure and chemical conditioner dosing, which makes them (especially MWW_NF) better treatment alternatives from the environmental sustainability perspective since they exhibited minimal contribution to environmental damage from emissions.« less
Antenatal education for childbirth-epidural analgesia.
Cutajar, Lisa; Cyna, Allan M
2018-05-07
The language structures used by antenatal educators have not been previously researched in the context of antenatal childbirth classes. Epidural analgesia for labour is a common, and a frequently asked about, component of antenatal education for parents in hospitals providing maternity care. We aimed to identify the way information is described and presented by childbirth educators to assess content and determine which language structures such as metaphor, suggestion, information and storytelling are utilized. This observational study of antenatal education was conducted at a single tertiary referral center for maternity care in Western Sydney, Australia. All three childbirth educators agreed to be video recorded whilst providing information to parents during antenatal classes. Audio data was subsequently transcribed and then analysed by two researchers, independently categorising the various language structures and types of information provided. For the purposes of the current study, data concerning a single topic was used for the analysis-'epidural analgesia for labour'. Language structures used were highly variable between educators, as was the content and time taken for the information being provided. Our findings represent a first attempt to identify baseline information used in the clinical setting of antenatal education in order to categories communication structures used. This study has identified areas for further improvements and consistency in the way educators provide information to parents and has important implications for future midwifery practice, education and research. Copyright © 2018 Elsevier Ltd. All rights reserved.
Correlation of Site of Embryo Transfer with IVF Outcome: Analysis of 743 Cycles from a Single Center
Singh, Neeta; Lata, Kusum; Malhotra, Neena; Vanamail, P.
2017-01-01
Objective: To investigate the influence of site of embryo transfer (ET) on reproductive outcome. Materials and Methods: A retrospective analysis of 743 ultrasound-guided ET in fresh in vitro fertilization (IVF) cycles from a single center over a period of 4 years was conducted. The distance between the fundal endometrial surface and the air bubble was measured, and accordingly, patients were divided into four groups (≤10 mm; >10 and ≤15 mm; >15 and 20 mm; >20 and <25 mm). Setting: Tertiary Assisted Reproductive Technology (ART) center. Patient(s): All patients enrolled in the IVF program undergoing ET. Intervention(s): Controlled ovarian hyperstimulation (OS), IVF, and ET. Main Outcome Measure(s): Cleavage rate and clinical pregnancy rate. Result(s): Clinical pregnancy rate was significantly more in groups 2 and 3 compared to the other groups. Logistic regression analysis showed that one unit increase in embryos transfer will enhance the pregnancy outcome about 3.7 (adjusted odds ratio) times with 95% confidence limits 2.6 to 5.4. Similarly, pregnancy outcome will be 3.1 (95% confidence limits: 1.5–6.4) times higher for distance group >15 and <20 mm compared to less than 10-mm distance group. Ectopic pregnancy rates were similar in all the four groups. Conclusion: The present study demonstrates that site of ET has significant difference on reproductive outcome. PMID:28904498
Izzo, Flavia; Schäfer, Martina; Lienau, Philip; Ganzer, Ursula; Stockman, Robert; Lücking, Ulrich
2018-05-04
An unprecedented set of structurally diverse sulfonimidamides (47 compounds) has been prepared by various N-functionalization reactions of tertiary =NH sulfonimidamide 2 aa. These N-functionalization reactions of model compound 2 aa include arylation, alkylation, trifluoromethylation, cyanation, sulfonylation, alkoxycarbonylation (carbamate formation) and aminocarbonylation (urea formation). Small molecule X-ray analyses of selected N-functionalized products are reported. To gain further insight into the properties of sulfonimidamides relevant to medicinal chemistry, a variety of structurally diverse reaction products were tested in selected in vitro assays. The described N-functionalization reactions provide a short and efficient approach to structurally diverse sulfonimidamides which have been the subject of recent, growing interest in the life sciences. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ang, Marcus; Tan, Donald; Mehta, Jodhbir S
2012-05-31
Small incision lenticule extraction or SMILE is a novel form of 'flapless' corneal refractive surgery that was adapted from refractive lenticule extraction (ReLEx). SMILE uses only one femtosecond laser to complete the refractive surgery, potentially reducing surgical time, side effects, and cost. If successful, SMILE could potentially replace the current, widely practiced laser in-situ keratomileusis or LASIK. The aim of this study is to evaluate whether SMILE is non-inferior to LASIK in terms of refractive outcomes at 3 months post-operatively. Single tertiary center, parallel group, single-masked, paired-eye design, non-inferiority, randomized controlled trial. Participants who are eligible for LASIK will be enrolled for study after informed consent. Each participant will be randomized to receive SMILE and LASIK in each eye. Our primary hypothesis (stated as null) in this non-inferiority trial would be that SMILE differs from LASIK in adults (>21 years old) with myopia (> -3.00 diopter (D)) at a tertiary eye center in terms of refractive predictability at 3 months post-operatively. Our secondary hypothesis (stated as null) in this non-inferiority trial would be that SMILE differs from LASIK in adults (>21 years old) with myopia (> -3.00 D) at a tertiary eye center in terms of other refractive outcomes (efficacy, safety, higher-order aberrations) at 3 months post-operatively. Our primary outcome is refractive predictability, which is one of several standard refractive outcomes, defined as the proportion of eyes achieving a postoperative spherical equivalent (SE) within ±0.50 D of the intended target. Randomization will be performed using random allocation sequence generated by a computer with no blocks or restrictions, and implemented by concealing the number-coded surgery within sealed envelopes until just before the procedure. In this single-masked trial, subjects and their caregivers will be masked to the assigned treatment in each eye. This novel trial will provide information on whether SMILE has comparable, if not superior, refractive outcomes compared to the established LASIK for myopia, thus providing evidence for translation into clinical practice. Clinicaltrials.gov NCT01216475.
MICRODISSECTION TESTICULAR SPERM EXTRACTION IN MEN WITH SERTOLI CELL ONLY TESTICULAR HISTOLOGY
Berookhim, Boback M.; Palermo, Gianpiero D.; Zaninovic, Nikica; Rosenwaks, Zev; Schlegel, Peter N.
2015-01-01
Objective To study the outcomes of microdissection testicular sperm extraction (microTESE) among men with pure Sertoli cell only histology on diagnostic testicular biopsy. Design Retrospective cohort study. Setting Tertiary referral center. Patients 640 patients with pure Sertoli cell only histology on testicular biopsy who underwent microTESE by a single surgeon. Intervention MicroTESE. Main Outcome Measure Sperm retrieval rates. Results Overall, 44.5% of patients with Sertoli cell-only had sperm retrieved with microTESE. No difference was noted in sperm retrieval rates based on testis volume (≥ 15cc versus <15cc, 35.3% versus 46.1%, respectively). Patients with ≥ 15cc testicular volume and FSH 10-15 mU/mL had the worst prognosis, with a sperm retrieval rate of 6.7%. Conclusions Patients with previous testicular biopsy demonstrating Sertoli cell only histology can be counseled that they have a reasonable likelihood of sperm retrieval with the contemporary delivery of microTESE. Given this finding, the utility of testicular biopsy prior to microTESE is further questioned. PMID:25441063
Safety of cupping during bevacizumab therapy.
Klempner, Samuel J; Costa, Daniel B; Wu, Peggy A; Ariyabuddhiphongs, Kim D
2013-08-01
This study reports on the safety of the complementary and alternative medicine (CAM) practice of cupping in a patient undergoing concomitant therapy with bevacizumab for advanced non-small-cell lung cancer (NSCLC), and raises awareness of the need for improved communication between CAM practitioners and oncologists during the care of patients with cancer. The practice of cupping generates local hyperemia, disrupts superficial vasculature in the dermis, and leads to cutaneous lesions including circular erythema, edema, and subsequently ecchymosis. There are no data on the safety of cupping in patients being treated with bevacizumab. This is a single-institution case report. The setting for this study was a tertiary-care academic medical center. A patient with advanced NSCLC received four cycles of carboplatin AUC 6, paclitaxel 200 mg/m(2), and bevacizumab 15 mg/kg, and was continued on every-3-week maintenance bevacizumab 15 mg/kg. The patient underwent glass dry cupping during cycle six of maintenance bevacizumab treatment without overt cutaneous adverse events or bleeding. The patient did not realize he should have communicated his cupping plans or recent bevacizumab treatment with his providers.
Ewing sarcoma of the head and neck: The Mayo Clinic experience.
Olson, Michael D; Van Abel, Kathryn M; Wehrs, Rebecca N; Garcia, Joaquin J; Moore, Eric J
2018-05-13
Treatment options of Ewing sarcoma of the head and neck include surgery, radiotherapy (RT), and chemoradiotherapy. However, local control can be challenging. We conducted a retrospective review of all patients with head and neck Ewing sarcoma treated from 1972 to 2015 at a single tertiary care hospital. Seventeen patients met criteria (median 21 years, range 5-58 years; 5 women). Mean follow-up was 10.4 years (range 2.2-39 years). Tumors occurred commonly in the cervical spine (5/17), the skull (3/17), and the paranasal sinuses (3/17). A total of 14 of 17 patients underwent surgical resection, 9 with gross total resection. After multimodality therapy, the 5-year overall survival (OS) and recurrence-free survival (RFS) was 87% and 75%, respectively. Combined multimodal treatment resulted in a 5-year OS and RFS of 87% and 75%, respectively. Aggressive surgical resection with adjuvant chemoradiotherapy should be considered. Although negative margin surgery is the goal, subtotal resection may be acceptable in the setting of adjuvant treatment. © 2018 Wiley Periodicals, Inc.
Mitochondria-Targeted Antioxidant Mitoquinone Reduces Cisplatin-Induced Ototoxicity in Guinea Pigs.
Tate, Alan D; Antonelli, Patrick J; Hannabass, Kyle R; Dirain, Carolyn O
2017-03-01
Objective To determine if mitoquinone (MitoQ) attenuates cisplatin-induced hearing loss in guinea pigs. Study Design Prospective and controlled animal study. Setting Academic, tertiary medical center. Subjects and Methods Guinea pigs were injected subcutaneously with either 5 mg/kg MitoQ (n = 9) or normal saline (control, n = 9) for 7 days and 1 hour before receiving a single dose of 10 mg/kg cisplatin. Auditory brainstem response thresholds were measured before MitoQ or saline administration and 3 to 4 days after cisplatin administration. Results Auditory brainstem response threshold shifts after cisplatin treatment were smaller by 28 to 47 dB in guinea pigs injected with MitoQ compared with those in the control group at all tested frequencies (4, 8, 16, and 24 kHz, P = .0002 to .04). Scanning electron microscopy of cochlear hair cells showed less outer hair cell loss and damage in the MitoQ group. Conclusion MitoQ reduced cisplatin-induced hearing loss in guinea pigs. MitoQ appears worthy of further investigation as a means of preventing cisplatin ototoxicity in humans.
Flow Field and Acoustic Predictions for Three-Stream Jets
NASA Technical Reports Server (NTRS)
Simmons, Shaun Patrick; Henderson, Brenda S.; Khavaran, Abbas
2014-01-01
Computational fluid dynamics was used to analyze a three-stream nozzle parametric design space. The study varied bypass-to-core area ratio, tertiary-to-core area ratio and jet operating conditions. The flowfield solutions from the Reynolds-Averaged Navier-Stokes (RANS) code Overflow 2.2e were used to pre-screen experimental models for a future test in the Aero-Acoustic Propulsion Laboratory (AAPL) at the NASA Glenn Research Center (GRC). Flowfield solutions were considered in conjunction with the jet-noise-prediction code JeNo to screen the design concepts. A two-stream versus three-stream computation based on equal mass flow rates showed a reduction in peak turbulent kinetic energy (TKE) for the three-stream jet relative to that for the two-stream jet which resulted in reduced acoustic emission. Additional three-stream solutions were analyzed for salient flowfield features expected to impact farfield noise. As tertiary power settings were increased there was a corresponding near nozzle increase in shear rate that resulted in an increase in high frequency noise and a reduction in peak TKE. As tertiary-to-core area ratio was increased the tertiary potential core elongated and the peak TKE was reduced. The most noticeable change occurred as secondary-to-core area ratio was increased thickening the secondary potential core, elongating the primary potential core and reducing peak TKE. As forward flight Mach number was increased the jet plume region decreased and reduced peak TKE.
Large eddy simulation study of spanwise spacing effects on secondary flows in turbulent channel flow
NASA Astrophysics Data System (ADS)
Aliakbarimiyanmahaleh, Mohammad; Anderson, William
2015-11-01
The structure of turbulent flow over a complex topography composed of streamwise-aligned rows of cones with varying spanwise spacing, s is studied with large-eddy simulation (LES). Similar to the experimental study of Vanderwel and Ganapathisubramani, 2015: J. Fluid Mech., we investigate the relationship between secondary flow and s, for 0 . 25 <= s / δ <= 5 . For cases with s / δ > 2 , domain-scale rollers freely exist. These had previously been called ``turbulent secondary flows'' (Willingham et al., 2014: Phys. Fluids; Barros and Christensen, 2014: J. Fluid Mech.; Anderson et al., 2015: J. Fluid Mech.), but closer inspection of the statistics indicates these are a turbulent tertiary flow: they only remain ``anchored'' to the conical roughness elements for s / δ > 2 . For s / δ < 2 , turbulent tertiary flows are prevented from occupying the domain by virtue of proximity to adjacent, counter-rotating tertiary flows. Turbulent secondary flows are associated with the conical roughness elements. These turbulent secondary flows emanate from individual conical topographic elements and set the roughness sublayer depth. The turbulent secondary flows remain intact for large and small spacing. For s / δ < 1 , a mean tertiary flow is not present. This work was supported by the Air Force Office of Sci. Research, Young Inv. Program (PM: Dr. R. Ponnoppan and Ms. E. Montomery) under Grant # FA9550-14-1-0394. Computational resources were provided by the Texas Adv. Comp. Center at the Univ. of Texas.
Tertiary work-up of apparent treatment-resistant hypertension.
Heimark, Sondre; Eskås, Per Anders; Mariampillai, Julian Eek; Larstorp, Anne Cecilie K; Høieggen, Aud; Fadl Elmula, Fadl Elmula M
2016-10-01
Treatment-resistant hypertension (TRH) has regained attention with development of new methods for treatment. However, the prevalence of TRH varies considerably from primary to secondary and tertiary care. We aimed to assess the prevalence of true TRH in a population of patients with apparent TRH in a university hospital setting of tertiary work-up and also investigate reasons for poor BP control and evaluate how work-up can be performed in general practice and secondary care. In this cohort study, we characterize a study population from Oslo Renal Denervation (RDN) Study. Patients (n = 83) were referred for RDN from secondary care. All patients underwent thorough medical investigation and 24-h ambulatory blood pressure measurements (24ABPM) after directly observed therapy (DOT). We then assessed reasons for lack of BP control. Fifty-three of 83 patients did not have true TRH. Main reasons for non-TRH were poor drug adherence (32%), secondary hypertension (30%) and white coat hypertension (15%). Forty-seven percent achieved blood pressure control after DOT with subsequent 24ABPM. There were otherwise no statistically significant differences in patient characteristics between the true TRH and the non-TRH group. Despite being a highly selected cohort referred for tertiary work-up of apparent TRH, BP control was achieved or secondary causes were identified in almost two thirds of the patients. Thorough investigation according to guidelines and DOT with subsequent 24ABPM is needed in work-up of apparent TRH.
"It Depends on the Students Themselves": Independent Language Learning at an Indonesian State School
ERIC Educational Resources Information Center
Lamb, Martin
2004-01-01
There is continuing interest in the notion of learner autonomy, both as an effective means and valid goal of a language learning curriculum. However, the concept is recognised as emanating from Western tertiary educational contexts and as open to question in different sociocultural settings. This paper reports on a study of language learning…
ERIC Educational Resources Information Center
Persson, Roland S.
2010-01-01
A study was launched in an educational setting where giftedness is not officially recognized o explore intellectually gifted students' experience of family background and support, their age and means of identification, the degree of support received in school, and the understanding they experienced from a primary to a tertiary education level. In…
An Exploratory Study of Students' Constructions of Gender in Science, Engineering and Technology
ERIC Educational Resources Information Center
Lynch, Ingrid; Nowosenetz, Tessa
2009-01-01
Despite an appreciation of the need to increase gender sensitivity and awareness among tertiary students in the field of science, engineering and technology (SET), there is a paucity of research that explores how students in this field construct gender. A greater understanding of such constructions can assist in transforming gender relations and…
Teachers Matter: Expectancy Effects in Chinese University English-as-a-Foreign-Language Classrooms
ERIC Educational Resources Information Center
Li, Zheng; Rubie-Davies, Christine Margaret
2017-01-01
This study was designed to investigate teacher expectation effects for intact student groups (rather than individuals) in tertiary settings, which have been little studied in the literature. The participants were 50 teachers and their 4617 first-year undergraduate students learning English as a foreign language at two universities in China.…
A Case Study of Pedagogy of Mathematics Support Tutors without a Background in Mathematics Education
ERIC Educational Resources Information Center
Walsh, Richard
2017-01-01
This study investigates the pedagogical skills and knowledge of three tertiary-level mathematics support tutors in a large group classroom setting. This is achieved through the use of video analysis and a theoretical framework comprising Rowland's Knowledge Quartet and general pedagogical knowledge. The study reports on the findings in relation to…
TNE-Trans-National Education or Tensions between National and External? a Case Study of Malaysia
ERIC Educational Resources Information Center
Hill, Christopher; Cheong, Kee-Cheok; Leong, Yin-Ching; Fernandez-Chung, Rozilini
2014-01-01
Transnational education, primarily at the tertiary level, has been growing rapidly, bringing with it high hopes and expectations of benefits to institutions in the countries of origin and destination. However, these potential benefits come with a set of challenges that must be overcome. These challenges include the need to reconcile the…
A Multivariate Analysis of Secondary Students' Experience of Web-Based Language Acquisition
ERIC Educational Resources Information Center
Felix, Uschi
2004-01-01
This paper reports on a large-scale project designed to replicate an earlier investigation of tertiary students (Felix, 2001) in a secondary school environment. The new project was carried out in five settings, again investigating the potential of the Web as a medium of language instruction. Data was collected by questionnaires and observational…
ERIC Educational Resources Information Center
Raikou, Natassa
2016-01-01
This article addresses an application performed in tertiary education--a department of pedagogical and educational sciences--of a contemporary method, Transformative Learning through Aesthetic Experience. The method is based on the use of art and aims to reinforce and promote the development of critical thinking within educational settings.…
ERIC Educational Resources Information Center
Oram, Lindsay; Owens, Sarah; Maras, Melissa
2016-01-01
A wealth of research highlights negative outcomes associated with mental and behavioral health problems in children and adolescents. Prevention-based frameworks have been developed to provide prevention and early intervention in the school setting. Tertiary behavioral supports often include the use of functional behavior assessments (FBAs) and…
Code-Switching in Vietnamese University EFL Teachers' Classroom Instruction: A Pedagogical Focus
ERIC Educational Resources Information Center
Grant, Lynn E.; Nguyen, Thi Hang
2017-01-01
This study examines the under-explored phenomenon in Vietnamese tertiary settings of code-switching practised by EFL (English as a foreign language) teachers in classroom instruction, as well as their awareness of this practice. Among the foreign languages taught and learned in Vietnamese universities, English is the most popular. The research…
ERIC Educational Resources Information Center
Mir, Monir; Fan, Hai Wei; Daly, Anne; Boland, Greg
2014-01-01
In Australia there is no centrally administered nationwide assessment system for students who complete their final year (Year 12) of high school. Each state and territory uses its own Year 12 assessment system. Apart from Queensland and the Australian Capital Territory, all states and territories use externally set competitive examinations. The…
NASA Technical Reports Server (NTRS)
Urrutia-Fucugauchi, J.; Marin, Luis; Sharpton, Virgil L.
1994-01-01
We report paleomagnetic results for core samples of the breccia and andesitic rocks recovered from the Yucatan-6 Petrolcos Mexicanos exploratory well within the Chicxulub structure (about 60 km SSW from its center), northern Yucatan, Mexico. A previous study has shown that the rocks studied contain high iridium levels and shocked breccia clasts and an Ar/Ar date of 65.2 +/- 0.4 Ma. Andesitic rocks are characterized by stable single-component magnetizations with a mean inclination of -42.6 deg +/- 2.4 deg. Breccias present a complex paleomagnetic record characterized by multivectorial magnetizations with widely different initial NRM inclinations. However, after alternating field demagnetization, well defined characteristic components with upward inclinations are defined. IRM acquisition experiments, comparison of IRM and NRM coercivity spectra and the single component magnetization of the andesitic rocks indicate the occurrence of iron-rich titanomagnetites of single or pseudo-single domain states as the dominant magnetic carriers. Mean inclinations from the andesitic rocks and most of the breccia samples give a mean inclination of about -40 deg to -45 deg, indicating a reverse polarity for the characteristic magnetization that is consistent with geomagnetic chron 29R, which spans the Cretaceous/Tertiary (K/T) boundary. The inclination is also consistent with the expected value (and corresponding paleolatitude) for the site estimated from the reference polar wander curve for North America. We suggest that the characteristic magnetizations for the andesitic and breccia rocks are the result of shock heating at the time of formation of the impact structure and that the age, polarity and pateolatitude are consistent with a time at the K/T boundary.
Manohar, Harshini; Subramanian, Karthick; Menon, Vikas; Kattimani, Shivanand
2017-01-01
Context: There is a paucity of systematic data reflecting the practice of electroconvulsive therapy (ECT) from developing countries. Aim: We aimed to identify the number of ECT sessions required to yield response and gender diffeferences in the number of sessions across various diagnostic categories. Setting and Design: A record-based study from a teaching cum tertiary care hospital in South India. Subjects and Methods: Case records of patients who received modified ECT from January 2011 to January 2016 were reviewed. The sociodemographic details and ECT-related data were collected. Psychiatric diagnoses were ascertained as per the International Classification of Diseases, 10th Revision criteria. Statistical Analysis Used: Kruskal–Wallis test and Mann–Whitney U-test. Results: Among 148 patients, 82 (55.4%) had mood disorder (bipolar disorder and recurrent depressive disorder), 43 (29.1%) had schizophrenia, and 22 (14.9%) had other acute and transient psychotic disorders (ATPDs). Patients with mood disorders, schizophrenia, and other ATPD received 7.3 (± 3.8), 9.7 (± 6.1), and 5.4 (± 2.0) ECT sessions, respectively, to achieve response. There was no gender difference in the number of sessions received. Conclusion: Our findings show that number of ECT sessions required to yield response may be disorder-specific. Gender does not influence the ECT dose requirement. Variations in ECT parameters across settings may limit the generalizability of results. PMID:28694625
NASA Astrophysics Data System (ADS)
Gill, Kanwar Rupinder S.; Gross, Seth A.; Greenwald, Bruce D.; Hemminger, Lois L.; Wolfsen, Herbert C.
2009-06-01
Background: There are few data available comparing endoscopic ablation methods for Barrett's esophagus with high-grade dysplasia (BE-HGD). Objective: To determine differences in symptoms and complications associated with endoscopic ablation. Design: Prospective observational study. Setting: Two tertiary care centers in USA. Patients: Consecutive patients with BE-HGD Interventions: In this pilot study, symptoms profile data were collected for BE-HGD patients among 3 endoscopic ablation methods: porfimer sodium photodynamic therapy, radiofrequency ablation and low-pressure liquid nitrogen spray cryotherapy. Main Outcome Measurements: Symptom profiles and complications from the procedures were assessed 1-8 weeks after treatment. Results: Ten BE-HGD patients were treated with each ablation modality (30 patients total; 25 men, median age: 69 years (range 53-81). All procedures were performed in the clinic setting and none required subsequent hospitalization. The most common symptoms among all therapies were chest pain, dysphagia and odynophagia. More patients (n=8) in the porfimer sodium photodynamic therapy group reported weight loss compared to radio-frequency ablactation (n=2) and cryotherapy (n=0). Four patients in the porfimer sodium photodynamic therapy group developed phototoxicity requiring medical treatment. Strictures, each requiring a single dilation, were found in radiofrequency ablactation (n=1) and porfimer sodium photodynamic therapy (n=2) patients. Limitations: Small sample size, non-randomized study. Conclusions: These three endoscopic therapies are associated with different types and severity of post-ablation symptoms and complications.
Non-invasive ventilation in amyotrophic lateral sclerosis: a 10 year population based study.
Chiò, Adriano; Calvo, Andrea; Moglia, Cristina; Gamna, Federica; Mattei, Alessio; Mazzini, Letizia; Mora, Gabriele
2012-04-01
To evaluate the clinical characteristics and outcome of non-invasive ventilation (NIV) in an epidemiological based series of amyotrophic lateral sclerosis (ALS) patients. The study was performed using data from the Piemonte and Valle d'Aosta Register for ALS, a prospective epidemiological register enrolling all ALS incident cases in two Italian regions. Among the 1260 patients incident in the period 1995-2004, 259 (20.6%) underwent NIV. Young male patients and subjects attending the tertiary ALS centres were more likely to undergo NIV. There was a progressive significant increase in the use of NIV during the study but was limited to patients attending the ALS tertiary centres. Median survival after NIV was 289 days (95% CI 255 to 333). In an epidemiological setting, NIV represents an increasingly utilised option for the treatment of respiratory disturbances in ALS and has favourable effects on survival, in particular among patients followed by tertiary ALS centres. Sociocultural factors, such as age, gender and marital status, strongly influence the probability of undergoing NIV. Efforts should be made to remove these obstacles in order to spread the use of NIV in all ALS patients with respiratory failure.
Gorman, Sean K; Slavik, Richard S; Lam, Stefanie
2012-01-01
Background: Clinicians commonly rely on tertiary drug information references to guide drug dosages for patients who are receiving continuous renal replacement therapy (CRRT). It is unknown whether the dosage recommendations in these frequently used references reflect the most current evidence. Objective: To determine the presence and accuracy of drug dosage recommendations for patients undergoing CRRT in 4 drug information references. Methods: Medications commonly prescribed during CRRT were identified from an institutional medication inventory database, and evidence-based dosage recommendations for this setting were developed from the primary and secondary literature. The American Hospital Formulary System—Drug Information (AHFS–DI), Micromedex 2.0 (specifically the DRUGDEX and Martindale databases), and the 5th edition of Drug Prescribing in Renal Failure (DPRF5) were assessed for the presence of drug dosage recommendations in the CRRT setting. The dosage recommendations in these tertiary references were compared with the recommendations derived from the primary and secondary literature to determine concordance. Results: Evidence-based drug dosage recommendations were developed for 33 medications administered in patients undergoing CRRT. The AHFS–DI provided no dosage recommendations specific to CRRT, whereas the DPRF5 provided recommendations for 27 (82%) of the medications and the Micromedex 2.0 application for 20 (61%) (13 [39%] in the DRUGDEX database and 16 [48%] in the Martindale database, with 9 medications covered by both). The dosage recommendations were in concordance with evidence-based recommendations for 12 (92%) of the 13 medications in the DRUGDEX database, 26 (96%) of the 27 in the DPRF5, and all 16 (100%) of those in the Martindale database. Conclusions: One prominent tertiary drug information resource provided no drug dosage recommendations for patients undergoing CRRT. However, 2 of the databases in an Internet-based medical information application and the latest edition of a renal specialty drug information resource provided recommendations for a majority of the medications investigated. Most dosage recommendations were similar to those derived from the primary and secondary literature. The most recent edition of the DPRF is the preferred source of information when prescribing dosage regimens for patients receiving CRRT. PMID:22783029
Burnout in Otolaryngology-Head and Neck Surgery: A Single Academic Center Experience.
Geelan-Hansen, Katie; Anne, Samantha; Benninger, Michael S
2018-05-01
Burnout in modern medicine is becoming more recognized and researched. The objective in this study is to evaluate burnout in a tertiary care academic institution and compare results among faculty, trainees, and advanced practice practitioners (APPs) in a cross-sectional survey using the Maslach Burnout Inventory. Fifty-two surveys were distributed; 44 participants completed the survey (85%): 25 staff physicians (57%), 14 resident physicians (32%), and 5 nurse practitioners (11%). Staff physicians had low emotional exhaustion, moderate depersonalization, and low result for reduced personal accomplishments; trainees reported low emotional exhaustion, high depersonalization, and moderate reduced personal accomplishment; and nurse practitioners reported moderate on all 3 dimensions. There is overall low burnout in this tertiary care academic center of otolaryngologist providers and no difference in rates among the different groups (trainees, APPs, staff). Measures addressing specific deficiencies among dimensions of burnout would be helpful to prevent disintegration of physician satisfaction into burnout.
Adapting the academic motivation scale for use in pre-tertiary mathematics classrooms
NASA Astrophysics Data System (ADS)
Lim, Siew Yee; Chapman, Elaine
2015-09-01
The Academic Motivation Scale ( ams) is a comprehensive and widely used instrument for assessing motivation based on the self-determination theory. Currently, no such comprehensive instrument exists to assess the different domains of motivation (stipulated by the self-determination theory) in mathematics education at the pre-tertiary level (grades 11 and 12) in Asia. This study adapted the ams for this use and assessed the properties of the adapted instrument with 1610 students from Singapore. Exploratory and confirmatory factor analyses indicated a five-factor structure for the modified instrument (the three original ams intrinsic subscales collapsed into a single factor). Additionally, the modified instrument exhibited good internal consistency (mean α = .88), and satisfactory test-retest reliability over a 1-month interval (mean r xx = .73). The validity of the modified ams was further demonstrated through correlational analyses among scores on its subscales, and with scores on other instruments measuring mathematics attitudes, anxiety and achievement.
Co-isolation of Vahlkampfia and acanthamoeba in acanthamoeba-like keratitis in a Spanish population.
Arnalich-Montiel, Francisco; Lorenzo-Morales, Jacob; Irigoyen, Cristina; Morcillo-Laiz, Rafael; López-Vélez, Rogelio; Muñoz-Negrete, Francisco; Piñero, Jose E; Valladares, Basilio
2013-05-01
To report the co-isolation incidence of Acanthamoeba and Vahlkampfia in amoebic keratitis from a tertiary care institution in Madrid, Spain. In this retrospective case series, 7 eyes of 7 consecutive patients with culture-proven or polymerase chain reaction-positive Acanthamoeba keratitis were seen at a tertiary care institution from January 2010 to April 2011, and their charts were reviewed. Two of 7 patients showed mixed Acanthamoeba and Vahlkampfia keratitis. Good clinical response to the treatment was strongly correlated with early diagnosis, whereas delayed diagnosis resulted in poor response to the treatment in single or mixed infection. Co-isolation of Vahlkampfia and Acanthamoeba in Acanthamoeba-like keratitis has recently been detected in our population. This finding should raise awareness of the existence of other amoeba different from Acanthamoeba causing keratitis. There are not enough cases yet to determine the impact of mixed amoebic keratitis in the prognosis of this disease.
Radial Velocities of 41 Kepler Eclipsing Binaries
NASA Astrophysics Data System (ADS)
Matson, Rachel A.; Gies, Douglas R.; Guo, Zhao; Williams, Stephen J.
2017-12-01
Eclipsing binaries are vital for directly determining stellar parameters without reliance on models or scaling relations. Spectroscopically derived parameters of detached and semi-detached binaries allow us to determine component masses that can inform theories of stellar and binary evolution. Here we present moderate resolution ground-based spectra of stars in close binary systems with and without (detected) tertiary companions observed by NASA’s Kepler mission and analyzed for eclipse timing variations. We obtain radial velocities and spectroscopic orbits for five single-lined and 35 double-lined systems, and confirm one false positive eclipsing binary. For the double-lined spectroscopic binaries, we also determine individual component masses and examine the mass ratio {M}2/{M}1 distribution, which is dominated by binaries with like-mass pairs and semi-detached classical Algol systems that have undergone mass transfer. Finally, we constrain the mass of the tertiary component for five double-lined binaries with previously detected companions.
Mackuľak, Tomáš; Mosný, Michal; Škubák, Jaroslav; Grabic, Roman; Birošová, Lucia
2015-03-01
In this study we analyzed and characterized 29 psychoactive remedies, illicit drugs and their metabolites in single stages of wastewater treatment plants in the capital city of Slovakia. Psychoactive compounds were present within all stages, and tramadol was detected at a very high concentration (706 ng/L). Significant decreases of codeine, THC-COOH, cocaine and buprenorphine concentration were observed in the biological stage. Consequently, we were interested in the possibility of alternative tertiary post-treatment of effluent water with the following aquatic plants: Cabomba caroliniana, Limnophila sessiliflora, Egeria najas and Iris pseudacorus. The most effective plant for tertiary cleansing was I. pseudacorus which demonstrated the best pharmaceutical removal capacity. After 48 h codeine and citalopram was removed with 87% efficiency. After 96 h were all analyzed compounds were eliminated with efficiencies above 58%. Copyright © 2015 Elsevier B.V. All rights reserved.
Xenobiotics removal by adsorption in the context of tertiary treatment: a mini review.
Tahar, Alexandre; Choubert, Jean-Marc; Coquery, Marina
2013-08-01
Many xenobiotics, including several pharmaceuticals and pesticides, are poorly treated in domestic wastewater treatment plants. Adsorption processes, such as with activated carbons, could be a solution to curb their discharge into the aquatic environment. As adsorbent-like activated carbon is known to be expensive, identifying promising alternative adsorbent materials is a key challenge for efficient yet affordable xenobiotic removal from wastewaters. As part of the effort to address this challenge, we surveyed the literature on pharmaceutical and pesticide xenobiotics and built a database compiling data from 38 scientific publications covering 65 xenobiotics and 58 materials. Special focus was given to the relevance and comparability of the data to the characteristics of the adsorbent materials used and to the operating conditions of the batch tests inventoried. This paper gives an in-depth overview of the adsorption capacities of various adsorbents. The little data on alternative adsorbent materials, especially for the adsorption of pharmaceuticals, makes it difficult to single out any one activated carbon alternative capable of adsorbing pesticides and pharmaceuticals at the tertiary stage of treatment. There is a pressing need for further lab-scale experiments to investigate the tertiary treatment of discharged effluents. We conclude with recommendations on how future data should best be used and interpreted.
Tertiary structure-based analysis of microRNA–target interactions
Gan, Hin Hark; Gunsalus, Kristin C.
2013-01-01
Current computational analysis of microRNA interactions is based largely on primary and secondary structure analysis. Computationally efficient tertiary structure-based methods are needed to enable more realistic modeling of the molecular interactions underlying miRNA-mediated translational repression. We incorporate algorithms for predicting duplex RNA structures, ionic strength effects, duplex entropy and free energy, and docking of duplex–Argonaute protein complexes into a pipeline to model and predict miRNA–target duplex binding energies. To ensure modeling accuracy and computational efficiency, we use an all-atom description of RNA and a continuum description of ionic interactions using the Poisson–Boltzmann equation. Our method predicts the conformations of two constructs of Caenorhabditis elegans let-7 miRNA–target duplexes to an accuracy of ∼3.8 Å root mean square distance of their NMR structures. We also show that the computed duplex formation enthalpies, entropies, and free energies for eight miRNA–target duplexes agree with titration calorimetry data. Analysis of duplex–Argonaute docking shows that structural distortions arising from single-base-pair mismatches in the seed region influence the activity of the complex by destabilizing both duplex hybridization and its association with Argonaute. Collectively, these results demonstrate that tertiary structure-based modeling of miRNA interactions can reveal structural mechanisms not accessible with current secondary structure-based methods. PMID:23417009
Topological Constraints and Their Conformational Entropic Penalties on RNA Folds.
Mak, Chi H; Phan, Ethan N H
2018-05-08
Functional RNAs can fold into intricate structures using a number of different secondary and tertiary structural motifs. Many factors contribute to the overall free energy of the target fold. This study aims at quantifying the entropic costs coming from the loss of conformational freedom when the sugar-phosphate backbone is subjected to constraints imposed by secondary and tertiary contacts. Motivated by insights from topology theory, we design a diagrammatic scheme to represent different types of RNA structures so that constraints associated with a folded structure may be segregated into mutually independent subsets, enabling the total conformational entropy loss to be easily calculated as a sum of independent terms. We used high-throughput Monte Carlo simulations to simulate large ensembles of single-stranded RNA sequences in solution to validate the assumptions behind our diagrammatic scheme, examining the entropic costs for hairpin initiation and formation of many multiway junctions. Our diagrammatic scheme aids in the factorization of secondary/tertiary constraints into distinct topological classes and facilitates the discovery of interrelationships among multiple constraints on RNA folds. This perspective, which to our knowledge is novel, leads to useful insights into the inner workings of some functional RNA sequences, demonstrating how they might operate by transforming their structures among different topological classes. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Robertson, Alastair; Unlügenç, Ülvi Can; İnan, Nurdan; Ta ṡli, Kemal
2004-01-01
The Mid-Tertiary (Mid-Eocene to earliest Miocene) Misis-Andırın Complex documents tectonic-sedimentary processes affecting the northerly, active margin of the South Tethys (Neotethys) in the easternmost Mediterranean region. Each of three orogenic segments, Misis (in the SW), Andırın (central) and Engizek (in the NE) represent parts of an originally continuous active continental margin. A structurally lower Volcanic-Sedimentary Unit includes Late Cretaceous arc-related extrusives and their Lower Tertiary pelagic cover. This unit is interpreted as an Early Tertiary remnant of the Mesozoic South Tethys. The overlying melange unit is dominated by tectonically brecciated blocks (>100 m across) of Mesozoic neritic limestone that were derived from the Tauride carbonate platform to the north, together with accreted ophiolitic material. The melange matrix comprises polymict debris flows, high- to low-density turbidites and minor hemipelagic sediments. The Misis-Andırın Complex is interpreted as an accretionary prism related to the latest stages of northward subduction of the South Tethys and diachronous continental collision of the Tauride (Eurasian) and Arabian (African) plates during Mid-Eocene to earliest Miocene time. Slivers of Upper Cretaceous oceanic crust and its Early Tertiary pelagic cover were accreted, while blocks of Mesozoic platform carbonates slid from the overriding plate. Tectonic mixing and sedimentary recycling took place within a trench. Subduction culminated in large-scale collapse of the overriding (northern) margin and foundering of vast blocks of neritic carbonate into the trench. A possible cause was rapid roll back of dense downgoing Mesozoic oceanic crust, such that the accretionary wedge taper was extended leading to gravity collapse. Melange formation was terminated by underthrusting of the Arabian plate from the south during earliest Miocene time. Collision was diachronous. In the east (Engizek Range and SE Anatolia) collision generated a Lower Miocene flexural basin infilled with turbidites and a flexural bulge to the south. Miocene turbiditic sediments also covered the former accretionary prism. Further west (Misis Range) the easternmost Mediterranean remained in a pre-collisional setting with northward underthrusting (incipient subduction) along the Cyprus arc. The Lower Miocene basins to the north (Misis and Adana) indicate an extensional (to transtensional) setting. The NE-SW linking segment (Andırın) probably originated as a Mesozoic palaeogeographic offset of the Tauride margin. This was reactivated by strike-slip (and transtension) during Later Tertiary diachronous collision. Related to on-going plate convergence the former accretionary wedge (upper plate) was thrust over the Lower Miocene turbiditic basins in Mid-Late Miocene time. The Plio-Quaternary was dominated by left-lateral strike-slip along the East Anatolian transform fault and also along fault strands cutting the Misis-Andırın Complex.
Biomaterials and the U.S. Navy.
1984-07-10
one lipid film adsorbed on a solid substrate ( Langmuir - Blodgett films). By this method diffusion of the lipid molecules could be studied. It was also...produces a potent emulsifier, allowing utilization of liquid hydrocarbons, such as decane, dodecane, tetradecane, or hexadecane. The strain also...efficiency 0 L -2%). Even though the tertiary structure of rhodopsin is known to a 7A -16- understand collagen. They prepared poly L proline, a single
Nobile, Stefano; Gnocchini, Francesco; Pantanetti, Marco; Battistini, Paola; Carnielli, Virgilio P
2014-01-01
To report the impact of the adoption of a low oxygen saturation policy on retinopathy of prematurity (ROP) incidence at a single tertiary care center. ROP incidence, procedures for ROP, and neonatal outcome among very low birth weight infants were compared before and after the adoption of a low saturation policy, which took place in 2004. The Mann– Whitney test was performed to look for differences. The incidence of severe ROP significantly decreased from 5.3% of live very low birth weight infants between 1999 and 2004 to 1% of live very low birth weight infants between 2005 and 2012 (P = .003). The use of laser therapy for severe ROP between the same periods significantly decreased from 6.4% of live very low birth weight infants between 1999 and 2004 to 0.6% of live very low birth weight infants between 2005 and 2012 (P = .002). There was also a significant reduction of death or bronchopulmonary dysplasia from 33.8% between 1999 and 2004 to 24.2% between 2005 and 2012 (P = .02). Trained personnel and low and tailored oxygen saturation intervals for very low birth weight infants could play a pivotal role in reducing the incidence of severe ROP without increasing mortality.
The debate over the Cretaceous-Tertiary boundary
NASA Technical Reports Server (NTRS)
Alvarez, W.; Asaro, F.; Alvarez, L. W.; Michel, H. V.
1988-01-01
Large-body impact on the Earth is a rare but indisputable geologic process. The impact rate is approximately known from objects discovered in Earth-crossing orbits and from the statistics of craters on the Earth's surface. Tektite and microtektite strewn fields constitute unmistakable ejecta deposits that can be due only to large-body impacts. The Cretaceous-Tertiary (K-T) boundary coincides with an unusually severe biological trauma, and this stratigraphic horizon is marked on a worldwide basis by anomalous concentrations of noble metals in chondritic proportions, mineral spherules with relict quench-crystallization textures, and mineral and rock grains showing shock deformation. These features are precisely compatible with an impact origin. Although only impact explains all the types of K-T boundary evidence, the story may not be as simple as once thought. The original hypothesis envisioned one large impact, triggering one great extinction. Newer evidence hints at various complications. Different challenges are faced by the occupants of each apex of a three-cornered argument over the K-T event. Proponents of a non-impact explanation must show that the evidence fits their preferred model better than it fits the impact scenario. Proponents of the single impact-single extinction view must explain away the complications. Proponents of a more complex impact crisis must develop a reasonable scenario which honors the new evidence.
Javali, Mahendra; Acharya, Purushottam; Mehta, Aneesh; John, Aju Abraham; Mahale, Rohan; Srinivasa, R
2017-10-01
CNS infections like meningitis and encephalitis pose enormous healthcare challenges due to mortality, sequelae and socioeconomic burden. In tertiary setting, clinical, microbiological, cytological and radiological investigations are not distinctive enough for diagnosing microbial etiology. Molecular diagnostics is filling this gap. We evaluated the clinical impact of a commercially available multiplex molecular diagnostic system - SES for diagnosing suspected CNS infections. This study was conducted in our tertiary level Neurology ICU. 110 patients admitted during Nov-2010 to April-2014 were included. CSF samples of patients clinically suspected of having CNS infections were subjected to routine investigation in our laboratory and SES test at XCyton Diagnostics. We studied the impact of SES in diagnosis of CNS infections and its efficacy in helping therapeutic management. SES showed detection rate of 42.18% and clinical specificity of 100%. It had 10 times higher detection rate than conventional tests. Streptococcus pneumoniae and Mycobacterium tuberculosis were two top bacterial pathogens. VZV was most detected viral pathogen. SES results elicited changes in therapy in both positive and negative cases. We observed superior patient outcomes as measured by GCS scale. 75% and 82.14% of the patients positive and negative on SES respectively, recovered fully. Detecting causative organism and ruling out infectious etiology remain the most critical aspect for management and prognosis of patients with suspected CNS infections. In this study, we observed higher detection rate of pathogens, target specific escalation and evidence based de-escalation of antimicrobials using SES. Institution of appropriate therapy helped reduce unnecessary use of antimicrobials. Copyright © 2017 Elsevier B.V. All rights reserved.
Back to the future: A practice led transition program from Assistant in Nursing to Enrolled Nurse.
Faithfull-Byrne, Annette; Thompson, Lorraine; Welch, Tony; Williamson, Moira; Schafer, Keppel; Hallinan, Claire
2017-01-01
Continuing professional development is an essential element in professional nursing practice. In our Hospital and Health service, a gap in existing nursing pathways was identified for Assistants in Nursing (AINs), who wished to further their career in nursing and progress to Enrolled Nurse (EN). There is also little in the literature that addresses Assistants in Nursing wishing to progress their career to Enrolled Nurses. This article describes a quality improvement project designed to address this gap. The project was a collaborative venture between a Queensland Hospital and Health Service and an Institute of Tertiary and Further Education (TAFE). The focus was on creating a flexible career path for Assistants in Nursing, wishing to become Enrolled Nurses. The project resulted in the Diploma of Nursing program (theory and practice) being delivered within the hospital setting by nurse educators and clinical nurse consultants. This is unusual in that the program is normally delivered in the tertiary setting, by academic staff from the Institute of Further Education. Program implementation is described along with the challenges encountered. Outcomes from the project were: 78% completion rate; 100% employment on completion of their course of study; and 18% progressing to further their education such as Advance Enrolled Nurse or Registered Nurse. Student satisfaction regarding the program was also positive. The initiative established a local career path for Assistants in Nursing wishing to progress to Enrolled Nurse. This quality project demonstrates that collaborative ventures between the tertiary sector and hospital and health services, can create innovative flexible solutions for staff wishing to further their career in nursing. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Cogné, Nathan; Cobbold, Peter R.; Riccomini, Claudio; Gallagher, Kerry
2013-03-01
In southeastern Brazil, a series of onshore Tertiary basins provides good evidence for post-rift tectonic activity. So as better to constrain their tectonic setting, we have revisited outcrops in the Taubaté and Resende basins and have reinterpreted 11 seismic profiles of the Taubaté Basin. Where Eocene to Oligocene strata crop out, syn-sedimentary faults are common and their senses of slip are mainly normal. In contrast, for two outcrops in particular, where syn-sedimentary faults have put Precambrian crystalline basement against Eocene strata, senses of slip are strongly left-lateral, as well as normal. Thus we distinguish between thin-skinned and thick-skinned faulting. Furthermore, at four outcrops, Precambrian basement has overthrust Tertiary or Quaternary strata. On the seismic profiles, basal strata onlap basement highs. Structures and stratigraphic relationships are not typical of a rift basin. Although normal faults are common, they tend to be steeply dipping, their stratigraphic offsets are small (tens of metres) and the faults do not bound large stratigraphic wedges or tilted blocks. At the edges of the basin, Eocene or Oligocene strata dip basinward, have been subject to exhumation, and in places form gentle anticlines, so that we infer post-Oligocene inversion. We conclude that, after an earlier phase of deformation, probably during the Late Cretaceous, the Taubaté Basin formed under left-lateral transtension during the Palaeogene, but was subject to right-lateral transpression during the Neogene. Thus the principal directions of stress varied in time. Because they did so consistently with those of the adjacent regions, as well as those of the Incaic and Quechua phases of Andean orogeny, we argue that the Tertiary basins of southeast Brazil have resulted from reactivation of Precambrian shear zones under plate-wide stress.
Primary Immunodeficiency Diseases in Oman: 10-Year Experience in a Tertiary Care Hospital.
Al-Tamemi, Salem; Naseem, Shafiq Ur Rehman; Al-Siyabi, Nabila; El-Nour, Ibtisam; Al-Rawas, Abdulhakim; Dennison, David
2016-11-01
Primary immunodeficiency (PID) diseases are rare, complex medical disorders that often are overlooked in clinical settings. There are emerging reports of PID from Middle Eastern populations. This study describes the features of PID patients in a tertiary care setting in Oman and compares them with regional and worldwide reports. Sultan Qaboos University Hospital (SQUH) is an academic tertiary care-level hospital for specialized healthcare, including PID patients. At the time of diagnosis, patients' sociodemographics, clinical features, laboratory investigations, and management were entered in electronic form. This study included patients seen between August 2005 and July 2015. One hundred forty patients were registered with a minimum estimated population prevalence of 7.0/100,000. The male/female ratio was 1.6:1, the median age of onset of symptoms was 8 months, and diagnosis was 21 months with a delay of 13 months. Family history was positive in 44 %, consanguinity was present in 76 %, death of a previous sibling was present in 36 %, and there was an overall mortality in 18 %, with an 85 % probability of survival 10 years following diagnosis. The most common type of immunodeficiency was phagocytic disorders (35.0 %), followed by predominantly antibody disorders (20.7 %), combined immunodeficiency (17.8 %), other well-defined PID syndromes (15.0 %), immune dysregulation syndromes (3.5 %), complement deficiencies (3.5 %), and unclassified immunodeficiency (4.2 %). The commonest presenting infection was pneumonia (47.1 %). PID is not a rare condition in Oman. The prevalence is in concordance with reports from the region but higher than in Western populations. The findings of the current study would help to improve the awareness and management of, and policy making for PID.
Seo, Ja Young; Park, Hyung-Doo; Kim, Jong Won; Oh, Hyeon Ju; Yang, Jeong Soo; Chang, Yun Sil; Park, Won Soon; Lee, Soo-Youn
2014-01-01
Newborn screening for congenital adrenal hyperplasia (CAH) based on measuring 17-hydroxyprogesterone (17-OHP) by immunoassay generates a number of false-positive results, especially in preterm neonates. We applied steroid profiling by using liquid chromatography-tandem mass spectrometry (LC-MS/MS) as a second-tier test in newborns with positive CAH screening and evaluated its clinical utility in a tertiary care hospital setting. By performing a 4-year retrospective data review, we were able to test 121 dried blood spots from newborns with positive CAH screening for 17-OHP, androstenedione and cortisol levels by LC-MS/MS. We prospectively evaluated the clinical utility of steroid profiling after the implementation of steroid profiling as a second-tier test in our routine clinical practice. During the 2-year prospective study period, 104 cases with positive initial screening by FIA were tested by LC-MS/MS. Clinical and laboratory follow-up were performed for at least 6 months. The preterm neonates accounted for 50.7% (76/150) and 70.4% (88/125) of screening-positive cases in retrospective and prospective cohorts, respectively. By applying steroid profiling as a second-tier test for positive CAH screening, we eliminated all false-positive results and decreased the median follow-up time from 75 to 8 days. Our data showed that steroid profiling reduced the burden of follow-up exams by improving the positive predictive value of the CAH screening program. The use of steroid profiling as a second-tier test for positive CAH screening will improve clinical practice particularly in a tertiary care hospital setting where positive CAH screening from preterm neonates is frequently encountered.
Simm, Peter J; Wong, Nicole; Fraser, Lynne; Kearney, John; Fenton, Judy; Jachno, Kim; Cameron, Fergus J
2014-06-01
Young people with type 1 diabetes mellitus living in rural and regional Australia have previously been shown to have limited access to specialised diabetes services. The Royal Children's Hospital Melbourne has been running diabetes outreach clinics to Western Victoria, Australia, for over 13 years. We aim to evaluate this service by comparing the outcomes of three outreach clinics with our urban diabetes clinic at the Royal Children's Hospital Melbourne. We examine our tertiary, multidisciplinary team-based model of care, where visiting specialist medical staff work alongside local allied health teams. The local teams provide interim care between clinics utilising the same protocols and treatment practices as the tertiary centre. Longitudinal data encapsulating the years 2005-2010, as a cohort study with a control group, are reviewed. A total of 69 rural patients were compared with 1387 metropolitan patients. Metabolic control was comparable, with no difference in mean HbA1c (8.3%/67 mmol/mol for both groups). Treatment options varied slightly at diagnosis, while insulin pump usage was comparable between treatment settings (20.3% rural compared with 27.6% urban, P = 0.19). Of note was that the number of visits per year was higher in the rural group (3.3 per year rural compared with 2.7 urban, P < 0.001). We conclude that the outreach service is able to provide a comparable level of care when the urban model is translated to a rural setting. This model may be further able to be extrapolated to other geographic areas and also other chronic health conditions of childhood. © 2014 The Authors. Journal of Paediatrics and Child Health © 2014 Paediatrics and Child Health Division (Royal Australasian College of Physicians).
ERIC Educational Resources Information Center
McCurdy, Susan M.; Zegwaard, Karsten E.; Dalgety, Jacinta
2013-01-01
Concept understanding, the development of analytical skills and a research mind set are explored through the use of academic tools common in a tertiary science education and relevant work-integrated learning (WIL) experiences. The use and development of the tools; laboratory book, technical report, and literature review are examined by way of…
ERIC Educational Resources Information Center
Hodgson, Ann; Spours, Ken
2010-01-01
Ensuring effective progression from vocational qualifications to higher education has become an important issue internationally as a part of government strategies to raise skill levels and to provide more equitable access to tertiary level study. From September 2008, the Government in England has begun to introduce a new set of qualifications for…
ERIC Educational Resources Information Center
Shallcross, D. E.; Harrison, T. G.; Shaw, A. J.; Shallcross, K. L.; Croker, S. J.; Norman, N. C.
2013-01-01
Two summer schools focused on practical chemistry, one involving secondary school students and one involving visually impaired adults (i.e., not involving undergraduates) have produced students that appeared to be on the way to achieving the basic criteria set out by Buckley and Kempa (1971) in terms of practical skills. These criteria being that…
ERIC Educational Resources Information Center
Kung, Fan-Wei
2017-01-01
The advancement of computer technologies has brought a plethora of technological innovations in educational settings. It is no exception in teacher training and education programmes around the world as the growth of professionalism has made the distance doctoral programmes possible for mid-career English language teaching (ELT) practitioners. The…
ERIC Educational Resources Information Center
Wong, Ruth M. H.
2008-01-01
English competency is known as one of the crucial skills in various social contexts in Hong Kong. In tertiary educational setting, English courses do not focus solely on the development of the four language skills. Rather, they put emphasis on the application of English Language for academic use or instrumental use. This paper will investigate the…
Exploring the Oral Communication Strategies Used by Turkish EFL Learners: A Mixed Methods Study
ERIC Educational Resources Information Center
Demir, Yusuf; Mutlu, Gülçin; Sisman, Yavuz Selim
2018-01-01
This study set out with a threefold purpose: to examine (1) the oral communication strategies (CSs) employed by tertiary-level Turkish EFL learners, (2) the use of CSs based on exposure to English through audio-visual tools, university subject domain and gender differences, (3) the correlation between use of CSs and oral proficiency scores. To…
ERIC Educational Resources Information Center
Majeika, Caitlyn E.; Walder, Jessica P.; Hubbard, Jessica P.; Steeb, Kelly M.; Ferris, Geoffrey J.; Oakes, Wendy P.; Lane, Kathleen Lynne
2011-01-01
A comprehensive, integrated, three-tiered model (CI3T) of prevention is a framework for proactively meeting students' academic, behavioral, and social skills. At the tertiary (Tier 3) level of prevention, functional-assessment based interventions (FABIs) may be used to identify, develop, and implement supports based on the function, or purpose, of…
Perceived Views of Language Teachers on the Use of Needs Analysis in ESP Materials Writing
ERIC Educational Resources Information Center
Ali, Holi Ibrahim Holi; Salih, Abdel Rahman Abdalla
2013-01-01
Needs analysis is generally believed to be important in ESP/EAP context because it enables practitioners and materials writers to find out about their real learners' needs. Therefore, this study is set out to investigate EFL teachers' beliefs and views about need analysis use and practices, specifically in the ESP/EAP tertiary context of the…
ERIC Educational Resources Information Center
Oh, Eunjou
2016-01-01
The present study investigated the relative contributions of vocabulary knowledge, grammar knowledge, and processing speed to second language listening and reading comprehension. Seventy-five Korean university students participated in the study. Results showed the three tested components had a significant portion of shared variance in explaining…
ERIC Educational Resources Information Center
Suess, Alyssa N.; Romani, Patrick W.; Wacker, David P.; Dyson, Shannon M.; Kuhle, Jennifer L.; Lee, John F.; Lindgren, Scott D.; Kopelman, Todd G.; Pelzel, Kelly E.; Waldron, Debra B.
2014-01-01
We conducted a retrospective, descriptive evaluation of the fidelity with which parents of three children with autism spectrum disorders conducted functional communication training (FCT) in their homes. All training was provided to the parents via telehealth by a behavior consultant in a tertiary-level hospital setting. FCT trials coached by the…
ERIC Educational Resources Information Center
Okumura, Shinji
2016-01-01
This study describes an attempt of using an educational social networking platform, which is called Edmodo, for English language learning outside classrooms at tertiary level. Considering the notion of communicative competence, the instructor incorporated Edmodo into his English classes as a project which is a formal assignment. In the project,…
Harris, Susan; Buchinski, Bev; Gryzbowski, Stefan; Janssen, Patti; Mitchell, G.W. Erle; Farquharson, Duncan
2000-01-01
This article describes a program developed to improve the process of planned induction of labour and to reduce the rates of inappropriate induction. The setting is a tertiary-care maternity hospital in urban Vancouver, BC, in which 7000 deliveries take place annually. Approximately 65% of these can be considered primary care; the remainder are secondary- or tertiary-level cases. Continuous quality improvement (CQI) methods were used by a multidisciplinary team, which included nursing staff, physicians, health records personnel and a CQI facilitator. Interventions included the development of a new induction-booking process, clear criteria for induction, feedback to caregivers about changes and a peer review system to oversee and maintain improvement. The overall induction rate for the institution decreased, and this change has been maintained. PMID:11079064
Progression of major depression during pregnancy and postpartum: a preliminary study.
Shivakumar, Geetha; Johnson, Neysa L; McIntire, Donald D; Leveno, Kenneth
2014-04-01
The purpose of this pilot study was to investigate major depressive symptoms among a high-risk group of pregnant women managed at a tertiary care setting. The study prospectively evaluated pregnant women who met DSM-IV criteria for a major depressive episode (MDE). Psychiatric measures for depression, anxiety and social impairment were administered at monthly intervals during pregnancy and immediate postpartum period. Twenty-four women provided longitudinal data from mid pregnancy to 2 months of postpartum period. 86% of women were clinically symptomatic at the beginning of study during pregnancy and only 32% remained clinically symptomatic at 2 months following delivery reaching. This difference reached a statistical significance level p < 0.001. Pregnant women with prior histories of major depression, comorbid anxiety disorder, histories of domestic violence, and those with uninvolved spouse or partners were more at-risk to be clinically symptomatic in the immediate postpartum period. In a group consisting of largely Latina women at a tertiary care setting, progression of major depression when treated with antidepressant medication(s) is that of an improvement from pregnancy to immediate postpartum period. Further longitudinal studies are needed to assess impact of clinical characteristics and treatment on major depression in larger diverse obstetric group.
Wood, Laura D; Salaria, Safia N; Cruise, Michael W; Giardiello, Francis M; Montgomery, Elizabeth A
2014-03-01
Patients with familial adenomatous polyposis (FAP), an autosomal dominant cancer predisposition syndrome caused by mutations in the APC gene, develop neoplasms in both the upper and lower gastrointestinal (GI) tract. To clarify the upper GI tract lesions in FAP patients in a tertiary care setting, we reviewed specimens from 321 endoscopies in 66 patients with FAP. Tubular adenomas in the small bowel were the most common neoplasms (present in 89% of patients), although only 1 patient developed invasive carcinoma of the small bowel. Several types of gastric neoplasms were identified--65% of patients had at least 1 fundic gland polyp, and 23% of patients had at least 1 gastric foveolar-type gastric adenoma. Pyloric gland adenomas were also enriched, occurring in 6% of patients--this is a novel finding in FAP patients. Despite the high frequency of gastric neoplasms, only 1 patient developed carcinoma in the stomach. The very low frequency of carcinoma in these patients suggests that current screening procedures prevent the vast majority of upper GI tract carcinomas in patients with FAP, at least in the tertiary care setting.
Allander, Kip K.; Berger, David L.
2009-01-01
To better understand how proposed large-scale water withdrawals in Snake Valley may affect the water resources and hydrologic processes in the Great Basin National Park, the National Park Service needs to have a better understanding of the relations between streamflow and groundwater flow through alluvium and karst topography of the Pole Canyon Limestone. Information that is critical to understanding these relations is the thickness of alluvial deposits that overlay the Pole Canyon Limestone. In mid-April 2009, the U.S. Geological Survey and National Park Service used seismic refraction along three profiles adjacent to Baker Creek to further refine understanding of the local geology. Two refractors and three distinct velocity layers were detected along two of the profiles and a single refractor and two distinct velocity layers were detected along a third profile. In the unsaturated alluvium, average velocity was 2,000 feet per second, thickness ranged from about 7 to 20 feet along two profiles downstream of the Narrows, and thickness was at least 100 feet along a single profile upstream of the Narrows. Saturated alluvium was only present downstream of the Narrows - average velocity was 4,400 feet per second, and thickness ranged from about 40 to 110 feet. The third layer probably represented Pole Canyon Limestone or Tertiary granitic rock units with an average velocity of 12,500 feet per second. Along the upstream and middle profiles (profiles 3 and 1, respectively), the depth to top of the third layer ranged from at least 60 to 110 feet below land surface and is most likely the Pole Canyon Limestone. The third layer at the farthest downstream profile (profile 2) may be a Tertiary granitic rock unit. Baker Creek is disconnected from the groundwater system along the upstream profile (profile 3) and streamflow losses infiltrate vertically downward to the Pole Canyon Limestone. Along the downstream and middle profiles (profiles 2 and 1, respectively), the presence of a shallow water table indicates that low permeability Tertiary granitic rock may extend across the Baker Creek Drainage intersecting the Pole Canyon Limestone. The Tertiary granitic rock may be acting as a barrier to groundwater flow within the Pole Canyon Limestone.
Graystone, H J; Garner, M J; Baldwin, D S
2009-04-01
Social phobia is a common, persistent and disabling anxiety disorder in which co-existing depressive symptoms are common. However the prevalence of social anxiety symptoms in patients with other mood and anxiety disorders is uncertain. In consecutive patients attending a tertiary referral mood and anxiety disorders service, depressive symptoms were assessed by the Montgomery-Asberg Depression Rating Scale (MADRS) and social anxiety symptoms by the Liebowitz Social Anxiety Scale (LSAS). The Clinical Global Impression of Severity (CGI-S) was completed following the appointment. 75 patients (48 women, 27 men; mean age 45.9 years) completed the study. 38 had a single diagnosis and 37 co-morbid diagnoses: 15 patients had bipolar disorder, 35 unipolar depressive disorder, 19 an anxiety disorder, and 6 other disorders. Independent samples t-tests and one-way between-subjects ANOVA revealed that the severity of social anxiety symptoms but not depressive symptoms was significantly greater in patients with co-morbid diagnoses (LSAS 73.7 vs 54.2, t(72)=2.44, p<.05; MADRS 21.9 vs 18.0, t(73)=1.76, p=.08; CGI-S 3.7 vs 3.2, t(73)=2.64, p<.05); and in anxiety disorders than in unipolar depression or bipolar disorder (respectively; LSAS 78.8 vs 59.4 vs 50.0, F(2, 65)=3.13, p=.05; MADRS 22.2 vs 19.8 vs 17.5, F(2, 66)<1, ns; CGI-S 3.9 vs 3.3 vs 3.1, F(2, 66)=5.43, p<.01). In the overall sample, correlation coefficients were MADRS and LSAS, R(2)=0.2628, p<.001; MADRS and CGI-S, R(2)=0.5863, p<.001; and LSAS and CGI-S, R(2)=0.327, p<.001. Correlations between MADRS and LSAS scores were higher in bipolar disorder (R(2)=0.4900, p<.01) than in unipolar depression (R(2)=0.376, p<.01) or anxiety disorders (R(2)=0.0041, ns). Small size of convenience sample undergoing varying treatments within a single specialist tertiary referral centre. There was only a moderate correlation between depressive and social anxiety symptoms across a range of diagnoses. Depressive and social anxiety symptoms were most severe but least well correlated among tertiary care outpatients with anxiety disorders, emphasising the need for comprehensive evaluation and treatment.
Rajgaria, R.; Wei, Y.; Floudas, C. A.
2010-01-01
An integer linear optimization model is presented to predict residue contacts in β, α + β, and α/β proteins. The total energy of a protein is expressed as sum of a Cα – Cα distance dependent contact energy contribution and a hydrophobic contribution. The model selects contacts that assign lowest energy to the protein structure while satisfying a set of constraints that are included to enforce certain physically observed topological information. A new method based on hydrophobicity is proposed to find the β-sheet alignments. These β-sheet alignments are used as constraints for contacts between residues of β-sheets. This model was tested on three independent protein test sets and CASP8 test proteins consisting of β, α + β, α/β proteins and was found to perform very well. The average accuracy of the predictions (separated by at least six residues) was approximately 61%. The average true positive and false positive distances were also calculated for each of the test sets and they are 7.58 Å and 15.88 Å, respectively. Residue contact prediction can be directly used to facilitate the protein tertiary structure prediction. This proposed residue contact prediction model is incorporated into the first principles protein tertiary structure prediction approach, ASTRO-FOLD. The effectiveness of the contact prediction model was further demonstrated by the improvement in the quality of the protein structure ensemble generated using the predicted residue contacts for a test set of 10 proteins. PMID:20225257
BOREAS Soils Data over the SSA in Raster Format and AEAC Projection
NASA Technical Reports Server (NTRS)
Knapp, David; Rostad, Harold; Hall, Forrest G. (Editor)
2000-01-01
This data set consists of GIS layers that describe the soils of the BOREAS SSA. The original data were submitted as vector layers that were gridded by BOREAS staff to a 30-meter pixel size in the AEAC projection. These data layers include the soil code (which relates to the soil name), modifier (which also relates to the soil name), and extent (indicating the extent that this soil exists within the polygon). There are three sets of these layers representing the primary, secondary, and tertiary soil characteristics. Thus, there is a total of nine layers in this data set along with supporting files. The data are stored in binary, image format files.
Thermochronological evidence for polyphase post-rift reactivation in SE Brazil
NASA Astrophysics Data System (ADS)
Cogné, N.; Gallagher, K.; Cobbold, P. R.; Riccomini, C.
2012-04-01
The continental margin of SE Brazil shows good evidence for tectonic activity well after the break-up of Western Gondwana (see Cobbold et al., 2001 for a review). Additionally, SE Brazil ranks as an HEPM (high elevation passive margin), summits reaching 2800 m. To constrain the onshore evolution of the margin, especially during the Tertiary, we did a new thermochronological and structural study. After an initial regional study, during which we found additional evidence for a major phase of exhumation during the Late Cretaceous to Early Tertiary (Cogné et al., 2011), we focussed on a region that was clearly subject to Tertiary tectonics. This region includes the Tertiary Taubaté basin and the adjacent Serra do Mar and Serra da Mantiqueira. We used two thermochronolgical methods on the same samples, apatite fission tracks (AFT) and U-Th/He on apatite (AHe). AFT ages range from 129.3±4.3 Ma to 60.7±1.9 Ma with mean track lengths (MTL) from 14.31±0.24 μm to 11.41±0.23 μm, whereas AHe ages range from 519.6±16.6 to 10.1±0.1 Ma. A subset of AHe ages, selected on the basis of data consistency and geological arguments, has a smaller range (122.4±2.5 to 45.1±1.5 Ma). We have combined inverse and forward modelling to assess the range of acceptable thermal histories. Results of inverse modelling confirm our earlier study by showing a Late Cretaceous phase of cooling. Around the onshore Taubaté Basin, for a limited number of samples, another period of cooling occurred during the Early Tertiary, around the time when the basin formed. The inferred thermal histories for most of the samples also imply a later reheating, followed by a Neogene cooling. According to forward modelling, the evidence for reheating seems to be robust around the margins of the Taubaté Basin, but elsewhere the data cannot really discriminate between this and a less complex thermal history. However forward modelling and geologically independent information support the conclusion that the whole area cooled and uplifted during the Neogene. The synchronicity of the cooling phases with tectonic pulses in the Andes and in NE Brazil, as well as the tectonic setting of the Tertiary basins (Cogné et al., submitted) lead us to attribute these phases to a plate-wide compressive stress, which reactivated inherited structures during the Late Cretaceous and Tertiary. The relief of the margin is therefore due, more to polyphase post-rift reactivation and uplift, than to rifting itself. - Cobbold, P.R., Meisling, K.E., Mount, V.S., 2001. Reactivation of an obliquely rifted margin, Campos and Santos Basins, Southeastern Brazil. AAPG Bulletin 85, 1925-1944. - Cogné, N., Gallagher, K., Cobbold, P.R., 2011. Post-rift reactivation of the onshore margin of southeast Brazil: Evidence from apatite (U-Th)/He and fission-track data. Earth and Planetary Science Letters 309, 118-130. - Cogné, N., Cobbold, P.R., Riccomini, C., Gallagher, K. Tectonic setting of the Taubaté basin (southeastern Brazil): insights from regional seismic profiles and outcrop data. Submitted to Journal of South American Earth Sciences.
Sood, Neeraj; Wagner, Zachary
2016-01-01
Objectives To evaluate the effects of a government insurance programme covering tertiary care for the poor in Karnataka, India—Vajpayee Arogyashree Scheme (VAS)—on treatment seeking and postoperative outcomes. Design Geographic regression discontinuity. Setting 572 villages in Karnataka, India. Participants 3478 households in 300 villages where VAS was implemented and 3486 households in 272 neighbouring matched villages ineligible for VAS. Intervention A government insurance programme that provided free tertiary care to households below the poverty line in half of villages in Karnataka from February 2010 to August 2012. Main outcome measure Seeking treatment for symptoms, posthospitalisation well-being, occurrence of infections during hospitalisation and need for rehospitalisation. Results The prevalence of symptoms was nearly identical for households in VAS-eligible villages compared with households in VAS-ineligible villages. However, households eligible for VAS were 4.96 percentage points (95% CI 1 to 8.9; p=0.014) more likely to seek treatment for their symptoms. The increase in treatment seeking was more pronounced for symptoms of cardiac conditions, the condition most frequently covered by VAS. Respondents from VAS-eligible villages reported greater improvements in well-being after a hospitalisation in all categories assessed and they were statistically significant in 3 of the 6 categories (walking ability, pain and anxiety). Respondents eligible for VAS were 9.4 percentage points less likely to report any infection after their hospitalisation (95% CI −20.2 to 1.4; p=0.087) and 16.5 percentage points less likely to have to be rehospitalised after the initial hospitalisation (95% CI −28.7 to −4.3; p<0.01). Conclusions Insurance for tertiary care increased treatment seeking among eligible households. Moreover, insured patients experienced better posthospitalisation outcomes, suggesting better quality of care received. These results suggest that there are several pathways through which tertiary care insurance could improve health, aside from increasing utilisation of the services that the programme directly subsidises. PMID:26739744
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Chun-Hwey; Song, Mi-Hwa; Yoon, Jo-Na
A photometric study of BD And was made through the analysis of two sets of new BVR light curves. The light curves with migrating photometric waves outside eclipse show that BD And is a short-period RS CVn-type binary star. The analysis of all available timings reveals that the orbital period has varied in a strictly cyclical way with a period of 9.2 yr. The periodic variation most likely arises from the light-time effect due to a tertiary moving in a highly elliptical orbit (e {sub 3} = 0.76). The Applegate mechanism could not operate properly in the eclipsing pair. Themore » light curves were modeled with two large spots on the hotter star and a large third light amounting to about 14% of the total systemic light. BD And is a triple system: a detached binary system consisting of two nearly equal solar-type stars with an active primary star and a G6-G7 tertiary dwarf. The absolute dimensions of the eclipsing pair and tertiary components were determined. The three components with a mean age of about 5.8 Gyr are located at midpositions in main-sequence bands. The radius of the secondary is about 17% larger than that deduced from stellar models. The orbital and radiometric characteristics of the tertiary are intensively investigated. One important feature is that the mutual inclination between two orbits is larger than 60°, implying that Kozai cycles had occurred very efficiently in the past. The possible past and future evolutions of the BD And system, driven by KCTF and MBTF, are also discussed.« less
Thermodynamic Origins of Monovalent Facilitated RNA Folding
Holmstrom, Erik D.; Fiore, Julie L.; Nesbitt, David J.
2012-01-01
Cations have long been associated with formation of native RNA structure and are commonly thought to stabilize the formation of tertiary contacts by favorably interacting with the electrostatic potential of the RNA, giving rise to an “ion atmosphere”. A significant amount of information regarding the thermodynamics of structural transitions in the presence of an ion atmosphere has accumulated and suggests stabilization is dominated by entropic terms. This work provides an analysis of how RNA–cation interactions affect the entropy and enthalpy associated with an RNA tertiary transition. Specifically, temperature-dependent single-molecule fluorescence resonance energy transfer studies have been exploited to determine the free energy (ΔG°), enthalpy (ΔH°), and entropy (ΔS°) of folding for an isolated tetraloop–receptor tertiary interaction as a function of Na+ concentration. Somewhat unexpectedly, increasing the Na+ concentration changes the folding enthalpy from a strongly exothermic process [e.g., ΔH° = −26(2) kcal/mol at 180 mM] to a weakly exothermic process [e.g., ΔH° = −4(1) kcal/mol at 630 mM]. As a direct corollary, it is the strong increase in folding entropy [Δ(ΔS°) > 0] that compensates for this loss of exothermicity for the achievement of more favorable folding [Δ(ΔG°) < 0] at higher Na+ concentrations. In conjunction with corresponding measurements of the thermodynamics of the transition state barrier, these data provide a detailed description of the folding pathway associated with the GAAA tetraloop–receptor interaction as a function of Na+ concentration. The results support a potentially universal mechanism for monovalent facilitated RNA folding, whereby an increasing monovalent concentration stabilizes tertiary structure by reducing the entropic penalty for folding. PMID:22448852
Tertiary survey in polytrauma patients should be an ongoing process.
Ferree, Steven; Houwert, Roderick M; van Laarhoven, Jacqueline J E M; Smeeing, Diederik P J; Leenen, Luke P H; Hietbrink, Falco
2016-04-01
Due to prioritisation in the initial trauma care, non-life threatening injuries can be overlooked or temporally neglected. Polytrauma patients in particular might be at risk for delayed diagnosed injuries (DDI). Studies that solely focus on DDI in polytrauma patients are not available. Therefore the aim of this study was to analyze DDI and determine risk factors associated with DDI in polytrauma patients. In this single centre retrospective cohort study, patients were considered polytrauma when the Injury Severity Score was ≥ 16 as a result of injury in at least 2 body regions. Adult polytrauma patients admitted from 2007 until 2012 were identified. Hospital charts were reviewed to identify DDI. 1416 polytrauma patients were analyzed of which 12% had DDI. Most DDI were found during initial hospital admission after tertiary survey (63%). Extremities were the most affected regions for all types of DDI (78%) with the highest intervention rate (35%). Most prevalent DDI were fractures of the hand (54%) and foot (38%). In 2% of all patients a DDI was found after discharge, consisting mainly of injuries other than a fracture. High energy trauma mechanism (OR 1.8, 95% CI 1.2-2.7), abdominal injury (OR 1.5, 95% CI 1.1-2.1) and extremity injuries found during initial assessment (OR 2.3, 95% CI 1.6-3.3) were independent risk factors for DDI. In polytrauma patients, most DDI were found during hospital admission but after tertiary survey. This demonstrates that the tertiary survey should be an ongoing process and thus repeated daily in polytrauma patients. Most frequent DDI were extremity injuries, especially injuries of the hand and foot. Copyright © 2015 Elsevier Ltd. All rights reserved.
Freeman, H J
2001-02-01
An international working party at the World Congress of Gastroenterology held in Vienna, Austria from September 6 to 11, 1998 defined a classification for Crohn's disease based on patient age at diagnosis (eg, less than 40 years of age, 40 years of age or older), disease location (eg, terminal ileum, colon, ileocolon or upper gastrointestinal tract) and behaviour (eg, stricturing, penetrating). Disease location in the upper gastrointestinal tract was defined by disease being present proximal to the terminal ileum, regardless of terminal ileal or colon involvement. A 20-year, single clinician database of 877 patients from a university campus hospital was used, and comprised 492 women (56.1%) and 385 men (43.9%). Of these patients, 740 (84.4%) were diagnosed before age 40 years and 137 (15.6%) were diagnosed by 40 years of age or older. Disease was located in the terminal ileum alone in 222 patients (25.3%), colon alone in 238 patients (27.2%) and ileocolon in 304 patients (34.6%). Another 113 patients (13.1%) had disease in the upper gastrointestinal tract, usually with disease also in the terminal ileum (23 patients), colon (12 patients) or ileocolon (71 patients). Only seven of 877 patients had disease located in the upper gastrointestinal tract alone with no distal disease. Disease behaviour could be classified as nonstricturing and nonpenetrating in 256 patients (29.2%), stricturing in 294 patients (33.6%) and penetrating in 327 patients (37.2%). Of the 877 patients with Crohn's disease, 837 were white, 38 were Asian and two were black. In this tertiary care setting of a single clinician practice in a Canadian teaching hospital at the University of British Columbia, Crohn's disease predominantly affects women, and young adults with a high rate of stricturing and penetrating complications.
1987-01-01
The Court ruled that where pupils coming from within a local community were segregated into single sex schools with differences in their curricula that resulted in a variation in educational qualification such that the school qualification of boys for tertiary education and employment was greater than that of girls, the Equal Opportunity Tribunal could conclude that the girls were being discriminated against under Section 31A of the Anti-Discrimination Act 1977. full text
Norfolk, Stephanie G; Hollingsworth, Caroline L; Wolfe, Cameron R; Govert, Joseph A; Que, Loretta G; Cheifetz, Ira M; Hollingsworth, John W
2010-11-01
Severe respiratory failure is a well-recognized complication of pH1N1 influenza infection. Limited data regarding the efficacy of rescue therapies, including high-frequency oscillatory ventilation and extracorporeal membrane oxygenation, have been previously reported in the setting of pH1N1 influenza infection in the United States. Retrospective, single-center cohort study. Pediatric, cardiac, surgical, and medical intensive care units in a single tertiary care center in the United States. One hundred twenty-seven consecutive patients with confirmed influenza A infection requiring hospitalization between April 1, 2009, and October 31, 2009. Electronic medical records were reviewed for demographic and clinical data. The number of intensive care unit admissions appears inversely related to age with 39% of these admissions <20 yrs of age. Median duration of intensive care unit care was 10.0 days (4.0-24.0), and median duration of mechanical ventilation was 8.0 days (0.0-23.5). Rescue therapy (high-frequency oscillatory ventilation or extracorporeal membrane oxygenation) was used in 36% (12 of 33) of intensive care unit patients. The severity of respiratory impairment was determined by Pao²/Fio² ratio and oxygenation index. High-frequency oscillatory ventilation at 24 hrs resulted in improvements in median Pao²/Fio² ratio (71 [58-93] vs. 145 [126-185]; p < .001), oxygenation index (27 [20-30] vs. 18 [12-25]; p = .016), and Fio2 (100 [70-100] vs. 45 [40-55]; p < .001). Extracorporeal membrane oxygenation resulted in anticipated improvement in parameters of oxygenation at both 2 hrs and 24 hrs after initiation of therapy. Despite the severity of oxygenation impairment, overall survival for both rescue therapies was 75% (nine of 12), 80% (four of five) for high-frequency oscillatory ventilation alone, and 71% (five of seven) for high-frequency oscillatory ventilation + extracorporeal membrane oxygenation. In critically ill adult and pediatric patients with pH1N1 infection and severe lung injury, the use of high-frequency oscillatory ventilation and extracorporeal membrane oxygenation can result in significant improvements in Pao²/Fio² ratio, oxygenation index, and Fio². However, the impact on mortality is less certain.
Lai, Lillian; Liddy, Clare; Keely, Erin; Afkham, Amir; Kurzawa, Julia; Abdeen, Nishard; Audcent, Tobey; Bromwich, Matthew; Brophy, Jason; Carsen, Sasha; Fournier, Annick; Fraser-Roberts, Leigh; Gandy, Hazen; Hui, Charles; Johnston, Donna; Keely, Kathryn; Kontio, Ken; Lamontagne, Christine; Major, Nathalie; O'Connor, Michael; Radhakrishnan, Dhenuka; Reisman, Joe; Robb, Marjorie; Samson, Lindy; Sell, Erick; Splinter, William; van Stralen, Judy; Venkateswaran, Sunita; Murto, Kimmo
2018-01-01
Champlain BASE™ (Building Access to Specialists through eConsultation) is a web-based asynchronous electronic communication service that allows primary-care- practitioners (PCPs) to submit "elective" clinical questions to a specialist. For adults, PCPs have reported improved access and timeliness to specialist advice, averted face-to-face specialist referrals in up to 40% of cases and high provider satisfaction. To determine whether the expansion of eConsult to a pediatric setting would result in similar measures of improved healthcare system process and high provider acceptance reported in adults. Prospective observational cohort study. Single Canadian tertiary-care academic pediatric hospital (June 2014-16) servicing 1.2 million people. 1. PCPs already using eConsult. 2.Volunteer pediatric specialists provided services in addition to their regular workload. 3.Pediatric patients (< 18 years-old) referred for none-acute care conditions. Specialty service utilization and access, impact on PCP course-of-action and referral-patterns and survey-based provider satisfaction data were collected. 1064 eConsult requests from 367 PCPs were answered by 23 pediatric specialists representing 14 specialty-services. The top three specialties represented were: General Pediatrics 393 cases (36.9%), Orthopedics 162 (15.2%) and Psychiatry 123 (11.6%). Median specialist response time was 0.9 days (range <1 hour-27 days), most consults (63.2%) required <10minutes to complete and 21/21(100%) specialist survey-respondents reported minimal workload burden. For 515/1064(48.4%) referrals, PCPs received advice for a new or additional course of action; 391/1064(36.7%) referrals resulted in an averted face-to-face specialist visit. In 9 specialties with complete data, the median wait-time was significantly less (p<0.001) for an eConsult (1 day, 95%CI:0.9-1.2) compared with a face-to-face referral (132 days; 95%CI:127-136). The majority (>93.3%) of PCPs rated eConsult as very good/excellent value for both patients and themselves. All specialist survey-respondents indicated eConsult should be a continued service. Similar to adults, eConsult improves PCP access and timeliness to elective pediatric specialist advice and influences their care decisions, while reporting high end-user satisfaction. Further study is warranted to assess impact on resource utilization and clinical outcomes.
ERIC Educational Resources Information Center
Demir, Yusuf
2017-01-01
On a multifaceted basis, this paper explores the challenges experienced by native and non-native English language teachers (NESTs and NNESTs) in a tertiary-level EFL setting in Turkey. Adopting a qualitative case study design, the data were gathered from five NESTs through interviews and from five NNESTs through hand-written accounts based on the…
ERIC Educational Resources Information Center
Argüelles Álvarez, Irina
2013-01-01
The new requirement placed on students in tertiary settings in Spain to demonstrate a B1 or a B2 proficiency level of English, in accordance with the Common European Framework of Reference for Languages (CEFRL), has led most Spanish universities to develop a program of certification or accreditation of the required level. The first part of this…
ERIC Educational Resources Information Center
Wessels, P. L.; Steenkamp, L. P.
2009-01-01
Generation Y students (born after 1982) have developed a different set of attitudes and aptitudes as a result of growing up in an IT and media-rich environment. This article has two objectives: firstly to discuss the learning styles preferred by generation Y students in order to identify the effect of these preferences on tertiary education in…
ERIC Educational Resources Information Center
Eybers, Sunet; Hattingh, Mariè
2016-01-01
Data is everywhere. As a result the need for data scientists with the correct skill set to analyze and interpret the data has escalated. Not surprisingly, data scientists are currently one of the most wanted professions. Tertiary institutions are faced with the challenge of producing students with the correct blend of theoretical knowledge and…
ERIC Educational Resources Information Center
Ramsay, Guy
2005-01-01
While the internationalisation of higher education has made learner diversity a key consideration in tertiary pedagogical practice, research into the application of computer-mediated technologies in this domain has rarely taken into account culture. This article responds to this gap in the research by comparing "Confucian-heritage" and…
Outcomes following cervical disc arthroplasty: a retrospective review.
Cody, John P; Kang, Daniel G; Tracey, Robert W; Wagner, Scott C; Rosner, Michael K; Lehman, Ronald A
2014-11-01
Cervical disc arthroplasty has emerged as a viable technique for the treatment of cervical radiculopathy and myelopathy, with the proposed benefit of maintenance of segmental range of motion. There are relatively few, non-industry sponsored studies examining the outcomes and complications of cervical disc arthroplasty. Therefore, we set out to perform a single center evaluation of the outcomes and complications of cervical disc arthroplasty. We performed a retrospective review of all patients from a single military tertiary medical center undergoing cervical disc arthroplasty from August 2008 to August 2012. The clinical outcomes and complications associated with the procedure were evaluated. A total of 219 consecutive patients were included in the review, with an average follow-up of 11.2 (±11.0)months. Relief of pre-operative symptoms was noted in 88.7% of patients, and 92.2% of patients were able to return to full pre-operative activity. There was a low rate of complications related to the anterior cervical approach (3.2% with recurrent laryngeal nerve injury, 8.9% with dysphagia), with no device/implant related complications. Symptomatic cervical radiculopathy is a common problem in both the civilian and active duty military populations and can cause significant disability leading to loss of work and decreased operational readiness. There exist several surgical treatment options for appropriately indicated patients. Based on our findings, cervical disc arthroplasty is a safe and effective treatment for symptomatic cervical radiculopathy and myelopathy, with a low incidence of complications and high rate of symptom relief. Published by Elsevier Ltd.
Heiser, Clemens; Maurer, Joachim T; Hofauer, Benedikt; Sommer, J Ulrich; Seitz, Annemarie; Steffen, Armin
2017-02-01
Objective Selective stimulation of the hypoglossal nerve is a new surgical therapy for obstructive sleep apnea, with proven efficacy in well-designed clinical trials. The aim of the study is to obtain additional safety and efficacy data on the use of selective upper airway stimulation during daily clinical routine. Study Design Prospective single-arm study. Setting Three tertiary hospitals in Germany (Munich, Mannheim, Lübeck). Subjects and Methods A multicenter prospective single-arm study under a common implant and follow-up protocol took place in 3 German centers (Mannheim, Munich, Lübeck). Every patient who received an implant of selective upper airway stimulation was included in this trial (apnea-hypopnea index ≥15/h and ≤65/h and body mass index <35 kg/m 2 ). Before and 6 months after surgery, a 2-night home sleep test was performed. Data regarding the safety and efficacy were collected. Results From July 2014 through October 2015, 60 patients were included. Every subject reported improvement in sleep and daytime symptoms. The average usage time of the system was 42.9 ± 11.9 h/wk. The median apnea-hypopnea index was significantly reduced at 6 months from 28.6/h to 8.3/h. No patient required surgical revision of the implanted system. Conclusion Selective upper airway stimulation is a safe and effective therapy for patients with obstructive sleep apnea and represents a powerful option for its surgical treatment.
Parsons, Shaun R; Hughes, Andrew J; Friedman, N Deborah
2016-01-01
Objectives To investigate how patients prefer to be addressed by healthcare providers and to assess their knowledge of their attending medical team's identity in an Australian Hospital. Setting Single-centre, large tertiary hospital in Australia. Participants 300 inpatients were included in the survey. Patients were selected in a sequential, systematic and whole-ward manner. Participants were excluded with significant cognitive impairment, non-English speaking, under the age of 18 years or were too acutely unwell to participate. The sample demographic was predominately an older population of Anglo-Saxon background. Primary and secondary outcome measures Patients preferred mode of address from healthcare providers including first name, title and second name, abbreviated first name or another name. Whether patients disliked formal address of title and second name. Secondarily, patient knowledge of their attending medical team members name and role and if correct, what position within the medical hierarchy they held. Results Over 99% of patients prefer informal address with greater than one-third having a preference to being called a name other than their legal first name. 57% of patients were unable to correctly name a single member of their attending medical team. Conclusions These findings support patient preference of informal address; however, healthcare providers cannot assume that a documented legal first name is preferred by the patient. Patient knowledge of their attending medical team is poor and suggests current introduction practices are insufficient. PMID:26739720
Folding associated with extensional faulting: Sheep Range detachment, southern Nevada
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guth, P.L.
1985-01-01
The Sheep Range detachment is a major Miocene extensional fault system of the Great Basin. Its major faults have a scoop shape, with straight, N-S traces extending 15-30 km and then abruptly turning to strike E-W. Tertiary deformation involved simultaneous normal faulting, sedimentation, landsliding, and strike-slip faulting. Folds occur in two settings: landslide blocks and drag along major faults. Folds occur in landslide blocks and beneath them. Most folds within landslide blocks are tight anticlines, with limbs dipping 40-60 degrees. Brecciation of the folds and landslide blocks suggests brittle deformation. Near Quijinump Canyon in the Sheep Range, at least threemore » landslide blocks (up to 500 by 1500 m) slid into a small Tertiary basin. Tertiary limestone beneath the Paleozoic blocks was isoclinally folded. Westward dips reveal drag folds along major normal faults, as regional dips are consistently to the east. The Chowderhead anticline is the largest drag fold, along an extensional fault that offsets Ordovician units 8 km. East-dipping Ordovician and Silurian rocks in the Desert Range form the hanging wall. East-dipping Cambrian and Ordovician units in the East Desert Range form the foot wall and east limb of the anticline. Caught along the fault plane, the anticline's west-dipping west limb contains mostly Cambrian units.« less
Kumpatla, S.; Sekar, A.; Achanta, S.; Sharath, B. N.; Kumar, A. M. V.; Harries, A. D.
2013-01-01
Setting: Tertiary care hospital for diabetes mellitus (DM) in Tamil Nadu, South India. Objective: To compare the socio-demographic, clinical and biochemical characteristics in DM patients with and without tuberculosis (TB). Design: A descriptive study involving a review of routinely maintained records to capture the results of screening of DM patients for TB between March and December 2012. DM patients were first asked whether they already had TB, and if not they were screened for TB symptoms, followed by investigations for and possible diagnosis of TB. Results: Of 7083 DM patients, 38 already had TB. Of the remainder, 125 (1.8%) had TB symptoms; 71 were investigated and 12 were newly diagnosed with TB. Of the 50 TB patients, 64% had smear-positive pulmonary TB (PTB). DM-TB patients were older, and had lower education level and economic status, a higher frequency of alcohol use, lower body mass index, a longer duration of DM, a greater likelihood of receiving insulin and poorer glycaemic control. Conclusion: Screening of DM patients for TB was feasible in a tertiary care hospital. The yield of new TB cases was low and merits further investigation. Socio-demographic and clinical characteristics were different in patients with DM and TB compared to those with DM only. PMID:26393064
Jordan, J. M.; Gaspar, D.
1995-01-01
OBJECTIVE: To determine referral rates, to study the nature of consultations with obstetricians, and to examine how both patient and physician characteristics affect referrals. DESIGN: Case series. Retrospective review of hospital records. SETTING: Victoria Hospital, a tertiary care centre affiliated with the University of Western Ontario in London, Ont. PARTICIPANTS: Five hundred forty-two women admitted consecutively for delivery under the care of family physicians from October 1, 1990, to September 31, 1991. OUTCOME MEASURE: The number and types of obstetrical consultations obtained for the study population. RESULTS: Of the 50.7% of cases requiring consultation, half were delivered by obstetricians. The most common reasons for consultation were failure to progress in labour, induction of labour, posterior presentation, fetal distress, and pregnancy-induced hypertension. The most common reasons for obstetricians to attend delivery were to perform forceps rotations and cesarean sections. CONCLUSIONS: Parity and risk classification were the two most important factors for predicting whether consultation would occur. The high rate of consultation in this study might relate to ease of access to consultation in a tertiary care environment. More study is needed to examine the reasons for consultation because it seems that some of the situations for which obstetricians were consulted could have been safely managed by family physicians. PMID:7787491
Jain, S M; Bagde, M N; Bagde, N D
2016-01-01
Cancer cervix is the leading cause of cancer deaths in females in developing countries and one in five women suffering from cervical cancer lives in India. The aim of this study is to determine the awareness about cervical cancer and Pap smear among nurses working in a tertiary care institute. Study Setting and Design: Cross-sectional survey in a tertiary care institute. Nurses working at our institute excluding those who have worked or working in the Obstetrics and Gynecology department were provided with a pre-designed questionnaire testing their knowledge about cervical cancer. Approximately, 86% were aware about cancer cervix and 69% were aware of a pre-cancerous stage. 42.3% were not aware of any risk factor and 27.6% were not aware of any symptom of cancer cervix. 86.2% were aware about Pap smear, but only 58.6% were aware that facilities of Pap smear were available at our hospital. Knowledge about cervical cancer and awareness of Pap smear as screening test was inadequate in nursing staff. Awareness programs about cervical cancer and screening are needed to increase awareness for this preventable condition. There is a need to arrange reorientation programs to sensitize nurses and establish cytology clinics to offer facilities for easily accessible and affordable screening.
Self-reported verbal abuse in 1300+ older women within a private, tertiary women's health clinic.
Sood, Richa; Novotny, Paul; Faubion, Stephanie S; Thielen, Jacqueline M; Shuster, Lynne T; Kuhle, Carol L; Kapoor, Ekta; Marnach, Mary; Barrette, Brigitte; Jatoi, Aminah
2016-01-01
Several studies describe "elder abuse" among residents of nursing homes, but this issue is less well studied among independently functioning, community-based women. The current study was undertaken to report rates of self-reported intimate partner violence - with a focus on verbal abuse - among older women within a private tertiary women's health clinic. This study focused on women who completed a questionnaire on domestic abuse. A total of 1389 women with a median age of 55 years (range: 50, 90) are the focus of this report. Most 1102 (79%) were married. Within this group, 100 (7%) women reported verbal abuse within the last year. Rates of physical and sexual abuse were much lower with 9 women (1%) and 2 (<1%), respectively. In univariate analyses, being divorced, being an alcoholic, and having suffered prior abuse were associated with reported verbal abuse. In multivariate analyses, self-reported alcoholism and physical abuse were independently associated with reported verbal abuse. This study found a notable rate of patient-reported verbal abuse in older women within a private, tertiary women's health clinic. This observation should prompt healthcare providers to ask about intimate partner violence - and specifically verbal abuse - regardless of healthcare setting. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Development of chemistry attitudes and experiences questionnaire (CAEQ)
NASA Astrophysics Data System (ADS)
Dalgety, Jacinta; Coll, Richard K.; Jones, Alister
2003-09-01
In this article we describe the development of the Chemistry Attitudes and Experiences Questionnaire (CAEQ) that measures first-year university chemistry students' attitude toward chemistry, chemistry self-efficacy, and learning experiences. The instrument was developed as part of a larger study and sought to fulfill a need for an instrument to investigate factors that influence student enrollment choice. We set out to design the instrument in a manner that would maximize construct validity. The CAEQ was piloted with a cohort of science and technology students (n = 129) at the end of their first year. Based on statistical analysis the instrument was modified and subsequently administered on two occasions at two tertiary institutions (n = 669). Statistical data along with additional data gathered from interviews suggest that the CAEQ possesses good construct validity and will prove a useful tool for tertiary level educators who wish to gain an understanding of factors that influence student choice of chemistry enrolment.
NASA Astrophysics Data System (ADS)
Supriyanto, Noor, T.; Suhanto, E.
2017-07-01
The Endut geothermal prospect is located in Banten Province, Indonesia. The geological setting of the area is dominated by quaternary volcanic, tertiary sediments and tertiary rock intrusion. This area has been in the preliminary study phase of geology, geochemistry, and geophysics. As one of the geophysical study, the gravity data measurement has been carried out and analyzed in order to understand geological condition especially subsurface fault structure that control the geothermal system in Endut area. After precondition applied to gravity data, the complete Bouguer anomaly have been analyzed using advanced derivatives method such as Horizontal Gradient (HG) and Euler Deconvolution (ED) to clarify the existance of fault structures. These techniques detected boundaries of body anomalies and faults structure that were compared with the lithologies in the geology map. The analysis result will be useful in making a further realistic conceptual model of the Endut geothermal area.
Outcomes of antiretroviral therapy in a northern Indian urban clinic.
Sharma, Surendra K; Dhooria, Sahajal; Prasad, K T; George, Ninoo; Ranjan, Sanjay; Gupta, Deepak; Sreenivas, Vishnubhatla; Kadhiravan, Tamilarasu; Miglani, Sunita; Sinha, Sanjeev; Wig, Naveet; Biswas, Ashutosh; Vajpayee, Madhu
2010-03-01
Antiretroviral therapy (ART) programmes have been successful in several countries. However, whether they would succeed as part of a national programme in a resource-constrained setting such as India is not clear. The outcomes and specific problems encountered in such a setting have not been adequately studied. We assessed the efficacy and functioning of India's national ART programme in a tertiary care centre in northern India. All ART-naive patients started on ART between May 2005 and October 2006 were included in the study and were followed until 31 April 2008. Periodic clinical and laboratory evaluations were carried out in accordance with national guidelines. Changes in CD4+ lymphocyte count, body weight and body mass index were assessed at follow-up, and the operational problems analysed. The setting was a tertiary care centre in northern India with a mixed population of patients, mostly of low socioeconomic status. The centre is reasonably well resourced but faces constraints in health-care delivery, such as lack of adequate human resources and a high patient load. The response to ART in the cohort studied was comparable to that reported from other countries. However, the programme had a high attrition rate, possibly due to patient-related factors and operational constraints. A high rate of attrition can affect the overall efficacy and functioning of an ART programme. Addressing the issues causing attrition might improve patient outcomes in India and in other resource-constrained countries.
What is the role of general internists in the tertiary or academic setting?
Tanriover, Mine Durusu; Rigby, Shirley; van Hulsteijn, L Harry; Ferreira, Faustino; Oliveira, Narcisso; Schumm-Draeger, Petra-Maria; Weidanz, Frauke; Kramer, Mark H H
2015-01-01
The changing demography of European populations mandates a vital role for internists in caring for patients in each level of healthcare. Internists in the tertiary or academic setting are highly ranked in terms of their responsibilities: they are clinicians, educators, researchers, role models, mentors and administrators. Contrary to the highly focused approach of sub-specialties, general internists working in academic settings can ensure that coordinated care is delivered in the most cost-conscious and efficient way. Moreover, internal medicine is one of the most appropriate specialties in which to teach clinical reasoning skills, decision-making and analytical thinking, as well as evidence based, patient oriented medicine. Internists deal with challenging patients of the new millennium with a high burden of chronic diseases and polypharmacy; practice personalised medicine with a wide scientific background and so they are the perfect fit to establish and implement new tools for scientific research. In conclusion, internal medicine is developing a new identity as a specialty in its own right. The European Federation of Internal Medicine supports the concept of academic internists and calls upon the member countries to construct academic (general) internal medicine departments in their respective countries. As 'internal medicine is the cornerstone of every national healthcare system', academic (general) internal medicine should strive to be the cornerstone of every integrated, patient-centred, modern medical care and training system. Copyright © 2014 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved.
Sharma, Megha; Joshi, Rita; Shah, Harshada; Macaden, Ragini; Lundborg, Cecilia Stålsby
2015-04-29
Appropriate hand hygiene is a gold standard to combat healthcare associated infections (HAIs). The World Health Organization (WHO) has recommended alcohol based hand rub (ABHR) as the most effective tool to maintain hand hygiene. In resource poor settings commercially available ABHR is not "economically accessible". The objectives of this study were to assess the acceptability of, and to build confidence for an in-house prepared (based on WHO guidelines) alcohol based hand rub among healthcare workers (HCWs) using a rural, tertiary care hospital in central India as an example. A series of activities were developed and conducted based on the Precede-Proceed model, the Trans Theoretical model of behaviour change, Front line ownership and Social marketing. A modified WHO-ABHR formulation, the 'test product' and 'WHO product evaluation form' were used for self assessment of acceptability of the 'test product'. Confidence building activities, as finger tip culture, visual portrayal method and handmade posters, were used in high-risk wards for HAIs, to build confidence for the 'test product' in removing transient flora from the hands. A locally developed feedback from was used to evaluate the impact of the activities conducted. Overall 183 HCWs were enrolled for the assessment of the 'test product' (130- doctors and 53 nurses). Out of these 83% (108/130) doctors and 94% (50/53) nurses were satisfied with the 'test product'. The confidence building activity was conducted with 116 participants (49 doctors). After single use of the 'test product', overall a significant reduction was observed for the CFUs on the blood agar plates (0.77 Log(10), p < 0.001). A complete reduction (100%) in colony forming units on incubated blood agar plates was seen for 13% (15/116) participants. Eighty two percent (95/116) participants expressed their confidence in the 'test product'. The self reported acceptance level for the 'test product' was high. The use of finger tip culture coupled with the visual portrayal was perceived as a convincing and highly effective way to develop confidence in HCWs. Thus, is the foremost step towards successful introduction of ABHR and can be seen as a model for similar settings.
2012-01-01
Background Small incision lenticule extraction or SMILE is a novel form of ‘flapless’ corneal refractive surgery that was adapted from refractive lenticule extraction (ReLEx). SMILE uses only one femtosecond laser to complete the refractive surgery, potentially reducing surgical time, side effects, and cost. If successful, SMILE could potentially replace the current, widely practiced laser in-situ keratomileusis or LASIK. The aim of this study is to evaluate whether SMILE is non-inferior to LASIK in terms of refractive outcomes at 3 months post-operatively. Methods/Design Single tertiary center, parallel group, single-masked, paired-eye design, non-inferiority, randomized controlled trial. Participants who are eligible for LASIK will be enrolled for study after informed consent. Each participant will be randomized to receive SMILE and LASIK in each eye. Our primary hypothesis (stated as null) in this non-inferiority trial would be that SMILE differs from LASIK in adults (>21 years old) with myopia (> −3.00 diopter (D)) at a tertiary eye center in terms of refractive predictability at 3 months post-operatively. Our secondary hypothesis (stated as null) in this non-inferiority trial would be that SMILE differs from LASIK in adults (>21 years old) with myopia (> −3.00 D) at a tertiary eye center in terms of other refractive outcomes (efficacy, safety, higher-order aberrations) at 3 months post-operatively. Our primary outcome is refractive predictability, which is one of several standard refractive outcomes, defined as the proportion of eyes achieving a postoperative spherical equivalent (SE) within ±0.50 D of the intended target. Randomization will be performed using random allocation sequence generated by a computer with no blocks or restrictions, and implemented by concealing the number-coded surgery within sealed envelopes until just before the procedure. In this single-masked trial, subjects and their caregivers will be masked to the assigned treatment in each eye. Discussion This novel trial will provide information on whether SMILE has comparable, if not superior, refractive outcomes compared to the established LASIK for myopia, thus providing evidence for translation into clinical practice. Trial registration Clinicaltrials.gov NCT01216475. PMID:22647480
Pazderková, Markéta; Profant, Václav; Hodačová, Jana; Sebestík, Jaroslav; Pazderka, Tomáš; Novotná, Pavlína; Urbanová, Marie; Safařík, Martin; Buděšínský, Miloš; Tichý, Miloš; Bednárová, Lucie; Baumruk, Vladimír; Maloň, Petr
2013-08-22
We investigate amide nonplanarity in vibrational optical activity (VOA) spectra of tricyclic spirodilactams 5,8-diazatricyclo[6,3,0,0(1,5)]undecan-4,9-dione (I) and its 6,6',7,7'-tetradeuterio derivative (II). These rigid molecules constrain amide groups to nonplanar geometries with twisted pyramidal arrangements of bonds to amide nitrogen atoms. We have collected a full range vibrational circular dichroism (VCD) and Raman optical activity (ROA) spectra including signals of C-H and C-D stretching vibrations. We report normal-mode analysis and a comparison of calculated to experimental VCD and ROA. The data provide band-to-band assignment and offer a possibility to evaluate roles of constrained nonplanar tertiary amide groups and rigid chiral skeletons. Nonplanarity shows as single-signed VCD and ROA amide I signals, prevailing the couplets expected to arise from the amide-amide interaction. Amide-amide coupling dominates amide II (mainly C'-N stretching, modified in tertiary amides by the absence of a N-H bond) transitions (strong couplet in VCD, no significant ROA) probably due to the close proximity of amide nitrogen atoms. At lower wavenumbers, ROA spectra exhibit another likely manifestation of amide nonplanarity, showing signals of amide V (δ(oop)(N-C) at ~570 cm(-1)) and amide VI (δ(oop)(C'═O) at ~700 cm(-1) and ~650 cm(-1)) vibrations.
Moreno-Ribera, N; Fuertes-de Vega, I; Blanco-Arévalo, J L; Bosch-Mestres, J; González-Cordón, A; Estrach-Panella, T; García-de Olalla, P; Alsina-Gibert, M
2016-04-01
The number of consultations for sexually transmitted infections (STIs) is increasing in Spain. The aim of this study was to describe and analyze the epidemiological, behavioral, clinical, and microbiological characteristics of patients registered at the STI unit of a tertiary hospital. This was a retrospective, single-center descriptive study carried out between 2010 and 2013 in a multidisciplinary unit specialized in STIs, situated in a tertiary hospital. Epidemiological, clinical, and behavioral data were gathered using a face-to-face interview and a standardized questionnaire. Samples were collected for microbiology analysis. The study included 546 patients: 96% were men, 41% had human immunodeficiency virus (HIV) infection, and 56% were men who have sex with men. The reasons for consultation were the following: urethritis; genital, anal, or perianal ulcers; proctitis; oral ulcers; sexual contact with a person with a known STI; and high-risk sexual contact. The most common microbiological diagnoses were Neisseria gonorrhoeae in urethritis, Treponema pallidum in genital and anal or perianal ulcers, and Chlamydia trachomatis lymphogranuloma venereum serovars in proctitis. The highest prevalences of the main STIs studied occurred in homosexual men with HIV infection. This study confirms the increase in the incidence of STIs in recent years and the epidemiological characteristics of the HIV/STI epidemic in Spain. Copyright © 2015 AEDV. Published by Elsevier España, S.L.U. All rights reserved.
Increased helix and protein stability through the introduction of a new tertiary hydrogen bond.
Peterson, R W; Nicholson, E M; Thapar, R; Klevit, R E; Scholtz, J M
1999-03-12
In an effort to quantify the importance of hydrogen bonding and alpha-helix formation to protein stability, a capping box motif was introduced into the small phosphocarrier protein HPr. Previous studies had confirmed that Ser46, at the N-cap position of the short helix-B in HPr, serves as an N-cap in solution. Thus, only a single-site mutation was required to produce a canonical S-X-X-E capping box: Lys49 at the N3 position was substituted with a glutamic acid residue. Thermal and chemical denaturation studies on the resulting K49E HPr show that the designed variant is approximately 2 kcal mol-1 more stable than the wild-type protein. However, NMR studies indicate that the side-chain of Glu49 does not participate in the expected capping H-bond interaction, but instead forms a new tertiary H-bond that links helix-B to the four-stranded beta-sheet of HPr. Here, we demonstrate that a strategy in which new non-native H-bonds are introduced can generate proteins with increased stability. We discuss why the original capping box design failed, and compare the energetic consequences of the new tertiary side-chain to main-chain H-bond with a local (helix-capping) side-chain to main-chain H-bond on the protein's global stability. Copyright 1999 Academic Press.
Salesky, Madeleine A; Grace, Trevor R; Feeley, Brian T; Ma, C Benjamin; Zhang, Alan L
2018-05-01
The influence of primary humeral stem fixation method (cemented or press fit) on intraoperative or postoperative outcomes in the setting of revision shoulder arthroplasty is unknown. A retrospective analysis of a prospectively collected cohort of revision shoulder arthroplasty patients from a single tertiary center was performed. Demographic variables, intraoperative data, and 90-day complication rates were compared between cemented and press-fit primary stem fixation cohorts. Follow-up radiographs were graded and compared using a modified Gruen system for humeral lucencies. Eighty-six primary shoulder replacements (34 hemiarthroplasties, 39 anatomic total shoulder arthroplasties, 13 reverse total shoulder arthroplasties) underwent revision arthroplasty with humeral stem removal between 2004 and 2017. Forty-five patients had cemented primary humeral fixation and 41 had press-fit fixation. The cemented cohort was older than the cementless cohort (66.6 vs. 61.4 years; P = .03) but otherwise demonstrated no difference in gender, body mass index, type of primary prosthesis (hemi, total, or reverse), or time between primary and revision operations. The cemented and cementless cohorts showed similar rates of humeral osteotomy (28.9% vs. 29.3%; P = .97), operative time (133.5 vs. 121.3 minutes; P = .16), and 90-day complication rates (13.3% vs. 9.8%; P = .61). Cemented vs. press-fit primary stems also had similar rates of humeral lucencies seen on follow-up radiographs after revision (77.1% vs. 60.6%; P = .14). Humeral stem fixation with or without cement during primary shoulder arthroplasty demonstrated similar operative time, need for intraoperative humeral osteotomy, and postoperative complication rates in the setting of revision arthroplasty. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.
Godo, Shigeo; Irino, Shigemi; Nakagawa, Atsuhiro; Kawazoe, Yu; Fujita, Motoo; Kudo, Daisuke; Nomura, Ryosuke; Shimokawa, Hiroaki; Kushimoto, Shigeki
2017-09-01
Paroxysmal sympathetic hyperactivity (PSH) is a distinct syndrome of episodic sympathetic hyperactivities following severe acquired brain injury, characterized by paroxysmal transient fever, tachycardia, hypertension, tachypnea, excessive diaphoresis and specific posturing. PSH remains to be an under-recognized condition with a diagnostic pitfall especially in the intensive care unit (ICU) settings due to the high prevalence of concomitant diseases that mimic PSH. A consensus set of diagnostic criteria named PSH-Assessment Measure (PSH-AM) has been developed recently, which is consisted of two components: a diagnosis likelihood tool derived from clinical characteristics of PSH, and a clinical feature scale assigned to the severity of each sympathetic hyperactivity. We herein present a case series of patients with PSH who were diagnosed and followed by using PSH-AM in our tertiary institutional medical and surgical ICU between April 2015 and March 2017 in order to evaluate the clinical efficacy of PSH-AM. Among 394 survivors of 521 patients admitted with acquired brain injury defined as acute brain injury at all levels of severity regardless of the presence of altered consciousness, including traumatic brain injury, stroke, infectious disease, and encephalopathy, 6 patients (1.5%) were diagnosed as PSH by using PSH-AM. PSH-AM served as a useful scoring system for early objective diagnosis, assessment of severity, and serial evaluation of treatment efficacy in the management of PSH in the ICU settings. In conclusion, critical care clinicians should consider the possibility of PSH and can use PSH-AM as a useful diagnostic and guiding tool in the management of PSH.
Which Assessment Method of Malnutrition in Head and Neck Cancer?
Saroul, Nicolas; Pastourel, Rémy; Mulliez, Aurélien; Farigon, Nicolas; Dupuch, Vincent; Mom, Thierry; Boirie, Yves; Gilain, Laurent
2018-06-01
Objective To assess the value of several diagnostic methods of nutritional status during the initial management of a head and neck cancer. Study Design Single-center prospective study. Setting Tertiary referral center. Subjects and Methods Ninety patients with head and neck cancer participated in the study. Assessment of their nutritional status was made with anthropometric, biological, body, and muscle measurements (the last by computed tomography: L3 muscle mass index [L3MMI]). Assessment of muscle performance (functional reflection of nutritional status) was made via the Short Physical Performance Battery test. The malnutrition thresholds were set according to the literature. Results Mean body mass index (BMI) was 24.6 ± 5.4 kg/m 2 . Mean weight loss and albumin levels were -4.5 ± 10.5 kg and 37.1 ± 5.2 g/L, respectively. Fourteen percent of patients were diagnosed as malnourished on the basis of BMI, 54% according to the Nutritional Risk Index (NRI), and 58% by L3MMI. There was 64% agreement between NRI and L3MMI ( P < .001). All patients identified as malnourished by BMI were considered as such by the other assessment methods; however, many malnourished patients had normal or high BMI. The Short Physical Performance Battery score was low particularly among patients considered to be the most undernourished by the other methods. Conclusion NRI and L3MMI are the best methods to identify patients as being malnourished. Functional muscle assessment can determine the severity of malnutrition.
Nitrolysis of the CN Single Bond and Related Chemistry of Nitro and Nitroso Groups
1985-02-01
nitrosonium cation, eq (1). 3 An alternative source of the iminium cation intermediate was proposed for the very poor conversions of tertiary aliphatic...the molecular ion I + at 228 (100%) and contained no evidence for the presence of contamination with partial deuter- ation products with masses 222...expected property of R-salt. Lewis acids also were found to be reac- tive. Both nitrosonium and nitronium tetrafluoroborate con- verted R-salt to the oxide
Trends in referral to a single encopresis clinic over 20 years.
Fishman, Laurie; Rappaport, Leonard; Schonwald, Alison; Nurko, Samuel
2003-05-01
To compare the characteristics of children with encopresis referred to a single encopresis clinic over the course of 20 years, including symptoms, previous diagnostic and therapeutic interventions, and parental attitudes. A retrospective study was conducted of an encopresis clinic at a tertiary care pediatric hospital. Questionnaires at initial evaluation elicited information about bowel habits, soiling, previous evaluations, previous treatments, and parental attitudes. In 503 children with encopresis, the average age of referral dropped from 115 months during the earliest 5 years to 77 months during the most recent 5 years. Children who had soiling for >3 years before referral decreased from 63% to 12%. The use of barium enema before referral decreased from 14% to 5%, as did psychological evaluation, from 25% to 14%. Previous therapy with enemas decreased from 45% to 27%. Mineral oil use remained at approximately 50%, and 20% of children had no previous treatment. Symptoms at referral and parental attitudes did not change across the years. Children are now referred at an earlier age to our tertiary encopresis clinic. The number of invasive and psychological evaluations has decreased before referral. However, treatment by many primary care providers before the referral has not changed. These data may suggest that pediatricians have increased awareness of encopresis and greater appreciation of its primarily physical rather than psychological nature. Additional studies will be needed to determine how these factors affect outcome.
Electrospray ionization tandem mass spectrometry of ammonium cationized polyethers.
Nasioudis, Andreas; Heeren, Ron M A; van Doormalen, Irene; de Wijs-Rot, Nicolette; van den Brink, Oscar F
2011-05-01
Quaternary ammonium salts (Quats) and amines are known to facilitate the MS analysis of high molar mass polyethers by forming low charge state adduct ions. The formation, stability, and behavior upon collision-induced dissociation (CID) of adduct ions of polyethers with a variety of Quats and amines were studied by electrospray ionization quadrupole time-of-flight, quadrupole ion trap, and linear ion trap tandem mass spectrometry (MS/MS). The linear ion trap instrument was part of an Orbitrap hybrid mass spectrometer that allowed accurate mass MS/MS measurements. The Quats and amines studied were of different degree of substitution, structure, and size. The stability of the adduct ions was related to the structure of the cation, especially the amine's degree of substitution. CID of singly/doubly charged primary and tertiary ammonium cationized polymers resulted in the neutral loss of the amine followed by fragmentation of the protonated product ions. The latter reveals information about the monomer unit, polymer sequence, and endgroup structure. In addition, the detection of product ions retaining the ammonium ion was observed. The predominant process in the CID of singly charged quaternary ammonium cationized polymers was cation detachment, whereas their doubly charged adduct ions provided the same information as the primary and tertiary ammonium cationized adduct ions. This study shows the potential of specific amines as tools for the structural elucidation of high molar mass polyethers. © American Society for Mass Spectrometry, 2011
Two new species of Chrysopathes (Cnidaria : Anthozoa : Antipatharia) from the western Atlantic
DOE Office of Scientific and Technical Information (OSTI.GOV)
Opresko, Dennis M; Loiola, L. de Laia
2008-02-01
Two new species of Chrysopathes are described, C. oligocrada from Yucatan and Brazil, and C. micracantha from the southeastern coast of the U.S. and Brazil. Chrysopathes oligocrada is characterized by lateral pinnules mostly 7 8 mm long (to 2 cm); 18 21 primary pinnules per cm; anterior-most primary pinnules with no more than one secondary pinnule (absent on some); some posterior primaries with a single secondary pinnule; lateral primary pinnules usually simple, rarely with a single subpinnule; tertiary pinnules absent; pinnular spines to 0.07 mm. This species is similar to C. formosa Opresko 2003 from the Pacific; the latter speciesmore » differing in density of pinnulation (15 18 per cm) and size of the spines (to 0.16 mm). Chrysopathes micracantha is characterized by lateral pinnules mostly 5 6 mm long (to 2 cm); 24 33 primary pinnules per cm; anterior and posterior primary pinnules with as many as two subopposite secondary pinnules; lateral primary pinnules usually simple but with subpinnules on the thicker branches and stem; tertiary pinnules rarely present; pinnular spines to 0.1 mm. Chrysopathes micracantha is similar to C. speciosa Opresko 2003 from the Pacific, the latter species differing in a greater number of secondary pinnules per primary (three or more) and in size of the spines (to 0.18 mm).« less
Automated 3D structure composition for large RNAs
Popenda, Mariusz; Szachniuk, Marta; Antczak, Maciej; Purzycka, Katarzyna J.; Lukasiak, Piotr; Bartol, Natalia; Blazewicz, Jacek; Adamiak, Ryszard W.
2012-01-01
Understanding the numerous functions that RNAs play in living cells depends critically on knowledge of their three-dimensional structure. Due to the difficulties in experimentally assessing structures of large RNAs, there is currently great demand for new high-resolution structure prediction methods. We present the novel method for the fully automated prediction of RNA 3D structures from a user-defined secondary structure. The concept is founded on the machine translation system. The translation engine operates on the RNA FRABASE database tailored to the dictionary relating the RNA secondary structure and tertiary structure elements. The translation algorithm is very fast. Initial 3D structure is composed in a range of seconds on a single processor. The method assures the prediction of large RNA 3D structures of high quality. Our approach needs neither structural templates nor RNA sequence alignment, required for comparative methods. This enables the building of unresolved yet native and artificial RNA structures. The method is implemented in a publicly available, user-friendly server RNAComposer. It works in an interactive mode and a batch mode. The batch mode is designed for large-scale modelling and accepts atomic distance restraints. Presently, the server is set to build RNA structures of up to 500 residues. PMID:22539264
Gardberg, Anna; Abendroth, Jan; Bhandari, Janhavi; Sankaran, Banumathi; Staker, Bart
2011-09-01
Fructose bisphosphate aldolase (FBPA) enzymes have been found in a broad range of eukaryotic and prokaryotic organisms. FBPA catalyses the cleavage of fructose 1,6-bisphosphate into glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. The SSGCID has reported several FBPA structures from pathogenic sources, including the bacterium Brucella melitensis and the protozoan Babesia bovis. Bioinformatic analysis of the Bartonella henselae genome revealed an FBPA homolog. The B. henselae FBPA enzyme was recombinantly expressed and purified for X-ray crystallographic studies. The purified enzyme crystallized in the apo form but failed to diffract; however, well diffracting crystals could be obtained by cocrystallization in the presence of the native substrate fructose 1,6-bisphosphate. A data set to 2.35 Å resolution was collected from a single crystal at 100 K. The crystal belonged to the orthorhombic space group P2(1)2(1)2(1), with unit-cell parameters a=72.39, b=127.71, c=157.63 Å. The structure was refined to a final free R factor of 22.2%. The structure shares the typical barrel tertiary structure and tetrameric quaternary structure reported for previous FBPA structures and exhibits the same Schiff base in the active site.
Soni, Resha S; Ebersole, Barbara; Jamal, Nausheen
2017-01-01
Objective Chronic cough remains a challenging condition, especially in cases where it persists despite comprehensive medical management. For these particular patients, there appears to be an emerging role for behavior modification therapy. We report a series of patients with refractory chronic cough to assess if there is any benefit of adding behavioral therapy to their treatment regimen. Study Design A case series with planned chart review of patients treated for chronic cough. Setting The review was performed with an outpatient electronic health record system at a tertiary care center. Subjects and Methods The charts of all patients treated for chronic cough by a single laryngologist over a 30-month period were analyzed. Patients' response to treatment and rate of cough improvement were assessed for those with refractory chronic cough who underwent behavior modification therapy. Results Thirty-eight patients with chronic cough were initially treated empirically for the most common causes of cough, of which 32% experienced improvement. Nineteen patients who did not significantly improve with medical management underwent behavior modification therapy with a speech-language pathologist. Of these patients, 84% experienced resolution or marked improvement of their symptoms. Conclusion Behavioral therapy may be underutilized in practice and could lead to improvement of otherwise recalcitrant cough.
Wang, Kun; Bhandari, Vineet; Giuliano, John S.; O′Hern, Corey S.; Shattuck, Mark D.; Kirby, Michael
2014-01-01
Severe pediatric sepsis continues to be associated with high mortality rates in children. Thus, an important area of biomedical research is to identify biomarkers that can classify sepsis severity and outcomes. The complex and heterogeneous nature of sepsis makes the prospect of the classification of sepsis severity using a single biomarker less likely. Instead, we employ machine learning techniques to validate the use of a multiple biomarkers scoring system to determine the severity of sepsis in critically ill children. The study was based on clinical data and plasma samples provided by a tertiary care center's Pediatric Intensive Care Unit (PICU) from a group of 45 patients with varying sepsis severity at the time of admission. Canonical Correlation Analysis with the Forward Selection and Random Forests methods identified a particular set of biomarkers that included Angiopoietin-1 (Ang-1), Angiopoietin-2 (Ang-2), and Bicarbonate (HCO) as having the strongest correlations with sepsis severity. The robustness and effectiveness of these biomarkers for classifying sepsis severity were validated by constructing a linear Support Vector Machine diagnostic classifier. We also show that the concentrations of Ang-1, Ang-2, and HCO enable predictions of the time dependence of sepsis severity in children. PMID:25255212
Shi, Lei; Zhang, Danyang; Zhou, Chenyu; Yang, Libin; Sun, Tao; Hao, Tianjun; Peng, Xiangwen; Gao, Lei; Liu, Wenhui; Mu, Yi; Han, Yuzhen; Fan, Lihua
2017-01-01
Objectives The purpose of the present study was to explore the characteristics of workplace violence that Chinese nurses at tertiary and county–level hospitals encountered in the 12 months from December 2014 to January 2016, to identify and analyse risk factors for workplace violence, and to establish the basis for future preventive strategies. Design A cross–sectional study. Setting A total of 44 tertiary hospitals and 90 county–level hospitals in 16 provinces (municipalities or autonomous regions) in China. Methods We used stratified random sampling to collect data from December 2014 to January 2016. We distributed 21 360 questionnaires, and 15 970 participants provided valid data (effective response rate=74.77%). We conducted binary logistic regression analyses on the risk factors for workplace violence among the nurses in our sample and analysed the reasons for aggression. Results The prevalence of workplace violence was 65.8%; of this, 64.9% was verbal violence, and physical violence and sexual harassment accounted for 11.8% and 3.9%, respectively. Frequent workplace violence occurred primarily in emergency and paediatric departments. Respondents reported that patients’ relatives were the main perpetrators in tertiary and county–level hospitals. Logistic regression analysis showed that respondents’ age, department, years of experience and direct contact with patients were common risk factors at different levels of hospitals. Conclusions Workplace violence is frequent in China’s tertiary and county–level hospitals; its occurrence is especially frequent in the emergency and paediatric departments. It is necessary to cope with workplace violence by developing effective control strategies at individual, hospital and national levels. PMID:28647719
The changing profile of eating disorders at a tertiary psychiatric clinic in Hong Kong (1987-2007).
Lee, Sing; Ng, King Lam; Kwok, Kathleen; Fung, Corina
2010-05-01
To examine the clinical profile of Chinese eating disorder patients at a tertiary psychiatric clinic in Hong Kong from 1987 to 2007. Data on 195 consecutive patients were retrieved from a standardized intake interview by an eating disorder specialist. Patients seen between 1987-1997 (n = 67) and 1998-2007 (n = 128) and fat-phobic (n = 76) and nonfat-phobic (n = 39) anorexic patients were compared. Patients were predominantly single (91.8%), female (99.0%), in their early-20s and suffered from anorexia (n = 115; 59.0%) or bulimia (n = 78; 40.0%) nervosa. The number of patients increased twofold across the two periods. Bulimia nervosa became more common while anorexia nervosa exhibited an increasingly fat-phobic pattern. Nonfat-phobic anorexic patients exhibited significantly lower premorbid body weight, less body dissatisfaction, less weight control behavior, and lower EAT-26 scores than fat-phobic anorexic patients. The clinical profile of eating disorders in Hong Kong has increasingly conformed to that of Western countries. 2009 by Wiley Periodicals, Inc.
Prospective analysis of percutaneous endoscopic colostomy at a tertiary referral centre.
Baraza, W; Brown, S; McAlindon, M; Hurlstone, P
2007-11-01
Percutaneous endoscopic colostomy (PEC) is an alternative to surgery in selected patients with recurrent sigmoid volvulus, recurrent pseudo-obstruction or severe slow-transit constipation. A percutaneous tube acts as an irrigation or decompressant channel, or as a mode of sigmoidopexy. This prospective study evaluated the safety and efficacy of this procedure at a single tertiary referral centre. Nineteen patients with recurrent sigmoid volvulus, ten with idiopathic slow-transit constipation and four with pseudo-obstruction underwent PEC. The tube was left in place indefinitely in those with recurrent sigmoid volvulus or constipation, whereas in patients with pseudo-obstruction it was left in place for a variable period of time, depending on symptoms. Thirty-five procedures were performed in 33 patients. Three patients developed peritonitis, of whom one died, and ten patients had minor complications. Symptoms resolved in 26 patients. This large prospective study has confirmed the value of PEC in the treatment of recurrent sigmoid volvulus and pseudo-obstruction in high-risk surgical patients. Copyright (c) 2007 British Journal of Surgery Society Ltd.
NASA Astrophysics Data System (ADS)
Nguyen, Jane Q.; Withers, Nathan J.; Alas, Gema; Senthil, Arjun; Minetos, Christina; Jaiswal, Nikita; Ivanov, Sergei A.; Huber, Dale L.; Smolyakov, Gennady A.; Osiński, Marek
2018-02-01
The human mouth is a host of a large gamut of bacteria species, with over 700 of different bacteria strains identified. Most of these bacterial species are harmless, some are beneficial (such as probiotics assisting in food digestion), but some are responsible for various diseases, primarily tooth decay and gum diseases such as gingivitis and periodontitis. Dental plaque has a complicated structure that varies from patient to patient, but a common factor in most cases is the single species of bacterium acting as a secondary colonizer, namely Fusobacterium nucleatum, while the actual disease is caused by a variety of tertiary colonizers. We hypothesize that destruction of a compound biofilm containing Fusobacterium nucleatum will prevent tertiary colonizers (oral pathogens) from establishing a biofilm, and thus will protect the patient from developing gingivitis and periodontitis. In this paper, we report on the effects of exposure of compound biofilms of a primary colonizer Streptococcus gordonii combined with Fusobacterium nucleatum to iron oxide nanoparticles as possible bactericidal agent.
Birth setting, labour experience, and postpartum psychological distress.
MacKinnon, Anna L; Yang, Lisa; Feeley, Nancy; Gold, Ian; Hayton, Barbara; Zelkowitz, Phyllis
2017-07-01
although psychosocial risk factors have been identified for postpartum depression (PPD) and perinatal posttraumatic stress disorder (PTSD), the role of labour- and birth-related factors remains unclear. The present investigation explored the impact of birth setting, subjective childbirth experience, and their interplay, on PPD and postpartum PTSD. in this prospective longitudinal cohort study, three groups of women who had vaginal births at a tertiary care hospital, a birthing center, and those transferred from the birthing centre to the tertiary care hospital were compared. Participants were followed twice during pregnancy (12-14 and 32-34 weeks gestation) and twice after childbirth (1-3 and 7-9 weeks postpartum). symptoms of PPD and PTSD did not significantly differ between birth groups; however, measures of subjective childbirth experience and obstetric factors did. Moderation analyses indicated a significant interaction between pain and birth group, such that higher ratings of pain among women who were transferred was associated with greater symptoms of postpartum PTSD. women who are transferred appear to have a unique experience that may put them at greater risk for postpartum psychological distress. It may be beneficial for care providers to help prepare women for pain management and potential unexpected complications, particularly if it is their first childbirth. Copyright © 2017 Elsevier Ltd. All rights reserved.
Evaluation of a cardiopulmonary resuscitation curriculum in a low resource environment.
Chang, Mary P; Lyon, Camila B; Janiszewski, David; Aksamit, Deborah; Kateh, Francis; Sampson, John
2015-11-07
To evaluate whether a 2-day International Liaison Committee on Resuscitation (ILCOR) Universal Algorithm-based curriculum taught in a tertiary care hospital in Liberia increases local health care provider knowledge and skill comfort level. A combined basic and advanced cardiopulmonary resuscitation (CPR) curriculum was developed for low-resource settings that included lectures and low-fidelity manikin-based simulations. In March 2014, the curriculum was taught to healthcare providers in a tertiary care hospital in Liberia. In a quality assurance review, participants were evaluated for knowledge and comfort levels with resuscitation before and after the workshop. They were also videotaped during simulation sessions and evaluated on standardized performance metrics. Fifty-two hospital staff completed both pre-and post-curriculum surveys. The median score was 45% pre-curriculum and 82% post-curriculum (p<0.00001). The median provider comfort level score was 4 of 5 pre-curriculum and 5 of 5 post-curriculum (p<0.00001). During simulations, 93.2% of participants performed the pulse check within 10 seconds, and 97.7% performed defibrillation within 180 seconds. Clinician knowledge of and comfort level with CPR increased significantly after participating in our curriculum. A CPR curriculum based on lectures and low-fidelity manikin simulations may be an effective way to teach resuscitation in this low-resource setting.
Rheumatic heart disease: infectious disease origin, chronic care approach.
Katzenellenbogen, Judith M; Ralph, Anna P; Wyber, Rosemary; Carapetis, Jonathan R
2017-11-29
Rheumatic heart disease (RHD) is a chronic cardiac condition with an infectious aetiology, causing high disease burden in low-income settings. Affected individuals are young and associated morbidity is high. However, RHD is relatively neglected due to the populations involved and its lower incidence relative to other heart diseases. In this narrative review, we describe how RHD care can be informed by and integrated with models of care developed for priority non-communicable diseases (coronary heart disease), and high-burden communicable diseases (tuberculosis). Examining the four-level prevention model (primordial through tertiary prevention) suggests primordial and primary prevention of RHD can leverage off existing tuberculosis control efforts, given shared risk factors. Successes in coronary heart disease control provide inspiration for similarly bold initiatives for RHD. Further, we illustrate how the Chronic Care Model (CCM), developed for use in non-communicable diseases, offers a relevant framework to approach RHD care. Systems strengthening through greater integration of services can improve RHD programs. Strengthening of systems through integration/linkages with other well-performing and resourced services in conjunction with policies to adopt the CCM framework for the secondary and tertiary prevention of RHD in settings with limited resources, has the potential to significantly reduce the burden of RHD globally. More research is required to provide evidence-based recommendations for policy and service design.
Di Nardo, Giovanni; Rossi, Paolo; Oliva, Salvatore; Aloi, Marina; Cozzi, Denis A; Frediani, Simone; Redler, Adriano; Mallardo, Saverio; Ferrari, Federica; Cucchiara, Salvatore
2012-11-01
The use of pneumatic dilation (PD) is well established in adults with achalasia; however, it is less commonly used in children. To evaluate the efficacy of PD in pediatric achalasia and to define predictive factors for its treatment failure. Single-center, prospective cohort study. Academic tertiary referral center. Twenty-four patients with achalasia were enrolled from January 2004 to November 2009 and were followed for a median of 6 years. PD was performed with the patients under general anesthesia. Efficacy and safety of PD. Follow-up was performed by using the Eckardt score, barium swallow contrast studies, and esophageal manometry at baseline; 1, 3, and 6 months after dilation; and every year thereafter. A Cox regression model was used to identify independent predictors of failure after the first PD. The PD success rate was 67%. In 8 patients, the first PD failed, but the parents of one patient refused a second PD and requested surgery. Of the 7 patients who underwent repeated treatment, the second PD failed in 3 (43%). Overall, only 3 of the 24 patients underwent surgery (overall success rate after a maximum of 3 PDs was 87%). Multivariate analysis showed that only older age was independently associated with a higher probability of the procedure success (hazard ratio [HR] 0.66; 95% CI, 0.45-0.97). Small sample size, single-center study. PD is a safe and effective technique in the management of pediatric achalasia. Young age is an independent negative predictive factor for successful clinical outcome. Copyright © 2012 American Society for Gastrointestinal Endoscopy. Published by Mosby, Inc. All rights reserved.
MRI findings in eastern equine encephalitis: the "parenthesis" sign.
Nickerson, Joshua P; Kannabiran, Suma; Burbank, Heather N
2016-01-01
Two patients with eastern equine encephalitis (EEE) presented to a tertiary referral center. Both subjects' brain magnetic resonance imaging showed T2/FLAIR (fluid-attenuated inversion recovery) hyperintensities including linear areas of hyperintensity in the external and internal capsules with sparing of the lentiform nuclei. Single case reports of imaging findings in EEE exist with nonspecific patterns of abnormality. We propose that this "( ) parentheses sign" on T2 or FLAIR imaging may distinguish EEE from other processes. Copyright © 2015 Elsevier Inc. All rights reserved.
O'Driscoll, C; Murphy, V; Doyle, O; Wrenn, C; Flynn, A; O'Flaherty, N; Fenelon, L E; Schaffer, K; FitzGerald, S F
2015-12-01
An outbreak of linezolid-resistant vancomycin-resistant Enterococcus faecium (LRVREfm) occurred in the hepatology ward of a tertiary referral hospital in Ireland between February and September 2014. LRVREfm was isolated from 15 patients; pulsed-field gel electrophoresis confirmed spread of a single clone. This is the first report of an outbreak of linezolid-resistant vancomycin-resistant enterococcus in Ireland. Copyright © 2015 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
Sanz, J M; Lopez, R; Garcia, J L
1988-05-23
Tertiary amines appear to be the minimal structure needed to convert in vitro the inactive form (E-form) of pneumococcal amidase to the catalytic active form (C-form). Diethylethanolamine was one of the compounds that converted the E-form, a finding that has been used successfully to develop an affinity chromatography system in DEAE-cellulose for the rapid and efficient purification of lytic enzymes of pneumococcus and its bacteriophages.
Molecular Epidemiology of Emerging Adenovirus 14 Associated Respiratory Disease in the United States
2010-01-01
nucleotides and 99.6% amino acids), including pos- session of a single 3-nucleotide GTG insertion corresponding to amino acid 148 (Ser) that was present in all...trainees: the Adenovirus Surveillance Program, 1966–1971. Am J Epidemiol 1973; 97:187–98. 4. Gray GC, Goswami PR, Malasig MD, et al. Adult adenovirus...facility and tertiary-care hospital. Clin Infect Dis 2001; 32:694–700. 43. Gray GC, McCarthy T, Lebeck MG, et al. Genotype prevalence and risk factors
Interpretation of a 3D Seismic-Reflection Volume in the Basin and Range, Hawthorne, Nevada
NASA Astrophysics Data System (ADS)
Louie, J. N.; Kell, A. M.; Pullammanappallil, S.; Oldow, J. S.; Sabin, A.; Lazaro, M.
2009-12-01
A collaborative effort by the Great Basin Center for Geothermal Energy at the University of Nevada, Reno, and Optim Inc. of Reno has interpreted a 3d seismic data set recorded by the U.S. Navy Geothermal Programs Office (GPO) at the Hawthorne Army Depot, Nevada. The 3d survey incorporated about 20 NNW-striking lines covering an area of approximately 3 by 10 km. The survey covered an alluvial area below the eastern flank of the Wassuk Range. In the reflection volume the most prominent events are interpreted to be the base of Quaternary alluvium, the Quaternary Wassuk Range-front normal fault zone, and sequences of intercalated Tertiary volcanic flows and sediments. Such a data set is rare in the Basin and Range. Our interpretation reveals structural and stratigraphic details that form a basis for rapid development of the geothermal-energy resources underlying the Depot. We interpret a map of the time-elevation of the Wassuk Range fault and its associated splays and basin-ward step faults. The range-front fault is the deepest, and its isochron map provides essentially a map of "economic basement" under the prospect area. There are three faults that are the most readily picked through vertical sections. The fault reflections show an uncertainty in the time-depth that we can interpret for them of 50 to 200 ms, due to the over-migrated appearance of the processing contractor’s prestack time-migrated data set. Proper assessment of velocities for mitigating the migration artifacts through prestack depth migration is not possible from this data set alone, as the offsets are not long enough for sufficiently deep velocity tomography. The three faults we interpreted appear as gradients in potential-field maps. In addition, the southern boundary of a major Tertiary graben may be seen within the volume as the northward termination of the strong reflections from older Tertiary volcanics. Using a transparent volume view across the survey gives a view of the volcanics in full, providing a clear picture of prominent structures. Potential drill targets and areas of development are defined within the data volume by the intersections of the fault surfaces with the tracked, strong stratigraphic reflections. Target volumes for drilling and development are defined by the intersections of the faults and bright-spot stratigraphy, and their uncertainty bounds. There are a few such intersections present within the 3d volume. Analyzing seismic attributes gives the opportunity to identify characteristics common in geothermal environments.
Paleomagnetism and tectonics of the Southern Tarim Basin, northwestern China
NASA Astrophysics Data System (ADS)
Gilder, Stuart; Zhao, Xixi; Coe, Robert; Meng, Zifang; Courtillot, Vincent; Besse, Jean
1996-10-01
We report Late Carboniferous, Permian, and early Tertiary paleomagnetic data from the southern Tarim basin. Prefolding magnetizations were isolated in each case. The Late Carboniferous-Permian and early Tertiary poles lie at 64.6°N, 166.5°E, A95 = 6.3° and 58.1°N, 202.0°E, A95 = 12.7°, respectively. The Late Jurassic to early Tertiary (J3-E1) paleolatitudes of Tarim and several basins throughout central Asia are similar, yet significantly (10° to 20°) shallower than those predicted by the Eurasian apparent polar wander path. Resolving this discrepancy remains a major problem in Asian paleomagnetism. Discordance of the late Paleozoic poles from Tarim and Siberia suggest that Tarim has rotated about 30° counterclockwise with respect to Siberia since the Permian. Where paleomagnetic samples of both Late Carboniferous to Early Triassic (C3-T1) and J3-E1 ages were collected from the same area of Tarim, a great circle passes through the means of the poles and the sampling locality. This suggests that (1) only a difference in inclination (and not declination) distinguishes the two data sets, and (2) vertical axis block rotations of the C3-E1 strata occurred after E1. Although based on data of lesser quality, the mean Early to Middle Jurassic (J1-2) pole from Tarim differs significantly from the Eurasian reference pole, requiring radical tectonic solutions to resolve them. The Tarim J1-2 pole is indistinguishable from both the mean J3-E1 and C3-T1 poles. The similarity of all the poles and the analogous tectonic setting of present-day central Asia to that of the late Paleozoic in eastern North America raises the question whether all the data from Tarim are overprinted.
Miller, Suellen; Fathalla, Mohamed M F; Ojengbede, Oladosu A; Camlin, Carol; Mourad-Youssif, Mohammed; Morhason-Bello, Imran O; Galadanci, Hadiza; Nsima, David; Butrick, Elizabeth; Al Hussaini, Tarek; Turan, Janet; Meyer, Carinne; Martin, Hilarie; Mohammed, Aminu I
2010-10-18
Obstetric hemorrhage is the leading cause of maternal mortality globally. The Non-pneumatic Anti-Shock Garment (NASG) is a low-technology, first-aid compression device which, when added to standard hypovolemic shock protocols, may improve outcomes for women with hypovolemic shock secondary to obstetric hemorrhage in tertiary facilities in low-resource settings. This study employed a pre-intervention/intervention design in four facilities in Nigeria and two in Egypt. Primary outcomes were measured mean and median blood loss, severe end-organ failure morbidity (renal failure, pulmonary failure, cardiac failure, or CNS dysfunctions), mortality, and emergency hysterectomy for 1442 women with ≥750 mL blood loss and at least one sign of hemodynamic instability. Comparisons of outcomes by study phase were assessed with rank sum tests, relative risks (RR), number needed to treat for benefit (NNTb), and multiple logistic regression. Women in the NASG phase (n = 835) were in worse condition on study entry, 38.5% with mean arterial pressure <60 mmHg vs. 29.9% in the pre-intervention phase (p = 0.001). Despite this, negative outcomes were significantly reduced in the NASG phase: mean measured blood loss decreased from 444 mL to 240 mL (p < 0.001), maternal mortality decreased from 6.3% to 3.5% (RR 0.56, 95% CI 0.35-0.89), severe morbidities from 3.7% to 0.7% (RR 0.20, 95% CI 0.08-0.50), and emergency hysterectomy from 8.9% to 4.0% (RR 0.44, 0.23-0.86). In multiple logistic regression, there was a 55% reduced odds of mortality during the NASG phase (aOR 0.45, 0.27-0.77). The NNTb to prevent either mortality or severe morbidity was 18 (12-36). Adding the NASG to standard shock and hemorrhage management may significantly improve maternal outcomes from hypovolemic shock secondary to obstetric hemorrhage at tertiary care facilities in low-resource settings.
Ho, Chester H; Cheung, Amanda; Southern, Danielle; Ocampo, Wrechelle; Kaufman, Jaime; Hogan, David B; Baylis, Barry; Conly, John M; Stelfox, Henry T; Ghali, William A
2016-12-01
Research regarding the reliability of the Braden Scale and nurses' perspectives on the instrument for predicting pressure ulcer (PU) risk in acute care settings is limited. A mixed-methods study was conducted in a tertiary acute care facility to examine interrater reliability (IRR) of the Braden Scale and its subscales, and a qualitative survey using semi-structured interviews was conducted among nurses caring for patients in acute care units to gain nurse perspective regarding scale usability. Data were extracted from a previous retrospective, randomized, controlled trial involving adult patients with compromised mobility receiving care in a tertiary acute care hospital in Canada. One-way, intraclass correlation coefficients (ICCs) were calculated on item and total scores, and kappa statistics were used to determine reliability of categorizing patients on their risk. Interview results were categorized by common themes. Reliability was assessed on 64 patients, where nurses and research staff independently assessed enrolled participants at baseline and after 72 hours using the Braden Scale as it appeared on an electronic medical record. IRR for the total score was high (ICC = 0.807). The friction and shear item had the lowest reliability (ICC = 0.266). Reliability of categorizing patients' level of risk had moderate agreement (κ = 0.408). Three (3) major and 12 subthemes emerged from the 14 nurse interviews; nurses were aware of the scale's purpose but were uncertain of its effectiveness, some items were difficult to rate, and questions were raised as to whether using the scale enhanced patient care. Aspects identified by nurses to enhance usability included: 1) changes to the electronic version (incorporating the scale into daily assessment documents with readily available item descriptions), 2) additional training, and 3) easily available resource material to improve reliability and usability of scale. These findings need to be considered when using the Braden Scale in clinical practice. Further study of the value of the total Braden Scale and its subscales is warranted.
Kilcullen, Meegan; Ireland, Susan
2017-05-11
Neonatology has made significant advances in the last 30 years. Despite the advances in treatments, not all neonates survive and a palliative care model is required within the neonatal context. Previous research has focused on the barriers of palliative care provision. A holistic approach to enhancing palliative care provision should include identifying both facilitators and barriers. A strengths-based approach would allow barriers to be addressed while also enhancing facilitators. The current study qualitatively explored perceptions of neonatal nurses about facilitators and barriers to delivery of palliative care and also the impact of the regional location of the unit. The study was conducted at the Townsville Hospital, which is the only regional tertiary neonatal unit in Australia. Semi-structured interviews were conducted with a purposive sample of eight neonatal nurses. Thematic analysis of the data was conducted within a phenomenological framework. Six themes emerged regarding family support and staff factors that were perceived to support the provision of palliative care of a high quality. Staff factors included leadership, clinical knowledge, and morals, values, and beliefs. Family support factors included emotional support, communication, and practices within the unit. Five themes emerged from the data that were perceived to be barriers to providing quality palliative care. Staff perceived education, lack of privacy, isolation, staff characteristics and systemic (policy, and procedure) factors to impact upon palliative care provision. The regional location of the unit also presented unique facilitators and barriers to care. This study identified and explored facilitators and barriers in the delivery of quality palliative care for neonates in a regional tertiary setting. Themes identified suggested that a strengths-approach, which engages and amplifies facilitating factors while identified barriers are addressed or minimized, would be successful in supporting quality palliative care provision in the neonatal care setting. Study findings will be used to inform clinical education and practice.
Nanomanipulation of Single RNA Molecules by Optical Tweezers
Stephenson, William; Wan, Gorby; Tenenbaum, Scott A.; Li, Pan T. X.
2014-01-01
A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be increasingly important. As RNA function often depends on its ability to adopt alternative structures, it is difficult to predict RNA three-dimensional structures directly from sequence. Single-molecule approaches show potentials to solve the problem of RNA structural polymorphism by monitoring molecular structures one molecule at a time. This work presents a method to precisely manipulate the folding and structure of single RNA molecules using optical tweezers. First, methods to synthesize molecules suitable for single-molecule mechanical work are described. Next, various calibration procedures to ensure the proper operations of the optical tweezers are discussed. Next, various experiments are explained. To demonstrate the utility of the technique, results of mechanically unfolding RNA hairpins and a single RNA kissing complex are used as evidence. In these examples, the nanomanipulation technique was used to study folding of each structural domain, including secondary and tertiary, independently. Lastly, the limitations and future applications of the method are discussed. PMID:25177917
Clayden, Jonathan; Foricher, Yann J Y; Helliwell, Madeleine; Johnson, Paul; Mitjans, David; Vinader, Victoria
2006-02-07
The orientation of a tertiary amide group adjacent to an aromatic ring may be governed by the stereochemistry of an adjacent chiral substituent. With a chiral substituent in both ortho positions, matched/mismatched pairs of isomers result. Evidence for matched stereochemistry is provided by the clean NMR spectra of single conformers, while mismatching gives poor or unexpected selectivities in the formation of chiral substituents, or mixtures of amide conformers. Attempts to use the match-mismatch effect to select for racemic pairs of enantiomeric substituents, and hence develop a "racemate-sequestering" reagent, are described, along with the use of "matching" to scavenge a single enantiomer of a diamine from material of incomplete enantiomeric purity.
Böhm, Stanislav; Exner, Otto
2004-02-01
The geometrical parameters of molecules of 2-substituted 2-methylpropanes and 1-substituted bicyclo[2.2.2]octanes were calculated at the B3LYP/6-311+G(d,p) level. They agreed reasonably well with the mean crystallographic values retrieved from the Cambridge Structural Database for a set of diverse non-cyclic structures with a tertiary C atom. The angle deformations at this C atom produced by the immediately bonded substituent are also closely related to those observed previously in benzene mono derivatives (either as calculated or as derived from crystallographic data). The calculated geometrical parameters were used to test the classical Walsh rule: It is evidently true that an electron-attracting substituent increases the proportion of C-atom p-electrons in the bond to the substituent and leaves more s-electrons to the remaining bonds; as a consequence the C-C-C angles at a tertiary carbon are widened and the C-C bonds shortened. However, this rule describes only part of the reality since the bond angles and lengths are controlled by other factors as well, for instance by steric crowding. Another imperfection of the Walsh rule is that the sequence of substituents does not correspond to their electronegativities, as measured by any known scale; more probably it is connected with the inductive effect, but then only very roughly.
The desirable qualities of future doctors--a study of medical student perceptions.
Hurwitz, Steven; Kelly, Brian; Powis, David; Smyth, Robyn; Lewin, Terry
2013-07-01
There is a lack of consensus regarding the qualities possessed by the ideal doctor, and very limited research regarding the views of medical students on these qualities. To investigate the views of commencing medical students regarding the desirable qualities of doctors. A survey containing a set of proposed desirable qualities of doctors identified from the existing literature was completed by 158 first-year medical students. The survey had a 75% response rate. Students rated the individual qualities of empathy, motivation to be a doctor, good verbal communication, ethically sound, integrity and honesty as the most important. A factor analysis identified six categories of qualities: methodical processing, cognitive capacity, people skills, generic work ethic, role certainty and warmth. Significant differences in factor scores were found across subgroups of students (international and domestic students, with and without prior tertiary studies) on the following factors: methodical processing, which was scored highest by domestic students with prior tertiary studies, cognitive capacity, which was scored highest by domestic students without prior tertiary studies and generic work ethic, which was scored highest by international students. Medical students identified a range of desirable personal qualities of a doctor which varied according to student characteristics, including their prior educational experience. Future research aiming to define such desirable qualities should include a broader range of stakeholders, including students at different training levels and institutions.
Keating, Kevin S.; Humphris, Elisabeth L.; Pyle, Anna Marie
2015-01-01
Unlike proteins, the RNA backbone has numerous degrees of freedom (eight, if one counts the sugar pucker), making RNA modeling, structure building and prediction a multidimensional problem of exceptionally high complexity. And yet RNA tertiary structures are not infinite in their structural morphology; rather, they are built from a limited set of discrete units. In order to reduce the dimensionality of the RNA backbone in a physically reasonable way, a shorthand notation was created that reduced the RNA backbone torsion angles to two (η and θ, analogous to ϕ and ψ in proteins). When these torsion angles are calculated for nucleotides in a crystallographic database and plotted against one another, one obtains a plot analogous to a Ramachandran plot (the η/θ plot), with highly populated and unpopulated regions. Nucleotides that occupy proximal positions on the plot have identical structures and are found in the same units of tertiary structure. In this review, we describe the statistical validation of the η/θ formalism and the exploration of features within the η/θ plot. We also describe the application of the η/θ formalism in RNA motif discovery, structural comparison, RNA structure building and tertiary structure prediction. More than a tool, however, the η/θ formalism has provided new insights into RNA structure itself, revealing its fundamental components and the factors underlying RNA architectural form. PMID:21729350
Tele-cytology: An innovative approach for cervical cancer screening in resource-poor settings.
Singh, Sandeep; Badaya, Sorabh
2016-01-01
Carcinoma cervix remains a leading cause of cancer mortality among women in countries lacking any screening program. The existing screening policy and approach via conventional cytology centered mainly in Tertiary Care Center, is totally unaffordable to Indian women, especially in the remote areas. This suggests the need of depolarizing the resources via generating the near real time modalities which could be used at the door step of the needy ones. For any screening modality to be effective it should be adequately sensitive, specific, reproducible, cheap, simple, affordable, and the most important is should be real time to ensure wide coverage and curtail loss to follow-up. Incorporating telecytology as a screening tool could make the dream come true. Telecytology is the interpretation of cytology material at a distance using digital images. Use of mobile telecytology unit housed in a van carrying satellite equipment and the automated image capturing systems is the central theme behind this idea. The imaging equipment would be carrying out the imaging of Papanicolaou smears prepared at the screening site and sending the images to the central laboratories situated at some tertiary care level. This concept could overcome the hindrance of trained cytology infrastructure in the resource poor settings and could provide an efficient and economical way of screening patients. There is possibility that the designed approach may not detect the entire women positive for the disease but if the desired objective was to diagnose as many cases as possible in resource poor setting, then this process offers an advantage over no screening at all.
Halland, M; Ravi, K; Barlow, J; Arora, A
2016-01-01
Barium esophagrams are a frequently performed test, and radiological observations about potential abnormal esophageal motility, such as tertiary contractions, are commonly reported. We sought to assess the correlation between tertiary waves, and in particular isolated tertiary waves, on esophagrams and findings on non-synchronous high-resolution esophageal manometry. We retrospectively reviewed reports of esophagrams performed at a tertiary referral center and identified patients in whom tertiary waves were observed and a high-resolution esophageal manometry had been performed. We defined two groups; group 1 was defined as patients with isolated tertiary waves, whereas group 2 had tertiary waves and evidence of achalasia or an obstructing structural abnormality on the esophagram. We collected data on demographics, dysphagia score, associated findings on esophagram, and need for intervention. We reviewed the reports of 2100 esophagrams of which tertiary waves were noted as an isolated abnormality in 92, and in association with achalasia or a structural obstruction in 61. High-resolution manometry was performed in 17 patients in group 1, and five had evidence of a significant esophageal motility disorder and 4 required any intervention. Twenty-one patients in group 2 underwent manometry, and 18 had a significant esophageal motility disorder. An isolated finding of tertiary waves on an esophagram is rarely associated with a significant esophageal motility disorder that requires intervention. All patients with isolated tertiary waves who required intervention had a dysphagia to liquids. Tertiary contractions, in the absence of dysphagia to liquids, indicate no significant esophageal motility disorder. © 2014 International Society for Diseases of the Esophagus.
On-site wastewater treatment using subsurface flow constructed wetlands in Ireland.
Gill, Laurence W; O'Luanaigh, Niall; Johnston, Paul M
2011-01-01
The results from an Irish EPA-funded project on the effectiveness of using constructed wetlands for treating wastewater from single households is presented, which has contributed to the design guidelines included in the new EPA Code of Practice. Three subsurface flow gravel-filled wetlands were constructed on separate sites--one to provide secondary treatment and the other two to provide tertiary treatment stages for the domestic effluent. A comprehensive analysis over three years was then conducted to provide a robust characterization of the internal dynamics of the systems, particularly with respect to N and P removal as well as evaluating the temporal water balance across the different seasons. The removal of Total N was only 29% and 30% in the secondary and tertiary treatment wetlands, respectively; particularly disappointing for the tertiary treatment process, which was receiving nitrified effluent. Studies on the (15)N stable isotope confirmed that 35% of the ammonium from the septic tank was passing straight through the process without taking part in any biogeochemical processes. However, influent N in the wetlands was shown to be biologically assimilated into organic nitrogen and then released again as soluble ammonium--so-called nitrogen "spiraling." Removal of Total P in the wetlands averaged from 28% to 45% with higher P removals measured during summer periods, although the effluent concentrations were still found to be high (> 5 mg/l on average). The phosphorus in the plant material was also analysed revealing that the annual above-ground stem matter only accounted for 1.3% to 8.4% of the annual total P-load in the wetlands. Finally, the water balance analyses showed that the mean flow discharging from both the secondary and tertiary treatment wetlands was slightly greater than the mean flow to the reed bed over the trial period, with rainfall acting to increase flows by 13% and 5%, respectively, on average in winter while just about balancing evapotranspiration in the summer.
Tectonic history of Sweetgrass Arch, Montana and Alberta-key to finding new hydrocarbons
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shepard, W. Shepard, B.
1985-05-01
The Sweetgrass arch of northwestern Montana and southern Alberta is a major ancient structural feature. Initial anticlinal emplacement occurred during the early Paleozoic and was parallel with the cratonic margin. Strong uplift followed by peneplanation occurred during the Late Jurassic and basal Cretaceous during the westward drifting of the North American plate following the breakup of Pangea. During Cretaceous and early Tertiary times, the Sweetgrass arch was quiescent, but was rejuvenated in mid to late Tertiary, upwarped by a basement flexure to its present structural configuration: a 200 mi (322 km) long, north-plunging anticline showing 10,000 ft (350 m) ofmore » structural relief. Midway down its plunge, the anticline is offset 30 mi (48 km) by a right-lateral transcurrent fault. During Late Cretaceous and early Tertiary, plutonic uplifts were emplaced on the east flank, forming traps for oil then migrating updip from the Williston and Alberta basins. Oil and gas accumulated in Mississippian, Jurassic, and basal Cretaceous reservoirs in structural and stratigraphic traps around these plutonic uplifts. Subsequent late Tertiary doming of the Sweetgrass arch tilted the earlier structural traps and drained them, resulting in remigration of much of the oil and gas to the crest of the arch. The tilting failed to destroy many of the stratigraphic traps. As a result, down the flanks of the Sweetgrass arch are many frozen stratigraphic traps including Cut Bank field, the largest single-pay stratigraphic trap in the north Rockies. On the crest are large structure accumulations of remigrated oil at Kevin Sunburst and Pondera. Evidence of remigration is recorded by live oil show tracks in the reservoirs and remnant gas caps throughout the area of earlier accumulations. A potential exists for finding new frozen traps on the flanks and remigrated oil accumulations on or near the crest of the Sweetgrass arch.« less
Mobius Syndrome: A 35-Year Single Institution Experience.
K McClure, Philip; Kilinc, Eray; Oishi, Scott; I Riccio, Anthony; A Karol, Lori
Mobius syndrome is a rare syndrome that is known to be associated with a variety of orthopaedic conditions including scoliosis, clubfoot, transverse limb deficiencies, Poland syndrome, and a myriad of hand conditions. To date, no large series exist to characterize the orthopaedic manifestations of Mobius syndrome. Medical records at a single tertiary pediatric institution were reviewed for all patients diagnosed with Mobius syndrome from January 1, 1980 to December 31, 2015. Records and radiographs were reviewed for associated orthopaedic conditions and their management. In total, 44 patients with Mobius syndrome were identified. Age at presentation ranged from 6 days to 14 years. When compared with the general population, patients with Mobius syndrome had an increased incidence of clubfoot (41%), Poland syndrome (20%), and scoliosis (14%). Clubfoot treated both before and after the institution of Ponseti casting had a high rate of requiring posteromedial release, with a significant rate of subsequent revision. Hip dysplasia was noted in 1 patient and required surgical correction. Other associated syndromes included arthrogryposis, Pierre Robin syndrome, and chromosome 10 defect. Mobius syndrome is accompanied by an increased rate of several orthopaedic problems; most notably clubfoot, scoliosis, and upper extremity differences that often require surgical treatment. The management of clubfoot in the setting of Mobius syndrome often requires surgical intervention due to failure of casting, and seems to have a higher rate of need for revision. Early involvement of orthopaedists in the care of patients with Mobius syndrome is often necessary. Orthopaedist should counsel families that treatment may be more complex than that of idiopathic disease. Level IV-case series.
Lee, Cha Gon; Park, Sang-Jin; Yun, Jun-No; Ko, Jung Min; Kim, Hyon-Ju; Yim, Shin-Young; Sohn, Young Bae
2013-11-01
This study analyzed and evaluated the demographic, clinical, and cytogenetic data [G-banded karyotyping and array-based comparative genomic hybridization (array CGH)] of patients with unexplained developmental delay or intellectual disability at a single Korean institution. We collected clinical and cytogenetic data based on retrospective charts at Ajou University Medical Center, Suwon, Korea from April 2008 to March 2012. A total of 190 patients were identified. Mean age was 5.1±1.87 years. Array CGH yielded abnormal results in 26 of 190 patients (13.7%). Copy number losses were about two-fold more frequent than gains. A total of 61.5% of all patients had copy number losses. The most common deletion disorders included 22q11.2 deletion syndrome, 15q11.2q12 deletion and 18q deletion syndrome. Copy number gains were identified in 34.6% of patients, and common diseases among these included Potocki-Lupski syndrome, 15q11-13 duplication syndrome and duplication 22q. Abnormal karyotype with normal array CGH results was exhibited in 2.6% of patients; theses included balanced translocation (n=2), inversion (n=2) and low-level mosaicism (n=1). Facial abnormalities (p<0.001) and failure to thrive were (p<0.001) also more frequent in the group of patients with abnormal CGH findings. Array CGH is a useful diagnostic tool in clinical settings in patients with developmental delay or intellectual disability combined with facial abnormalities or failure to thrive.
The Colorado front range: anatomy of a Laramide uplift
Kellogg, Karl; Bryant, Bruce; Reed, John C.
2004-01-01
Along a transect across the Front Range from Denver to the Blue River valley near Dillon, the trip explores the geologic framework and Laramide (Late Cretaceous to early Eocene) uplift history of this basement-cored mountain range. Specific items for discussion at various stops are (1) the sedimentary and structural record along the upturned eastern margin of the range, which contains several discontinuous, east-directed reverse faults; (2) the western structural margin of the range, which contains a minimum of 9 km of thrust overhang and is significantly different in structural style from the eastern margin; (3) mid- to late-Tertiary modifications to the western margin of the range from extensional faulting along the northern Rio Grande rift trend; (4) the thermal and uplift history of the range as revealed by apatite fission track analysis; (5) the Proterozoic basement of the range, including the significance of northeast-trending shear zones; and (6) the geologic setting of the Colorado mineral belt, formed during Laramide and mid-Tertiary igneous activity.
NASA Astrophysics Data System (ADS)
Pharoe, Benedict Kinshasa; Liu, Kuiwu
2018-07-01
The lithostratigraphy of pedogenic manganese (Mn) nodules in the Carletonville area is similar to the Klipkuil, Ryedale, Wes Wits, and Houtkoppies deposits in the West Rand region of the Gauteng and North West Provinces and to a lesser extent the Bronkhorstfontein manganese deposit in the Limpopo Province of South Africa. The lithostratigraphy of the ore deposit at the General Nice Manganese Mine consists of a basal manganese wad, preserved in a typical karst setting on top of the underlying Malmani stromatolitic dolomites and Tertiary fluvial and secondary mineral deposits consisting of manganese nodules of variable size in a finer-grained soil matrix. At the top of the deposit is a Mn-depleted Quaternary sand cover. The Tertiary alluvial succession hosting Mn nodules was informally subdivided into A, B, C, D, E, F, G and H zones on the basis of geochemical analyses (XRD, XRF and SEM) of bulk zone samples and the manganese nodule size and concentration.
Acid-base disorders in critically ill neonates
Lekhwani, S.; Shanker, V.; Gathwala, G.; Vaswani, N. D.
2010-01-01
Objective: To study acid–base imbalance in common pediatric diseases (such as sepsis, bronchopneumonia, diarrhea, birth-asphyxia etc.) in neonates. Design and Setting: An observational study was conducted in an emergency room of a tertiary teaching care hospital in Haryana, India. Patients and Methods: Fifty neonates (from first hour to one month) attending pediatric emergency services with various ailments. Blood gas analysis, electrolytes, plasma lactate, and plasma albumin were estimated in neonates. Results: Metabolic acidosis was the most common acid–base disorder. Hyperlactatemia was observed in more than half of such cases. Birth asphyxia was another common disorder with the highest mortality in neonates followed by bronchopneumonia and sepsis. Significant correlation between mortality and critical values of lactate was observed. Conclusion: Birth asphyxia with high-lactate levels in neonates constituted major alterations in acid–base disorders seen in an emergency room of a tertiary teaching care hospital. Plasma lactate concentration measurement provides an invaluable tool to assess type of metabolic acidosis in addition to predicting mortality in these neonates. PMID:20859489
Docker, Charles E J; Lewthwaite, Simon; Kiely, Nigel T
2007-07-01
The Ponseti technique is a well-proven way of managing paediatric clubfoot deformity. We describe a management set-up which spreads the care between secondary and tertiary care with no loss of quality. In our audit of the first 2 years of Ponseti casting in the treatment of idiopathic congenital talipes equinovarus (CTEV, clubfoot) deformity, we identified 77 feet having been treated in 50 patients. Forty-nine feet were treated primarily in Oswestry, a tertiary referral centre for paediatric orthopaedic conditions, and 13 feet were treated in conjunction with the physiotherapy department at one of the region's district general hospitals (Leighton Hospital, Crewe, Cheshire). Similar good results and low requirement for surgical interventions other than Achilles tenotomy, which forms part of the Ponseti regimen, were found in both cohorts. This 'hub-and-spoke' approach would appear to be efficient in terms of resource utilisation. Additional benefits for patients and their carers include ease of access to services and reduced financial and transport burdens.
Delays in diagnosis and treatment of extrapulmonary tuberculosis in Guatemala.
Shah, Pooja Ajay; Coj, Merida; Rohloff, Peter
2017-10-09
A 23-year-old indigenous Guatemalan man presented in 2016 to our clinic in Sololá, Guatemala, with 10 months of recurrent neck swelling, fevers, night sweats and weight loss. Previously, he had sought care in three different medical settings, including a private physician-run clinic, a tertiary private cancer treatment centre and, finally, a rural government health post. With assistance from our institution's accompaniment staff, the patient was admitted to a public tertiary care hospital for work-up. Rifampin-susceptible tuberculosis was diagnosed, and appropriate treatment was begun. The case illustrates how low tuberculosis recognition among community health workers and health system segmentation creates obstacles to appropriate care, especially for patients with limited means. As a result, significant diagnostic and treatment delays can occur, increasing the public health burden of tuberculosis. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Drellack, S.L.; Prothro, L.B.; Townsend, M.J.
2011-02-01
The geologic setting and history, along with observations through 50 years of detailed geologic field work, show that large-displacement (i.e., greater than 30 meters of displacement) syn- to post-volcanic faults are rare in the Rainier Mesa area. Faults observed in tunnels and drill holes are mostly tight, with small displacements (most less than 1.5 meters) and small associated damage zones. Faults are much more abundant in the zeolitized tuffs than in the overlying vitric tuffs, and there is little evidence that faults extend downward from the tuff section through the argillic paleocolluvium into pre-Tertiary rocks. The differences in geomechanical characteristicsmore » of the various tuff lithologies at Rainier Mesa suggest that most faults on Rainer Mesa are limited to the zeolitic units sandwiched between the overlying vitric bedded tuffs and the underlying pre-Tertiary units (lower carbonate aquifer–3, lower clastic confining unit–1, and Mesozoic granite confining unit).« less
Bouse, R.M.; Ruiz, J.; Titley, S.R.; Tosdal, R.M.; Wooden, J.L.
1999-01-01
Porphyry copper deposits in Arizona are genetically associated with Late Cretaceous and early Tertiary igneous complexes that consist of older intermediate volcanic rocks and younger intermediate to felsic intrusions. The igneous complexes and their associated porphyry copper deposits were emplaced into an Early Proterozoic basement characterized by different rocks, geologic histories, and isotopic compositions. Lead isotope compositions of the Proterozoic basement rocks define, from northwest to southeast, the Mojave, central Arizona, and southeastern Arizona provinces. Porphyry copper deposits are present in each Pb isotope province. Lead isotope compositions of Late Cretaceous and early Tertiary plutons, together with those of sulfide minerals in porphyry copper deposits and of Proterozoic country rocks, place important constraints on genesis of the magmatic suites and the porphyry copper deposits themselves. The range of age-corrected Pb isotope compositions of plutons in 12 Late Cretaceous and early Tertiary igneous complexes is 206Pb/204Pb = 17.34 to 22.66, 207Pb/204Pb = 15.43 to 15.96, and 208Pb/204Pb = 37.19 to 40.33. These Pb isotope compositions and calculated model Th/U are similar to those of the Proterozoic rocks in which the plutons were emplaced, thereby indicating that Pb in the younger rocks and ore deposits was inherited from the basement rocks and their sources. No Pb isotope differences distinguish Late Cretaceous and early Tertiary igneous complexes that contain large economic porphyry copper deposits from less rich or smaller deposits that have not been considered economic for mining. Lead isotope compositions of Late Cretaceous and early Tertiary plutons and sulfide minerals from 30 metallic mineral districts, furthermore, require that the southeastern Arizona Pb province be divided into two subprovinces. The northern subprovince has generally lower 206Pb/204Pb and higher model Th/U, and the southern subprovince has higher 206Pb/204Pb and lower model Th/U. These Pb isotope differences are inferred to result from differences in their respective post-1.7 Ga magmatic histories. Throughout Arizona, Pb isotope compositions of Late Cretaceous and early Tertiary plutons and associated sulfide minerals are distinct from those of Jurassic plutons and also middle Tertiary igneous rocks and sulfide minerals. These differences most likely reflect changes in tectonic setting and magmatic sources. Within Late Cretaceous and early Tertiary igneous complexes that host economic porphyry copper deposits, there is commonly a decrease in Pb isotope composition from older to younger plutons. This decrease in Pb isotope values with time suggests an increasing involvement of crust with lower U/Pb than average crust in the source(s) of Late Cretaceous and early Tertiary magmas. Lead isotope compositions of the youngest porphyries in the igneous complexes are similar to those in most sulfide minerals within the associated porphyry copper deposit. This Pb isotope similarity argues for a genetic link between them. However, not all Pb in the sulfide minerals in porphyry copper deposits is magmatically derived. Some sulfide minerals, particularly those that are late stage, or distal to the main orebody, or in Proterozoic or Paleozoic rocks, have elevated Pb isotope compositions displaced toward the gross average Pb isotope composition of the local country rocks. The more radiogenic isotopic compositions argue for a contribution of Pb from those rocks at the site of ore deposition. Combining the Pb isotope data with available geochemical, isotopic, and petrologic data suggests derivation of the young porphyry copper-related plutons, most of their Pb, and other metals from a hybridized lower continental crustal source. Because of the likely involvement of subduction-related mantle-derived basaltic magma in the hybridized lower crustal source, an indiscernible mantle contribution is probable in the porphyry magmas. Clearly, in addition
Methicillin resistant Staphylococcus aureus contamination of phlebotomy tourniquets and faucets
Abeywickrama, T; Amarasinghe, K; Wijerathne, S; Dharmaratne, C; Fernando, D; Senaratna, B C; Gunasekera, H A K M
2018-03-31
Methicillin resistant Staphylococcus aureus (MRSA) is transmitted through direct contact or fomites. The most important means of nosocomial spread is by hospital personnel. However, fomites are being increasingly recognized as sources of nosocomial infection. Our aim was to describe the MRSA contamination rate of phlebotomy tourniquets and faucets in a tertiary care hospital and to compare the contamination of plastic tourniquets with that of fabric tourniquets. A cross-sectional study was carried out in the general wards of a tertiary care hospital in the Colombo District. Two hundred tourniquets were collected and 100 faucets were swabbed and cultured on CHROMagar™ MRSA medium (CHROMagar Microbiology). Contamination rates of 50 plastic tourniquets and 50 fabric tourniquets were compared. MRSA grew in 26% of tourniquets. Majority were plastic tubes. MRSA contamination of tourniquets did not significantly differ by ward (p>0.4). MRSA was found on 26% of faucets. Contamination rate was highest in the common wards for dermatology, dental, rheumatology, and neurology (55.6%), followed by gynaecology (45.2%), cardiology (33.3%), surgery (18.8%), psychiatry (11.1%), and medicine (5.6%). There was a significant difference in rates of contamination of faucets in the different wards (p<0.01). There was no significant difference in the colony count per surface area of the two types of tourniquets after a single use. MRSA contamination rates of tourniquets and faucets were high. Single-use plastic tourniquets were much less contaminated with MRSA than reused tourniquets.
Visualizing the global secondary structure of a viral RNA genome with cryo-electron microscopy
Garmann, Rees F.; Gopal, Ajaykumar; Athavale, Shreyas S.; Knobler, Charles M.; Gelbart, William M.; Harvey, Stephen C.
2015-01-01
The lifecycle, and therefore the virulence, of single-stranded (ss)-RNA viruses is regulated not only by their particular protein gene products, but also by the secondary and tertiary structure of their genomes. The secondary structure of the entire genomic RNA of satellite tobacco mosaic virus (STMV) was recently determined by selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE). The SHAPE analysis suggested a single highly extended secondary structure with much less branching than occurs in the ensemble of structures predicted by purely thermodynamic algorithms. Here we examine the solution-equilibrated STMV genome by direct visualization with cryo-electron microscopy (cryo-EM), using an RNA of similar length transcribed from the yeast genome as a control. The cryo-EM data reveal an ensemble of branching patterns that are collectively consistent with the SHAPE-derived secondary structure model. Thus, our results both elucidate the statistical nature of the secondary structure of large ss-RNAs and give visual support for modern RNA structure determination methods. Additionally, this work introduces cryo-EM as a means to distinguish between competing secondary structure models if the models differ significantly in terms of the number and/or length of branches. Furthermore, with the latest advances in cryo-EM technology, we suggest the possibility of developing methods that incorporate restraints from cryo-EM into the next generation of algorithms for the determination of RNA secondary and tertiary structures. PMID:25752599
Cao, Renzhi; Bhattacharya, Debswapna; Adhikari, Badri; Li, Jilong; Cheng, Jianlin
2015-01-01
Model evaluation and selection is an important step and a big challenge in template-based protein structure prediction. Individual model quality assessment methods designed for recognizing some specific properties of protein structures often fail to consistently select good models from a model pool because of their limitations. Therefore, combining multiple complimentary quality assessment methods is useful for improving model ranking and consequently tertiary structure prediction. Here, we report the performance and analysis of our human tertiary structure predictor (MULTICOM) based on the massive integration of 14 diverse complementary quality assessment methods that was successfully benchmarked in the 11th Critical Assessment of Techniques of Protein Structure prediction (CASP11). The predictions of MULTICOM for 39 template-based domains were rigorously assessed by six scoring metrics covering global topology of Cα trace, local all-atom fitness, side chain quality, and physical reasonableness of the model. The results show that the massive integration of complementary, diverse single-model and multi-model quality assessment methods can effectively leverage the strength of single-model methods in distinguishing quality variation among similar good models and the advantage of multi-model quality assessment methods of identifying reasonable average-quality models. The overall excellent performance of the MULTICOM predictor demonstrates that integrating a large number of model quality assessment methods in conjunction with model clustering is a useful approach to improve the accuracy, diversity, and consequently robustness of template-based protein structure prediction. PMID:26369671
Screening for Body Dysmorphic Disorder in a Dermatology Outpatient Setting at a Tertiary Care Centre
Thanveer, Fibin; Khunger, Niti
2016-01-01
Context: A distressing pre-occupation with an imagined or slight defect in appearance with a marked negative effect on the patient's life is the core symptom of body dysmorphic disorder (BDD). Aim: To screen the patients attending a dermatology clinic at a tertiary care centre for BDD using the BDD-dermatology version (DV) questionnaire. Settings and Design: This cross-sectional study enrolled 245 consecutive patients from the dermatology outpatients clinic. Methods: The demographic details were collected and the DV of BDD screening questionnaire was administered. A 5-point Likert scale was used for objective scoring of the stated concern and patients who scored ≥3 were excluded from the study. Statistical Analysis Used: The results were statistically analysed. Differences between the groups were investigated by Chi-square analysis for categorical variables, and Fisher exact test wherever required. Results: A total of 177 patients completed the study, and of these, eight patients screened positive for BDD. The rate of BDD in patients presenting with cosmetic complaints was 7.5% and in those with general dermatology, complaints were 2.1%, with no significant difference between the two groups (P = 0.156). Facial flaws (62.5%) were the most common concern followed by body asymmetry (25%). Conclusion: The rates of BDD found in this study are comparable but at a lower rate than that reported in literature data. PMID:27761090
Modeling of beam-induced damage of the LHC tertiary collimators
NASA Astrophysics Data System (ADS)
Quaranta, E.; Bertarelli, A.; Bruce, R.; Carra, F.; Cerutti, F.; Lechner, A.; Redaelli, S.; Skordis, E.; Gradassi, P.
2017-09-01
Modern hadron machines with high beam intensity may suffer from material damage in the case of large beam losses and even beam-intercepting devices, such as collimators, can be harmed. A systematic method to evaluate thresholds of damage owing to the impact of high energy particles is therefore crucial for safe operation and for predicting possible limitations in the overall machine performance. For this, a three-step simulation approach is presented, based on tracking simulations followed by calculations of energy deposited in the impacted material and hydrodynamic simulations to predict the thermomechanical effect of the impact. This approach is applied to metallic collimators at the CERN Large Hadron Collider (LHC), which in standard operation intercept halo protons, but risk to be damaged in the case of extraction kicker malfunction. In particular, tertiary collimators protect the aperture bottlenecks, their settings constrain the reach in β* and hence the achievable luminosity at the LHC experiments. Our calculated damage levels provide a very important input on how close to the beam these collimators can be operated without risk of damage. The results of this approach have been used already to push further the performance of the present machine. The risk of damage is even higher in the upgraded high-luminosity LHC with higher beam intensity, for which we quantify existing margins before equipment damage for the proposed baseline settings.
2012-01-01
Background Children with sickle cell disease (SCD) frequently and unpredictably present to the emergency department (ED) with pain. The painful event is the hallmark acute clinical manifestation of SCD, characterised by sudden onset and is usually bony in origin. This study aims to establish if 1.5mcg/kg of intranasal fentanyl (INF; administered via a Mucosal Atomiser Device, MAD™) is non-inferior to intravenous morphine 0.1 mg/kg in severe SCD-associated pain. Methods/design This study is a randomised,double-blind, double-dummy active control trial of children (weighing more than 10 kg) between 1 year and 21 years of age with severe painful sickle cell crisis. Severe pain is defined as rated seven or greater on a 0 to 10 age-appropriate numeric pain scale or equivalent. The trial will be conducted in a single tertiary urban paediatric ED in Dublin, Ireland. Each patient will receive a single active agent and a single placebo via the intravenous and intranasal routes. All clinical and research staff, patients and parents will be blinded to the treatment allocation. The primary endpoint is severity of pain scored at 10 min from administration of the study medications. Secondary endpoints include pain severity measured at 0, 5, 15, 20, 30, 60 and 120 min after the administration of analgesia, proportion of patients requiring rescue analgesia and incidence of adverse events. The trial ends at 120 min after the administration of the study drugs. A clinically meaningful difference in validated pain scores has been defined as 13 mm. Setting the permitted threshold to 50% of this limit (6 mm) and assuming both treatments are on average equal, a sample size of 30 patients (15 per group) will provide at least 80% power to demonstrate that INF is non-inferior to IV morphine with a level of significance of 0.05. Discussion This clinical trial will inform of the role of INF 1.5mcg/kg via MAD in the acute treatment of severe painful sickle cell crisis in children in the ED setting. Trial registration Current Controlled Trials ISRCTN67469672 and EudraCT no. 2011-005161-20 PMID:22647439
Planet-driven Spiral Arms in Protoplanetary Disks. I. Formation Mechanism
NASA Astrophysics Data System (ADS)
Bae, Jaehan; Zhu, Zhaohuan
2018-06-01
Protoplanetary disk simulations show that a single planet can excite more than one spiral arm, possibly explaining the recent observations of multiple spiral arms in some systems. In this paper, we explain the mechanism by which a planet excites multiple spiral arms in a protoplanetary disk. Contrary to previous speculations, the formation of both primary and additional arms can be understood as a linear process when the planet mass is sufficiently small. A planet resonantly interacts with epicyclic oscillations in the disk, launching spiral wave modes around the Lindblad resonances. When a set of wave modes is in phase, they can constructively interfere with each other and create a spiral arm. More than one spiral arm can form because such constructive interference can occur for different sets of wave modes, with the exact number and launching position of the spiral arms being dependent on the planet mass as well as the disk temperature profile. Nonlinear effects become increasingly important as the planet mass increases, resulting in spiral arms with stronger shocks and thus larger pitch angles. This is found to be common for both primary and additional arms. When a planet has a sufficiently large mass (≳3 thermal masses for (h/r) p = 0.1), only two spiral arms form interior to its orbit. The wave modes that would form a tertiary arm for smaller mass planets merge with the primary arm. Improvements in our understanding of the formation of spiral arms can provide crucial insights into the origin of observed spiral arms in protoplanetary disks.
Adhisesha Reddy, Priya; Kishiki, Elizabeth A; Thapa, Hari Bahadur; Demers, Lisa; Geneau, Robert; Bassett, Ken
2018-06-01
Gender and blindness initiatives continue to make eye care personnel aware of the service utilization inequity strongly favouring men, yet interventions to reduce that inequity, particularly for girls, are under developed. This descriptive study gathered quantitative data on the degree of gender equity at five Child Eye Health Tertiary Facilities (CEHTFs) in Asia and Africa and conducted in-depth interviews with eye care personnel to assess their strategies and capacity to reduce gender inequity. Cataract surgery was utilized to assess the degree of inequity and success of interventions to reduce inequity in case finding, service utilization, and follow-up. CEHTF administrative data showed significant gender inequity in cataract surgical services favouring boys in all settings. CEHTFs actively seek children through community and school-based outreach, yet do not have initiatives to reduce gender inequity. Little gender inequity was found among children receiving surgical and follow-up care, although two out of three children were boys. CEHTF staff, despite being aware, offered no effective means to reduce gender inequity involving cataract surgical services. Interventions that successfully increased service utilization by girls came from individual cases, involving extraordinary effort by a single eye care programme person. Community-based case finders such as Anganwadi workers in India, Female Community Health Volunteers (FCHVs) in Nepal, and Key Informants (KIs) in Africa are necessary to identify children in need of cataract services, but insufficient to increase service utilization by girls. Secondary, often extra-ordinary community-based interventions by eye care personnel are needed in all settings.
Lee, Hong Kai; Lee, Chun Kiat; Loh, Tze Ping; Tang, Julian Wei-Tze; Chiu, Lily; Tambyah, Paul A; Sethi, Sunil K; Koay, Evelyn Siew-Chuan
2010-09-01
With the relative global lack of immunity to the pandemic influenza A/H1N1/2009 virus that emerged in April 2009 as well as the sustained susceptibility to infection, rapid and accurate diagnostic assays are essential to detect this novel influenza A variant. Among the molecular diagnostic methods that have been developed to date, most are in tandem monoplex assays targeting either different regions of a single viral gene segment or different viral gene segments. We describe a dual-gene (duplex) quantitative real-time RT-PCR method selectively targeting pandemic influenza A/H1N1/2009. The assay design includes a primer-probe set specific to only the hemagglutinin (HA) gene of this novel influenza A variant and a second set capable of detecting the nucleoprotein (NP) gene of all swine-origin influenza A virus. In silico analysis of the specific HA oligonucleotide sequence used in the assay showed that it targeted only the swine-origin pandemic strain; there was also no cross-reactivity against a wide spectrum of noninfluenza respiratory viruses. The assay has a diagnostic sensitivity and specificity of 97.7% and 100%, respectively, a lower detection limit of 50 viral gene copies/PCR, and can be adapted to either a qualitative or quantitative mode. It was first applied to 3512 patients with influenza-like illnesses at a tertiary hospital in Singapore, during the containment phase of the pandemic (May to July 2009).
Choke, E; Lee, K; McCarthy, M; Nasim, A; Naylor, A R; Bown, M; Sayers, R
2012-12-01
To develop and validate an "in house" risk model for predicting perioperative mortality following elective AAA repair and to compare this with other models. Multivariate logistics regression analysis was used to identify risk factors for perioperative-day mortality from one tertiary institution's prospectively maintained database. Consecutive elective open (564) and endovascular (589) AAA repairs (2000-2010) were split randomly into development (810) and validation (343) data sets. The resultant model was compared to Glasgow Aneurysm Score (GAS), Modified Customised Probability Index (m-CPI), CPI, the Vascular Governance North West (VGNW) model and the Medicare model. Variables associated with perioperative mortality included: increasing age (P = 0.034), myocardial infarct within last 10 years (P = 0.0008), raised serum creatinine (P = 0.005) and open surgery (P = 0.0001). The areas under the receiver operating characteristic curve (AUC) for predicted probability of 30-day mortality in development and validation data sets were 0.79 and 0.82 respectively. AUCs for GAS, m-CPI and CPI were poor (0.63, 0.58 and 0.58 respectively), whilst VGNW and Medicare model were fair (0.73 and 0.79 respectively). In this study, an "in-house" developed and validated risk model has the most accurate discriminative value in predicting perioperative mortality after elective AAA repair. For purposes of comparative audit with case mix adjustments, national models such as the VGNW or Medicare models should be used. Copyright © 2012 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.
2014-01-01
Background Initial management of chemotherapy-induced febrile neutropaenia (FN) comprises empirical therapy with a broad-spectrum antimicrobial. Currently, there is sufficient evidence to indicate which antibiotic regimen should be administered initially. However, no randomized trial has evaluated whether adherence to an antimicrobial stewardship program (ASP) results in lower rates of mortality in this setting. The present study sought to assess the association between adherence to an ASP and mortality among hospitalised cancer patients with FN. Methods We conducted a prospective cohort study in a single tertiary hospital from October 2009 to August 2011. All adult patients who were admitted to the haematology ward with cancer and FN were followed up for 28 days. ASP adherence to the initial antimicrobial prescription was determined. The mortality rates of patients who were treated with antibiotics according to the ASP protocol were compared with those of patients treated with other antibiotic regimens. The multivariate Cox proportional hazards model and propensity score were used to estimate 28-day mortality risk. Results A total of 307 FN episodes in 169 subjects were evaluated. The rate of adherence to the ASP was 53%. In a Cox regression analysis, adjusted for propensity scores and other potential confounding factors, ASP adherence was independently associated with lower mortality (hazard ratio, 0.36; 95% confidence interval, 0.14–0.92). Conclusions Antimicrobial selection is important for the initial management of patients with FN, and adherence to the ASP, which calls for the rational use of antibiotics, was associated with lower mortality rates in this setting. PMID:24884397
Rosa, Regis G; Goldani, Luciano Z; dos Santos, Rodrigo P
2014-05-23
Initial management of chemotherapy-induced febrile neutropaenia (FN) comprises empirical therapy with a broad-spectrum antimicrobial. Currently, there is sufficient evidence to indicate which antibiotic regimen should be administered initially. However, no randomized trial has evaluated whether adherence to an antimicrobial stewardship program (ASP) results in lower rates of mortality in this setting. The present study sought to assess the association between adherence to an ASP and mortality among hospitalised cancer patients with FN. We conducted a prospective cohort study in a single tertiary hospital from October 2009 to August 2011. All adult patients who were admitted to the haematology ward with cancer and FN were followed up for 28 days. ASP adherence to the initial antimicrobial prescription was determined. The mortality rates of patients who were treated with antibiotics according to the ASP protocol were compared with those of patients treated with other antibiotic regimens. The multivariate Cox proportional hazards model and propensity score were used to estimate 28-day mortality risk. A total of 307 FN episodes in 169 subjects were evaluated. The rate of adherence to the ASP was 53%. In a Cox regression analysis, adjusted for propensity scores and other potential confounding factors, ASP adherence was independently associated with lower mortality (hazard ratio, 0.36; 95% confidence interval, 0.14-0.92). Antimicrobial selection is important for the initial management of patients with FN, and adherence to the ASP, which calls for the rational use of antibiotics, was associated with lower mortality rates in this setting.
Buckets and Fire: Metaphors in Tertiary Teaching
ERIC Educational Resources Information Center
Emerson, Lisa; Mansvelt, Juliana
2015-01-01
This paper examines New Zealand tertiary teachers' use of metaphor and their attitudes to the consumer metaphor in relation to teaching. Based on interviews with 16 tertiary teachers, this study shows that although teachers believe the consumer metaphor is accepted by students, tertiary institutions and policy makers, and that it has affected…
Singhi, Sunit; Kumar, Ramesh; Singhi, Pratibha; Jayashree, Muralidharan; Bansal, Arun
2015-06-01
Intracranial pressure monitoring can help in early identification of raised intracranial pressure and in setting more informed goals for treatment. We describe our 10-year experience of bedside burr holes performed by pediatric intensivists to establish intracranial pressure monitoring in children with CNS infections in a resource-limited setting and the technical difficulties and complications encountered. Descriptive study of prospectively recorded data. PICU of a tertiary care academic institute. Consecutive comatose patients with raised intracranial pressure who underwent intracranial pressure monitoring from 2004 to 2013. An intraparenchymal (1.2 mm) or an intraventricular transducer (3.4 mm) (Codman) was placed by a pediatric intensivist through a micro burr hole using a standard protocol. Technical difficulties during the procedure and complications were recorded. Over 10 years, 265 intracranial pressure catheters were placed in 259 patients, mainly for acute CNS infections (n = 242, 93.4%). Median age of patients was 4.8 years, youngest being 6 weeks; 21 patients (8.1%) were younger than 1 year. Intraparenchymal transducer was used in 252 patients (97.3%). Median (interquartile range) duration of intracranial pressure monitoring was 96 hours (72-144 hr). Complications were seen in 3.5% of patients (n = 9/259); the incidence was 0.28 per 1,000 hours of intracranial pressure monitoring. Procedure-related ventriculitis occurred in three of seven patients (42.8%) with intraventricular catheter, in contrast to none in patients with intraparenchymal transducer. Overall mortality was 32.8% (n = 85). On Cox-regression analysis, "blood component therapy" was an independent predictor of poor outcome defined as death or severe neurodisability (adjusted hazard ratio, 1.58; 95% CI, 1.16-2.16; p = 0.004). In a resource-limited setting, pediatric intensivists can safely and successfully perform burr holes at bedside for establishing intraparenchymal intracranial pressure monitoring in children with acute CNS infections. However, our data do not support placement of ventriculostomy catheters by pediatric intensivists in similar settings.
Chandramuki, Akepati; Khanna, Neelam; Shashkina, Elena; Kurepina, Natalia; Mathema, Barun; Kreiswirth, Barry N; Venkataswamy, Manjunatha M
2017-01-01
Specific genotypes of Mycobacterium tuberculosis (MTB) have been reported to cause outbreaks of pulmonary tuberculosis (TB) in geographical areas that are endemic to TB. However, since there is little epidemiological evidence on the association of particular genotypes that cause tuberculous meningitis (TBM), we sought to investigate the association of specific MTB strains with infection of the central nervous system (CNS). We carried out a genetic characterisation of 89 MTB isolates from TBM patients at a Southern Indian tertiary neurocare centre and compared the genotypes with strains of pulmonary TB isolated from Indian immigrants in New York City. We applied the standard methods of genotyping of MTB, namely, IS6110-based restriction fragment length polymorphism and spoligotyping for strain identification, along with principal genetic grouping and single-nucleotide polymorphism cluster analysis. The analysis revealed a high-level of diversity amongst the strain population. The genotypes of the isolates from TBM patients paralleled the pulmonary TB strain population recovered from the Indian immigrants in NYC. We conclude that there is no apparent association between genotypes of MTB and propensity to infect CNS tissue.
Kelly, Elizabeth W; Kelly, Jonathan D; Hiestand, Brian; Wells-Kiser, Kathy; Starling, Stephanie; Hoekstra, James W
2010-01-01
Rapid reperfusion in patients with ST-elevation myocardial infarction (STEMI) is associated with lower mortality. Reduction in door-to-balloon (D2B) time for percutaneous coronary intervention requires multidisciplinary cooperation, process analysis, and quality improvement methodology. Six Sigma methodology was used to reduce D2B times in STEMI patients presenting to a tertiary care center. Specific steps in STEMI care were determined, time goals were established, and processes were changed to reduce each step's duration. Outcomes were tracked, and timely feedback was given to providers. After process analysis and implementation of improvements, mean D2B times decreased from 128 to 90 minutes. Improvement has been sustained; as of June 2010, the mean D2B was 56 minutes, with 100% of patients meeting the 90-minute window for the year. Six Sigma methodology and immediate provider feedback result in significant reductions in D2B times. The lessons learned may be extrapolated to other primary percutaneous coronary intervention centers. Copyright © 2010 Elsevier Inc. All rights reserved.
Casimiro-Soriguer, Ramón; Talavera, María; Balao, Francisco; Terrab, Anass; Herrera, Javier; Talavera, Salvador
2010-07-01
The genus Erophaca comprises a single herbaceous perennial species with two subspecies distributed at opposite ends of the Mediterranean region. We used nrDNA ITS to investigate the phylogeny of the genus, and AFLP markers (9 primers, 20 populations) to establish the genetic relationship between subspecies, and among populations at each side of the Gibraltar Strait. According to nrDNA ITS, Erophaca is monophyletic, old (Miocene), and sister to the Astragalean clade. Life form attributes and molecular clock estimates suggest that Erophaca is one of the many Tertiary relicts that form part of the present Mediterranean flora. Within the occidental subspecies, European plants are clearly derived from North-African populations (Morocco) which, despite being rare on a regional scale, present the highest genetic diversity (as estimated by private and rare fragment numbers). In general, genetic diversity decreased with increasing distance from Morocco. AFLP and nrDNA ITS markers evidenced that the Eastern and the Western subspecies are genetically distinct. Possible causes for their disjunct distribution are discussed. Copyright 2010 Elsevier Inc. All rights reserved.
Molecular crowding overcomes the destabilizing effects of mutations in a bacterial ribozyme
Lee, Hui-Ting; Kilburn, D.; Behrouzi, R.; ...
2014-12-05
The native structure of the Azoarcus group I ribozyme is stabilized by the cooperative formation of tertiary interactions between double helical domains. Thus, even single mutations that break this network of tertiary interactions reduce ribozyme activity in physiological Mg2+ concentrations. Here, we report that molecular crowding comparable to that in the cell compensates for destabilizing mutations in the Azoarcus ribozyme. Small angle X-ray scattering, native polyacrylamide gel electrophoresis and activity assays were used to compare folding free energies in dilute and crowded solutions containing 18% PEG1000. Crowder molecules allowed the wild-type and mutant ribozymes to fold at similarly low Mg2+more » concentrations and stabilized the active structure of the mutant ribozymes under physiological conditions. This compensation helps explains why ribozyme mutations are often less deleterious in the cell than in the test tube. Nevertheless, crowding did not rescue the high fraction of folded but less active structures formed by double and triple mutants. We conclude that crowding broadens the fitness landscape by stabilizing compact RNA structures without improving the specificity of self-assembly.« less
Molecular crowding overcomes the destabilizing effects of mutations in a bacterial ribozyme
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Hui-Ting; Kilburn, D.; Behrouzi, R.
The native structure of the Azoarcus group I ribozyme is stabilized by the cooperative formation of tertiary interactions between double helical domains. Thus, even single mutations that break this network of tertiary interactions reduce ribozyme activity in physiological Mg2+ concentrations. Here, we report that molecular crowding comparable to that in the cell compensates for destabilizing mutations in the Azoarcus ribozyme. Small angle X-ray scattering, native polyacrylamide gel electrophoresis and activity assays were used to compare folding free energies in dilute and crowded solutions containing 18% PEG1000. Crowder molecules allowed the wild-type and mutant ribozymes to fold at similarly low Mg2+more » concentrations and stabilized the active structure of the mutant ribozymes under physiological conditions. This compensation helps explains why ribozyme mutations are often less deleterious in the cell than in the test tube. Nevertheless, crowding did not rescue the high fraction of folded but less active structures formed by double and triple mutants. We conclude that crowding broadens the fitness landscape by stabilizing compact RNA structures without improving the specificity of self-assembly.« less
Medical ethics in the primary care setting.
Smith, H L
1987-01-01
Much popular and professional understanding of 'medical ethics' is nowadays located in quandary ethics, exotic life-and-death decision-making, and tertiary care settings. Medical ethics in the primary care setting is concerned with very different matters. Among these are issues having to do with basic self-understandings of health professionals and patients and their fiduciary relationships; with fundamental social, political and economic notions which will and do shape the allocation and distribution of health care resources; with the goals and purposes appropriate to medical interventions of various sorts; and with the care of the whole person rather than the limited attention to a particular illness or disease syndrome. The commitments of primary care medicine challenge in radical ways some cherished claims of modern liberal societies by questioning the limits of autonomous individualism and by affirming the indispensability of social justice.
Burke, Michael P; Baber, Yeliena; Cheung, Zoe; Fitzgerald, Mark
2018-05-01
Determining the manner of death in cases involving multiple stab injuries from a knife is generally straightforward. The medico-legal investigation of a stabbing death caused by a single stab injury from a knife comprises a smaller but potentially more problematic subset of forensic cases. We reviewed our institute's experience with single stab injuries and endeavored to identify features identified at the post-mortem examination which may aid in the differentiation between cases of homicide, suicide and accidental death. The single stab injury was to the left chest in the majority of deaths from homicide and from suicide. Clothing was nearly always involved in cases of homicide, but was also seen in cases of suicide. The knife was found in situ in 9 of the 11 cases of suicide involving a chest injury, but was not seen in any of the cases of homicide. There were no cases of an accidental single stab death from a knife in our records. Clinical data on accidental stab injuries was sought via a search of the medical records of a major tertiary referral hospital. A single non-fatal case of an accidental single stab injury from a knife was identified after the conclusion of our study period. Accidental stab injuries from a knife causing injury or death are rare.
Crystal growth of enzymes in low gravity (L-5)
NASA Technical Reports Server (NTRS)
Morita, Yuhei
1993-01-01
Recent developments in protein engineering have expanded the possibilities of studies of enzymes and other proteins. Now such studies are not limited to the elucidation of the relationship between the structure and function of the protein. They also aim at the production of proteins with new and practical functions, based on results obtained during investigation of structure and function. For continuing research in this field, investigation of the tertiary structure of proteins is important. X-ray diffraction of single crystals of protein is usually used for this purpose. The main difficulty is the preparation of the crystals. The theme of the research is to prepare such crystals at very low gravity, with the main purpose being to obtain large single crystals of proteins suitable for x-ray diffraction studies.
Suppan, Catherine A; Bae, Donald S; Donohue, Kyna S; Miller, Patricia E; Kocher, Mininder S; Heyworth, Benton E
2016-07-01
The purpose of this study was to examine institutional trends in the volume of clavicle fractures in children and adolescents. Medical records were retrospectively reviewed to identify patients aged 10-18 years treated for a clavicle fracture between 1999 and 2011 at a single tertiary-care pediatric hospital. There were significant increases in the number of clavicle fractures seen annually, of midshaft clavicle fractures, and of midshaft clavicle fractures treated operatively. The percentage of midshaft clavicle fractures treated with fixation also increased significantly. The volumes of clavicle fractures and midshaft clavicle fractures treated operatively appear to be increasing. Despite a lack of evidence-based support, the frequency of fixation of midshaft clavicle fractures appear to be increasing in the pediatric population.
Diversification Management at Tertiary Education Level: A Review
ERIC Educational Resources Information Center
Takwate, Kwaji Tizhe
2016-01-01
This paper examines the concept of management of diversification at tertiary education level in view of the growth of national secondary education system which vested high scramble for tertiary education was made in relation to question of access and expansion. This paper examines management of diversification at tertiary education level as a…
ERIC Educational Resources Information Center
AbdulAzeez, Abbas Tunde
2016-01-01
This research investigated total quality management practices and quality teacher education in public tertiary institutions in Lagos State. The study was therefore designed to analyse management practices in Lagos state tertiary institutions through total quality management structural framework. The selected public tertiary institutions in Lagos…
A New Synthesis of Tertiary Alkyl N-Arylcarbamates from Isocyanates.
ERIC Educational Resources Information Center
Bailey, William J.; Griffith, James R.
1978-01-01
The method involves the dissolution of a small piece of metallic lithium in a small quantity of tertiary alcohol followed by addition to a mixture of the isocyanate and the tertiary alcohol in ether. This should be useful in organic chemistry laboratory courses for the identification of tertiary alcohols. (Author/BB)
ERIC Educational Resources Information Center
Martins, Joaquim Oliveira; Boarini, Romina; Strauss, Hubert; de la Maisonneuve, Christine; Saadi, Clarice
2007-01-01
This paper assesses how policies and institutions affect private returns to invest in tertiary human capital, the ability of individuals to finance this investment and the institutional characteristics of tertiary education systems. Focusing on core tertiary education services, the paper presents new measures of private returns to tertiary…
1993-05-01
in real time. RMSDs were calculated only to a single structure on which the others were then superimposed. To get a pairwise listing of RMSDs, a group...to fix the chirality, minimize and anneal in 4-D (if necessary) an increasing number of residues until the entire structure is treated as one get /sym...nstr "Number of structures to create: get /sym refseq "Sequence to use: . get /sym refbmx "Bounds matrix to use: get /sym fname "Filename for written
Sheldon, Michael; Cavanaugh, James T; Croninger, William; Osgood, Wendy; Robnett, Regi; Seigle, Janice; Simonsen, Linda
2012-01-01
Health profession education programs often struggle with barriers to implementing interprofesssional educational (IPE) initiatives, limiting early and consistent exposure of students to core IPE competencies. Few published reports are available to guide the implementation of IPE programs into practice. This article describes a successful and evolving partnership between an independent university and a tertiary care hospital. The IPE goals of this partnership were to expose students to roles of other disciplines in the complex hospital environment and integrate acute care exposure throughout the Doctor of Physical Therapy and Master of Science in Occupational Therapy curricula. Faculty and students, patients and families, and occupational and physical therapy clinicians participated in a series of learning activities in an acute care setting involving interprofessional teams of students. Activities included observations of OT and PT clinicians providing standard patient care, practice conducting team patient interviews, and interactive treatment planning sessions conducted live via videoconferencing technology between a patient's hospital room and an academic classroom on the university campus. The activities generally were designed to improve student preparedness for working as part of an interprofessional team in an acute care setting. Student and clinician feedback support the early development of student IPE competencies, including the appreciation and understanding of professional roles in the team approach to patient care and the development of effective communication skills. The partnership between the academic institution and tertiary care hospital is an effective vehicle to deliver and sustain IPE educational initiatives in the acute care setting. Current and planned IPE curriculum integration are discussed along with a preliminary analysis of IPE outcomes.
Hammond, Athena; Homer, Caroline S E; Foureur, Maralyn
2017-07-01
to identify and describe the design characteristics of hospital birth rooms that support midwives and their practice. this study used a qualitative exploratory descriptive methodology underpinned by the theoretical approach of critical realism. Data was collected through 21 in-depth, face-to-face photo-elicitation interviews and a thematic analysis guided by study objectives and the aims of exploratory research was undertaken. the study was set at a recently renovated tertiary hospital in a large Australian city. participants were 16 registered midwives working in a tertiary hospital; seven in delivery suite and nine in birth centre settings. Experience as a midwife ranged from three to 39 years and the sample included midwives in diverse roles such as educator, student support and unit manager. three design characteristics were identified that supported midwifery practice. They were friendliness, functionality and freedom. Friendly rooms reduced stress and increased midwives' feelings of safety. Functional rooms enabled choice and provided options to better meet the needs of labouring women. And freedom allowed for flexible, spontaneous and responsive midwifery practice. hospital birth rooms that possess the characteristics of friendliness, functionality and freedom offer enhanced support for midwives and may therefore increase effective care provision. new and existing birth rooms can be designed or adapted to better support the wellbeing and effectiveness of midwives and may thereby enhance the quality of midwifery care delivered in the hospital. Quality midwifery care is associated with positive outcomes and experiences for labouring women. Further research is required to investigate the benefit that may be transmitted to women by implementing design intended to support and enhance midwifery practice. Copyright © 2017 Elsevier Ltd. All rights reserved.
Diabetes Care in Malaysia: Problems, New Models, and Solutions.
Hussein, Zanariah; Taher, Sri Wahyu; Gilcharan Singh, Harvinder Kaur; Chee Siew Swee, Winnie
2015-01-01
Diabetes is a major public health concern in Malaysia, and the prevalence of type 2 diabetes (T2D) has escalated to 20.8% in adults above the age of 30, affecting 2.8 million individuals. The burden of managing diabetes falls on primary and tertiary health care providers operating in various settings. This review focuses on the current status of diabetes in Malaysia, including epidemiology, complications, lifestyle, and pharmacologic treatments, as well as the use of technologies in its management and the adoption of the World Health Organization chronic care model in primary care clinics. A narrative review based on local available health care data, publications, and observations from clinic experience. The prevalence of diabetes varies among the major ethnic groups in Malaysia, with Asian Indians having the highest prevalence of T2D, followed by Malays and Chinese. The increase prevalence of overweight and obesity has accompanied the rise in T2D. Multidisciplinary care is available in tertiary and primary care settings with integration of pharmacotherapy, diet, and lifestyle changes. Poor dietary adherence, high consumption of carbohydrates, and sedentary lifestyle are prevalent in patients with T2D. The latest medication options are available with increasing use of intensive insulin regimens, insulin pumps, and continuous glucose monitoring systems for managing glycemic control. A stepwise approach is proposed to expand the chronic care model into an Innovative Care for Chronic Conditions framework to facilitate implementation and realize better outcomes in primary care settings. A comprehensive strategy and approach has been established by the Malaysian government to improve prevention, treatment, and control of diabetes as an urgent response to this growing chronic disease. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Cystic Echinococcosis in a Single Tertiary Care Center in Rome, Italy
Cuzzi, Gilda; Ettorre, Giuseppe Maria; Busi-Rizzi, Elisa; Schininà, Vincenzo; Pucillo, Leopoldo; Pane, Stefania; Bordi, Eugenio; Pozio, Edoardo; Corpolongo, Angela; Teggi, Antonella; Brunetti, Enrico
2013-01-01
Background. Cystic echinococcosis (CE) is a chronic, clinically complex, and neglected disease. Its prevalence in Italy, a country of medium to high endemicity, remains poorly defined, as notification has long ceased to be mandatory. Methods. We set up a retrospective cohort study involving all CE patients followed at our institute between January 2005 and December 2012. Demographical and clinical features were recorded and analyzed. Results. CE was found in 28 patients (64.3%), mostly Italians from the central regions (50%), followed by subjects from the islands (33.3%) and Southern Italy (16.7%). Their median age was 45 years (IQR: 38.5–66.5), with Eastern Europeans being significantly younger (28 years, IQR: 19–39) than other patients (P ≤ 0.0001). A total of 149 cysts, mostly with hepatic localization (96%), were described. Based on the WHO classification, the cysts were mainly small (80.5%) and active (CE1 (73.8%); CE2 (7.4%)). Active cysts were more common in Eastern Europeans (85.7%) than Italians (66.7%). Conclusion. Our data confirm CE occurrence in Italy. We emphasize the importance to have a national CE registry, opportunely recently introduced. This is essential to assess CE prevalence in this country, implement appropriate control measures, and improve patient management. PMID:24151631
Finale of a Quartet: Hints on Supernova Formation
NASA Astrophysics Data System (ADS)
Fang, Xiao; Thompson, Todd A.; Hirata, Christopher M.
2018-01-01
The origin of Type Ia Supernovae (SNe) is not well understood. Two most popular hypotheses are the single-degenerate scenario, where one white dwarf (WD) accretes matter from its giant companion until the Chandrasekhar limit is reached, and the double-degenerate scenario, where two WDs merge and explode. We focus on the second scenario. It has long been realized that binary WD systems normally take extremely long time to merge via gravitational waves and it is still unclear whether WD mergers can fully account for the observed SN Ia rate. Recent effort has been devoted to the effects of introducing a distant tertiary to the binary system. The standard “Kozai-Lidov” mechanism can lead to high eccentricities of the binary WDs, which could lead to direct collisions or much efficient energy dissipation. Alternatively, we investigate the long-term evolution of the hierarchical quadruple systems, i.e. WD binary with a binary companion, which are basically unexplored, yet they should be numerous. We explore their interesting dynamics and find that the fraction of reaching high eccentricities is largely enhanced, which hints on a higher WD merger rate than predicted from triple systems with the same set of secular and non-secular effects considered. Considering the population of quadruple stellar systems, the quadruple scenario might contribute significantly to the overall rate of Ia SNe.
Gardberg, Anna; Abendroth, Jan; Bhandari, Janhavi; Sankaran, Banumathi; Staker, Bart
2011-01-01
Fructose bisphosphate aldolase (FBPA) enzymes have been found in a broad range of eukaryotic and prokaryotic organisms. FBPA catalyses the cleavage of fructose 1,6-bisphosphate into glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. The SSGCID has reported several FBPA structures from pathogenic sources, including the bacterium Brucella melitensis and the protozoan Babesia bovis. Bioinformatic analysis of the Bartonella henselae genome revealed an FBPA homolog. The B. henselae FBPA enzyme was recombinantly expressed and purified for X-ray crystallographic studies. The purified enzyme crystallized in the apo form but failed to diffract; however, well diffracting crystals could be obtained by cocrystallization in the presence of the native substrate fructose 1,6-bisphosphate. A data set to 2.35 Å resolution was collected from a single crystal at 100 K. The crystal belonged to the orthorhombic space group P212121, with unit-cell parameters a = 72.39, b = 127.71, c = 157.63 Å. The structure was refined to a final free R factor of 22.2%. The structure shares the typical barrel tertiary structure and tetrameric quaternary structure reported for previous FBPA structures and exhibits the same Schiff base in the active site. PMID:21904049
Nd:YAG laser therapy for rectal and vaginal venous malformations.
Gurien, Lori A; Jackson, Richard J; Kiser, Michelle M; Richter, Gresham T
2017-08-01
Limited therapeutic options exist for rectal and vaginal venous malformations (VM). We describe our center's experience using Nd:YAG laser for targeted ablation of abnormal veins to treat mucosally involved pelvic VM. Records of patients undergoing non-contact Nd:YAG laser therapy of pelvic VM at a tertiary children's hospital were reviewed. Symptoms, operative findings and details, complications, and outcomes were evaluated. Nine patients (age 0-24) underwent Nd:YAG laser therapy of rectal and/or vaginal VM. Rectal bleeding was present in all patients and vaginal bleeding in all females (n = 5). 5/7 patients had extensive pelvic involvement on MRI. Typical settings were 30 (rectum) and 20-25 W (vagina), with 0.5-1.0 s pulse duration. Patients underwent the same-day discharge. Treatment intervals ranged from 14 to 180 (average = 56) weeks, with 6.1-year mean follow-up. Five patients experienced symptom relief with a single treatment. Serial treatments managed recurrent bleeding successfully in all patients, with complete resolution of vaginal lesions in 40% of cases. No complications occurred. Nd:YAG laser treatment of rectal and vaginal VM results in substantial improvement and symptom control, with low complication risk. Given the high morbidity of surgical resection, Nd:YAG laser treatment of pelvic VM should be considered as first line therapy.
Samanamalee, Samitha; Sigera, Ponsuge Chathurani; De Silva, Ambepitiyawaduge Pubudu; Thilakasiri, Kaushila; Rashan, Aasiyah; Wadanambi, Saman; Jayasinghe, Kosala Saroj Amarasiri; Dondorp, Arjen M; Haniffa, Rashan
2018-01-08
This study evaluates post-ICU outcomes of patients admitted with moderate and severe Traumatic Brain Injury (TBI) in a tertiary neurocritical care unit in an low middle income country and the performance of trauma scores: A Severity Characterization of Trauma, Trauma and Injury Severity Score, Injury Severity Score and Revised Trauma Score in this setting. Adult patients directly admitted to the neurosurgical intensive care units of the National Hospital of Sri Lanka between 21st July 2014 and 1st October 2014 with moderate or severe TBI were recruited. A telephone administered questionnaire based on the Glasgow Outcome Scale Extended (GOSE) was used to assess functional outcome of patients at 3 and 6 months after injury. The economic impact of the injury was assessed before injury, and at 3 and 6 months after injury. One hundred and one patients were included in the study. Survival at ICU discharge, 3 and 6 months after injury was 68.3%, 49.5% and 45.5% respectively. Of the survivors at 3 months after injury, 43 (86%) were living at home. Only 19 (38%) patients had a good recovery (as defined by GOSE 7 and 8). Three months and six months after injury, respectively 25 (50%) and 14 (30.4%) patients had become "economically dependent". Selected trauma scores had poor discriminatory ability in predicting mortality. This observational study of patients sustaining moderate or severe TBI in Sri Lanka (a LMIC) reveals only 46% of patients were alive at 6 months after ICU discharge and only 20% overall attained a good (GOSE 7 or 8) recovery. The social and economic consequences of TBI were long lasting in this setting. Injury Severity Score, Revised Trauma Score, A Severity Characterization of Trauma and Trauma and Injury Severity Score, all performed poorly in predicting mortality in this setting and illustrate the need for setting adapted tools.
NASA Astrophysics Data System (ADS)
Maheran, Y.; Fadzidah, A.; Nur Fadhilah, R.; Farha, S.
2017-12-01
A proper design outdoor environment in higher institutions contributes to the students’ learning performances and produce better learning outcomes. Campus surrounding has the potential to provide an informal outdoor learning environment, especially when it has the existing physical element, like open spaces and natural features, that may support the learning process. However, scholarly discourses on environmental aspects in tertiary education have minimal environmental inputs to fulfill students’ needs for outdoor exposure. Universities have always emphasized on traditional instructional methods in classroom settings, without concerning the importance of outdoor classroom towards students’ learning needs. Moreover, the inconvenience and discomfort outdoor surrounding in campus environment offers a minimal opportunity for students to study outside the classroom, and students eventually do not favor to utilize the spaces because no learning facility is provided. Hence, the objective of this study is to identify the appropriate criteria of outdoor areas that could be converted to be outdoor classrooms in tertiary institutions. This paper presents a review of scholars’ work in regards to the characteristics of the outdoor classrooms that could be designed as part of contemporary effective learning space, for the development of students’ learning performances. The information gathered from this study will become useful knowledge in promoting effective outdoor classroom and create successful outdoor learning space in landscape campus design. It I hoped that the finding of this study could provide guidelines on how outdoor classrooms should be designed to improve students’ academic achievement.
Acheampong, Franklin; Tetteh, Ashalley Raymond; Anto, Berko Panyin
2016-12-01
This study determined the incidence, types, clinical significance, and potential causes of medication administration errors (MAEs) at the emergency department (ED) of a tertiary health care facility in Ghana. This study used a cross-sectional nonparticipant observational technique. Study participants (nurses) were observed preparing and administering medication at the ED of a 2000-bed tertiary care hospital in Accra, Ghana. The observations were then compared with patients' medication charts, and identified errors were clarified with staff for possible causes. Of the 1332 observations made, involving 338 patients and 49 nurses, 362 had errors, representing 27.2%. However, the error rate excluding "lack of drug availability" fell to 12.8%. Without wrong time error, the error rate was 22.8%. The 2 most frequent error types were omission (n = 281, 77.6%) and wrong time (n = 58, 16%) errors. Omission error was mainly due to unavailability of medicine, 48.9% (n = 177). Although only one of the errors was potentially fatal, 26.7% were definitely clinically severe. The common themes that dominated the probable causes of MAEs were unavailability, staff factors, patient factors, prescription, and communication problems. This study gives credence to similar studies in different settings that MAEs occur frequently in the ED of hospitals. Most of the errors identified were not potentially fatal; however, preventive strategies need to be used to make life-saving processes such as drug administration in such specialized units error-free.
Kumari, A. K.; Subramonianpillai, J.; Shabna, D. S.; Kumar, S. M.; Balakrishnan, S.; Naik, B.; Kumar, A. M. V.; Isaakidis, P.; Satyanarayana, S.
2013-01-01
Setting: Two tertiary care hospitals and 12 peripheral health institutions (PHIs) in Trivandrum, Kerala, India. Objective: To determine factors associated with the prevalence of diabetes mellitus (DM) among tuberculosis (TB) patients and examine differences in the proportion of new DM cases among TB patients diagnosed at tertiary care centres and PHIs. Design: A descriptive study: TB patients diagnosed during March–September 2012 were screened for known DM. Those with unknown DM status were tested for random blood glucose and fasting blood glucose (FBG); FBG ≥ 126 mg/dl was diagnosed as new DM. Results: Of 920 TB patients, 689 (72%) were male and the mean (standard deviation) age was 47.6 (16.4) years. Of these, 298 (32.4%) were diabetic: 235 (26%) had previously known DM and 63 (7%) were newly diagnosed. During the screening at PHIs and tertiary care hospitals, respectively 30/183 (16.4%) and 33/737 (4.5%) were newly diagnosed with DM (OR 3.71; 95%CI 2.17–6.32). Overall, age >50 years and pulmonary tuberculosis were independently associated with a higher prevalence of diabetes. Conclusion: As nearly one in three TB patients had DM, we recommend that TB patients should be routinely screened for DM in Kerala. As the proportion of new DM was higher among TB patients diagnosed at PHIs, we would recommend that specific attention and investment be directed to PHIs. PMID:26393068
Vermeulen, A; Devlieghere, F; De Loy-Hendrickx, A; Uyttendaele, M
2011-01-31
In November 2008, a technical guidance document on the challenge test protocol was published by the EU CRL (Community of Reference Laboratory) for L. monocytogenes. This document describes the practical aspects on the execution of a challenge test in order to comply to the EU Commission regulation N° 2073/2005 on microbiological criteria for foodstuff. In this guideline two approaches are specified. On the one hand challenge tests, based on actual data measurements at the beginning and end of the shelf-life of products stored under reasonably foreseen T-profile, are described. On the other hand, growth potential is calculated by predictive models using a validated maximum specific growth rate. The present study evaluates the two above mentioned approaches on cold smoked salmon, a typical risk product for L. monocytogenes. The focus is on: (i) the relative importance of intrabatch versus interbatch variability, (ii) the concept of a simple challenge test based on actual data at start and end of shelf life versus a modelling approach and (iii) the interpretation of challenge tests. Next to this, available tertiary models were used to estimate the growth potential of these products based on their initial physicochemical characteristics. From the results it could be concluded that in some batches considerable intrabatch variability was obtained. In general, however, the interbatch variability was significantly higher than intrabatch variability. Concerning the two above mentioned methods for challenge tests, it can be stated that the first approach (simple challenge test) can be set up rather rapidly and is cost-effective for SMEs (small and medium enterprises) but provides only a single isolated outcome. This implies that challenge tests should be redone if changes occur in composition or production process. The second (modelling) approach, using extended challenge tests to establish growth parameters needs larger set ups and more complicated data analysis, which makes them more expensive. Using available tertiary models has the major advantage that the most important intrinsic and extrinsic factors can be included for the prediction of the growth parameter. It was clear that product specific models, taking into account the interaction effects with background flora, performed the best. Regarding the challenge tests, it can be concluded that the best approach to choose will depend on the particular context as in the end both approaches will lead to the same conclusion. Copyright © 2010 Elsevier B.V. All rights reserved.
Policy Innovation and Tertiary Education Graduation Rates: A Cross-Country Analysis
ERIC Educational Resources Information Center
Delaney, Jennifer A.; Yu, Patricia
2013-01-01
This study extends Trow's theory of higher education development to examine changes in national-level tertiary education graduation rates. Applying Trow's framework we arrive at three stages: (1) elite systems with gross tertiary graduation rates less than 15%, (2) massified systems with gross tertiary graduation rates between 15% and 50%, and (3)…
A Comparison of Career Success between Graduates of Vocational and Academic Tertiary Education
ERIC Educational Resources Information Center
Backes-Gellner, Uschi; Geel, Regula
2014-01-01
This paper analyses whether tertiary education of different types, i.e., academic or vocational tertiary education, leads to more or less favorable labor market outcomes. We study the problem for Switzerland, where more than two thirds of the workforce gain vocational secondary degrees and a substantial number go on to a vocational tertiary degree…
Recently, two papers reported the use of solid-phase microextraction (SPME) with polydimethylsiloxane(PDMS)/Carboxen fibers to determine trace levels of methyl tertiary butyl ether (MTBE) and tertiary butyl alcohol (tBA) in water. Attempts were made to apply this technique to th...
ERIC Educational Resources Information Center
Štefánik, Miroslav; Horvát, Peter
2015-01-01
This article provides evidence about differences in the recent tertiary education expansion in Austria, Germany, the Czech Republic, Poland and Slovakia. Focusing on these differences, we have examined private returns to tertiary education acquired before and after the tertiary education expansion. We compare these returns as follows: Austria with…
Foundation Report, Dam & Spillway, Taylorsville Lake, Ohio River Basin, Salt River, Kentucky.
1983-04-01
methods. The spacing of the primary holes was set on 10- foot centers, followed by secondary holes on 5- foot centers and tertiary holes on 2.5- foot ...88’ and 5+00. This area was further divided into 100- foot sections and drilled and grouted in alternating sections. Sections 7, 9 and 5 were drilled...100- foot sections and grouted by alternate sections to preclude violating the 100- foot spacing requirement. Many of the first holes on the left abutment
Navy-NGO Coordination for Health-Related HCA Missions: A Suggested Planning Framework
2008-11-01
however, on how to work with NCOs in the HCA setting. As a result, there is currendy no systematic frame - work for military-NGO coordination. The...agencies and NGOs, make up a tertiary audience. The issues are framed in a way that reflects the Navy’s current views and thinking, but NGO perspectives...it is written mainly from a Navy-centric perspective. The framing of the issues, in particular, reflects the Navy’s current views and thinking. NGO
Sá Machado, Rita; Perez Duque, Mariana; Almeida, Soraia; Cruz, Ivo; Sottomayor, Ana; Almeida, Isabel; R Oliveira, Júlio; Antunes, Delfina
2018-05-01
A measles outbreak has been occurring in a healthcare setting in Porto, Portugal, since early March 2018, posing public health challenges for a central hospital and the community. Up to 22 April, 96 cases were confirmed, 67 in vaccinated healthcare workers, mostly between 18-39 years old. Following identification of the first cases, control measures were rapidly implemented. Concomitantly, other measles cases were notified in the Northern Region of the country. No common epidemiological link was identified.
Choosing wisely and the use of antibiotics in ophthalmic surgery: There is more than meets the eye.
Grosso, Andrea; Ceruti, Piero; Scarpa, Giuseppe; Giardini, Franco; Marchini, Giorgio; Aragona, Emanuela; Bert, Fabrizio; Bandello, Francesco; Siliquini, Roberta
2018-02-01
One of the directions of modern ophthalmology is toward an odontoiatric model, and new settings of eye care are becoming the standard of care: one day surgery and also office-based therapies. Retrospective analysis of three tertiary-care centers in Italy and analysis of the literature. We provide readers with state-of-the-art measures of prophylaxis in ophthalmic surgery. Role of antibiotics is criticized in the light of stewardship antimicrobial paradigm.
Single-bubble and multibubble cavitation in water triggered by laser-driven focusing shock waves
NASA Astrophysics Data System (ADS)
Veysset, D.; Gutiérrez-Hernández, U.; Dresselhaus-Cooper, L.; De Colle, F.; Kooi, S.; Nelson, K. A.; Quinto-Su, P. A.; Pezeril, T.
2018-05-01
In this study a single laser pulse spatially shaped into a ring is focused into a thin water layer, creating an annular cavitation bubble and cylindrical shock waves: an outer shock that diverges away from the excitation laser ring and an inner shock that focuses towards the center. A few nanoseconds after the converging shock reaches the focus and diverges away from the center, a single bubble nucleates at the center. The inner diverging shock then reaches the surface of the annular laser-induced bubble and reflects at the boundary, initiating nucleation of a tertiary bubble cloud. In the present experiments, we have performed time-resolved imaging of shock propagation and bubble wall motion. Our experimental observations of single-bubble cavitation and collapse and appearance of ring-shaped bubble clouds are consistent with our numerical simulations that solve a one-dimensional Euler equation in cylindrical coordinates. The numerical results agree qualitatively with the experimental observations of the appearance and growth of large bubble clouds at the smallest laser excitation rings. Our technique of shock-driven bubble cavitation opens interesting perspectives for the investigation of shock-induced single-bubble or multibubble cavitation phenomena in thin liquids.
On the Formation of Multiple Concentric Rings and Gaps in Protoplanetary Disks
NASA Astrophysics Data System (ADS)
Bae, Jaehan; Zhu, Zhaohuan; Hartmann, Lee
2017-12-01
As spiral waves driven by a planet in a gaseous disk steepen into a shock, they deposit angular momentum, opening a gap in the disk. This has been well studied using both linear theory and numerical simulations, but so far only for the primary spiral arm: the one directly attached to the planet. Using 2D hydrodynamic simulations, we show that the secondary and tertiary arms driven by a planet can also open gaps as they steepen into shocks. The depths of the secondary/tertiary gaps in surface density grow with time in a low-viscosity disk (α =5× {10}-5), so even low-mass planets (e.g., super-Earth or mini-Neptune-mass) embedded in the disk can open multiple observable gaps, provided that sufficient time has passed. Applying our results to the HL Tau disk, we show that a single 30 Earth-mass planet embedded in the ring at 68.8 au (B5) can reasonably well reproduce the positions of the two major gaps at 13.2 and 32.3 au (D1 and D2), and roughly reproduce two other major gaps at 64.2 and 74.7 au (D5 and D6) seen in the mm continuum. The positions of secondary/tertiary gaps are found to be sensitive to the planetary mass and the disk temperature profile, so with accurate observational measurements of the temperature structure, the positions of multiple gaps can be used to constrain the mass of the planet. We also comment on the gaps seen in the TW Hya and HD 163296 disk.
Telford, Robert; Viney, Richard; Patel, Prashant
2016-01-01
Introduction We aim to present transperineal template-guided prostate biopsy (template biopsy) outcomes at a tertiary referral centre. Furthermore, to identify the detection rate of prostate cancer in those with a previous negative transrectal ultrasound guided prostate biopsy and the upgrade rate of those on active surveillance for Gleason 3 + 3 = 6 prostate adenocarcinoma. Material and methods We conducted a prospective study of 200 consecutive men who underwent template biopsy over a 22-month period in a tertiary referral centre, using a standard 24 region template prostate biopsy technique. Indications and histology results, as well as complications, were recorded. Results Median age was 67 years and median PSA was 10 ng/mL. Overall detection rate was 47%. 39.5% of cases with previous negative transrectal biopsies were found to have prostate adenocarcinoma. 47.5% of cases on active surveillance for Gleason 3 + 3 = 6 prostate adenocarcinoma were upgraded. The most frequent complication was acute urinary retention at a rate of 12.5%, however, the use of a single prophylactic dose of tamsulosin was found to be beneficial, with 13 cases needed to treat to prevent one episode. Conclusions Template biopsies are safe and efficacious with an overall detection rate of 47% in the present series. Due to the high detection rate, one must consider template biopsy following one negative transrectal biopsy where there is persistent clinical suspicion. Furthermore, those considering active surveillance for Gleason 3 + 3 = 6 disease should be offered template biopsy to confirm the grade of their disease. PMID:27123325
Donoghue, Aaron; Hsieh, Ting-Chang; Myers, Sage; Mak, Allison; Sutton, Robert; Nadkarni, Vinay
2015-06-01
To describe the adherence to guidelines for CPR in a tertiary pediatric emergency department (ED) where resuscitations are reviewed by videorecording. Resuscitations in a tertiary pediatric ED are videorecorded as part of a quality improvement project. Patients receiving CPR under videorecorded conditions were eligible for inclusion. CPR parameters were quantified by retrospective review. Data were described by 30-s epoch (compression rate, ventilation rate, compression:ventilation ratio), by segment (duration of single providers' compressions) and by overall event (compression fraction). Duration of interruptions in compressions was measured; tasks completed during pauses were tabulated. 33 children received CPR under videorecorded conditions. A total of 650 min of CPR were analyzed. Chest compressions were performed at <100/min in 90/714 (13%) of epochs; 100-120/min in 309/714 (43%); >120/min in 315/714 (44%). Ventilations were 6-12 breaths/min in 201/708 (23%) of epochs and >12/min in 489/708 (70%). During CPR without an artificial airway, compression:ventilation coordination (15:2) was done in 93/234 (40%) of epochs. 178 pauses in CPR occurred; 120 (67%) were <10s in duration. Of 370 segments of compressions by individual providers, 282/370 (76%) were <2 min in duration. Median compression fraction was 91% (range 88-100%). CPR in a tertiary pediatric ED frequently met recommended parameters for compression rate, pause duration, and compression fraction. Hyperventilation and failure of C:V coordination were very common. Future studies should focus on the impact of training methods on CPR performance as documented by videorecording. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Czarnecki, S.; Jarvis, J.; Satterfield, J. I.
2016-12-01
The Sand Springs Range in western Nevada exposes Mesozoic through Cenozoic structures of the eastern Sierra Nevada, Luning-Fencemaker Thrust Belt (LFTB), Basin and Range province, and Walker Lane. A recent undergraduate geologic mapping project in the northern Sand Springs Range (nSSR) set out to map igneous intrusions in detail, specifically smaller intrusions which had not been a focus in previous work. This was accomplished using different techniques including mapping at a smaller scale (1:8000 vs. 1:24000), locating contacts and faults using handheld GPS, and focusing on relationships between metamorphic tectonites and igneous units. This revealed key cross-cutting relations between structures and diverse Triassic through Tertiary igneous rocks as well as distinctions between the nSSR and the surrounding LFTB assemblages. During our mapping we identified four metamorphic tectonite map units, Cretaceous granitoid and diorite plutons and sills, Tertiary rhyolite sills and dikes, and interbedded Tertiary basalt and ash flow tuff. The cross-cutting relations of these units overturn previously published sequences of events and constrain the timing of a deformation sequence which differs from the surrounding LFTB assemblages. We found that the nSSR contains three phases of deformation: a pre-LFTB syn-metamorphic event which achieved amphibolite facies that is not described elsewhere in the LFTB (D1), followed by two non-metamorphic folding and thrusting phases characteristic of the LFTB (D2 and D3). Our mapping provided four key timing constraints. First, D1 axial-planar cleavage (S1) deformed Triassic intrusions. Second, Cretaceous granitoid and diorite units cross-cut S1 foliation, D1 folds, and low-angle faults. Third, Cretaceous and Tertiary sills that locally terminate at a low-angle fault actually post-dated faulting. Fourth, cross-cutting relations showed a basaltic lava previously mapped as Jurassic is actually Tertiary. The large Sand Springs Pluton was the only intrusion mapped in detail during previous studies; but our mapping has demonstrated the importance of both small and large intrusions in understanding the overall structural history of a complex area. This project was supported by research grants from Angelo State University and the Southwest Section AAPG.
Epstein, Jonathan I.; Feng, Zhaoyong; Trock, Bruce J.; Pierorazio, Phillip M.
2015-01-01
Background Prior studies assessing the correlation of Gleason score (GS) at needle biopsy and corresponding radical prostatectomy (RP) predated the use of the modified Gleason scoring system and did not factor in tertiary grade patterns. Objective To assess the relation of biopsy and RP grade in the largest study to date. Design, setting, and participants A total of 7643 totally embedded RP and corresponding needle biopsies (2004–2010) were analyzed according to the updated Gleason system. Interventions All patients underwent prostate biopsy prior to RP. Measurements The relation of upgrading or downgrading to patient and cancer characteristics was compared using the chi-square test, Student t test, and multivariable logistic regression. Results and limitations A total of 36.3% of cases were upgraded from a needle biopsy GS 5–6 to a higher grade at RP (11.2% with GS 6 plus tertiary). Half of the cases had matching GS 3 + 4 = 7 at biopsy and RP with an approximately equal number of cases downgraded and upgraded at RP. With biopsy GS 4 + 3 = 7, RP GS was almost equally 3 + 4 = 7 and 4 + 3 = 7. Biopsy GS 8 led to an almost equal distribution between RP GS 4 + 3 = 7, 8, and 9–10. A total of 58% of the cases had matching GS 9–10 at biopsy and RP. In multivariable analysis, increasing age (p < 0.0001), increasing serum prostate-specific antigen level (p < 0.0001), decreasing RP weight (p < 0.0001), and increasing maximum percentage cancer/core (p < 0.0001) predicted the upgrade from biopsy GS 5–6 to higher at RP. Despite factoring in multiple variables including the number of positive cores and the maximum percentage of cancer per core, the concordance indexes were not sufficiently high to justify the use of nomograms for predicting upgrading and downgrading for the individual patient. Conclusions Almost 20% of RP cases have tertiary patterns. A needle biopsy can sample a tertiary higher Gleason pattern in the RP, which is then not recorded in the standard GS reporting, resulting in an apparent overgrading on the needle biopsy. PMID:22336380
Occupational therapy practice in acute physical hospital settings: Evidence from a scoping review.
Britton, Lauren; Rosenwax, Lorna; McNamara, Beverley
2015-12-01
Increased accountability and growing fiscal limitations in global health care continue to challenge how occupational therapy practices are undertaken. Little is known about how these changes affect current practice in acute hospital settings. This article reviews the relevant literature to further understanding of occupational therapy practice in acute physical hospital settings. A scoping review of five electronic databases was completed using the keywords Occupational therapy, acute hospital settings/acute physical hospital settings, acute care setting/acute care hospital setting, general medicine/general medical wards, occupational therapy service provision/teaching hospitals/tertiary care hospitals. Criteria were applied to determine suitability for inclusion and the articles were analysed to uncover key themes. In total 34 publications were included in the review. Analysis of the publications revealed four themes: (1) Comparisons between the practice of novice and experienced occupational therapists in acute care (2) Occupational therapists and the discharge planning process (3) Role of occupation in the acute care setting and (4) Personal skills needed and organisation factors affecting acute care practice. The current literature has highlighted the challenges occupational therapists face in practicing within an acute setting. Findings from this review enhance understanding of how occupational therapy department managers and educators can best support staff that practise in acute hospital settings. © 2015 Occupational Therapy Australia.
Apker, Julie; Propp, Kathleen M; Zabava Ford, Wendy S; Hofmeister, Nancee
2006-01-01
This study explored how nurses communicate professionalism in interactions with members of their health care teams. Extant research show that effective team communication is a vital aspect of a positive nursing practice environment, a setting that has been linked to enhanced patient outcomes. Although communication principles are emphasized in nursing education as an important component of professional nursing practice, actual nurse interaction skills in team-based health care delivery remain understudied. Qualitative analysis of interview transcripts with 50 participants at a large tertiary hospital revealed four communicative skill sets exemplified by nursing professionals: collaboration, credibility, compassion, and coordination. Study findings highlight specific communicative behaviors associated with each skill set that exemplify nurse professionalism to members of health care teams. Theoretical and pragmatic conclusions are drawn regarding the communicative responsibilities of professional nurses in health care teams. Specific interaction techniques that nurses could use in nurse-team communication are then offered for use in baccalaureate curriculum and organizational in-service education.
Rapid Syphilis Testing Is Cost-Effective Even in Low-Prevalence Settings: The CISNE-PERU Experience.
Mallma, Patricia; Garcia, Patricia; Carcamo, Cesar; Torres-Rueda, Sergio; Peeling, Rosanna; Mabey, David; Terris-Prestholt, Fern
2016-01-01
Studies have addressed cost-effectiveness of syphilis testing of pregnant women in high-prevalence settings. This study compares costs of rapid syphilis testing (RST) with laboratory-based rapid plasma reagin (RPR) tests in low-prevalence settings in Peru. The RST was introduced in a tertiary-level maternity hospital and in the Ventanilla Network of primary health centers, where syphilis prevalence is approximately 1%. The costs per woman tested and treated with RST at the hospital were $2.70 and $369 respectively compared with $3.60 and $740 for RPR. For the Ventanilla Network the costs per woman tested and treated with RST were $3.19 and $295 respectively compared with $5.55 and $1454 for RPR. The cost per DALY averted using RST was $46 vs. $109 for RPR. RST showed lower costs compared to the WHO standard costs per DALY ($64). Findings suggest syphilis screening with RST is cost-effective in low-prevalence settings.
Rapid Syphilis Testing Is Cost-Effective Even in Low-Prevalence Settings: The CISNE-PERU Experience
Mallma, Patricia; Garcia, Patricia; Carcamo, Cesar; Torres-Rueda, Sergio; Peeling, Rosanna; Mabey, David; Terris-Prestholt, Fern
2016-01-01
Studies have addressed cost-effectiveness of syphilis testing of pregnant women in high-prevalence settings. This study compares costs of rapid syphilis testing (RST) with laboratory-based rapid plasma reagin (RPR) tests in low-prevalence settings in Peru. The RST was introduced in a tertiary-level maternity hospital and in the Ventanilla Network of primary health centers, where syphilis prevalence is approximately 1%. The costs per woman tested and treated with RST at the hospital were $2.70 and $369 respectively compared with $3.60 and $740 for RPR. For the Ventanilla Network the costs per woman tested and treated with RST were $3.19 and $295 respectively compared with $5.55 and $1454 for RPR. The cost per DALY averted using RST was $46 vs. $109 for RPR. RST showed lower costs compared to the WHO standard costs per DALY ($64). Findings suggest syphilis screening with RST is cost-effective in low-prevalence settings. PMID:26949941
Precious metals associated with Late Cretaceous-early Tertiary igneous rocks of southwestern Alaska
Bundtzen, Thomas K.; Miller, Marti L.; Goldfarb, Richard J.; Miller, Lance D.
1997-01-01
Placer gold and precious metal-bearing lode deposits of southwestern Alaska lie within a region 550 by 350 km, herein referred to as the Kuskokwim mineral belt. This mineral belt has yielded 100,240 kg (3.22 Moz) of gold, 12, 813 kg (412,000 oz) of silver, 1,377,412 kg (39,960 flasks) of mercury, and modest amounts of antimony and tungsten derived primarily from the late Cretaceous-early Tertiary igneous complexes of four major types: (1) alkali-calcic, comagmatic volcanic-plutonic complexes and isolated plutons, (2) calc-alkaline, meta-aluminous reduced plutons, (3) peraluminous alaskite or granite-porphyry sills and dike swarms, and (4) andesite-rhyolite subaerial volcanic rocks.About 80 percent of the 77 to 52 Ma intrusive and volcanic rocks intrude or overlie the middle to Upper Cretaceous Kuskokwim Group sedimentary and volcanic rocks, as well as the Paleozoic-Mesozoic rocks of the Nixon Fork, Innoko, Goodnews, and Ruby preaccretionary terranes.The major precious metal-bearing deposit types related to Late Cretaceous-early Tertiary igneous complexes of the Kuskokwim mineral belt are subdivided as follows: (1) plutonic-hosted copper-gold polymetallic stockwork, skarn, and vein deposits, (2) peraluminous granite-porphory-hosted gold polymetallic deposits, (3) plutonic-related, boron-enriched silver-tin polymetallic breccia pipes and replacement deposits, (4) gold and silver mineralization in epithermal systems, and (5) gold polymetallic heavy mineral placer deposits. Ten deposits genetically related to Late Cretaceous-early Tertiary intrusions contain minimum, inferred reserves amounting to 162,572 kg (5.23 Moz) of gold, 201,015 kg (6.46 Moz) silver, 12,160 metric tons (t) of tin, and 28,088 t of copper.The lodes occur in veins, stockworks, breccia pipes, and replacement deposits that formed in epithermal to mesothermal temperature-pressure conditions. Fluid inclusion, isotopic age, mineral assemblage, alteration assemblage, and structural data indicate that many of the mineral deposits associated with Late Cretaceous-early tertiary volcanic and plutonic rocks represent geologically and spatially related, vertically zoned hydrothermal systems now exposed at several erosional levels.Polymetallic gold deposits of the Kuskokwim mineral belt are probably related to 77 to 52 Ma plutonism and volcanism associated with a period of rapid, north-directed subduction of the Kula plate. The geologic interpretation suggests that igneous complexes of the Kuskokwim mineral belt formed in an intracontinental back-arc setting during a period of extensional, wrench fault tectonics.The Kuskokwim mineral belt has many geologic and metallogenic features similar to other precious metal-bearing systems associated with arc-related igneous rocks such as the Late Cretaceous-early Tertiary Rocky Mountain alkalic province, the Jurassic Mount Milligan district of central British Columbia, the Andean orogen of South America, and the Okhotsk-Chukotka belt of northeast Asia.
Wingard, G. Lynn
1993-01-01
Current theories on the causes of extinction at the CretaceousTertiary boundary have been based on previously published data; however, few workers have stopped to ask the question, 'How good is the basic data set?' To test the accuracy of the published record, a quantitative and qualitative analysis of the Crassatellidae (Mollusca, Bivalvia) of the Gulf and Mid-Atlantic Coastal Plains of the United States for the Upper Cretaceous and lower Tertiary was conducted. Thirty-eight species names and four generic names are used in publications for the Crassatellidae within the geographic and stratigraphic constraints of this analysis. Fourteen of the 38 species names are represented by statistically valid numbers of specimens and were tested by using canonical discriminant analysis. All 38 names, with the exception of 1 invalid name and 4 names for which no representative specimen could be located, were evaluated qualitatively. The results show that the published fossil record is highly inaccurate. Only 8 valid, recognizable species exist in the Crassatellidae within the limits of this study, 14 names are synonymized, and 11 names are represented by indeterminate molds or poorly preserved specimens. Three of the four genera are well founded; the fourth is based on the juvenile of another genus and therefore synonymized. This detailed taxonomic analysis of the Crassatellidae illustrates that the published fossil record is not reliable. Calculations of evolutionary and paleobiologic significance based on poorly defined, overly split fossil groups, such as the Crassatellidae, are biased in the following ways: Rates of evolution and extinction are higher, Faunal turnover at mass extinctions appears more catastrophic, Species diversity is high, Average species durations are shortened, and Geographic ranges are restricted. The data on the taxonomically standardized Crassatellidae show evolutionary rates one-quarter to one-half that of the published fossil record; faunal change at the Cretaceous-Tertiary boundary that was not catastrophic; a constant number of species on each side of the Cretaceous-Tertiary boundary; a decrease in abundance in the Tertiary; and lower species diversity, longer average species durations, and expanded geographic ranges. Similar detailed taxonomic studies need to be conducted on other groups of organisms to test the patterns illustrated for the Crassatellidae and to determine the extent and direction of the bias in the published fossil record. Answers to our questions about evolutionary change cannot be found in the literature but rather with the fossils themselves. Evolution and extinction occur within small populations of species groups, and it is only through detailed analysis of these groups that we can achieve an understanding of the causes and effects of evolution and extinction.
Feasibility of zero or near zero fluoroscopy during catheter ablation procedures.
Haegeli, Laurent M; Stutz, Linda; Mohsen, Mohammed; Wolber, Thomas; Brunckhorst, Corinna; On, Chol-Jun; Duru, Firat
2018-04-03
Awareness of risks associated with radiation exposure to patients and medical staff has significantly increased. It has been reported before that the use of advanced three-dimensional electro-anatomical mapping (EAM) system significantly reduces fluoroscopy time, however this study aimed for zero or near zero fluoroscopy ablation to assess its feasibility and safety in ablation of atrial fibrillation (AF) and other tachyarrhythmias in a "real world" experience of a single tertiary care center. This was a single-center study where ablation procedures were attempted without fluoroscopy in 34 consecutive patients with different tachyarrhythmias under the support of EAM system. When transseptal puncture (TSP) was needed, it was attempted under the guidance of intracardiac echocardiography (ICE). Among 34 patients consecutively enrolled in this study, 28 (82.4%) patients were referred for radiofrequency ablation (RFA) of AF, 3 (8.8%) patients for ablation of right ventricular outflow tract (RVOT) ventricular extrasystole (VES), 1 (2.9%) patient for ablation of atrioventricular nodal reentry tachycardia (AVNRT), 2 (5.9%) patients for typical atrial flutter ablation. In 21 (62%) patients the entire procedure was carried out without the use of fluoroscopy. Among 28 AF patients, 15 (54%) patients underwent ablation without the use of fluoroscopy and among these 15 patients, 10 (67%) patients required TSP under ICE guidance while 5 (33%) patients the catheters were introduced to left atrium through a patent foramen ovale. In 13 AF patients, fluoroscopy was only required for double TSP. The total procedure time of AF ablation was 130 ± 50 min. All patients referred for atrial flutter, AVNRT, and VES of the RVOT ablation did not require any fluoroscopy. This study demonstrates the feasibility of zero or near zero fluoroscopy procedure including TSP with the support of EAM and ICE guidance in a "real world" experience of a single tertiary care center. When fluoroscopy was required, it was limited to TSP hence keeping the radiation dose very low. .
Cao, Renzhi; Bhattacharya, Debswapna; Adhikari, Badri; Li, Jilong; Cheng, Jianlin
2016-09-01
Model evaluation and selection is an important step and a big challenge in template-based protein structure prediction. Individual model quality assessment methods designed for recognizing some specific properties of protein structures often fail to consistently select good models from a model pool because of their limitations. Therefore, combining multiple complimentary quality assessment methods is useful for improving model ranking and consequently tertiary structure prediction. Here, we report the performance and analysis of our human tertiary structure predictor (MULTICOM) based on the massive integration of 14 diverse complementary quality assessment methods that was successfully benchmarked in the 11th Critical Assessment of Techniques of Protein Structure prediction (CASP11). The predictions of MULTICOM for 39 template-based domains were rigorously assessed by six scoring metrics covering global topology of Cα trace, local all-atom fitness, side chain quality, and physical reasonableness of the model. The results show that the massive integration of complementary, diverse single-model and multi-model quality assessment methods can effectively leverage the strength of single-model methods in distinguishing quality variation among similar good models and the advantage of multi-model quality assessment methods of identifying reasonable average-quality models. The overall excellent performance of the MULTICOM predictor demonstrates that integrating a large number of model quality assessment methods in conjunction with model clustering is a useful approach to improve the accuracy, diversity, and consequently robustness of template-based protein structure prediction. Proteins 2016; 84(Suppl 1):247-259. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.
Reduction of Insulin Related Preventable Severe Hypoglycemic Events in Hospitalized Children
Poppy, Amy; Retamal-Munoz, Claudia; Cree-Green, Melanie; Wood, Colleen; Davis, Shanlee; Clements, Scott A.; Majidi, Shideh; Steck, Andrea K.; Alonso, G. Todd; Chambers, Christina; Rewers, Arleta
2018-01-01
OBJECTIVE Insulin is a commonly used, high-risk medication in the inpatient setting. Incorrect insulin administration can lead to preventable hypoglycemic events, which are a significant morbidity in inpatient diabetes care. The goal of this intervention was to decrease preventable insulin-related hypoglycemic events in an inpatient setting in a tertiary care pediatric hospital. METHODS Methods included the institution of several interventions such as nursing and physician education, electronic medical record order sets, electronic communication note templates, and the development of new care guidelines. RESULTS After the institution of multiple interventions, the rate of preventable hypoglycemic events decreased from 1.4 preventable events per 100 insulin days to 0.4 preventable events per 100 insulin days. CONCLUSIONS Through the use of a multi-interventional approach with oversight of a multidisciplinary insulin safety committee, a sustained decreased rate of severe preventable hypoglycemic events in hospitalized pediatric patients receiving insulin was achieved. PMID:27317577
Reduction of Insulin Related Preventable Severe Hypoglycemic Events in Hospitalized Children.
Poppy, Amy; Retamal-Munoz, Claudia; Cree-Green, Melanie; Wood, Colleen; Davis, Shanlee; Clements, Scott A; Majidi, Shideh; Steck, Andrea K; Alonso, G Todd; Chambers, Christina; Rewers, Arleta
2016-07-01
Insulin is a commonly used, high-risk medication in the inpatient setting. Incorrect insulin administration can lead to preventable hypoglycemic events, which are a significant morbidity in inpatient diabetes care. The goal of this intervention was to decrease preventable insulin-related hypoglycemic events in an inpatient setting in a tertiary care pediatric hospital. Methods included the institution of several interventions such as nursing and physician education, electronic medical record order sets, electronic communication note templates, and the development of new care guidelines. After the institution of multiple interventions, the rate of preventable hypoglycemic events decreased from 1.4 preventable events per 100 insulin days to 0.4 preventable events per 100 insulin days. Through the use of a multi-interventional approach with oversight of a multidisciplinary insulin safety committee, a sustained decreased rate of severe preventable hypoglycemic events in hospitalized pediatric patients receiving insulin was achieved. Copyright © 2016 by the American Academy of Pediatrics.
Vance, Carol Grace T.; Rakel, Barbara A.; Blodgett, Nicole P.; DeSantana, Josimari Melo; Amendola, Annunziato; Zimmerman, Miriam Bridget; Walsh, Deirdre M.
2012-01-01
Background Transcutaneous electrical nerve stimulation (TENS) is commonly used for the management of pain; however, its effects on several pain and function measures are unclear. Objective The purpose of this study was to determine the effects of high-frequency TENS (HF-TENS) and low-frequency TENS (LF-TENS) on several outcome measures (pain at rest, movement-evoked pain, and pain sensitivity) in people with knee osteoarthritis. Design The study was a double-blind, randomized clinical trial. Setting The setting was a tertiary care center. Participants Seventy-five participants with knee osteoarthritis (29 men and 46 women; 31–94 years of age) were assessed. Intervention Participants were randomly assigned to receive HF-TENS (100 Hz) (n=25), LF-TENS (4 Hz) (n=25), or placebo TENS (n=25) (pulse duration=100 microseconds; intensity=10% below motor threshold). Measurements The following measures were assessed before and after a single TENS treatment: cutaneous mechanical pain threshold, pressure pain threshold (PPT), heat pain threshold, heat temporal summation, Timed “Up & Go” Test (TUG), and pain intensity at rest and during the TUG. A linear mixed-model analysis of variance was used to compare differences before and after TENS and among groups (HF-TENS, LF-TENS, and placebo TENS). Results Compared with placebo TENS, HF-TENS and LF-TENS increased PPT at the knee; HF-TENS also increased PPT over the tibialis anterior muscle. There was no effect on the cutaneous mechanical pain threshold, heat pain threshold, or heat temporal summation. Pain at rest and during the TUG was significantly reduced by HF-TENS, LF-TENS, and placebo TENS. Limitations This study tested only a single TENS treatment. Conclusions Both HF-TENS and LF-TENS increased PPT in people with knee osteoarthritis; placebo TENS had no significant effect on PPT. Cutaneous pain measures were unaffected by TENS. Subjective pain ratings at rest and during movement were similarly reduced by active TENS and placebo TENS, suggesting a strong placebo component of the effect of TENS. PMID:22466027
Nasirudeen, A M A; Lee Chin Adeline, Lau; Wat Neo Josephine, Koh; Lay Seng, Lim; Wenjie, Li
2017-01-01
Many tertiary students access social networking sites on a daily basis. With the increased usage of smartphones, accessing social networking sites while commuting, in schools, waiting for friends, television commercial breaks has become prevalent among tertiary students. What started as a lifestyle choice has now become a daily necessity. Such behavior among tertiary students raises an important question for educators: how does social media usage affect tertiary students' sleep patterns and daytime sleepiness, their attention difficulties, especially in school? Thus, the aim of this study was to examine the relationships between tertiary students' self-reports of social media usage and daytime sleepiness. The design was a cross-sectional, quantitative research study. We used a survey that contained questions concerning demographic data, daytime sleepiness, total sleep time and social media usage and a version of the Cleveland Adolescent Sleepiness Questionnaire, modified for use in tertiary students, were used for data collection ( n = 969). The most preferred tool for accessing social networking sites was smartphones and WhatsApp was the most accessed site. Results indicated that nocturnal technology use has a weak, negative impact on tertiary students' quantity of sleep that may lead to daytime sleepiness. Local Singapore students spent significantly more time on social networking sites at night compared to foreign students. As a result, local students experienced more daytime sleepiness compared to foreign students. Prolonged social media usage, especially in bed, has a negative impact on tertiary students' daytime sleepiness. Since the technology is such an integral part of most tertiary students' lives, it is important to understand the impact it has on their sleep and daytime sleepiness.
Ferreira, Ana Paula A; Póvoa, Luciana C; Zanier, José F C; Ferreira, Arthur S
2017-02-01
The aim of this study was to assess the thorax-rib static method (TRSM), a palpation method for locating the seventh cervical spinous process (C7SP), and to report clinical data on the accuracy of this method and that of the neck flexion-extension method (FEM), using radiography as the gold standard. A single-blinded, cross-sectional diagnostic accuracy study was conducted. One hundred and one participants from a primary-to-tertiary health care center (63 men, 56 ± 17 years of age) had their neck palpated using the FEM and the TRSM. A single examiner performed both the FEM and TRSM in a random sequence. Radiopaque markers were placed at each location with the aid of an ultraviolet lamp. Participants underwent chest radiography for assessment of the superimposed inner body structure, which was located by using either the FEM or the TRSM. Accuracy in identifying the C7SP was 18% and 33% (P = .013) with use of the FEM and the TRSM, respectively. The cumulative accuracy considering both caudal and cephalic directions (C7SP ± 1SP) increased to 58% and 81% (P = .001) with use of the FEM and the TRSM, respectively. Age had a significant effect on the accuracy of FEM (P = .027) but not on the accuracy of TRSM (P = .939). Sex, body mass, body height, and body mass index had no significant effects on the accuracy of both the FEM (P = .209 or higher) and the TRSM (P = .265 or higher). The TRMS located the C7SP more accurately compared with the FEM at any given level of anatomic detail, although both still underperformed in terms of acceptable accuracy for a clinical setting. Copyright © 2016. Published by Elsevier Inc.
Conn, Jason R.; Catchpoole, Elizabeth M.; Runnegar, Naomi; Mapp, Sally J.
2017-01-01
Febrile neutropenia (FN) is a medical emergency and can represent a life-threatening complication for hematology patients treated with intensive chemotherapy regimens. In clinical practice, the diagnostic yield of blood cultures and other investigations which aim to identify a causative organism or site of infection is low. We have retrospectively examined all blood cultures collected in a “real world” cohort of patients receiving chemotherapy for acute leukemia and patients with aggressive lymphoma treated with Hyper-CVAD/MTX-cytarabine, at a single tertiary center over a five-year period. In this cohort, the 30-day mortality following confirmed blood stream infection (BSI) was 5.9%, which is lower than most reports in the recent literature. We compared the blood culture results of inpatients undergoing induction chemotherapy and outpatients presenting with fevers and found a significantly higher rate of proven BSI in the outpatient group. In all settings, gram-negative organisms were most common. The rate of resistance to first-line empiric antibiotics among pathogenic isolates was 11.6% in the whole cohort, independent of blood culture circumstances. There was a trend to higher resistance rates among inpatients undergoing induction chemotherapy compared to patients presenting to the emergency department (17.4% vs 7.5%) but this did not reach statistical significance. We also report low rates of ciprofloxacin resistance (5% of isolates), in a center where universal fluoroquinolone prophylaxis is not employed. Our low resistance and mortality rates support our current therapeutic strategies, however presence of resistant organisms across the spectrum of indications for BC collection highlights the importance of surveilling local patterns, escalating antimicrobial therapy in the deteriorating patient, and considering advanced techniques for the rapid identification of resistance in this patient population. PMID:28542412
DOE Office of Scientific and Technical Information (OSTI.GOV)
Douthit, T.L.; Meyers, W.J.; Hanson, G.N.
1993-05-01
Detailed analysis of compositionally unaltered marine fibrous cements (MFC) from a single core through the Mississippian irish Waulsortian Limestone indicates that the variation of seawater [sup 87]Sr/[sup 86]Sr is nonmonotonic across the Ivorian-Chadian boundary. This nonmonotonic variation has not been recognized by previous studies. Furthermore, marine cement yielded [sup 87]Sr/[sup 86]Sr ratios lower than previously reported values for the Ivorian-Chadian (sagean). Marine fibrous cements are interpreted to be compositionally unaltered on the basis of nonluminescent character and stable isotope (C, O) composition comparable to previous estimates of Mississippian marine calcite. The isotope chemistry (C, O, Sr) and cathodoluminescent character ofmore » the marine fibrous cements therefore remained intact during their conversion from high-Mg calcite to low-Mg calcite + microdolomite, a conversion that probably took place in marine water during precipitation of Zone 1 calcite cement, the oldest non-MFC cement. High stratigraphic resolution was obtained by restricting the sample set to a single core, 429 m long, thereby eliminating chronostratigraphic correlation errors. The core is estimated to represent about 9.8 million years of Waulsortian Limestone deposition. The maximum rate of change in seawater [sup 87]Sr/[sup 86]Sr is [minus]0.00012/Ma, comparable in magnitude to Tertiary values. The authors data document the presence of fine-scale seawater [sup 87]Sr/[sup 86]Sr modulations for the Ivorian/Chadian, in contrast to the previously published monotonic seawater [sup 87]Sr/[sup 86]Sr curve for this interval, and emphasize the importance of well characterized intraformational isotopic baselines.« less
Selective upper airway stimulation for obstructive sleep apnea: a single center clinical experience.
Heiser, Clemens; Knopf, Andreas; Bas, Murat; Gahleitner, Constanze; Hofauer, Benedikt
2017-03-01
Selective upper airway stimulation (UAS) is a novel therapy for patients with obstructive sleep apnea (OSA). The aim of this study was to analyze the application and outcome of UAS in patients with moderate to severe OSA in the clinical routine of a tertiary referral center. The design of this study is single-center, prospective clinical trial. Thirty-one patients who received a UAS device (Inspire Medical Systems) were included. Treatment outcome was evaluated at 2, 3, 6, and 12 months after surgery. Data collection included demographics, body mass index (BMI), apnea hypopnea index (AHI), oxygen saturation and desaturation index (ODI), Epworth Sleepiness Score (ESS), adverse events, and adherence to therapy. Sher criteria were used to evaluate treatment response. The mean age was 59.6 years with thirty patients being male. Mean BMI was 28.8 kg/m 2 . The mean pre-implantation AHI of 32.9/h could be reduced to 7.1/h after 12 months (p < 0.001). The mean pre-implantation ODI of 30.7/h could be reduced to 9.9/h after 12 months (p = 0.004). The mean pre-implantation ESS of 12.6 could be reduced to 5.9 after 12 months (p = 0.006). Serious adverse events did not occur. Therapy adherence was a usage of 6.6 h/night after 12 months. OSA severity and subjective daytime sleepiness were improved in patients with moderate to severe OSA after receiving UAS therapy. Patients maintained high adherence to therapy use after 12 months. It is encouraging that UAS has been shown to be successfully implemented in the routine clinical management of OSA outside of a clinical trial setting.
Predicting loop–helix tertiary structural contacts in RNA pseudoknots
Cao, Song; Giedroc, David P.; Chen, Shi-Jie
2010-01-01
Tertiary interactions between loops and helical stems play critical roles in the biological function of many RNA pseudoknots. However, quantitative predictions for RNA tertiary interactions remain elusive. Here we report a statistical mechanical model for the prediction of noncanonical loop–stem base-pairing interactions in RNA pseudoknots. Central to the model is the evaluation of the conformational entropy for the pseudoknotted folds with defined loop–stem tertiary structural contacts. We develop an RNA virtual bond-based conformational model (Vfold model), which permits a rigorous computation of the conformational entropy for a given fold that contains loop–stem tertiary contacts. With the entropy parameters predicted from the Vfold model and the energy parameters for the tertiary contacts as inserted parameters, we can then predict the RNA folding thermodynamics, from which we can extract the tertiary contact thermodynamic parameters from theory–experimental comparisons. These comparisons reveal a contact enthalpy (ΔH) of −14 kcal/mol and a contact entropy (ΔS) of −38 cal/mol/K for a protonated C+•(G–C) base triple at pH 7.0, and (ΔH = −7 kcal/mol, ΔS = −19 cal/mol/K) for an unprotonated base triple. Tests of the model for a series of pseudoknots show good theory–experiment agreement. Based on the extracted energy parameters for the tertiary structural contacts, the model enables predictions for the structure, stability, and folding pathways for RNA pseudoknots with known or postulated loop–stem tertiary contacts from the nucleotide sequence alone. PMID:20100813
Code of Federal Regulations, 2011 CFR
2011-07-01
... Homemakers, and Single Pregnant Women Program be offered? 403.82 Section 403.82 Education Regulations of the... Secretary Assist Under the Basic Programs? Single Parents, Displaced Homemakers, and Single Pregnant Women Program § 403.82 In what settings may the Single Parents, Displaced Homemakers, and Single Pregnant Women...
Code of Federal Regulations, 2013 CFR
2013-07-01
... Homemakers, and Single Pregnant Women Program be offered? 403.82 Section 403.82 Education Regulations of the... Secretary Assist Under the Basic Programs? Single Parents, Displaced Homemakers, and Single Pregnant Women Program § 403.82 In what settings may the Single Parents, Displaced Homemakers, and Single Pregnant Women...
Code of Federal Regulations, 2012 CFR
2012-07-01
... Homemakers, and Single Pregnant Women Program be offered? 403.82 Section 403.82 Education Regulations of the... Secretary Assist Under the Basic Programs? Single Parents, Displaced Homemakers, and Single Pregnant Women Program § 403.82 In what settings may the Single Parents, Displaced Homemakers, and Single Pregnant Women...
Code of Federal Regulations, 2014 CFR
2014-07-01
... Homemakers, and Single Pregnant Women Program be offered? 403.82 Section 403.82 Education Regulations of the... Secretary Assist Under the Basic Programs? Single Parents, Displaced Homemakers, and Single Pregnant Women Program § 403.82 In what settings may the Single Parents, Displaced Homemakers, and Single Pregnant Women...
Code of Federal Regulations, 2010 CFR
2010-07-01
... Homemakers, and Single Pregnant Women Program be offered? 403.82 Section 403.82 Education Regulations of the... Secretary Assist Under the Basic Programs? Single Parents, Displaced Homemakers, and Single Pregnant Women Program § 403.82 In what settings may the Single Parents, Displaced Homemakers, and Single Pregnant Women...
Marriott, John; Graham-Clarke, Emma; Shirley, Debra; Rushton, Alison
2018-01-01
Objective To evaluate the clinical and cost-effectiveness of non-medical prescribing (NMP). Design Systematic review. Two reviewers independently completed searches, eligibility assessment and assessment of risk of bias. Data sources Pre-defined search terms/combinations were utilised to search electronic databases. In addition, hand searches of reference lists, key journals and grey literature were employed alongside consultation with authors/experts. Eligibility criteria for included studies Randomised controlled trials (RCTs) evaluating clinical or cost-effectiveness of NMP. Measurements reported on one or more outcome(s) of: pain, function, disability, health, social impact, patient-safety, costs-analysis, quality adjusted life years (QALYs), patient satisfaction, clinician perception of clinical and functional outcomes. Results Three RCTs from two countries were included (n = 932 participants) across primary and tertiary care settings. One RCT was assessed as low risk of bias, one as high risk of bias and one as unclear risk of bias. All RCTs evaluated clinical effectiveness with one also evaluating cost-effectiveness. Clinical effectiveness was evaluated using a range of safety and patient-reported outcome measures. Participants demonstrated significant improvement in outcomes when receiving NMP compared to treatment as usual (TAU) in all RCTs. An associated cost analysis showed NMP to be more expensive than TAU (regression coefficient p = 0.0000), however experimental groups generated increased QALYs compared to TAU. Conclusion Limited evidence with overall unclear risk of bias exists evaluating clinical and cost-effectiveness of NMP across all professions and clinical settings. GRADE assessment revealed moderate quality evidence. Evidence suggests that NMP is safe and can provide beneficial clinical outcomes. Benefits to the health economy remain unclear, with the cost-effectiveness of NMP assessed by a single pilot RCT of low risk of bias. Adequately powered low risk of bias RCTs evaluating clinical and cost effectiveness are required to evaluate NMP across clinical specialities, professions and settings. Registration PROSPERO (CRD42015017212). PMID:29509763
Accurate blood pressure recording: is it difficult?
Bhalla, A; Singh, R; D'cruz, S; Lehl, S S; Sachdev, A
2005-11-01
Blood pressure (BP) measurement is a routine procedure but errors are frequently committed during BP recording. AIMS AND SETTINGS: The aim of the study was to look at the prevalent practices in the institute regarding BP recording. The study was conducted in the Medicine Department at Government Medical College, Chandigarh, a teaching institute for MBBS students. A prospective, observational study was performed amongst the 80 doctors in a tertiary care hospital. All of them were observed by a single observer during the act of BP recording. The observer was well versed with the guidelines issued by British Hypertension Society (BHS) and the deviations from the standard set of guidelines issued by BHS were noted. The errors were defined as deviations from these guidelines. The results were recorded as percentage of doctors committing these errors. In our study, 90% used mercury type sphygmomanometer. Zero error of the apparatus, hand dominance was not noted by any one. Every one used the standard BP cuff for recording BP. 70% of them did not let the patient rest before recording BP. 80% did not remove the clothing from the arm. None of them recorded BP in both arms. In out patient setting, 80% recorded blood pressure in sitting position and 14% in supine position. In all the patients where BP was recorded in sitting position BP apparatus was below the level of heart and 20% did not have their arm supported. 60% did not use palpatory method for noticing systolic BP and 70% did not raise pressure 30-40 mm Hg above the systolic level before checking the BP by auscultation. 80% lowered the BP at a rate of more than 2 mm/s and 60% rounded off the BP to nearest 5-10 mm Hg. 70% recorded BP only once and 90% of the rest re inflated the cuff without completely deflating and allowing rest before a second reading was obtained. The practice of recording BP in our hospital varies from the standard guidelines issued by the BHS.
Shocked quartz and more: Impact signatures in K-T boundary clays and claystones
NASA Technical Reports Server (NTRS)
Bohor, Bruce F.
1988-01-01
Quartz grains displaying multiple sets of planar features are described from numerous Cretaceous-Tertiary (K-T) boundary clays and claystones at both marine and nonmarine depositional sites around the world. All these sites also show anomalously high amounts of iridium and enrichments of other siderophile elements in cosmic ratios within these boundary units. This combination of mineralogical and geochemical features are used in support of an impact hypothesis for the end-Cretaceous event. Recently, it was suggested that some combination of explosive and nonexplosive volcanism associated with the formation of the Deccan traps in India could be responsible for the mineralogy and geochemistry seen in the K-T boundary units. Besides the obvious contradition of simultaneous explosive and nonexplosive volcanism from one locality during an instant of geologic time, there remains the difficulty of spreading both iridium (and trace elements in cosmic proportions) and quartz grains around the world by volcanic (atmospheric) transport. In addition, the ability of volcanism to produce the type of shock metamorphism seen in minerals at the K-T boundary was not demonstrated. Multiple sets of shock lamellae in quartz are considered characteristic of shock metamorphism in rocks at the sites of known impact craters and are the type of deformation seen in quartz from K-T boundary clays and claystones. Single sets of poorly defined lamellae described from rare quartz grains in certain volcanic deposits are characteristic of tectonic deformation and do not correspond to the shock lamellae in quartz from K-T sediments and impact structures. So-called shock mosaicism in quartz and feldspar grains described from volcanic deposits can result from many processes other than shock metamorphism, and therefore is not considered to be an effect characteristic solely of shock. The mineralogy of shock-metamorphosed grains at the K-T boundary also argues against a volcanic origin.
Alderazi, Ahmed Ali; Lynch, Mary
2017-01-01
In response to growing concerns regarding the overuse of coronary computed tomography angiography (CCTA) in the clinical setting, multiple societies, including the American College of Cardiology Foundation, have jointly published revised criteria regarding the appropriate use of this imaging modality. However, previous research indicates significant discrepancies in the rate of adherence to these guidelines. To assess the appropriateness of CCTA referrals in a tertiary cardiac center in Bahrain. This retrospective clinical audit examined the records of patients referred to CCTA between the April 1, 2015 and December 31, 2015 in Mohammed bin Khalifa Cardiac Center. Using information from medical records, each case was meticulously audited against guidelines to categorize it as appropriate, inappropriate, or uncertain. Of the 234 records examined, 176 (75.2%) were appropriate, 47 (20.1%) were uncertain, and 11 (4.7%) were inappropriate. About 74.4% of all referrals were to investigate coronary artery disease (CAD). The most common indication that was deemed appropriate was the detection of CAD in the setting of suspected ischemic equivalent in patients with an intermediate pretest probability of CAD (65.9%). Most referrals deemed inappropriate were requested to detect CAD in asymptomatic patients at low or intermediate risk of CAD (63.6%). This audit demonstrates a relatively low rate of inappropriate CCTA referrals, indicating the appropriate and efficient use of this resource in the Mohammed bin Khalifa Cardiac Center. Agreement on and reclassification of "uncertain" cases by guideline authorities would facilitate a deeper understanding of referral appropriateness.
Otolaryngology Service Usage in Children With Cleft Palate.
Whittemore, Kenneth R; Dargie, Jenna M; Dornan, Briana K; Boudreau, Brian
2018-05-01
To determine the usage of otolaryngology services by children with cleft palate at a pediatric tertiary care facility. Retrospective case series. Specialty clinic at a pediatric tertiary care hospital. Children born between January 1, 1999, and December 31, 2002, with the diagnosis of cleft palate or cleft lip and palate. A total of 41 female and 48 male patients were included. Total number of otolaryngology clinic visits and total number of otolaryngologic surgeries (tympanostomy tube placements and other otologic or upper airway procedures). In the first 5 years of life, these children utilized an average of 8.2 otolaryngology clinic visits (SD = 5.0; range: 1-22) and underwent 3.3 tympanostomy tube surgeries (SD = 2.0; range: 0-10). Seventy-three had their first tube placed at the time of palate repair, and 4 at the time of lip repair. Fifty-one (57.3%) required other otologic or upper airway procedures, including tonsillectomy and/or adenoidectomy (27 children), removal of tympanostomy tubes (24 children), tympanomastoidectomy (3 children), and tympanoplasty (14 children). Of the children who underwent other procedures, they underwent a mean of 1.67 (SD = 0.84; range: 1-4) surgeries. Children with cleft palate are at increased risk for eustachian tube dysfunction, frequently utilize otolaryngology care, and typically receive multiple sets of tympanostomy tubes. This study found that children with cleft palate receive on average of approximately 3 sets of tympanostomy tubes, and the majority required another otologic or upper airway surgery.
Idiopathic dental pulp calcifications in a tertiary care setting in South India.
Satheeshkumar, P S; Mohan, Minu P; Saji, Sweta; Sadanandan, Sudheesh; George, Giju
2013-01-01
Dental pulp calcifications are unique and represent the dental pulp regenerative process. Dental pulp calcifications are sometimes routine findings in oral radiographs and may later serve as an important diagnostic criterion for a hidden aspect of systemic illness. The purpose of this study was to assess the patterns and prevalence of idiopathic dental pulp calcifications in a tertiary care setting in South India. A total of 227 patients were included in the study fulfilling the inclusion criteria. Age range of the study population was from 15 to 70 years. Teeth were examined under digital panoramic radiograph. The presence or absence of pulp stones was recorded. The presence of pulp stone were categorized according to the types classified as Type I, Type IA, Type II, Type IIA, Type II B, and Type III. The frequency of occurrence of pulp stones with sex, tooth type, dental arches, and types were compared with the types of calcification. Total no. of patients with pulpal calcification were 227 [females 133 (58.59%) and males 94 (41.40%)]. The most common type between both sexes was Type I (48%). Total no. of teeth with calcification was 697; maxilla (48%), mandible (52%). The prevalence of pulp stone was found to be higher in the molars in both the arches. Most no. of pulp stones are reported at the third and fourth decade of life. Idiopathic dental pulp calcifications are incidental radiographic findings of the pulp tissue and also may be an indicator of underlying disease.
Cheetham, T Craig; Niu, Fang; Chiang, Kevin; Yuan, Yong; Kalsekar, Anu; Hechter, Rulin; Hay, Joel W; Nyberg, Lisa
2015-08-01
Achievement of sustained virologic response (SVR) and factors associated with treatment failure in hepatitis C virus (HCV) genotype 3 have been described in tertiary and referral care settings, with rates of SVR reported to range between 72% and 89%. Fewer data exist on SVR outside of these settings. To describe rates of SVR and characterize factors associated with achievement of SVR within an integrated health care delivery system. A retrospective cohort study of genotype 3 HCV patients treated with dual therapy (pegylated interferon-alpha plus ribavirin) was conducted at Kaiser Permanente Southern California. Adult patients diagnosed with HCV and testing positive for HCV-RNA genotype 3 were identified from electronic medical records. Data were collected on patient demographics, baseline health status, and comorbid conditions. A multivariate logistic regression model was used to determine the association between baseline patient factors and SVR. A total of 484 HCV genotype 3 patients met the eligibility criteria. The median age was 49 years, and 65.7% were male. Overall, 252 (52.1%) achieved SVR. Aged ≥ 45 years and male gender were associated with lower rates of SVR; cirrhosis and chronic diseases (diabetes and chronic obstructive pulmonary disease) were also associated with lower rates of SVR. SVR was lower in patients within an integrated care delivery system than in those in tertiary and referral centers. Males and older patients had lower rates of SVR, as well as patients with cirrhosis, diabetes, and chronic obstructive pulmonary disease.
Van der Bij, A K; Van der Zwan, D; Peirano, G; Severin, J A; Pitout, J D D; Van Westreenen, M; Goessens, W H F
2012-09-01
Recently, the first outbreak of clonally related VIM-2 metallo-β-lactamase (MBL)-producing Pseudomonas aeruginosa in a Dutch tertiary-care centre was described. Subsequently, a nationwide surveillance study was performed in 2010-2011, which identified the presence of VIM-2 MBL-producing P. aeruginosa in 11 different hospitals. Genotyping by multiple-locus variable-number tandem-repeat analysis (MLVA) showed that the majority of the 82 MBL-producing isolates found belonged to a single MLVA type (n = 70, 85%), identified as ST111 by multilocus sequence typing (MLST). As MBL-producing isolates cause serious infections that are difficult to treat, the presence of clonally related isolates in various hospitals throughout the Netherlands is of nationwide concern. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.
ERIC Educational Resources Information Center
Golebiowski, Zofia, Ed.
This selection of papers from the First Conference on Tertiary Literacy, which examined the role of literacy as a foundation for knowledge acquisition and dissemination that influences the academic success of tertiary students, presents a number of case studies of policy and practice in Australian universities. Keynote addresses included:…
Secondary structure encodes a cooperative tertiary folding funnel in the Azoarcus ribozyme
Mustoe, Anthony M.; Al-Hashimi, Hashim M.; Brooks, Charles L.
2016-01-01
A requirement for specific RNA folding is that the free-energy landscape discriminate against non-native folds. While tertiary interactions are critical for stabilizing the native fold, they are relatively non-specific, suggesting additional mechanisms contribute to tertiary folding specificity. In this study, we use coarse-grained molecular dynamics simulations to explore how secondary structure shapes the tertiary free-energy landscape of the Azoarcus ribozyme. We show that steric and connectivity constraints posed by secondary structure strongly limit the accessible conformational space of the ribozyme, and that these so-called topological constraints in turn pose strong free-energy penalties on forming different tertiary contacts. Notably, native A-minor and base-triple interactions form with low conformational free energy, while non-native tetraloop/tetraloop–receptor interactions are penalized by high conformational free energies. Topological constraints also give rise to strong cooperativity between distal tertiary interactions, quantitatively matching prior experimental measurements. The specificity of the folding landscape is further enhanced as tertiary contacts place additional constraints on the conformational space, progressively funneling the molecule to the native state. These results indicate that secondary structure assists the ribozyme in navigating the otherwise rugged tertiary folding landscape, and further emphasize topological constraints as a key force in RNA folding. PMID:26481360
Hu, Desheng; Mohanta, Sarajo K.; Yin, Changjun; Peng, Li; Ma, Zhe; Srikakulapu, Prasad; Grassia, Gianluca; MacRitchie, Neil; Dever, Gary; Gordon, Peter; Burton, Francis L.; Ialenti, Armando; Sabir, Suleman R.; McInnes, Iain B.; Brewer, James M.; Garside, Paul; Weber, Christian; Lehmann, Thomas; Teupser, Daniel; Habenicht, Livia; Beer, Michael; Grabner, Rolf; Maffia, Pasquale; Weih, Falk; Habenicht, Andreas J.R.
2015-01-01
Summary Tertiary lymphoid organs (TLOs) emerge during nonresolving peripheral inflammation, but their impact on disease progression remains unknown. We have found in aged Apoe−/− mice that artery TLOs (ATLOs) controlled highly territorialized aorta T cell responses. ATLOs promoted T cell recruitment, primed CD4+ T cells, generated CD4+, CD8+, T regulatory (Treg) effector and central memory cells, converted naive CD4+ T cells into induced Treg cells, and presented antigen by an unusual set of dendritic cells and B cells. Meanwhile, vascular smooth muscle cell lymphotoxin β receptors (VSMC-LTβRs) protected against atherosclerosis by maintaining structure, cellularity, and size of ATLOs though VSMC-LTβRs did not affect secondary lymphoid organs: Atherosclerosis was markedly exacerbated in Apoe−/−Ltbr−/− and to a similar extent in aged Apoe−/−Ltbrfl/flTagln-cre mice. These data support the conclusion that the immune system employs ATLOs to organize aorta T cell homeostasis during aging and that VSMC-LTβRs participate in atherosclerosis protection via ATLOs. PMID:26084025
Mutations In Rare Ataxia Genes Are Uncommon Causes of Sporadic Cerebellar Ataxia
Fogel, Brent L.; Lee, Ji Yong; Lane, Jessica; Wahnich, Amanda; Chan, Sandy; Huang, Alden; Osborn, Greg E.; Klein, Eric; Mamah, Catherine; Perlman, Susan; Geschwind, Daniel H.; Coppola, Giovanni
2012-01-01
BACKGROUND Sporadic-onset ataxia is common in a tertiary care setting but a significant percentage remains unidentified despite extensive evaluation. Rare genetic ataxias, reported only in specific populations or families, may contribute to a percentage of sporadic ataxia. METHODS Patients with adult-onset sporadic ataxia, who tested negative for common genetic ataxias (SCA1, SCA2, SCA3, SCA6, SCA7, and/or Friedreich ataxia), were evaluated using a stratified screening approach for variants in seven rare ataxia genes. RESULTS We screened patients for published mutations in SYNE1 (n=80) and TGM6 (n=118), copy number variations in LMNB1 (n=40) and SETX (n=11), sequence variants in SACS (n=39) and PDYN (n=119), and the pentanucleotide insertion of spinocerebellar ataxia type 31 (n=101). Overall, we identified one patient with a LMNB1 duplication, one patient with a PDYN variant, and one compound SACS heterozygote, including a novel variant. CONCLUSIONS The rare genetic ataxias examined here do not significantly contribute to sporadic cerebellar ataxia in our tertiary care population. PMID:22287014
Petroleum geology of the Gulf of Lion (Mediterranean offshore-France)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vially, R.; Jean-Jacques, B.; Alain, I.E.M.
1995-08-01
The onshore sedimentary basins of Camargue and the northern edge of the Gulf of Lion have been explored since the middle of the last century. The results of this petroleum exploration were poor despite two small oil discoveries: the Oligocene onshore Gallician field and the Triassic onshore Gabian field (respectively 7000 tons and 23000 tons of oil production). Eleven wells were drilled offshore (from 1968 to 1985), all located on highs of the pre-Tertiary substratum. Few oil and gas shows were proven by only three of these wells. The seismic data base has been fully reinterpreted. The mapping of themore » pre-Tertiary substratum shows wide unexplored grabens in the Gulf of Lion. Some Oligocene prospects have been evidenced which are either stratigraphic traps or faulted blocks associated to salt seals. A new set of geochemical analysis of the Oligocene source rock has been performed as well as systematic generation and migration models (1D and 2D models) leading to the definition of an effective oil kitchen of an Oligocene lacustrine source rock (type 1).« less
Docker, Charles EJ; Lewthwaite, Simon; Kiely, Nigel T
2007-01-01
INTRODUCTION The Ponseti technique is a well-proven way of managing paediatric clubfoot deformity. We describe a management set-up which spreads the care between secondary and tertiary care with no loss of quality. PATIENTS AND METHODS In our audit of the first 2 years of Ponseti casting in the treatment of idiopathic congenital talipes equinovarus (CTEV, clubfoot) deformity, we identified 77 feet having been treated in 50 patients. Forty-nine feet were treated primarily in Oswestry, a tertiary referral centre for paediatric orthopaedic conditions, and 13 feet were treated in conjunction with the physiotherapy department at one of the region's district general hospitals (Leighton Hospital, Crewe, Cheshire). RESULTS Similar good results and low requirement for surgical interventions other than Achilles tenotomy, which forms part of the Ponseti regimen, were found in both cohorts. CONCLUSIONS This ‘hub-and-spoke’ approach would appear to be efficient in terms of resource utilisation. Additional benefits atients and their carers include ease of access to services and reduced financial and transport burdens. PMID:17688726
Eyrich, V A; Standley, D M; Friesner, R A
1999-05-14
We report the tertiary structure predictions for 95 proteins ranging in size from 17 to 160 residues starting from known secondary structure. Predictions are obtained from global minimization of an empirical potential function followed by the application of a refined atomic overlap potential. The minimization strategy employed represents a variant of the Monte Carlo plus minimization scheme of Li and Scheraga applied to a reduced model of the protein chain. For all of the cases except beta-proteins larger than 75 residues, a native-like structure, usually 4-6 A root-mean-square deviation from the native, is located. For beta-proteins larger than 75 residues, the energy gap between native-like structures and the lowest energy structures produced in the simulation is large, so that low RMSD structures are not generated starting from an unfolded state. This is attributed to the lack of an explicit hydrogen bond term in the potential function, which we hypothesize is necessary to stabilize large assemblies of beta-strands. Copyright 1999 Academic Press.
Wang, Xiaohui; Chontawan, Ratanawadee; Nantsupawat, Raymoul
2012-02-01
The aim of this study was to describe the relationship between the transformational leadership of nurse managers and job satisfaction among clinical Registered Nurses at a tertiary care hospital in China. The healthcare system is changing rapidly. Research in Western countries has shown that transformational leadership affects job satisfaction. However, very little research related to this subject has been conducted in healthcare settings in China. The sample consisted of 238 nurses who work at a tertiary care hospital in China. Data were collected from April to August 2006. Research instruments included a demographic data form, a Leadership Practice Inventory and a Job Satisfaction Scale for clinical registered nurses. Both the transformational leadership of nurse managers and job satisfaction among clinical Registered Nurses were at a moderate level. There was a statistically significant positive correlation between the transformational leadership of nurse managers and job satisfaction (r = 0·556, P < 0·001). The findings indicate that the transformational leadership of nurse managers could have an effect on the job satisfaction of clinical Registered Nurses. © 2011 Blackwell Publishing Ltd.
Extreme close approaches in hierarchical triple systems with comparable masses
NASA Astrophysics Data System (ADS)
Haim, Niv; Katz, Boaz
2018-06-01
We study close approaches in hierarchical triple systems with comparable masses using full N-body simulations, motivated by a recent model for type Ia supernovae involving direct collisions of white dwarfs (WDs). For stable hierarchical systems where the inner binary components have equal masses, we show that the ability of the inner binary to achieve very close approaches, where the separation between the components of the inner binary reaches values which are orders of magnitude smaller than the semi-major axis, can be analytically predicted from initial conditions. The rate of close approaches is found to be roughly linear with the mass of the tertiary. The rate increases in systems with unequal inner binaries by a marginal factor of ≲ 2 for mass ratios 0.5 ≤ m1/m2 ≤ 1 relevant for the inner white-dwarf binaries. For an average tertiary mass of ˜0.3M⊙ which is representative of typical M-dwarfs, the chance for clean collisions is ˜1% setting challenging constraints on the collisional model for type Ia's.
The subsurface geology of the Florida-Hatteras shelf, slope, and inner Blake Plateau
Paull, Charles K.; Dillon, William P.
1979-01-01
The structure and stratigraphy of the Florida-Hatteras Slope and inner Blake Plateau was studied by means of 4,780 km of single-channel air gun seismic reflection profiles. Control for the seismic stratigraphy is provided by correlating reflecting units and paleontologically dated stratigraphic units identified in offshore wells and dredge hauls. Many Tertiary unconformities exist, and major regional unconformities at the end of the Oligocene and in the late Paleocene are mapped. Reflecting surfaces believed to represent the tops of the Cretaceous, Paleocene, and Oligocene extend throughout the region. Upper Cretaceous (pre-Maastrichtian) rocks on the southeastern side of the Carolina Platform form a large seaward-facing progradational wedge. The Upper Cretaceous rocks in the Southeast Georgia Embayment, are seismically transparent and on the inner Blake Plateau are cut by numerous small faults, perhaps due to compaction. Within the survey area relatively flat-lying Maastrichtian and Paleocene strata show no evidence that a feature similar to the present Florida-Hatteras Slope existed at the beginning of the Tertiary. Late Paleocene erosion, related to the initiation of the Gulf Stream flow, probably developed this regional unconformity. Eocene and Oligocene sediments landward of the present Gulf Stream form a thick sequence of seaward-dipping progradational beds. A seaward progradational wedge of Miocene to Holocene age covers a regionally traceable unconformity, which separates the Oligocene from the Miocene sediments. Under and seaward of the present Gulf Stream, the Eocene and younger sediment supply was much smaller and the buildup is comparatively insignificant. The difference in accumulation rates in the Eocene and younger sediments, landward and seaward of the Gulf Stream, is responsible for the Florida-Hatteras Slope. Tertiary isopach maps suggest that there is a well developed triangular depocenter under the shelf. The edges of the depocenter correspond with magnetic anomalies and it is suggested that the depocenter is related to differential subsidence during the Tertiary across older crustal structures. The Eocene and Oligocene units contain the aquifer onshore, and the aquifer probably remains in these units offshore. With this assumption the potential aquifer has been identified and traced under the shelf and slope.
From Ramachandran Maps to Tertiary Structures of Proteins.
DasGupta, Debarati; Kaushik, Rahul; Jayaram, B
2015-08-27
Sequence to structure of proteins is an unsolved problem. A possible coarse grained resolution to this entails specification of all the torsional (Φ, Ψ) angles along the backbone of the polypeptide chain. The Ramachandran map quite elegantly depicts the allowed conformational (Φ, Ψ) space of proteins which is still very large for the purposes of accurate structure generation. We have divided the allowed (Φ, Ψ) space in Ramachandran maps into 27 distinct conformations sufficient to regenerate a structure to within 5 Å from the native, at least for small proteins, thus reducing the structure prediction problem to a specification of an alphanumeric string, i.e., the amino acid sequence together with one of the 27 conformations preferred by each amino acid residue. This still theoretically results in 27(n) conformations for a protein comprising "n" amino acids. We then investigated the spatial correlations at the two-residue (dipeptide) and three-residue (tripeptide) levels in what may be described as higher order Ramachandran maps, with the premise that the allowed conformational space starts to shrink as we introduce neighborhood effects. We found, for instance, for a tripeptide which potentially can exist in any of the 27(3) "allowed" conformations, three-fourths of these conformations are redundant to the 95% confidence level, suggesting sequence context dependent preferred conformations. We then created a look-up table of preferred conformations at the tripeptide level and correlated them with energetically favorable conformations. We found in particular that Boltzmann probabilities calculated from van der Waals energies for each conformation of tripeptides correlate well with the observed populations in the structural database (the average correlation coefficient is ∼0.8). An alpha-numeric string and hence the tertiary structure can be generated for any sequence from the look-up table within minutes on a single processor and to a higher level of accuracy if secondary structure can be specified. We tested the methodology on 100 small proteins, and in 90% of the cases, a structure within 5 Å is recovered. We thus believe that the method presented here provides the missing link between Ramachandran maps and tertiary structures of proteins. A Web server to convert a tertiary structure to an alphanumeric string and to predict the tertiary structure from the sequence of a protein using the above methodology is created and made freely accessible at http://www.scfbio-iitd.res.in/software/proteomics/rm2ts.jsp.
PFARRER, CHRISTIANE; EBERT, BRIGITTE; MIGLINO, MARIA ANGELICA; KLISCH, KARL; LEISER, RUDOLF
2001-01-01
Both the fetal and maternal microvasculature of bovine placentomes was examined by scanning electron microscopy of vascular casts. So far the development of the vascular architecture of the bovine placentome in early gestation has only been studied 2-dimensionally due to technical difficulties arising from the fragility of the early placental blood vessels. Repeated experiments led to the selection of the microvascular corrosion casts presented here. The vasculature of the maternal compartment is supplied by large caruncular stalk or spiral arteries, which release short maternal stem arteries. In the 3rd month of gestation, these arteries branch into several arterioles at their base, thus providing the vascular framework for the lower part of the septal walls of the primary crypts. In the 4th month, due to progressive longitudinal growth of the stem arteries, branching into arterioles occurs not only at the base, but over the whole length of the stem arteries. These arterioles supply the capillary complexes of the septa which resemble the major part of the septal vasculature and face the secondary crypts. Further indentation results in the formation of tertiary crypt capillary complexes, encircling the earlier secondary unit. From the 6th month of gestation the architecture resembles the fully developed maternal placenta with stem arteries running directly to the fetal side to branch into 4 to 6 arterioles, which turn back to enter secondary and tertiary septa. Maternal venules, collecting the blood from the capillary bed of secondary and tertiary septa, converge onto stem veins leaving the caruncle via branches of the uterine vein. The fetal part of the placentome is supplied by the cotyledonary arteries, which branch into fetal stem arteries that are the tributary to single villous trees. Over their whole course towards the maternal side, these give off arterioles entering secondary villi. The tertiary or terminal villous vasculature consists of capillaries, which are organised in serial capillary loops. This system is progressively elaborated in the course of gestation. In the 4th month there are only finger-like loops, whereas from the 6th month large fan-like structures can be observed. In early gestation the maternal and fetal blood vessels meet predominantly in a countercurrent fashion, changing to the less efficient crosscurrent exchange when the tertiary unit develops. These results indicate the development of a highly elaborated fetomaternal villous-crypt exchange system, already established in the 1st half of gestation, thus meeting the increasing needs of the fetus. PMID:11430698
Lee, Richmond; Gryn'ova, Ganna; Ingold, K U; Coote, Michelle L
2016-08-24
High-level ab initio calculations are used to identify the mechanism of secondary (and primary) alkylperoxyl radical termination and explain why their reactions are much faster than their tertiary counterparts. Contrary to existing literature, the decomposition of both tertiary and non-tertiary tetroxides follows the same asymmetric two-step bond cleavage pathway to form a caged intermediate of overall singlet multiplicity comprising triplet oxygen and two alkoxyl radicals. The alpha hydrogen atoms of non-tertiary species facilitate this process by forming unexpected CHO hydrogen bonds to the evolving O2. For non-tertiary peroxyls, subsequent alpha hydrogen atom transfer then yields the experimentally observed non-radical products, ketone, alcohol and O2, whereas for tertiary species, this reaction is precluded and cage escape of the (unpaired) alkoxyl radicals is a likely outcome with important consequences for autoxidation.
Thomas, V; Daly, M K; Cakiner-Egilmez, T; Baker, E
2011-05-01
Given the Veterans Affairs Boston Healthcare System's recent introduction of single-use Tonosafe disposable tonometer prisms as an alternative to Goldmann applanation tonometers (GATs), this study had two aims: to conduct a large-scale quality assurance trial to assess the reliability of intraocular pressure (IOP) measurements of the Tonosafe disposable tonometer compared with GAT, particularly at extremes of pressure; to evaluate the suitability of Tonosafe disposable tonometer prisms as an acceptable substitute for GATs and for clinic-wide implementation in an academic tertiary referral setting. Ophthalmology resident physicians measured the IOPs of patients in general and specialty eye clinics with the Tonosafe disposable tonometer and GAT. Tonosafe test-retest reliability data were also collected. A retrospective review of patient charts and data analysis were performed to determine the reliability of measurements. The IOPs of 652 eyes (326 patients) were measured with both GAT and Tonosafe, with a range of 3-34 mm Hg. Linear regression analysis showed R=0.93, slope=0.91, both of which supported the proposed hypothesis, and the y-intercept=-1.05 was significantly different from the hypothesized value. The Tonosafe test-retest repeatability (40 eyes of 40 patients), r=0.977, was very high, which was further supported by linear regression slope=0.993, y-intercept=0.118, and a Tonosafe repeatability coefficient of 2.06, similar to GAT repeatability. The IOP measurements by Tonosafe disposable prisms correlated closely with Goldmann measurements, with similar repeated measurement variability to GAT. This suggests that the Tonosafe is an acceptable substitute for GAT to measure IOP in ophthalmology clinic settings.
Thomas, V; Daly, M K; Cakiner-Egilmez, T; Baker, E
2011-01-01
Purpose Given the Veterans Affairs Boston Healthcare System's recent introduction of single-use Tonosafe disposable tonometer prisms as an alternative to Goldmann applanation tonometers (GATs), this study had two aims: to conduct a large-scale quality assurance trial to assess the reliability of intraocular pressure (IOP) measurements of the Tonosafe disposable tonometer compared with GAT, particularly at extremes of pressure; to evaluate the suitability of Tonosafe disposable tonometer prisms as an acceptable substitute for GATs and for clinic-wide implementation in an academic tertiary referral setting. Methods Ophthalmology resident physicians measured the IOPs of patients in general and specialty eye clinics with the Tonosafe disposable tonometer and GAT. Tonosafe test–retest reliability data were also collected. A retrospective review of patient charts and data analysis were performed to determine the reliability of measurements. Results The IOPs of 652 eyes (326 patients) were measured with both GAT and Tonosafe, with a range of 3–34 mm Hg. Linear regression analysis showed R=0.93, slope=0.91, both of which supported the proposed hypothesis, and the y-intercept=−1.05 was significantly different from the hypothesized value. The Tonosafe test–retest repeatability (40 eyes of 40 patients), r=0.977, was very high, which was further supported by linear regression slope=0.993, y-intercept=0.118, and a Tonosafe repeatability coefficient of 2.06, similar to GAT repeatability. Conclusions The IOP measurements by Tonosafe disposable prisms correlated closely with Goldmann measurements, with similar repeated measurement variability to GAT. This suggests that the Tonosafe is an acceptable substitute for GAT to measure IOP in ophthalmology clinic settings. PMID:21455241
Incidence, aetiology and resistance of late-onset neonatal sepsis: a five-year prospective study.
Hammoud, Majeda S; Al-Taiar, Abdullah; Thalib, Lukman; Al-Sweih, Noura; Pathan, Seema; Isaacs, David
2012-07-01
Investigate the incidence, etiological pattern and the antimicrobial resistance of late-onset neonatal infections over a period of 5 years. Longitudinal audit of neonatal sepsis from January 2005 to December 2009, in the main maternity hospital in Kuwait. Late-onset neonatal infection was defined as the culture of a single potentially pathogenic organism from blood or cerebrospinal fluid from an infant older than 6 days in association with clinical or laboratory findings consistent with infection. The overall incidence was 16.9 (95% confidence interval: 15.8-18.0) episodes per 1000 live births. The commonest pathogen was coagulase-negative Staphylococcus, 339 (35.7%), while Klebsiella was the most common gram-negative infection, 178 (18.8%). Escherichia coli, Enterococcus and Enterobacter spp were each responsible for 6% of all infections. Candida caused 104 (11.0%) infections. The general pattern of infection remained unchanged over the study period. Case fatality was 11.7% (95% confidence interval: 9.7-13.9%) and was high for Pseudomonas (18.4%) and Candida (22.1%) infections. Approximately 24 and 20% of Klebsiella infections were resistant to cefotaxime and gentamicin, respectively, while 28 and 24% of Escherichia coli infections were resistant to cefotaxime and gentamicin, respectively. The incidence of late-onset infection in Kuwait is high, resembling that in resource-poor countries. The high incidence coupled with low case fatality provides an example for settings where tertiary care is introduced without strict measures against nosocomial infections. Prevention against nosocomial infections in neonatal units has the potential to further reduce neonatal mortality in these settings. © 2012 The Authors. Journal of Paediatrics and Child Health © 2012 Paediatrics and Child Health Division (Royal Australasian College of Physicians).
Molecular Characterisation of nfsA Gene in Nitrofurantoin Resistant Uropathogens
Shanmugam, Dhivyalakshmi; Narayanaswamy, Anbumani
2016-01-01
Introduction Majority of Urinary Tract Infections (UTI’s) are lower UTI’s which constitute the real burden in the primary care setting and are usually treated empirically. Nitrofurantoin is an underused antimicrobial for empiric therapy for community-acquired and nosocomial lower UTIs. Nitrofurantoin has a wide spectrum of action against Escherichia coli, Klebsiella pneumonia and Enterococci, which are the frequent causes of nosocomial lower UTIs and also against multidrug-resistant gram-negative organisms including extended spectrum beta lactamase (ESBL) producers, Amp-C producers and Carbapenamase producers. Aim The study was conducted to describe the resistance pattern of nitrofurantoin and to identify the genes responsible for nitrofurantoin resistance (i.e.) nfsA and the type of mutations involved. Settings and Design This study was conducted in a tertiary care hospital for a period of six months which caters to a total of 1200 beds. Materials and Methods A total of 115 clinical strains of Escherichia coli and Klebsiella pneumoniae including ESBL and Carbapenemase producing isolates were analysed for susceptibility to commonly used antimicrobials. Results ESBL producers 65% and 51% of carbapenems resistant strains were susceptible to nitrofurantoin by minimal inhibitory concentration. MIC to nitrofurantoin was determined by E-strip method. Nitroreductase nfsA gene was detected by PCR in 64 of 70 E.coli isolates with reduced susceptibility to nitrofurantoin. Gene sequencing was done using BLAST algorithm and substitution (N=12) and insertion mutation (N=1) were observed in the resistant strains. Conclusion Nitrofurantoin being an oral antibiotic, its usage in ESBL producers and carbapenamase producers is still warranted. Surprisingly, resistance to nitrofurantoin remains minimal even after extensive use and may be related to the fact that it has multiple mechanisms of action hence may require organisms to develop more than a single mutation to concur resistance. PMID:27504284
Enabling factors for specialist outreach in western KwaZulu-Natal
2018-01-01
Background There exists a major disparity in access to specialist care between patients in urban and rural areas. Specialists are a scarce resource and are concentrated in urban areas. Specialist outreach attempts to fill the gap in service provision for patients situated remotely. While there is international evidence that multifaceted specialist outreach has achieved varying levels of success, factors that influence the effectiveness of outreach have not yet been fully elucidated in South Africa. Aim This study attempts to uncover some of the factors that enable good multifaceted specialist outreach. Setting The study was conducted in hospitals in western KwaZulu-Natal province. This health area is served by a tertiary hospital and 20 peripheral hospitals; three of these are regional level and the majority are district level hospitals. Specialist outreach emanates from the tertiary hospital. Methods Specialists providing outreach services from the tertiary hospital and medical officers at seven receiving hospitals were interviewed to explore perceptions regarding factors that might enable successful specialist outreach. Framework analysis on the transcribed interviews was carried out using NVivo version 11. Results A major positive finding concerns the relationships formed between outreach specialists and doctors at the recipient hospitals. The management of the programme with respect to structure, dependability, data management, transport provision, communication technology and public health systems was also seen as beneficial in specialist outreach. Conclusion Specialist outreach plays an essential role in providing equality in health care. To enable effectiveness, it is important to make full use of the multifaceted nature of this intervention. PMID:29781691
Wang, Huan-Ling; Ghanem, Khalil G; Wang, Peng; Yang, Shuang; Li, Tai-Sheng
2013-03-01
Listeriosis is an emerging infectious disease associated with high mortality. There are few published reports from East Asia and developing countries. Our goal was to describe the clinical characteristics and outcomes of patients diagnosed with Listeria monocytogenes at a tertiary care hospital in Beijing, China. Peking Union Medical College Hospital (PUMCH), an 1800-bed hospital, consists of 2 campuses that house different medical departments. We retrospectively reviewed all culture-proven cases of listeriosis occurring at PUMCH between 1999 and 2011. Point estimates and 95% confidence intervals are presented. There were 38 patients with listeriosis: 5 neonatal, 8 maternal, and 25 nonmaternal. The median age of the adult nonmaternal patients was 47 (range, 18-79) years with a female predominance (72%). Forty percent (n = 10) had an underlying rheumatic disease. Forty-four percent of cases (n = 11) were healthcare-associated infections occurring a median of 20 (range, 3-44) days after hospital admission. Only 2 of the 11 healthcare-associated cases clustered in space and time. One healthcare-associated case occurred in a patient receiving KHI-272 therapy, an oral, irreversible dual EGFR/HER2 inhibitor. The neonatal and maternal listeriosis cases were similar to those reported in the literature. Nonclustered healthcare-associated cases of L. monocytogenes occurred at a large tertiary care hospital in Beijing, China. The source of these infections is unclear. Although rare, in the setting of immunosuppression, Listeria should be considered in the differential diagnosis of healthcare-associated infections, even in the absence of a point-source outbreak.
Alavinia, Seyed Mohammad; Omidvar, Maryam; Farahani, Farnoosh; Bayley, Mark; Zee, Joana; Craven, Beverley Catharine
2017-11-01
To reduce the incidence of Urinary Tract Infection (UTI) in subacute SCI individuals admitted for tertiary inpatient rehabilitation. A quality improvement team was assembled to improve UTI prevention/diagnosis. To plan data collection, UTI-related factors were mapped in an Ishikawa (fishbone) driver diagram. Data including patient demographics, presence and frequency of signs and/or symptoms of UTI and antibiotic initiation from August to December 2015 were recorded. Sensitivity, Specificity, Positive and Negative Predictive Values (PPV, NPV), and Likelihood Ratios (LR) were calculated for each sign and symptom. Tertiary SCI Rehabilitation Results: Among 55 inpatients with subacute SCI who had signs/symptoms prompting urine culture and sensitivity (C&S), 32 (58.18%) were diagnosed with a UTI. The most frequent symptoms were foul smelling urine (41%), change in urine color (31%), and incontinence (25%), and the most common sign was fever (34%). Most UTIs (81%) occurred among individuals using Clean Intermittent Catheterization (CIC), with 46% of catheterizations performed by nurses. Foul smelling urine had the highest sensitivity (0.50, 95% CI: 0.31-0.69), and new incontinence had the highest specificity (0.88, 95% CI: 0.69-0.97) for UTI diagnosis. The highest PPV belonged to the cloudy urine (0.71, 95% CI: 0.42-0.92). The combination of cloudy and foul smelling urine increased the PPV to 78% (95% CI: (0.40-0.97). The concurrent presence of cloudy and foul smelling urine is predicted of UTI diagnosis inpatients tertiary setting. SCI inpatients are susceptible to UTI when learning CIC technique from nurses.
Methotrexate Hypersensitivity Reactions in Pediatrics: Evaluation and Management
Dilley, Meredith A.; Lee, Joyce P.; Broyles, Ana Dioun
2017-01-01
Reports of hypersensitivity reactions (HSRs) to MTX are limited to single case studies. We retrospectively reviewed HSRs to MTX during a 12-year period in our tertiary care pediatric center. Seven patients were evaluated for HSRs to MTX. Skin testing was positive in one of the 4 patients tested. One patient underwent successful graded challenge to MTX. Seventeen desensitizations to MTX were successfully performed in the other 6 patients. Skin testing, graded challenge, and desensitization were safe and effective procedures in the evaluation and management of patients with HSRs to MTX in our pediatric population. PMID:27786403
Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J
2017-11-01
Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1.92-8.79, P <0.001) in males and 1.73 (95% CI 0.80-3.76, P =0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.
Unilateral vocal fold immobility: a tertiary hospital's experience over 5 years.
Prasad, Vyas M N; Fakhoury, Raja; Helou, Diane; Lawson, Georges; Remacle, Marc
2017-07-01
The objective of the study was to determine the etiology and subsequent management of patients with unilateral vocal fold immobility (UVFI) and compare our results with other such studies. This was a retrospective case series of all patients that were treated for UVFI at one single tertiary referral centre between 2010 and 2014. The medical records of 161 patients over a 5-year period diagnosed with UVFI were analyzed. We looked at the patient demographics, side of immobility, etiology, management and voice assessment. A total of 21 patients were excluded due to varying reasons including second presentation and incomplete data. Our results demonstrated 37.1% of cases to be due to non-thyroid surgery (mainly vascular or anterior cervical spine surgery) compared to thyroid or parathyroid (18.6%). Carotid endarterectomy was the commonest cause followed by cervical spine discectomy or fusion. Other iatrogenic causes included thoracic surgery either involving the lung or not. Our results are very much in keeping with those seen by our colleagues in North America. A better appreciation of the causes of UVFI especially in cases not performed by otolaryngologists and head and neck surgeons should be highlighted and the necessary steps should be taken to prevent this iatrogenic complication.
[Streptococcal toxic shock syndrome: ten years' experience at a tertiary hospital].
Vallalta-Morales, Manuel; Salavert-Lletí, Miguel; Artero-Mora, Arturo; Mahiques-Santos, Laura; Solaz-Moreno, Elena; Pérez-Bellés, Carmen
2005-11-01
In the last two decades there has been a reported increase in the incidence of streptococcal toxic shock syndrome (STSS). The objective of this study was to determine the clinical and epidemiological characteristics of this infection. Retrospective study of all cases of STSS diagnosed at a single tertiary hospital over the last ten years. We report 13 cases of STSS (8 men, mean age 62 years). The mean annual incidence was 0.19 episodes/100,000 population from 1994 to 1998 and 0.53 episodes/100,000 population from 1999 to 2003 (p = 0.059). All patients had at least one underlying disease and there were no intravenous drug users. The most common portals of entry were the skin and soft tissues (85%) and all but one patient had a positive blood culture. Two cases were nosocomial and five patients required surgery (amputation and/or debridement). There was a high mortality rate (85%) and a rapid course from onset to death; nine patients died within four days after establishing the diagnosis. The incidence of SSTS has increased over the last five years at our hospital. Elderly patients with underlying medical conditions were more susceptible to acquiring this infection. Early mortality was very high.
One hospital, one appendectomy: The cost effectiveness of a standardized doctor's preference card.
Skarda, David E; Rollins, Michael; Andrews, Seth; McFadden, Molly; Barnhart, Doug; Meyers, Rebecka; Scaife, Eric
2015-06-01
Appendicitis in children provides a unique opportunity to explore changes that reduce variation, reduce cost, and improve value. In this study we sought to evaluate the effectiveness of standardization of surgical technique and intraoperative disposable device utilization for laparoscopic appendectomy among all surgeons at a tertiary children's hospital. All 6 surgeons at our tertiary children's hospital agreed to standardize to a single technique of performing a laparoscopic appendectomy. We collected data on all pediatric patients who had a laparoscopic appendectomy following implementation of the uniform doctor's preference card (DPC) (March 1, 2013 to February 28, 2014) and compared them to a historical control group. Implementation of the uniform DPC decreased the device cost per appendectomy from $844.11 to $305.32. Operative times (skin incision to skin closure) were 34.8 minutes prior to the uniform DPC and 37.0 minutes using the uniform DPC. There were no significant differences in postappendectomy outcomes. We have demonstrated that implementation of a uniform DPC and technical standardization for laparoscopic appendectomy can significantly reduce cost. Furthermore, this can occur without dramatically increasing operative times, length of stay, or postoperative complications. Copyright © 2015 Elsevier Inc. All rights reserved.
Disruptive innovation in academic medical centers: balancing accountable and academic care.
Stein, Daniel; Chen, Christopher; Ackerly, D Clay
2015-05-01
Numerous academic medicine leaders have argued that academic referral centers must prepare for the growing importance of accountability-driven payment models by adopting population health initiatives. Although this shift has merit, execution of this strategy will prove significantly more problematic than most observers have appreciated. The authors describe how successful implementation of an accountable care health strategy within a referral academic medical center (AMC) requires navigating a critical tension: The academic referral business model, driven by tertiary-level care, is fundamentally in conflict with population health. Referral AMCs that create successful value-driven population health systems within their organizations will in effect disrupt their own existing tertiary care businesses. The theory of disruptive innovation suggests that balancing the push and pull of academic and accountable care within a single organization is achievable. However, it will require significant shifts in resource allocation and changes in management structure to enable AMCs to make the inherent difficult choices and trade-offs that will ensue. On the basis of the theories of disruptive innovation, the authors present recommendations for how academic health systems can successfully navigate these issues as they transition toward accountability-driven care.
Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt.
Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; El-Mahallawy, Hadir Ahmed; Amin, Magdy Aly; El Din Ashour, Seif
2015-03-12
Pseudomonas aeruginosa is an important nosocomial pathogen, commonly causing infections in immunocompromised patients. The aim of this study was to examine the genetic relatedness of metallo-beta-lactamase (MBL) producing carbapenem resistant Pseudomonas aeruginosa clinical isolates collected from 2 tertiary hospitals in Cairo, Egypt using Multi Locus sequence typing (MLST). Phenotypic and genotypic detection of metallo-beta-lactamase for forty eight non-duplicate carbapenem resistant P. aeruginosa isolates were carried out. DNA sequencing and MLST were done. The bla VIM-2 gene was highly prevalent (28/33 strains, 85%) among 33 MBL-positive P.aeruginosa isolates. MLST revealed eleven distinct Sequence Types (STs). A unique ST233 clone producing VIM-2 was documented by MLST in P.aeruginosa strains isolated from Cairo university hospitals. The high prevalence of VIM-2 producers was not due to the spread of a single clone. The findings of the present study clearly demonstrate that clones of VIM-2 positive in our hospitals are different from those reported from European studies. Prevalence of VIM-2 producers of the same clone was detected from surgical specimens whereas oncology related specimens were showing diverse clones.
Experience of Oesophageal atresia management in a tertiary Bangladeshi hospital.
Islam, Md Kabirul
2018-01-16
Background and aim: This study has been conducted to determine the clinical presentations and surgical outcome of patients with OA admitted in a tertiary level hospital in Bangladesh. A prospective analysis was conducted for 32 patients with confirmed OA between July 2007 and June 2015. Of them surgical correction was done in 25 cases. The other 7, in whom surgery could not be done, were excluded from the study. Of the 25 cases, that had been operated, 15 were full term and 52% were more than 48 hours old. Type-C OA with TOF was the commonest type (96%). 24 cases were operated through Right Thoracotomy. Of them 52% were done by Single Lung (left) ventilation. 'Division of the fistula' with 'end to end anastomosis' was done in all of them. Only 1 patient had a Gastric pull up surgery. Of the 25 cases, 16 survived (64%). In follow up all the patients were found thriving and showed no problem in swallowing. Our study which shows 64% survival is a great achievement for us but not satisfactory in international standard. However, the experience and encouragement that we are gathering, will guide us to achieve better result in near future.
Miocene honey bees from the Randeck Maar of southwestern Germany (Hymenoptera, Apidae)
Kotthoff, Ulrich; Wappler, Torsten; Engel, Michael S.
2011-01-01
Abstract The Miocene Randeck Maar (southwestern Germany) is one of the only sites with abundant material of fossil honey bees. The fauna has been the focus of much scrutiny by early authors who recognized multiple species or subspecies within the fauna. The history of work on the Randeck Maar is briefly reviewed and these fossils placed into context with other Tertiary and living species of the genus Apis Linnaeus (Apinae: Apini). Previously unrecorded specimens from Randeck Maar were compared with earlier series in an attempt to evaluate the observed variation. A morphometric analysis of forewing venation angles across representative Recent and Tertiary species of Apis as well as various non-Apini controls was undertaken to evaluate the distribution of variation in fossil honey bees. The resulting dendrogram shows considerable variation concerning the wing venation of Miocene Apini, but intergradation of other morphological characters reveals no clear pattern of separate species. This suggests that a single, highly variable species was present in Europe during the Miocene. The pattern also supports the notion that the multiple species and subspecies proposed by earlier authors for the Randeck Maar honey bee fauna are not valid, and all are accordingly recognized as Apis armbrusteri Zeuner. PMID:21594072
Intermittent Demand Forecasting in a Tertiary Pediatric Intensive Care Unit.
Cheng, Chen-Yang; Chiang, Kuo-Liang; Chen, Meng-Yin
2016-10-01
Forecasts of the demand for medical supplies both directly and indirectly affect the operating costs and the quality of the care provided by health care institutions. Specifically, overestimating demand induces an inventory surplus, whereas underestimating demand possibly compromises patient safety. Uncertainty in forecasting the consumption of medical supplies generates intermittent demand events. The intermittent demand patterns for medical supplies are generally classified as lumpy, erratic, smooth, and slow-moving demand. This study was conducted with the purpose of advancing a tertiary pediatric intensive care unit's efforts to achieve a high level of accuracy in its forecasting of the demand for medical supplies. On this point, several demand forecasting methods were compared in terms of the forecast accuracy of each. The results confirm that applying Croston's method combined with a single exponential smoothing method yields the most accurate results for forecasting lumpy, erratic, and slow-moving demand, whereas the Simple Moving Average (SMA) method is the most suitable for forecasting smooth demand. In addition, when the classification of demand consumption patterns were combined with the demand forecasting models, the forecasting errors were minimized, indicating that this classification framework can play a role in improving patient safety and reducing inventory management costs in health care institutions.
Mixed La-Li heterobimetallic complexes for tertiary nitroaldol resolution.
Tosaki, Shin-ya; Hara, Keiichi; Gnanadesikan, Vijay; Morimoto, Hiroyuki; Harada, Shinji; Sugita, Mari; Yamagiwa, Noriyuki; Matsunaga, Shigeki; Shibasaki, Masakatsu
2006-09-13
A kinetic resolution of tertiary nitroaldols derived from simple ketones is described. Mixed BINOL/biphenol La-Li heterobimetallic complexes gave the best selectivity in retro-nitroaldol reactions of racemic tertiary nitroaldols. By using a mixture of La-Li3-(1a)3 complex (LLB 2a) and La-Li3-(1b)3 (LLB* 2b) complex in a ratio of 2/1, chiral tertiary nitroaldols were obtained in 80-97% ee and 30-47% recovery yield.
2015-01-01
Chloramination of drinking waters has been associated with N-nitrosodimethylamine (NDMA) formation as a disinfection byproduct. NDMA is classified as a probable carcinogen and thus its formation during chloramination has recently become the focus of considerable research interest. In this study, the formation mechanisms of NDMA from ranitidine and trimethylamine (TMA), as models of tertiary amines, during chloramination were investigated by using density functional theory (DFT). A new four-step formation pathway of NDMA was proposed involving nucleophilic substitution by chloramine, oxidation, and dehydration followed by nitrosation. The results suggested that nitrosation reaction is the rate-limiting step and determines the NDMA yield for tertiary amines. When 45 other tertiary amines were examined, the proposed mechanism was found to be more applicable to aromatic tertiary amines, and there may be still some additional factors or pathways that need to be considered for aliphatic tertiary amines. The heterolytic ONN(Me)2–R+ bond dissociation energy to release NDMA and carbocation R+ was found to be a criterion for evaluating the reactivity of aromatic tertiary amines. A structure–activity study indicates that tertiary amines with benzyl, aromatic heterocyclic ring, and diene-substituted methenyl adjacent to the DMA moiety are potentially significant NDMA precursors. The findings of this study are helpful for understanding NDMA formation mechanism and predicting NDMA yield of a precursor. PMID:24968236
Liu, Yong Dong; Selbes, Meric; Zeng, Chengchu; Zhong, Rugang; Karanfil, Tanju
2014-01-01
Chloramination of drinking waters has been associated with N-nitrosodimethylamine (NDMA) formation as a disinfection byproduct. NDMA is classified as a probable carcinogen and thus its formation during chloramination has recently become the focus of considerable research interest. In this study, the formation mechanisms of NDMA from ranitidine and trimethylamine (TMA), as models of tertiary amines, during chloramination were investigated by using density functional theory (DFT). A new four-step formation pathway of NDMA was proposed involving nucleophilic substitution by chloramine, oxidation, and dehydration followed by nitrosation. The results suggested that nitrosation reaction is the rate-limiting step and determines the NDMA yield for tertiary amines. When 45 other tertiary amines were examined, the proposed mechanism was found to be more applicable to aromatic tertiary amines, and there may be still some additional factors or pathways that need to be considered for aliphatic tertiary amines. The heterolytic ONN(Me)2-R(+) bond dissociation energy to release NDMA and carbocation R(+) was found to be a criterion for evaluating the reactivity of aromatic tertiary amines. A structure-activity study indicates that tertiary amines with benzyl, aromatic heterocyclic ring, and diene-substituted methenyl adjacent to the DMA moiety are potentially significant NDMA precursors. The findings of this study are helpful for understanding NDMA formation mechanism and predicting NDMA yield of a precursor.
NASA Astrophysics Data System (ADS)
Lemaître, Gérard R.; Montiel, Pierre; Joulié, Patrice; Dohlen, Kjetil; Lanzoni, Patrick
2005-12-01
Wide-field astronomy requires the development of larger aperture telescopes. The optical properties of a three-mirror modified-Rumsey design provide significant advantages when compared to other telescope designs: (i) at any wavelength, the design has a flat field and is anastigmatic; (ii) the system is extremely compact, i.e., it is almost four times shorter than a Schmidt. Compared to the equally compact flat-field Ritchey-Chrétien with a doublet-lens corrector, as developed for the Sloan digital sky survey - and which requires the polishing of six optical surfaces - the proposed modified-Rumsey design requires only a two-surface polishing and provides a better imaging quality. All the mirrors are spheroids of the hyperboloid type. Starting from the classical Rumsey design, it is shown that the use of all eight available free parameters allows the simultaneous aspherization of the primary and tertiary mirrors by active optics methods from a single deformable substrate. The continuity conditions between the primary and the tertiary hyperbolizations are achieved by an intermediate narrow ring of constant thickness that is not optically used. After the polishing of a double vase form in a spherical shape, the primary-tertiary hyperbolizations are achieved by in situ stressing. The tulip-form secondary is hyperbolized by stress polishing. Other active optics alternatives are possible for a space telescope. The modified-Rumsey design is of interest for developing large space- and ground-based survey telescopes in UV, visible, or IR ranges, such as currently demonstrated with the construction of identical telescopes MINITRUST-1 and -2, f/5 - 2° field of view. Double-pass optical tests show diffraction-limited images.
Andrews, Tulsa; Cole, Clare
2015-04-01
To share the experience of implementing and refining the use of e-portfolios into an undergraduate nursing degree. This is a reflective piece that explores the hurdles experienced in introducing and maintaining e-portfolio's into higher education, particularly in undergraduate nursing curricula. Nil Review of the literature, and comparing and contrasting this against the experience of the authors. Hurdles included access to computer and quality internet connections, along with the levels of IT literacy of staff, and the common misconception that all students are IT savvy. What was also evident was how the need for both pedagogical and technical support to both staff and students was paramount in achieving an understanding of the software, and the scope and perspective of e-portfolio pedagogy. With each of these hurdles, staff reluctance to engage in e-portfolio use in the tertiary sector was evident. On reflection of each of these challenges, the authors identified that their experience mirrored other tertiary institutions in that a single hurdle alone is not responsible for fragmented e-portfolio implementation, but a combination of factors. Through exploring recommendations from other tertiary institutions, the authors recognize the limitations within their own working environment that contributed to the pitfalls experienced. Despite e-portfolios being introduced into higher education for over a decade, its successful implementation into undergraduate nursing curricula continues to be fraught with pitfalls, creating the sense of moving backwards more so than forwards. As with any new learning tool, careful consideration needs to be given to comprehensive planning, implementation, review and evaluation to either prevent the hurdles identified, or limit their impact on the quality of the portfolio produced and the learning attained from the process. Copyright © 2015 Elsevier Ltd. All rights reserved.
Geology and assessment of undiscovered oil and gas resources of the Yukon Flats Basin Province, 2008
Bird, Kenneth J.; Stanley, Richard G.; Moore, Thomas E.; Gautier, Donald L.
2017-12-22
The hydrocarbon potential of the Yukon Flats Basin Province in Central Alaska was assessed in 2004 as part of an update to the National Oil and Gas Assessment. Three assessment units (AUs) were identified and assessed using a methodology somewhat different than that of the 2008 Circum-Arctic Resource Appraisal (CARA). An important difference in the methodology of the two assessments is that the 2004 assessment specified a minimum accumulation size of 0.5 million barrels of oil equivalent (MMBOE), whereas the 2008 CARA assessment specified a minimum size of 50 MMBOE. The 2004 assessment concluded that >95 percent of the estimated mean undiscovered oil and gas resources occur in a single AU, the Tertiary Sandstone AU. This is also the only AU of the three that extends north of the Arctic Circle.For the CARA project, the number of oil and gas accumulations in the 2004 assessment of the Tertiary Sandstone AU was re-evaluated in terms of the >50-MMBOE minimum accumulation size. By this analysis, and assuming the resource to be evenly distributed across the AU, 0.23 oil fields and 1.20 gas fields larger than 50 MMBOE are expected in the part of the AU north of the Arctic Circle. The geology suggests, however, that the area north of the Arctic Circle has a lower potential for oil and gas accumulations than the area to the south where the sedimentary section is thicker, larger volumes of hydrocarbons may have been generated, and potential structural traps are probably more abundant. Because of the low potential implied for the area of the AU north of the Arctic Circle, the Yukon Flats Tertiary Sandstone AU was not quantitatively assessed for the 2008 CARA.
Craig, D G; Zafar, S; Reid, T W D J; Martin, K G; Davidson, J S; Hayes, P C; Simpson, K J
2012-06-01
The sequential organ failure assessment (SOFA) score is an effective triage marker following single time point paracetamol (acetaminophen) overdose, but has not been evaluated following staggered (multiple supratherapeutic doses over >8 h, resulting in cumulative dose of >4 g/day) overdoses. To evaluate the prognostic accuracy of the SOFA score following staggered paracetamol overdose. Time-course analysis of 50 staggered paracetamol overdoses admitted to a tertiary liver centre. Individual timed laboratory samples were correlated with corresponding clinical parameters and the daily SOFA scores were calculated. A total of 39/50 (78%) patients developed hepatic encephalopathy. The area under the SOFA receiver operator characteristic for death/liver transplantation was 87.4 (95% CI 73.2-95.7), 94.3 (95% CI 82.5-99.1), and 98.4 (95% CI 84.3-100.0) at 0, 24 and 48 h, respectively, postadmission. A SOFA score of <6 at tertiary care admission predicted survival with a sensitivity of 100.0% (95% CI 76.8-100.0) and specificity of 58.3% (95% CI 40.8-74.5), compared with 85.7% (95% CI 60.6-97.4) and 75.0% (95% CI 65.2-79.5) , respectively, for the modified Kings College criteria. Only 2/21 patients with an admission SOFA score <6 required renal replacement therapy or intracerebral pressure monitoring. SOFA significantly outperformed the Model for End-stage Liver Disease, but not APACHE II, at 0, 24-and 48-h following admission. A SOFA score <6 at tertiary care admission following a staggered paracetamol overdose, is associated with a good prognosis. Both the SOFA and APACHE II scores could improve triage of high-risk staggered paracetamol overdose patients. © 2012 Blackwell Publishing Ltd.
Lead-isotopic data from sulfide minerals from the Cascade Range, Oregon and Washington
Church, S.E.; LeHuray, A.P.; Grant, A.R.; Delevaux, M.H.; Gray, J.E.
1986-01-01
Lead-isotopic studies of mineral deposits associated with Tertiary plutons found in the Cascade Range of Oregon and Washington demonstrate a rather uniform isotopic composition in various sulfide minerals ( 206Pb 204Pb = 18.84 to 19.05; 207Pb 204Pb = 15.57 to 15.62; 208Pb 204Pb = 38.49 to 38.74), show less variation than data from the volcanic rocks of the Cascade Range and fall within the mixing array defined by the MORB regression line and continental sediments. An evaluation of the role of crustal assimilation by hydrothermal convection during emplacement was made on five sulfide deposits associated with a single composite batholith, the Cloudy Pass pluton. The Pb-isotopic data and mass balance calculations suggest that only minor amounts of the lead were derived from the overlying Precambrian (?) Swakane Biotite Gneiss during emplacement. The bulk of the metal that occurs in sulfide deposits in the Cascade mineral belt appears to have been derived from subducted continental detritus. The variation of the Pb-isotopic signature of Sulfides from specific districts or deposits suggests that there is a correlation with age and structure of the crust. 206Pb 204Pb is greater than 18.92 in northern Washington and southern Oregon where deposits have intruded Mesozoic or older crust. However, the ore deposits between the northern Oregon border and central Oregon, south of Eugene, have intruded younger crust composed largely of mafic and andesitic volcanic rocks and 206Pb 204Pb lies between 18.84 and 18.92. This region, previously called the Columbia embayment, appears to be underlain by Tertiary volcanic rocks. Lead-isotopic data may be used to define the boundaries between discontinuous blocks of Mesozoic crust and Tertiary volcanic cover. ?? 1986.
Chughtai, Abrar Ahmad; MacIntyre, C Raina; Ashraf, Muhammad Orooj; Zheng, Yang; Yang, Peng; Wang, Quanyi; Dung, Tham Chi; Hien, Nguyen Tran; Seale, Holly
2015-10-01
A cross-sectional survey was conducted in 89 secondary- and tertiary-level hospitals in 3 countries, and samples of masks and respirators were also collected and examined. Results showed varied practices around the use of masks and respirators, which are probably influenced by the available resources and local recommendations. Nonstandardized practices are common in low-resource settings, which may be placing health care workers at risk. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Testbeds for Assessing Critical Scenarios in Power Control Systems
NASA Astrophysics Data System (ADS)
Dondossola, Giovanna; Deconinck, Geert; Garrone, Fabrizio; Beitollahi, Hakem
The paper presents a set of control system scenarios implemented in two testbeds developed in the context of the European Project CRUTIAL - CRitical UTility InfrastructurAL Resilience. The selected scenarios refer to power control systems encompassing information and communication security of SCADA systems for grid teleoperation, impact of attacks on inter-operator communications in power emergency conditions, impact of intentional faults on the secondary and tertiary control in power grids with distributed generators. Two testbeds have been developed for assessing the effect of the attacks and prototyping resilient architectures.
Quantitative analysis of single- vs. multiple-set programs in resistance training.
Wolfe, Brian L; LeMura, Linda M; Cole, Phillip J
2004-02-01
The purpose of this study was to examine the existing research on single-set vs. multiple-set resistance training programs. Using the meta-analytic approach, we included studies that met the following criteria in our analysis: (a) at least 6 subjects per group; (b) subject groups consisting of single-set vs. multiple-set resistance training programs; (c) pretest and posttest strength measures; (d) training programs of 6 weeks or more; (e) apparently "healthy" individuals free from orthopedic limitations; and (f) published studies in English-language journals only. Sixteen studies generated 103 effect sizes (ESs) based on a total of 621 subjects, ranging in age from 15-71 years. Across all designs, intervention strategies, and categories, the pretest to posttest ES in muscular strength was (chi = 1.4 +/- 1.4; 95% confidence interval, 0.41-3.8; p < 0.001). The results of 2 x 2 analysis of variance revealed simple main effects for age, training status (trained vs. untrained), and research design (p < 0.001). No significant main effects were found for sex, program duration, and set end point. Significant interactions were found for training status and program duration (6-16 weeks vs. 17-40 weeks) and number of sets performed (single vs. multiple). The data indicated that trained individuals performing multiple sets generated significantly greater increases in strength (p < 0.001). For programs with an extended duration, multiple sets were superior to single sets (p < 0.05). This quantitative review indicates that single-set programs for an initial short training period in untrained individuals result in similar strength gains as multiple-set programs. However, as progression occurs and higher gains are desired, multiple-set programs are more effective.
NASA Astrophysics Data System (ADS)
Maity, Hiranmay; Reddy, Govardhan
2018-04-01
Small single-domain globular proteins, which are believed to be dominantly two-state folders, played an important role in elucidating various aspects of the protein folding mechanism. However, recent single molecule fluorescence resonance energy transfer experiments [H. Y. Aviram et al. J. Chem. Phys. 148, 123303 (2018)] on a single-domain two-state folding protein L showed evidence for the population of an intermediate state and it was suggested that in this state, a β-hairpin present near the C-terminal of the native protein state is unfolded. We performed molecular dynamics simulations using a coarse-grained self-organized-polymer model with side chains to study the folding pathways of protein L. In agreement with the experiments, an intermediate is populated in the simulation folding pathways where the C-terminal β-hairpin detaches from the rest of the protein structure. The lifetime of this intermediate structure increased with the decrease in temperature. In low temperature conditions, we also observed a second intermediate state, which is globular with a significant fraction of the native-like tertiary contacts satisfying the features of a dry molten globule.
Protein single-model quality assessment by feature-based probability density functions.
Cao, Renzhi; Cheng, Jianlin
2016-04-04
Protein quality assessment (QA) has played an important role in protein structure prediction. We developed a novel single-model quality assessment method-Qprob. Qprob calculates the absolute error for each protein feature value against the true quality scores (i.e. GDT-TS scores) of protein structural models, and uses them to estimate its probability density distribution for quality assessment. Qprob has been blindly tested on the 11th Critical Assessment of Techniques for Protein Structure Prediction (CASP11) as MULTICOM-NOVEL server. The official CASP result shows that Qprob ranks as one of the top single-model QA methods. In addition, Qprob makes contributions to our protein tertiary structure predictor MULTICOM, which is officially ranked 3rd out of 143 predictors. The good performance shows that Qprob is good at assessing the quality of models of hard targets. These results demonstrate that this new probability density distribution based method is effective for protein single-model quality assessment and is useful for protein structure prediction. The webserver of Qprob is available at: http://calla.rnet.missouri.edu/qprob/. The software is now freely available in the web server of Qprob.
Tertiary Education and Training in Australia, 2010
ERIC Educational Resources Information Center
National Centre for Vocational Education Research (NCVER), 2012
2012-01-01
This publication presents information on tertiary education and training during 2010, including statistics on participation and outcomes. The definition of tertiary education and training adopted for this publication is formal study in vocational education and training (VET) and higher education, including enrolments in Australian Qualifications…
Rotational spectra of tetracyclic quinolizidine alkaloids: does a water molecule flip sparteine?
Lesarri, Alberto; Pinacho, Ruth; Enríquez, Lourdes; Rubio, José E; Jaraíz, Martín; Abad, José L; Gigosos, Marco A
2017-07-21
Sparteine is a quinolizidine alkaloid used as a chiral auxiliary in asymmetric synthesis. We examine whether hydration by a single molecule can flip sparteine from the most stable trans conformation to the bidentate cis arrangement observed in catalytic complexation to a metal center. Sparteine and the sparteine-water dimer were generated in a supersonic jet expansion with H 2 16 O and H 2 18 O, and characterized by broadband chirped-pulse microwave spectroscopy. Even though the bidentate water dimer was predicted with larger binding energy, a single isomer was observed for the monohydrated cluster, with sparteine retaining the trans conformation observed for the free molecule. The absence of the bidentate dimer is attributed to the kinetic control of cluster formation, favoring the pre-expansion most abundant monomer. The structural properties of the O-HN hydrogen bond in the dimer are compared with those of complexes of other secondary and tertiary amines.
Protein Detection via Direct Enzymatic Amplification of Short DNA Aptamers
Fischer, Nicholas O.; Tarasow, Theodore M.; Tok, Jeffrey B.-H.
2008-01-01
Aptamers are single-stranded nucleic acids that fold into defined tertiary structures to bind target molecules with high specificities and affinities. DNA aptamers have garnered much interest as recognition elements for biodetection and diagnostic applications due to their small size, ease of discovery and synthesis, and chemical and thermal stability. Herein, we describe the design and application of a short DNA molecule capable of both protein target binding and amplifiable bioreadout processes. As both recognition and readout capabilities are incorporated into a single DNA molecule, tedious conjugation procedures required for protein-DNA hybrids can be omitted. The DNA aptamer is designed to be amplified directly by either the polymerase chain reaction (PCR) or rolling circle amplification (RCA) processes, taking advantage of real-time amplification monitoring techniques for target detection. A combination of both RCA and PCR provides a wide protein target dynamic range (1 μM to 10 pM). PMID:17980857
Identification of the duodenal papilla by colon capsule endoscope.
Karagiannis, S; Dücker, C; Dautel, P; Strubenhoff, J; Faiss, S
2010-07-01
The sensitivity of small-bowel capsule endoscopy in visualizing a single finding present in everyone, the duodenal papilla, is limited. In this retrospective case series study we evaluated whether the duodenal papilla can be better visualized by a capsule endoscope equipped with cameras on both ends. The recordings of 45 colonic capsule endoscopies (PillCam Colon) performed in a single tertiary center were re-evaluated seeking for the duodenal papilla. The two-hour sleeping period of the colon capsule endoscopy system led to the imaging of duodenum in 10 / 45 patients. The duodenal papilla was identified in 6 / 10 (60 %) patients while the number of frames where the papilla was clearly visualized ranged from 2 - 9. Consequently, a small-bowel capsule endoscope containing two cameras could better identify the duodenal papilla and theoretically other obscure areas of the small bowel, expanding its diagnostic accuracy.
Twelve- to 14-Month-Old Infants Can Predict Single-Event Probability with Large Set Sizes
ERIC Educational Resources Information Center
Denison, Stephanie; Xu, Fei
2010-01-01
Previous research has revealed that infants can reason correctly about single-event probabilities with small but not large set sizes (Bonatti, 2008; Teglas "et al.", 2007). The current study asks whether infants can make predictions regarding single-event probability with large set sizes using a novel procedure. Infants completed two trials: A…
Calibration results using highly aberrated images for aligning the JWST instruments to the telescope
NASA Astrophysics Data System (ADS)
Smith, Koby Z.; Acton, D. Scott; Gallagher, Ben B.; Knight, J. Scott; Dean, Bruce H.; Jurling, Alden S.; Zielinski, Thomas P.
2016-07-01
The James Webb Space Telescope (JWST) project is an international collaboration led by NASA's Goddard Space Flight Center (GSFC) in Greenbelt, MD. JWST is NASA's flagship observatory that will operate nearly a million miles away from Earth at the L2 Lagrange point. JWST's optical design is a three-mirror anastigmat with four main optical components; 1) the eighteen Primary Mirror Segment Assemblies (PMSA), 2) a single Secondary Mirror Assembly (SMA), 3) an Aft-Optics Subsystem (AOS) consisting of a Tertiary Mirror and Fine Steering Mirror, and 4) an Integrated Science Instrument Module consisting of the various instruments for JWST. JWST's optical system has been designed to accommodate a significant amount of alignment capability and risk with the PMSAs and SMA having rigid body motion available on-orbit just for alignment purposes. However, the Aft-Optics Subsystem (AOS) and Integrated Science Instrument Module (ISIM) are essentially fixed optical subsystems within JWST, and therefore the cryogenic alignment of the AOS to the ISIM is critical to the optical performance and mission success of JWST. In support of this cryogenic alignment of the AOS to ISIM, an array of fiber optic sources, known as the AOS Source Plate Assembly (ASPA), are placed near the intermediate image location of JWST (between the secondary and tertiary mirrors) during thermal vacuum ground-test operations. The AOS produces images of the ASPA fiber optic sources at the JWST focal surface location, where they are captured by the various science instruments. In this manner, the AOS provides an optical yardstick by which the instruments within ISIM can evaluate their relative positions to and the alignment of the AOS to ISIM can be quantified. However, since the ASPA is located at the intermediate image location of the JWST three-mirror anastigmat design, the images of these fiber optic sources produced by the AOS are highly aberrated with approximately 2-3μm RMS wavefront error consisting mostly of 3rd-order astigmatism and coma. This is because the elliptical tertiary mirror of the AOS is used off of its ideal foci locations without the compensating wavefront effects of the JWST primary and secondary mirrors. Therefore, the PSFs created are highly asymmetric with relatively complex structure and the centroid and encircled energy analyses traditionally used to locate images are not sufficient for ensuring the AOS to ISIM alignment. A novel approach combining phase retrieval and spatial metrology was developed to both locate the images with respect to the AOS and provide calibration information for eventual AOS to ISIM alignment verification. During final JWST OTE and ISIM (OTIS) testing, only a single thru-focus image will be collected by the instruments. Therefore, tools and processes were developed to perform single-image phase retrieval on these highly aberrated images such that any single image of the ASPA source can provide calibrated knowledge of the instruments' position relative to the AOS. This paper discusses the results of the methodology, hardware, and calibration performed to ensure that the AOS and ISIM are aligned within their respective tolerances at JWST OTIS testing.
Diversification of Tertiary Education in Switzerland.
ERIC Educational Resources Information Center
Crausaz, Roselyne
The structure of Switzerland's educational system is described including the types of secondary schools and/or courses and the system of tertiary education. Fields of study, types of institutions, and characteristics of tertiary education in Switzerland are discussed. The chapter on students covers admission procedures, trends in enrollment,…
Towards the 21st Century. Facilities for Tertiary Education.
ERIC Educational Resources Information Center
Corbett, Anne, Ed.
This report presents observations of experts in planning, design, construction or management of tertiary educational facilities about the emerging issues and the appropriate planning and architectural solutions for higher education facilities as the new millennium approaches. Specific topics discuss the current context of tertiary education…
Lawrence, Christopher; Romagnuolo, Joseph; Payne, K Mark; Hawes, Robert H; Cotton, Peter B
2010-09-01
Benign biliary strictures are typically managed endoscopically whereby an increasing size or number of plastic stents is placed at ERCP. Stents are often changed every 3 to 4 months based on the known median patency of a single biliary stent, but patency data for multiple biliary stents are lacking. To assess the incidence of occlusion-free survival of multiple plastic biliary stents and the rate of premature occlusion if left in longer than 6 months. Retrospective. Tertiary-care medical center (Charleston, SC). Consecutive patients who received multiple plastic stents for benign nonhilar biliary strictures from 1994 to 2008 were identified. Exchange of multiple plastic biliary stents within 6 months (group 1) or 6 months or longer (group 2) after placement. Symptomatic stent occlusion. Seventy-nine patients with nonhilar extrahepatic benign biliary stricture underwent 125 ERCPs with multiple plastic biliary stents. Stents were scheduled for removal/exchange within 6 months in 52 patients (86 ERCPs) compared with after 6 months in 22 patients (26 ERCPs). The median interval between multiple stent placement and removal/exchange was 90 days for group 1 and 242 days for group 2. Premature stent occlusion occurred in 4 of 52 (7.7%) patients in group 1 versus 1 of 22 (4.5%) in group 2, with significantly longer occlusion-free survival in group 2 (log-rank P < .0001). Retrospective study at a single tertiary referral center. Multiple plastic biliary stents for benign nonhilar strictures were associated with a low rate of premature symptomatic stent occlusion at more than 6 months and a longer occlusion-free survival. Copyright 2010 American Society for Gastrointestinal Endoscopy. Published by Mosby, Inc. All rights reserved.