Sample records for shared sequence similarity

  1. The limits of protein sequence comparison?

    PubMed Central

    Pearson, William R; Sierk, Michael L

    2010-01-01

    Modern sequence alignment algorithms are used routinely to identify homologous proteins, proteins that share a common ancestor. Homologous proteins always share similar structures and often have similar functions. Over the past 20 years, sequence comparison has become both more sensitive, largely because of profile-based methods, and more reliable, because of more accurate statistical estimates. As sequence and structure databases become larger, and comparison methods become more powerful, reliable statistical estimates will become even more important for distinguishing similarities that are due to homology from those that are due to analogy (convergence). The newest sequence alignment methods are more sensitive than older methods, but more accurate statistical estimates are needed for their full power to be realized. PMID:15919194

  2. A plasma membrane sucrose-binding protein that mediates sucrose uptake shares structural and sequence similarity with seed storage proteins but remains functionally distinct.

    PubMed

    Overvoorde, P J; Chao, W S; Grimes, H D

    1997-06-20

    Photoaffinity labeling of a soybean cotyledon membrane fraction identified a sucrose-binding protein (SBP). Subsequent studies have shown that the SBP is a unique plasma membrane protein that mediates the linear uptake of sucrose in the presence of up to 30 mM external sucrose when ectopically expressed in yeast. Analysis of the SBP-deduced amino acid sequence indicates it lacks sequence similarity with other known transport proteins. Data presented here, however, indicate that the SBP shares significant sequence and structural homology with the vicilin-like seed storage proteins that organize into homotrimers. These similarities include a repeated sequence that forms the basis of the reiterated domain structure characteristic of the vicilin-like protein family. In addition, analytical ultracentrifugation and nonreducing SDS-polyacrylamide gel electrophoresis demonstrate that the SBP appears to be organized into oligomeric complexes with a Mr indicative of the existence of SBP homotrimers and homodimers. The structural similarity shared by the SBP and vicilin-like proteins provides a novel framework to explore the mechanistic basis of SBP-mediated sucrose uptake. Expression of the maize Glb protein (a vicilin-like protein closely related to the SBP) in yeast demonstrates that a closely related vicilin-like protein is unable to mediate sucrose uptake. Thus, despite sequence and structural similarities shared by the SBP and the vicilin-like protein family, the SBP is functionally divergent from other members of this group.

  3. SCPRED: accurate prediction of protein structural class for sequences of twilight-zone similarity with predicting sequences.

    PubMed

    Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke

    2008-05-01

    Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods.

  4. SCPRED: Accurate prediction of protein structural class for sequences of twilight-zone similarity with predicting sequences

    PubMed Central

    Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke

    2008-01-01

    Background Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. Results SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. Conclusion The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods. PMID:18452616

  5. Two new miniature inverted-repeat transposable elements in the genome of the clam Donax trunculus.

    PubMed

    Šatović, Eva; Plohl, Miroslav

    2017-10-01

    Repetitive sequences are important components of eukaryotic genomes that drive their evolution. Among them are different types of mobile elements that share the ability to spread throughout the genome and form interspersed repeats. To broaden the generally scarce knowledge on bivalves at the genome level, in the clam Donax trunculus we described two new non-autonomous DNA transposons, miniature inverted-repeat transposable elements (MITEs), named DTC M1 and DTC M2. Like other MITEs, they are characterized by their small size, their A + T richness, and the presence of terminal inverted repeats (TIRs). DTC M1 and DTC M2 are 261 and 286 bp long, respectively, and in addition to TIRs, both of them contain a long imperfect palindrome sequence in their central parts. These elements are present in complete and truncated versions within the genome of the clam D. trunculus. The two new MITEs share only structural similarity, but lack any nucleotide sequence similarity to each other. In a search for related elements in databases, blast search revealed within the Crassostrea gigas genome a larger element sharing sequence similarity only to DTC M1 in its TIR sequences. The lack of sequence similarity with any previously published mobile elements indicates that DTC M1 and DTC M2 elements may be unique to D. trunculus.

  6. Identification of distant drug off-targets by direct superposition of binding pocket surfaces.

    PubMed

    Schumann, Marcel; Armen, Roger S

    2013-01-01

    Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target ("distant off-targets"). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target ("distant off-target").

  7. Identification of Distant Drug Off-Targets by Direct Superposition of Binding Pocket Surfaces

    PubMed Central

    Schumann, Marcel; Armen, Roger S.

    2013-01-01

    Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target (“distant off-targets”). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target (“distant off-target”). PMID:24391782

  8. Dipeptide frequency/bias analysis identifies conserved sites of nonrandomness shared by cysteine-rich motifs.

    PubMed

    Campion, S R; Ameen, A S; Lai, L; King, J M; Munzenmaier, T N

    2001-08-15

    This report describes the application of a simple computational tool, AAPAIR.TAB, for the systematic analysis of the cysteine-rich EGF, Sushi, and Laminin motif/sequence families at the two-amino acid level. Automated dipeptide frequency/bias analysis detects preferences in the distribution of amino acids in established protein families, by determining which "ordered dipeptides" occur most frequently in comprehensive motif-specific sequence data sets. Graphic display of the dipeptide frequency/bias data revealed family-specific preferences for certain dipeptides, but more importantly detected a shared preference for employment of the ordered dipeptides Gly-Tyr (GY) and Gly-Phe (GF) in all three protein families. The dipeptide Asn-Gly (NG) also exhibited high-frequency and bias in the EGF and Sushi motif families, whereas Asn-Thr (NT) was distinguished in the Laminin family. Evaluation of the distribution of dipeptides identified by frequency/bias analysis subsequently revealed the highly restricted localization of the G(F/Y) and N(G/T) sequence elements at two separate sites of extreme conservation in the consensus sequence of all three sequence families. The similar employment of the high-frequency/bias dipeptides in three distinct protein sequence families was further correlated with the concurrence of these shared molecular determinants at similar positions within the distinctive scaffolds of three structurally divergent, but similarly employed, motif modules.

  9. Profiling mRNAs of Two Cuscuta Species Reveals Possible Candidate Transcripts Shared by Parasitic Plants

    PubMed Central

    Wijeratne, Saranga; Fraga, Martina; Meulia, Tea; Doohan, Doug; Li, Zhaohu; Qu, Feng

    2013-01-01

    Dodders are among the most important parasitic plants that cause serious yield losses in crop plants. In this report, we sought to unveil the genetic basis of dodder parasitism by profiling the trancriptomes of Cuscuta pentagona and C. suaveolens, two of the most common dodder species using a next-generation RNA sequencing platform. De novo assembly of the sequence reads resulted in more than 46,000 isotigs and contigs (collectively referred to as expressed sequence tags or ESTs) for each species, with more than half of them predicted to encode proteins that share significant sequence similarities with known proteins of non-parasitic plants. Comparing our datasets with transcriptomes of 12 other fully sequenced plant species confirmed a close evolutionary relationship between dodder and tomato. Using a rigorous set of filtering parameters, we were able to identify seven pairs of ESTs that appear to be shared exclusively by parasitic plants, thus providing targets for tailored management approaches. In addition, we also discovered ESTs with sequences similarities to known plant viruses, including cryptic viruses, in the dodder sequence assemblies. Together this study represents the first comprehensive transcriptome profiling of parasitic plants in the Cuscuta genus, and is expected to contribute to our understanding of the molecular mechanisms of parasitic plant-host plant interactions. PMID:24312295

  10. Profiling mRNAs of two Cuscuta species reveals possible candidate transcripts shared by parasitic plants.

    PubMed

    Jiang, Linjian; Wijeratne, Asela J; Wijeratne, Saranga; Fraga, Martina; Meulia, Tea; Doohan, Doug; Li, Zhaohu; Qu, Feng

    2013-01-01

    Dodders are among the most important parasitic plants that cause serious yield losses in crop plants. In this report, we sought to unveil the genetic basis of dodder parasitism by profiling the trancriptomes of Cuscuta pentagona and C. suaveolens, two of the most common dodder species using a next-generation RNA sequencing platform. De novo assembly of the sequence reads resulted in more than 46,000 isotigs and contigs (collectively referred to as expressed sequence tags or ESTs) for each species, with more than half of them predicted to encode proteins that share significant sequence similarities with known proteins of non-parasitic plants. Comparing our datasets with transcriptomes of 12 other fully sequenced plant species confirmed a close evolutionary relationship between dodder and tomato. Using a rigorous set of filtering parameters, we were able to identify seven pairs of ESTs that appear to be shared exclusively by parasitic plants, thus providing targets for tailored management approaches. In addition, we also discovered ESTs with sequences similarities to known plant viruses, including cryptic viruses, in the dodder sequence assemblies. Together this study represents the first comprehensive transcriptome profiling of parasitic plants in the Cuscuta genus, and is expected to contribute to our understanding of the molecular mechanisms of parasitic plant-host plant interactions.

  11. A Deep-Coverage Tomato BAC Library and Prospects Toward Development of an STC Framework for Genome Sequencing

    PubMed Central

    Budiman, Muhammad A.; Mao, Long; Wood, Todd C.; Wing, Rod A.

    2000-01-01

    Recently a new strategy using BAC end sequences as sequence-tagged connectors (STCs) was proposed for whole-genome sequencing projects. In this study, we present the construction and detailed characterization of a 15.0 haploid genome equivalent BAC library for the cultivated tomato, Lycopersicon esculentum cv. Heinz 1706. The library contains 129,024 clones with an average insert size of 117.5 kb and a chloroplast content of 1.11%. BAC end sequences from 1490 ends were generated and analyzed as a preliminary evaluation for using this library to develop an STC framework to sequence the tomato genome. A total of 1205 BAC end sequences (80.9%) were obtained, with an average length of 360 high-quality bases, and were searched against the GenBank database. Using a cutoff expectation value of <10−6, and combining the results from BLASTN, BLASTX, and TBLASTX searches, 24.3% of the BAC end sequences were similar to known sequences, of which almost half (48.7%) share sequence similarities to retrotransposons and 7% to known genes. Some of the transposable element sequences were the first reported in tomato, such as sequences similar to maize transposon Activator (Ac) ORF and tobacco pararetrovirus-like sequences. Interestingly, there were no BAC end sequences similar to the highly repeated TGRI and TGRII elements. However, the majority (70.3%) of STCs did not share significant sequence similarities to any sequences in GenBank at either the DNA or predicted protein levels, indicating that a large portion of the tomato genome is still unknown. Our data demonstrate that this BAC library is suitable for developing an STC database to sequence the tomato genome. The advantages of developing an STC framework for whole-genome sequencing of tomato are discussed. [The BAC end sequences described in this paper have been deposited in the GenBank data library under accession nos. AQ367111–AQ368361.] PMID:10645957

  12. FoxP2 in song-learning birds and vocal-learning mammals.

    PubMed

    Webb, D M; Zhang, J

    2005-01-01

    FoxP2 is the first identified gene that is specifically involved in speech and language development in humans. Population genetic studies of FoxP2 revealed a selective sweep in recent human history associated with two amino acid substitutions in exon 7. Avian song learning and human language acquisition share many behavioral and neurological similarities. To determine whether FoxP2 plays a similar role in song-learning birds, we sequenced exon 7 of FoxP2 in multiple song-learning and nonlearning birds. We show extreme conservation of FoxP2 sequences in birds, including unusually low rates of synonymous substitutions. However, no amino acid substitutions are shared between the song-learning birds and humans. Furthermore, sequences from vocal-learning whales, dolphins, and bats do not share the human-unique substitutions. While FoxP2 appears to be under strong functional constraints in mammals and birds, we find no evidence for its role during the evolution of vocal learning in nonhuman animals as in humans.

  13. Interactive web-based identification and visualization of transcript shared sequences.

    PubMed

    Azhir, Alaleh; Merino, Louis-Henri; Nauen, David W

    2018-05-12

    We have developed TraC (Transcript Consensus), a web-based tool for detecting and visualizing shared sequences among two or more mRNA transcripts such as splice variants. Results including exon-exon boundaries are returned in a highly intuitive, data-rich, interactive plot that permits users to explore the similarities and differences of multiple transcript sequences. The online tool (http://labs.pathology.jhu.edu/nauen/trac/) is free to use. The source code is freely available for download (https://github.com/nauenlab/TraC). Copyright © 2018 Elsevier Inc. All rights reserved.

  14. 'Candidatus Phytoplasma palmicola', associated with a lethal yellowing-type disease of coconut (Cocos nucifera L.) in Mozambique.

    PubMed

    Harrison, Nigel A; Davis, Robert E; Oropeza, Carlos; Helmick, Ericka E; Narváez, María; Eden-Green, Simon; Dollet, Michel; Dickinson, Matthew

    2014-06-01

    In this study, the taxonomic position and group classification of the phytoplasma associated with a lethal yellowing-type disease (LYD) of coconut (Cocos nucifera L.) in Mozambique were addressed. Pairwise similarity values based on alignment of nearly full-length 16S rRNA gene sequences (1530 bp) revealed that the Mozambique coconut phytoplasma (LYDM) shared 100% identity with a comparable sequence derived from a phytoplasma strain (LDN) responsible for Awka wilt disease of coconut in Nigeria, and shared 99.0-99.6% identity with 16S rRNA gene sequences from strains associated with Cape St Paul wilt (CSPW) disease of coconut in Ghana and Côte d'Ivoire. Similarity scores further determined that the 16S rRNA gene of the LYDM phytoplasma shared <97.5% sequence identity with all previously described members of 'Candidatus Phytoplasma'. The presence of unique regions in the 16S rRNA gene sequence distinguished the LYDM phytoplasma from all currently described members of 'Candidatus Phytoplasma', justifying its recognition as the reference strain of a novel taxon, 'Candidatus Phytoplasma palmicola'. Virtual RFLP profiles of the F2n/R2 portion (1251 bp) of the 16S rRNA gene and pattern similarity coefficients delineated coconut LYDM phytoplasma strains from Mozambique as novel members of established group 16SrXXII, subgroup A (16SrXXII-A). Similarity coefficients of 0.97 were obtained for comparisons between subgroup 16SrXXII-A strains and CSPW phytoplasmas from Ghana and Côte d'Ivoire. On this basis, the CSPW phytoplasma strains were designated members of a novel subgroup, 16SrXXII-B.

  15. Genome Sequences of Ilzat and Eleri, Two Phages Isolated Using Microbacterium foliorum NRRL B-24224

    PubMed Central

    Ali, Ilzat; Jones, Acacia Eleri; Mohamed, Aleem

    2018-01-01

    ABSTRACT Bacteriophages Ilzat and Eleri are newly isolated Siphoviridae infecting Microbacterium foliorum NRRL B-24224. The phage genomes are similar in length, G+C content, and architecture and share 62.9% nucleotide sequence identity. PMID:29650566

  16. A discrete artificial bee colony algorithm for detecting transcription factor binding sites in DNA sequences.

    PubMed

    Karaboga, D; Aslan, S

    2016-04-27

    The great majority of biological sequences share significant similarity with other sequences as a result of evolutionary processes, and identifying these sequence similarities is one of the most challenging problems in bioinformatics. In this paper, we present a discrete artificial bee colony (ABC) algorithm, which is inspired by the intelligent foraging behavior of real honey bees, for the detection of highly conserved residue patterns or motifs within sequences. Experimental studies on three different data sets showed that the proposed discrete model, by adhering to the fundamental scheme of the ABC algorithm, produced competitive or better results than other metaheuristic motif discovery techniques.

  17. Predicted secondary structure similarity in the absence of primary amino acid sequence homology: hepatitis B virus open reading frames.

    PubMed Central

    Schaeffer, E; Sninsky, J J

    1984-01-01

    Proteins that are related evolutionarily may have diverged at the level of primary amino acid sequence while maintaining similar secondary structures. Computer analysis has been used to compare the open reading frames of the hepatitis B virus to those of the woodchuck hepatitis virus at the level of amino acid sequence, and to predict the relative hydrophilic character and the secondary structure of putative polypeptides. Similarity is seen at the levels of relative hydrophilicity and secondary structure, in the absence of sequence homology. These data reinforce the proposal that these open reading frames encode viral proteins. Computer analysis of this type can be more generally used to establish structural similarities between proteins that do not share obvious sequence homology as well as to assess whether an open reading frame is fortuitous or codes for a protein. PMID:6585835

  18. Complete Genome Sequence of the Avian Paramyxovirus Serotype 5 Strain APMV-5/budgerigar/Japan/TI/75.

    PubMed

    Hiono, Takahiro; Matsuno, Keita; Tuchiya, Kotaro; Lin, Zhifeng; Okamatsu, Masatoshi; Sakoda, Yoshihiro

    2016-09-22

    Here, we report the complete genome sequence of the avian paramyxovirus serotype 5 strain APMV-5/budgerigar/Japan/TI/75, which was determined using the Illumina MiSeq platform. The determined sequence shares 97% homology and similar genetic features with the previously known genome sequence of avian paramyxovirus serotype 5 strain APMV-5/budgerigar/Japan/Kunitachi/74. Copyright © 2016 Hiono et al.

  19. Quaranfil, Johnston Atoll, and Lake Chad viruses are novel members of the family Orthomyxoviridae.

    PubMed

    Presti, Rachel M; Zhao, Guoyan; Beatty, Wandy L; Mihindukulasuriya, Kathie A; da Rosa, Amelia P A Travassos; Popov, Vsevolod L; Tesh, Robert B; Virgin, Herbert W; Wang, David

    2009-11-01

    Arboviral infections are an important cause of emerging infections due to the movements of humans, animals, and hematophagous arthropods. Quaranfil virus (QRFV) is an unclassified arbovirus originally isolated from children with mild febrile illness in Quaranfil, Egypt, in 1953. It has subsequently been isolated in multiple geographic areas from ticks and birds. We used high-throughput sequencing to classify QRFV as a novel orthomyxovirus. The genome of this virus is comprised of multiple RNA segments; five were completely sequenced. Proteins with limited amino acid similarity to conserved domains in polymerase (PA, PB1, and PB2) and hemagglutinin (HA) genes from known orthomyxoviruses were predicted to be present in four of the segments. The fifth sequenced segment shared no detectable similarity to any protein and is of uncertain function. The end-terminal sequences of QRFV are conserved between segments and are different from those of the known orthomyxovirus genera. QRFV is known to cross-react serologically with two other unclassified viruses, Johnston Atoll virus (JAV) and Lake Chad virus (LKCV). The complete open reading frames of PB1 and HA were sequenced for JAV, while a fragment of PB1 of LKCV was identified by mass sequencing. QRFV and JAV PB1 and HA shared 80% and 70% amino acid identity to each other, respectively; the LKCV PB1 fragment shared 83% amino acid identity with the corresponding region of QRFV PB1. Based on phylogenetic analyses, virion ultrastructural features, and the unique end-terminal sequences identified, we propose that QRFV, JAV, and LKCV comprise a novel genus of the family Orthomyxoviridae.

  20. Quaranfil, Johnston Atoll, and Lake Chad Viruses Are Novel Members of the Family Orthomyxoviridae▿

    PubMed Central

    Presti, Rachel M.; Zhao, Guoyan; Beatty, Wandy L.; Mihindukulasuriya, Kathie A.; Travassos da Rosa, Amelia P. A.; Popov, Vsevolod L.; Tesh, Robert B.; Virgin, Herbert W.; Wang, David

    2009-01-01

    Arboviral infections are an important cause of emerging infections due to the movements of humans, animals, and hematophagous arthropods. Quaranfil virus (QRFV) is an unclassified arbovirus originally isolated from children with mild febrile illness in Quaranfil, Egypt, in 1953. It has subsequently been isolated in multiple geographic areas from ticks and birds. We used high-throughput sequencing to classify QRFV as a novel orthomyxovirus. The genome of this virus is comprised of multiple RNA segments; five were completely sequenced. Proteins with limited amino acid similarity to conserved domains in polymerase (PA, PB1, and PB2) and hemagglutinin (HA) genes from known orthomyxoviruses were predicted to be present in four of the segments. The fifth sequenced segment shared no detectable similarity to any protein and is of uncertain function. The end-terminal sequences of QRFV are conserved between segments and are different from those of the known orthomyxovirus genera. QRFV is known to cross-react serologically with two other unclassified viruses, Johnston Atoll virus (JAV) and Lake Chad virus (LKCV). The complete open reading frames of PB1 and HA were sequenced for JAV, while a fragment of PB1 of LKCV was identified by mass sequencing. QRFV and JAV PB1 and HA shared 80% and 70% amino acid identity to each other, respectively; the LKCV PB1 fragment shared 83% amino acid identity with the corresponding region of QRFV PB1. Based on phylogenetic analyses, virion ultrastructural features, and the unique end-terminal sequences identified, we propose that QRFV, JAV, and LKCV comprise a novel genus of the family Orthomyxoviridae. PMID:19726499

  1. Genetic diversity and antigenicity variation of Babesia bovis merozoite surface antigen-1 (MSA-1) in Thailand.

    PubMed

    Tattiyapong, Muncharee; Sivakumar, Thillaiampalam; Takemae, Hitoshi; Simking, Pacharathon; Jittapalapong, Sathaporn; Igarashi, Ikuo; Yokoyama, Naoaki

    2016-07-01

    Babesia bovis, an intraerythrocytic protozoan parasite, causes severe clinical disease in cattle worldwide. The genetic diversity of parasite antigens often results in different immune profiles in infected animals, hindering efforts to develop immune control methodologies against the B. bovis infection. In this study, we analyzed the genetic diversity of the merozoite surface antigen-1 (msa-1) gene using 162 B. bovis-positive blood DNA samples sourced from cattle populations reared in different geographical regions of Thailand. The identity scores shared among 93 msa-1 gene sequences isolated by PCR amplification were 43.5-100%, and the similarity values among the translated amino acid sequences were 42.8-100%. Of 23 total clades detected in our phylogenetic analysis, Thai msa-1 gene sequences occurred in 18 clades; seven among them were composed of sequences exclusively from Thailand. To investigate differential antigenicity of isolated MSA-1 proteins, we expressed and purified eight recombinant MSA-1 (rMSA-1) proteins, including an rMSA-1 from B. bovis Texas (T2Bo) strain and seven rMSA-1 proteins based on the Thai msa-1 sequences. When these antigens were analyzed in a western blot assay, anti-T2Bo cattle serum strongly reacted with the rMSA-1 from T2Bo, as well as with three other rMSA-1 proteins that shared 54.9-68.4% sequence similarity with T2Bo MSA-1. In contrast, no or weak reactivity was observed for the remaining rMSA-1 proteins, which shared low sequence similarity (35.0-39.7%) with T2Bo MSA-1. While demonstrating the high genetic diversity of the B. bovis msa-1 gene in Thailand, the present findings suggest that the genetic diversity results in antigenicity variations among the MSA-1 antigens of B. bovis in Thailand. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Draft Genome Sequence of Thermus scotoductus Strain K1, Isolated from a Geothermal Spring in Karvachar, Nagorno Karabakh

    PubMed Central

    Saghatelyan, Ani; Poghosyan, Lianna

    2015-01-01

    The 2,379,636-bp draft genome sequence of Thermus scotoductus strain K1, isolated from geothermal spring outlet located in the Karvachar region in Nagorno Karabakh is presented. Strain K1 shares about 80% genome sequence similarity with T. scotoductus strain SA-01, recovered from a deep gold mine in South Africa. PMID:26564055

  3. Prediction of G protein-coupled receptor encoding sequences from the synganglion transcriptome of the cattle tick, Rhipicephalus microplus

    USDA-ARS?s Scientific Manuscript database

    The cattle tick, Rhipicephalus (Boophilus) microplus, is a pest which causes multiple health complications in cattle. The G-protein coupled receptor (GPCR) super-family presents an interesting target for developing novel tick control methods. However, GPCRs share limited sequence similarity among or...

  4. The HMMER Web Server for Protein Sequence Similarity Search.

    PubMed

    Prakash, Ananth; Jeffryes, Matt; Bateman, Alex; Finn, Robert D

    2017-12-08

    Protein sequence similarity search is one of the most commonly used bioinformatics methods for identifying evolutionarily related proteins. In general, sequences that are evolutionarily related share some degree of similarity, and sequence-search algorithms use this principle to identify homologs. The requirement for a fast and sensitive sequence search method led to the development of the HMMER software, which in the latest version (v3.1) uses a combination of sophisticated acceleration heuristics and mathematical and computational optimizations to enable the use of profile hidden Markov models (HMMs) for sequence analysis. The HMMER Web server provides a common platform by linking the HMMER algorithms to databases, thereby enabling the search for homologs, as well as providing sequence and functional annotation by linking external databases. This unit describes three basic protocols and two alternate protocols that explain how to use the HMMER Web server using various input formats and user defined parameters. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  5. The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

    PubMed

    Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

    2018-05-17

    Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. Draft Genome Sequence of Thermus scotoductus Strain K1, Isolated from a Geothermal Spring in Karvachar, Nagorno Karabakh.

    PubMed

    Saghatelyan, Ani; Poghosyan, Lianna; Panosyan, Hovik; Birkeland, Nils-Kåre

    2015-11-12

    The 2,379,636-bp draft genome sequence of Thermus scotoductus strain K1, isolated from geothermal spring outlet located in the Karvachar region in Nagorno Karabakh is presented. Strain K1 shares about 80% genome sequence similarity with T. scotoductus strain SA-01, recovered from a deep gold mine in South Africa. Copyright © 2015 Saghatelyan et al.

  7. Vacuolar H[sup +]-ATPase 69-kilodalton catalytic subunit cDNA from developing cotton (Gossypium hirsutum) ovules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilkins, T.A.

    1993-06-01

    This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.

  8. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less

  9. BLAST and FASTA similarity searching for multiple sequence alignment.

    PubMed

    Pearson, William R

    2014-01-01

    BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.

  10. Characterization of a chimeric foot-and-mouth disease virus bearing bovine rhinitis B virus leader proteinase

    USDA-ARS?s Scientific Manuscript database

    Our recent study has shown that bovine rhinovirus type 2 (BRV2), a new member of the Aphthovirus genus, shares many motifs and sequence similarities with foot-and-mouth disease virus (FMDV). Despite low sequence conservation (36percent amino acid identity) and N- and C-terminus folding differences,...

  11. Identification and analysis of pig chimeric mRNAs using RNA sequencing data

    PubMed Central

    2012-01-01

    Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

  12. Dissimilar sweet proteins from plants: oddities or normal components?

    PubMed

    Picone, Delia; Temussi, Piero Andrea

    2012-10-01

    The fruits of a few tropical plants contain intensely sweet proteins. Their common property points to a protein family. Generally, proteins belonging to the same family share similar folds, similar sequences and, at least in part, similar function but sweet proteins constitute an exception to this rule. Apart from sharing the rather unusual taste function, they show no obvious similarities either in their sequences or in three-dimensional structures. In this review we describe the nature, structure and mechanism of action of the best known sweet tasting proteins, including two taste modifying proteins. Sweet proteins stand out among sweet molecules because their volume is not compatible with an interaction with orthosteric active sites of the sweet taste receptor. The best explanation of their mechanism of action is the interaction with the external surface of the sweet taste receptor, according to a model that has been named "wedge model". It is hypothesized that this mode of action may be related to the ability of other members of their protein families to inhibit different enzymes. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  13. African swine fever virus encodes two genes which share significant homology with the two largest subunits of DNA-dependent RNA polymerases.

    PubMed Central

    Yáñez, R J; Boursnell, M; Nogal, M L; Yuste, L; Viñuela, E

    1993-01-01

    A random sequencing strategy applied to two large SalI restriction fragments (SB and SD) of the African swine fever virus (ASFV) genome revealed that they might encode proteins similar to the two largest RNA polymerase subunits of eukaryotes, poxviruses and Escherichia coli. After further mapping by dot-blot hybridization, two large open reading frames (ORFs) were completely sequenced. The first ORF (NP1450L) encodes a protein of 1450 amino acids with extensive similarity to the largest subunit of RNA polymerases. The second one (EP1242L) codes for a protein of 1242 amino acids similar to the second largest RNA polymerase subunit. Proteins NP1450L and EP1242L are more similar to the corresponding subunits of eukaryotic RNA polymerase II than to those of vaccinia virus, the prototype poxvirus, which shares many functional characteristics with ASFV. ORFs NP1450L and EP1242L are mainly expressed late in ASFV infection, after the onset of DNA replication. Images PMID:8506138

  14. The genome sequence of avian pathogenic Escherichia coli strain O1:K1:H7 shares strong similarities with human extraintestinal pathogenic E. coli genomes.

    PubMed

    Johnson, Timothy J; Kariyawasam, Subhashinie; Wannemuehler, Yvonne; Mangiamele, Paul; Johnson, Sara J; Doetkott, Curt; Skyberg, Jerod A; Lynne, Aaron M; Johnson, James R; Nolan, Lisa K

    2007-04-01

    Escherichia coli strains that cause disease outside the intestine are known as extraintestinal pathogenic E. coli (ExPEC) and include human uropathogenic E. coli (UPEC) and avian pathogenic E. coli (APEC). Regardless of host of origin, ExPEC strains share many traits. It has been suggested that these commonalities may enable APEC to cause disease in humans. Here, we begin to test the hypothesis that certain APEC strains possess potential to cause human urinary tract infection through virulence genotyping of 1,000 APEC and UPEC strains, generation of the first complete genomic sequence of an APEC (APEC O1:K1:H7) strain, and comparison of this genome to all available human ExPEC genomic sequences. The genomes of APEC O1 and three human UPEC strains were found to be remarkably similar, with only 4.5% of APEC O1's genome not found in other sequenced ExPEC genomes. Also, use of multilocus sequence typing showed that some of the sequenced human ExPEC strains were more like APEC O1 than other human ExPEC strains. This work provides evidence that at least some human and avian ExPEC strains are highly similar to one another, and it supports the possibility that a food-borne link between some APEC and UPEC strains exists. Future studies are necessary to assess the ability of APEC to overcome the hurdles necessary for such a food-borne transmission, and epidemiological studies are required to confirm that such a phenomenon actually occurs.

  15. Quantifying humpback whale song sequences to understand the dynamics of song exchange at the ocean basin scale.

    PubMed

    Garland, Ellen C; Noad, Michael J; Goldizen, Anne W; Lilley, Matthew S; Rekdahl, Melinda L; Garrigue, Claire; Constantine, Rochelle; Daeschler Hauser, Nan; Poole, M Michael; Robbins, Jooke

    2013-01-01

    Humpback whales have a continually evolving vocal sexual display, or "song," that appears to undergo both evolutionary and "revolutionary" change. All males within a population adhere to the current content and arrangement of the song. Populations within an ocean basin share similarities in their songs; this sharing is complex as multiple variations of the song (song types) may be present within a region at any one time. To quantitatively investigate the similarity of song types, songs were compared at both the individual singer and population level using the Levenshtein distance technique and cluster analysis. The highly stereotyped sequences of themes from the songs of 211 individuals from populations within the western and central South Pacific region from 1998 through 2008 were grouped together based on the percentage of song similarity, and compared to qualitatively assigned song types. The analysis produced clusters of highly similar songs that agreed with previous qualitative assignments. Each cluster contained songs from multiple populations and years, confirming the eastward spread of song types and their progressive evolution through the study region. Quantifying song similarity and exchange will assist in understanding broader song dynamics and contribute to the use of vocal displays as population identifiers.

  16. A statistical physics perspective on alignment-independent protein sequence comparison.

    PubMed

    Chattopadhyay, Amit K; Nasiev, Diar; Flower, Darren R

    2015-08-01

    Within bioinformatics, the textual alignment of amino acid sequences has long dominated the determination of similarity between proteins, with all that implies for shared structure, function and evolutionary descent. Despite the relative success of modern-day sequence alignment algorithms, so-called alignment-free approaches offer a complementary means of determining and expressing similarity, with potential benefits in certain key applications, such as regression analysis of protein structure-function studies, where alignment-base similarity has performed poorly. Here, we offer a fresh, statistical physics-based perspective focusing on the question of alignment-free comparison, in the process adapting results from 'first passage probability distribution' to summarize statistics of ensemble averaged amino acid propensity values. In this article, we introduce and elaborate this approach. © The Author 2015. Published by Oxford University Press.

  17. Sequentially distant but structurally similar proteins exhibit fold specific patterns based on their biophysical properties.

    PubMed

    Rajendran, Senthilnathan; Jothi, Arunachalam

    2018-05-16

    The Three-dimensional structure of a protein depends on the interaction between their amino acid residues. These interactions are in turn influenced by various biophysical properties of the amino acids. There are several examples of proteins that share the same fold but are very dissimilar at the sequence level. For proteins to share a common fold some crucial interactions should be maintained despite insignificant sequence similarity. Since the interactions are because of the biophysical properties of the amino acids, we should be able to detect descriptive patterns for folds at such a property level. In this line, the main focus of our research is to analyze such proteins and to characterize them in terms of their biophysical properties. Protein structures with sequence similarity lesser than 40% were selected for ten different subfolds from three different mainfolds (according to CATH classification) and were used for this analysis. We used the normalized values of the 49 physio-chemical, energetic and conformational properties of amino acids. We characterize the folds based on the average biophysical property values. We also observed a fold specific correlational behavior of biophysical properties despite a very low sequence similarity in our data. We further trained three different binary classification models (Naive Bayes-NB, Support Vector Machines-SVM and Bayesian Generalized Linear Model-BGLM) which could discriminate mainfold based on the biophysical properties. We also show that among the three generated models, the BGLM classifier model was able to discriminate protein sequences coming under all beta category with 81.43% accuracy and all alpha, alpha-beta proteins with 83.37% accuracy. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. A search for structurally similar cellular internal ribosome entry sites

    PubMed Central

    Baird, Stephen D.; Lewis, Stephen M.; Turcotte, Marcel; Holcik, Martin

    2007-01-01

    Internal ribosome entry sites (IRES) allow ribosomes to be recruited to mRNA in a cap-independent manner. Some viruses that impair cap-dependent translation initiation utilize IRES to ensure that the viral RNA will efficiently compete for the translation machinery. IRES are also employed for the translation of a subset of cellular messages during conditions that inhibit cap-dependent translation initiation. IRES from viruses like Hepatitis C and Classical Swine Fever virus share a similar structure/function without sharing primary sequence similarity. Of the cellular IRES structures derived so far, none were shown to share an overall structural similarity. Therefore, we undertook a genome-wide search of human 5′UTRs (untranslated regions) with an empirically derived structure of the IRES from the key inhibitor of apoptosis, X-linked inhibitor of apoptosis protein (XIAP), to identify novel IRES that share structure/function similarity. Three of the top matches identified by this search that exhibit IRES activity are the 5′UTRs of Aquaporin 4, ELG1 and NF-kappaB repressing factor (NRF). The structures of AQP4 and ELG1 IRES have limited similarity to the XIAP IRES; however, they share trans-acting factors that bind the XIAP IRES. We therefore propose that cellular IRES are not defined by overall structure, as viral IRES, but are instead dependent upon short motifs and trans-acting factors for their function. PMID:17591613

  19. Genome Sequences of Akhmeta Virus, an Early Divergent Old World Orthopoxvirus.

    PubMed

    Gao, Jinxin; Gigante, Crystal; Khmaladze, Ekaterine; Liu, Pengbo; Tang, Shiyuyun; Wilkins, Kimberly; Zhao, Kun; Davidson, Whitni; Nakazawa, Yoshinori; Maghlakelidze, Giorgi; Geleishvili, Marika; Kokhreidze, Maka; Carroll, Darin S; Emerson, Ginny; Li, Yu

    2018-05-12

    Annotated whole genome sequences of three isolates of the Akhmeta virus (AKMV), a novel species of orthopoxvirus (OPXV), isolated from the Akhmeta and Vani regions of the country Georgia, are presented and discussed. The AKMV genome is similar in genomic content and structure to that of the cowpox virus (CPXV), but a lower sequence identity was found between AKMV and Old World OPXVs than between other known species of Old World OPXVs. Phylogenetic analysis showed that AKMV diverged prior to other Old World OPXV. AKMV isolates formed a monophyletic clade in the OPXV phylogeny, yet the sequence variability between AKMV isolates was higher than between the monkeypox virus strains in the Congo basin and West Africa. An AKMV isolate from Vani contained approximately six kb sequence in the left terminal region that shared a higher similarity with CPXV than with other AKMV isolates, whereas the rest of the genome was most similar to AKMV, suggesting recombination between AKMV and CPXV in a region containing several host range and virulence genes.

  20. MHC class II genes in European wolves: a comparison with dogs.

    PubMed

    Seddon, Jennifer M; Ellegren, Hans

    2002-10-01

    The genome of the grey wolf, one of the most widely distributed land mammal species, has been subjected to both stochastic factors, including biogeographical subdivision and population fragmentation, and strong selection during the domestication of the dog. To explore the effects of drift and selection on the partitioning of MHC variation in the diversification of species, we present nine DQA, 10 DQB, and 17 DRB1 sequences of the second exon for European wolves and compare them with sequences of North American wolves and dogs. The relatively large number of class II alleles present in both European and North American wolves attests to their large historical population sizes, yet there are few alleles shared between these regions at DQB and DRB1. Similarly, the dog has an extensive array of class II MHC alleles, a consequence of a genetically diverse origin, but allelic overlap with wolves only at DQA. Although we might expect a progression from shared alleles to shared allelic lineages during differentiation, the partitioning of diversity between wolves and dogs at DQB and DRB1 differs from that at DQA. Furthermore, an extensive region of nucleotide sequence shared between DRB1 and DQB alleles and a shared motif suggests intergenic recombination may have contributed to MHC diversity in the Canidae.

  1. Report of Two Fatal Cases of Mycobacterium mucogenicum Central Nervous System Infection in Immunocompetent Patients

    PubMed Central

    Adékambi, Toïdi; Foucault, Cedric; La Scola, Bernard; Drancourt, Michel

    2006-01-01

    Neurological infections due to rapidly growing mycobacteria (RGM) have rarely been reported. We recently investigated two unrelated immunocompetent patients, one with community-acquired lymphocytic meningitis and the other with cerebral thrombophlebitis. Mycobacterium mucogenicum was isolated in pure culture and detected by PCR sequencing of cerebrospinal fluid samples. Both patients eventually died. The two isolates exhibited an overlapping antimicrobial susceptibility pattern. They were susceptible in vitro to tetracyclines, macrolides, quinolones, amikacin, imipenem, cefoxitin, and trimethoprim-sulfamethoxazole and resistant to ceftriaxone. They shared 100% 16S rRNA gene sequence similarity with M. mucogenicum ATCC 49650T over 1,482 bp. Their partial rpoB sequences shared 97.8% and 98.1% similarity with M. mucogenicum ATCC 49650T, suggesting that the two isolates were representative of two sequevars of M. mucogenicum species. This case report should make clinicians aware that M. mucogenicum, an RGM frequently isolated from tap water or from respiratory specimens and mostly without clinical significance, can even be encountered in the central nervous system of immunocompetent patients. PMID:16517863

  2. A Sand Fly Salivary Protein Vaccine Shows Efficacy Against Vector-Transmitted Cutaneous Leishmaniasis in Nonhuman Primates

    DTIC Science & Technology

    2015-06-03

    demonstrating its immunogenicity in humans. PdSP15 sequence and structure show no homol- ogy to mammalian proteins, further demonstrating its potential...sequence or structure homology to known human proteins The protective salivary antigen PdSP15 shares sequence homology only to the small odorant binding...salivary proteins PpSP15 and PsSP15, respectively (Fig. 4B). To exclude any structural similarities to human pro teins, the crystal structure of PdPS15

  3. Sequence-based evidence for major histocompatibility complex-disassortative mating in a colonial seabird.

    PubMed

    Juola, Frans A; Dearborn, Donald C

    2012-01-07

    The major histocompatibility complex (MHC) is a polymorphic gene family associated with immune defence, and it can play a role in mate choice. Under the genetic compatibility hypothesis, females choose mates that differ genetically from their own MHC genotypes, avoiding inbreeding and/or enhancing the immunocompetence of their offspring. We tested this hypothesis of disassortative mating based on MHC genotypes in a population of great frigatebirds (Fregata minor) by sequencing the second exon of MHC class II B. Extensive haploid cloning yielded two to four alleles per individual, suggesting the amplification of two genes. MHC similarity between mates was not significantly different between pairs that did (n = 4) or did not (n = 42) exhibit extra-pair paternity. Comparing all 46 mated pairs to a distribution based on randomized re-pairings, we observed the following (i): no evidence for mate choice based on maximal or intermediate levels of MHC allele sharing (ii), significantly disassortative mating based on similarity of MHC amino acid sequences, and (iii) no evidence for mate choice based on microsatellite alleles, as measured by either allele sharing or similarity in allele size. This suggests that females choose mates that differ genetically from themselves at MHC loci, but not as an inbreeding-avoidance mechanism.

  4. Characterization of cDNAs and genomic DNAs for human threonyl- and cysteinyl-tRNA synthetases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cruzen, M.E.

    1993-01-01

    Techniques of molecular biology were used to clone, sequence and map two human aminoacyl-tRNA synthetase (aaRS) cDNAs: threonyl-tRNA synthetase (ThrRS) a class II enzyme and cysteinyl-tRNA synthetase (CysRS) a class I enzyme. The predicted protein sequence of human ThrRS is highly homologous to that of lower eukaryotic and prokaryotic ThRSs, particularly in the regions containing the three structural motifs common to all class II synthetases. Signature regions 1 and 2, which characterize the class IIa subgroup (SerRS, ThrRS and HisRS) are highly conserved from bacteria to human. Structural predictions for human ThrRS based on the known structure of the closelymore » related SerRS from E.coli implicate strongly conserved residues in the signature sequences to be important in substrate binding. The amino terminal 100 residues of the deduced amino acid sequence of ThrRS shares structural similarity to SerRS consistent with forming an antiparallel helix implicated in tRNA binding. The 5' untranslated sequence of the human ThrRS gene shares short stretches of common sequence with the gene for hamster HisRS including a binding site for the promoter specific transcription factor sp-1. The deduced amino acid sequence of human CysRS has a high degree of sequence identify to E. coli CysRS. Human CysRS possesses the classic characteristics of a class I synthetase and is most closely related to the MetRS subgroup. The amino terminal half of human CysRS can be modeled as a nucleotide binding fold and shares significant sequence and structural similarity to the other enzymes in this subgroup. The CysRS structural gene (CARS) was mapped to human chromosome 11p15.5 by fluorescent in situ hybridization. CARS is the first aaRS gene to be mapped to chromosome 11. The steady state of both CysRS and ThrRs mRNA were quantitated in several human tissues. Message levels for these enzymes appear to be subjected to differential regulation in different cell types.« less

  5. Discovery of a novel retrovirus sequence in an Australian native rodent (Melomys burtoni): a putative link between gibbon ape leukemia virus and koala retrovirus.

    PubMed

    Simmons, Greg; Clarke, Daniel; McKee, Jeff; Young, Paul; Meers, Joanne

    2014-01-01

    Gibbon ape leukaemia virus (GALV) and koala retrovirus (KoRV) share a remarkably close sequence identity despite the fact that they occur in distantly related mammals on different continents. It has previously been suggested that infection of their respective hosts may have occurred as a result of a species jump from another, as yet unidentified vertebrate host. To investigate possible sources of these retroviruses in the Australian context, DNA samples were obtained from 42 vertebrate species and screened using PCR in order to detect proviral sequences closely related to KoRV and GALV. Four proviral partial sequences totalling 2880 bases which share a strong similarity with KoRV and GALV were detected in DNA from a native Australian rodent, the grassland melomys, Melomys burtoni. We have designated this novel gammaretrovirus Melomys burtoni retrovirus (MbRV). The concatenated nucleotide sequence of MbRV shares 93% identity with the corresponding sequence from GALV-SEATO and 83% identity with KoRV. The geographic ranges of the grassland melomys and of the koala partially overlap. Thus a species jump by MbRV from melomys to koalas is conceivable. However the genus Melomys does not occur in mainland South East Asia and so it appears most likely that another as yet unidentified host was the source of GALV.

  6. Gibbs motif sampling: detection of bacterial outer membrane protein repeats.

    PubMed Central

    Neuwald, A. F.; Liu, J. S.; Lawrence, C. E.

    1995-01-01

    The detection and alignment of locally conserved regions (motifs) in multiple sequences can provide insight into protein structure, function, and evolution. A new Gibbs sampling algorithm is described that detects motif-encoding regions in sequences and optimally partitions them into distinct motif models; this is illustrated using a set of immunoglobulin fold proteins. When applied to sequences sharing a single motif, the sampler can be used to classify motif regions into related submodels, as is illustrated using helix-turn-helix DNA-binding proteins. Other statistically based procedures are described for searching a database for sequences matching motifs found by the sampler. When applied to a set of 32 very distantly related bacterial integral outer membrane proteins, the sampler revealed that they share a subtle, repetitive motif. Although BLAST (Altschul SF et al., 1990, J Mol Biol 215:403-410) fails to detect significant pairwise similarity between any of the sequences, the repeats present in these outer membrane proteins, taken as a whole, are highly significant (based on a generally applicable statistical test for motifs described here). Analysis of bacterial porins with known trimeric beta-barrel structure and related proteins reveals a similar repetitive motif corresponding to alternating membrane-spanning beta-strands. These beta-strands occur on the membrane interface (as opposed to the trimeric interface) of the beta-barrel. The broad conservation and structural location of these repeats suggests that they play important functional roles. PMID:8520488

  7. Discovery of a novel iflavirus sequence in the eastern paralysis tick Ixodes holocyclus.

    PubMed

    O'Brien, Caitlin A; Hall-Mendelin, Sonja; Hobson-Peters, Jody; Deliyannis, Georgia; Allen, Andy; Lew-Tabor, Ala; Rodriguez-Valle, Manuel; Barker, Dayana; Barker, Stephen C; Hall, Roy A

    2018-05-11

    Ixodes holocyclus, the eastern paralysis tick, is a significant parasite in Australia in terms of animal and human health. However, very little is known about its virome. In this study, next-generation sequencing of I. holocyclus salivary glands yielded a full-length genome sequence which phylogenetically groups with viruses classified in the Iflaviridae family and shares 45% amino acid similarity with its closest relative Bole hyalomma asiaticum virus 1. The sequence of this virus, provisionally named Ixodes holocyclus iflavirus (IhIV) has been identified in tick populations from northern New South Wales and Queensland, Australia and represents the first virus sequence reported from I. holocyclus.

  8. Previously unknown and highly divergent ssDNA viruses populate the oceans.

    PubMed

    Labonté, Jessica M; Suttle, Curtis A

    2013-11-01

    Single-stranded DNA (ssDNA) viruses are economically important pathogens of plants and animals, and are widespread in oceans; yet, the diversity and evolutionary relationships among marine ssDNA viruses remain largely unknown. Here we present the results from a metagenomic study of composite samples from temperate (Saanich Inlet, 11 samples; Strait of Georgia, 85 samples) and subtropical (46 samples, Gulf of Mexico) seawater. Most sequences (84%) had no evident similarity to sequenced viruses. In total, 608 putative complete genomes of ssDNA viruses were assembled, almost doubling the number of ssDNA viral genomes in databases. These comprised 129 genetically distinct groups, each represented by at least one complete genome that had no recognizable similarity to each other or to other virus sequences. Given that the seven recognized families of ssDNA viruses have considerable sequence homology within them, this suggests that many of these genetic groups may represent new viral families. Moreover, nearly 70% of the sequences were similar to one of these genomes, indicating that most of the sequences could be assigned to a genetically distinct group. Most sequences fell within 11 well-defined gene groups, each sharing a common gene. Some of these encoded putative replication and coat proteins that had similarity to sequences from viruses infecting eukaryotes, suggesting that these were likely from viruses infecting eukaryotic phytoplankton and zooplankton.

  9. Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

    PubMed

    Seal, B S; Neill, J D; Ridpath, J F

    1994-07-01

    Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

  10. De novo truncating mutations in ASXL3 are associated with a novel clinical phenotype with similarities to Bohring-Opitz syndrome

    PubMed Central

    2013-01-01

    Background Molecular diagnostics can resolve locus heterogeneity underlying clinical phenotypes that may otherwise be co-assigned as a specific syndrome based on shared clinical features, and can associate phenotypically diverse diseases to a single locus through allelic affinity. Here we describe an apparently novel syndrome, likely caused by de novo truncating mutations in ASXL3, which shares characteristics with Bohring-Opitz syndrome, a disease associated with de novo truncating mutations in ASXL1. Methods We used whole-genome and whole-exome sequencing to interrogate the genomes of four subjects with an undiagnosed syndrome. Results Using genome-wide sequencing, we identified heterozygous, de novo truncating mutations in ASXL3, a transcriptional repressor related to ASXL1, in four unrelated probands. We found that these probands shared similar phenotypes, including severe feeding difficulties, failure to thrive, and neurologic abnormalities with significant developmental delay. Further, they showed less phenotypic overlap with patients who had de novo truncating mutations in ASXL1. Conclusion We have identified truncating mutations in ASXL3 as the likely cause of a novel syndrome with phenotypic overlap with Bohring-Opitz syndrome. PMID:23383720

  11. The influence of phonological priming on variability in articulation

    NASA Astrophysics Data System (ADS)

    Babel, Molly E.; Munson, Benjamin

    2004-05-01

    Previous research [Sevald and Dell, Cognition 53, 91-127 (1994)] has found that reiterant sequences of CVC words are produced more quickly when the prime word and target word share VC sequences (i.e., sequences like sit sick) than when they are identical (sequences like sick sick). Even slower production rates are found when primes and targets share a CV sequence (sequences like kick sick). These data have been used to support a model of speech production in which lexical items and their constituent phonemes are activated sequentially. The current experiment investigated whether phonological priming also influences variability in the acoustic characteristics of words. Specifically, we examined whether greater variability in the acoustic characteristics of target words was noted in the CV-related prime context than in the identical-prime context, and whether less variability was noted in the VC-related context. Thirty adult subjects with typical speech, language, and hearing ability produced reiterant two-word sequences that varied in their phonological similarity. The duration, first, and second formant frequencies of the target-words' vowels were measured. Preliminary analyses indicate that phonological priming does not have a systematic effect on variability in these acoustic parameters.

  12. Lactobacillus rodentium sp. nov., from the digestive tract of wild rodents.

    PubMed

    Killer, J; Havlík, J; Vlková, E; Rada, V; Pechar, R; Benada, O; Kopečný, J; Kofroňová, O; Sechovcová, H

    2014-05-01

    Three strains of regular, long, Gram-stain-positive bacterial rods were isolated using TPY, M.R.S. and Rogosa agar under anaerobic conditions from the digestive tract of wild mice (Mus musculus). All 16S rRNA gene sequences of these isolates were most similar to sequences of Lactobacillus gasseri ATCC 33323T and Lactobacillus johnsonii ATCC 33200T (97.3% and 97.2% sequence similarities, respectively). The novel strains shared 99.2-99.6% 16S rRNA gene sequence similarities. Type strains of L. gasseri and L. johnsonii were also most related to the newly isolated strains according to rpoA (83.9-84.0% similarities), pheS (84.6-87.8%), atpA (86.2-87.7%), hsp60 (89.4-90.4%) and tuf (92.7-93.6%) gene sequence similarities. Phylogenetic studies based on 16S rRNA, hsp60, rpoA, atpA and pheS gene sequences, other genotypic and many phenotypic characteristics (results of API 50 CHL, Rapid ID 32A and API ZYM biochemical tests; cellular fatty acid profiles; cellular polar lipid profiles; end products of glucose fermentation) showed that these bacterial strains represent a novel species within the genus Lactobacillus. The name Lactobacillus rodentium sp. nov. is proposed to accommodate this group of new isolates. The type strain is MYMRS/TLU1T (=DSM 24759T=CCM 7945T).

  13. What is a melody? On the relationship between pitch and brightness of timbre.

    PubMed

    Cousineau, Marion; Carcagno, Samuele; Demany, Laurent; Pressnitzer, Daniel

    2013-01-01

    Previous studies showed that the perceptual processing of sound sequences is more efficient when the sounds vary in pitch than when they vary in loudness. We show here that sequences of sounds varying in brightness of timbre are processed with the same efficiency as pitch sequences. The sounds used consisted of two simultaneous pure tones one octave apart, and the listeners' task was to make same/different judgments on pairs of sequences varying in length (one, two, or four sounds). In one condition, brightness of timbre was varied within the sequences by changing the relative level of the two pure tones. In other conditions, pitch was varied by changing fundamental frequency, or loudness was varied by changing the overall level. In all conditions, only two possible sounds could be used in a given sequence, and these two sounds were equally discriminable. When sequence length increased from one to four, discrimination performance decreased substantially for loudness sequences, but to a smaller extent for brightness sequences and pitch sequences. In the latter two conditions, sequence length had a similar effect on performance. These results suggest that the processes dedicated to pitch and brightness analysis, when probed with a sequence-discrimination task, share unexpected similarities.

  14. Microbial diversity and methanogenic activity of Antrim Shale formation waters from recently fractured wells

    PubMed Central

    Wuchter, Cornelia; Banning, Erin; Mincer, Tracy J.; Drenzek, Nicholas J.; Coolen, Marco J. L.

    2013-01-01

    The Antrim Shale in the Michigan Basin is one of the most productive shale gas formations in the U.S., but optimal resource recovery strategies must rely on a thorough understanding of the complex biogeochemical, microbial, and physical interdependencies in this and similar systems. We used Illumina MiSeq 16S rDNA sequencing to analyze the diversity and relative abundance of prokaryotic communities present in Antrim shale formation water of three closely spaced recently fractured gas-producing wells. In addition, the well waters were incubated with a suite of fermentative and methanogenic substrates in an effort to stimulate microbial methane generation. The three wells exhibited substantial differences in their community structure that may arise from their different drilling and fracturing histories. Bacterial sequences greatly outnumbered those of archaea and shared highest similarity to previously described cultures of mesophiles and moderate halophiles within the Firmicutes, Bacteroidetes, and δ- and ε-Proteobacteria. The majority of archaeal sequences shared highest sequence similarity to uncultured euryarchaeotal environmental clones. Some sequences closely related to cultured methylotrophic and hydrogenotrophic methanogens were also present in the initial well water. Incubation with methanol and trimethylamine stimulated methylotrophic methanogens and resulted in the largest increase in methane production in the formation waters, while fermentation triggered by the addition of yeast extract and formate indirectly stimulated hydrogenotrophic methanogens. The addition of sterile powdered shale as a complex natural substrate stimulated the rate of methane production without affecting total methane yields. Depletion of methane indicative of anaerobic methane oxidation (AMO) was observed over the course of incubation with some substrates. This process could constitute a substantial loss of methane in the shale formation. PMID:24367357

  15. Analysis of Neuronal Sequences Using Pairwise Biases

    DTIC Science & Technology

    2015-08-27

    semantic memory (knowledge of facts) and implicit memory (e.g., how to ride a bike ). Evidence for the participation of the hippocampus in the formation of...hippocampal formation in an attempt to be cured of severe epileptic seizures. Although the surgery was successful in regards to reducing the frequency and...very different from each other in many ways including duration and number of spikes. Still, these sequences share a similar trend in the general order

  16. An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van De Loo, F.J.; Broun, P.; Turner, S.

    1995-07-18

    Recent spectroscopic evidence implicating a binuclear iron site at the reaction center of fatty acyl desaturases suggested to us that certain fatty acyl hydroxylases may share significant amino acid sequence similarity with desaturases. To test this theory, we prepared a cDNA library from developing endosperm of the castor-oil plant (Ricinus communis L.) and obtained partial nucleotide sequences for 468 anonymous clones that were not expressed at high levels in leaves, a tissue deficient in 12-hydroxyoleic acid. This resulted in the identification of several cDNA clones encoding a polypeptide of 387 amino acids with a predicted molecular weight of 44,407 andmore » with {approx}67% sequence homology to microsomal oleate desaturase from Arabidopsis. Expression of a full-length clone under control of the cauliflower mosaic virus 35S promoter in transgenic tobacco resulted in the accumulation of low levels of 12-hydroxyoleic acid in seeds, indicating that the clone encodes the castor oleate hydroxylase. These results suggest that fatty acyl desaturases and hydroxylases share similar reaction mechanisms and provide an example of enzyme evolution. 26 refs., 6 figs., 1 tab.« less

  17. Cloning and characterization of the hamster and guinea pig nicotinic acid receptors.

    PubMed

    Torhan, April Smith; Cheewatrakoolpong, Boonlert; Kwee, Lia; Greenfeder, Scott

    2007-09-01

    In this study, we present the identification and characterization of hamster and guinea pig nicotinic acid receptors. The hamster receptor shares approximately 80-90% identity with the nucleotide and amino acid sequences of human, mouse, and rat receptors. The guinea pig receptor shares 76-80% identity with the nucleotide and amino acid sequences of these other species. [(3)H]nicotinic acid binding affinity at guinea pig and hamster receptors is similar to that in human (dissociation constant = 121 nM for guinea pig, 72 nM for hamster, and 74 nM for human), as are potencies of nicotinic acid analogs in competition binding studies. Inhibition of forskolin-stimulated cAMP production by nicotinic acid and related analogs is also similar to the activity in the human receptor. Analysis of mRNA tissue distribution for the hamster and guinea pig nicotinic acid receptors shows expression across a number of tissues, with higher expression in adipose, lung, skeletal muscle, spleen, testis, and ovary.

  18. Analysis of 10,000 ESTs from lymphocytes of the cynomolgus monkey to improve our understanding of its immune system

    PubMed Central

    Chen, Wei-Hua; Wang, Xue-Xia; Lin, Wei; He, Xiao-Wei; Wu, Zhen-Qiang; Lin, Ying; Hu, Song-Nian; Wang, Xiao-Ning

    2006-01-01

    Background The cynomolgus monkey (Macaca fascicularis) is one of the most widely used surrogate animal models for an increasing number of human diseases and vaccines, especially immune-system-related ones. Towards a better understanding of the gene expression background upon its immunogenetics, we constructed a cDNA library from Epstein-Barr virus (EBV)-transformed B lymphocytes of a cynomolgus monkey and sequenced 10,000 randomly picked clones. Results After processing, 8,312 high-quality expressed sequence tags (ESTs) were generated and assembled into 3,728 unigenes. Annotations of these uniquely expressed transcripts demonstrated that out of the 2,524 open reading frame (ORF) positive unigenes (mitochondrial and ribosomal sequences were not included), 98.8% shared significant similarities (E-value less than 1e-10) with the NCBI nucleotide (nt) database, while only 67.7% (E-value less than 1e-5) did so with the NCBI non-redundant protein (nr) database. Further analysis revealed that 90.0% of the unigenes that shared no similarities to the nr database could be assigned to human chromosomes, in which 75 did not match significantly to any cynomolgus monkey and human ESTs. The mapping regions to known human genes on the human genome were described in detail. The protein family and domain analysis revealed that the first, second and fourth of the most abundantly expressed protein families were all assigned to immunoglobulin and major histocompatibility complex (MHC)-related proteins. The expression profiles of these genes were compared with that of homologous genes in human blood, lymph nodes and a RAMOS cell line, which demonstrated expression changes after transformation with EBV. The degree of sequence similarity of the MHC class I and II genes to the human reference sequences was evaluated. The results indicated that class I molecules showed weak amino acid identities (<90%), while class II showed slightly higher ones. Conclusion These results indicated that the genes expressed in the cynomolgus monkey could be used to identify novel protein-coding genes and revise those incomplete or incorrect annotations in the human genome by comparative methods, since the old world monkeys and humans share high similarities at the molecular level, especially within coding regions. The identification of multiple genes involved in the immune response, their sequence variations to the human homologues, and their responses to EBV infection could provide useful information to improve our understanding of the cynomolgus monkey immune system. PMID:16618371

  19. Bartonellae are Prevalent and Diverse in Costa Rican Bats and Bat Flies.

    PubMed

    Judson, S D; Frank, H K; Hadly, E A

    2015-12-01

    Species in the bacterial genus, Bartonella, can cause disease in both humans and animals. Previous reports of Bartonella in bats and ectoparasitic bat flies suggest that bats could serve as mammalian hosts and bat flies as arthropod vectors. We compared the prevalence and genetic similarity of bartonellae in individual Costa Rican bats and their bat flies using molecular and sequencing methods targeting the citrate synthase gene (gltA). Bartonellae were more prevalent in bat flies than in bats, and genetic variants were sometimes, but not always, shared between bats and their bat flies. The detected bartonellae genetic variants were diverse, and some were similar to species known to cause disease in humans and other mammals. The high prevalence and sharing of bartonellae in bat flies and bats support a role for bat flies as a potential vector for Bartonella, while the genetic diversity and similarity to known species suggest that bartonellae could spill over into humans and animals sharing the landscape. © 2015 Blackwell Verlag GmbH.

  20. Molecular cloning and characterization of rhesus monkey platelet glycoprotein Ibα, a major ligand-binding subunit of GPIb-IX-V complex.

    PubMed

    Qiao, Jianlin; Shen, Yang; Shi, Meimei; Lu, Yanrong; Cheng, Jingqiu; Chen, Younan

    2014-05-01

    Through binding to von Willebrand factor (VWF), platelet glycoprotein (GP) Ibα, the major ligand-binding subunit of the GPIb-IX-V complex, initiates platelet adhesion and aggregation in response to exposed VWF or elevated fluid-shear stress. There is little data regarding non-human primate platelet GPIbα. This study cloned and characterized rhesus monkey (Macaca Mullatta) platelet GPIbα. DNAMAN software was used for sequence analysis and alignment. N/O-glycosylation sites and 3-D structure modelling were predicted by online OGPET v1.0, NetOGlyc 1.0 Server and SWISS-MODEL, respectively. Platelet function was evaluated by ADP- or ristocetin-induced platelet aggregation. Rhesus monkey GPIbα contains 2,268 nucleotides with an open reading frame encoding 755 amino acids. Rhesus monkey GPIbα nucleotide and protein sequences share 93.27% and 89.20% homology respectively, with human. Sequences encoding the leucine-rich repeats of rhesus monkey GPIbα share strong similarity with human, whereas PEST sequences and N/O-glycosylated residues vary. The GPIbα-binding residues for thrombin, filamin A and 14-3-3ζ are highly conserved between rhesus monkey and human. Platelet function analysis revealed monkey and human platelets respond similarly to ADP, but rhesus monkey platelets failed to respond to low doses of ristocetin where human platelets achieved 76% aggregation. However, monkey platelets aggregated in response to higher ristocetin doses. Monkey GPIbα shares strong homology with human GPIbα, however there are some differences in rhesus monkey platelet activation through GPIbα engagement, which need to be considered when using rhesus monkey platelet to investigate platelet GPIbα function. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Discrimination of germline V genes at different sequencing lengths and mutational burdens: A new tool for identifying and evaluating the reliability of V gene assignment.

    PubMed

    Zhang, Bochao; Meng, Wenzhao; Prak, Eline T Luning; Hershberg, Uri

    2015-12-01

    Immune repertoires are collections of lymphocytes that express diverse antigen receptor gene rearrangements consisting of Variable (V), (Diversity (D) in the case of heavy chains) and Joining (J) gene segments. Clonally related cells typically share the same germline gene segments and have highly similar junctional sequences within their third complementarity determining regions. Identifying clonal relatedness of sequences is a key step in the analysis of immune repertoires. The V gene is the most important for clone identification because it has the longest sequence and the greatest number of sequence variants. However, accurate identification of a clone's germline V gene source is challenging because there is a high degree of similarity between different germline V genes. This difficulty is compounded in antibodies, which can undergo somatic hypermutation. Furthermore, high-throughput sequencing experiments often generate partial sequences and have significant error rates. To address these issues, we describe a novel method to estimate which germline V genes (or alleles) cannot be discriminated under different conditions (read lengths, sequencing errors or somatic hypermutation frequencies). Starting with any set of germline V genes, this method measures their similarity using different sequencing lengths and calculates their likelihood of unambiguous assignment under different levels of mutation. Hence, one can identify, under different experimental and biological conditions, the germline V genes (or alleles) that cannot be uniquely identified and bundle them together into groups of specific V genes with highly similar sequences. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. A Longitudinal Assessment of the Victim-Offender Overlap

    ERIC Educational Resources Information Center

    Jennings, Wesley G.; Higgins, George E.; Tewksbury, Richard; Gover, Angela R.; Piquero, Alex R.

    2010-01-01

    Although research has established an offending/victimization overlap and that offenders and victims share similar characteristics, much less work has examined the longitudinal sequencing of victimization and offending in the same developmental period and whether key risk/protective factors significantly distinguish both offenders and victims. This…

  3. Do Knowledge Arrangements Affect Student Reading Comprehension of Genetics?

    ERIC Educational Resources Information Center

    Wu, Jen-Yi; Tung, Yu-Neng; Hwang, Bi-Chi; Lin, Chen-Yung; Che-Di, Lee; Chang, Yung-Ta

    2014-01-01

    Various sequences for teaching genetics have been proposed. Three seventh-grade biology textbooks in Taiwan share similar key knowledge assemblages but have different knowledge arrangements. To investigate the influence of knowledge arrangements on student understanding of genetics, we compared students' reading comprehension of the three texts…

  4. What is a melody? On the relationship between pitch and brightness of timbre

    PubMed Central

    Cousineau, Marion; Carcagno, Samuele; Demany, Laurent; Pressnitzer, Daniel

    2014-01-01

    Previous studies showed that the perceptual processing of sound sequences is more efficient when the sounds vary in pitch than when they vary in loudness. We show here that sequences of sounds varying in brightness of timbre are processed with the same efficiency as pitch sequences. The sounds used consisted of two simultaneous pure tones one octave apart, and the listeners’ task was to make same/different judgments on pairs of sequences varying in length (one, two, or four sounds). In one condition, brightness of timbre was varied within the sequences by changing the relative level of the two pure tones. In other conditions, pitch was varied by changing fundamental frequency, or loudness was varied by changing the overall level. In all conditions, only two possible sounds could be used in a given sequence, and these two sounds were equally discriminable. When sequence length increased from one to four, discrimination performance decreased substantially for loudness sequences, but to a smaller extent for brightness sequences and pitch sequences. In the latter two conditions, sequence length had a similar effect on performance. These results suggest that the processes dedicated to pitch and brightness analysis, when probed with a sequence-discrimination task, share unexpected similarities. PMID:24478638

  5. Genetic signature analysis of Perkinsus marinus in Mexico suggests possible translocation from the Atlantic Ocean to the Pacific coast of Mexico.

    PubMed

    Ek-Huchim, Juan Pablo; Aguirre-Macedo, Ma Leopoldina; Améndola-Pimenta, Monica; Vidal-Martínez, Victor Manuel; Pérez-Vega, Juan Antonio; Simá-Alvarez, Raúl; Jiménez-García, Isabel; Zamora-Bustillos, Roberto; Rodríguez-Canul, Rossanna

    2017-08-02

    The protozoan Perkinsus marinus (Mackin, Owen & Collier) Levine, 1978 causes perkinsosis in the American oyster Crassostrea virginica Gmelin, 1791. This pathogen is present in cultured C. virginica from the Gulf of Mexico and has been reported recently in Saccostrea palmula (Carpenter, 1857), Crassostrea corteziensis (Hertlein, 1951) and Crassostrea gigas (Thunberg, 1793) from the Mexican Pacific coast. Transportation of fresh oysters for human consumption and repopulation could be implicated in the transmission and dissemination of this parasite across the Mexican Pacific coast. The aim of this study was two-fold. First, we evaluated the P. marinus infection parameters by PCR and RFTM (Ray's fluid thioglycollate medium) in C. virginica from four major lagoons (Términos Lagoon, Campeche; Carmen-Pajonal-Machona Lagoon complex, Tabasco; Mandinga Lagoon, Veracruz; and La Pesca Lagoon, Tamaulipas) from the Gulf of Mexico. Secondly, we used DNA sequence analyses of the ribosomal non-transcribed spacer (rNTS) region of P. marinus to determine the possible translocation of this species from the Gulf of Mexico to the Mexican Pacific coast. Perkinsus marinus prevalence by PCR was 57.7% (338 out of 586 oysters) and 38.2% (224 out of 586 oysters) by RFTM. The highest prevalence was observed in the Carmen-Pajonal-Machona Lagoon complex in the state of Tabasco (73% by PCR and 58% by RFTM) and the estimated weighted prevalence (WP) was less than 1.0 in the four lagoons. Ten unique rDNA-NTS sequences of P. marinus [termed herein the "P. marinus (Pm) haplotype"] were identified in the Gulf of Mexico sample. They shared 96-100% similarity with 18 rDNA-NTS sequences from the GenBank database which were derived from 16 Mexican Pacific coast infections and two sequences from the USA. The phylogenetic tree and the haplotype network showed that the P. marinus rDNA-NTS sequences from Mexico were distant from the rDNA-NTS sequences of P. marinus reported from the USA. The ten rDNA-NTS sequences described herein were restricted to specific locations displaying different geographical connections within the Gulf of Mexico; the Carmen-Pajonal-Machona Pm1 haplotype from the state of Tabasco shared a cluster with P. marinus isolates reported from the Mexican Pacific coast. The rDNA-NTS sequences of P. marinus from the state of Tabasco shared high similarity with the reference rDNA-NTS sequences from the Mexican Pacific coast. The high similarity suggests a transfer of oysters infected with P. marinus from the Mexican part of the Gulf of Mexico into the Mexican Pacific coast.

  6. Pattern similarity study of functional sites in protein sequences: lysozymes and cystatins

    PubMed Central

    Nakai, Shuryo; Li-Chan, Eunice CY; Dou, Jinglie

    2005-01-01

    Background Although it is generally agreed that topography is more conserved than sequences, proteins sharing the same fold can have different functions, while there are protein families with low sequence similarity. An alternative method for profile analysis of characteristic conserved positions of the motifs within the 3D structures may be needed for functional annotation of protein sequences. Using the approach of quantitative structure-activity relationships (QSAR), we have proposed a new algorithm for postulating functional mechanisms on the basis of pattern similarity and average of property values of side-chains in segments within sequences. This approach was used to search for functional sites of proteins belonging to the lysozyme and cystatin families. Results Hydrophobicity and β-turn propensity of reference segments with 3–7 residues were used for the homology similarity search (HSS) for active sites. Hydrogen bonding was used as the side-chain property for searching the binding sites of lysozymes. The profiles of similarity constants and average values of these parameters as functions of their positions in the sequences could identify both active and substrate binding sites of the lysozyme of Streptomyces coelicolor, which has been reported as a new fold enzyme (Cellosyl). The same approach was successfully applied to cystatins, especially for postulating the mechanisms of amyloidosis of human cystatin C as well as human lysozyme. Conclusion Pattern similarity and average index values of structure-related properties of side chains in short segments of three residues or longer were, for the first time, successfully applied for predicting functional sites in sequences. This new approach may be applicable to studying functional sites in un-annotated proteins, for which complete 3D structures are not yet available. PMID:15904486

  7. A high level interface to SCOP and ASTRAL implemented in python.

    PubMed

    Casbon, James A; Crooks, Gavin E; Saqi, Mansoor A S

    2006-01-10

    Benchmarking algorithms in structural bioinformatics often involves the construction of datasets of proteins with given sequence and structural properties. The SCOP database is a manually curated structural classification which groups together proteins on the basis of structural similarity. The ASTRAL compendium provides non redundant subsets of SCOP domains on the basis of sequence similarity such that no two domains in a given subset share more than a defined degree of sequence similarity. Taken together these two resources provide a 'ground truth' for assessing structural bioinformatics algorithms. We present a small and easy to use API written in python to enable construction of datasets from these resources. We have designed a set of python modules to provide an abstraction of the SCOP and ASTRAL databases. The modules are designed to work as part of the Biopython distribution. Python users can now manipulate and use the SCOP hierarchy from within python programs, and use ASTRAL to return sequences of domains in SCOP, as well as clustered representations of SCOP from ASTRAL. The modules make the analysis and generation of datasets for use in structural genomics easier and more principled.

  8. Distant plant homologues: don't throw out the baby.

    PubMed

    Gardiner, John; Overall, Robyn; Marc, Jan

    2012-03-01

    Plants and metazoans share many similarities in terms of conserved proteins. Antibodies have been used extensively to detect remote homologues, many of which are yet to be identified conclusively. Genome sequencing and the creation of novel sequence or structure comparison programs have assisted greatly in the identification of distant protein homologues. The continuing development of new software algorithms and the combining of bioinformatics with proteomics offer hope that remaining homologues will be soon identified. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Promoters, toll like receptors and microRNAs: a strange association.

    PubMed

    Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K

    2013-06-01

    Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.

  10. Role of molecular mimicry to HIV-1 peptides in HIV-1–related immunologic thrombocytopenia

    PubMed Central

    Li, Zongdong; Nardi, Michael A.; Karpatkin, Simon

    2005-01-01

    Patients with early HIV-1 infection develop an autoimmune thrombocytopenia in which antibody is directed against an immunodominant epitope of the β3 (glycoprotein IIIa [GPIIIa]) integrin, GPIIIa49-66. This antibody induces thrombocytopenia by a novel complement-independent mechanism in which platelets are fragmented by antibody-induced generation of H2O2 derived from the interaction of platelet nicotinamide adenine dinucleotide phosphate (NADPH) oxidase and 12-lipoxygenase. To examine whether sharing of epitope between host and parasite may be responsible for this immunodominant epitope, we screened for antibody-reactive peptides capable of inhibiting platelet lysis and oxidation in vitro, using a filamentous phage display 7-mer peptide library. Fourteen of these phage-peptide clones were identified. Five shared close sequence similarity with GPIIIa49-66, as expected. Ten were molecular mimics with close sequence similarity to HIV-1 proteins nef, gag, env, and pol. Seven were synthesized as 10-mers from their known HIV-1 sequence and found to inhibit anti–GPIIIa49-66–induced platelet oxidation/fragmentation in vitro. Three rabbit antibodies raised against these peptides induced platelet oxidation/fragmentation in vitro and thrombocytopenia in vivo when passively transferred into mice. One of the peptides shared a known epitope region with HIV-1 protein nef and was derived from a variant region of the protein. These data provide strong support for molecular mimicry in HIV-1-immunologic thrombocytopenia within polymorphic regions of HIV-1 proteins. A known epitope of nef is particularly incriminated. PMID:15774614

  11. Comparison of topological clustering within protein networks using edge metrics that evaluate full sequence, full structure, and active site microenvironment similarity.

    PubMed

    Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S

    2015-09-01

    The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. © 2015 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

  12. Comparison of topological clustering within protein networks using edge metrics that evaluate full sequence, full structure, and active site microenvironment similarity

    PubMed Central

    Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S

    2015-01-01

    The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. PMID:26073648

  13. Exploring the Midgut Transcriptome and Brush Border Membrane Vesicle Proteome of the Rice Stem Borer, Chilo suppressalis (Walker)

    PubMed Central

    Peng, Chuanhua; Wang, Xiaoping; Li, Fei; Lin, Yongjun

    2012-01-01

    The rice stem borer, Chilo suppressalis (Walker) (Lepidoptera: Pyralidae), is one of the most detrimental pests affecting rice crops. The use of Bacillus thuringiensis (Bt) toxins has been explored as a means to control this pest, but the potential for C. suppressalis to develop resistance to Bt toxins makes this approach problematic. Few C. suppressalis gene sequences are known, which makes in-depth study of gene function difficult. Herein, we sequenced the midgut transcriptome of the rice stem borer. In total, 37,040 contigs were obtained, with a mean size of 497 bp. As expected, the transcripts of C. suppressalis shared high similarity with arthropod genes. Gene ontology and KEGG analysis were used to classify the gene functions in C. suppressalis. Using the midgut transcriptome data, we conducted a proteome analysis to identify proteins expressed abundantly in the brush border membrane vesicles (BBMV). Of the 100 top abundant proteins that were excised and subjected to mass spectrometry analysis, 74 share high similarity with known proteins. Among these proteins, Western blot analysis showed that Aminopeptidase N and EH domain-containing protein have the binding activities with Bt-toxin Cry1Ac. These data provide invaluable information about the gene sequences of C. suppressalis and the proteins that bind with Cry1Ac. PMID:22666467

  14. B-Bolivia, an Allele of the Maize b1 Gene with Variable Expression, Contains a High Copy Retrotransposon-Related Sequence Immediately Upstream1

    PubMed Central

    Selinger, David A.; Chandler, Vicki L.

    2001-01-01

    The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116

  15. Low Maternal Microbiota Sharing across Gut, Breast Milk and Vagina, as Revealed by 16S rRNA Gene and Reduced Metagenomic Sequencing.

    PubMed

    Avershina, Ekaterina; Angell, Inga Leena; Simpson, Melanie; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; Rudi, Knut

    2018-05-01

    The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS) approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types ( Bifidobacterium longum and Enterococcus faecalis ). Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis . We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation.

  16. Low Maternal Microbiota Sharing across Gut, Breast Milk and Vagina, as Revealed by 16S rRNA Gene and Reduced Metagenomic Sequencing

    PubMed Central

    Angell, Inga Leena; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; Rudi, Knut

    2018-01-01

    The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS) approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types (Bifidobacterium longum and Enterococcus faecalis). Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis. We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation. PMID:29724017

  17. Deciphering the mechanisms for targeting and interaction of Arabidopsis Lipid Droplet Associated Protein (LDAP) to the lipid droplet surface

    USDA-ARS?s Scientific Manuscript database

    We recently identified a new class of lipid-droplet associated proteins (LDAPs) in plants that share extensive sequence similarity with abundant structural proteins that coat rubber particles in rubber-producing plants. A majority of higher plants, however, including those that do not produce rubber...

  18. The DNA Bank: High-Security Bank Accounts to Protect and Share Your Genetic Identity.

    PubMed

    den Dunnen, Johan T

    2015-07-01

    With the cost of genome sequencing decreasing every day, DNA information has the potential of affecting the lives of everyone. Surprisingly, an individual has little knowledge about his own DNA information, can rarely access it, and has hardly any control over its use. This may result in preventable, life-threatening situations, and also significantly inhibits scientific progress. What we urgently need is a "DNA bank," a resource providing a secure personal account where, similar to a financial institution, you can store your DNA sequence. Using this private and secure DNA bank account, you govern your sequence-related business. For any genetic study performed, the data generated must be transferred (paid) to your DNA account. Using your account, you regulate access, knowing for what purpose (informed consent) and only for the genetic data you are willing to share. The DNA account ensures you are in the driver's seat, know what is known, and control what is happening with it. © 2015 WILEY PERIODICALS, INC.

  19. Comparison of intrinsic dynamics of cytochrome p450 proteins using normal mode analysis

    PubMed Central

    Dorner, Mariah E; McMunn, Ryan D; Bartholow, Thomas G; Calhoon, Brecken E; Conlon, Michelle R; Dulli, Jessica M; Fehling, Samuel C; Fisher, Cody R; Hodgson, Shane W; Keenan, Shawn W; Kruger, Alyssa N; Mabin, Justin W; Mazula, Daniel L; Monte, Christopher A; Olthafer, Augustus; Sexton, Ashley E; Soderholm, Beatrice R; Strom, Alexander M; Hati, Sanchita

    2015-01-01

    Cytochrome P450 enzymes are hemeproteins that catalyze the monooxygenation of a wide-range of structurally diverse substrates of endogenous and exogenous origin. These heme monooxygenases receive electrons from NADH/NADPH via electron transfer proteins. The cytochrome P450 enzymes, which constitute a diverse superfamily of more than 8,700 proteins, share a common tertiary fold but < 25% sequence identity. Based on their electron transfer protein partner, cytochrome P450 proteins are classified into six broad classes. Traditional methods of pro are based on the canonical paradigm that attributes proteins' function to their three-dimensional structure, which is determined by their primary structure that is the amino acid sequence. It is increasingly recognized that protein dynamics play an important role in molecular recognition and catalytic activity. As the mobility of a protein is an intrinsic property that is encrypted in its primary structure, we examined if different classes of cytochrome P450 enzymes display any unique patterns of intrinsic mobility. Normal mode analysis was performed to characterize the intrinsic dynamics of five classes of cytochrome P450 proteins. The present study revealed that cytochrome P450 enzymes share a strong dynamic similarity (root mean squared inner product > 55% and Bhattacharyya coefficient > 80%), despite the low sequence identity (< 25%) and sequence similarity (< 50%) across the cytochrome P450 superfamily. Noticeable differences in Cα atom fluctuations of structural elements responsible for substrate binding were noticed. These differences in residue fluctuations might be crucial for substrate selectivity in these enzymes. PMID:26130403

  20. Analysis of expressed sequence tags from Maize mosaic rhabdovirus-infected gut tissues of Peregrinus maidis reveals the presence of key components of insect innate immunity.

    PubMed

    Whitfield, A E; Rotenberg, D; Aritua, V; Hogenhout, S A

    2011-04-01

    The corn planthopper, Peregrinus maidis, causes direct feeding damage to plants and transmits Maize mosaic rhabdovirus (MMV) in a persistent-propagative manner. MMV must cross several insect tissue layers for successful transmission to occur, and the gut serves as an important barrier for rhabdovirus transmission. In order to facilitate the identification of proteins that may interact with MMV either by facilitating acquisition or responding to virus infection, we generated and analysed the gut transcriptome of P. maidis. From two normalized cDNA libraries, we generated a P. maidis gut transcriptome composed of 20,771 expressed sequence tags (ESTs). Assembly of the sequences yielded 1860 contigs and 14,032 singletons, and biological roles were assigned to 5793 (36%). Comparison of P. maidis ESTs with other insect amino acid sequences revealed that P. maidis shares greatest sequence similarity with another hemipteran, the brown planthopper Nilaparvata lugens. We identified 202 P. maidis transcripts with putative homology to proteins associated with insect innate immunity, including those implicated in the Toll, Imd, JAK/STAT, Jnk and the small-interfering RNA-mediated pathways. Sequence comparisons between our P. maidis gut EST collection and the currently available National Center for Biotechnology Information EST database collection for Ni. lugens revealed that a pathogen recognition receptor in the Imd pathway, peptidoglycan recognition protein-long class (PGRP-LC), is present in these two members of the family Delphacidae; however, these recognition receptors are lacking in the model hemipteran Acyrthosiphon pisum. In addition, we identified sequences in the P. maidis gut transcriptome that share significant amino acid sequence similarities with the rhabdovirus receptor molecule, acetylcholine receptor (AChR), found in other hosts. This EST analysis sheds new light on immune response pathways in hemipteran guts that will be useful for further dissecting innate defence response pathways to rhabdovirus infection. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.

  1. Eco-epidemiology of Novel Bartonella Genotypes from Parasitic Flies of Insectivorous Bats.

    PubMed

    Sándor, Attila D; Földvári, Mihály; Krawczyk, Aleksandra I; Sprong, Hein; Corduneanu, Alexandra; Barti, Levente; Görföl, Tamás; Estók, Péter; Kováts, Dávid; Szekeres, Sándor; László, Zoltán; Hornok, Sándor; Földvári, Gábor

    2018-04-29

    Bats are important zoonotic reservoirs for many pathogens worldwide. Although their highly specialized ectoparasites, bat flies (Diptera: Hippoboscoidea), can transmit Bartonella bacteria including human pathogens, their eco-epidemiology is unexplored. Here, we analyzed the prevalence and diversity of Bartonella strains sampled from 10 bat fly species from 14 European bat species. We found high prevalence of Bartonella spp. in most bat fly species with wide geographical distribution. Bat species explained most of the variance in Bartonella distribution with the highest prevalence of infected flies recorded in species living in dense groups exclusively in caves. Bat gender but not bat fly gender was also an important factor with the more mobile male bats giving more opportunity for the ectoparasites to access several host individuals. We detected high diversity of Bartonella strains (18 sequences, 7 genotypes, in 9 bat fly species) comparable with tropical assemblages of bat-bat fly association. Most genotypes are novel (15 out of 18 recorded strains have a similarity of 92-99%, with three sequences having 100% similarity to Bartonella spp. sequences deposited in GenBank) with currently unknown pathogenicity; however, 4 of these sequences are similar (up to 92% sequence similarity) to Bartonella spp. with known zoonotic potential. The high prevalence and diversity of Bartonella spp. suggests a long shared evolution of these bacteria with bat flies and bats providing excellent study targets for the eco-epidemiology of host-vector-pathogen cycles.

  2. Polynucleobacter bacteria in the brackish-water species Euplotes harpa (Ciliata Hypotrichia).

    PubMed

    Vannini, Claudia; Petroni, Giulio; Verni, Franco; Rosati, Giovanna

    2005-01-01

    We have found a Polynucleobacter bacterium in the cytoplasm of Euplotes harpa, a species living in a brackish-water habitat, with a cirral pattern not corresponding to that of the freshwater Euplotes species known to harbor this type of bacteria. The symbiont has been found in three strains of the species, obtained by clonal cultures from ciliates collected in different geographic regions. The 16S rRNA gene sequence of this bacterium identifies it as a member of the beta-proteobacterial genus Polynucleobacter. This sequence shares a high similarity value (98.4-98.5%) with P. necessarius, the type species of the genus, and is associated with 16S rRNA gene sequences of environmental clones and bacterial strains included in the Polynucleobacter cluster (>95%). An oligonucleotide probe was designed to corroborate the assignment of the retrieved sequence to the symbiont and to detect similar bacteria rapidly. Antibiotic experiments showed that the elimination of the bacteria stops the reproductive cycle in E. harpa, as has been shown for the freshwater Euplotes species.

  3. Molecular analysis of the split cox1 gene from the Basidiomycota Agrocybe aegerita: relationship of its introns with homologous Ascomycota introns and divergence levels from common ancestral copies.

    PubMed

    Gonzalez, P; Barroso, G; Labarère, J

    1998-10-05

    The Basidiomycota Agrocybe aegerita (Aa) mitochondrial cox1 gene (6790 nucleotides), encoding a protein of 527aa (58377Da), is split by four large subgroup IB introns possessing site-specific endonucleases assumed to be involved in intron mobility. When compared to other fungal COX1 proteins, the Aa protein is closely related to the COX1 one of the Basidiomycota Schizophyllum commune (Sc). This clade reveals a relationship with the studied Ascomycota ones, with the exception of Schizosaccharomyces pombe (Sp) which ranges in an out-group position compared with both higher fungi divisions. When comparison is extended to other kingdoms, fungal COX1 sequences are found to be more related to algae and plant ones (more than 57.5% aa similarity) than to animal sequences (53.6% aa similarity), contrasting with the previously established close relationship between fungi and animals, based on comparisons of nuclear genes. The four Aa cox1 introns are homologous to Ascomycota or algae cox1 introns sharing the same location within the exonic sequences. The percentages of identity of the intronic nucleotide sequences suggest a possible acquisition by lateral transfers of ancestral copies or of their derived sequences. These identities extend over the whole intronic sequences, arguing in favor of a transfer of the complete intron rather than a transfer limited to the encoded ORF. The intron i4 shares 74% of identity, at the nucleotidic level, with the Podospora anserina (Pa) intron i14, and up to 90.5% of aa similarity between the encoded proteins, i.e. the highest values reported to date between introns of two phylogenetically distant species. This low divergence argues for a recent lateral transfer between the two species. On the contrary, the low sequence identities (below 36%) observed between Aa i1 and the homologous Sp i1 or Prototheca wickeramii (Pw) i1 suggest a long evolution time after the separation of these sequences. The introns i2 and i3 possessed intermediate percentages of identity with their homologous Ascomycota introns. This is the first report of the complete nucleotide sequence and molecular organization of a mitochondrial cox1 gene of any member of the Basidiomycota division.

  4. Transfer of Pseudomonas flectens Johnson 1956 to Phaseolibacter gen. nov., in the family Enterobacteriaceae, as Phaseolibacter flectens gen. nov., comb. nov.

    PubMed

    Halpern, Malka; Fridman, Svetlana; Aizenberg-Gershtein, Yana; Izhaki, Ido

    2013-01-01

    Pseudomonas flectens Johnson 1956, a plant-pathogenic bacterium on the pods of the French bean, is no longer considered to be a member of the genus Pseudomonas sensu stricto. A polyphasic approach that included examination of phenotypic properties and phylogenetic analyses based on 16S rRNA, rpoB and atpD gene sequences supported the transfer of Pseudomonas flectens Johnson 1956 to a new genus in the family Enterobacteriaceae as Phaseolibacter flectens gen. nov., comb. nov. Two strains of Phaseolibacter flectens were studied (ATCC 12775(T) and LMG 2186); the strains shared 99.8 % sequence similarity in their 16S rRNA genes and the housekeeping gene sequences were identical. Strains of Phaseolibacter flectens shared 96.6 % or less 16S rRNA gene sequence similarity with members of different genera in the family Enterobacteriaceae and only 84.7 % sequence similarity with Pseudomonas aeruginosa LMG 1242(T), demonstrating that they are not related to the genus Pseudomonas. As Phaseolibacter flectens formed an independent phyletic lineage in all of the phylogenetic analyses, it could not be affiliated to any of the recognized genera within the family Enterobacteriaceae and therefore was assigned to a new genus. Cells were Gram-negative, straight rods, motile by means of one or two polar flagella, fermentative, facultative anaerobes, oxidase-negative and catalase-positive. Growth occurred in the presence of 0-60 % sucrose. The DNA G+C content of the type strain was 44.3 mol%. On the basis of phenotypic properties and phylogenetic distinctiveness, Pseudomonas flectens Johnson 1956 is transferred to the novel genus Phaseolibacter gen. nov. as Phaseolibacter flectens gen. nov., comb. nov. The type strain of Phaseolibacter flectens is ATCC 12775(T) = CFBP 3281(T) = ICMP 745(T) = LMG 2187(T) = NCPPB 539(T).

  5. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

    PubMed Central

    Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry. PMID:28056060

  6. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    PubMed

    Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry.

  7. Presence of a Shared 5'-Leader Sequence in Ancestral Human and Mammalian Retroviruses and Its Transduction into Feline Leukemia Virus.

    PubMed

    Kawasaki, Junna; Kawamura, Maki; Ohsato, Yoshiharu; Ito, Jumpei; Nishigaki, Kazuo

    2017-10-15

    Recombination events induce significant genetic changes, and this process can result in virus genetic diversity or in the generation of novel pathogenicity. We discovered a new recombinant feline leukemia virus (FeLV) gag gene harboring an unrelated insertion, termed the X region, which was derived from Felis catus endogenous gammaretrovirus 4 (FcERV-gamma4). The identified FcERV-gamma4 proviruses have lost their coding capabilities, but some can express their viral RNA in feline tissues. Although the X-region-carrying recombinant FeLVs appeared to be replication-defective viruses, they were detected in 6.4% of tested FeLV-infected cats. All isolated recombinant FeLV clones commonly incorporated a middle part of the FcERV-gamma4 5'-leader region as an X region. Surprisingly, a sequence corresponding to the portion contained in all X regions is also present in at least 13 endogenous retroviruses (ERVs) observed in the cat, human, primate, and pig genomes. We termed this shared genetic feature the commonly shared (CS) sequence. Despite our phylogenetic analysis indicating that all CS-sequence-carrying ERVs are classified as gammaretroviruses, no obvious closeness was revealed among these ERVs. However, the Shannon entropy in the CS sequence was lower than that in other parts of the provirus genome. Notably, the CS sequence of human endogenous retrovirus T had 73.8% similarity with that of FcERV-gamma4, and specific signals were detected in the human genome by Southern blot analysis using a probe for the FcERV-gamma4 CS sequence. Our results provide an interesting evolutionary history for CS-sequence circulation among several distinct ancestral viruses and a novel recombined virus over a prolonged period. IMPORTANCE Recombination among ERVs or modern viral genomes causes a rapid evolution of retroviruses, and this phenomenon can result in the serious situation of viral disease reemergence. We identified a novel recombinant FeLV gag gene that contains an unrelated sequence, termed the X region. This region originated from the 5' leader of FcERV-gamma4, a replication-incompetent feline ERV. Surprisingly, a sequence corresponding to the X region is also present in the 5' portion of other ERVs, including human endogenous retroviruses. Scattered copies of the ERVs carrying the unique genetic feature, here named the commonly shared (CS) sequence, were found in each host genome, suggesting that ancestral viruses may have captured and maintained the CS sequence. More recently, a novel recombinant FeLV hijacked the CS sequence from inactivated FcERV-gamma4 as the X region. Therefore, tracing the CS sequences can provide unique models for not only the modern reservoir of new recombinant viruses but also the genetic features shared among ancient retroviruses. Copyright © 2017 American Society for Microbiology.

  8. A Case-by-Case Evolutionary Analysis of Four Imprinted Retrogenes

    PubMed Central

    McCole, Ruth B; Loughran, Noeleen B; Chahal, Mandeep; Fernandes, Luis P; Roberts, Roland G; Fraternali, Franca; O'Connell, Mary J; Oakey, Rebecca J

    2011-01-01

    Retroposition is a widespread phenomenon resulting in the generation of new genes that are initially related to a parent gene via very high coding sequence similarity. We examine the evolutionary fate of four retrogenes generated by such an event; mouse Inpp5f_v2, Mcts2, Nap1l5, and U2af1-rs1. These genes are all subject to the epigenetic phenomenon of parental imprinting. We first provide new data on the age of these retrogene insertions. Using codon-based models of sequence evolution, we show these retrogenes have diverse evolutionary trajectories, including divergence from the parent coding sequence under positive selection pressure, purifying selection pressure maintaining parent-retrogene similarity, and neutral evolution. Examination of the expression pattern of retrogenes shows an atypical, broad pattern across multiple tissues. Protein 3D structure modeling reveals that a positively selected residue in U2af1-rs1, not shared by its parent, may influence protein conformation. Our case-by-case analysis of the evolution of four imprinted retrogenes reveals that this interesting class of imprinted genes, while similar in regulation and sequence characteristics, follow very varied evolutionary paths. PMID:21166792

  9. Reptiles and mammals have differentially retained long conserved noncoding sequences from the amniote ancestor.

    PubMed

    Janes, D E; Chapus, C; Gondo, Y; Clayton, D F; Sinha, S; Blatti, C A; Organ, C L; Fujita, M K; Balakrishnan, C N; Edwards, S V

    2011-01-01

    Many noncoding regions of genomes appear to be essential to genome function. Conservation of large numbers of noncoding sequences has been reported repeatedly among mammals but not thus far among birds and reptiles. By searching genomes of chicken (Gallus gallus), zebra finch (Taeniopygia guttata), and green anole (Anolis carolinensis), we quantified the conservation among birds and reptiles and across amniotes of long, conserved noncoding sequences (LCNS), which we define as sequences ≥500 bp in length and exhibiting ≥95% similarity between species. We found 4,294 LCNS shared between chicken and zebra finch and 574 LCNS shared by the two birds and Anolis. The percent of genomes comprised by LCNS in the two birds (0.0024%) is notably higher than the percent in mammals (<0.0003% to <0.001%), differences that we show may be explained in part by differences in genome-wide substitution rates. We reconstruct a large number of LCNS for the amniote ancestor (ca. 8,630) and hypothesize differential loss and substantial turnover of these sites in descendent lineages. By contrast, we estimated a small role for recruitment of LCNS via acquisition of novel functions over time. Across amniotes, LCNS are significantly enriched with transcription factor binding sites for many developmental genes, and 2.9% of LCNS shared between the two birds show evidence of expression in brain expressed sequence tag databases. These results show that the rate of retention of LCNS from the amniote ancestor differs between mammals and Reptilia (including birds) and that this may reflect differing roles and constraints in gene regulation.

  10. Reptiles and Mammals Have Differentially Retained Long Conserved Noncoding Sequences from the Amniote Ancestor

    PubMed Central

    Janes, D.E.; Chapus, C.; Gondo, Y.; Clayton, D.F.; Sinha, S.; Blatti, C.A.; Organ, C.L.; Fujita, M.K.; Balakrishnan, C.N.; Edwards, S.V.

    2010-01-01

    Many noncoding regions of genomes appear to be essential to genome function. Conservation of large numbers of noncoding sequences has been reported repeatedly among mammals but not thus far among birds and reptiles. By searching genomes of chicken (Gallus gallus), zebra finch (Taeniopygia guttata), and green anole (Anolis carolinensis), we quantified the conservation among birds and reptiles and across amniotes of long, conserved noncoding sequences (LCNS), which we define as sequences ≥500 bp in length and exhibiting ≥95% similarity between species. We found 4,294 LCNS shared between chicken and zebra finch and 574 LCNS shared by the two birds and Anolis. The percent of genomes comprised by LCNS in the two birds (0.0024%) is notably higher than the percent in mammals (<0.0003% to <0.001%), differences that we show may be explained in part by differences in genome-wide substitution rates. We reconstruct a large number of LCNS for the amniote ancestor (ca. 8,630) and hypothesize differential loss and substantial turnover of these sites in descendent lineages. By contrast, we estimated a small role for recruitment of LCNS via acquisition of novel functions over time. Across amniotes, LCNS are significantly enriched with transcription factor binding sites for many developmental genes, and 2.9% of LCNS shared between the two birds show evidence of expression in brain expressed sequence tag databases. These results show that the rate of retention of LCNS from the amniote ancestor differs between mammals and Reptilia (including birds) and that this may reflect differing roles and constraints in gene regulation. PMID:21183607

  11. Simple Shared Motifs (SSM) in conserved region of promoters: a new approach to identify co-regulation patterns.

    PubMed

    Gruel, Jérémy; LeBorgne, Michel; LeMeur, Nolwenn; Théret, Nathalie

    2011-09-12

    Regulation of gene expression plays a pivotal role in cellular functions. However, understanding the dynamics of transcription remains a challenging task. A host of computational approaches have been developed to identify regulatory motifs, mainly based on the recognition of DNA sequences for transcription factor binding sites. Recent integration of additional data from genomic analyses or phylogenetic footprinting has significantly improved these methods. Here, we propose a different approach based on the compilation of Simple Shared Motifs (SSM), groups of sequences defined by their length and similarity and present in conserved sequences of gene promoters. We developed an original algorithm to search and count SSM in pairs of genes. An exceptional number of SSM is considered as a common regulatory pattern. The SSM approach is applied to a sample set of genes and validated using functional gene-set enrichment analyses. We demonstrate that the SSM approach selects genes that are over-represented in specific biological categories (Ontology and Pathways) and are enriched in co-expressed genes. Finally we show that genes co-expressed in the same tissue or involved in the same biological pathway have increased SSM values. Using unbiased clustering of genes, Simple Shared Motifs analysis constitutes an original contribution to provide a clearer definition of expression networks.

  12. Simple Shared Motifs (SSM) in conserved region of promoters: a new approach to identify co-regulation patterns

    PubMed Central

    2011-01-01

    Background Regulation of gene expression plays a pivotal role in cellular functions. However, understanding the dynamics of transcription remains a challenging task. A host of computational approaches have been developed to identify regulatory motifs, mainly based on the recognition of DNA sequences for transcription factor binding sites. Recent integration of additional data from genomic analyses or phylogenetic footprinting has significantly improved these methods. Results Here, we propose a different approach based on the compilation of Simple Shared Motifs (SSM), groups of sequences defined by their length and similarity and present in conserved sequences of gene promoters. We developed an original algorithm to search and count SSM in pairs of genes. An exceptional number of SSM is considered as a common regulatory pattern. The SSM approach is applied to a sample set of genes and validated using functional gene-set enrichment analyses. We demonstrate that the SSM approach selects genes that are over-represented in specific biological categories (Ontology and Pathways) and are enriched in co-expressed genes. Finally we show that genes co-expressed in the same tissue or involved in the same biological pathway have increased SSM values. Conclusions Using unbiased clustering of genes, Simple Shared Motifs analysis constitutes an original contribution to provide a clearer definition of expression networks. PMID:21910886

  13. Molecular characterization of the full-length L and M RNAs of Tomato yellow ring virus, a member of the genus Tospovirus.

    PubMed

    Chen, Tsung-Chi; Li, Ju-Ting; Fan, Ya-Shu; Yeh, Yi-Chun; Yeh, Shyi-Dong; Kormelink, Richard

    2013-06-01

    Tomato yellow ring virus (TYRV), first isolated from tomato in Iran, was classified as a non-approved species of the genus Tospovirus based on the characterization of its genomic S RNA. In the current study, the complete sequences of the genomic L and M RNAs of TYRV were determined and analyzed. The L RNA has 8,877 nucleotides (nt) and codes in the viral complementary (vc) strand for the putative RNA-dependent RNA polymerase (RdRp) of 2,873 amino acids (aa) (331 kDa). The RdRp of TYRV shares the highest aa sequence identity (88.7 %) with that of Iris yellow spot virus (IYSV), and contains conserved motifs shared with those of the animal-infecting bunyaviruses. The M RNA contains 4,786 nt and codes in ambisense arrangement for the NSm protein of 308 aa (34.5 kDa) in viral sense, and the Gn/Gc glycoprotein precursor (GP) of 1,310 aa (128 kDa) in vc-sense. Phylogenetic analyses indicated that TYRV is closely clustered with IYSV and Polygonum ringspot virus (PolRSV). The NSm and GP of TYRV share the highest aa sequence identity with those of IYSV and PolRSV (89.9 and 80.2-86.5 %, respectively). Moreover, the GPs of TYRV, IYSV, and PolRSV share highly similar characteristics, among which an identical deduced N-terminal protease cleavage site that is distinct from all tospoviral GPs analyzed thus far. Taken together, the elucidation of the complete genome sequence and biological features of TYRV support a close ancestral relationship with IYSV and PolRSV.

  14. Identification and functional activity of a staphylocoagulase type XI variant originating from staphylococcal food poisoning isolates.

    PubMed

    Suzuki, Y; Matsushita, S; Kubota, H; Kobayashi, M; Murauchi, K; Higuchi, Y; Kato, R; Hirai, A; Sadamasu, K

    2016-09-01

    Staphylocoagulase, an extracellular protein secreted by Staphylococcus aureus, has been used as an epidemiological marker. At least 12 serotypes and 24 genotypes subdivided on the basis of nucleotide sequence have been reported to date. In this study, we identified a novel staphylocoagulase nucleotide sequence, coa310, from staphylococcal food poisoning isolates that had the ability to coagulate plasma, but could not be typed using the conventional method. The protein encoded by coa310 contained the six fundamental conserved domains of staphylocoagulase. The full-length nucleotide sequence of coa310 shared the highest similarity (77·5%) with that of staphylocoagulase-type (SCT) XIa. The sequence of the D1 region, which would be responsible for the determination of SCT, shared the highest similarity (91·8%) with that of SCT XIa. These results suggest that coa310 is a novel variant of SCT XI. Moreover, we demonstrated that coa310 encodes a functioning coagulase, by confirming the coagulating activity of the recombinant protein expressed from coa310. This is the first study to directly demonstrate that Coa310, a putative SCT XI, has coagulating activity. These findings may be useful for the improvement of the staphylocoagulase-typing method, including serotyping and genotyping. This is the first study to identify a novel variant of staphylocoagulase type XI based on its nucleotide sequence and to demonstrate coagulating activity in the variant using a recombinant protein. Elucidation of the variety of staphylocoagulases will provide suggestions for further improvement of the staphylocoagulase-typing method and contribute to our understanding of the epidemiologic characterization of Staphylococcus aureus. © 2016 The Society for Applied Microbiology.

  15. A candidate gene for choanal atresia in alpaca.

    PubMed

    Reed, Kent M; Bauer, Miranda M; Mendoza, Kristelle M; Armién, Aníbal G

    2010-03-01

    Choanal atresia (CA) is a common nasal craniofacial malformation in New World domestic camelids (alpaca and llama). CA results from abnormal development of the nasal passages and is especially debilitating to newborn crias. CA in camelids shares many of the clinical manifestations of a similar condition in humans (CHARGE syndrome). Herein we report on the regulatory gene CHD7 of alpaca, whose homologue in humans is most frequently associated with CHARGE. Sequence of the CHD7 coding region was obtained from a non-affected cria. The complete coding region was 9003 bp, corresponding to a translated amino acid sequence of 3000 aa. Additional genomic sequences corresponding to a significant portion of the CHD7 gene were identified and assembled from the 2x alpaca whole genome sequence, providing confirmatory sequence for much of the CHD7 coding region. The alpaca CHD7 mRNA sequence was 97.9% similar to the human sequence, with the greatest sequence difference being an insertion in exon 38 that results in a polyalanine repeat (A12). Polymorphism in this repeat was tested for association with CA in alpaca by cloning and sequencing the repeat from both affected and non-affected individuals. Variation in length of the poly-A repeat was not associated with CA. Complete sequencing of the CHD7 gene will be necessary to determine whether other mutations in CHD7 are the cause of CA in camelids.

  16. Response and recovery lessons from the 2010-2011 earthquake sequence in Canterbury, New Zealand

    USGS Publications Warehouse

    Pierepiekarz, Mark; Johnston, David; Berryman, Kelvin; Hare, John; Gomberg, Joan S.; Williams, Robert A.; Weaver, Craig S.

    2014-01-01

    The impacts and opportunities that result when low-probability moderate earthquakes strike an urban area similar to many throughout the US were vividly conveyed in a one-day workshop in which social and Earth scientists, public officials, engineers, and an emergency manager shared their experiences of the earthquake sequence that struck the city of Christchurch and surrounding Canterbury region of New Zealand in 2010-2011. Without question, the earthquake sequence has had unprecedented impacts in all spheres on New Zealand society, locally to nationally--10% of the country's population was directly impacted and losses total 8-10% of their GDP. The following paragraphs present a few lessons from Christchurch.

  17. Sequence analysis of the mitochondrial DNA control region of ciscoes (genus Coregonus): taxonomic implications for the Great Lakes species flock.

    PubMed

    Reed, K M; Dorschner, M O; Todd, T N; Phillips, R B

    1998-09-01

    Sequence variation in the control region (D-loop) of the mitochondrial DNA (mtDNA) was examined to assess the genetic distinctiveness of the shortjaw cisco (Coregonus zenithicus). Individuals from within the Great Lakes Basin as well as inland lakes outside the basin were sampled. DNA fragments containing the entire D-loop were amplified by PCR from specimens of C. zenithicus and the related species C. artedi, C. hoyi, C. kiyi, and C. clupeaformis. DNA sequence analysis revealed high similarity within and among species and shared polymorphism for length variants. Based on this analysis, the shortjaw cisco is not genetically distinct from other cisco species.

  18. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry)

    PubMed Central

    Villacreses, Javier; Rojas-Herrera, Marcelo; Sánchez, Carolina; Hewstone, Nicole; Undurraga, Soledad F.; Alzate, Juan F.; Manque, Patricio; Maracaja-Coutinho, Vinicius; Polanco, Victor

    2015-01-01

    Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1). High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs): ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV), Petuvirus genus. ORF1 encodes a movement protein (MP); ORF2 a Reverse Transcriptase (RT) and a Ribonuclease H (RNase H) domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs), AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq). Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant. PMID:25855242

  19. An Action Sequence Withheld in Memory Can Delay Execution of Visually Guided Actions: The Generalization of Response Compatibility Interference

    ERIC Educational Resources Information Center

    Wiediger, Matthew D.; Fournier, Lisa R.

    2008-01-01

    Withholding an action plan in memory for later execution can delay execution of another action, if the actions share a similar (compatible) action feature (i.e., response hand). This phenomenon, termed compatibility interference (CI), was found for identity-based actions that do not require visual guidance. The authors examined whether CI can…

  20. Genetic diversity in Trypanosoma theileri from Sri Lankan cattle and water buffaloes.

    PubMed

    Yokoyama, Naoaki; Sivakumar, Thillaiampalam; Fukushi, Shintaro; Tattiyapong, Muncharee; Tuvshintulga, Bumduuren; Kothalawala, Hemal; Silva, Seekkuge Susil Priyantha; Igarashi, Ikuo; Inoue, Noboru

    2015-01-30

    Trypanosoma theileri is a hemoprotozoan parasite that infects various ruminant species. We investigated the epidemiology of this parasite among cattle and water buffalo populations bred in Sri Lanka, using a diagnostic PCR assay based on the cathepsin L-like protein (CATL) gene. Blood DNA samples sourced from cattle (n=316) and water buffaloes (n=320) bred in different geographical areas of Sri Lanka were PCR screened for T. theileri. Parasite DNA was detected in cattle and water buffaloes alike in all the sampling locations. The overall T. theileri-positive rate was higher in water buffaloes (15.9%) than in cattle (7.6%). Subsequently, PCR amplicons were sequenced and the partial CATL sequences were phylogenetically analyzed. The identity values for the CATL gene were 89.6-99.7% among the cattle-derived sequences, compared with values of 90.7-100% for the buffalo-derived sequences. However, the cattle-derived sequences shared 88.2-100% identity values with those from buffaloes. In the phylogenetic tree, the Sri Lankan CATL gene sequences fell into two major clades (TthI and TthII), both of which contain CATL sequences from several other countries. Although most of the CATL sequences from Sri Lankan cattle and buffaloes clustered independently, two buffalo-derived sequences were observed to be closely related to those of the Sri Lankan cattle. Furthermore, a Sri Lankan buffalo sequence clustered with CATL gene sequences from Brazilian buffalo and Thai cattle. In addition to reporting the first PCR-based survey of T. theileri among Sri Lankan-bred cattle and water buffaloes, the present study found that some of the CATL gene fragments sourced from water buffaloes shared similarity with those determined from cattle in this country. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. ACLAME: a CLAssification of Mobile genetic Elements, update 2010.

    PubMed

    Leplae, Raphaël; Lima-Mendez, Gipsi; Toussaint, Ariane

    2010-01-01

    The ACLAME database is dedicated to the collection, analysis and classification of sequenced mobile genetic elements (MGEs, in particular phages and plasmids). In addition to providing information on the MGEs content, classifications are available at various levels of organization. At the gene/protein level, families group similar sequences that are expected to share the same function. Families of four or more proteins are manually assigned with a functional annotation using the GeneOntology and the locally developed ontology MeGO dedicated to MGEs. At the genome level, evolutionary cohesive modules group sets of protein families shared among MGEs. At the population level, networks display the reticulate evolutionary relationships among MGEs. To increase the coverage of the phage sequence space, ACLAME version 0.4 incorporates 760 high-quality predicted prophages selected from the Prophinder database. Most of the data can be downloaded from the freely accessible ACLAME web site (http://aclame.ulb.ac.be). The BLAST interface for querying the database has been extended and numerous tools for in-depth analysis of the results have been added.

  2. Mosaic Graphs and Comparative Genomics in Phage Communities

    PubMed Central

    Belcaid, Mahdi; Bergeron, Anne

    2010-01-01

    Abstract Comparing the genomes of two closely related viruses often produces mosaics where nearly identical sequences alternate with sequences that are unique to each genome. When several closely related genomes are compared, the unique sequences are likely to be shared with third genomes, leading to virus mosaic communities. Here we present comparative analysis of sets of Staphylococcus aureus phages that share large identical sequences with up to three other genomes, and with different partners along their genomes. We introduce mosaic graphs to represent these complex recombination events, and use them to illustrate the breath and depth of sequence sharing: some genomes are almost completely made up of shared sequences, while genomes that share very large identical sequences can adopt alternate functional modules. Mosaic graphs also allow us to identify breakpoints that could eventually be used for the construction of recombination networks. These findings have several implications on phage metagenomics assembly, on the horizontal gene transfer paradigm, and more generally on the understanding of the composition and evolutionary dynamics of virus communities. PMID:20874413

  3. Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

    PubMed

    Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

    2018-05-23

    Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

  4. K-shuff: A Novel Algorithm for Characterizing Structural and Compositional Diversity in Gene Libraries.

    PubMed

    Jangid, Kamlesh; Kao, Ming-Hung; Lahamge, Aishwarya; Williams, Mark A; Rathbun, Stephen L; Whitman, William B

    2016-01-01

    K-shuff is a new algorithm for comparing the similarity of gene sequence libraries, providing measures of the structural and compositional diversity as well as the significance of the differences between these measures. Inspired by Ripley's K-function for spatial point pattern analysis, the Intra K-function or IKF measures the structural diversity, including both the richness and overall similarity of the sequences, within a library. The Cross K-function or CKF measures the compositional diversity between gene libraries, reflecting both the number of OTUs shared as well as the overall similarity in OTUs. A Monte Carlo testing procedure then enables statistical evaluation of both the structural and compositional diversity between gene libraries. For 16S rRNA gene libraries from complex bacterial communities such as those found in seawater, salt marsh sediments, and soils, K-shuff yields reproducible estimates of structural and compositional diversity with libraries greater than 50 sequences. Similarly, for pyrosequencing libraries generated from a glacial retreat chronosequence and Illumina® libraries generated from US homes, K-shuff required >300 and 100 sequences per sample, respectively. Power analyses demonstrated that K-shuff is sensitive to small differences in Sanger or Illumina® libraries. This extra sensitivity of K-shuff enabled examination of compositional differences at much deeper taxonomic levels, such as within abundant OTUs. This is especially useful when comparing communities that are compositionally very similar but functionally different. K-shuff will therefore prove beneficial for conventional microbiome analysis as well as specific hypothesis testing.

  5. 'Candidatus Phytoplasma solani', a novel taxon associated with stolbur- and bois noir-related diseases of plants.

    PubMed

    Quaglino, Fabio; Zhao, Yan; Casati, Paola; Bulgari, Daniela; Bianco, Piero Attilio; Wei, Wei; Davis, Robert Edward

    2013-08-01

    Phytoplasmas classified in group 16SrXII infect a wide range of plants and are transmitted by polyphagous planthoppers of the family Cixiidae. Based on 16S rRNA gene sequence identity and biological properties, group 16SrXII encompasses several species, including 'Candidatus Phytoplasma australiense', 'Candidatus Phytoplasma japonicum' and 'Candidatus Phytoplasma fragariae'. Other group 16SrXII phytoplasma strains are associated with stolbur disease in wild and cultivated herbaceous and woody plants and with bois noir disease in grapevines (Vitis vinifera L.). Such latter strains have been informally proposed to represent a separate species, 'Candidatus Phytoplasma solani', but a formal description of this taxon has not previously been published. In the present work, stolbur disease strain STOL11 (STOL) was distinguished from reference strains of previously described species of the 'Candidatus Phytoplasma' genus based on 16S rRNA gene sequence similarity and a unique signature sequence in the 16S rRNA gene. Other stolbur- and bois noir-associated ('Ca. Phytoplasma solani') strains shared >99 % 16S rRNA gene sequence similarity with strain STOL11 and contained the signature sequence. 'Ca. Phytoplasma solani' is the only phytoplasma known to be transmitted by Hyalesthes obsoletus. Insect vectorship and molecular characteristics are consistent with the concept that diverse 'Ca. Phytoplasma solani' strains share common properties and represent an ecologically distinct gene pool. Phylogenetic analyses of 16S rRNA, tuf, secY and rplV-rpsC gene sequences supported this view and yielded congruent trees in which 'Ca. Phytoplasma solani' strains formed, within the group 16SrXII clade, a monophyletic subclade that was most closely related to, but distinct from, that of 'Ca. Phytoplasma australiense'-related strains. Based on distinct molecular and biological properties, stolbur- and bois noir-associated strains are proposed to represent a novel species level taxon, 'Ca. Phytoplasma solani'; STOL11 is designated the reference strain.

  6. Frontoxins, three-finger toxins from Micrurus frontalis venom, decrease miniature endplate potential amplitude at frog neuromuscular junction.

    PubMed

    Moreira, K G; Prates, M V; Andrade, F A C; Silva, L P; Beirão, P S L; Kushmerick, C; Naves, L A; Bloch, C

    2010-08-01

    Neurotoxicity is a major symptom of envenomation caused by Brazilian coral snake Micrurus frontalis. Due to the small amount of material that can be collected, no neurotoxin has been fully sequenced from this venom. In this work we report six new three-finger like toxins isolated from the venom of the coral snake M. frontalis which we named Frontoxin (FTx) I-VI. Toxins were purified using multiple steps of RP-HPLC. Molecular masses were determined by MALDI-TOF and ESI ion-trap mass spectrometry. The complete amino acid sequence of FTx II, III, IV and V were determined by sequencing of overlapping proteolytic fragments by Edman degradation and by de novo sequencing. The amino acid sequences of FTx I, II, III and VI predict 4 conserved disulphide bonds and structural similarity to previously reported short-chain alpha-neurotoxins. FTx IV and V each contained 10 conserved cysteines and share high similarity with long-chain alpha-neurotoxins. At the frog neuromuscular junction FTx II, III and IV reduced miniature endplate potential amplitudes in a time-and concentration-dependent manner suggesting Frontoxins block nicotinic acetylcholine receptors. Copyright 2010 Elsevier Ltd. All rights reserved.

  7. Functionally Convergent B Cell Receptor Sequences in Transgenic Rats Expressing a Human B Cell Repertoire in Response to Tetanus Toxoid and Measles Antigens.

    PubMed

    Bürckert, Jean-Philippe; Dubois, Axel R S X; Faison, William J; Farinelle, Sophie; Charpentier, Emilie; Sinner, Regina; Wienecke-Baldacchino, Anke; Muller, Claude P

    2017-01-01

    The identification and tracking of antigen-specific immunoglobulin (Ig) sequences within total Ig repertoires is central to high-throughput sequencing (HTS) studies of infections or vaccinations. In this context, public Ig sequences shared by different individuals exposed to the same antigen could be valuable markers for tracing back infections, measuring vaccine immunogenicity, and perhaps ultimately allow the reconstruction of the immunological history of an individual. Here, we immunized groups of transgenic rats expressing human Ig against tetanus toxoid (TT), Modified Vaccinia virus Ankara (MVA), measles virus hemagglutinin and fusion proteins expressed on MVA, and the environmental carcinogen benzo[a]pyrene, coupled to TT. We showed that these antigens impose a selective pressure causing the Ig heavy chain (IgH) repertoires of the rats to converge toward the expression of antibodies with highly similar IgH CDR3 amino acid sequences. We present a computational approach, similar to differential gene expression analysis, that selects for clusters of CDR3s with 80% similarity, significantly overrepresented within the different groups of immunized rats. These IgH clusters represent antigen-induced IgH signatures exhibiting stereotypic amino acid patterns including previously described TT- and measles-specific IgH sequences. Our data suggest that with the presented methodology, transgenic Ig rats can be utilized as a model to identify antigen-induced, human IgH signatures to a variety of different antigens.

  8. The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome.

    PubMed

    Albayrak, Levent; Khanipov, Kamil; Pimenova, Maria; Golovko, George; Rojas, Mark; Pavlidis, Ioannis; Chumakov, Sergei; Aguilar, Gerardo; Chávez, Arturo; Widger, William R; Fofanov, Yuriy

    2016-12-12

    Low-abundance mutations in mitochondrial populations (mutations with minor allele frequency ≤ 1%), are associated with cancer, aging, and neurodegenerative disorders. While recent progress in high-throughput sequencing technology has significantly improved the heteroplasmy identification process, the ability of this technology to detect low-abundance mutations can be affected by the presence of similar sequences originating from nuclear DNA (nDNA). To determine to what extent nDNA can cause false positive low-abundance heteroplasmy calls, we have identified mitochondrial locations of all subsequences that are common or similar (one mismatch allowed) between nDNA and mitochondrial DNA (mtDNA). Performed analysis revealed up to a 25-fold variation in the lengths of longest common and longest similar (one mismatch allowed) subsequences across the mitochondrial genome. The size of the longest subsequences shared between nDNA and mtDNA in several regions of the mitochondrial genome were found to be as low as 11 bases, which not only allows using these regions to design new, very specific PCR primers, but also supports the hypothesis of the non-random introduction of mtDNA into the human nuclear DNA. Analysis of the mitochondrial locations of the subsequences shared between nDNA and mtDNA suggested that even very short (36 bases) single-end sequencing reads can be used to identify low-abundance variation in 20.4% of the mitochondrial genome. For longer (76 and 150 bases) reads, the proportion of the mitochondrial genome where nDNA presence will not interfere found to be 44.5 and 67.9%, when low-abundance mutations at 100% of locations can be identified using 417 bases long single reads. This observation suggests that the analysis of low-abundance variations in mitochondria population can be extended to a variety of large data collections such as NCBI Sequence Read Archive, European Nucleotide Archive, The Cancer Genome Atlas, and International Cancer Genome Consortium.

  9. Characterization of 47 MHC class I sequences in Filipino cynomolgus macaques

    PubMed Central

    Campbell, Kevin J.; Detmer, Ann M.; Karl, Julie A.; Wiseman, Roger W.; Blasky, Alex J.; Hughes, Austin L.; Bimber, Benjamin N.; O’Connor, Shelby L.; O’Connor, David H.

    2009-01-01

    Cynomolgus macaques (Macaca fascicularis) provide increasingly common models for infectious disease research. Several geographically distinct populations of these macaques from Southeast Asia and the Indian Ocean island of Mauritius are available for pathogenesis studies. Though host genetics may profoundly impact results of such studies, similarities and differences between populations are often overlooked. In this study we identified 47 full-length MHC class I nucleotide sequences in 16 cynomolgus macaques of Filipino origin. The majority of MHC class I sequences characterized (39 of 47) were unique to this regional population. However, we discovered eight sequences with perfect identity and six sequences with close similarity to previously defined MHC class I sequences from other macaque populations. We identified two ancestral MHC haplotypes that appear to be shared between Filipino and Mauritian cynomolgus macaques, notably a Mafa-B haplotype that has previously been shown to protect Mauritian cynomolgus macaques against challenge with a simian/human immunodeficiency virus, SHIV89.6P. We also identified a Filipino cynomolgus macaque MHC class I sequence for which the predicted protein sequence differs from Mamu-B*17 by a single amino acid. This is important because Mamu-B*17 is strongly associated with protection against simian immunodeficiency virus (SIV) challenge in Indian rhesus macaques. These findings have implications for the evolutionary history of Filipino cynomolgus macaques as well as for the use of this model in SIV/SHIV research protocols. PMID:19107381

  10. Function-based classification of carbohydrate-active enzymes by recognition of short, conserved peptide motifs.

    PubMed

    Busk, Peter Kamp; Lange, Lene

    2013-06-01

    Functional prediction of carbohydrate-active enzymes is difficult due to low sequence identity. However, similar enzymes often share a few short motifs, e.g., around the active site, even when the overall sequences are very different. To exploit this notion for functional prediction of carbohydrate-active enzymes, we developed a simple algorithm, peptide pattern recognition (PPR), that can divide proteins into groups of sequences that share a set of short conserved sequences. When this method was used on 118 glycoside hydrolase 5 proteins with 9% average pairwise identity and representing four characterized enzymatic functions, 97% of the proteins were sorted into groups correlating with their enzymatic activity. Furthermore, we analyzed 8,138 glycoside hydrolase 13 proteins including 204 experimentally characterized enzymes with 28 different functions. There was a 91% correlation between group and enzyme activity. These results indicate that the function of carbohydrate-active enzymes can be predicted with high precision by finding short, conserved motifs in their sequences. The glycoside hydrolase 61 family is important for fungal biomass conversion, but only a few proteins of this family have been functionally characterized. Interestingly, PPR divided 743 glycoside hydrolase 61 proteins into 16 subfamilies useful for targeted investigation of the function of these proteins and pinpointed three conserved motifs with putative importance for enzyme activity. Furthermore, the conserved sequences were useful for cloning of new, subfamily-specific glycoside hydrolase 61 proteins from 14 fungi. In conclusion, identification of conserved sequence motifs is a new approach to sequence analysis that can predict carbohydrate-active enzyme functions with high precision.

  11. Complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera, and comparative analyses with other grass genomes

    PubMed Central

    Saski, Christopher; Lee, Seung-Bum; Fjellheim, Siri; Guda, Chittibabu; Jansen, Robert K.; Luo, Hong; Tomkins, Jeffrey; Rognli, Odd Arne; Clarke, Jihong Liu

    2009-01-01

    Comparisons of complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera to six published grass chloroplast genomes reveal that gene content and order are similar but two microstructural changes have occurred. First, the expansion of the IR at the SSC/IRa boundary that duplicates a portion of the 5′ end of ndhH is restricted to the three genera of the subfamily Pooideae (Agrostis, Hordeum and Triticum). Second, a 6 bp deletion in ndhK is shared by Agrostis, Hordeum, Oryza and Triticum, and this event supports the sister relationship between the subfamilies Erhartoideae and Pooideae. Repeat analysis identified 19–37 direct and inverted repeats 30 bp or longer with a sequence identity of at least 90%. Seventeen of the 26 shared repeats are found in all the grass chloroplast genomes examined and are located in the same genes or intergenic spacer (IGS) regions. Examination of simple sequence repeats (SSRs) identified 16–21 potential polymorphic SSRs. Five IGS regions have 100% sequence identity among Zea mays, Saccharum officinarum and Sorghum bicolor, whereas no spacer regions were identical among Oryza sativa, Triticum aestivum, H. vulgare and A. stolonifera despite their close phylogenetic relationship. Alignment of EST sequences and DNA coding sequences identified six C–U conversions in both Sorghum bicolor and H. vulgare but only one in A. stolonifera. Phylogenetic trees based on DNA sequences of 61 protein-coding genes of 38 taxa using both maximum parsimony and likelihood methods provide moderate support for a sister relationship between the subfamilies Erhartoideae and Pooideae. PMID:17534593

  12. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  13. Genome-wide analysis of the homeodomain-leucine zipper (HD-ZIP) gene family in peach (Prunus persica).

    PubMed

    Zhang, C H; Ma, R J; Shen, Z J; Sun, X; Korir, N K; Yu, M L

    2014-04-08

    In this study, 33 homeodomain-leucine zipper (HD-ZIP) genes were identified in peach using the HD-ZIP amino acid sequences of Arabidopsis thaliana as a probe. Based on the phylogenetic analysis and the individual gene or protein characteristics, the HD-ZIP gene family in peach can be classified into 4 subfamilies, HD-ZIP I, II, III, and IV, containing 14, 7, 4, and 8 members, respectively. The most closely related peach HD-ZIP members within the same subfamilies shared very similar gene structure in terms of either intron/exon numbers or lengths. Almost all members of the same subfamily shared common motif compositions, thereby implying that the HD-ZIP proteins within the same subfamily may have functional similarity. The 33 peach HD-ZIP genes were distributed across scaffolds 1 to 7. Although the primary structure varied among HD-ZIP family proteins, their tertiary structures were similar. The results from this study will be useful in selecting candidate genes from specific subfamilies for functional analysis.

  14. Characterization of Intestinal Bacteria in Wild and Domesticated Adult Black Tiger Shrimp (Penaeus monodon)

    PubMed Central

    Rungrassamee, Wanilada; Klanchui, Amornpan; Maibunkaew, Sawarot; Chaiyapechara, Sage; Jiravanichpaisal, Pikul; Karoonuthaisiri, Nitsara

    2014-01-01

    The black tiger shrimp (Penaeus monodon) is a marine crustacean of economic importance in the world market. To ensure sustainability of the shrimp industry, production capacity and disease outbreak prevention must be improved. Understanding healthy microbial balance inside the shrimp intestine can provide an initial step toward better farming practice and probiotic applications. In this study, we employed a barcode pyrosequencing analysis of V3-4 regions of 16S rRNA genes to examine intestinal bacteria communities in wild-caught and domesticated P. monodon broodstock. Shrimp faeces were removed from intestines prior to further analysis in attempt to identify mucosal bacterial population. Five phyla, Actinobacteria, Fusobacteria, Proteobacteria, Firmicutes and Bacteroidetes, were found in all shrimp from both wild and domesticated environments. The operational taxonomic unit (OTU) was assigned at 97% sequence identity, and our pyrosequencing results identified 18 OTUs commonly found in both groups. Sequences of the shared OTUs were similar to bacteria in three phyla, namely i) Proteobacteria (Vibrio, Photobacterium, Novosphingobium, Pseudomonas, Sphingomonas and Undibacterium), ii) Firmicutes (Fusibacter), and iii) Bacteroidetes (Cloacibacterium). The shared bacterial members in P. monodon from two different habitats provide evidence that the internal environments within the host shrimp also exerts selective pressure on bacterial members. Intestinal bacterial profiles were compared using denaturing gradient gel electrophoresis (DGGE). The sequences from DGGE bands were similar to those of Vibrio and Photobacterium in all shrimp, consistent with pyrosequencing results. This work provides the first comprehensive report on bacterial populations in the intestine of adult black tiger shrimp and reveals some similar bacterial members between the intestine of wild-caught and domesticated shrimp. PMID:24618668

  15. The Genome of Gryllus bimaculatus Nudivirus Indicates an Ancient Diversification of Baculovirus-Related Nonoccluded Nudiviruses of Insects▿

    PubMed Central

    Wang, Yongjie; Kleespies, Regina G.; Huger, Alois M.; Jehle, Johannes A.

    2007-01-01

    The Gryllus bimaculatus nudivirus (GbNV) infects nymphs and adults of the cricket Gryllus bimaculatus (Orthoptera: Gryllidae). GbNV and other nudiviruses such as Heliothis zea nudivirus 1 (HzNV-1) and Oryctes rhinoceros nudivirus (OrNV) were previously called “nonoccluded baculoviruses” as they share some similar structural, genomic, and replication aspects with members of the family Baculoviridae. Their relationships to each other and to baculoviruses are elucidated by the sequence of the complete genome of GbNV, which is 96,944 bp, has an AT content of 72%, and potentially contains 98 predicted protein-coding open reading frames (ORFs). Forty-one ORFs of GbNV share sequence similarities with ORFs found in OrNV, HzNV-1, baculoviruses, and bacteria. Most notably, 15 GbNV ORFs are homologous to the baculovirus core genes, which are associated with transcription (lef-8, lef-9, lef-4, vlf-1, and lef-5), replication (dnapol), structural proteins (p74, pif-1, pif-2, pif-3, vp91, and odv-e56), and proteins of unknown function (38K, ac81, and 19kda). Homologues to these baculovirus core genes have been predicted in HzNV-1 as well. Six GbNV ORFs are homologous to nonconserved baculovirus genes dnaligase, helicase 2, rr1, rr2, iap-3, and desmoplakin. However, the remaining 57 ORFs revealed no homology or poor similarities to the current gene databases. No homologous repeat (hr) sequences but fourteen short direct repeat (dr) regions were detected in the GbNV genome. Gene content and sequence similarity suggest that the nudiviruses GbNV, HzNV-1, and OrNV form a monophyletic group of nonoccluded double-stranded DNA viruses, which separated from the baculovirus lineage before this radiated into dipteran-, hymenopteran-, and lepidopteran-specific clades of occluded nucleopolyhedroviruses and granuloviruses. The accumulated information on the GbNV genome suggests that nudiviruses form a highly diverse and phylogenetically ancient sister group of the baculoviruses, which have evolved in a variety of highly divergent host orders. PMID:17360757

  16. Draft genome sequence of Thermoanaerobacterium sp. strain PSU-2 isolated from thermophilic hydrogen producing reactor.

    PubMed

    O-Thong, Sompong; Khongkliang, Peerawat; Mamimin, Chonticha; Singkhala, Apinya; Prasertsan, Poonsuk; Birkeland, Nils-Kåre

    2017-06-01

    Thermoanaerobacterium sp. strain PSU-2 was isolated from thermophilic hydrogen producing reactor and subjected to draft genome sequencing on 454 pyrosequencing and annotated on RAST. The draft genome sequence of strain PSU-2 contains 2,552,497 bases with an estimated G + C content of 35.2%, 2555 CDS, 8 rRNAs and 57 tRNAs. The strain had a number of genes responsible for carbohydrates metabolic, amino acids and derivatives, and protein metabolism of 17.7%, 14.39% and 9.81%, respectively. Strain PSU-2 also had gene responsible for hydrogen biosynthesis as well as the genes related to Ni-Fe hydrogenase. Comparative genomic analysis indicates strain PSU-2 shares about 94% genome sequence similarity with Thermoanaerobacterium xylanolyticum LX-11. The nucleotide sequence of this draft genome was deposited into DDBJ/ENA/GenBank under the accession MSQD00000000.

  17. Identification of a novel vitivirus from grapevines in New Zealand.

    PubMed

    Blouin, Arnaud G; Keenan, Sandi; Napier, Kathryn R; Barrero, Roberto A; MacDiarmid, Robin M

    2018-01-01

    We report a sequence of a novel vitivirus from Vitis vinifera obtained using two high-throughput sequencing (HTS) strategies on RNA. The initial discovery from small-RNA sequencing was confirmed by HTS of the total RNA and Sanger sequencing. The new virus has a genome structure similar to the one reported for other vitiviruses, with five open reading frames (ORFs) coding for the conserved domains described for members of that genus. Phylogenetic analysis of the complete genome sequence confirmed its affiliation to the genus Vitivirus, with the closest described viruses being grapevine virus E (GVE) and Agave tequilana leaf virus (ATLV). However, the virus we report is distinct and shares only 51% amino acid sequence identity with GVE in the replicase polyprotein and 66.8% amino acid sequence identity with ATLV in the coat protein. This is well below the threshold determined by the ICTV for species demarcation, and we propose that this virus represents a new species. It is provisionally named "grapevine virus G".

  18. Morphological and molecular characterization of an uninucleated cyst-producing Entamoeba spp. in captured Rangeland goats in Western Australia.

    PubMed

    Al-Habsi, Khalid; Yang, Rongchang; Ryan, Una; Jacobson, Caroline; Miller, David W

    2017-02-15

    Uninucleated Entamoeba cysts measuring 7.3×7.7μm were detected in faecal samples collected from wild Rangeland goats (Capra hircus) after arrival at a commercial goat depot near Geraldton, Western Australia at a prevalence of 6.4% (8/125). Sequences were obtained at the 18S rRNA (n=8) and actin (n=5) loci following PCR amplification. At the 18S locus, phylogenetic analysis grouped the isolates closest with an E. bovis isolate (FN666250) from a sheep from Sweden with 99% similarity. At the actin locus, no E. bovis sequences were available, and the isolates shared 94.0% genetic similarity with E. suis from a pig in Western Japan. This is the first report to describe the morphology and molecular characterisation of Entamoeba from Rangeland goats in Western Australia and the first study to produce actin sequences from E. bovis-like Entamoeba sp. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. The mitochondrial genome of Pocillopora (Cnidaria: Scleractinia) contains two variable regions: the putative D-loop and a novel ORF of unknown function.

    PubMed

    Flot, Jean-François; Tillier, Simon

    2007-10-15

    The complete mitochondrial genomes of two individuals attributed to different morphospecies of the scleractinian coral genus Pocillopora have been sequenced. Both genomes, respectively 17,415 and 17,422 nt long, share the presence of a previously undescribed ORF encoding a putative protein made up of 302 amino acids and of unknown function. Surprisingly, this ORF turns out to be the second most variable region of the mitochondrial genome (1% nucleotide sequence difference between the two individuals) after the putative control region (1.5% sequence difference). Except for the presence of this ORF and for the location of the putative control region, the mitochondrial genome of Pocillopora is organized in a fashion similar to the other scleractinian coral genomes published to date. For the first time in a cnidarian, a putative second origin of replication is described based on its secondary structure similar to the stem-loop structure of O(L), the origin of L-strand replication in vertebrates.

  20. The siRNA Non-seed Region and Its Target Sequences Are Auxiliary Determinants of Off-Target Effects.

    PubMed

    Kamola, Piotr J; Nakano, Yuko; Takahashi, Tomoko; Wilson, Paul A; Ui-Tei, Kumiko

    2015-12-01

    RNA interference (RNAi) is a powerful tool for post-transcriptional gene silencing. However, the siRNA guide strand may bind unintended off-target transcripts via partial sequence complementarity by a mechanism closely mirroring micro RNA (miRNA) silencing. To better understand these off-target effects, we investigated the correlation between sequence features within various subsections of siRNA guide strands, and its corresponding target sequences, with off-target activities. Our results confirm previous reports that strength of base-pairing in the siRNA seed region is the primary factor determining the efficiency of off-target silencing. However, the degree of downregulation of off-target transcripts with shared seed sequence is not necessarily similar, suggesting that there are additional auxiliary factors that influence the silencing potential. Here, we demonstrate that both the melting temperature (Tm) in a subsection of siRNA non-seed region, and the GC contents of its corresponding target sequences, are negatively correlated with the efficiency of off-target effect. Analysis of experimentally validated miRNA targets demonstrated a similar trend, indicating a putative conserved mechanistic feature of seed region-dependent targeting mechanism. These observations may prove useful as parameters for off-target prediction algorithms and improve siRNA 'specificity' design rules.

  1. Complete genome sequence of a Chinese isolate of pepper vein yellows virus and evolutionary analysis based on the CP, MP and RdRp coding regions.

    PubMed

    Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun

    2016-03-01

    The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.

  2. [Detection and diversity analysis of rumen methanogens in the co-cultures with anaerobic fungi].

    PubMed

    Cheng, Yan-fen; Mao, Sheng-yong; Pei, Cai-xia; Liu, Jian-xin; Zhu, Wei-yun

    2006-12-01

    Rumen methanogen diversity in the co-cultures with anaerobic fungi from goat rumen was analyzed. Mix-cultures of anaerobic fungi and methanogens were obtained from goat rumen using anaerobic fungal medium and the addition of penicillin and streptomycin and then subcultured 62 times by transferring cultures every 3 - 4d. Total DNA from the original rumen fluid and subcultured fungal cultures was used for PCR/DGGE and RFLP analysis. 16S rDNA of clones corresponding to representative OTUs were sequenced. Results showed that the diversity index (Shannon index) of the methanogens generated from DGGE profiles reduced from 1.32 to 0.99 from rumen fluid to fungal culture after 45 subculturing, with the lowest similarity of DGGE profiles at 34.7%. The Shannon index increased from 0.99 to 1.15 from the fungal culture after 45 subculturing to that after 62 subculturing, with the lowest similarity at 89.2% . A total of 5 OTUs were obtained from 69. clones using RFLP analysis and six clones representing the 5 OTUs respectively were sequenced. Of the 5 OTUs, three had their cloned 16S rDNA sequences most closely related to uncultured archaeal symbiont PA202 with the same similarity of 95 %, but had not closely related to any identified culturable methanogen. The rest two OTUs had their cloned 16S rDNA sequences sharing the same closest relative, uncultured rumen methanogen 956, with the same similarity of 97% .Their 16S rDNA sequences of these two OTUs also showed 97% similar to the closest identified culturable methanogen Methanobrevibacter sp. NT7. In conclusion, diverse yet unidentified rumen methanogen species exist in the co-cultures with anaerobic fungi isolated from the goat rumen.

  3. De novo assembly and characterization of the transcriptome in the desiccation-tolerant moss Syntrichia caninervis

    PubMed Central

    2014-01-01

    Background Syntrichia caninervis is a desiccation-tolerant moss and the dominant bryophyte of the Biological Soil Crusts (BSCs) found in the Mojave and Gurbantunggut deserts. Next generation high throughput sequencing technologies offer an efficient and economic choice for characterizing non-model organism transcriptomes with little or no prior molecular information available. Results In this study, we employed next generation, high-throughput, Illumina RNA-Seq to analyze the poly-(A) + mRNA from hydrated, dehydrating and desiccated S. caninervis gametophores. Approximately 58.0 million paired-end short reads were obtained and 92,240 unigenes were assembled with an average size of 493 bp, N50 value of 662 bp and a total size of 45.48 Mbp. Sequence similarity searches against five public databases (NR, Swiss-Prot, COSMOSS, KEGG and COG) found 54,125 unigenes (58.7%) with significant similarity to an existing sequence (E-value ≤ 1e-5) and could be annotated. Gene Ontology (GO) annotation assigned 24,183 unigenes to the three GO terms: Biological Process, Cellular Component or Molecular Function. GO comparison between P. patens and S. caninervis demonstrated similar sequence enrichment across all three GO categories. 29,370 deduced polypeptide sequences were assigned Pfam domain information and categorized into 4,212 Pfam domains/families. Using the PlantTFDB, 778 unigenes were predicted to be involved in the regulation of transcription and were classified into 49 transcription factor families. Annotated unigenes were mapped to the KEGG pathways and further annotated using MapMan. Comparative genomics revealed that 44% of protein families are shared in common by S. caninervis, P. patens and Arabidopsis thaliana and that 80% are shared by both moss species. Conclusions This study is one of the first comprehensive transcriptome analyses of the moss S. caninervis. Our data extends our knowledge of bryophyte transcriptomes, provides an insight to plants adapted to the arid regions of central Asia, and continues the development of S. caninervis as a model for understanding the molecular aspects of desiccation-tolerance. PMID:25086984

  4. Telomere biology of trypanosomatids: beginning to answer some questions.

    PubMed

    Lira, Cristina B B; Giardini, Miriam A; Neto, Jair L Siqueira; Conte, Fábio F; Cano, Maria Isabel N

    2007-08-01

    Studies of telomere structure and maintenance in trypanosomatids have provided insights into the evolutionary origin and conservation of some telomeric components shared by trypanosomes and vertebrates. For example, trypanosomatid telomeres are maintained by telomerase and consist of the canonical TTAGGG repeats, which in Trypanosoma brucei can form telomeric loops (t-loops). However, the telomeric chromatin of trypanosomatids is composed of organism-specific proteins and other proteins that share little sequence similarity with their vertebrate counterparts. Because telomere maintenance mechanisms are essential for genome stability, we propose that the particular features shown by the trypanosome telomeric chromatin hold the key for the design of antiparasitic drugs.

  5. Cellulose in Cyanobacteria. Origin of Vascular Plant Cellulose Synthase?

    PubMed Central

    Nobles, David R.; Romanovicz, Dwight K.; Brown, R. Malcolm

    2001-01-01

    Although cellulose biosynthesis among the cyanobacteria has been suggested previously, we present the first conclusive evidence, to our knowledge, of the presence of cellulose in these organisms. Based on the results of x-ray diffraction, electron microscopy of microfibrils, and cellobiohydrolase I-gold labeling, we report the occurrence of cellulose biosynthesis in nine species representing three of the five sections of cyanobacteria. Sequence analysis of the genomes of four cyanobacteria revealed the presence of multiple amino acid sequences bearing the DDD35QXXRW motif conserved in all cellulose synthases. Pairwise alignments demonstrated that CesAs from plants were more similar to putative cellulose synthases from Anabaena sp. Pasteur Culture Collection 7120 and Nostoc punctiforme American Type Culture Collection 29133 than any other cellulose synthases in the database. Multiple alignments of putative cellulose synthases from Anabaena sp. Pasteur Culture Collection 7120 and N. punctiforme American Type Culture Collection 29133 with the cellulose synthases of other prokaryotes, Arabidopsis, Gossypium hirsutum, Populus alba × Populus tremula, corn (Zea mays), and Dictyostelium discoideum showed that cyanobacteria share an insertion between conserved regions U1 and U2 found previously only in eukaryotic sequences. Furthermore, phylogenetic analysis indicates that the cyanobacterial cellulose synthases share a common branch with CesAs of vascular plants in a manner similar to the relationship observed with cyanobacterial and chloroplast 16s rRNAs, implying endosymbiotic transfer of CesA from cyanobacteria to plants and an ancient origin for cellulose synthase in eukaryotes. PMID:11598227

  6. Sequence analysis of the mitochondrial DNA control region of ciscoes (genus Coregonus): Taxonomic implications for the Great Lakes species flock

    USGS Publications Warehouse

    Reed, Kent M.; Dorschner, Michael O.; Todd, Thomas N.; Phillips, Ruth B.

    1998-01-01

    Sequence variation in the control region (D-loop) of the mitochondrial DNA (mtDNA) was examined to assess the genetic distinctiveness of the shortjaw cisco (Coregonus zenithicus). Individuals from within the Great Lakes Basin as well as inland lakes outside the basin were sampled. DNA fragments containing the entire D-loop were amplified by PCR from specimens ofC. zenithicus and the related species C. artedi, C. hoyi, C. kiyi, and C. clupeaformis. DNA sequence analysis revealed high similarity within and among species and shared polymorphism for length variants. Based on this analysis, the shortjaw cisco is not genetically distinct from other cisco species.

  7. Chloroplast genomes of Arabidopsis halleri ssp. gemmifera and Arabidopsis lyrata ssp. petraea: Structures and comparative analysis.

    PubMed

    Asaf, Sajjad; Khan, Abdul Latif; Khan, Muhammad Aaqil; Waqas, Muhammad; Kang, Sang-Mo; Yun, Byung-Wook; Lee, In-Jung

    2017-08-08

    We investigated the complete chloroplast (cp) genomes of non-model Arabidopsis halleri ssp. gemmifera and Arabidopsis lyrata ssp. petraea using Illumina paired-end sequencing to understand their genetic organization and structure. Detailed bioinformatics analysis revealed genome sizes of both subspecies ranging between 154.4~154.5 kbp, with a large single-copy region (84,197~84,158 bp), a small single-copy region (17,738~17,813 bp) and pair of inverted repeats (IRa/IRb; 26,264~26,259 bp). Both cp genomes encode 130 genes, including 85 protein-coding genes, eight ribosomal RNA genes and 37 transfer RNA genes. Whole cp genome comparison of A. halleri ssp. gemmifera and A. lyrata ssp. petraea, along with ten other Arabidopsis species, showed an overall high degree of sequence similarity, with divergence among some intergenic spacers. The location and distribution of repeat sequences were determined, and sequence divergences of shared genes were calculated among related species. Comparative phylogenetic analysis of the entire genomic data set and 70 shared genes between both cp genomes confirmed the previous phylogeny and generated phylogenetic trees with the same topologies. The sister species of A. halleri ssp. gemmifera is A. umezawana, whereas the closest relative of A. lyrata spp. petraea is A. arenicola.

  8. Conserved Features in the Structure, Mechanism, and Biogenesis of the Inverse Autotransporter Protein Family

    PubMed Central

    Heinz, Eva; Stubenrauch, Christopher J.; Grinter, Rhys; Croft, Nathan P.; Purcell, Anthony W.; Strugnell, Richard A.; Dougan, Gordon; Lithgow, Trevor

    2016-01-01

    The bacterial cell surface proteins intimin and invasin are virulence factors that share a common domain structure and bind selectively to host cell receptors in the course of bacterial pathogenesis. The β-barrel domains of intimin and invasin show significant sequence and structural similarities. Conversely, a variety of proteins with sometimes limited sequence similarity have also been annotated as “intimin-like” and “invasin” in genome datasets, while other recent work on apparently unrelated virulence-associated proteins ultimately revealed similarities to intimin and invasin. Here we characterize the sequence and structural relationships across this complex protein family. Surprisingly, intimins and invasins represent a very small minority of the sequence diversity in what has been previously the “intimin/invasin protein family”. Analysis of the assembly pathway for expression of the classic intimin, EaeA, and a characteristic example of the most prevalent members of the group, FdeC, revealed a dependence on the translocation and assembly module as a common feature for both these proteins. While the majority of the sequences in the grouping are most similar to FdeC, a further and widespread group is two-partner secretion systems that use the β-barrel domain as the delivery device for secretion of a variety of virulence factors. This comprehensive analysis supports the adoption of the “inverse autotransporter protein family” as the most accurate nomenclature for the family and, in turn, has important consequences for our overall understanding of the Type V secretion systems of bacterial pathogens. PMID:27190006

  9. Genome-wide analysis of putative peroxiredoxin in unicellular and filamentous cyanobacteria.

    PubMed

    Cui, Hongli; Wang, Yipeng; Wang, Yinchu; Qin, Song

    2012-11-16

    Cyanobacteria are photoautotrophic prokaryotes with wide variations in genome sizes and ecological habitats. Peroxiredoxin (PRX) is an important protein that plays essential roles in protecting own cells against reactive oxygen species (ROS). PRXs have been identified from mammals, fungi and higher plants. However, knowledge on cyanobacterial PRXs still remains obscure. With the availability of 37 sequenced cyanobacterial genomes, we performed a comprehensive comparative analysis of PRXs and explored their diversity, distribution, domain structure and evolution. Overall 244 putative prx genes were identified, which were abundant in filamentous diazotrophic cyanobacteria, Acaryochloris marina MBIC 11017, and unicellular cyanobacteria inhabiting freshwater and hot-springs, while poor in all Prochlorococcus and marine Synechococcus strains. Among these putative genes, 25 open reading frames (ORFs) encoding hypothetical proteins were identified as prx gene family members and the others were already annotated as prx genes. All 244 putative PRXs were classified into five major subfamilies (1-Cys, 2-Cys, BCP, PRX5_like, and PRX-like) according to their domain structures. The catalytic motifs of the cyanobacterial PRXs were similar to those of eukaryotic PRXs and highly conserved in all but the PRX-like subfamily. Classical motif (CXXC) of thioredoxin was detected in protein sequences from the PRX-like subfamily. Phylogenetic tree constructed of catalytic domains coincided well with the domain structures of PRXs and the phylogenies based on 16s rRNA. The distribution of genes encoding PRXs in different unicellular and filamentous cyanobacteria especially those sub-families like PRX-like or 1-Cys PRX correlate with the genome size, eco-physiology, and physiological properties of the organisms. Cyanobacterial and eukaryotic PRXs share similar conserved motifs, indicating that cyanobacteria adopt similar catalytic mechanisms as eukaryotes. All cyanobacterial PRX proteins share highly similar structures, implying that these genes may originate from a common ancestor. In this study, a general framework of the sequence-structure-function connections of the PRXs was revealed, which may facilitate functional investigations of PRXs in various organisms.

  10. Genome-wide analysis of putative peroxiredoxin in unicellular and filamentous cyanobacteria

    PubMed Central

    2012-01-01

    Background Cyanobacteria are photoautotrophic prokaryotes with wide variations in genome sizes and ecological habitats. Peroxiredoxin (PRX) is an important protein that plays essential roles in protecting own cells against reactive oxygen species (ROS). PRXs have been identified from mammals, fungi and higher plants. However, knowledge on cyanobacterial PRXs still remains obscure. With the availability of 37 sequenced cyanobacterial genomes, we performed a comprehensive comparative analysis of PRXs and explored their diversity, distribution, domain structure and evolution. Results Overall 244 putative prx genes were identified, which were abundant in filamentous diazotrophic cyanobacteria, Acaryochloris marina MBIC 11017, and unicellular cyanobacteria inhabiting freshwater and hot-springs, while poor in all Prochlorococcus and marine Synechococcus strains. Among these putative genes, 25 open reading frames (ORFs) encoding hypothetical proteins were identified as prx gene family members and the others were already annotated as prx genes. All 244 putative PRXs were classified into five major subfamilies (1-Cys, 2-Cys, BCP, PRX5_like, and PRX-like) according to their domain structures. The catalytic motifs of the cyanobacterial PRXs were similar to those of eukaryotic PRXs and highly conserved in all but the PRX-like subfamily. Classical motif (CXXC) of thioredoxin was detected in protein sequences from the PRX-like subfamily. Phylogenetic tree constructed of catalytic domains coincided well with the domain structures of PRXs and the phylogenies based on 16s rRNA. Conclusions The distribution of genes encoding PRXs in different unicellular and filamentous cyanobacteria especially those sub-families like PRX-like or 1-Cys PRX correlate with the genome size, eco-physiology, and physiological properties of the organisms. Cyanobacterial and eukaryotic PRXs share similar conserved motifs, indicating that cyanobacteria adopt similar catalytic mechanisms as eukaryotes. All cyanobacterial PRX proteins share highly similar structures, implying that these genes may originate from a common ancestor. In this study, a general framework of the sequence-structure-function connections of the PRXs was revealed, which may facilitate functional investigations of PRXs in various organisms. PMID:23157370

  11. Diversity of Micromonospora strains isolated from nitrogen fixing nodules and rhizosphere of Pisum sativum analyzed by multilocus sequence analysis.

    PubMed

    Carro, Lorena; Spröer, Cathrin; Alonso, Pilar; Trujillo, Martha E

    2012-03-01

    It was recently reported that Micromonospora inhabits the intracellular tissues of nitrogen fixing nodules of the wild legume Lupinus angustifolius. To determine if Micromonospora populations are also present in nitrogen fixing nodules of cultivated legumes such as Pisum sativum, we carried out the isolation of this actinobacterium from P. sativum plants collected in two man-managed fields in the region of Castilla and León (Spain). In this work, we describe the isolation of 93 Micromonospora strains recovered from nitrogen fixing nodules and the rhizosphere of P. sativum. The genomic diversity of the strains was analyzed by amplified ribosomal DNA restriction analysis (ARDRA). Forty-six isolates and 34 reference strains were further analyzed using a multilocus sequence analysis scheme developed to address the phylogeny of the genus Micromonospora and to evaluate the species distribution in the two studied habitats. The MLSA results were evaluated by DNA-DNA hybridization to determine their usefulness for the delineation of Micromonospora at the species level. In most cases, DDH values below 70% were obtained with strains that shared a sequence similarity of 98.5% or less. Thus, MLSA studies clearly supported the established taxonomy of the genus Micromonospora and indicated that genomic species could be delineated as groups of strains that share > 98.5% sequence similarity based on the 5 genes selected. The species diversity of the strains isolated from both the rhizosphere and nodules was very high and in many cases the new strains could not be related to any of the currently described species. Copyright © 2011 Elsevier GmbH. All rights reserved.

  12. Comparative Genomics and Identification of an Enterotoxin-Bearing Pathogenicity Island, SEPI-1/SECI-1, in Staphylococcus epidermidis Pathogenic Strains.

    PubMed

    Argemi, Xavier; Nanoukon, Chimène; Affolabi, Dissou; Keller, Daniel; Hansmann, Yves; Riegel, Philippe; Baba-Moussa, Lamine; Prévost, Gilles

    2018-02-25

    Staphylococcus epidermidis is a leading cause of nosocomial infections, majorly resistant to beta-lactam antibiotics, and may transfer several mobile genetic elements among the members of its own species, as well as to Staphylococcus aureus ; however, a genetic exchange from S. aureus to S. epidermidis remains controversial. We recently identified two pathogenic clinical strains of S. epidermidis that produce a staphylococcal enterotoxin C3-like (SEC) similar to that by S. aureus pathogenicity islands. This study aimed to determine the genetic environment of the SEC-coding sequence and to identify the mobile genetic elements. Whole-genome sequencing and annotation of the S. epidermidis strains were performed using Illumina technology and a bioinformatics pipeline for assembly, which provided evidence that the SEC-coding sequences were located in a composite pathogenicity island that was previously described in the S. epidermidis strain FRI909, called SePI-1/SeCI-1, with 83.8-89.7% nucleotide similarity. Various other plasmids were identified, particularly p_3_95 and p_4_95, which carry antibiotic resistance genes ( hsrA and dfrG , respectively), and share homologies with SAP085A and pUSA04-2-SUR11, two plasmids described in S. aureus . Eventually, one complete prophage was identified, ΦSE90, sharing 30 out of 52 coding sequences with the Acinetobacter phage vB_AbaM_IME200. Thus, the SePI-1/SeCI-1 pathogenicity island was identified in two pathogenic strains of S. epidermidis that produced a SEC enterotoxin causing septic shock. These findings suggest the existence of in vivo genetic exchange from S. aureus to S. epidermidis .

  13. Comparative Genomics and Identification of an Enterotoxin-Bearing Pathogenicity Island, SEPI-1/SECI-1, in Staphylococcus epidermidis Pathogenic Strains

    PubMed Central

    Nanoukon, Chimène; Affolabi, Dissou; Keller, Daniel; Hansmann, Yves; Riegel, Philippe; Baba-Moussa, Lamine; Prévost, Gilles

    2018-01-01

    Staphylococcus epidermidis is a leading cause of nosocomial infections, majorly resistant to beta-lactam antibiotics, and may transfer several mobile genetic elements among the members of its own species, as well as to Staphylococcus aureus; however, a genetic exchange from S. aureus to S. epidermidis remains controversial. We recently identified two pathogenic clinical strains of S. epidermidis that produce a staphylococcal enterotoxin C3-like (SEC) similar to that by S. aureus pathogenicity islands. This study aimed to determine the genetic environment of the SEC-coding sequence and to identify the mobile genetic elements. Whole-genome sequencing and annotation of the S. epidermidis strains were performed using Illumina technology and a bioinformatics pipeline for assembly, which provided evidence that the SEC-coding sequences were located in a composite pathogenicity island that was previously described in the S. epidermidis strain FRI909, called SePI-1/SeCI-1, with 83.8–89.7% nucleotide similarity. Various other plasmids were identified, particularly p_3_95 and p_4_95, which carry antibiotic resistance genes (hsrA and dfrG, respectively), and share homologies with SAP085A and pUSA04-2-SUR11, two plasmids described in S. aureus. Eventually, one complete prophage was identified, ΦSE90, sharing 30 out of 52 coding sequences with the Acinetobacter phage vB_AbaM_IME200. Thus, the SePI-1/SeCI-1 pathogenicity island was identified in two pathogenic strains of S. epidermidis that produced a SEC enterotoxin causing septic shock. These findings suggest the existence of in vivo genetic exchange from S. aureus to S. epidermidis. PMID:29495323

  14. StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase.

    PubMed

    Zemla, Adam T; Lang, Dorothy M; Kostova, Tanya; Andino, Raul; Ecale Zhou, Carol L

    2011-06-02

    Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory--still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could help overcome these difficulties by facilitating the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV (structure-alignment sequence variability), a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus, and we demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique, or that share structural similarity with proteins that would be considered distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local structural alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position. StralSV is provided as a web service at http://proteinmodel.org/AS2TS/STRALSV/.

  15. The European Classical Swine Fever Virus Database: Blueprint for a Pathogen-Specific Sequence Database with Integrated Sequence Analysis Tools

    PubMed Central

    Postel, Alexander; Schmeiser, Stefanie; Zimmermann, Bernd; Becher, Paul

    2016-01-01

    Molecular epidemiology has become an indispensable tool in the diagnosis of diseases and in tracing the infection routes of pathogens. Due to advances in conventional sequencing and the development of high throughput technologies, the field of sequence determination is in the process of being revolutionized. Platforms for sharing sequence information and providing standardized tools for phylogenetic analyses are becoming increasingly important. The database (DB) of the European Union (EU) and World Organisation for Animal Health (OIE) Reference Laboratory for classical swine fever offers one of the world’s largest semi-public virus-specific sequence collections combined with a module for phylogenetic analysis. The classical swine fever (CSF) DB (CSF-DB) became a valuable tool for supporting diagnosis and epidemiological investigations of this highly contagious disease in pigs with high socio-economic impacts worldwide. The DB has been re-designed and now allows for the storage and analysis of traditionally used, well established genomic regions and of larger genomic regions including complete viral genomes. We present an application example for the analysis of highly similar viral sequences obtained in an endemic disease situation and introduce the new geographic “CSF Maps” tool. The concept of this standardized and easy-to-use DB with an integrated genetic typing module is suited to serve as a blueprint for similar platforms for other human or animal viruses. PMID:27827988

  16. Comparison and correlation of binding mode of ATP in the kinase domains of Hexokinase family

    PubMed Central

    Kumar, Yellapu Nanda; Kumar, Pasupuleti Santhosh; Sowjenya, Gopal; Rao, Valasani Koteswara; Yeswanth, Sthanikam; Prasad, Uppu Venkateswara; Pradeepkiran, Jangampalli Adi; Sarma, PVGK; Bhaskar, Matcha

    2012-01-01

    Hexokinases (HKs) are the enzymes that catalyses the ATP dependent phosphorylation of Hexose sugars to Hexose-6-Phosphate (Hex-6-P). There exist four different forms of HKs namely HK-I, HK-II, HK-III and HK-IV and all of them share a common ATP binding site core surrounded by more variable sequence that determine substrate affinities. Although they share a common binding site but they differ in their kinetic functions, hence the present study is aimed to analyze the binding mode of ATP. The analysis revealed that the four ATP binding domains are showing 13 identical, 7 similar and 6 dissimilar residues with similar structural conformation. Molecular docking of ATP into the kinase domains using Molecular Operating Environment (MOE) soft ware tool clearly showed the variation in the binding mode of ATP with variable docking scores. This probably explains the variable phosphorylation rates among hexokinases family. PMID:22829728

  17. K-shuff: A Novel Algorithm for Characterizing Structural and Compositional Diversity in Gene Libraries

    PubMed Central

    Jangid, Kamlesh; Kao, Ming-Hung; Lahamge, Aishwarya; Williams, Mark A.; Rathbun, Stephen L.; Whitman, William B.

    2016-01-01

    K-shuff is a new algorithm for comparing the similarity of gene sequence libraries, providing measures of the structural and compositional diversity as well as the significance of the differences between these measures. Inspired by Ripley’s K-function for spatial point pattern analysis, the Intra K-function or IKF measures the structural diversity, including both the richness and overall similarity of the sequences, within a library. The Cross K-function or CKF measures the compositional diversity between gene libraries, reflecting both the number of OTUs shared as well as the overall similarity in OTUs. A Monte Carlo testing procedure then enables statistical evaluation of both the structural and compositional diversity between gene libraries. For 16S rRNA gene libraries from complex bacterial communities such as those found in seawater, salt marsh sediments, and soils, K-shuff yields reproducible estimates of structural and compositional diversity with libraries greater than 50 sequences. Similarly, for pyrosequencing libraries generated from a glacial retreat chronosequence and Illumina® libraries generated from US homes, K-shuff required >300 and 100 sequences per sample, respectively. Power analyses demonstrated that K-shuff is sensitive to small differences in Sanger or Illumina® libraries. This extra sensitivity of K-shuff enabled examination of compositional differences at much deeper taxonomic levels, such as within abundant OTUs. This is especially useful when comparing communities that are compositionally very similar but functionally different. K-shuff will therefore prove beneficial for conventional microbiome analysis as well as specific hypothesis testing. PMID:27911946

  18. Characterization of Satellite DNA Sequences from the Commercially Important Marine Rotifers Brachionus rotundiformis and Brachionus plicatilis.

    PubMed

    Boehm; Gibson; Lubzens

    2000-01-01

    This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.

  19. Increasing Sequence Diversity with Flexible Backbone Protein Design: The Complete Redesign of a Protein Hydrophobic Core

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murphy, Grant S.; Mills, Jeffrey L.; Miley, Michael J.

    2015-10-15

    Protein design tests our understanding of protein stability and structure. Successful design methods should allow the exploration of sequence space not found in nature. However, when redesigning naturally occurring protein structures, most fixed backbone design algorithms return amino acid sequences that share strong sequence identity with wild-type sequences, especially in the protein core. This behavior places a restriction on functional space that can be explored and is not consistent with observations from nature, where sequences of low identity have similar structures. Here, we allow backbone flexibility during design to mutate every position in the core (38 residues) of a four-helixmore » bundle protein. Only small perturbations to the backbone, 12 {angstrom}, were needed to entirely mutate the core. The redesigned protein, DRNN, is exceptionally stable (melting point >140C). An NMR and X-ray crystal structure show that the side chains and backbone were accurately modeled (all-atom RMSD = 1.3 {angstrom}).« less

  20. Chryseobacterium chaponense sp. nov., isolated from farmed Atlantic salmon (Salmo salar).

    PubMed

    Kämpfer, Peter; Fallschissel, Kerstin; Avendaño-Herrera, Ruben

    2011-03-01

    Two bacterial strains, designated Sa 1147-06(T) and Sa 1143-06, were isolated from Atlantic salmon (Salmo salar) farmed in Lake Chapo, Chile, and were studied using a polyphasic approach. Both isolates were very similar; cells were rod-shaped, formed yellow-pigmented colonies and were Gram-reaction-negative. Based on 16S rRNA gene sequence analysis, strains Sa 1147-06(T) and Sa 1143-06 shared 100  % sequence similarity and showed 98.9 and 97.5 % sequence similarity to Chryseobacterium jeonii AT1047(T) and Chryseobacterium antarcticum AT1013(T), respectively. Sequence similarities to all other members of the genus Chryseobacterium were below 97.3  %. The major fatty acids of strain Sa 1147-06(T) were iso-C₁₃:₀, iso-C₁₅:₀, anteiso-C₁₅:₀ and iso-C₁₇:₁ω9c, with iso-C₁₅:₀ 3-OH, iso-C₁₆:₀ 3-OH and iso-C₁₇:₀ 3-OH constituting the major hydroxylated fatty acids. DNA-DNA hybridizations with C. jeonii JMSNU 14049(T) and C. antarcticum JMNSU 14040(T) gave relatedness values of 20.7  % (reciprocal 15.1  %) and 15.7 % (reciprocal 25.7  %), respectively. Together, the DNA-DNA hybridization results and differentiating biochemical properties showed that strains Sa 1147-06(T) and Sa 1143-06 represent a novel species, for which the name Chryseobacterium chaponense sp. nov. is proposed. The type strain is Sa 1147-06(T) (=DSM 23145(T) =CCM 7737(T)).

  1. High copy number of highly similar mariner-like transposons in planarian (Platyhelminthe): evidence for a trans-phyla horizontal transfer.

    PubMed

    Garcia-Fernàndez, J; Bayascas-Ramírez, J R; Marfany, G; Muñoz-Mármol, A M; Casali, A; Baguñà, J; Saló, E

    1995-05-01

    Several DNA sequences similar to the mariner element were isolated and characterized in the platyhelminthe Dugesia (Girardia) tigrina. They were 1,288 bp long, flanked by two 32 bp-inverted repeats, and contained a single 339 amino acid open-reading frame (ORF) encoding the transposase. The number of copies of this element is approximately 8,000 per haploid genome, constituting a member of the middle-repetitive DNA of Dugesia tigrina. Sequence analysis of several elements showed a high percentage of conservation between the different copies. Most of them presented an intact ORF and the standard signals of actively expressed genes, which suggests that some of them are or have recently been functional transposons. The high degree of similarity shared with other mariner elements from some arthropods, together with the fact that this element is undetectable in other planarian species, strongly suggests a case of horizontal transfer between these two distant phyla.

  2. Tracing common origins of Genomic Islands in prokaryotes based on genome signature analyses.

    PubMed

    van Passel, Mark Wj

    2011-09-01

    Horizontal gene transfer constitutes a powerful and innovative force in evolution, but often little is known about the actual origins of transferred genes. Sequence alignments are generally of limited use in tracking the original donor, since still only a small fraction of the total genetic diversity is thought to be uncovered. Alternatively, approaches based on similarities in the genome specific relative oligonucleotide frequencies do not require alignments. Even though the exact origins of horizontally transferred genes may still not be established using these compositional analyses, it does suggest that compositionally very similar regions are likely to have had a common origin. These analyses have shown that up to a third of large acquired gene clusters that reside in the same genome are compositionally very similar, indicative of a shared origin. This brings us closer to uncovering the original donors of horizontally transferred genes, and could help in elucidating possible regulatory interactions between previously unlinked sequences.

  3. Molecular characterization and chromosomal distribution of Galileo, Kepler and Newton, three foldback transposable elements of the Drosophila buzzatii species complex.

    PubMed

    Casals, Ferran; Cáceres, Mario; Manfrin, Maura Helena; González, Josefa; Ruiz, Alfredo

    2005-04-01

    Galileo is a foldback transposable element that has been implicated in the generation of two polymorphic chromosomal inversions in Drosophila buzzatii. Analysis of the inversion breakpoints led to the discovery of two additional elements, called Kepler and Newton, sharing sequence and structural similarities with Galileo. Here, we describe in detail the molecular structure of these three elements, on the basis of the 13 copies found at the inversion breakpoints plus 10 additional copies isolated during this work. Similarly to the foldback elements described in other organisms, these elements have long inverted terminal repeats, which in the case of Galileo possess a complex structure and display a high degree of internal variability between copies. A phylogenetic tree built with their shared sequences shows that the three elements are closely related and diverged approximately 10 million years ago. We have also analyzed the abundance and chromosomal distribution of these elements in D. buzzatii and other species of the repleta group by Southern analysis and in situ hybridization. Overall, the results suggest that these foldback elements are present in all the buzzatti complex species and may have played an important role in shaping their genomes. In addition, we show that recombination rate is the main factor determining the chromosomal distribution of these elements.

  4. Evolutionary Relationships among Actinophages and a Putative Adaptation for Growth in Streptomyces spp.

    PubMed Central

    Hendrix, Roger W.; Dedrick, Rebekah; Mitchell, Kaitlin; Ko, Ching-Chung; Russell, Daniel; Bell, Emma; Gregory, Matthew; Bibb, Maureen J.; Pethick, Florence; Jacobs-Sera, Deborah; Herron, Paul; Buttner, Mark J.; Hatfull, Graham F.

    2013-01-01

    The genome sequences of eight Streptomyces phages are presented, four of which were isolated for this study. Phages R4, TG1, ϕHau3, and SV1 were isolated previously and have been exploited as tools for understanding and genetically manipulating Streptomyces spp. We also extracted five apparently intact prophages from recent Streptomyces spp. genome projects and, together with six phage genomes in the database, we analyzed all 19 Streptomyces phage genomes with a view to understanding their relationships to each other and to other actinophages, particularly the mycobacteriophages. Fifteen of the Streptomyces phages group into four clusters of related genomes. Although the R4-like phages do not share nucleotide sequence similarity with other phages, they clearly have common ancestry with cluster A mycobacteriophages, sharing many protein homologues, common gene syntenies, and similar repressor-stoperator regulatory systems. The R4-like phage ϕHau3 and the prophage StrepC.1 (from Streptomyces sp. strain C) appear to have hijacked a unique adaptation of the streptomycetes, i.e., use of the rare UUA codon, to control translation of the essential phage protein, the terminase. The Streptomyces venezuelae generalized transducing phage SV1 was used to predict the presence of other generalized transducing phages for different Streptomyces species. PMID:23995638

  5. Microbial community analysis of a coastal hot spring in Kagoshima, Japan, using molecular- and culture-based approaches.

    PubMed

    Nishiyama, Minako; Yamamoto, Shuichi; Kurosawa, Norio

    2013-08-01

    Ibusuki hot spring is located on the coastline of Kagoshima Bay, Japan. The hot spring water is characterized by high salinity, high temperature, and neutral pH. The hot spring is covered by the sea during high tide, which leads to severe fluctuations in several environmental variables. A combination of molecular- and culture-based techniques was used to determine the bacterial and archaeal diversity of the hot spring. A total of 48 thermophilic bacterial strains were isolated from two sites (Site 1: 55.6°C; Site 2: 83.1°C) and they were categorized into six groups based on their 16S rRNA gene sequence similarity. Two groups (including 32 isolates) demonstrated low sequence similarity with published species, suggesting that they might represent novel taxa. The 148 clones from the Site 1 bacterial library included 76 operational taxonomy units (OTUs; 97% threshold), while 132 clones from the Site 2 bacterial library included 31 OTUs. Proteobacteria, Bacteroidetes, and Firmicutes were frequently detected in both clone libraries. The clones were related to thermophilic, mesophilic and psychrophilic bacteria. Approximately half of the sequences in bacterial clone libraries shared <92% sequence similarity with their closest sequences in a public database, suggesting that the Ibusuki hot spring may harbor a unique and novel bacterial community. By contrast, 77 clones from the Site 2 archaeal library contained only three OTUs, most of which were affiliated with Thaumarchaeota.

  6. Whole-genome and multisector exome sequencing of primary and post-treatment glioblastoma reveals patterns of tumor evolution

    PubMed Central

    Kim, Hoon; Zheng, Siyuan; Amini, Seyed S.; Virk, Selene M.; Mikkelsen, Tom; Brat, Daniel J.; Grimsby, Jonna; Sougnez, Carrie; Muller, Florian; Hu, Jian; Sloan, Andrew E.; Cohen, Mark L.; Van Meir, Erwin G.; Scarpace, Lisa; Laird, Peter W.; Weinstein, John N.; Lander, Eric S.; Gabriel, Stacey; Getz, Gad; Meyerson, Matthew; Chin, Lynda; Barnholtz-Sloan, Jill S.

    2015-01-01

    Glioblastoma (GBM) is a prototypical heterogeneous brain tumor refractory to conventional therapy. A small residual population of cells escapes surgery and chemoradiation, resulting in a typically fatal tumor recurrence ∼7 mo after diagnosis. Understanding the molecular architecture of this residual population is critical for the development of successful therapies. We used whole-genome sequencing and whole-exome sequencing of multiple sectors from primary and paired recurrent GBM tumors to reconstruct the genomic profile of residual, therapy resistant tumor initiating cells. We found that genetic alteration of the p53 pathway is a primary molecular event predictive of a high number of subclonal mutations in glioblastoma. The genomic road leading to recurrence is highly idiosyncratic but can be broadly classified into linear recurrences that share extensive genetic similarity with the primary tumor and can be directly traced to one of its specific sectors, and divergent recurrences that share few genetic alterations with the primary tumor and originate from cells that branched off early during tumorigenesis. Our study provides mechanistic insights into how genetic alterations in primary tumors impact the ensuing evolution of tumor cells and the emergence of subclonal heterogeneity. PMID:25650244

  7. CPm gene diversity in field isolates of Citrus tristeza virus from Colombia.

    PubMed

    Oliveros-Garay, Oscar Arturo; Martinez-Salazar, Natalhie; Torres-Ruiz, Yanneth; Acosta, Orlando

    2009-01-01

    The nucleotide sequence diversity of the CPm gene from 28 field isolates of Citrus tristeza virus (CTV) was assessed by SSCP and sequence analyses. These isolates showed two major shared haplotypes, which differed in distribution: A1 was the major haplotype in 23 isolates from different geographic regions, whereas R1 was found in isolates from a discrete region. Phylogenetic reconstruction clustered A1 within an independent group, while R1 was grouped with mild isolates T30 from Florida and T385 from Spain. Some isolates contained several minor haplotypes, which were very similar to, and associated with, the major haplotype.

  8. Complete genome sequence of Sebaldella termitidis type strain (NCTC 11300T)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harmon-Smith, Miranda; Celia, Laura; Chertkov, Olga

    2010-01-01

    Sebaldella termitidis (Sebald 1962) Collins and Shah 1986, is the only species in the genus Sebaldella within the fusobacterial family Leptotrichiaceae . The sole and type strain of the species was first isolated about 50 years ago from intestinal content of Mediterranean ter-mites. The species is of interest for its very isolated phylogenetic position within the phylum Fusobacteria in the tree of life, with no other species sharing more than 90% 16S rRNA se-quence similarity. The 4,486,650 bp long genome with its 4,210 protein-coding and 54 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  9. Genetic diversity of the DBLalpha region in Plasmodium falciparum var genes among Asia-Pacific isolates.

    PubMed

    Fowler, Elizabeth V; Peters, Jennifer M; Gatton, Michelle L; Chen, Nanhua; Cheng, Qin

    2002-03-01

    In Plasmodium falciparum a highly polymorphic multi-copy gene family, var, encodes the variant surface antigen P. falciparum erythrocyte membrane protein 1 (PfEMP1), which has an important role in cytoadherence and immune evasion. Using previously described universal PCR primers for the first Duffy binding-like domain (DBLalpha) of var we analysed the DBLalpha repertoires of Dd2 (originally from Thailand) and eight isolates from the Solomon Islands (n=4), Philippines (n=2), Papua New Guinea (n=1) and Africa (n=1). We found 15-32 unique DBLalpha sequence types among these isolates and estimated detectable DBLalpha repertoire sizes ranging from 33-38 to 52-57 copies per genome. Our data suggest that var gene repertoires generally consist of 40-50 copies per genome. Eighteen DBLalpha sequences appeared in more than one Asia-Pacific isolate with the number of sequences shared between any two isolates ranging from 0 to 6 (mean=2.0 +/-1.6). At the amino acid level DBLalpha sequence similarity within isolates ranged from 45.2 +/- 7.1 to 50.2 +/- 6.9%, and was not significantly different from the DBLalpha amino acid sequence similarity among isolates (P>0.1). Comparisons with published sequences also revealed little overlap among DBLalpha sequences from different regions. High DBLalpha sequence diversity and minimal overlap among these isolates suggest that the global var gene repertoire is immense, and may potentially be selected for by the host's protective immune response to the var gene products, PfEMP1.

  10. Analagous Population Structures for Two Alphabaculoviruses Highlight a Functional Role for Deletion Mutants

    PubMed Central

    Serrano, Amaya; Williams, Trevor; Simón, Oihane; López-Ferber, Miguel; Caballero, Primitivo

    2013-01-01

    A natural Spodoptera exigua multiple nucleopolyhedrovirus (SeMNPV) isolate from Florida shares a strikingly similar genotypic composition to that of a natural Spodoptera frugiperda MNPV (SfMNPV) isolate from Nicaragua. Both isolates comprise a high proportion of large-deletion genotypes that lack genes that are essential for viral replication or transmission. To determine the likely origins of such genotypically similar population structures, we performed genomic and functional analyses of these genotypes. The homology of nucleotides in the deleted regions was as high as 79%, similar to those of other colinear genomic regions, although some SfMNPV genes were not present in SeMNPV. In addition, no potential consensus sequences were shared between the deletion flanking sequences. These results indicate an evolutionary mechanism that independently generates and sustains deletion mutants within each virus population. Functional analyses using different proportions of complete and deletion genotypes were performed with the two viruses in mixtures of occlusion bodies (OBs) or co-occluded virions. Ratios greater than 3:1 of complete/deletion genotypes resulted in reduced pathogenicity (expressed as median lethal dose), but there were no significant changes in the speed of kill. In contrast, OB yields increased only in the 1:1 mixture. The three phenotypic traits analyzed provide a broader picture of the functional significance of the most extensively deleted SeMNPV genotype and contribute toward the elucidation of the role of such mutants in baculovirus populations. PMID:23204420

  11. Immune Repertoire after Immunization As Seen by Next-Generation Sequencing and Proteomics

    PubMed Central

    VanDuijn, Martijn M.; Dekker, Lennard J.; van IJcken, Wilfred F. J.; Sillevis Smitt, Peter A. E.; Luider, Theo M.

    2017-01-01

    The immune system produces a diverse repertoire of immunoglobulins in response to foreign antigens. During B-cell development, VDJ recombination and somatic mutations generate diversity, whereas selection processes remove it. Using both proteomic and NGS approaches, we characterized the immune repertoires in groups of rats after immunization with purified antigens. Proteomics and NGS data on the repertoire are in qualitative agreement, but did show quantitative differences that may relate to differences between the biological niches that were sampled for these approaches. Both methods contributed complementary information in the characterization of the immune repertoire. It was found that the immune repertoires resulting from each antigen had many similarities that allowed samples to cluster together, and that mutated immunoglobulin peptides were shared among animals with a response to the same antigen significantly more than for different antigens. However, the number of shared sequences decreased in a log-linear fashion relative to the number of animals that share them, which may affect future applications. A phylogenetic analysis on the NGS reads showed that reads from different individuals immunized with the same antigen populated distinct branches of the phylogram, an indication that the repertoire had converged. Also, similar mutation patterns were found in branches of the phylogenetic tree that were associated with antigen-specific immunoglobulins through proteomics data. Thus, data from different analysis methods and different experimental platforms show that the immunoglobulin repertoires of immunized animals have overlapping and converging features. With additional research, this may enable interesting applications in biotechnology and clinical diagnostics. PMID:29085363

  12. Comparison of the Distal Gut Microbiota from People and Animals in Africa

    PubMed Central

    Ellis, Richard J.; Bruce, Kenneth D.; Jenkins, Claire; Stothard, J. Russell; Ajarova, Lilly; Mugisha, Lawrence; Viney, Mark E.

    2013-01-01

    The gut microbiota plays a key role in the maintenance of healthy gut function as well as many other aspects of health. High-throughput sequence analyses have revealed the composition of the gut microbiota, showing that there is a core signature to the human gut microbiota, as well as variation in its composition between people. The gut microbiota of animals is also being investigated. We are interested in the relationship between bacterial taxa of the human gut microbiota and those in the gut microbiota of domestic and semi-wild animals. While it is clear that some human gut bacterial pathogens come from animals (showing that human – animal transmission occurs), the extent to which the usually non-pathogenic commensal taxa are shared between humans and animals has not been explored. To investigate this we compared the distal gut microbiota of humans, cattle and semi-captive chimpanzees in communities that are geographically sympatric in Uganda. The gut microbiotas of these three host species could be distinguished by the different proportions of bacterial taxa present. We defined multiple operational taxonomic units (OTUs) by sequence similarity and found evidence that some OTUs were common between human, cattle and chimpanzees, with the largest number of shared OTUs occurring between chimpanzees and humans, as might be expected with their close physiological similarity. These results show the potential for the sharing of usually commensal bacterial taxa between humans and other animals. This suggests that further investigation of this phenomenon is needed to fully understand how it drives the composition of human and animal gut microbiotas. PMID:23355898

  13. Expressed sequence tags from the oomycete fish pathogen Saprolegnia parasitica reveal putative virulence factors

    PubMed Central

    Torto-Alalibo, Trudy; Tian, Miaoying; Gajendran, Kamal; Waugh, Mark E; van West, Pieter; Kamoun, Sophien

    2005-01-01

    Background The oomycete Saprolegnia parasitica is one of the most economically important fish pathogens. There is a dramatic recrudescence of Saprolegnia infections in aquaculture since the use of the toxic organic dye malachite green was banned in 2002. Little is known about the molecular mechanisms underlying pathogenicity in S. parasitica and other animal pathogenic oomycetes. In this study we used a genomics approach to gain a first insight into the transcriptome of S. parasitica. Results We generated 1510 expressed sequence tags (ESTs) from a mycelial cDNA library of S. parasitica. A total of 1279 consensus sequences corresponding to 525944 base pairs were assembled. About half of the unigenes showed similarities to known protein sequences or motifs. The S. parasitica sequences tended to be relatively divergent from Phytophthora sequences. Based on the sequence alignments of 18 conserved proteins, the average amino acid identity between S. parasitica and three Phytophthora species was 77% compared to 93% within Phytophthora. Several S. parasitica cDNAs, such as those with similarity to fungal type I cellulose binding domain proteins, PAN/Apple module proteins, glycosyl hydrolases, proteases, as well as serine and cysteine protease inhibitors, were predicted to encode secreted proteins that could function in virulence. Some of these cDNAs were more similar to fungal proteins than to other eukaryotic proteins confirming that oomycetes and fungi share some virulence components despite their evolutionary distance Conclusion We provide a first glimpse into the gene content of S. parasitica, a reemerging oomycete fish pathogen. These resources will greatly accelerate research on this important pathogen. The data is available online through the Oomycete Genomics Database [1]. PMID:16076392

  14. Generation and Analysis of Expressed Sequence Tags (ESTs) from Halophyte Atriplex canescens to Explore Salt-Responsive Related Genes

    PubMed Central

    Li, Jingtao; Sun, Xinhua; Yu, Gang; Jia, Chengguo; Liu, Jinliang; Pan, Hongyu

    2014-01-01

    Little information is available on gene expression profiling of halophyte A. canescens. To elucidate the molecular mechanism for stress tolerance in A. canescens, a full-length complementary DNA library was generated from A. canescens exposed to 400 mM NaCl, and provided 343 high-quality ESTs. In an evaluation of 343 valid EST sequences in the cDNA library, 197 unigenes were assembled, among which 190 unigenes (83.1% ESTs) were identified according to their significant similarities with proteins of known functions. All the 343 EST sequences have been deposited in the dbEST GenBank under accession numbers JZ535802 to JZ536144. According to Arabidopsis MIPS functional category and GO classifications, we identified 193 unigenes of the 311 annotations EST, representing 72 non-redundant unigenes sharing similarities with genes related to the defense response. The sets of ESTs obtained provide a rich genetic resource and 17 up-regulated genes related to salt stress resistance were identified by qRT-PCR. Six of these genes may contribute crucially to earlier and later stage salt stress resistance. Additionally, among the 343 unigenes sequences, 22 simple sequence repeats (SSRs) were also identified contributing to the study of A. canescens resources. PMID:24960361

  15. Microsporidia, amitochondrial protists, possess a 70-kDa heat shock protein gene of mitochondrial evolutionary origin.

    PubMed

    Peyretaillade, E; Broussolle, V; Peyret, P; Méténier, G; Gouy, M; Vivarès, C P

    1998-06-01

    An intronless gene encoding a protein of 592 amino acid residues with similarity to 70-kDa heat shock proteins (HSP70s) has been cloned and sequenced from the amitochondrial protist Encephalitozoon cuniculi (phylum Microsporidia). Southern blot analyses show the presence of a single gene copy located on chromosome XI. The encoded protein exhibits an N-terminal hydrophobic leader sequence and two motifs shared by proteobacterial and mitochondrially expressed HSP70 homologs. Phylogenetic analysis using maximum likelihood and evolutionary distances place the E. cuniculi sequence in the cluster of mitochondrially expressed HSP70s, with a higher evolutionary rate than those of homologous sequences. Similar results were obtained after cloning a fragment of the homologous gene in the closely related species E. hellem. The presence of a nuclear targeting signal-like sequence supports a role of the Encephalitozoon HSP70 as a molecular chaperone of nuclear proteins. No evidence for cytosolic or endoplasmic reticulum forms of HSP70 was obtained through PCR amplification. These data suggest that Encephalitozoon species have evolved from an ancestor bearing mitochondria, which is in disagreement with the postulated presymbiotic origin of Microsporidia. The specific role and intracellular localization of the mitochondrial HSP70-like protein remain to be elucidated.

  16. Molecular Cloning of Secreted Luciferases from Marine Planktonic Copepods.

    PubMed

    Takenaka, Yasuhiro; Ikeo, Kazuho; Shigeri, Yasushi

    2016-01-01

    Secreted luciferases isolated from copepod crustaceans are frequently used for nondisruptive reporter-gene assays, such as the continuous, automated and/or high-throughput monitoring of gene expression in living cells. All known copepod luciferases share highly conserved amino acid residues in two similar, repeated domains in the sequence. The similarity in the domains are ideal nature for designing PCR primers to amplify cDNA fragments of unidentified copepod luciferases from bioluminescent copepod crustaceans. Here, we introduce how to establish a cDNA encoding novel copepod luciferases from a copepod specimen by PCR with degenerated primers.

  17. The Liverwort Contains a Lectin That Is Structurally and Evolutionary Related to the Monocot Mannose-Binding Lectins1

    PubMed Central

    Peumans, Willy J.; Barre, Annick; Bras, Julien; Rougé, Pierre; Proost, Paul; Van Damme, Els J.M.

    2002-01-01

    A mannose (Man)-binding lectin has been isolated and characterized from the thallus of the liverwort Marchantia polymorpha. N-terminal sequencing indicated that the M. polymorpha agglutinin (Marpola) shares sequence similarity with the superfamily of monocot Man-binding lectins. Searches in the databases yielded expressed sequence tags encoding Marpola. Sequence analysis, molecular modeling, and docking experiments revealed striking structural similarities between Marpola and the monocot Man-binding lectins. Activity and specificity studies further indicated that Marpola is a much stronger agglutinin than the Galanthus nivalis agglutinin and exhibits a preference for methylated Man and glucose, which is unprecedented within the family of monocot Man-binding lectins. The discovery of Marpola allows us, for the first time, to corroborate the evolutionary relationship between a lectin from a lower plant and a well-established lectin family from flowering plants. In addition, the identification of Marpola sheds a new light on the molecular evolution of the superfamily of monocot Man-binding lectins. Beside evolutionary considerations, the occurrence of a G. nivalis agglutinin homolog in a lower plant necessitates the rethinking of the physiological role of the whole family of monocot Man-binding lectins. PMID:12114560

  18. [A family of short retroposons (Squaml) from squamate reptiles (Reptilia: Squamata): structure, evolution and correlation with phylogeny].

    PubMed

    Kosushkin, S A; Borodulina, O R; Solov'eva, E N; Grechko, V V

    2008-01-01

    We have isolated and characterised sequences of a SINE family specific for squamate reptiles from a genome of lacertid lizard that we called Squam1. Copies are 360-390 bp in length and share a significant similarity with tRNA gene sequence on its 5'-end. This family was also detected by us in DNA of representatives of varanids, iguanids (anolis), gekkonids, and snakes. No signs of it were found in DNA of mammals, birds, amphibians, and crocodiles. Detailed analysis of primary structure of the retroposons obtained by us from genomic libraries or GenBank sequences was carried out. Most taxa possess 2-3 subfamilies of the SINE in their genomes with specific diagnostic features in their primary structure. Individual variability of copies in different families is about 85% and is just slightly lower on the genera level. Comparison of consensus sequences on family level reveals a high degree of structural similarity with a number of specific apomorphic features which makes it a useful marker of phylogeny for this group of reptiles. Snakes do not show specific affinity to varanids when compared to other lizards, as it was suggested earlier.

  19. StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zemla, A; Lang, D; Kostova, T

    2010-11-29

    Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitatemore » the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position.« less

  20. First complete genome sequence of vanilla mosaic strain of Dasheen mosaic virus isolated from the Cook Islands.

    PubMed

    Puli'uvea, Christopher; Khan, Subuhi; Chang, Wee-Leong; Valmonte, Gardette; Pearson, Michael N; Higgins, Colleen M

    2017-02-01

    We present the first complete genome of vanilla mosaic virus (VanMV). The VanMV genomic structure is consistent with that of a potyvirus, containing a single open reading frame (ORF) encoding a polyprotein of 3139 amino acids. Motif analyses indicate the polyprotein can be cleaved into the expected ten individual proteins; other recognised potyvirus motifs are also present. As expected, the VanMV genome shows high sequence similarity to the published Dasheen mosaic virus (DsMV) genome sequences; comparisons with DsMV continue to support VanMV as a vanilla infecting strain of DsMV. Phylogenetic analyses indicate that VanMV and DsMV share a common ancestor, with VanMV having the closest relationship with DsMV strains from the South Pacific.

  1. Music and language perception: expectations, structural integration, and cognitive sequencing.

    PubMed

    Tillmann, Barbara

    2012-10-01

    Music can be described as sequences of events that are structured in pitch and time. Studying music processing provides insight into how complex event sequences are learned, perceived, and represented by the brain. Given the temporal nature of sound, expectations, structural integration, and cognitive sequencing are central in music perception (i.e., which sounds are most likely to come next and at what moment should they occur?). This paper focuses on similarities in music and language cognition research, showing that music cognition research provides insight into the understanding of not only music processing but also language processing and the processing of other structured stimuli. The hypothesis of shared resources between music and language processing and of domain-general dynamic attention has motivated the development of research to test music as a means to stimulate sensory, cognitive, and motor processes. Copyright © 2012 Cognitive Science Society, Inc.

  2. Nucleotide sequences of the tet(M) genes from the American and Dutch type tetracycline resistance plasmids of Neisseria gonorrhoeae.

    PubMed

    Gascoyne-Binzi, D M; Heritage, J; Hawkey, P M

    1993-11-01

    High-level tetracycline-resistant Neisseria gonorrhoeae (TRNG) has been associated with the presence of a plasmid approximately 25.2 MDa in size which carries a Tet M tetracycline resistance determinant. Two different plasmid types, American and Dutch, have previously been described, based on the restriction endonuclease digestion pattern. In this study, the tet(M) genes from the two plasmid types have been amplified by the polymerase chain reaction (PCR) and then sequenced. The gene sequences from the two plasmids shared 96.8% identity, and showed similarities with different segments of the tet(M) gene sequences from Tn1545, Tn916 and Ureaplasma urealyticum. The data suggest that it is highly likely that the Tet M determinant found in the American type plasmid has a different origin from that present in the Dutch plasmid.

  3. Bhageerath-H: A homology/ab initio hybrid server for predicting tertiary structures of monomeric soluble proteins

    PubMed Central

    2014-01-01

    Background The advent of human genome sequencing project has led to a spurt in the number of protein sequences in the databanks. Success of structure based drug discovery severely hinges on the availability of structures. Despite significant progresses in the area of experimental protein structure determination, the sequence-structure gap is continually widening. Data driven homology based computational methods have proved successful in predicting tertiary structures for sequences sharing medium to high sequence similarities. With dwindling similarities of query sequences, advanced homology/ ab initio hybrid approaches are being explored to solve structure prediction problem. Here we describe Bhageerath-H, a homology/ ab initio hybrid software/server for predicting protein tertiary structures with advancing drug design attempts as one of the goals. Results Bhageerath-H web-server was validated on 75 CASP10 targets which showed TM-scores ≥0.5 in 91% of the cases and Cα RMSDs ≤5Å from the native in 58% of the targets, which is well above the CASP10 water mark. Comparison with some leading servers demonstrated the uniqueness of the hybrid methodology in effectively sampling conformational space, scoring best decoys and refining low resolution models to high and medium resolution. Conclusion Bhageerath-H methodology is web enabled for the scientific community as a freely accessible web server. The methodology is fielded in the on-going CASP11 experiment. PMID:25521245

  4. Biodiversity and phylogenetic analysis of culturable bacteria indigenous to Khewra salt mine of pakistan and their industrial importance

    PubMed Central

    Akhtar, Nasrin; Ghauri, Muhammad A.; Iqbal, Aamira; Anwar, Munir A.; Akhtar, Kalsoom

    2008-01-01

    Culturable bacterial biodiversity and industrial importance of the isolates indigenous to Khewra salt mine, Pakistan was assessed. PCR Amplification of 16S rDNA of isolates was carried out by using universal primers FD1 and rP1and products were sequenced commercially. These gene sequences were compared with other gene sequences in the GenBank databases to find the closely related sequences. The alignment of these sequences with sequences available from GenBank database was carried out to construct a phylogenetic tree for these bacteria. These genes were deposited to GenBank and accession numbers were obtained. Most of the isolates belonged to different species of genus Bacillus, sharing 92-99% 16S rDNA identity with the respective type strain. Other isolates had close similarities with Escherichia coli, Staphylococcus arlettae and Staphylococcus gallinarum with 97%, 98% and 99% 16S rDNA similarity respectively. The abilities of isolates to produce industrial enzymes (amylase, carboxymethylcellulase, xylanase, cellulase and protease) were checked. All isolates were tested against starch, carboxymethylcellulose (CMC), xylane, cellulose, and casein degradation in plate assays. BPT-5, 11,18,19 and 25 indicated the production of copious amounts of carbohydrates and protein degrading enzymes. Based on this study it can be concluded that Khewra salt mine is populated with diverse bacterial groups, which are potential source of industrial enzymes for commercial applications. PMID:24031194

  5. Origin and spread of photosynthesis based upon conserved sequence features in key bacteriochlorophyll biosynthesis proteins.

    PubMed

    Gupta, Radhey S

    2012-11-01

    The origin of photosynthesis and how this capability has spread to other bacterial phyla remain important unresolved questions. I describe here a number of conserved signature indels (CSIs) in key proteins involved in bacteriochlorophyll (Bchl) biosynthesis that provide important insights in these regards. The proteins BchL and BchX, which are essential for Bchl biosynthesis, are derived by gene duplication in a common ancestor of all phototrophs. More ancient gene duplication gave rise to the BchX-BchL proteins and the NifH protein of the nitrogenase complex. The sequence alignment of NifH-BchX-BchL proteins contain two CSIs that are uniquely shared by all NifH and BchX homologs, but not by any BchL homologs. These CSIs and phylogenetic analysis of NifH-BchX-BchL protein sequences strongly suggest that the BchX homologs are ancestral to BchL and that the Bchl-based anoxygenic photosynthesis originated prior to the chlorophyll (Chl)-based photosynthesis in cyanobacteria. Another CSI in the BchX-BchL sequence alignment that is uniquely shared by all BchX homologs and the BchL sequences from Heliobacteriaceae, but absent in all other BchL homologs, suggests that the BchL homologs from Heliobacteriaceae are primitive in comparison to all other photosynthetic lineages. Several other identified CSIs in the BchN homologs are commonly shared by all proteobacterial homologs and a clade consisting of the marine unicellular Cyanobacteria (Clade C). These CSIs in conjunction with the results of phylogenetic analyses and pair-wise sequence similarity on the BchL, BchN, and BchB proteins, where the homologs from Clade C Cyanobacteria and Proteobacteria exhibited close relationship, provide strong evidence that these two groups have incurred lateral gene transfers. Additionally, phylogenetic analyses and several CSIs in the BchL-N-B proteins that are uniquely shared by all Chlorobi and Chloroflexi homologs provide evidence that the genes for these proteins have also been laterally transferred between these groups. Other results and observations reported here indicate that the genes for the BchL-N-B proteins in Proteobacteria are derived from the Clade C Cyanobacteria, whereas those in Chlorobi were acquired from Chloroflexus or related bacteria by means of LGTs. Some implications of these observations regarding the origin and spread of photosynthesis are discussed.

  6. Expression of three mammalian cDNAs that interfere with RAS function in Saccharomyces cerevisiae.

    PubMed Central

    Colicelli, J; Nicolette, C; Birchmeier, C; Rodgers, L; Riggs, M; Wigler, M

    1991-01-01

    Saccharomyces cerevisiae strains expressing the activated RAS2Val19 gene or lacking both cAMP phosphodiesterase genes, PDE1 and PDE2, have impaired growth control and display an acute sensitivity to heat shock. We have isolated two classes of mammalian cDNAs from yeast expression libraries that suppress the heat shock-sensitive phenotype of RAS2Val19 strain. Members of the first class of cDNAs also suppress the heat shock-sensitive phenotype of pde1- pde2- strains and encode cAMP phosphodiesterases. Members of the second class fail to suppress the phenotype of pde1- pde2- strains and therefore are candidate cDNAs encoding proteins that interact with RAS proteins. We report the nucleotide sequence of three members of this class. Two of these cDNAs share considerable sequence similarity, but none are clearly similar to previously isolated genes. Images PMID:1849280

  7. Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis

    PubMed Central

    Grassi, Elena; Damasco, Christian; Silengo, Lorenzo; Oti, Martin; Provero, Paolo; Di Cunto, Ferdinando

    2008-01-01

    Background Even in the post-genomic era, the identification of candidate genes within loci associated with human genetic diseases is a very demanding task, because the critical region may typically contain hundreds of positional candidates. Since genes implicated in similar phenotypes tend to share very similar expression profiles, high throughput gene expression data may represent a very important resource to identify the best candidates for sequencing. However, so far, gene coexpression has not been used very successfully to prioritize positional candidates. Methodology/Principal Findings We show that it is possible to reliably identify disease-relevant relationships among genes from massive microarray datasets by concentrating only on genes sharing similar expression profiles in both human and mouse. Moreover, we show systematically that the integration of human-mouse conserved coexpression with a phenotype similarity map allows the efficient identification of disease genes in large genomic regions. Finally, using this approach on 850 OMIM loci characterized by an unknown molecular basis, we propose high-probability candidates for 81 genetic diseases. Conclusion Our results demonstrate that conserved coexpression, even at the human-mouse phylogenetic distance, represents a very strong criterion to predict disease-relevant relationships among human genes. PMID:18369433

  8. Factor structure of paediatric timed motor examination and its relationship with IQ

    PubMed Central

    MARTIN, REBECCA; TIGERA, CASSIE; DENCKLA, MARTHA B; MAHONE, E MARK

    2012-01-01

    AIM Brain systems supporting higher cognitive and motor control develop in a parallel manner, dependent on functional integrity and maturation of related regions, suggesting neighbouring neural circuitry. Concurrent examination of motor and cognitive control can provide a window into neurological development. However, identification of performance-based measures that do not correlate with IQ has been a challenge. METHOD Timed motor performance from the Physical and Neurological Examination of Subtle Signs and IQ were analysed in 136 children aged 6 to 16 (mean age 10y 2.6mo, SD 2y 6.4mo; 98 female, 38male) attending an outpatient neuropsychology clinic and 136 right-handed comparison individuals aged 6 to 16 (mean age 10y 3.1mo, SD 2y 6.1mo; 98 female, 38male). Timed activities – three repetitive movements (toe tapping, hand patting, finger tapping) and three sequenced movements (heel–toe tap, hand pronate/supinate, finger sequencing) each performed on the right and left – were included in exploratory factor analyses. RESULTS Among comparison individuals, factor analysis yielded two factors – repetitive and sequenced movements – with the sequenced factor significantly predictive of Verbal IQ (VIQ) (ΔR2=0.018, p=0.019), but not the repetitive factor (ΔR2=0.004, p=0.39). Factor analysis within the clinical group yielded two similar factors (repetitive and sequenced), both significantly predictive of VIQ, (ΔR2=0.028, p=0.015; ΔR2=0.046, p=0.002 respectively). INTERPRETATION Among typical children, repetitive timed tasks may be independent of IQ; however, sequenced tasks share more variance, implying shared neural substrates. Among neurologically vulnerable populations, however, both sequenced and repetitive movements covary with IQ, suggesting that repetitive speed is more indicative of underlying neurological integrity. PMID:20412260

  9. Probabilistic Evaluation of Competing Climate Models

    NASA Astrophysics Data System (ADS)

    Braverman, A. J.; Chatterjee, S.; Heyman, M.; Cressie, N.

    2017-12-01

    A standard paradigm for assessing the quality of climate model simulations is to compare what these models produce for past and present time periods, to observations of the past and present. Many of these comparisons are based on simple summary statistics called metrics. Here, we propose an alternative: evaluation of competing climate models through probabilities derived from tests of the hypothesis that climate-model-simulated and observed time sequences share common climate-scale signals. The probabilities are based on the behavior of summary statistics of climate model output and observational data, over ensembles of pseudo-realizations. These are obtained by partitioning the original time sequences into signal and noise components, and using a parametric bootstrap to create pseudo-realizations of the noise sequences. The statistics we choose come from working in the space of decorrelated and dimension-reduced wavelet coefficients. We compare monthly sequences of CMIP5 model output of average global near-surface temperature anomalies to similar sequences obtained from the well-known HadCRUT4 data set, as an illustration.

  10. Identification of full-length proviral DNA of porcine endogenous retrovirus from Chinese Wuzhishan miniature pigs inbred.

    PubMed

    Ma, Yuyuan; Lv, Maomin; Xu, Shu; Wu, Jianmin; Tian, Kegong; Zhang, Jingang

    2010-07-01

    Existence of porcine endogenous retrovirus (PERV) hinders pigs to be used in clinical xenotransplantation to alleviate the shortage of human transplants. Chinese miniature pigs are potential organ donors for xenotransplantation in China. However, so far, an adequate level of information on the molecular characteristics of PERV from Chinese miniature pigs has not been available. We described here the cloning and characterization of full-length proviral DNA of PERV from Chinese Wuzhishan miniature pigs inbred (WZSP). Full-length nucleotide sequences of PERV-WZSP and other PERVs were aligned and phylogenetic tree was constructed from deduced amino-acid sequences of env. The results demonstrated that the full-length proviral DNA of PERV-WZSP belongs to gammaretrovirus and shares high similarity with other PERVs. Sequence analysis also suggested that different patterns of LTR existed in the same porcine germ line and partial PERV-C sequence may recombine with PERV-A sequence in LTR. (c) 2008 Elsevier Ltd. All rights reserved.

  11. Genetic and phylogenetic analysis of a novel parvovirus isolated from chickens in Guangxi, China.

    PubMed

    Feng, Bin; Xie, Zhixun; Deng, Xianwen; Xie, Liji; Xie, Zhiqin; Huang, Li; Fan, Qin; Luo, Sisi; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Wang, Sheng; Wang, Leyi

    2016-11-01

    A previously unidentified chicken parvovirus (ChPV) strain, associated with runting-stunting syndrome (RSS), is now endemic among chickens in China. To explore the genetic diversity of ChPV strains, we determined the first complete genome sequence of a novel ChPV isolate (GX-CH-PV-7) identified in chickens in Guang Xi, China, and showed moderate genome sequence similarity to reference strains. Analysis showed that the viral genome sequence is 86.4 %-93.9 % identical to those of other ChPVs. Genetic and phylogenetic analyses showed that this newly emergent GX-CH-PV-7 is closely related to Gallus gallus enteric parvovirus isolate ChPV 798 from the USA, indicating that they may share a common ancestor. The complete DNA sequence is 4612 bp long with an A+T content of 56.66 %. We determined the first complete genome sequence of a previously unidentified ChPV strain to elucidate its origin and evolutionary status.

  12. Characterization of a Novel Simian Immunodeficiency Virus (SIVmonNG1) Genome Sequence from a Mona Monkey (Cercopithecus mona)

    PubMed Central

    Barlow, Katrina L.; Ajao, Adebowale Oluwafemi; Clewley, Jonathan P.

    2003-01-01

    A novel simian immunodeficiency virus (SIV) sequence has been recovered from RNA extracted from the serum of a mona monkey (Cercopithecus mona) wild born in Nigeria. The sequence was obtained by using novel generic (degenerate) PCR primers and spans from two-thirds into the gag gene to the 3′ poly(A) tail of the SIVmonNG1 RNA genome. Analysis of the open reading frames revealed that the SIVmonNG1 genome codes for a Vpu protein, in addition to Gag, Pol, Vif, Vpr, Tat, Rev, Env, and Nef proteins. Previously, only lentiviruses infecting humans (human immunodeficiency virus type 1 [HIV-1]) and chimpanzees (SIVcpz) were known to have a vpu gene; more recently, this has also been found in SIVgsn from Cercopithecus nictitans. Overall, SIVmonNG1 most closely resembles SIVgsn: the env gene sequence groups with HIV-1/SIVcpz env sequences, whereas the pol gene sequence clusters closely with the pol sequence of SIVsyk from Cercopithecus albogaris. By bootscanning and similarity plotting, the first half of pol resembles SIVsyk, whereas the latter part is closer to SIVcol from Colobus guereza. The similarities between the complex mosaic genomes of SIVmonNG1 and SIVgsn are consistent with a shared or common lineage. These data further highlight the intricate nature of the relationships between the SIVs from different primate species and will be helpful for unraveling these associations. PMID:12768007

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Howe, Adina; Yang, Fan; Williams, Ryan J.

    Despite the central role of soil microbial communities in global carbon (C) cycling, little is known about soil microbial community structure and even less about their metabolic pathways. Efforts to characterize soil communities often focus on identifying differences in gene content across environmental gradients, but an alternative question is what genes are similar in soils. These genes may indicate critical species or potential functions that are required in all soils. Here we identified the “core” set of C cycling sequences widely present in multiple soil metagenomes from a fertilized prairie (FP). Of 226,887 sequences associated with known enzymes involved inmore » the synthesis, metabolism, and transport of carbohydrates, 843 were identified to be consistently prevalent across four replicate soil metagenomes. This core metagenome was functionally and taxonomically diverse, representing five enzyme classes and 99 enzyme families within the CAZy database. Though it only comprised 0.4% of all CAZy-associated genes identified in FP metagenomes, the core was found to be comprised of functions similar to those within cumulative soils. The FP CAZy-associated core sequences were present in multiple publicly available soil metagenomes and most similar to soils sharing geographic proximity. As a result, in soil ecosystems, where high diversity remains a key challenge for metagenomic investigations, these core genes represent a subset of critical functions necessary for carbohydrate metabolism, which can be targeted to evaluate important C fluxes in these and other similar soils.« less

  14. Modular prediction of protein structural classes from sequences of twilight-zone identity with predicting sequences.

    PubMed

    Mizianty, Marcin J; Kurgan, Lukasz

    2009-12-13

    Knowledge of structural class is used by numerous methods for identification of structural/functional characteristics of proteins and could be used for the detection of remote homologues, particularly for chains that share twilight-zone similarity. In contrast to existing sequence-based structural class predictors, which target four major classes and which are designed for high identity sequences, we predict seven classes from sequences that share twilight-zone identity with the training sequences. The proposed MODular Approach to Structural class prediction (MODAS) method is unique as it allows for selection of any subset of the classes. MODAS is also the first to utilize a novel, custom-built feature-based sequence representation that combines evolutionary profiles and predicted secondary structure. The features quantify information relevant to the definition of the classes including conservation of residues and arrangement and number of helix/strand segments. Our comprehensive design considers 8 feature selection methods and 4 classifiers to develop Support Vector Machine-based classifiers that are tailored for each of the seven classes. Tests on 5 twilight-zone and 1 high-similarity benchmark datasets and comparison with over two dozens of modern competing predictors show that MODAS provides the best overall accuracy that ranges between 80% and 96.7% (83.5% for the twilight-zone datasets), depending on the dataset. This translates into 19% and 8% error rate reduction when compared against the best performing competing method on two largest datasets. The proposed predictor provides accurate predictions at 58% accuracy for membrane proteins class, which is not considered by majority of existing methods, in spite that this class accounts for only 2% of the data. Our predictive model is analyzed to demonstrate how and why the input features are associated with the corresponding classes. The improved predictions stem from the novel features that express collocation of the secondary structure segments in the protein sequence and that combine evolutionary and secondary structure information. Our work demonstrates that conservation and arrangement of the secondary structure segments predicted along the protein chain can successfully predict structural classes which are defined based on the spatial arrangement of the secondary structures. A web server is available at http://biomine.ece.ualberta.ca/MODAS/.

  15. Modular prediction of protein structural classes from sequences of twilight-zone identity with predicting sequences

    PubMed Central

    2009-01-01

    Background Knowledge of structural class is used by numerous methods for identification of structural/functional characteristics of proteins and could be used for the detection of remote homologues, particularly for chains that share twilight-zone similarity. In contrast to existing sequence-based structural class predictors, which target four major classes and which are designed for high identity sequences, we predict seven classes from sequences that share twilight-zone identity with the training sequences. Results The proposed MODular Approach to Structural class prediction (MODAS) method is unique as it allows for selection of any subset of the classes. MODAS is also the first to utilize a novel, custom-built feature-based sequence representation that combines evolutionary profiles and predicted secondary structure. The features quantify information relevant to the definition of the classes including conservation of residues and arrangement and number of helix/strand segments. Our comprehensive design considers 8 feature selection methods and 4 classifiers to develop Support Vector Machine-based classifiers that are tailored for each of the seven classes. Tests on 5 twilight-zone and 1 high-similarity benchmark datasets and comparison with over two dozens of modern competing predictors show that MODAS provides the best overall accuracy that ranges between 80% and 96.7% (83.5% for the twilight-zone datasets), depending on the dataset. This translates into 19% and 8% error rate reduction when compared against the best performing competing method on two largest datasets. The proposed predictor provides accurate predictions at 58% accuracy for membrane proteins class, which is not considered by majority of existing methods, in spite that this class accounts for only 2% of the data. Our predictive model is analyzed to demonstrate how and why the input features are associated with the corresponding classes. Conclusions The improved predictions stem from the novel features that express collocation of the secondary structure segments in the protein sequence and that combine evolutionary and secondary structure information. Our work demonstrates that conservation and arrangement of the secondary structure segments predicted along the protein chain can successfully predict structural classes which are defined based on the spatial arrangement of the secondary structures. A web server is available at http://biomine.ece.ualberta.ca/MODAS/. PMID:20003388

  16. Space-related pharma-motifs for fast search of protein binding motifs and polypharmacological targets

    PubMed Central

    2012-01-01

    Background To discover a compound inhibiting multiple proteins (i.e. polypharmacological targets) is a new paradigm for the complex diseases (e.g. cancers and diabetes). In general, the polypharmacological proteins often share similar local binding environments and motifs. As the exponential growth of the number of protein structures, to find the similar structural binding motifs (pharma-motifs) is an emergency task for drug discovery (e.g. side effects and new uses for old drugs) and protein functions. Results We have developed a Space-Related Pharmamotifs (called SRPmotif) method to recognize the binding motifs by searching against protein structure database. SRPmotif is able to recognize conserved binding environments containing spatially discontinuous pharma-motifs which are often short conserved peptides with specific physico-chemical properties for protein functions. Among 356 pharma-motifs, 56.5% interacting residues are highly conserved. Experimental results indicate that 81.1% and 92.7% polypharmacological targets of each protein-ligand complex are annotated with same biological process (BP) and molecular function (MF) terms, respectively, based on Gene Ontology (GO). Our experimental results show that the identified pharma-motifs often consist of key residues in functional (active) sites and play the key roles for protein functions. The SRPmotif is available at http://gemdock.life.nctu.edu.tw/SRP/. Conclusions SRPmotif is able to identify similar pharma-interfaces and pharma-motifs sharing similar binding environments for polypharmacological targets by rapidly searching against the protein structure database. Pharma-motifs describe the conservations of binding environments for drug discovery and protein functions. Additionally, these pharma-motifs provide the clues for discovering new sequence-based motifs to predict protein functions from protein sequence databases. We believe that SRPmotif is useful for elucidating protein functions and drug discovery. PMID:23281852

  17. Space-related pharma-motifs for fast search of protein binding motifs and polypharmacological targets.

    PubMed

    Chiu, Yi-Yuan; Lin, Chun-Yu; Lin, Chih-Ta; Hsu, Kai-Cheng; Chang, Li-Zen; Yang, Jinn-Moon

    2012-01-01

    To discover a compound inhibiting multiple proteins (i.e. polypharmacological targets) is a new paradigm for the complex diseases (e.g. cancers and diabetes). In general, the polypharmacological proteins often share similar local binding environments and motifs. As the exponential growth of the number of protein structures, to find the similar structural binding motifs (pharma-motifs) is an emergency task for drug discovery (e.g. side effects and new uses for old drugs) and protein functions. We have developed a Space-Related Pharmamotifs (called SRPmotif) method to recognize the binding motifs by searching against protein structure database. SRPmotif is able to recognize conserved binding environments containing spatially discontinuous pharma-motifs which are often short conserved peptides with specific physico-chemical properties for protein functions. Among 356 pharma-motifs, 56.5% interacting residues are highly conserved. Experimental results indicate that 81.1% and 92.7% polypharmacological targets of each protein-ligand complex are annotated with same biological process (BP) and molecular function (MF) terms, respectively, based on Gene Ontology (GO). Our experimental results show that the identified pharma-motifs often consist of key residues in functional (active) sites and play the key roles for protein functions. The SRPmotif is available at http://gemdock.life.nctu.edu.tw/SRP/. SRPmotif is able to identify similar pharma-interfaces and pharma-motifs sharing similar binding environments for polypharmacological targets by rapidly searching against the protein structure database. Pharma-motifs describe the conservations of binding environments for drug discovery and protein functions. Additionally, these pharma-motifs provide the clues for discovering new sequence-based motifs to predict protein functions from protein sequence databases. We believe that SRPmotif is useful for elucidating protein functions and drug discovery.

  18. Substrate-Driven Mapping of the Degradome by Comparison of Sequence Logos

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.

    2013-01-01

    Sequence logos are frequently used to illustrate substrate preferences and specificity of proteases. Here, we employed the compiled substrates of the MEROPS database to introduce a novel metric for comparison of protease substrate preferences. The constructed similarity matrix of 62 proteases can be used to intuitively visualize similarities in protease substrate readout via principal component analysis and construction of protease specificity trees. Since our new metric is solely based on substrate data, we can engraft the protease tree including proteolytic enzymes of different evolutionary origin. Thereby, our analyses confirm pronounced overlaps in substrate recognition not only between proteases closely related on sequence basis but also between proteolytic enzymes of different evolutionary origin and catalytic type. To illustrate the applicability of our approach we analyze the distribution of targets of small molecules from the ChEMBL database in our substrate-based protease specificity trees. We observe a striking clustering of annotated targets in tree branches even though these grouped targets do not necessarily share similarity on protein sequence level. This highlights the value and applicability of knowledge acquired from peptide substrates in drug design of small molecules, e.g., for the prediction of off-target effects or drug repurposing. Consequently, our similarity metric allows to map the degradome and its associated drug target network via comparison of known substrate peptides. The substrate-driven view of protein-protein interfaces is not limited to the field of proteases but can be applied to any target class where a sufficient amount of known substrate data is available. PMID:24244149

  19. Comparative analysis of barophily-related amino acid content in protein domains of Pyrococcus abyssi and Pyrococcus furiosus.

    PubMed

    Yafremava, Liudmila S; Di Giulio, Massimo; Caetano-Anollés, Gustavo

    2013-01-01

    Amino acid substitution patterns between the nonbarophilic Pyrococcus furiosus and its barophilic relative P. abyssi confirm that hydrostatic pressure asymmetry indices reflect the extent to which amino acids are preferred by barophilic archaeal organisms. Substitution patterns in entire protein sequences, shared protein domains defined at fold superfamily level, domains in homologous sequence pairs, and domains of very ancient and very recent origin now provide further clues about the environment that led to the genetic code and diversified life. The pyrococcal proteomes are very similar and share a very early ancestor. Relative amino acid abundance analyses showed that biases in the use of amino acids are due to their shared fold superfamilies. Within these repertoires, only two of the five amino acids that are preferentially barophilic, aspartic acid and arginine, displayed this preference significantly and consistently across structure and in domains appearing in the ancestor. The more primordial asparagine, lysine and threonine displayed a consistent preference for nonbarophily across structure and in the ancestor. Since barophilic preferences are already evident in ancient domains that are at least ~3 billion year old, we conclude that barophily is a very ancient trait that unfolded concurrently with genetic idiosyncrasies in convergence towards a universal code.

  20. The impact of genetics on future drug discovery in schizophrenia.

    PubMed

    Matsumoto, Mitsuyuki; Walton, Noah M; Yamada, Hiroshi; Kondo, Yuji; Marek, Gerard J; Tajinda, Katsunori

    2017-07-01

    Failures of investigational new drugs (INDs) for schizophrenia have left huge unmet medical needs for patients. Given the recent lackluster results, it is imperative that new drug discovery approaches (and resultant drug candidates) target pathophysiological alterations that are shared in specific, stratified patient populations that are selected based on pre-identified biological signatures. One path to implementing this paradigm is achievable by leveraging recent advances in genetic information and technologies. Genome-wide exome sequencing and meta-analysis of single nucleotide polymorphism (SNP)-based association studies have already revealed rare deleterious variants and SNPs in patient populations. Areas covered: Herein, the authors review the impact that genetics have on the future of schizophrenia drug discovery. The high polygenicity of schizophrenia strongly indicates that this disease is biologically heterogeneous so the identification of unique subgroups (by patient stratification) is becoming increasingly necessary for future investigational new drugs. Expert opinion: The authors propose a pathophysiology-based stratification of genetically-defined subgroups that share deficits in particular biological pathways. Existing tools, including lower-cost genomic sequencing and advanced gene-editing technology render this strategy ever more feasible. Genetically complex psychiatric disorders such as schizophrenia may also benefit from synergistic research with simpler monogenic disorders that share perturbations in similar biological pathways.

  1. Sherpas share genetic variations with Tibetans for high-altitude adaptation.

    PubMed

    Bhandari, Sushil; Zhang, Xiaoming; Cui, Chaoying; Yangla; Liu, Lan; Ouzhuluobu; Baimakangzhuo; Gonggalanzi; Bai, Caijuan; Bianba; Peng, Yi; Zhang, Hui; Xiang, Kun; Shi, Hong; Liu, Shiming; Gengdeng; Wu, Tianyi; Qi, Xuebin; Su, Bing

    2017-01-01

    Sherpas, a highlander population living in Khumbu region of Nepal, are well known for their superior climbing ability in Himalayas. However, the genetic basis of their adaptation to high-altitude environments remains elusive. We collected DNA samples of 582 Sherpas from Nepal and Tibetan Autonomous Region of China, and we measured their hemoglobin levels and degrees of blood oxygen saturation. We genotyped 29 EPAS1 SNPs, two EGLN1 SNPs and the TED polymorphism (3.4 kb deletion) in Sherpas. We also performed genetic association analysis among these sequence variants with phenotypic data. We found similar allele frequencies on the tested 32 variants of these genes in Sherpas and Tibetans. Sherpa individuals carrying the derived alleles of EPAS1 (rs113305133, rs116611511 and rs12467821), EGLN1 (rs186996510 and rs12097901) and TED have lower hemoglobin levels when compared with those wild-type allele carriers. Most of the EPAS1 variants showing significant association with hemoglobin levels in Tibetans were replicated in Sherpas. The shared sequence variants and hemoglobin trait between Sherpas and Tibetans indicate a shared genetic basis for high-altitude adaptation, consistent with the proposal that Sherpas are in fact a recently derived population from Tibetans and they inherited adaptive variants for high-altitude adaptation from their Tibetan ancestors.

  2. Comparative Genetic Analyses of Human Rhinovirus C (HRV-C) Complete Genome from Malaysia.

    PubMed

    Khaw, Yam Sim; Chan, Yoke Fun; Jafar, Faizatul Lela; Othman, Norlijah; Chee, Hui Yee

    2016-01-01

    Human rhinovirus-C (HRV-C) has been implicated in more severe illnesses than HRV-A and HRV-B, however, the limited number of HRV-C complete genomes (complete 5' and 3' non-coding region and open reading frame sequences) has hindered the in-depth genetic study of this virus. This study aimed to sequence seven complete HRV-C genomes from Malaysia and compare their genetic characteristics with the 18 published HRV-Cs. Seven Malaysian HRV-C complete genomes were obtained with newly redesigned primers. The seven genomes were classified as HRV-C6, C12, C22, C23, C26, C42, and pat16 based on the VP4/VP2 and VP1 pairwise distance threshold classification. Five of the seven Malaysian isolates, namely, 3430-MY-10/C22, 8713-MY-10/C23, 8097-MY-11/C26, 1570-MY-10/C42, and 7383-MY-10/pat16 are the first newly sequenced complete HRV-C genomes. All seven Malaysian isolates genomes displayed nucleotide similarity of 63-81% among themselves and 63-96% with other HRV-Cs. Malaysian HRV-Cs had similar putative immunogenic sites, putative receptor utilization and potential antiviral sites as other HRV-Cs. The genomic features of Malaysian isolates were similar to those of other HRV-Cs. Negative selections were frequently detected in HRV-Cs complete coding sequences indicating that these sequences were under functional constraint. The present study showed that HRV-Cs from Malaysia have diverse genetic sequences but share conserved genomic features with other HRV-Cs. This genetic information could provide further aid in the understanding of HRV-C infection.

  3. Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

    PubMed Central

    Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

    2011-01-01

    Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

  4. Comparative Genetic Analyses of Human Rhinovirus C (HRV-C) Complete Genome from Malaysia

    PubMed Central

    Khaw, Yam Sim; Chan, Yoke Fun; Jafar, Faizatul Lela; Othman, Norlijah; Chee, Hui Yee

    2016-01-01

    Human rhinovirus-C (HRV-C) has been implicated in more severe illnesses than HRV-A and HRV-B, however, the limited number of HRV-C complete genomes (complete 5′ and 3′ non-coding region and open reading frame sequences) has hindered the in-depth genetic study of this virus. This study aimed to sequence seven complete HRV-C genomes from Malaysia and compare their genetic characteristics with the 18 published HRV-Cs. Seven Malaysian HRV-C complete genomes were obtained with newly redesigned primers. The seven genomes were classified as HRV-C6, C12, C22, C23, C26, C42, and pat16 based on the VP4/VP2 and VP1 pairwise distance threshold classification. Five of the seven Malaysian isolates, namely, 3430-MY-10/C22, 8713-MY-10/C23, 8097-MY-11/C26, 1570-MY-10/C42, and 7383-MY-10/pat16 are the first newly sequenced complete HRV-C genomes. All seven Malaysian isolates genomes displayed nucleotide similarity of 63–81% among themselves and 63–96% with other HRV-Cs. Malaysian HRV-Cs had similar putative immunogenic sites, putative receptor utilization and potential antiviral sites as other HRV-Cs. The genomic features of Malaysian isolates were similar to those of other HRV-Cs. Negative selections were frequently detected in HRV-Cs complete coding sequences indicating that these sequences were under functional constraint. The present study showed that HRV-Cs from Malaysia have diverse genetic sequences but share conserved genomic features with other HRV-Cs. This genetic information could provide further aid in the understanding of HRV-C infection. PMID:27199901

  5. Genomic and proteomic characterization of a thermophilic Geobacillus bacteriophage GBSV1.

    PubMed

    Liu, Bin; Zhou, Fengfeng; Wu, Suijie; Xu, Ying; Zhang, Xiaobo

    2009-03-01

    Phages are present wherever life is found, and play roles in many biogeochemical and ecological processes. The thermophilic bacteriophages, however, have not been well studied. In this study, phage GBSV1 was obtained from a thermophilic bacterium Geobacillus sp. 6k51 isolated from a hot spring. GBSV1 contains a double-stranded linear DNA of 34,683bp, which encodes 54 putative open reading frames (ORFs). Thirty three of these 54 ORFs exhibit sequence similarities to genes from 7 species of Geobacillus or Bacillus bacteria, as well as of bacteriophages infecting these bacteria. Twenty-two ORFs have been functionally annotated based on both their sequence similarities to known genes and predicted Pfam protein domains. Five structural proteins of the purified GBSV1 virion have been identified by proteomic analyses. Surprisingly, 7 of the GBSV1 ORFs share sequence similarities with genes from bacteria relevant to human diseases. This is the first report that genes of human disease-inducing bacteria are found in a thermophilic phage. It is suggested that thermophilic phages may be the potential evolutionary link between thermophiles and human pathogens. The characterization of GBSV1 may possibly lead to new insights into virus-host interactions and to a better understanding of gene transfers and evolution of life on earth in general.

  6. In silico characterization and analysis of RTBP1 and NgTRF1 protein through MD simulation and molecular docking - A comparative study.

    PubMed

    Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran

    2015-02-06

    Gaining access to sequence and structure information of telomere binding proteins helps in understanding the essential biological processes involve in conserved sequence specific interaction between DNA and the proteins. Rice telomere binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix turn helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain but till now there is very less communication on the in silico studies of these complete proteins.Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK web server.Digging up all the facts about the proteins it was reveled that around 120 amino acids in the tail part was showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicates the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and Energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.

  7. In Silico Characterization and Analysis of RTBP1 and NgTRF1 Protein Through MD Simulation and Molecular Docking: A Comparative Study.

    PubMed

    Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran

    2015-09-01

    Gaining access to sequence and structure information of telomere-binding proteins helps in understanding the essential biological processes involve in conserved sequence-specific interaction between DNA and the proteins. Rice telomere-binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix-turn-helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain, but till now there is very less communication on the in silico studies of these complete proteins. Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK Web server. By digging up all the facts about the proteins, it was revealed that around 120 amino acids in the tail part were showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicate the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA-binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.

  8. Cis-acting elements in the promoter region of the human aldolase C gene.

    PubMed

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

    1993-08-16

    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  9. MHC class I loci of the Bar-Headed goose (Anser indicus)

    PubMed Central

    2010-01-01

    MHC class I proteins mediate functions in anti-pathogen defense. MHC diversity has already been investigated by many studies in model avian species, but here we chose the bar-headed goose, a worldwide migrant bird, as a non-model avian species. Sequences from exons encoding the peptide-binding region (PBR) of MHC class I molecules were isolated from liver genomic DNA, to investigate variation in these genes. These are the first MHC class I partial sequences of the bar-headed goose to be reported. A preliminary analysis suggests the presence of at least four MHC class I genes, which share great similarity with those of the goose and duck. A phylogenetic analysis of bar-headed goose, goose and duck MHC class I sequences using the NJ method supports the idea that they all cluster within the anseriforms clade. PMID:21637434

  10. The genome sequence of ectromelia virus Naval and Cornell isolates from outbreaks in North America.

    PubMed

    Mavian, Carla; López-Bueno, Alberto; Bryant, Neil A; Seeger, Kathy; Quail, Michael A; Harris, David; Barrell, Bart; Alcami, Antonio

    2014-08-01

    Ectromelia virus (ECTV) is the causative agent of mousepox, a disease of laboratory mouse colonies and an excellent model for human smallpox. We report the genome sequence of two isolates from outbreaks in laboratory mouse colonies in the USA in 1995 and 1999: ECTV-Naval and ECTV-Cornell, respectively. The genome of ECTV-Naval and ECTV-Cornell was sequenced by the 454-Roche technology. The ECTV-Naval genome was also sequenced by the Sanger and Illumina technologies in order to evaluate these technologies for poxvirus genome sequencing. Genomic comparisons revealed that ECTV-Naval and ECTV-Cornell correspond to the same virus isolated from independent outbreaks. Both ECTV-Naval and ECTV-Cornell are extremely virulent in susceptible BALB/c mice, similar to ECTV-Moscow. This is consistent with the ECTV-Naval genome sharing 98.2% DNA sequence identity with that of ECTV-Moscow, and indicates that the genetic differences with ECTV-Moscow do not affect the virulence of ECTV-Naval in the mousepox model of footpad infection. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  11. eShadow: A tool for comparing closely related sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ovcharenko, Ivan; Boffelli, Dario; Loots, Gabriela G.

    2004-01-15

    Primate sequence comparisons are difficult to interpret due to the high degree of sequence similarity shared between such closely related species. Recently, a novel method, phylogenetic shadowing, has been pioneered for predicting functional elements in the human genome through the analysis of multiple primate sequence alignments. We have expanded this theoretical approach to create a computational tool, eShadow, for the identification of elements under selective pressure in multiple sequence alignments of closely related genomes, such as in comparisons of human to primate or mouse to rat DNA. This tool integrates two different statistical methods and allows for the dynamic visualizationmore » of the resulting conservation profile. eShadow also includes a versatile optimization module capable of training the underlying Hidden Markov Model to differentially predict functional sequences. This module grants the tool high flexibility in the analysis of multiple sequence alignments and in comparing sequences with different divergence rates. Here, we describe the eShadow comparative tool and its potential uses for analyzing both multiple nucleotide and protein alignments to predict putative functional elements. The eShadow tool is publicly available at http://eshadow.dcode.org/« less

  12. Similar folds with different stabilization mechanisms: the cases of prion and doppel proteins

    PubMed Central

    Colacino, Stefano; Tiana, Guido; Colombo, Giorgio

    2006-01-01

    Background Protein misfolding is the main cause of a group of fatal neurodegenerative diseases in humans and animals. In particular, in Prion-related diseases the normal cellular form of the Prion Protein PrP (PrPC) is converted into the infectious PrPSc through a conformational process during which it acquires a high β-sheet content. Doppel is a protein that shares a similar native fold, but lacks the scrapie isoform. Understanding the molecular determinants of these different behaviours is important both for biomedical and biophysical research. Results In this paper, the dynamical and energetic properties of the two proteins in solution is comparatively analyzed by means of long time scale explicit solvent, all-atom molecular dynamics in different temperature conditions. The trajectories are analyzed by means of a recently introduced energy decomposition approach (Tiana et al, Prot. Sci. 2004) aimed at identifying the key residues for the stabilization and folding of the protein. Our analysis shows that Prion and Doppel have two different cores stabilizing the native state and that the relative contribution of the nucleus to the global stability of the protein for Doppel is sensitively higher than for PrP. Moreover, under misfolding conditions the Doppel core is conserved, while the energy stabilization network of PrP is disrupted. Conclusion These observations suggest that different sequences can share similar native topology with different stabilizing interactions and that the sequences of the Prion and Doppel proteins may have diverged under different evolutionary constraints resulting in different folding and stabilization mechanisms. PMID:16857062

  13. Molecular Structures and Functional Relationships in Clostridial Neurotoxins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Swaminathan S.

    2011-12-01

    The seven serotypes of Clostridium botulinum neurotoxins (A-G) are the deadliest poison known to humans. They share significant sequence homology and hence possess similar structure-function relationships. Botulinum neurotoxins (BoNT) act via a four-step mechanism, viz., binding and internalization to neuronal cells, translocation of the catalytic domain into the cytosol and finally cleavage of one of the three soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNARE) causing blockage of neurotransmitter release leading to flaccid paralysis. Crystal structures of three holotoxins, BoNT/A, B and E, are available to date. Although the individual domains are remarkably similar, their domain organization is different. These structuresmore » have helped in correlating the structural and functional domains. This has led to the determination of structures of individual domains and combinations of them. Crystal structures of catalytic domains of all serotypes and several binding domains are now available. The catalytic domains are zinc endopeptidases and share significant sequence and structural homology. The active site architecture and the catalytic mechanism are similar although the binding mode of individual substrates may be different, dictating substrate specificity and peptide cleavage selectivity. Crystal structures of catalytic domains with substrate peptides provide clues to specificity and selectivity unique to BoNTs. Crystal structures of the receptor domain in complex with ganglioside or the protein receptor have provided information about the binding of botulinum neurotoxin to the neuronal cell. An overview of the structure-function relationship correlating the 3D structures with biochemical and biophysical data and how they can be used for structure-based drug discovery is presented here.« less

  14. Molecular Characterization and Chromosomal Distribution of Galileo, Kepler and Newton, Three Foldback Transposable Elements of the Drosophila buzzatii Species Complex

    PubMed Central

    Casals, Ferran; Cáceres, Mario; Manfrin, Maura Helena; González, Josefa; Ruiz, Alfredo

    2005-01-01

    Galileo is a foldback transposable element that has been implicated in the generation of two polymorphic chromosomal inversions in Drosophila buzzatii. Analysis of the inversion breakpoints led to the discovery of two additional elements, called Kepler and Newton, sharing sequence and structural similarities with Galileo. Here, we describe in detail the molecular structure of these three elements, on the basis of the 13 copies found at the inversion breakpoints plus 10 additional copies isolated during this work. Similarly to the foldback elements described in other organisms, these elements have long inverted terminal repeats, which in the case of Galileo possess a complex structure and display a high degree of internal variability between copies. A phylogenetic tree built with their shared sequences shows that the three elements are closely related and diverged ∼10 million years ago. We have also analyzed the abundance and chromosomal distribution of these elements in D. buzzatii and other species of the repleta group by Southern analysis and in situ hybridization. Overall, the results suggest that these foldback elements are present in all the buzzatti complex species and may have played an important role in shaping their genomes. In addition, we show that recombination rate is the main factor determining the chromosomal distribution of these elements. PMID:15695364

  15. Whole-genome and multisector exome sequencing of primary and post-treatment glioblastoma reveals patterns of tumor evolution.

    PubMed

    Kim, Hoon; Zheng, Siyuan; Amini, Seyed S; Virk, Selene M; Mikkelsen, Tom; Brat, Daniel J; Grimsby, Jonna; Sougnez, Carrie; Muller, Florian; Hu, Jian; Sloan, Andrew E; Cohen, Mark L; Van Meir, Erwin G; Scarpace, Lisa; Laird, Peter W; Weinstein, John N; Lander, Eric S; Gabriel, Stacey; Getz, Gad; Meyerson, Matthew; Chin, Lynda; Barnholtz-Sloan, Jill S; Verhaak, Roel G W

    2015-03-01

    Glioblastoma (GBM) is a prototypical heterogeneous brain tumor refractory to conventional therapy. A small residual population of cells escapes surgery and chemoradiation, resulting in a typically fatal tumor recurrence ∼ 7 mo after diagnosis. Understanding the molecular architecture of this residual population is critical for the development of successful therapies. We used whole-genome sequencing and whole-exome sequencing of multiple sectors from primary and paired recurrent GBM tumors to reconstruct the genomic profile of residual, therapy resistant tumor initiating cells. We found that genetic alteration of the p53 pathway is a primary molecular event predictive of a high number of subclonal mutations in glioblastoma. The genomic road leading to recurrence is highly idiosyncratic but can be broadly classified into linear recurrences that share extensive genetic similarity with the primary tumor and can be directly traced to one of its specific sectors, and divergent recurrences that share few genetic alterations with the primary tumor and originate from cells that branched off early during tumorigenesis. Our study provides mechanistic insights into how genetic alterations in primary tumors impact the ensuing evolution of tumor cells and the emergence of subclonal heterogeneity. © 2015 Kim et al.; Published by Cold Spring Harbor Laboratory Press.

  16. A new family of β-helix proteins with similarities to the polysaccharide lyases

    DOE PAGES

    Close, Devin W.; D'Angelo, Sara; Bradbury, Andrew R. M.

    2014-09-27

    Microorganisms that degrade biomass produce diverse assortments of carbohydrate-active enzymes and binding modules. Despite tremendous advances in the genomic sequencing of these organisms, many genes do not have an ascribed function owing to low sequence identity to genes that have been annotated. Consequently, biochemical and structural characterization of genes with unknown function is required to complement the rapidly growing pool of genomic sequencing data. A protein with previously unknown function (Cthe_2159) was recently isolated in a genome-wide screen using phage display to identify cellulose-binding protein domains from the biomass-degrading bacterium Clostridium thermocellum. Here, the crystal structure of Cthe_2159 is presentedmore » and it is shown that it is a unique right-handed parallel β-helix protein. Despite very low sequence identity to known β-helix or carbohydrate-active proteins, Cthe_2159 displays structural features that are very similar to those of polysaccharide lyase (PL) families 1, 3, 6 and 9. Cthe_2159 is conserved across bacteria and some archaea and is a member of the domain of unknown function family DUF4353. This suggests that Cthe_2159 is the first representative of a previously unknown family of cellulose and/or acid-sugar binding β-helix proteins that share structural similarities with PLs. More importantly, these results demonstrate how functional annotation by biochemical and structural analysis remains a critical tool in the characterization of new gene products.« less

  17. A new family of β-helix proteins with similarities to the polysaccharide lyases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Close, Devin W.; D'Angelo, Sara; Bradbury, Andrew R. M.

    Microorganisms that degrade biomass produce diverse assortments of carbohydrate-active enzymes and binding modules. Despite tremendous advances in the genomic sequencing of these organisms, many genes do not have an ascribed function owing to low sequence identity to genes that have been annotated. Consequently, biochemical and structural characterization of genes with unknown function is required to complement the rapidly growing pool of genomic sequencing data. A protein with previously unknown function (Cthe_2159) was recently isolated in a genome-wide screen using phage display to identify cellulose-binding protein domains from the biomass-degrading bacterium Clostridium thermocellum. Here, the crystal structure of Cthe_2159 is presentedmore » and it is shown that it is a unique right-handed parallel β-helix protein. Despite very low sequence identity to known β-helix or carbohydrate-active proteins, Cthe_2159 displays structural features that are very similar to those of polysaccharide lyase (PL) families 1, 3, 6 and 9. Cthe_2159 is conserved across bacteria and some archaea and is a member of the domain of unknown function family DUF4353. This suggests that Cthe_2159 is the first representative of a previously unknown family of cellulose and/or acid-sugar binding β-helix proteins that share structural similarities with PLs. More importantly, these results demonstrate how functional annotation by biochemical and structural analysis remains a critical tool in the characterization of new gene products.« less

  18. Sampling Daphnia's expressed genes: preservation, expansion and invention of crustacean genes with reference to insect genomes

    PubMed Central

    Colbourne, John K; Eads, Brian D; Shaw, Joseph; Bohuski, Elizabeth; Bauer, Darren J; Andrews, Justen

    2007-01-01

    Background Functional and comparative studies of insect genomes have shed light on the complement of genes, which in part, account for shared morphologies, developmental programs and life-histories. Contrasting the gene inventories of insects to those of the nematodes provides insight into the genomic changes responsible for their diversification. However, nematodes have weak relationships to insects, as each belongs to separate animal phyla. A better outgroup to distinguish lineage specific novelties would include other members of Arthropoda. For example, crustaceans are close allies to the insects (together forming Pancrustacea) and their fascinating aquatic lifestyle provides an important comparison for understanding the genetic basis of adaptations to life on land versus life in water. Results This study reports on the first characterization of cDNA libraries and sequences for the model crustacean Daphnia pulex. We analyzed 1,546 ESTs of which 1,414 represent approximately 787 nuclear genes, by measuring their sequence similarities with insect and nematode proteomes. The provisional annotation of genes is supported by expression data from microarray studies described in companion papers. Loci expected to be shared between crustaceans and insects because of their mutual biological features are identified, including genes for reproduction, regulation and cellular processes. We identify genes that are likely derived within Pancrustacea or lost within the nematodes. Moreover, lineage specific gene family expansions are identified, which suggest certain biological demands associated with their ecological setting. In particular, up to seven distinct ferritin loci are found in Daphnia compared to three in most insects. Finally, a substantial fraction of the sampled gene transcripts shares no sequence similarity with those from other arthropods. Genes functioning during development and reproduction are comparatively well conserved between crustaceans and insects. By contrast, genes that were responsive to environmental conditions (metal stress) and not sex-biased included the greatest proportion of genes with no matches to insect proteomes. Conclusion This study along with associated microarray experiments are the initial steps in a coordinated effort by the Daphnia Genomics Consortium to build the necessary genomic platform needed to discover genes that account for the phenotypic diversity within the genus and to gain new insights into crustacean biology. This effort will soon include the first crustacean genome sequence. PMID:17612412

  19. The Large Mitochondrial Genome of Symbiodinium minutum Reveals Conserved Noncoding Sequences between Dinoflagellates and Apicomplexans

    PubMed Central

    Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada

    2015-01-01

    Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. PMID:26199191

  20. Cloning and molecular characterization of the betaine aldehyde dehydrogenase involved in the biosynthesis of glycine betaine in white shrimp (Litopenaeus vannamei).

    PubMed

    Delgado-Gaytán, María F; Rosas-Rodríguez, Jesús A; Yepiz-Plascencia, Gloria; Figueroa-Soto, Ciria G; Valenzuela-Soto, Elisa M

    2017-10-01

    The enzyme betaine aldehyde dehydrogenase (BADH) catalyzes the irreversible oxidation of betaine aldehyde to glycine betaine (GB), a very efficient osmolyte accumulated during osmotic stress. In this study, we determined the nucleotide sequence of the cDNA for the BADH from the white shrimp Litopenaeus vannamei (LvBADH). The cDNA was 1882 bp long, with a complete open reading frame of 1524 bp, encoding 507 amino acids with a predicted molecular mass of 54.15 kDa and a pI of 5.4. The predicted LvBADH amino acid sequence shares a high degree of identity with marine invertebrate BADHs. Catalytic residues (C-298, E-264 and N-167) and the decapeptide VTLELGGKSP involved in nucleotide binding and highly conserved in BADHs were identified in the amino acid sequence. Phylogenetic analyses classified LvBADH in a clade that includes ALDH9 sequences from marine invertebrates. Molecular modeling of LvBADH revealed that the protein has amino acid residues and sequence motifs essential for the function of the ALDH9 family of enzymes. LvBADH modeling showed three potential monovalent cation binding sites, one site is located in an intra-subunit cavity; other in an inter-subunit cavity and a third in a central-cavity of the protein. The results show that LvBADH shares a high degree of identity with BADH sequences from marine invertebrates and enzymes that belong to the ALDH9 family. Our findings suggest that the LvBADH has molecular mechanisms of regulation similar to those of other BADHs belonging to the ALDH9 family, and that BADH might be playing a role in the osmoregulation capacity of L. vannamei. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Dissemination of IMP-6 metallo-β-lactamase-producing Pseudomonas aeruginosa sequence type 235 in Korea.

    PubMed

    Seok, Yoonmi; Bae, Il Kwon; Jeong, Seok Hoon; Kim, Soo Hyun; Lee, Hyukmin; Lee, Kyungwon

    2011-12-01

    To investigate the epidemiological traits of Pseudomonas aeruginosa clinical isolates producing metallo-β-lactamases (MBLs) in Korea. A total of 386 non-duplicate P. aeruginosa clinical isolates were collected from Korea in 2009. Detection of MBL genes was performed by PCR. The genetic organization of class 1 integrons carrying the MBL gene cassette was investigated by PCR mapping and sequencing. The epidemiological relationships of the isolates were investigated by multilocus sequence typing and PFGE. Of 386 P. aeruginosa isolates, 30 (7.8%) isolates carried the bla(IMP-6) gene and 1 (0.3%) isolate carried the bla(VIM-2) gene. A probe specific for the bla(IMP-6) gene was hybridized to an ∼950 kbp I-CeuI-macrorestriction fragment from all 30 isolates and a probe specific for the bla(VIM-2) gene also hybridized to an ∼500 kbp I-CeuI-macrorestriction fragment from 1 isolate (BDC10). All 31 MBL-producing isolates shared an identical sequence type (ST), ST235, and they carried the same bla(OXA-50) allelic type, bla(OXA-50g). All MBL-producing isolates showed similar XbaI-macrorestriction patterns (similarity >85%), irrespective of MBL genotype. P. aeruginosa ST235 carrying the chromosomally located bla(IMP-6) gene is widely disseminated in Korea.

  2. Microbial diversity in an Armenian geothermal spring assessed by molecular and culture-based methods.

    PubMed

    Panosyan, Hovik; Birkeland, Nils-Kåre

    2014-11-01

    The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Sequence-based analysis of pQBR103; a representative of a unique, transfer-proficient mega plasmid resident in the microbial community of sugar beet

    PubMed Central

    Tett, Adrian; Spiers, Andrew J; Crossman, Lisa C; Ager, Duane; Ciric, Lena; Dow, J Maxwell; Fry, John C; Harris, David; Lilley, Andrew; Oliver, Anna; Parkhill, Julian; Quail, Michael A; Rainey, Paul B; Saunders, Nigel J; Seeger, Kathy; Snyder, Lori AS; Squares, Rob; Thomas, Christopher M; Turner, Sarah L; Zhang, Xue-Xian; Field, Dawn; Bailey, Mark J

    2009-01-01

    The plasmid pQBR103 was found within Pseudomonas populations colonizing the leaf and root surfaces of sugar beet plants growing at Wytham, Oxfordshire, UK. At 425 kb it is the largest self-transmissible plasmid yet sequenced from the phytosphere. It is known to enhance the competitive fitness of its host, and parts of the plasmid are known to be actively transcribed in the plant environment. Analysis of the complete sequence of this plasmid predicts a coding sequence (CDS)-rich genome containing 478 CDSs and an exceptional degree of genetic novelty; 80% of predicted coding sequences cannot be ascribed a function and 60% are orphans. Of those to which function could be assigned, 40% bore greatest similarity to sequences from Pseudomonas spp, and the majority of the remainder showed similarity to other c-proteobacterial genera and plasmids. pQBR103 has identifiable regions presumed responsible for replication and partitioning, but despite being tra+ lacks the full complement of any previously described conjugal transfer functions. The DNA sequence provided few insights into the functional significance of plant-induced transcriptional regions, but suggests that 14% of CDSs may be expressed (11 CDSs with functional annotation and 54 without), further highlighting the ecological importance of these novel CDSs. Comparative analysis indicates that pQBR103 shares significant regions of sequence with other plasmids isolated from sugar beet plants grown at the same geographic location. These plasmid sequences indicate there is more novelty in the mobile DNA pool accessible to phytosphere pseudomonas than is currently appreciated or understood. PMID:18043644

  4. Biochemical and genetic characterization of enterocin A from Enterococcus faecium, a new antilisterial bacteriocin in the pediocin family of bacteriocins.

    PubMed Central

    Aymerich, T; Holo, H; Håvarstein, L S; Hugas, M; Garriga, M; Nes, I F

    1996-01-01

    A new bacteriocin has been isolated from an Enterococcus faecium strain. The bacteriocin, termed enterocin A, was purified to homogeneity as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, N-terminal amino acid sequencing, and mass spectrometry analysis. By combining the data obtained from amino acid and DNA sequencing, the primary structure of enterocin A was determined. It consists of 47 amino acid residues, and the molecular weight was calculated to be 4,829, assuming that the four cysteine residues form intramolecular disulfide bridges. This molecular weight was confirmed by mass spectrometry analysis. The amino acid sequence of enterocin A shared significant homology with a group of bacteriocins (now termed pediocin-like bacteriocins) isolated from a variety of lactic acid-producing bacteria, which include members of the genera Lactobacillus, Pediococcus, Leuconostoc, and Carnobacterium. Sequencing of the structural gene of enterocin A, which is located on the bacterial chromosome, revealed an N-terminal leader sequence of 18 amino acid residues, which was removed during the maturation process. The enterocin A leader belongs to the double-glycine leaders which are found among most other small nonlantibiotic bacteriocins, some lantibiotics, and colicin V. Downstream of the enterocin A gene was located a second open reading frame, encoding a putative protein of 103 amino acid residues. This gene may encode the immunity factor of enterocin A, and it shares 40% identity with a similar open reading frame in the operon of leucocin AUL 187, another pediocin-like bacteriocin. PMID:8633865

  5. Nonstructural proteins nsP3 and nsP4 of Ross River and O'Nyong-nyong viruses: sequence and comparison with those of other alphaviruses.

    PubMed

    Strauss, E G; Levinson, R; Rice, C M; Dalrymple, J; Strauss, J H

    1988-05-01

    We have sequenced the nsP3 and nsP4 region of two alphaviruses, Ross River virus and O'Nyong-nyong virus, in order to examine these viruses for the presence or absence of an opal termination codon present between nsP3 and nsP4 in many alphaviruses. We found that Ross River virus possesses an in-phase opal termination codon between nsP3 and nsP4, whereas in O'Nyong-nyong virus this termination codon is replaced by an arginine codon. Previous studies have shown that two other alphaviruses, Sindbis virus and Middelburg virus, possess an opal termination codon separating nsP3 and nsP4 [E.G. Strauss, C.M. Rice, and J.H. Strauss (1983), Proc. Natl. Acad. Sci. USA 80, 5271-5275], whereas Semliki Forest virus possesses an arginine codon in lieu of the opal codon [K. Takkinen (1986), Nucleic Acids Res. 14, 5667-5682]. Thus, of the five alphaviruses examined to date, three possess the opal codon and two do not. Production of nsP4 requires readthrough of the opal codon in those alphaviruses that possess this termination codon and the function of the termination codon may be to regulate the amount of nsP4 produced. It is an open question then as to whether alphaviruses with no termination codon use other mechanisms to regulate the activity of this gene. The nsP4s of these five alphaviruses are highly conserved, sharing 71-76% amino acid sequence similarity, and all five contain the Gly-Asp-Asp motif found in many RNA virus replicases. The nsP3s are somewhat less conserved, sharing 52-73% amino acid sequence similarity throughout most of the protein, but each possesses a nonconserved C-terminal domain of 134 to 246 amino acids of unknown function.

  6. Scaling similarities of multiple fracturing of solid materials

    NASA Astrophysics Data System (ADS)

    Kapiris, P. G.; Balasis, G. T.; Kopanas, J. A.; Antonopoulos, G. N.; Peratzakis, A. S.; Eftaxias, K. A.

    2004-02-01

    It has recently reported that electromagnetic flashes of low-energy gamma-rays emitted during multi-fracturing on a neutron star, and electromagnetic pulses emitted in the laboratory by a disordered material subjected to an increasing external load, share distinctive statistical properties with earthquakes, such as power-law energy distributions (Cheng et al., 1996; Kossobokov et al., 2000; Rabinovitch et al., 2001; Sornette and Helmstetter, 2002). The neutron starquakes may release strain energies up to 1046 erg, while, the fractures in laboratory samples release strain energies approximately a fraction of an erg. An earthquake fault region can build up strain energy up to approximately 1026 erg for the strongest earthquakes. Clear sequences of kilohertz-megahertz electromagnetic avalanches have been detected from a few days up to a few hours prior to recent destructive earthquakes in Greece. A question that arises effortlessly is if the pre-seismic electromagnetic fluctuations also share the same statistical properties. Our study justifies a positive answer. Our analysis also reveals "symptoms" of a transition to the main rupture common with earthquake sequences and acoustic emission pulses observed during laboratory experiments (Maes et al., 1998).

  7. On Asymptotically Good Ramp Secret Sharing Schemes

    NASA Astrophysics Data System (ADS)

    Geil, Olav; Martin, Stefano; Martínez-Peñas, Umberto; Matsumoto, Ryutaroh; Ruano, Diego

    Asymptotically good sequences of linear ramp secret sharing schemes have been intensively studied by Cramer et al. in terms of sequences of pairs of nested algebraic geometric codes. In those works the focus is on full privacy and full reconstruction. In this paper we analyze additional parameters describing the asymptotic behavior of partial information leakage and possibly also partial reconstruction giving a more complete picture of the access structure for sequences of linear ramp secret sharing schemes. Our study involves a detailed treatment of the (relative) generalized Hamming weights of the considered codes.

  8. Genetic diversity of merozoite surface antigens in Babesia bovis detected from Sri Lankan cattle.

    PubMed

    Sivakumar, Thillaiampalam; Okubo, Kazuhiro; Igarashi, Ikuo; de Silva, Weligodage Kumarawansa; Kothalawala, Hemal; Silva, Seekkuge Susil Priyantha; Vimalakumar, Singarayar Caniciyas; Meewewa, Asela Sanjeewa; Yokoyama, Naoaki

    2013-10-01

    Babesia bovis, the causative agent of severe bovine babesiosis, is endemic in Sri Lanka. The live attenuated vaccine (K-strain), which was introduced in the early 1990s, has been used to immunize cattle populations in endemic areas of the country. The present study was undertaken to determine the genetic diversity of merozoite surface antigens (MSAs) in B. bovis isolates from Sri Lankan cattle, and to compare the gene sequences obtained from such isolates against those of the K-strain. Forty-four bovine blood samples isolated from different geographical regions of Sri Lanka and judged to be B. bovis-positive by PCR screening were used to amplify MSAs (MSA-1, MSA-2c, MSA-2a1, MSA-2a2, and MSA-2b), AMA-1, and 12D3 genes from parasite DNA. Although the AMA-1 and 12D3 gene sequences were highly conserved among the Sri Lankan isolates, the MSA gene sequences from the same isolates were highly diverse. Sri Lankan MSA-1, MSA-2c, MSA-2a1, MSA-2a2, and MSA-2b sequences clustered within 5, 2, 4, 1, and 9 different clades in the gene phylograms, respectively, while the minimum similarity values among the deduced amino acid sequences of these genes were 36.8%, 68.7%, 80.3%, 100%, and 68.3%, respectively. In the phylograms, none of the Sri Lankan sequences fell within clades containing the respective K-strain sequences. Additionally, the similarity values for MSA-1 and MSA-2c were 40-61.8% and 90.9-93.2% between the Sri Lankan isolates and the K-strain, respectively, while the K-strain MSA-2a/b sequence shared 64.5-69.8%, 69.3%, and 70.5-80.3% similarities with the Sri Lankan MSA-2a1, MSA-2a2, and MSA-2b sequences, respectively. The present study has shown that genetic diversity among MSAs of Sri Lankan B. bovis isolates is very high, and that the sequences of field isolates diverged genetically from the K-strain. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Misconceptions on Missing Data in RAD-seq Phylogenetics with a Deep-scale Example from Flowering Plants.

    PubMed

    Eaton, Deren A R; Spriggs, Elizabeth L; Park, Brian; Donoghue, Michael J

    2017-05-01

    Restriction-site associated DNA (RAD) sequencing and related methods rely on the conservation of enzyme recognition sites to isolate homologous DNA fragments for sequencing, with the consequence that mutations disrupting these sites lead to missing information. There is thus a clear expectation for how missing data should be distributed, with fewer loci recovered between more distantly related samples. This observation has led to a related expectation: that RAD-seq data are insufficiently informative for resolving deeper scale phylogenetic relationships. Here we investigate the relationship between missing information among samples at the tips of a tree and information at edges within it. We re-analyze and review the distribution of missing data across ten RAD-seq data sets and carry out simulations to determine expected patterns of missing information. We also present new empirical results for the angiosperm clade Viburnum (Adoxaceae, with a crown age >50 Ma) for which we examine phylogenetic information at different depths in the tree and with varied sequencing effort. The total number of loci, the proportion that are shared, and phylogenetic informativeness varied dramatically across the examined RAD-seq data sets. Insufficient or uneven sequencing coverage accounted for similar proportions of missing data as dropout from mutation-disruption. Simulations reveal that mutation-disruption, which results in phylogenetically distributed missing data, can be distinguished from the more stochastic patterns of missing data caused by low sequencing coverage. In Viburnum, doubling sequencing coverage nearly doubled the number of parsimony informative sites, and increased by >10X the number of loci with data shared across >40 taxa. Our analysis leads to a set of practical recommendations for maximizing phylogenetic information in RAD-seq studies. [hierarchical redundancy; phylogenetic informativeness; quartet informativeness; Restriction-site associated DNA (RAD) sequencing; sequencing coverage; Viburnum.]. © The authors 2016. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

  10. Characterizing protein domain associations by Small-molecule ligand binding

    PubMed Central

    Li, Qingliang; Cheng, Tiejun; Wang, Yanli; Bryant, Stephen H.

    2012-01-01

    Background Protein domains are evolutionarily conserved building blocks for protein structure and function, which are conventionally identified based on protein sequence or structure similarity. Small molecule binding domains are of great importance for the recognition of small molecules in biological systems and drug development. Many small molecules, including drugs, have been increasingly identified to bind to multiple targets, leading to promiscuous interactions with protein domains. Thus, a large scale characterization of the protein domains and their associations with respect to small-molecule binding is of particular interest to system biology research, drug target identification, as well as drug repurposing. Methods We compiled a collection of 13,822 physical interactions of small molecules and protein domains derived from the Protein Data Bank (PDB) structures. Based on the chemical similarity of these small molecules, we characterized pairwise associations of the protein domains and further investigated their global associations from a network point of view. Results We found that protein domains, despite lack of similarity in sequence and structure, were comprehensively associated through binding the same or similar small-molecule ligands. Moreover, we identified modules in the domain network that consisted of closely related protein domains by sharing similar biochemical mechanisms, being involved in relevant biological pathways, or being regulated by the same cognate cofactors. Conclusions A novel protein domain relationship was identified in the context of small-molecule binding, which is complementary to those identified by traditional sequence-based or structure-based approaches. The protein domain network constructed in the present study provides a novel perspective for chemogenomic study and network pharmacology, as well as target identification for drug repurposing. PMID:23745168

  11. Adrenergic Agonists Bind to Adrenergic-Receptor-Like Regions of the Mu Opioid Receptor, Enhancing Morphine and Methionine-Enkephalin Binding: A New Approach to "Biased Opioids"?

    PubMed

    Root-Bernstein, Robert; Turke, Miah; Subhramanyam, Udaya K Tiruttani; Churchill, Beth; Labahn, Joerg

    2018-01-17

    Extensive evidence demonstrates functional interactions between the adrenergic and opioid systems in a diversity of tissues and organs. While some effects are due to receptor and second messenger cross-talk, recent research has revealed an extracellular, allosteric opioid binding site on adrenergic receptors that enhances adrenergic activity and its duration. The present research addresses whether opioid receptors may have an equivalent extracellular, allosteric adrenergic binding site that has similar enhancing effects on opioid binding. Comparison of adrenergic and opioid receptor sequences revealed that these receptors share very significant regions of similarity, particularly in some of the extracellular and transmembrane regions associated with adrenergic binding in the adrenergic receptors. Five of these shared regions from the mu opioid receptor (muOPR) were synthesized as peptides and tested for binding to adrenergic, opioid and control compounds using ultraviolet spectroscopy. Adrenergic compounds bound to several of these muOPR peptides with low micromolar affinity while acetylcholine, histamine and various adrenergic antagonists did not. Similar studies were then conducted with purified, intact muOPR with similar results. Combinations of epinephrine with methionine enkephalin or morphine increased the binding of both by about half a log unit. These results suggest that muOPR may be allosterically enhanced by adrenergic agonists.

  12. Identification of the Core Set of Carbon-Associated Genes in a Bioenergy Grassland Soil

    DOE PAGES

    Howe, Adina; Yang, Fan; Williams, Ryan J.; ...

    2016-11-17

    Despite the central role of soil microbial communities in global carbon (C) cycling, little is known about soil microbial community structure and even less about their metabolic pathways. Efforts to characterize soil communities often focus on identifying differences in gene content across environmental gradients, but an alternative question is what genes are similar in soils. These genes may indicate critical species or potential functions that are required in all soils. Here we identified the “core” set of C cycling sequences widely present in multiple soil metagenomes from a fertilized prairie (FP). Of 226,887 sequences associated with known enzymes involved inmore » the synthesis, metabolism, and transport of carbohydrates, 843 were identified to be consistently prevalent across four replicate soil metagenomes. This core metagenome was functionally and taxonomically diverse, representing five enzyme classes and 99 enzyme families within the CAZy database. Though it only comprised 0.4% of all CAZy-associated genes identified in FP metagenomes, the core was found to be comprised of functions similar to those within cumulative soils. The FP CAZy-associated core sequences were present in multiple publicly available soil metagenomes and most similar to soils sharing geographic proximity. As a result, in soil ecosystems, where high diversity remains a key challenge for metagenomic investigations, these core genes represent a subset of critical functions necessary for carbohydrate metabolism, which can be targeted to evaluate important C fluxes in these and other similar soils.« less

  13. Microbial genomic taxonomy

    PubMed Central

    2013-01-01

    A need for a genomic species definition is emerging from several independent studies worldwide. In this commentary paper, we discuss recent studies on the genomic taxonomy of diverse microbial groups and a unified species definition based on genomics. Accordingly, strains from the same microbial species share >95% Average Amino Acid Identity (AAI) and Average Nucleotide Identity (ANI), >95% identity based on multiple alignment genes, <10 in Karlin genomic signature, and > 70% in silico Genome-to-Genome Hybridization similarity (GGDH). Species of the same genus will form monophyletic groups on the basis of 16S rRNA gene sequences, Multilocus Sequence Analysis (MLSA) and supertree analysis. In addition to the established requirements for species descriptions, we propose that new taxa descriptions should also include at least a draft genome sequence of the type strain in order to obtain a clear outlook on the genomic landscape of the novel microbe. The application of the new genomic species definition put forward here will allow researchers to use genome sequences to define simultaneously coherent phenotypic and genomic groups. PMID:24365132

  14. The Classification and Evolution of Enzyme Function

    PubMed Central

    Martínez Cuesta, Sergio; Rahman, Syed Asad; Furnham, Nicholas; Thornton, Janet M.

    2015-01-01

    Enzymes are the proteins responsible for the catalysis of life. Enzymes sharing a common ancestor as defined by sequence and structure similarity are grouped into families and superfamilies. The molecular function of enzymes is defined as their ability to catalyze biochemical reactions; it is manually classified by the Enzyme Commission and robust approaches to quantitatively compare catalytic reactions are just beginning to appear. Here, we present an overview of studies at the interface of the evolution and function of enzymes. PMID:25986631

  15. Nucleic acids encoding plant glutamine phenylpyruvate transaminase (GPT) and uses thereof

    DOEpatents

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-03-29

    Glutamine phenylpyruvate transaminase (GPT) proteins, nucleic acid molecules encoding GPT proteins, and uses thereof are disclosed. Provided herein are various GPT proteins and GPT gene coding sequences isolated from a number of plant species. As disclosed herein, GPT proteins share remarkable structural similarity within plant species, and are active in catalyzing the synthesis of 2-hydroxy-5-oxoproline (2-oxoglutaramate), a powerful signal metabolite which regulates the function of a large number of genes involved in the photosynthesis apparatus, carbon fixation and nitrogen metabolism.

  16. Crystal Structure of the Nipah Virus Phosphoprotein Tetramerization Domain

    PubMed Central

    Bruhn, Jessica F.; Barnett, Katherine C.; Bibby, Jaclyn; Thomas, Jens M. H.; Keegan, Ronan M.; Rigden, Daniel J.; Bornholdt, Zachary A.

    2014-01-01

    The Nipah virus phosphoprotein (P) is multimeric and tethers the viral polymerase to the nucleocapsid. We present the crystal structure of the multimerization domain of Nipah virus P: a long, parallel, tetrameric, coiled coil with a small, α-helical cap structure. Across the paramyxoviruses, these domains share little sequence identity yet are similar in length and structural organization, suggesting a common requirement for scaffolding or spatial organization of the functions of P in the virus life cycle. PMID:24155387

  17. Modeling Pediatric Brain Trauma: Piglet Model of Controlled Cortical Impact.

    PubMed

    Pareja, Jennifer C Munoz; Keeley, Kristen; Duhaime, Ann-Christine; Dodge, Carter P

    2016-01-01

    The brain has different responses to traumatic injury as a function of its developmental stage. As a model of injury to the immature brain, the piglet shares numerous similarities in regards to morphology and neurodevelopmental sequence compared to humans. This chapter describes a piglet scaled focal contusion model of traumatic brain injury that accounts for the changes in mass and morphology of the brain as it matures, facilitating the study of age-dependent differences in response to a comparable mechanical trauma.

  18. A complete mitochondrial genome sequence of Asian black bear Sichuan subspecies (Ursus thibetanus mupinensis)

    PubMed Central

    Hou, Wan-ru; Chen, Yu; Wu, Xia; Hu, Jin-chu; Peng, Zheng-song; Yang, Jung; Tang, Zong-xiang; Zhou, Cai-Quan; Li, Yu-ming; Yang, Shi-kui; Du, Yu-jie; Kong, Ling-lu; Ren, Zheng-long; Zhang, Huai-yu; Shuai, Su-rong

    2007-01-01

    We obtained the complete mitochondrial genome of U.thibetanus mupinensis by DNA sequencing based on the PCR fragments of 18 primers we designed. The results indicate that the mtDNA is 16 868 bp in size, encodes 13 protein genes, 22 tRNA genes, and 2 rRNA genes, with an overall H-strand base composition of 31.2% A, 25.4% C, 15.5% G and 27.9% T. The sequence of the control region (CR) located between tRNA-Pro and tRNA-Phe is 1422 bp in size, consists of 8.43% of the whole genome, GC content is 51.9% and has a 6bp tandem repeat and two 10bp tandem repeats identified by using the Tandem Repeats Finder. U. thibetanus mupinensis mitochondrial genome shares high similarity with those of three other Ursidae: U. americanus (91.46%), U. arctos (89.25%) and U. maritimus (87.66%). PMID:17205108

  19. Comparative analysis of chloroplast genomes of the genus Citrus and its close relatives.

    PubMed

    Liu, Xiaogang; Wu, Hongkun; Luo, Yan; Xi, Wanpeng; Zhou, Zhiqin

    2017-01-01

    The genus Citrus and its close relatives are economically and nutritionally important fruit trees. However, the huge controversy over the phylogeny of key wild species, as well as the genetic relationship between the cultivated species and their putative wild progenitors, remains unresolved. Comparative analyses of chloroplast (cp) genomes have been useful in resolving various phylogenetic issues. Thus far, the cp genomes of only two Citrus species have been sequenced. In this study, we sequenced six complete cp genomes, four belonging to the genus Citrus, and two belonging to the genera Fortunella and Poncirus, respectively. These newly sequenced genomes together with the two publicly available were used for comparative analyses of the genus Citrus and its close relatives. All eight cp genomes share similar basic structure, gene order and gene content. Phylogenetic analyses supported the monophyly of the three genera in the order Sapindales within the major clade Malvidae.

  20. Fast Dissemination of New HIV-1 CRF02/A1 Recombinants in Pakistan

    PubMed Central

    Chen, Yue; Hora, Bhavna; DeMarco, Todd; Shah, Sharaf Ali; Ahmed, Manzoor; Sanchez, Ana M.; Su, Chang; Carter, Meredith; Stone, Mars; Hasan, Rumina; Hasan, Zahra; Busch, Michael P.; Denny, Thomas N.; Gao, Feng

    2016-01-01

    A number of HIV-1 subtypes are identified in Pakistan by characterization of partial viral gene sequences. Little is known whether new recombinants are generated and how they disseminate since whole genome sequences for these viruses have not been characterized. Near full-length genome (NFLG) sequences were obtained by amplifying two overlapping half genomes or next generation sequencing from 34 HIV-1-infected individuals in Pakistan. Phylogenetic tree analysis showed that the newly characterized sequences were 16 subtype As, one subtype C, and 17 A/G recombinants. Further analysis showed that all 16 subtype A1 sequences (47%), together with the vast majority of sequences from Pakistan from other studies, formed a tight subcluster (A1a) within the subtype A1 clade, suggesting that they were derived from a single introduction. More in-depth analysis of 17 A/G NFLG sequences showed that five shared similar recombination breakpoints as in CRF02 (15%) but were phylogenetically distinct from the prototype CRF02 by forming a tight subcluster (CRF02a) while 12 (38%) were new recombinants between CRF02a and A1a or a divergent A1b viruses. Unique recombination patterns among the majority of the newly characterized recombinants indicated ongoing recombination. Interestingly, recombination breakpoints in these CRF02/A1 recombinants were similar to those in prototype CRF02 viruses, indicating that recombination at these sites more likely generate variable recombinant viruses. The dominance and fast dissemination of new CRF02a/A1 recombinants over prototype CRF02 suggest that these recombinant have more adapted and may become major epidemic strains in Pakistan. PMID:27973597

  1. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    PubMed

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  2. Phylogenetic analysis of phenotypically characterized Cryptococcus laurentii isolates reveals high frequency of cryptic species.

    PubMed

    Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

    2014-01-01

    Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99-100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode.

  3. Second generation DNA sequencing of the mitogenome of the Chinstrap penguin and comparative genomics of Antarctic penguins.

    PubMed

    Subramanian, Sankar; Lingala, Syamala Gowri; Swaminathan, Siva; Huynen, Leon; Lambert, David

    2014-08-01

    The complete mitochondrial genome of the Chinstrap penguin (Pygoscelis antarcticus) was sequenced and compared with other penguin mitogenomes. The genome is 15,972 bp in length with the number and order of protein coding genes and RNAs being very similar to that of other known penguin mitogenomes. Comparative nucleotide analysis showed the Chinstrap mitogenome shares 94% homology with the mitogenome of its sister species, Pygoscelis adelie (Adélie penguin). Divergence at nonsynonymous nucleotide positions was found to be up to 23 times less than that observed in synonymous positions of protein coding genes, suggesting high selection constraints. The complete mitogenome data will be useful for genetic and evolutionary studies of penguins.

  4. Mitochondrial DNA variation and phylogenetic relationships among five tuna species based on sequencing of D-loop region.

    PubMed

    Kumar, Girish; Kocour, Martin; Kunal, Swaraj Priyaranjan

    2016-05-01

    In order to assess the DNA sequence variation and phylogenetic relationship among five tuna species (Auxis thazard, Euthynnus affinis, Katsuwonus pelamis, Thunnus tonggol, and T. albacares) out of all four tuna genera, partial sequences of the mitochondrial DNA (mtDNA) D-loop region were analyzed. The estimate of intra-specific sequence variation in studied species was low, ranging from 0.027 to 0.080 [Kimura's two parameter distance (K2P)], whereas values of inter-specific variation ranged from 0.049 to 0.491. The longtail tuna (T. tonggol) and yellowfin tuna (T. albacares) were found to share a close relationship (K2P = 0.049) while skipjack tuna (K. pelamis) was most divergent studied species. Phylogenetic analysis using Maximum-Likelihood (ML) and Neighbor-Joining (NJ) methods supported the monophyletic origin of Thunnus species. Similarly, phylogeny of Auxis and Euthynnus species substantiate the monophyly. However, results showed a distinct origin of K. pelamis from genus Thunnus as well as Auxis and Euthynnus. Thus, the mtDNA D-loop region sequence data supports the polyphyletic origin of tuna species.

  5. Identification and Sequencing of a Novel Rodent Gammaherpesvirus That Establishes Acute and Latent Infection in Laboratory Mice ▿

    PubMed Central

    Loh, Joy; Zhao, Guoyan; Nelson, Christopher A.; Coder, Penny; Droit, Lindsay; Handley, Scott A.; Johnson, L. Steven; Vachharajani, Punit; Guzman, Hilda; Tesh, Robert B.; Wang, David; Fremont, Daved H.; Virgin, Herbert W.

    2011-01-01

    Gammaherpesviruses encode numerous immunomodulatory molecules that contribute to their ability to evade the host immune response and establish persistent, lifelong infections. As the human gammaherpesviruses are strictly species specific, small animal models of gammaherpesvirus infection, such as murine gammaherpesvirus 68 (γHV68) infection, are important for studying the roles of gammaherpesvirus immune evasion genes in in vivo infection and pathogenesis. We report here the genome sequence and characterization of a novel rodent gammaherpesvirus, designated rodent herpesvirus Peru (RHVP), that shares conserved genes and genome organization with γHV68 and the primate gammaherpesviruses but is phylogenetically distinct from γHV68. RHVP establishes acute and latent infection in laboratory mice. Additionally, RHVP contains multiple open reading frames (ORFs) not present in γHV68 that have sequence similarity to primate gammaherpesvirus immunomodulatory genes or cellular genes. These include ORFs with similarity to major histocompatibility complex class I (MHC-I), C-type lectins, and the mouse mammary tumor virus and herpesvirus saimiri superantigens. As these ORFs may function as immunomodulatory or virulence factors, RHVP presents new opportunities for the study of mechanisms of immune evasion by gammaherpesviruses. PMID:21209105

  6. Novel FAM20A mutation causes autosomal recessive amelogenesis imperfecta.

    PubMed

    Volodarsky, Michael; Zilberman, Uri; Birk, Ohad S

    2015-06-01

    To relate the peculiar phenotype of amelogenesis imperfecta in a large Bedouin family to the genotype determined by whole genome linkage analysis. Amelogenesis imperfecta (AI) is a broad group of inherited pathologies affecting enamel formation, characterized by variability in phenotypes, causing mutations and modes of inheritance. Autosomal recessive or compound heterozygous mutations in FAM20A, encoding sequence similarity 20, member A, have been shown to cause several AI phenotypes. Five members from a large consanguineous Bedouin family presented with hypoplastic amelogenesis imperfecta with unerupted and resorbed permanent molars. Following Soroka Medical Center IRB approval and informed consent, blood samples were obtained from six affected offspring, five obligatory carriers and two unaffected siblings. Whole genome linkage analysis was performed followed by Sanger sequencing of FAM20A. The sequencing unravelled a novel homozygous deletion mutation in exon 11 (c.1523delC), predicted to insert a premature stop codon (p.Thr508Lysfs*6). We provide an interesting case of novel mutation in this rare disorder, in which the affected kindred is unique in the large number of family members sharing a similar phenotype. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Reclassification of Lactobacillus kimchii and Lactobacillus bobalius as later subjective synonyms of Lactobacillus paralimentarius.

    PubMed

    Pang, Huili; Kitahara, Maki; Tan, Zhongfang; Wang, Yanping; Qin, Guangyong; Ohkuma, Moriya; Cai, Yimin

    2012-10-01

    Characterization and identification of strain CW 1 ( = JCM 17161) isolated from corn silage were performed. Strain CW 1 was a Gram-positive, catalase-negative and homofermentative rod that produced the DL-form of lactic acid. This strain exhibited more than 99.6% 16S rRNA gene sequence similarity and greater than 82% DNA-DNA reassociation with type strains of Lactobacillus kimchii, L. bobalius and L. paralimentarius. To clarify the taxonomic positions of these type strains, phenotypic characterization, 16S rRNA gene sequencing, ribotyping and DNA-DNA relatedness were examined. The three type strains displayed different L-arabinose, lactose, melibiose, melezitose, raffinose and N-acetyl-β-glucosaminidase fermentation patterns. Phylogenetic analysis showed that L. paralimentarius is a closer neighbour of L. kimchii and L. bobalius, sharing 99.5-99.9% 16S rRNA gene sequence similarity, which was confirmed by the high DNA-DNA relatedness (≥82%) between L. paralimentarius JCM 10415(T), L. bobalius JCM 16180(T) and L. kimchii JCM 10707(T). Therefore, it is proposed that L. kimchii and L. bobalius should be reclassified as later synonyms of L. paralimentarius.

  8. Streptococcus moroccensis sp. nov. and Streptococcus rifensis sp. nov., isolated from raw camel milk.

    PubMed

    Kadri, Zaina; Amar, Mohamed; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; El Farricha, Omar; Vandamme, Peter

    2014-07-01

    Two catalase- and oxidase-negative Streptococcus-like strains, LMG 27682(T) and LMG 27684(T), were isolated from raw camel milk in Morocco. Comparative 16S rRNA gene sequencing assigned these bacteria to the genus Streptococcus with Streptococcus rupicaprae 2777-2-07(T) as their closest phylogenetic neighbour (95.9% and 95.7% similarity, respectively). 16S rRNA gene sequence similarity between the two strains was 96.7%. Although strains LMG 27682(T) and LMG 27684(T) shared a DNA-DNA hybridization value that corresponded to the threshold level for species delineation (68%), the two strains could be distinguished by multiple biochemical tests, sequence analysis of the phenylalanyl-tRNA synthase (pheS), RNA polymerase (rpoA) and ATP synthase (atpA) genes and by their MALDI-TOF MS profiles. On the basis of these considerable phenotypic and genotypic differences, we propose to classify both strains as novel species of the genus Streptococcus, for which the names Streptococcus moroccensis sp. nov. (type strain, LMG 27682(T)  = CCMM B831(T)) and Streptococcus rifensis sp. nov. (type strain, LMG 27684(T)  = CCMM B833(T)) are proposed. © 2014 IUMS.

  9. Murine mesenchymal and embryonic stem cells express a similar Hox gene profile.

    PubMed

    Phinney, Donald G; Gray, Andrew J; Hill, Katy; Pandey, Amitabh

    2005-12-30

    Using degenerate oligonucleotide primers targeting the homeobox domain, we amplified by PCR and sequenced 723 clones from five murine cell populations and lines derived from embryonic mesoderm and adult bone marrow. Transcripts from all four vertebrate Hox clusters were expressed by the different populations. Hierarchical clustering of the data revealed that mesenchymal stem cells (MSCs) and the embryonic stem (ES) cell line D3 shared a similar Hox expression profile. These populations exclusively expressed Hoxb2, Hoxb5, Hoxb7, and Hoxc4, transcripts regulating self-renewal and differentiation of other stem cells. Additionally, Hoxa7 transcript quantified by real-time PCR strongly correlated (r2=0.89) with the number of Hoxa7 clones identified by sequencing, validating that data from the PCR screen reflects differences in Hox mRNA abundance between populations. This is the first study to catalogue Hox transcripts in murine MSCs and by comparative analyses identify specific Hox genes that may contribute to their stem cell character.

  10. Genetic characterization of novel putative rhabdovirus and dsRNA virus from Japanese persimmon.

    PubMed

    Ito, Takao; Suzaki, Koichi; Nakano, Masaaki

    2013-08-01

    Deep-sequencing analysis of nucleic acids from leaf tissue of Japanese persimmon trees exhibiting fruit apex disorder in some fruits detected two molecules that were graft transmitted to healthy seedlings. One of the complete genomes consisted of 13 467 nt and encoded six genes similar to those of plant rhabdoviruses. The virus formed a distinct cluster in the genus Cytorhabdovirus with lettuce necrotic yellows virus, lettuce yellow mottle virus and strawberry crinkle virus in a phylogenetic tree based on the L protein (RNA-dependent RNA polymerase, RdRp). The other consisted of 7475 nt and shared a genome organization similar to those of some insect and fungal viruses having dsRNA genomes. In a phylogenetic tree using the RdRp sequence of several unassigned dsRNA viruses, the virus formed a possible new genus cluster with two insect viruses, Circulifer tenellus virus 1 and Spissistilus festinus virus 1, and one plant virus, cucurbit yellows-associated virus.

  11. Holding a manual response sequence in memory can disrupt vocal responses that share semantic features with the manual response.

    PubMed

    Fournier, Lisa Renee; Wiediger, Matthew D; McMeans, Ryan; Mattson, Paul S; Kirkwood, Joy; Herzog, Theibot

    2010-07-01

    Holding an action plan in memory for later execution can delay execution of another action if the actions share a similar (compatible) feature. This compatibility interference (CI) occurs for actions that share the same response modality (e.g., manual response). We investigated whether CI can generalize to actions that utilize different response modalities (manual and vocal). In three experiments, participants planned and withheld a sequence of key-presses with the left- or right-hand based on the visual identity of the first stimulus, and then immediately executed a speeded, vocal response ('left' or 'right') to a second visual stimulus. The vocal response was based on discriminating stimulus color (Experiment 1), reading a written word (Experiment 2), or reporting the antonym of a written word (Experiment 3). Results showed that CI occurred when the manual response hand (e.g., left) was compatible with the identity of the vocal response (e.g., 'left') in Experiment 1 and 3, but not in Experiment 2. This suggests that partial overlap of semantic codes is sufficient to obtain CI unless the intervening action can be accessed automatically (Experiment 2). These findings are consistent with the code occupation hypothesis and the general framework of the theory of event coding (Behav Brain Sci 24:849-878, 2001a; Behav Brain Sci 24:910-937, 2001b).

  12. Do humans and nonhuman animals share the grouping principles of the Iambic - Trochaic Law?

    PubMed Central

    de la Mora, Daniela M.; Nespor, Marina; Toro, Juan M.

    2014-01-01

    The Iambic-Trochaic Law describes humans’ tendency to form trochaic groups over sequences varying in pitch or intensity (i.e., the loudest or highest sound marks group beginnings), and iambic groups over sequences varying in duration (i.e., the longest sound marks group endings). The extent to which these perceptual biases are shared by humans and nonhuman animals is yet unclear. In Experiment 1, we trained rats to discriminate pitch-alternating sequences of tones from sequences randomly varying in pitch. In Experiment 2, rats were trained to discriminate duration-alternating sequences of tones from sequences randomly varying in duration. We found that nonhuman animals group as trochees sequences based on pitch variations, but they do not group as iambs sequences varying in duration. Importantly, humans grouped the same stimuli following the principles of the Iambic-Trochaic Law (Experiment 3). These results suggest an early emergence of the trochaic rhythmic grouping bias based on pitch, possibly relying on perceptual abilities shared by humans and other mammals as well, whereas the iambic rhythmic grouping bias based on duration might depend on language experience. PMID:22956287

  13. Do humans and nonhuman animals share the grouping principles of the iambic-trochaic law?

    PubMed

    de la Mora, Daniela M; Nespor, Marina; Toro, Juan M

    2013-01-01

    The iambic-trochaic law describes humans' tendency to form trochaic groups over sequences varying in pitch or intensity (i.e., the loudest or highest sounds mark group beginnings), and iambic groups over sequences varying in duration (i.e., the longest sounds mark group endings). The extent to which these perceptual biases are shared by humans and nonhuman animals is yet unclear. In Experiment 1, we trained rats to discriminate pitch-alternating sequences of tones from sequences randomly varying in pitch. In Experiment 2, rats were trained to discriminate duration-alternating sequences of tones from sequences randomly varying in duration. We found that nonhuman animals group sequences based on pitch variations as trochees, but they do not group sequences varying in duration as iambs. Importantly, humans grouped the same stimuli following the principles of the iambic-trochaic law (Exp. 3). These results suggest the early emergence of the trochaic rhythmic grouping bias based on pitch, possibly relying on perceptual abilities shared by humans and other mammals, whereas the iambic rhythmic grouping bias based on duration might depend on language experience.

  14. Molecular structures and functional relationships in clostridial neurotoxins.

    PubMed

    Swaminathan, Subramanyam

    2011-12-01

    The seven serotypes of Clostridium botulinum neurotoxins (A-G) are the deadliest poison known to humans. They share significant sequence homology and hence possess similar structure-function relationships. Botulinum neurotoxins (BoNT) act via a four-step mechanism, viz., binding and internalization to neuronal cells, translocation of the catalytic domain into the cytosol and finally cleavage of one of the three soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNARE) causing blockage of neurotransmitter release leading to flaccid paralysis. Crystal structures of three holotoxins, BoNT/A, B and E, are available to date. Although the individual domains are remarkably similar, their domain organization is different. These structures have helped in correlating the structural and functional domains. This has led to the determination of structures of individual domains and combinations of them. Crystal structures of catalytic domains of all serotypes and several binding domains are now available. The catalytic domains are zinc endopeptidases and share significant sequence and structural homology. The active site architecture and the catalytic mechanism are similar although the binding mode of individual substrates may be different, dictating substrate specificity and peptide cleavage selectivity. Crystal structures of catalytic domains with substrate peptides provide clues to specificity and selectivity unique to BoNTs. Crystal structures of the receptor domain in complex with ganglioside or the protein receptor have provided information about the binding of botulinum neurotoxin to the neuronal cell. An overview of the structure-function relationship correlating the 3D structures with biochemical and biophysical data and how they can be used for structure-based drug discovery is presented here. Journal compilation © 2011 FEBS. No claim to original US government works.

  15. The temperate marine phage PhiHAP-1 of Halomonas aquamarina possesses a linear plasmid-like prophage genome.

    PubMed

    Mobberley, Jennifer M; Authement, R Nathan; Segall, Anca M; Paul, John H

    2008-07-01

    A myovirus-like temperate phage, PhiHAP-1, was induced with mitomycin C from a Halomonas aquamarina strain isolated from surface waters in the Gulf of Mexico. The induced cultures produced significantly more virus-like particles (VLPs) (3.73 x 10(10) VLP ml(-1)) than control cultures (3.83 x 10(7) VLP ml(-1)) when observed with epifluorescence microscopy. The induced phage was sequenced by using linker-amplified shotgun libraries and contained a genome 39,245 nucleotides in length with a G+C content of 59%. The PhiHAP-1 genome contained 46 putative open reading frames (ORFs), with 76% sharing significant similarity (E value of <10(-3)) at the protein level with other sequences in GenBank. Putative functional gene assignments included small and large terminase subunits, capsid and tail genes, an N6-DNA adenine methyltransferase, and lysogeny-related genes. Although no integrase was found, the PhiHAP-1 genome contained ORFs similar to protelomerase and parA genes found in linear plasmid-like phages with telomeric ends. Southern probing and PCR analysis of host genomic, plasmid, and PhiHAP-1 DNA indicated a lack of integration of the prophage with the host chromosome and a difference in genome arrangement between the prophage and virion forms. The linear plasmid prophage form of PhiHAP-1 begins with the protelomerase gene, presumably due to the activity of the protelomerase, while the induced phage particle has a circularly permuted genome that begins with the terminase genes. The PhiHAP-1 genome shares synteny and gene similarity with coliphage N15 and vibriophages VP882 and VHML, suggesting an evolutionary heritage from an N15-like linear plasmid prophage ancestor.

  16. Towards a global cancer knowledge network: dissecting the current international cancer genomic sequencing landscape.

    PubMed

    Vis, D J; Lewin, J; Liao, R G; Mao, M; Andre, F; Ward, R L; Calvo, F; Teh, B T; Camargo, A A; Knoppers, B M; Sawyers, C L; Wessels, L F A; Lawler, M; Siu, L L; Voest, E

    2017-05-01

    While next generation sequencing has enhanced our understanding of the biological basis of malignancy, current knowledge on global practices for sequencing cancer samples is limited. To address this deficiency, we developed a survey to provide a snapshot of current sequencing activities globally, identify barriers to data sharing and use this information to develop sustainable solutions for the cancer research community. A multi-item survey was conducted assessing demographics, clinical data collection, genomic platforms, privacy/ethics concerns, funding sources and data sharing barriers for sequencing initiatives globally. Additionally, respondents were asked as to provide the primary intent of their initiative (clinical diagnostic, research or combination). Of 107 initiatives invited to participate, 59 responded (response rate = 55%). Whole exome sequencing (P = 0.03) and whole genome sequencing (P = 0.01) were utilized less frequently in clinical diagnostic than in research initiatives. Procedures to identify cancer-specific variants were heterogeneous, with bioinformatics pipelines employing different mutation calling/variant annotation algorithms. Measurement of treatment efficacy varied amongst initiatives, with time on treatment (57%) and RECIST (53%) being the most common; however, other parameters were also employed. Whilst 72% of initiatives indicated data sharing, its scope varied, with a number of restrictions in place (e.g. transfer of raw data). The largest perceived barriers to data harmonization were the lack of financial support (P < 0.01) and bioinformatics concerns (e.g. lack of interoperability) (P = 0.02). Capturing clinical data was more likely to be perceived as a barrier to data sharing by larger initiatives than by smaller initiatives (P = 0.01). These results identify the main barriers, as perceived by the cancer sequencing community, to effective sharing of cancer genomic and clinical data. They highlight the need for greater harmonization of technical, ethical and data capture processes in cancer sample sequencing worldwide, in order to support effective and responsible data sharing for the benefit of patients. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology.

  17. Using the shared genetics of dystonia and ataxia to unravel their pathogenesis

    PubMed Central

    Nibbeling, Esther A.R.; Delnooz, Cathérine C.S.; de Koning, Tom J.; Sinke, Richard J.; Jinnah, Hyder A.; Tijssen, Marina A.J.; Verbeek, Dineke S.

    2018-01-01

    In this review we explore the similarities between spinocerebellar ataxias and dystonias, and suggest potentially shared molecular pathways using a gene co-expression network approach. The spinocerebellar ataxias are a group of neurodegenerative disorders characterized by coordination problems caused mainly by atrophy of the cerebellum. The dystonias are another group of neurological movement disorders linked to basal ganglia dysfunction, although evidence is now pointing to cerebellar involvement as well. Our gene co-expression network approach identified 99 shared genes and showed the involvement of two major pathways: synaptic transmission and neurodevelopment. These pathways overlapped in the two disorders, with a large role for GABAergic signaling in both. The overlapping pathways may provide novel targets for disease therapies. We need to prioritize variants obtained by whole exome sequencing in the genes associated with these pathways in the search for new pathogenic variants, which can than be used to help in the genetic counseling of patients and their families. PMID:28143763

  18. Direct cortical stimulation of inferior frontal cortex disrupts both speech and music production in highly trained musicians.

    PubMed

    Leonard, Matthew K; Desai, Maansi; Hungate, Dylan; Cai, Ruofan; Singhal, Nilika S; Knowlton, Robert C; Chang, Edward F

    2018-05-22

    Music and speech are human-specific behaviours that share numerous properties, including the fine motor skills required to produce them. Given these similarities, previous work has suggested that music and speech may at least partially share neural substrates. To date, much of this work has focused on perception, and has not investigated the neural basis of production, particularly in trained musicians. Here, we report two rare cases of musicians undergoing neurosurgical procedures, where it was possible to directly stimulate the left hemisphere cortex during speech and piano/guitar music production tasks. We found that stimulation to left inferior frontal cortex, including pars opercularis and ventral pre-central gyrus, caused slowing and arrest for both speech and music, and note sequence errors for music. Stimulation to posterior superior temporal cortex only caused production errors during speech. These results demonstrate partially dissociable networks underlying speech and music production, with a shared substrate in frontal regions.

  19. Molecular characterization of a novel luteovirus infecting apple by next-generation sequencing.

    PubMed

    Shen, Pan; Tian, Xin; Zhang, Song; Ren, Fang; Li, Ping; Yu, Yun-Qi; Li, Ruhui; Zhou, Changyong; Cao, Mengji

    2018-03-01

    A new single-stranded positive-sense RNA virus, which shares the highest nucleotide (nt) sequence identity of 53.4% with the genome sequence of cherry-associated luteovirus South Korean isolate (ChALV-SK, genus Luteovirus), was discovered in this work. It is provisionally named apple-associated luteovirus (AaLV). The complete genome sequence of AaLV comprises 5,890 nt and contains eight open reading frames (ORFs), in a very similar arrangement that is typical of members of the genus Luteovirus. When compared with other members of the family Luteoviridae, ORF1 of AaLV was found to encompass another ORF, ORF1a, which encodes a putative 32.9-kDa protein. The ORF1-ORF2 region (RNA-dependent RNA polymerase, RdRP) showed the greatest amino acid (aa) sequence identity (59.7%) to that of cherry-associated luteovirus Czech Republic isolate (ChALV-CZ, genus Luteovirus). The results of genome sequence comparisons and phylogenetic analysis, suggest that AaLV should be a member of a novel species in the genus Luteovirus. To our knowledge, it is the sixth member of the genus Luteovirus reported to naturally infect rosaceous plants.

  20. Structure, organization, and sequence of alpha satellite DNA from human chromosome 17: evidence for evolution by unequal crossing-over and an ancestral pentamer repeat shared with the human X chromosome.

    PubMed

    Waye, J S; Willard, H F

    1986-09-01

    The centromeric regions of all human chromosomes are characterized by distinct subsets of a diverse tandemly repeated DNA family, alpha satellite. On human chromosome 17, the predominant form of alpha satellite is a 2.7-kilobase-pair higher-order repeat unit consisting of 16 alphoid monomers. We present the complete nucleotide sequence of the 16-monomer repeat, which is present in 500 to 1,000 copies per chromosome 17, as well as that of a less abundant 15-monomer repeat, also from chromosome 17. These repeat units were approximately 98% identical in sequence, differing by the exclusion of precisely 1 monomer from the 15-monomer repeat. Homologous unequal crossing-over is suggested as a probable mechanism by which the different repeat lengths on chromosome 17 were generated, and the putative site of such a recombination event is identified. The monomer organization of the chromosome 17 higher-order repeat unit is based, in part, on tandemly repeated pentamers. A similar pentameric suborganization has been previously demonstrated for alpha satellite of the human X chromosome. Despite the organizational similarities, substantial sequence divergence distinguishes these subsets. Hybridization experiments indicate that the chromosome 17 and X subsets are more similar to each other than to the subsets found on several other human chromosomes. We suggest that the chromosome 17 and X alpha satellite subsets may be related components of a larger alphoid subfamily which have evolved from a common ancestral repeat into the contemporary chromosome-specific subsets.

  1. The Large Mitochondrial Genome of Symbiodinium minutum Reveals Conserved Noncoding Sequences between Dinoflagellates and Apicomplexans.

    PubMed

    Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada

    2015-07-20

    Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Gene Discovery in the Apicomplexa as Revealed by EST Sequencing and Assembly of a Comparative Gene Database

    PubMed Central

    Li, Li; Brunk, Brian P.; Kissinger, Jessica C.; Pape, Deana; Tang, Keliang; Cole, Robert H.; Martin, John; Wylie, Todd; Dante, Mike; Fogarty, Steven J.; Howe, Daniel K.; Liberator, Paul; Diaz, Carmen; Anderson, Jennifer; White, Michael; Jerome, Maria E.; Johnson, Emily A.; Radke, Jay A.; Stoeckert, Christian J.; Waterston, Robert H.; Clifton, Sandra W.; Roos, David S.; Sibley, L. David

    2003-01-01

    Large-scale EST sequencing projects for several important parasites within the phylum Apicomplexa were undertaken for the purpose of gene discovery. Included were several parasites of medical importance (Plasmodium falciparum, Toxoplasma gondii) and others of veterinary importance (Eimeria tenella, Sarcocystis neurona, and Neospora caninum). A total of 55,192 ESTs, deposited into dbEST/GenBank, were included in the analyses. The resulting sequences have been clustered into nonredundant gene assemblies and deposited into a relational database that supports a variety of sequence and text searches. This database has been used to compare the gene assemblies using BLAST similarity comparisons to the public protein databases to identify putative genes. Of these new entries, ∼15%–20% represent putative homologs with a conservative cutoff of p < 10−9, thus identifying many conserved genes that are likely to share common functions with other well-studied organisms. Gene assemblies were also used to identify strain polymorphisms, examine stage-specific expression, and identify gene families. An interesting class of genes that are confined to members of this phylum and not shared by plants, animals, or fungi, was identified. These genes likely mediate the novel biological features of members of the Apicomplexa and hence offer great potential for biological investigation and as possible therapeutic targets. [The sequence data from this study have been submitted to dbEST division of GenBank under accession nos.: Toxoplasma gondii: –, –, –, –, – , –, –, –, –. Plasmodium falciparum: –, –, –, –. Sarcocystis neurona: , , , , , , , , , , , , , –, –, –, –, –. Eimeria tenella: –, –, –, –, –, –, –, –, – , –, –, –, –, –, –, –, –, –, –, –. Neospora caninum: –, –, , – , –, –.] PMID:12618375

  3. Defining the Role of the Environment in the Emergence and Persistence of vanA Vancomycin-Resistant Enterococcus (VRE) in an Intensive Care Unit: A Molecular Epidemiological Study.

    PubMed

    Lee, Andie S; White, Elizabeth; Monahan, Leigh G; Jensen, Slade O; Chan, Raymond; van Hal, Sebastiaan J

    2018-06-01

    OBJECTIVETo describe the transmission dynamics of the emergence and persistence of vanA vancomycin-resistant enterococcus (VRE) in an intensive care unit (ICU) using whole-genome sequencing of patient and environmental isolates.DESIGNRetrospective cohort study.SETTINGICU in a tertiary referral center.PARTICIPANTSPatients admitted to the ICU over an 11-month period.METHODS VanA VRE isolated from patients (n=31) were sequenced using the Illumina MiSeq platform. Environmental samples from bed spaces, equipment, and waste rooms were collected. All vanA VRE-positive environmental samples (n=14) were also sequenced. Data were collected regarding patient ward and bed movements.RESULTSThe 31 patient vanA VRE isolates were from screening (n=19), urine (n=4), bloodstream (n=3), skin/wound (n=3), and intra-abdominal (n=2) sources. The phylogeny from sequencing data confirmed several VRE clusters, with 1 group accounting for 38 of 45 isolates (84%). Within this cluster, cross-transmission was extensive and complex across the ICU. Directionality indicated that colonized patients contaminated environmental sites. Similarly, environmental sources not only led to patient colonization but also to infection. Notably, shared equipment acted as a conduit for transmission between different ICU areas. Infected patients, however, were not linked to further VRE transmission.CONCLUSIONSGenomic sequencing confirmed a predominantly clonal outbreak of VRE with complex transmission dynamics. The environmental reservoir, particularly from shared equipment, played a key role in ongoing VRE spread. This study provides evidence to support the use of multifaceted strategies, with an emphasis on measures to reduce bacterial burden in the environment, for successful VRE control.Infect Control Hosp Epidemiol 2018;39:668-675.

  4. Kangaroo IGF-II is structurally and functionally similar to the human [Ser29]-IGF-II variant.

    PubMed

    Yandell, C A; Francis, G L; Wheldrake, J F; Upton, Z

    1999-06-01

    Kangaroo IGF-II has been purified from western grey kangaroo (Macropus fuliginosus) serum and characterised in a number of in vitro assays. In addition, the complete cDNA sequence of mature IGF-II has been obtained by reverse-transcription polymerase chain reaction. Comparison of the kangaroo IGF-II cDNA sequence with known IGF-II sequences from other species revealed that it is very similar to the human variant, [Ser29]-hIGF-II. Both the variant and kangaroo IGF-II contain an insert of nine nucleotides that encode the amino acids Leu-Pro-Gly at the junction of the B and C domains of the mature protein. The deduced kangaroo IGF-II protein sequence also contains three other amino acid changes that are not observed in human IGF-II. These amino acid differences share similarities with the changes described in many of the IGF-IIs reported for non-mammalian species. Characterisation of human IGF-II, kangaroo IGF-II, chicken IGF-II and [Ser29]-hIGF-II in a number of in vitro assays revealed that all four proteins are functionally very similar. No significant differences were observed in the ability of the IGF-IIs to bind to the bovine IGF-II/cation-independent mannose 6-phosphate receptor or to stimulate protein synthesis in rat L6 myoblasts. However, differences were observed in their abilities to bind to IGF-binding proteins (IGFBPs) present in human serum. Kangaroo, chicken and [Ser29]-hIGF-II had lower apparent affinities for human IGFBPs than did human IGF-II. Thus, it appears that the major circulating form of IGF-II in the kangaroo and a minor form of IGF-II found in human serum are structurally and functionally very similar. This suggests that the splice site that generates both the variant and major form of human IGF-II must have evolved after the divergence of marsupials from placental mammals.

  5. Qualitative thematic analysis of consent forms used in cancer genome sequencing.

    PubMed

    Allen, Clarissa; Foulkes, William D

    2011-07-19

    Large-scale whole genome sequencing (WGS) studies promise to revolutionize cancer research by identifying targets for therapy and by discovering molecular biomarkers to aid early diagnosis, to better determine prognosis and to improve treatment response prediction. Such projects raise a number of ethical, legal, and social (ELS) issues that should be considered. In this study, we set out to discover how these issues are being handled across different jurisdictions. We examined informed consent (IC) forms from 30 cancer genome sequencing studies to assess (1) stated purpose of sample collection, (2) scope of consent requested, (3) data sharing protocols (4) privacy protection measures, (5) described risks of participation, (6) subject re-contacting, and (7) protocol for withdrawal. There is a high degree of similarity in how cancer researchers engaged in WGS are protecting participant privacy. We observed a strong trend towards both using samples for additional, unspecified research and sharing data with other investigators. IC forms were varied in terms of how they discussed re-contacting participants, returning results and facilitating participant withdrawal. Contrary to expectation, there were no consistent trends that emerged over the eight year period from which forms were collected. Examining IC forms from WGS studies elucidates how investigators are handling ELS challenges posed by this research. This information is important for ensuring that while the public benefits of research are maximized, the rights of participants are also being appropriately respected.

  6. The transcriptome of Lutzomyia longipalpis (Diptera: Psychodidae) male reproductive organs.

    PubMed

    Azevedo, Renata V D M; Dias, Denise B S; Bretãs, Jorge A C; Mazzoni, Camila J; Souza, Nataly A; Albano, Rodolpho M; Wagner, Glauber; Davila, Alberto M R; Peixoto, Alexandre A

    2012-01-01

    It has been suggested that genes involved in the reproductive biology of insect disease vectors are potential targets for future alternative methods of control. Little is known about the molecular biology of reproduction in phlebotomine sand flies and there is no information available concerning genes that are expressed in male reproductive organs of Lutzomyia longipalpis, the main vector of American visceral leishmaniasis and a species complex. We generated 2678 high quality ESTs ("Expressed Sequence Tags") of L. longipalpis male reproductive organs that were grouped in 1391 non-redundant sequences (1136 singlets and 255 clusters). BLAST analysis revealed that only 57% of these sequences share similarity with a L. longipalpis female EST database. Although no more than 36% of the non-redundant sequences showed similarity to protein sequences deposited in databases, more than half of them presented the best-match hits with mosquito genes. Gene ontology analysis identified subsets of genes involved in biological processes such as protein biosynthesis and DNA replication, which are probably associated with spermatogenesis. A number of non-redundant sequences were also identified as putative male reproductive gland proteins (mRGPs), also known as male accessory gland protein genes (Acps). The transcriptome analysis of L. longipalpis male reproductive organs is one step further in the study of the molecular basis of the reproductive biology of this important species complex. It has allowed the identification of genes potentially involved in spermatogenesis as well as putative mRGPs sequences, which have been studied in many insect species because of their effects on female post-mating behavior and physiology and their potential role in sexual selection and speciation. These data open a number of new avenues for further research in the molecular and evolutionary reproductive biology of sand flies.

  7. The Transcriptome of Lutzomyia longipalpis (Diptera: Psychodidae) Male Reproductive Organs

    PubMed Central

    Bretãs, Jorge A. C.; Mazzoni, Camila J.; Souza, Nataly A.; Albano, Rodolpho M.; Wagner, Glauber; Davila, Alberto M. R.; Peixoto, Alexandre A.

    2012-01-01

    Background It has been suggested that genes involved in the reproductive biology of insect disease vectors are potential targets for future alternative methods of control. Little is known about the molecular biology of reproduction in phlebotomine sand flies and there is no information available concerning genes that are expressed in male reproductive organs of Lutzomyia longipalpis, the main vector of American visceral leishmaniasis and a species complex. Methods/Principal Findings We generated 2678 high quality ESTs (“Expressed Sequence Tags”) of L. longipalpis male reproductive organs that were grouped in 1391 non-redundant sequences (1136 singlets and 255 clusters). BLAST analysis revealed that only 57% of these sequences share similarity with a L. longipalpis female EST database. Although no more than 36% of the non-redundant sequences showed similarity to protein sequences deposited in databases, more than half of them presented the best-match hits with mosquito genes. Gene ontology analysis identified subsets of genes involved in biological processes such as protein biosynthesis and DNA replication, which are probably associated with spermatogenesis. A number of non-redundant sequences were also identified as putative male reproductive gland proteins (mRGPs), also known as male accessory gland protein genes (Acps). Conclusions The transcriptome analysis of L. longipalpis male reproductive organs is one step further in the study of the molecular basis of the reproductive biology of this important species complex. It has allowed the identification of genes potentially involved in spermatogenesis as well as putative mRGPs sequences, which have been studied in many insect species because of their effects on female post-mating behavior and physiology and their potential role in sexual selection and speciation. These data open a number of new avenues for further research in the molecular and evolutionary reproductive biology of sand flies. PMID:22496818

  8. Enterobacter muelleri sp. nov., isolated from the rhizosphere of Zea mays.

    PubMed

    Kämpfer, Peter; McInroy, John A; Glaeser, Stefanie P

    2015-11-01

    A beige-pigmented, oxidase-negative bacterial strain (JM-458T), isolated from a rhizosphere sample, was studied using a polyphasic taxonomic approach. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain JM-458T with sequences of the type strains of closely related species of the genus Enterobacter showed that it shared highest sequence similarity with Enterobacter mori (98.7 %), Enterobacter hormaechei (98.3 %), Enterobacter cloacae subsp. dissolvens, Enterobacter ludwigii and Enterobacter asburiae (all 98.2 %). 16S rRNA gene sequence similarities to all other Enterobacter species were below 98 %. Multilocus sequence analysis based on concatenated partial rpoB, gyrB, infB and atpD gene sequences showed a clear distinction of strain JM-458T from its closest related type strains. The fatty acid profile of the strain consisted of C16 : 0, C17 : 0 cyclo, iso-C15 : 0 2-OH/C16 : 1ω7c and C18 : 1ω7c as major components. DNA-DNA hybridizations between strain JM-458T and the type strains of E. mori, E. hormaechei and E. ludwigii resulted in relatedness values of 29 % (reciprocal 25 %), 24 % (reciprocal 43 %) and 16 % (reciprocal 17 %), respectively. DNA-DNA hybridization results together with multilocus sequence analysis results and differential biochemical and chemotaxonomic properties showed that strain JM-458T represents a novel species of the genus Enterobacter, for which the name Enterobacter muelleri sp. nov. is proposed. The type strain is JM-458T ( = DSM 29346T = CIP 110826T = LMG 28480T = CCM 8546T).

  9. Genome Sequence, Structural Proteins, and Capsid Organization of the Cyanophage Syn5: A “Horned” Bacteriophage of Marine Synechococcus

    PubMed Central

    Pope, Welkin H.; Weigele, Peter R.; Chang, Juan; Pedulla, Marisa L.; Ford, Michael E.; Houtz, Jennifer M.; Jiang, Wen; Chiu, Wah; Hatfull, Graham F.; Hendrix, Roger W.; King, Jonathan

    2010-01-01

    Marine Synechococcus spp and marine Prochlorococcus spp are numerically dominant photoautotrophs in the open oceans and contributors to the global carbon cycle. Syn5 is a short-tailed cyanophage isolated from the Sargasso Sea on Synechococcus strain WH8109. Syn5 has been grown in WH8109 to high titer in the laboratory and purified and concentrated retaining infectivity. Genome sequencing and annotation of Syn5 revealed that the linear genome is 46,214bp with a 237bp terminal direct repeat. Sixty-one open reading frames (ORFs) were identified. Based on genomic organization and sequence similarity to known protein sequences within GenBank, Syn5 shares features with T7-like phages. The presence of a putative integrase suggests access to a temperate life-cycle. Assignment of eleven ORFs to structural proteins found within the phage virion was confirmed by mass-spectrometry and N-terminal sequencing. Eight of these identified structural proteins exhibited amino acid sequence similarity to enteric phage proteins. The remaining three virion proteins did not resemble any known phage sequences in GenBank as of August 2006. Cryoelectron micrographs of purified Syn5 virions revealed that the capsid has a single “horn”, a novel fibrous structure protruding from the opposing end of the capsid from the tail of the virion. The tail appendage displayed an apparent three-fold rather than six-fold symmetry. An 18Å-resolution icosahedral reconstruction of the capsid revealed a T=7 lattice, but with an unusual pattern of surface knobs. This phage/host system should allow detailed investigation of the physiology and biochemistry of phage propagation in marine photosynthetic bacteria. PMID:17383677

  10. Identification of a DNA sequence motif required for expression of iron-regulated genes in pseudomonads.

    PubMed

    Rombel, I T; McMorran, B J; Lamont, I L

    1995-02-20

    Many bacteria respond to a lack of iron in the environment by synthesizing siderophores, which act as iron-scavenging compounds. Fluorescent pseudomonads synthesize strain-specific but chemically related siderophores called pyoverdines or pseudobactins. We have investigated the mechanisms by which iron controls expression of genes involved in pyoverdine metabolism in Pseudomonas aeruginosa. Transcription of these genes is repressed by the presence of iron in the growth medium. Three promoters from these genes were cloned and the activities of the promoters were dependent on the amounts of iron in the growth media. Two of the promoters were sequenced and the transcriptional start site were identified by S1 nuclease analysis. Sequences similar to the consensus binding site for the Fur repressor protein, which controls expression of iron-repressible genes in several gram-negative species, were not present in the promoters, suggesting that they are unlikely to have a high affinity for Fur. However, comparison of the promoter sequences with those of iron-regulated genes from other Pseudomonas species and also the iron-regulated exotoxin gene of P. aeruginosa allowed identification of a shared sequence element, with the consensus sequence (G/C)CTAAAT-CCC, which is likely to act as a binding site for a transcriptional activator protein. Mutations in this sequence greatly reduced the activities of the promoters characterized here as well as those of other iron-regulated promoters. The requirement for this motif in the promoters of iron-regulated genes of different Pseudomonas species indicates that similar mechanisms are likely to be involved in controlling expression of a range of iron-regulated genes in pseudomonads.

  11. Distinct profiles of expressed sequence tags during intestinal regeneration in the sea cucumber Holothuria glaberrima

    PubMed Central

    Rojas-Cartagena, Carmencita; Ortíz-Pineda, Pablo; Ramírez-Gómez, Francisco; Suárez-Castillo, Edna C.; Matos-Cruz, Vanessa; Rodríguez, Carlos; Ortíz-Zuazaga, Humberto; García-Arrarás, José E.

    2010-01-01

    Repair and regeneration are key processes for tissue maintenance, and their disruption may lead to disease states. Little is known about the molecular mechanisms that underline the repair and regeneration of the digestive tract. The sea cucumber Holothuria glaberrima represents an excellent model to dissect and characterize the molecular events during intestinal regeneration. To study the gene expression profile, cDNA libraries were constructed from normal, 3-day, and 7-day regenerating intestines of H. glaberrima. Clones were randomly sequenced and queried against the nonredundant protein database at the National Center for Biotechnology Information. RT-PCR analyses were made of several genes to determine their expression profile during intestinal regeneration. A total of 5,173 sequences from three cDNA libraries were obtained. About 46.2, 35.6, and 26.2% of the sequences for the normal, 3-days, and 7-days cDNA libraries, respectively, shared significant similarity with known sequences in the protein database of GenBank but only present 10% of similarity among them. Analysis of the libraries in terms of functional processes, protein domains, and most common sequences suggests that a differential expression profile is taking place during the regeneration process. Further examination of the expressed sequence tag dataset revealed that 12 putative genes are differentially expressed at significant level (R > 6). Experimental validation by RT-PCR analysis reveals that at least three genes (unknown C-4677-1, melanotransferrin, and centaurin) present a differential expression during regeneration. These findings strongly suggest that the gene expression profile varies among regeneration stages and provide evidence for the existence of differential gene expression. PMID:17579180

  12. The mitochondrial genome sequence of Enterobius vermicularis (Nematoda: Oxyurida)--an idiosyncratic gene order and phylogenetic information for chromadorean nematodes.

    PubMed

    Kang, Seokha; Sultana, Tahera; Eom, Keeseon S; Park, Yung Chul; Soonthornpong, Nathan; Nadler, Steven A; Park, Joong-Ki

    2009-01-15

    The complete mitochondrial genome sequence was determined for the human pinworm Enterobius vermicularis (Oxyurida: Nematoda) and used to infer its phylogenetic relationship to other major groups of chromadorean nematodes. The E. vermicularis genome is a 14,010-bp circular DNA molecule that encodes 36 genes (12 proteins, 22 tRNAs, and 2 rRNAs). This mtDNA genome lacks atp8, as reported for almost all other nematode species investigated. Phylogenetic analyses (maximum parsimony, maximum likelihood, neighbor joining, and Bayesian inference) of nucleotide sequences for the 12 protein-coding genes of 25 nematode species placed E. vermicularis, a representative of the order Oxyurida, as sister to the main Ascaridida+Rhabditida group. Tree topology comparisons using statistical tests rejected an alternative hypothesis favoring a closer relationship among Ascaridida, Spirurida, and Oxyurida, which has been supported from most studies based on nuclear ribosomal DNA sequences. Unlike the relatively conserved gene arrangement found for most chromadorean taxa, E. vermicularis mtDNA gene order is very unique, not sharing similarity to any other nematode species reported to date. This lack of gene order similarity may represent idiosyncratic gene rearrangements unique to this specific lineage of the oxyurids. To more fully understand the extent of gene rearrangement and its evolutionary significance within the nematode phylogenetic framework, additional mitochondrial genomes representing a greater evolutionary diversity of species must be characterized.

  13. Genetic Diversity among Clostridium botulinum Strains Harboring bont/A2 and bont/A3 Genes

    PubMed Central

    Raphael, Brian H.; Joseph, Lavin A.; Meno, Sarah R.; Fernández, Rafael A.; Maslanka, Susan E.

    2012-01-01

    Clostridium botulinum type A strains are known to be genetically diverse and widespread throughout the world. Genetic diversity studies have focused mainly on strains harboring one type A botulinum toxin gene, bont/A1, although all reported bont/A gene variants have been associated with botulism cases. Our study provides insight into the genetic diversity of C. botulinum type A strains, which contain bont/A2 (n = 42) and bont/A3 (n = 4) genes, isolated from diverse samples and geographic origins. Genetic diversity was assessed by using bont nucleotide sequencing, content analysis of the bont gene clusters, multilocus sequence typing (MLST), and pulsed-field gel electrophoresis (PFGE). Sequences of bont genes obtained in this study showed 99.9 to 100% identity with other bont/A2 or bont/A3 gene sequences available in public databases. The neurotoxin gene clusters of the subtype A2 and A3 strains analyzed in this study were similar in gene content. C. botulinum strains harboring bont/A2 and bont/A3 genes were divided into six and two MLST profiles, respectively. Four groups of strains shared a similarity of at least 95% by PFGE; the largest group included 21 out of 46 strains. The strains analyzed in this study showed relatively limited genetic diversity using either MLST or PFGE. PMID:23042179

  14. Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

    PubMed

    Feng, X; Happ, G M

    1996-11-14

    The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

  15. Proposal of Vespertiliibacter pulmonis gen. nov., sp. nov. and two genomospecies as new members of the family Pasteurellaceae isolated from European bats.

    PubMed

    Mühldorfer, Kristin; Speck, Stephanie; Wibbelt, Gudrun

    2014-07-01

    Five bacterial strains isolated from bats of the family Vespertilionidae were characterized by phenotypic tests and multilocus sequence analysis (MLSA) using the 16S rRNA gene and four housekeeping genes (rpoA, rpoB, infB, recN). Phylogenetic analyses of individual and combined datasets indicated that the five strains represent a monophyletic cluster within the family Pasteurellaceae. Comparison of 16S rRNA gene sequences demonstrated a high degree of similarity (98.3-99.9%) among the group of bat-derived strains, while searches in nucleotide databases indicated less than 96% sequence similarity to known members of the Pasteurellaceae. The housekeeping genes rpoA, rpoB, infB and recN provided higher resolution compared with the 16S rRNA gene and subdivided the group according to the bat species from which the strains were isolated. Three strains derived from noctule bats shared 98.6-100% sequence similarity in all four genes investigated, whereas, based on rpoB, infB and recN gene sequences, 91.8-96% similarity was observed with and between the remaining two strains isolated from a serotine bat and a pipistrelle bat, respectively. Genome relatedness as deduced from recN gene sequences correlated well with the results of MLSA and indicated that the five strains represent a new genus. Based on these results, it is proposed to classify the five strains derived from bats within Vespertiliibacter pulmonis gen. nov., sp. nov. (the type species), Vespertiliibacter genomospecies 1 and Vespertiliibacter genomospecies 2. The genus can be distinguished phenotypically from recognized genera of the Pasteurellaceae by at least three characteristics. All strains are nutritionally fastidious and require a chemically defined supplement with NAD for growth. The DNA G+C content of strain E127/08(T) is 38.2 mol%. The type strain of Vespertiliibacter pulmonis gen. nov., sp. nov. is E127/08(T) ( = CCUG 64585(T) = DSM 27238(T)). The reference strains of Vespertiliibacter genomospecies 1 and 2 are E145/08 and E157/08, respectively. © 2014 IUMS.

  16. Genome sequencing identifies Listeria fleischmannii subsp. coloradonensis subsp. nov., isolated from a ranch.

    PubMed

    den Bakker, Henk C; Manuel, Clyde S; Fortes, Esther D; Wiedmann, Martin; Nightingale, Kendra K

    2013-09-01

    Twenty Listeria-like isolates were obtained from environmental samples collected on a cattle ranch in northern Colorado; all of these isolates were found to share an identical partial sigB sequence, suggesting close relatedness. The isolates were similar to members of the genus Listeria in that they were Gram-stain-positive, short rods, oxidase-negative and catalase-positive; the isolates were similar to Listeria fleischmannii because they were non-motile at 25 °C. 16S rRNA gene sequencing for representative isolates and whole genome sequencing for one isolate was performed. The genome of the type strain of Listeria fleischmannii (strain LU2006-1(T)) was also sequenced. The draft genomes were very similar in size and the average MUMmer nucleotide identity across 91% of the genomes was 95.16%. Genome sequence data were used to design primers for a six-gene multi-locus sequence analysis (MLSA) scheme. Phylogenies based on (i) the near-complete 16S rRNA gene, (ii) 31 core genes and (iii) six housekeeping genes illustrated the close relationship of these Listeria-like isolates to Listeria fleischmannii LU2006-1(T). Sufficient genetic divergence of the Listeria-like isolates from the type strain of Listeria fleischmannii and differing phenotypic characteristics warrant these isolates to be classified as members of a distinct infraspecific taxon, for which the name Listeria fleischmannii subsp. coloradonensis subsp. nov. is proposed. The type strain is TTU M1-001(T) ( =BAA-2414(T) =DSM 25391(T)). The isolates of Listeria fleischmannii subsp. coloradonensis subsp. nov. differ from the nominate subspecies by the inability to utilize melezitose, turanose and sucrose, and the ability to utilize inositol. The results also demonstrate the utility of whole genome sequencing to facilitate identification of novel taxa within a well-described genus. The genomes of both subspecies of Listeria fleischmannii contained putative enhancin genes; the Listeria fleischmannii subsp. coloradonensis subsp. nov. genome also encoded a putative mosquitocidal toxin. The presence of these genes suggests possible adaptation to an insect host, and further studies are needed to probe niche adaptation of Listeria fleischmannii.

  17. Crystal structures of botulinum neurotoxin DC in complex with its protein receptors synaptotagmin I and II.

    PubMed

    Berntsson, Ronnie Per-Arne; Peng, Lisheng; Svensson, Linda Marie; Dong, Min; Stenmark, Pål

    2013-09-03

    Botulinum neurotoxins (BoNTs) can cause paralysis at exceptionally low concentrations and include seven serotypes (BoNT/A-G). The chimeric BoNT/DC toxin has a receptor binding domain similar to the same region in BoNT/C. However, BoNT/DC does not share protein receptor with BoNT/C. Instead, it shares synaptotagmin (Syt) I and II as receptors with BoNT/B, despite their low sequence similarity. Here, we present the crystal structures of the binding domain of BoNT/DC in complex with the recognition domains of its protein receptors, Syt-I and Syt-II. The structures reveal that BoNT/DC possesses a Syt binding site, distinct from the established Syt-II binding site in BoNT/B. Structure-based mutagenesis further shows that hydrophobic interactions play a key role in Syt binding. The structures suggest that the BoNT/DC ganglioside binding sites are independent of the protein receptor binding site. Our results reveal the remarkable versatility in the receptor recognition of the BoNTs. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Silencing Effect of Hominoid Highly Conserved Noncoding Sequences on Embryonic Brain Development

    PubMed Central

    Mahmoudi Saber, Morteza

    2017-01-01

    Abstract Superfamily Hominoidea, which consists of Hominidae (humans and great apes) and Hylobatidae (gibbons), is well-known for sharing human-like characteristics, however, the genomic origins of these shared unique phenotypes have mainly remained elusive. To decipher the underlying genomic basis of Hominoidea-restricted phenotypes, we identified and characterized Hominoidea-restricted highly conserved noncoding sequences (HCNSs) that are a class of potential regulatory elements which may be involved in evolution of lineage-specific phenotypes. We discovered 679 such HCNSs from human, chimpanzee, gorilla, orangutan and gibbon genomes. These HCNSs were demonstrated to be under purifying selection but with lineage-restricted characteristics different from old CNSs. A significant proportion of their ancestral sequences had accelerated rates of nucleotide substitutions, insertions and deletions during the evolution of common ancestor of Hominoidea, suggesting the intervention of positive Darwinian selection for creating those HCNSs. In contrary to enhancer elements and similar to silencer sequences, these Hominoidea-restricted HCNSs are located in close proximity of transcription start sites. Their target genes are enriched in the nervous system, development and transcription, and they tend to be remotely located from the nearest coding gene. Chip-seq signals and gene expression patterns suggest that Hominoidea-restricted HCNSs are likely to be functional regulatory elements by imposing silencing effects on their target genes in a tissue-restricted manner during fetal brain development. These HCNSs, emerged through adaptive evolution and conserved through purifying selection, represent a set of promising targets for future functional studies of the evolution of Hominoidea-restricted phenotypes. PMID:28633494

  19. Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

    PubMed Central

    Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

    1993-01-01

    Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

  20. Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

    PubMed

    Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

    2011-09-01

    Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

  1. Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

    PubMed Central

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Hubisz, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Zhang, Peili; Liu, Jing; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catharine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenée; Verduzco, Daniel; Clerc-Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2005-01-01

    We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each arm gene order has been extensively reshuffled, leading to a minimum of 921 syntenic blocks shared between the species. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila. PMID:15632085

  2. Phylogenetic Analysis of Phenotypically Characterized Cryptococcus laurentii Isolates Reveals High Frequency of Cryptic Species

    PubMed Central

    Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J.; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

    2014-01-01

    Background Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. Methods In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. Results BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99–100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Conclusions Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode. PMID:25251413

  3. Sequence determination and analysis of the NSs genes of two tospoviruses.

    PubMed

    Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

    2012-03-01

    The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

  4. Networking Biology: The Origins of Sequence-Sharing Practices in Genomics.

    PubMed

    Stevens, Hallam

    2015-10-01

    The wide sharing of biological data, especially nucleotide sequences, is now considered to be a key feature of genomics. Historians and sociologists have attempted to account for the rise of this sharing by pointing to precedents in model organism communities and in natural history. This article supplements these approaches by examining the role that electronic networking technologies played in generating the specific forms of sharing that emerged in genomics. The links between early computer users at the Stanford Artificial Intelligence Laboratory in the 1960s, biologists using local computer networks in the 1970s, and GenBank in the 1980s, show how networking technologies carried particular practices of communication, circulation, and data distribution from computing into biology. In particular, networking practices helped to transform sequences themselves into objects that had value as a community resource.

  5. Genetic structure and genealogy in the Sphagnum subsecundum complex (Sphagnaceae: Bryophyta).

    PubMed

    Shaw, A J; Pokorny, L; Shaw, B; Ricca, M; Boles, S; Szövényi, P

    2008-10-01

    Allopolyploidy is probably the most extensively studied mode of plant speciation and allopolyploid species appear to be common in the mosses (Bryophyta). The Sphagnum subsecundum complex includes species known to be gametophytically haploid or diploid, and it has been proposed that the diploids (i.e., with tetraploid sporophytes) are allopolyploids. Nucleotide sequence and microsatellite variation among haploids and diploids from Newfoundland and Scandinavia indicate that (1) the diploids exhibit fixed or nearly fixed heterozygosity at the majority of loci sampled, and are clearly allopolyploids, (2) diploids originated independently in North America and Europe, (3) the European diploids appear to have the haploid species, S. subsecundum, as the maternal parent based on shared chloroplast DNA haplotypes, (4) the North American diploids do not have the chloroplast DNA of any sampled haploid, (5) both North American and European diploids share nucleotide and microsatellite similarities with S. subsecundum, (6) the diploids harbor more nucleotide and microsatellite diversity than the haploids, and (7) diploids exhibit higher levels of linkage disequilibrium among microsatellite loci. An experiment demonstrates significant artifactual recombination between interspecific DNAs coamplified by PCR, which may be a complicating factor in the interpretation of sequence-based analyses of allopolyploids.

  6. Adrenergic Agonists Bind to Adrenergic-Receptor-Like Regions of the Mu Opioid Receptor, Enhancing Morphine and Methionine-Enkephalin Binding: A New Approach to “Biased Opioids”?

    PubMed Central

    Turke, Miah; Subhramanyam, Udaya K. Tiruttani; Churchill, Beth; Labahn, Joerg

    2018-01-01

    Extensive evidence demonstrates functional interactions between the adrenergic and opioid systems in a diversity of tissues and organs. While some effects are due to receptor and second messenger cross-talk, recent research has revealed an extracellular, allosteric opioid binding site on adrenergic receptors that enhances adrenergic activity and its duration. The present research addresses whether opioid receptors may have an equivalent extracellular, allosteric adrenergic binding site that has similar enhancing effects on opioid binding. Comparison of adrenergic and opioid receptor sequences revealed that these receptors share very significant regions of similarity, particularly in some of the extracellular and transmembrane regions associated with adrenergic binding in the adrenergic receptors. Five of these shared regions from the mu opioid receptor (muOPR) were synthesized as peptides and tested for binding to adrenergic, opioid and control compounds using ultraviolet spectroscopy. Adrenergic compounds bound to several of these muOPR peptides with low micromolar affinity while acetylcholine, histamine and various adrenergic antagonists did not. Similar studies were then conducted with purified, intact muOPR with similar results. Combinations of epinephrine with methionine enkephalin or morphine increased the binding of both by about half a log unit. These results suggest that muOPR may be allosterically enhanced by adrenergic agonists. PMID:29342106

  7. The Classification and Evolution of Enzyme Function.

    PubMed

    Martínez Cuesta, Sergio; Rahman, Syed Asad; Furnham, Nicholas; Thornton, Janet M

    2015-09-15

    Enzymes are the proteins responsible for the catalysis of life. Enzymes sharing a common ancestor as defined by sequence and structure similarity are grouped into families and superfamilies. The molecular function of enzymes is defined as their ability to catalyze biochemical reactions; it is manually classified by the Enzyme Commission and robust approaches to quantitatively compare catalytic reactions are just beginning to appear. Here, we present an overview of studies at the interface of the evolution and function of enzymes. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  8. Use of a Drosophila Genome-Wide Conserved Sequence Database to Identify Functionally Related cis-Regulatory Enhancers

    PubMed Central

    Brody, Thomas; Yavatkar, Amarendra S; Kuzin, Alexander; Kundu, Mukta; Tyson, Leonard J; Ross, Jermaine; Lin, Tzu-Yang; Lee, Chi-Hon; Awasaki, Takeshi; Lee, Tzumin; Odenwald, Ward F

    2012-01-01

    Background: Phylogenetic footprinting has revealed that cis-regulatory enhancers consist of conserved DNA sequence clusters (CSCs). Currently, there is no systematic approach for enhancer discovery and analysis that takes full-advantage of the sequence information within enhancer CSCs. Results: We have generated a Drosophila genome-wide database of conserved DNA consisting of >100,000 CSCs derived from EvoPrints spanning over 90% of the genome. cis-Decoder database search and alignment algorithms enable the discovery of functionally related enhancers. The program first identifies conserved repeat elements within an input enhancer and then searches the database for CSCs that score highly against the input CSC. Scoring is based on shared repeats as well as uniquely shared matches, and includes measures of the balance of shared elements, a diagnostic that has proven to be useful in predicting cis-regulatory function. To demonstrate the utility of these tools, a temporally-restricted CNS neuroblast enhancer was used to identify other functionally related enhancers and analyze their structural organization. Conclusions: cis-Decoder reveals that co-regulating enhancers consist of combinations of overlapping shared sequence elements, providing insights into the mode of integration of multiple regulating transcription factors. The database and accompanying algorithms should prove useful in the discovery and analysis of enhancers involved in any developmental process. Developmental Dynamics 241:169–189, 2012. © 2011 Wiley Periodicals, Inc. Key findings A genome-wide catalog of Drosophila conserved DNA sequence clusters. cis-Decoder discovers functionally related enhancers. Functionally related enhancers share balanced sequence element copy numbers. Many enhancers function during multiple phases of development. PMID:22174086

  9. Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp.

    PubMed

    Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong

    2015-03-01

    The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.

  10. Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp

    PubMed Central

    DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG

    2015-01-01

    The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630

  11. DNA Barcode Sequence Identification Incorporating Taxonomic Hierarchy and within Taxon Variability

    PubMed Central

    Little, Damon P.

    2011-01-01

    For DNA barcoding to succeed as a scientific endeavor an accurate and expeditious query sequence identification method is needed. Although a global multiple–sequence alignment can be generated for some barcoding markers (e.g. COI, rbcL), not all barcoding markers are as structurally conserved (e.g. matK). Thus, algorithms that depend on global multiple–sequence alignments are not universally applicable. Some sequence identification methods that use local pairwise alignments (e.g. BLAST) are unable to accurately differentiate between highly similar sequences and are not designed to cope with hierarchic phylogenetic relationships or within taxon variability. Here, I present a novel alignment–free sequence identification algorithm–BRONX–that accounts for observed within taxon variability and hierarchic relationships among taxa. BRONX identifies short variable segments and corresponding invariant flanking regions in reference sequences. These flanking regions are used to score variable regions in the query sequence without the production of a global multiple–sequence alignment. By incorporating observed within taxon variability into the scoring procedure, misidentifications arising from shared alleles/haplotypes are minimized. An explicit treatment of more inclusive terminals allows for separate identifications to be made for each taxonomic level and/or for user–defined terminals. BRONX performs better than all other methods when there is imperfect overlap between query and reference sequences (e.g. mini–barcode queries against a full–length barcode database). BRONX consistently produced better identifications at the genus–level for all query types. PMID:21857897

  12. Complete genome sequences of Geobacillus sp. WCH70, a thermophilic strain isolated from wood compost

    DOE PAGES

    Brumm, Phillip; Land, Miriam L.; Mead, David

    2016-04-27

    Geobacillus sp. WCH70 was one of several thermophilic organisms isolated from hot composts in the Middleton, WI area. Comparison of 16 S rRNA sequences showed the strain may be a new species, and is most closely related to G. galactosidasius and G. toebii. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2009 (CP001638). The genome of Geobacillus species WCH70 consists of one circular chromosome of 3,893,306 bp with an average G + C content of 43 %, and two circular plasmids of 33,899 and 10,287 bp with anmore » average G + C content of 40 %. Among sequenced organisms, Geobacillus sp. WCH70 shares highest Average Nucleotide Identity (86 %) with G. thermoglucosidasius strains, as well as similar genome organization. Geobacillus sp. WCH70 appears to be a highly adaptable organism, with an exceptionally high 125 annotated transposons in the genome. The organism also possesses four predicted restriction-modification systems not found in other Geobacillus species.« less

  13. Molecular cloning and sequence analysis of the Anticarsia gemmatalis multicapsid nuclear polyhedrosis virus GP64 glycoprotein.

    PubMed

    Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

    2003-01-01

    The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.

  14. The nucleotide sequence of Watermelon mosaic virus (WMV, Potyvirus) reveals interspecific recombination between two related potyviruses in the 5' part of the genome.

    PubMed

    Desbiez, C; Lecoq, H

    2004-08-01

    Watermelon mosaic virus (WMV, Potyvirus) is a potyvirus with a worldwide distribution, mostly in temperate and mediterranean regions. According to the partial sequences that were available, WMV appeared to share high sequence similarity with Soybean mosaic virus (SMV), and it was almost considered as a strain of SMV in spite of its different and much broader host range. Like SMV, it was also related to legume-infecting potyviruses belonging to the " Bean common mosaic virus (BCMV) subgroup". In this paper we obtained the full-length sequence of WMV, and we confirmed that this virus is very closely related to SMV in most of its genome; however, there is evidence for an interspecific recombination in the P1 protein, as the P1 of WMV was 135 amino-acids longer than that of SMV, and the N-terminal half of the P1 showed no relation to SMV but was 85% identical to BCMV. This suggests that WMV has emerged through an ancestral recombination event, and supports the distinction of WMV and SMV as separate taxonomic units.

  15. Complete genome sequences of two novel European clade bovine foamy viruses from Germany and Poland.

    PubMed

    Hechler, Torsten; Materniak, Magdalena; Kehl, Timo; Kuzmak, Jacek; Löchelt, Martin

    2012-10-01

    Bovine foamy virus (BFV), or bovine spumaretrovirus, is an infectious agent of cattle with no obvious disease association but high prevalence in its host. Here, we report two complete BFV sequences, BFV-Riems, isolated in 1978 in East Germany, and BFV100, isolated in 2005 in Poland. Both new BFV isolates share the overall genetic makeup of other foamy viruses (FV). Although isolated almost 25 years apart and propagated in either bovine (BFV-Riems) or nonbovine (BFV100) cells, both viruses are highly related, forming the European BFV clade. Despite clear differences, BFV-Riems and BFV100 are still very similar to BFV isolates from China and the United States, comprising the non-European BFV clade. The genomic sequences presented here confirm the concept of high sequence conservation across most of the FV genome. Analyses of cell culture-derived genomes reveal that proviral DNA may specifically lack introns in the env-bel coding region. The spacing of the splice sites in this region suggests that BFV has developed a novel mode to express a secretory but nonfunctional Env protein.

  16. Complete Genome Sequences of Two Novel European Clade Bovine Foamy Viruses from Germany and Poland

    PubMed Central

    Hechler, Torsten; Materniak, Magdalena; Kehl, Timo; Kuzmak, Jacek

    2012-01-01

    Bovine foamy virus (BFV), or bovine spumaretrovirus, is an infectious agent of cattle with no obvious disease association but high prevalence in its host. Here, we report two complete BFV sequences, BFV-Riems, isolated in 1978 in East Germany, and BFV100, isolated in 2005 in Poland. Both new BFV isolates share the overall genetic makeup of other foamy viruses (FV). Although isolated almost 25 years apart and propagated in either bovine (BFV-Riems) or nonbovine (BFV100) cells, both viruses are highly related, forming the European BFV clade. Despite clear differences, BFV-Riems and BFV100 are still very similar to BFV isolates from China and the United States, comprising the non-European BFV clade. The genomic sequences presented here confirm the concept of high sequence conservation across most of the FV genome. Analyses of cell culture-derived genomes reveal that proviral DNA may specifically lack introns in the env-bel coding region. The spacing of the splice sites in this region suggests that BFV has developed a novel mode to express a secretory but nonfunctional Env protein. PMID:22966195

  17. Protein denaturation in vacuo: intrinsic unfolding pathways associated with the native tertiary structure of lysozyme

    NASA Astrophysics Data System (ADS)

    Arteca, Gustavo A.; Tapia, O.

    Using computer-simulated molecular dynamics, we study the effect of sequence mutation on the unfolding mechanism of a native fold. The system considered is the native fold of hen egg-white lysozyme, exposed to centrifugal unfolding in vacuo. This unfolding bias elicits configurational transitions that imitate the behaviour of anhydrous proteins diffusing after electrospraying from neutral-pH solutions. By changing the sequences threaded onto the native fold of lysozyme, we probe the role of disulfide bridges and the effect of a global mutation. We find that the initial denaturing steps share common characteristics for the tested sequences. Recurrent features are: (i) the presence of dumbbell conformers with significant residual secondary structure, (ii) the ubiquitous formation of hairpins and two-stranded β-sheets regardless of disulfide bridges, and (iii) an unfolding pattern where the reduction in folding complexity is highly correlated with the decrease in chain compactness. These findings appear to be intrinsic to the shape of the native fold, suggesting that similar unfolding pathways may be accessible to many protein sequences.

  18. Cloning and molecular characterization of scorpion Buthus martensi venom hyaluronidases: a novel full-length and diversiform noncoding isoforms.

    PubMed

    Xia, Xichao; Liu, Rongzhi; Li, Yi; Xue, Shipeng; Liu, Qingchun; Jiang, Xiao; Zhang, Wenjuan; Ding, Ke

    2014-09-01

    Hyaluronidase is a common component of scorpion venom and has been considered as "spreading factor" that promotes a fast penetration of the venom in the anaphylactic reaction. In the current study, a novel full-length of hyaluronidase BmHYI and three noncoding isoforms of BmHYII, BmHYIII and BmHYIV were cloned by using a combined strategy based on peptide sequencing and Rapid Amplification of cDNA Ends (RACE). BmHYI has 410 amino acid residues containing the catalytic, positional and five potential N-glycosylation sites. The deduced protein sequence of BmHYI shares significant identity with venom hyaluronidases from bees and snakes. The phylogenetic analysis showed early divergence and independent evolution of BmHYI from other hyaluronidases. An extraordinarily high level of sequence similarity was detected among four sequences. But, BmHYII, BmHYIII and BmHYIV were short of stop-codon in the open reading frame and poly(A) signal in the 3' end. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Principles of long noncoding RNA evolution derived from direct comparison of transcriptomes in 17 species.

    PubMed

    Hezroni, Hadas; Koppstein, David; Schwartz, Matthew G; Avrutin, Alexandra; Bartel, David P; Ulitsky, Igor

    2015-05-19

    The inability to predict long noncoding RNAs from genomic sequence has impeded the use of comparative genomics for studying their biology. Here, we develop methods that use RNA sequencing (RNA-seq) data to annotate the transcriptomes of 16 vertebrates and the echinoid sea urchin, uncovering thousands of previously unannotated genes, most of which produce long intervening noncoding RNAs (lincRNAs). Although in each species, >70% of lincRNAs cannot be traced to homologs in species that diverged >50 million years ago, thousands of human lincRNAs have homologs with similar expression patterns in other species. These homologs share short, 5'-biased patches of sequence conservation nested in exonic architectures that have been extensively rewired, in part by transposable element exonization. Thus, over a thousand human lincRNAs are likely to have conserved functions in mammals, and hundreds beyond mammals, but those functions require only short patches of specific sequences and can tolerate major changes in gene architecture. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Analysis of SINE and LINE repeat content of Y chromosomes in the platypus, Ornithorhynchus anatinus.

    PubMed

    Kortschak, R Daniel; Tsend-Ayush, Enkhjargal; Grützner, Frank

    2009-01-01

    Monotremes feature an extraordinary sex-chromosome system that consists of five X and five Y chromosomes in males. These sex chromosomes share homology with bird sex chromosomes but no homology with the therian X. The genome of a female platypus was recently completed, providing unique insights into sequence and gene content of autosomes and X chromosomes, but no Y-specific sequence has so far been analysed. Here we report the isolation, sequencing and analysis of approximately 700 kb of sequence of the non-recombining regions of Y2, Y3 and Y5, which revealed differences in base composition and repeat content between autosomes and sex chromosomes, and within the sex chromosomes themselves. This provides the first insights into repeat content of Y chromosomes in platypus, which overall show similar patterns of repeat composition to Y chromosomes in other species. Interestingly, we also observed differences between the various Y chromosomes, and in combination with timing and activity patterns we provide an approach that can be used to examine the evolutionary history of the platypus sex-chromosome chain.

  1. Resequencing Pathogen Microarray (RPM) for prospective detection and identification of emergent pathogen strains and variants

    NASA Astrophysics Data System (ADS)

    Tibbetts, Clark; Lichanska, Agnieszka M.; Borsuk, Lisa A.; Weslowski, Brian; Morris, Leah M.; Lorence, Matthew C.; Schafer, Klaus O.; Campos, Joseph; Sene, Mohamadou; Myers, Christopher A.; Faix, Dennis; Blair, Patrick J.; Brown, Jason; Metzgar, David

    2010-04-01

    High-density resequencing microarrays support simultaneous detection and identification of multiple viral and bacterial pathogens. Because detection and identification using RPM is based upon multiple specimen-specific target pathogen gene sequences generated in the individual test, the test results enable both a differential diagnostic analysis and epidemiological tracking of detected pathogen strains and variants from one specimen to the next. The RPM assay enables detection and identification of pathogen sequences that share as little as 80% sequence similarity to prototype target gene sequences represented as detector tiles on the array. This capability enables the RPM to detect and identify previously unknown strains and variants of a detected pathogen, as in sentinel cases associated with an infectious disease outbreak. We illustrate this capability using assay results from testing influenza A virus vaccines configured with strains that were first defined years after the design of the RPM microarray. Results are also presented from RPM-Flu testing of three specimens independently confirmed to the positive for the 2009 Novel H1N1 outbreak strain of influenza virus.

  2. Complete genome sequences of Geobacillus sp. WCH70, a thermophilic strain isolated from wood compost

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brumm, Phillip; Land, Miriam L.; Mead, David

    Geobacillus sp. WCH70 was one of several thermophilic organisms isolated from hot composts in the Middleton, WI area. Comparison of 16 S rRNA sequences showed the strain may be a new species, and is most closely related to G. galactosidasius and G. toebii. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2009 (CP001638). The genome of Geobacillus species WCH70 consists of one circular chromosome of 3,893,306 bp with an average G + C content of 43 %, and two circular plasmids of 33,899 and 10,287 bp with anmore » average G + C content of 40 %. Among sequenced organisms, Geobacillus sp. WCH70 shares highest Average Nucleotide Identity (86 %) with G. thermoglucosidasius strains, as well as similar genome organization. Geobacillus sp. WCH70 appears to be a highly adaptable organism, with an exceptionally high 125 annotated transposons in the genome. The organism also possesses four predicted restriction-modification systems not found in other Geobacillus species.« less

  3. NDE1 and NDEL1: twin neurodevelopmental proteins with similar ‘nature’ but different ‘nurture’

    PubMed Central

    Bradshaw, Nicholas J.; Hennah, William; Soares, Dinesh C.

    2013-01-01

    Nuclear distribution element 1 (NDE1, also known as NudE) and NDE-like 1 (NDEL1, also known as Nudel) are paralogous proteins essential for mitosis and neurodevelopment that have been implicated in psychiatric and neurodevelopmental disorders. The two proteins possess high sequence similarity and have been shown to physically interact with one another. Numerous lines of experimental evidence in vivo and in cell culture have demonstrated that these proteins share common functions, although instances of differing functions between the two have recently emerged. We review the key aspects of NDE1 and NDEL1 in terms of recent advances in structure elucidation and cellular function, with an emphasis on their differing mechanisms of post-translational modification. Based on a review of the literature and bioinformatics assessment, we advance the concept that the twin proteins NDE1 and NDEL1, while sharing a similar ‘nature’ in terms of their structure and basic functions, appear to be different in their ‘nurture’, the manner in which they are regulated both in terms of expression and of post-translational modification within the cell. These differences are likely to be of significant importance in understanding the specific roles of NDE1 and NDEL1 in neurodevelopment and disease. PMID:24093049

  4. A reassessment of IgM memory subsets in humans

    PubMed Central

    Bagnara, Davide; Squillario, Margherita; Kipling, David; Mora, Thierry; Walczak, Aleksandra M.; Da Silva, Lucie; Weller, Sandra; Dunn-Walters, Deborah K.; Weill, Jean-Claude; Reynaud, Claude-Agnès

    2015-01-01

    From paired blood and spleen samples from three adult donors we performed high-throughput V-h sequencing of human B-cell subsets defined by IgD and CD27 expression: IgD+CD27+ (“MZ”), IgD−CD27+(“memory”, including IgM (“IgM-only”), IgG and IgA) and IgD−CD27− cells (“double-negative”, including IgM, IgG and IgA). 91,294 unique sequences clustered in 42,670 clones, revealing major clonal expansions in each of these subsets. Among these clones, we further analyzed those shared sequences from different subsets or tissues for Vh-gene mutation, H-CDR3-length, and Vh/Jh usage, comparing these different characteristics with all sequences from their subset of origin, for which these parameters constitute a distinct signature. The IgM-only repertoire profile differed notably from that of MZ B cells by a higher mutation frequency, and lower Vh4 and higher Jh6 gene usage. Strikingly, IgM sequences from clones shared between the MZ and the memory IgG/IgA compartments showed a mutation and repertoire profile of IgM-only and not of MZ B cells. Similarly, all IgM clonal relationships (between MZ, IgM-only, and double-negative compartments) involved sequences with the characteristics of IgM-only B cells. Finally, clonal relationships between tissues suggested distinct recirculation characteristics between MZ and switched B cells. The “IgM-only” subset (including cells with its repertoire signature but higher IgD or lower CD27 expression levels) thus appear as the only subset showing precursor-product relationships with CD27+ switched memory B cells, indicating that they represent germinal center-derived IgM memory B cells, and that IgM memory and MZ B cells constitute two distinct entities. PMID:26355154

  5. A Reassessment of IgM Memory Subsets in Humans.

    PubMed

    Bagnara, Davide; Squillario, Margherita; Kipling, David; Mora, Thierry; Walczak, Aleksandra M; Da Silva, Lucie; Weller, Sandra; Dunn-Walters, Deborah K; Weill, Jean-Claude; Reynaud, Claude-Agnès

    2015-10-15

    From paired blood and spleen samples from three adult donors, we performed high-throughput VH sequencing of human B cell subsets defined by IgD and CD27 expression: IgD(+)CD27(+) ("marginal zone [MZ]"), IgD(-)CD27(+) ("memory," including IgM ["IgM-only"], IgG and IgA) and IgD(-)CD27(-) cells ("double-negative," including IgM, IgG, and IgA). A total of 91,294 unique sequences clustered in 42,670 clones, revealing major clonal expansions in each of these subsets. Among these clones, we further analyzed those shared sequences from different subsets or tissues for VH gene mutation, H-CDR3-length, and VH/JH usage, comparing these different characteristics with all sequences from their subset of origin for which these parameters constitute a distinct signature. The IgM-only repertoire profile differed notably from that of MZ B cells by a higher mutation frequency and lower VH4 and higher JH6 gene usage. Strikingly, IgM sequences from clones shared between the MZ and the memory IgG/IgA compartments showed a mutation and repertoire profile of IgM-only and not of MZ B cells. Similarly, all IgM clonal relationships (among MZ, IgM-only, and double-negative compartments) involved sequences with the characteristics of IgM-only B cells. Finally, clonal relationships between tissues suggested distinct recirculation characteristics between MZ and switched B cells. The "IgM-only" subset (including cells with its repertoire signature but higher IgD or lower CD27 expression levels) thus appear as the only subset showing precursor-product relationships with CD27(+) switched memory B cells, indicating that they represent germinal center-derived IgM memory B cells and that IgM memory and MZ B cells constitute two distinct entities. Copyright © 2015 by The American Association of Immunologists, Inc.

  6. Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens

    PubMed Central

    Naz, Sadia; Ngo, Tony; Farooq, Umar

    2017-01-01

    Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099

  7. Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens.

    PubMed

    Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben

    2017-01-01

    The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.

  8. Iterative dictionary construction for compression of large DNA data sets.

    PubMed

    Kuruppu, Shanika; Beresford-Smith, Bryan; Conway, Thomas; Zobel, Justin

    2012-01-01

    Genomic repositories increasingly include individual as well as reference sequences, which tend to share long identical and near-identical strings of nucleotides. However, the sequential processing used by most compression algorithms, and the volumes of data involved, mean that these long-range repetitions are not detected. An order-insensitive, disk-based dictionary construction method can detect this repeated content and use it to compress collections of sequences. We explore a dictionary construction method that improves repeat identification in large DNA data sets. Our adaptation, COMRAD, of an existing disk-based method identifies exact repeated content in collections of sequences with similarities within and across the set of input sequences. COMRAD compresses the data over multiple passes, which is an expensive process, but allows COMRAD to compress large data sets within reasonable time and space. COMRAD allows for random access to individual sequences and subsequences without decompressing the whole data set. COMRAD has no competitor in terms of the size of data sets that it can compress (extending to many hundreds of gigabytes) and, even for smaller data sets, the results are competitive compared to alternatives; as an example, 39 S. cerevisiae genomes compressed to 0.25 bits per base.

  9. Individual sequences in large sets of gene sequences may be distinguished efficiently by combinations of shared sub-sequences

    PubMed Central

    Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J

    2005-01-01

    Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134

  10. Paenibacillus profundus sp. nov., a deep sediment bacterium that produces isocoumarin and peptide antibiotics.

    PubMed

    Romanenko, Lyudmila A; Tanaka, Naoto; Svetashev, Vassilii I; Kalinovskaya, Natalia I

    2013-04-01

    A novel bacterial strain Sl 79(T) was isolated from a deep surface sediment sample obtained from the Sea of Japan and investigated by phenotypic and molecular methods. The bacterium Sl 79(T) was Gram-positive, facultatively anaerobic, spore-forming, motile and able to form two different types of colonies. It contained the major menaquinone MK-7 and anteiso-C(15:0) followed by iso-C(15:0) as predominant fatty acids. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain Sl 79(T) belonged to the genus Paenibacillus where it clustered to Paenibacillus apiarius NRRL NRS-1438(T) with a sequence similarity of 97.7 % and sharing sequence similarities below than 96.7 % to other validly named Paenibacillus species. Strain Sl 79(T) was found to possess a remarkable inhibitory activity against indicatory microorganisms. On the basis of combined spectral analyses, strain Paenibacillus sp. Sl 79(T) was established to produce isocoumarin and novel peptide antibiotics. On the basis of DNA-DNA relatedness, phenotypic and phylogenetic data obtained, it was concluded that strain Sl 79(T) represents a novel species, Paenibacillus profundus sp. nov. with the type strain Sl 79(T) = KMM 9420(T) = NRIC 0885(T).

  11. Identification of Opportunistic Pathogenic Bacteria in Drinking Water Samples of Different Rural Health Centers and Their Clinical Impacts on Humans

    PubMed Central

    Pindi, Pavan Kumar; Raghuveer Yadav, P.; Shiva Shanker, A.

    2013-01-01

    International drinking water quality monitoring programs have been established in order to prevent or to reduce the risk of contracting water-related infections. A survey was performed on groundwater-derived drinking water from 13 different hospitals in the Mahabubnagar District. A total of 55 bacterial strains were isolated which belonged to both gram-positive and gram-negative bacteria. All the taxa were identified based on the 16S rRNA gene sequence analysis based on which they are phylogenetically close to 27 different taxa. Many of the strains are closely related to their phylogenetic neighbors and exhibit from 98.4 to 100% sequence similarity at the 16S rRNA gene sequence level. The most common group was similar to Acinetobacter junii (21.8%) and Acinetobacter calcoaceticus (10.9%) which were shared by 7 and 5 water samples, respectively. Out of 55 isolates, only 3 isolates belonged to coliform group which are Citrobacter freundii and Pantoea anthophila. More than half (52.7%, 29 strains) of the phylogenetic neighbors which belonged to 12 groups were reported to be pathogenic and isolated from clinical specimens. Out of 27 representative taxa are affiliated have eight representative genera in drinking water except for those affiliated with the genera Exiguobacterium, Delftia, Kocuria, and Lysinibacillus. PMID:23862144

  12. Bean common mosaic virus isolates causing different symptoms in asparagus bean in China differ greatly in the 5'-parts of their genomes.

    PubMed

    Zheng, Hongying; Chen, Jiong; Chen, Jianping; Adams, Michael J; Hou, Mingsheng

    2002-06-01

    Potyvirus isolates from asparagus bean ( Vigna sesquipedalis) plants in Zhejiang province, China, caused either rugose and vein banding mosaic symptoms (isolate R) or severe yellowing (isolate Y) in this host, but were otherwise similar in host range. Both isolates were completely sequenced and shown to be isolates of Bean common mosaic virus (BCMV). The complete sequences were 9992 (R) or 10062 (Y) nucleotides long and shared 91.7% identical nucleotides (93.2% identical amino acids) in their genomes and were more distantly related to the BCMV-Peanut stripe virus sequence (PStV). The isolates were much less similar to one another in the 5'-UTR and the N-terminal region of the P1 protein. In the P1, isolate Y was closer to PStV (76.1% identical amino acids) than to isolate R (64.8%). Phylogenetic analyses of the coat protein region showed that the new isolates grouped with other isolates from Vigna spp., forming the blackeye cowpea mosaic strain subgroup of BCMV with 94-98% nucleotides (96-99% amino acids) identical to one another and about 90% identity to other BCMV isolates. Other significant subgroupings amongst published BCMV isolates were detected.

  13. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    PubMed

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  14. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    PubMed Central

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  15. Structural Plasticity and Rapid Evolution in a Viral RNA Revealed by In Vivo Genetic Selection▿ †

    PubMed Central

    Guo, Rong; Lin, Wai; Zhang, Jiuchun; Simon, Anne E.; Kushner, David B.

    2009-01-01

    Satellite RNAs usually lack substantial homology with their helper viruses. The 356-nucleotide satC of Turnip crinkle virus (TCV) is unusual in that its 3′-half shares high sequence similarity with the TCV 3′ end. Computer modeling, structure probing, and/or compensatory mutagenesis identified four hairpins and three pseudoknots in this TCV region that participate in replication and/or translation. Two hairpins and two pseudoknots have been confirmed as important for satC replication. One portion of the related 3′ end of satC that remains poorly characterized corresponds to juxtaposed TCV hairpins H4a and H4b and pseudoknot ψ3, which are required for the TCV-specific requirement of translation (V. A. Stupina et al., RNA 14:2379-2393, 2008). Replacement of satC H4a with randomized sequence and scoring for fitness in plants by in vivo genetic selection (SELEX) resulted in winning sequences that contain an H4a-like stem-loop, which can have additional upstream sequence composing a portion of the stem. SELEX of the combined H4a and H4b region in satC generated three distinct groups of winning sequences. One group models into two stem-loops similar to H4a and H4b of TCV. However, the selected sequences in the other two groups model into single hairpins. Evolution of these single-hairpin SELEX winners in plants resulted in satC that can accumulate to wild-type (wt) levels in protoplasts but remain less fit in planta when competed against wt satC. These data indicate that two highly distinct RNA conformations in the H4a and H4b region can mediate satC fitness in protoplasts. PMID:19004956

  16. Chloroplast Genome Evolution in Early Diverged Leptosporangiate Ferns

    PubMed Central

    Kim, Hyoung Tae; Chung, Myong Gi; Kim, Ki-Joong

    2014-01-01

    In this study, the chloroplast (cp) genome sequences from three early diverged leptosporangiate ferns were completed and analyzed in order to understand the evolution of the genome of the fern lineages. The complete cp genome sequence of Osmunda cinnamomea (Osmundales) was 142,812 base pairs (bp). The cp genome structure was similar to that of eusporangiate ferns. The gene/intron losses that frequently occurred in the cp genome of leptosporangiate ferns were not found in the cp genome of O. cinnamomea. In addition, putative RNA editing sites in the cp genome were rare in O. cinnamomea, even though the sites were frequently predicted to be present in leptosporangiate ferns. The complete cp genome sequence of Diplopterygium glaucum (Gleicheniales) was 151,007 bp and has a 9.7 kb inversion between the trnL-CAA and trnV-GCA genes when compared to O. cinnamomea. Several repeated sequences were detected around the inversion break points. The complete cp genome sequence of Lygodium japonicum (Schizaeales) was 157,142 bp and a deletion of the rpoC1 intron was detected. This intron loss was shared by all of the studied species of the genus Lygodium. The GC contents and the effective numbers of co-dons (ENCs) in ferns varied significantly when compared to seed plants. The ENC values of the early diverged leptosporangiate ferns showed intermediate levels between eusporangiate and core leptosporangiate ferns. However, our phylogenetic tree based on all of the cp gene sequences clearly indicated that the cp genome similarity between O. cinnamomea (Osmundales) and eusporangiate ferns are symplesiomorphies, rather than synapomorphies. Therefore, our data is in agreement with the view that Osmundales is a distinct early diverged lineage in the leptosporangiate ferns. PMID:24823358

  17. Chloroplast genome evolution in early diverged leptosporangiate ferns.

    PubMed

    Kim, Hyoung Tae; Chung, Myong Gi; Kim, Ki-Joong

    2014-05-01

    In this study, the chloroplast (cp) genome sequences from three early diverged leptosporangiate ferns were completed and analyzed in order to understand the evolution of the genome of the fern lineages. The complete cp genome sequence of Osmunda cinnamomea (Osmundales) was 142,812 base pairs (bp). The cp genome structure was similar to that of eusporangiate ferns. The gene/intron losses that frequently occurred in the cp genome of leptosporangiate ferns were not found in the cp genome of O. cinnamomea. In addition, putative RNA editing sites in the cp genome were rare in O. cinnamomea, even though the sites were frequently predicted to be present in leptosporangiate ferns. The complete cp genome sequence of Diplopterygium glaucum (Gleicheniales) was 151,007 bp and has a 9.7 kb inversion between the trnL-CAA and trnVGCA genes when compared to O. cinnamomea. Several repeated sequences were detected around the inversion break points. The complete cp genome sequence of Lygodium japonicum (Schizaeales) was 157,142 bp and a deletion of the rpoC1 intron was detected. This intron loss was shared by all of the studied species of the genus Lygodium. The GC contents and the effective numbers of codons (ENCs) in ferns varied significantly when compared to seed plants. The ENC values of the early diverged leptosporangiate ferns showed intermediate levels between eusporangiate and core leptosporangiate ferns. However, our phylogenetic tree based on all of the cp gene sequences clearly indicated that the cp genome similarity between O. cinnamomea (Osmundales) and eusporangiate ferns are symplesiomorphies, rather than synapomorphies. Therefore, our data is in agreement with the view that Osmundales is a distinct early diverged lineage in the leptosporangiate ferns.

  18. Pseudoxanthomonas koreensis sp. nov. and Pseudoxanthomonas daejeonensis sp. nov.

    PubMed

    Yang, Deok-Chun; Im, Wan-Taek; Kim, Myung Kyum; Lee, Sung-Taik

    2005-03-01

    Gram-negative, non-spore-forming, rod-shaped bacteria, T7-09(T) and TR6-08(T), were isolated from soil from a ginseng field in South Korea and characterized to determine their taxonomic position. 16S rRNA gene sequence analysis showed that the two isolates shared 99.5 % sequence similarity. Strains T7-09(T) and TR6-08(T) were shown to belong to the Proteobacteria and showed the highest levels of sequence similarity to Pseudoxanthomonas broegbernensis DSM 12573(T) (98.1 %), Pseudoxanthomonas mexicana AMX 26B(T) (97.4-97.5 %), Pseudoxanthomonas japonensis 12-3(T) (96.5-96.6 %), Pseudoxanthomonas taiwanensis ATCC BAA-404(T) (95.7 %) and Xanthomonas campestris ATCC 33913(T) (96.3-96.5 %). The sequence similarity values with respect to any species with validly published names in related genera were less than 96.5 %. The detection of a quinone system with Q-8 as the predominant compound and a fatty acid profile with C(15 : 0) iso as the predominant acid supported the assignment of the novel isolates to the order 'Xanthomonadales'. The two isolates could be distinguished from the established species of the genus Pseudoxanthomonas by the presence of quantitative unsaturated fatty acid C(17 : 1) iso omega9c and by their unique biochemical profiles. The results of DNA-DNA hybridization clearly demonstrated that T7-09(T) and TR6-08(T) represent separate species. On the basis of these data, it is proposed that T7-09(T) (=KCTC 12208(T)=IAM 15116(T)) and TR6-08(T) (=KCTC 12207(T)=IAM 15115(T)) be classified as the type strains of two novel Pseudoxanthomonas species, for which the names Pseudoxanthomonas koreensis sp. nov. and Pseudoxanthomonas daejeonensis sp. nov., respectively, are proposed.

  19. Genomic, proteomic and bioinformatic analysis of two temperate phages in Roseobacter clade bacteria isolated from the deep-sea water.

    PubMed

    Tang, Kai; Lin, Dan; Zheng, Qiang; Liu, Keshao; Yang, Yujie; Han, Yu; Jiao, Nianzhi

    2017-06-27

    Marine phages are spectacularly diverse in nature. Dozens of roseophages infecting members of Roseobacter clade bacteria were isolated and characterized, exhibiting a very high degree of genetic diversity. In the present study, the induction of two temperate bacteriophages, namely, vB_ThpS-P1 and vB_PeaS-P1, was performed in Roseobacter clade bacteria isolated from the deep-sea water, Thiobacimonas profunda JLT2016 and Pelagibaca abyssi JLT2014, respectively. Two novel phages in morphological, genomic and proteomic features were presented, and their phylogeny and evolutionary relationships were explored by bioinformatic analysis. Electron microscopy showed that the morphology of the two phages were similar to that of siphoviruses. Genome sequencing indicated that the two phages were similar in size, organization, and content, thereby suggesting that these shared a common ancestor. Despite the presence of Mu-like phage head genes, the phages are more closely related to Rhodobacter phage RC1 than Mu phages in terms of gene content and sequence similarity. Based on comparative genomic and phylogenetic analysis, we propose a Mu-like head phage group to allow for the inclusion of Mu-like phages and two newly phages. The sequences of the Mu-like head phage group were widespread, occurring in each investigated metagenomes. Furthermore, the horizontal exchange of genetic material within the Mu-like head phage group might have involved a gene that was associated with phage phenotypic characteristics. This study is the first report on the complete genome sequences of temperate phages that infect deep-sea roseobacters, belonging to the Mu-like head phage group. The Mu-like head phage group might represent a small but ubiquitous fraction of marine viral diversity.

  20. Intricate interactions between the bloom-forming cyanobacterium Microcystis aeruginosa and foreign genetic elements, revealed by diversified clustered regularly interspaced short palindromic repeat (CRISPR) signatures.

    PubMed

    Kuno, Sotaro; Yoshida, Takashi; Kaneko, Takakazu; Sako, Yoshihiko

    2012-08-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids.

  1. Intricate Interactions between the Bloom-Forming Cyanobacterium Microcystis aeruginosa and Foreign Genetic Elements, Revealed by Diversified Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Signatures

    PubMed Central

    Kuno, Sotaro; Kaneko, Takakazu; Sako, Yoshihiko

    2012-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids. PMID:22636003

  2. Multiple ice-binding proteins of probable prokaryotic origin in an Antarctic lake alga, Chlamydomonas sp. ICE-MDV (Chlorophyceae).

    PubMed

    Raymond, James A; Morgan-Kiss, Rachael

    2017-08-01

    Ice-associated algae produce ice-binding proteins (IBPs) to prevent freezing damage. The IBPs of the three chlorophytes that have been examined so far share little similarity across species, making it likely that they were acquired by horizontal gene transfer (HGT). To clarify the importance and source of IBPs in chlorophytes, we sequenced the IBP genes of another Antarctic chlorophyte, Chlamydomonas sp. ICE-MDV (Chlamy-ICE). Genomic DNA and total RNA were sequenced and screened for known ice-associated genes. Chlamy-ICE has as many as 50 IBP isoforms, indicating that they have an important role in survival. The IBPs are of the DUF3494 type and have similar exon structures. The DUF3494 sequences are much more closely related to prokaryotic sequences than they are to sequences in other chlorophytes, and the chlorophyte IBP and ribosomal 18S phylogenies are dissimilar. The multiple IBP isoforms found in Chlamy-ICE and other algae may allow the algae to adapt to a greater variety of ice conditions than prokaryotes, which typically have a single IBP gene. The predicted structure of the DUF3494 domain has an ice-binding face with an orderly array of hydrophilic side chains. The results indicate that Chlamy-ICE acquired its IBP genes by HGT in a single event. The acquisitions of IBP genes by this and other species of Antarctic algae by HGT appear to be key evolutionary events that allowed algae to extend their ranges into polar environments. © 2017 Phycological Society of America.

  3. Molecular systematics of higher primates: genealogical relations and classification.

    PubMed Central

    Miyamoto, M M; Koop, B F; Slightom, J L; Goodman, M; Tennant, M R

    1988-01-01

    We obtained 5' and 3' flanking sequences (5.4 kilobase pairs) from the psi eta-globin gene region of the rhesus macaque (Macaca mulatta) and combined them with available nucleotide data. The completed sequence, representing 10.8 kilobase pairs of contiguous noncoding DNA, was compared to the same orthologous regions available for human (Homo sapiens, as represented by five different alleles), common chimpanzee (Pan troglodytes), gorilla (Gorilla gorilla), and orangutan (Pongo pygmaeus). The nucleotide sequence for Macaca mulatta provided the outgroup perspective needed to evaluate better the relationships of humans and great apes. Pairwise comparisons and parsimony analysis of these orthologues clearly demonstrated (i) that humans and great apes share a high degree of genetic similarity and (ii) that humans, chimpanzees, and gorillas form a natural monophyletic group. These conclusions strongly favor a genealogical classification for higher primates consisting of a single family (Hominidae) with two subfamilies (Homininae for Homo, Pan, and Gorilla and Ponginae for Pongo). PMID:3174657

  4. Expression of glutathione peroxidase I gene in selenium-deficient rats.

    PubMed Central

    Reddy, A P; Hsu, B L; Reddy, P S; Li, N Q; Thyagaraju, K; Reddy, C C; Tam, M F; Tu, C P

    1988-01-01

    We have characterized a cDNA pGPX1211 encoding rat glutathione peroxidase I. The selenocysteine in the protein corresponded to a TGA codon in the coding region of the cDNA, similar to earlier findings in mouse and human genes, and a gene encoding the formate dehydrogenase from E. coli, another selenoenzyme. The rat GSH peroxidase I has a calculated subunit molecular weight of 22,155 daltons and shares 95% and 86% sequence homology with the mouse and human subunits, respectively. The 3'-noncoding sequence (greater than 930 bp) in pGPX1211 is much longer than that of the human sequences. We found that glutathione peroxidase I mRNA, but not the polypeptide, was expressed under nutritional stress of selenium deficiency where no glutathione peroxidase I activity can be detected. The failure of detecting any apoprotein for the glutathione peroxidase I under selenium deficiency and results published from other laboratories supports the proposal that selenium may be incorporated into the glutathione peroxidase I co-translationally. Images PMID:2838821

  5. The genome of the Lactobacillus sanfranciscensis temperate phage EV3

    PubMed Central

    2013-01-01

    Background Bacteriophages infection modulates microbial consortia and transduction is one of the most important mechanism involved in the bacterial evolution. However, phage contamination brings food fermentations to a halt causing economic setbacks. The number of phage genome sequences of lactic acid bacteria especially of lactobacilli is still limited. We analysed the genome of a temperate phage active on Lactobacillus sanfranciscensis, the predominant strain in type I sourdough fermentations. Results Sequencing of the DNA of EV3 phage revealed a genome of 34,834 bp and a G + C content of 36.45%. Of the 43 open reading frames (ORFs) identified, all but eight shared homology with other phages of lactobacilli. A similar genomic organization and mosaic pattern of identities align EV3 with the closely related Lactobacillus vaginalis ATCC 49540 prophage. Four unknown ORFs that had no homologies in the databases or predicted functions were identified. Notably, EV3 encodes a putative dextranase. Conclusions EV3 is the first L. sanfranciscensis phage that has been completely sequenced so far. PMID:24308641

  6. Clades of Adeno-Associated Viruses Are Widely Disseminated in Human Tissues

    PubMed Central

    Gao, Guangping; Vandenberghe, Luk H.; Alvira, Mauricio R.; Lu, You; Calcedo, Roberto; Zhou, Xiangyang; Wilson, James M.

    2004-01-01

    The potential for using Adeno-associated virus (AAV) as a vector for human gene therapy has stimulated interest in the Dependovirus genus. Serologic data suggest that AAV infections are prevalent in humans, although analyses of viruses and viral sequences from clinical samples are extremely limited. Molecular techniques were used in this study to successfully detect endogenous AAV sequences in 18% of all human tissues screened, with the liver and bone marrow being the most predominant sites. Sequence characterization of rescued AAV DNAs indicated a diverse array of molecular forms which segregate into clades whose members share functional and serologic similarities. One of the most predominant human clades is a hybrid of two previously described AAV serotypes, while another clade was found in humans and several species of nonhuman primates, suggesting a cross-species transmission of this virus. These data provide important information regarding the biology of parvoviruses in humans and their use as gene therapy vectors. PMID:15163731

  7. A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

    PubMed

    Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

    1994-12-01

    We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

  8. Lactobacillus allii sp. nov. isolated from scallion kimchi.

    PubMed

    Jung, Min Young; Lee, Se Hee; Lee, Moeun; Song, Jung Hee; Chang, Ji Yoon

    2017-12-01

    A novel strain of lactic acid bacteria, WiKim39 T , was isolated from a scallion kimchi sample consisting of fermented chili peppers and vegetables. The isolate was a Gram-positive, rod-shaped, non-motile, catalase-negative and facultatively anaerobic lactic acid bacterium. Phylogenetic analysis of the 16S rRNA gene sequence showed that strain WiKim39 T belonged to the genus Lactobacillus, and shared 97.1-98.2 % pair-wise sequence similarities with related type strains, Lactobacillus nodensis, Lactobacillus insicii, Lactobacillus versmoldensis, Lactobacillus tucceti and Lactobacillus furfuricola. The G+C content of the strain based on its genome sequence was 35.3 mol%. The ANI values between WiKim39 T and the closest relatives were lower than 80 %. Based on the phenotypic, biochemical, and phylogenetic analyses, strain WiKim39 T represents a novel species of the genus Lactobacillus, for which the name Lactobacillus allii sp. nov. is proposed. The type strain is WiKim39 T (=KCTC 21077 T =JCM 31938 T ).

  9. Lactobacillus allii sp. nov. isolated from scallion kimchi

    PubMed Central

    Jung, Min Young; Lee, Se Hee; Lee, Moeun; Song, Jung Hee; Chang, Ji Yoon

    2017-01-01

    A novel strain of lactic acid bacteria, WiKim39T, was isolated from a scallion kimchi sample consisting of fermented chili peppers and vegetables. The isolate was a Gram-positive, rod-shaped, non-motile, catalase-negative and facultatively anaerobic lactic acid bacterium. Phylogenetic analysis of the 16S rRNA gene sequence showed that strain WiKim39T belonged to the genus Lactobacillus, and shared 97.1–98.2 % pair-wise sequence similarities with related type strains, Lactobacillus nodensis, Lactobacillus insicii, Lactobacillus versmoldensis, Lactobacillus tucceti and Lactobacillus furfuricola. The G+C content of the strain based on its genome sequence was 35.3 mol%. The ANI values between WiKim39T and the closest relatives were lower than 80 %. Based on the phenotypic, biochemical, and phylogenetic analyses, strain WiKim39T represents a novel species of the genus Lactobacillus, for which the name Lactobacillus allii sp. nov. is proposed. The type strain is WiKim39T (=KCTC 21077T=JCM 31938T). PMID:29043955

  10. Mitochondrial genome of the bullet tuna Auxis rochei from Indo-West Pacific collection provides novel genetic information about two subspecies.

    PubMed

    Li, Mingming; Guo, Liang; Zhang, Heng; Yang, Sen; Chen, Xinghan; Lin, Haoran; Meng, Zining

    2016-09-01

    Previously morphological studies supported the division of the bullet tuna into the two subspecies, Auxis rochei rochei and A. rochei eudorax. As a cosmopolitan species, A. rochei rochei ranges in the Indo-West Pacific and Atlantic oceans, while A. rochei eudorax inhabits in eastern Pacific region. Here, we used the HiSeq next-generation sequencing technique to determine the mitochondrial genome (mitogenome) of A. rochei from Indo-West Pacific collection, and then compared our data with mitogenomic sequences of the Atlantic and eastern Pacific retrieved from NCBI database. Results showed the mitogenome of A. rochei from three geographic collections shared the same genes and gene order, similar to typical teleosts. Also, we examined a low level of nucleotide diversity among these mitogenomic sequences. Interestingly, nucleotide diversity of intra-subspecies (Atlantic versus Indo-West) was higher than that of inter-subspecies (Atlantic versus eastern Pacific, Indo-West versus eastern Pacific).

  11. A bacterial Argonaute with noncanonical guide RNA specificity

    PubMed Central

    Kaya, Emine; Doxzen, Kevin W.; Knoll, Kilian R.; Wilson, Ross C.; Strutt, Steven C.; Kranzusch, Philip J.; Doudna, Jennifer A.

    2016-01-01

    Eukaryotic Argonaute proteins induce gene silencing by small RNA-guided recognition and cleavage of mRNA targets. Although structural similarities between human and prokaryotic Argonautes are consistent with shared mechanistic properties, sequence and structure-based alignments suggested that Argonautes encoded within CRISPR-cas [clustered regularly interspaced short palindromic repeats (CRISPR)-associated] bacterial immunity operons have divergent activities. We show here that the CRISPR-associated Marinitoga piezophila Argonaute (MpAgo) protein cleaves single-stranded target sequences using 5′-hydroxylated guide RNAs rather than the 5′-phosphorylated guides used by all known Argonautes. The 2.0-Å resolution crystal structure of an MpAgo–RNA complex reveals a guide strand binding site comprising residues that block 5′ phosphate interactions. Using structure-based sequence alignment, we were able to identify other putative MpAgo-like proteins, all of which are encoded within CRISPR-cas loci. Taken together, our data suggest the evolution of an Argonaute subclass with noncanonical specificity for a 5′-hydroxylated guide. PMID:27035975

  12. A proposed model for the flowering signaling pathway of sugarcane under photoperiodic control.

    PubMed

    Coelho, C P; Costa Netto, A P; Colasanti, J; Chalfun-Júnior, A

    2013-04-25

    Molecular analysis of floral induction in Arabidopsis has identified several flowering time genes related to 4 response networks defined by the autonomous, gibberellin, photoperiod, and vernalization pathways. Although grass flowering processes include ancestral functions shared by both mono- and dicots, they have developed their own mechanisms to transmit floral induction signals. Despite its high production capacity and its important role in biofuel production, almost no information is available about the flowering process in sugarcane. We searched the Sugarcane Expressed Sequence Tags database to look for elements of the flowering signaling pathway under photoperiodic control. Sequences showing significant similarity to flowering time genes of other species were clustered, annotated, and analyzed for conserved domains. Multiple alignments comparing the sequences found in the sugarcane database and those from other species were performed and their phylogenetic relationship assessed using the MEGA 4.0 software. Electronic Northerns were run with Cluster and TreeView programs, allowing us to identify putative members of the photoperiod-controlled flowering pathway of sugarcane.

  13. [Molecular aspects of allergy to plant products. Part II. Pathogenesis-related proteins (PRs), apple allergenicity governed by Mal d 1 gene].

    PubMed

    Bokszczanin, Kamila Ł; Przybyła, Andrzej A

    2012-03-01

    Of the plant allergens listed in the Official Allergen Database of the International Union of Immunological Societies, approximately 25% belong to the group of pathogenesis-related proteins (PRs). They have been classified into 17 PR families based on similarities in their amino acid sequence, enzymatic activities, or other functional properties. Plant-derived allergens have been identified with sequence similarities to PR families 2, 3, 4, 5, 8, 10, and 14. The main birch allergen in northern Europe is a class 10 (PR-10) protein from the European white birch (Betula pendula) termed Bet v 1. Pollen of other Fagales species contains PR-10 homologues that share epitopes with Bet v 1, as do several fruits, nuts and vegetables. Among the plant food fruits of the Rosaceae family are the most frequently responsible for allergenic reactions. It is documented, that approximately 2% of European population is allergic to apples. The article presents molecular characterization of PR-10 proteins with regard to their structure and function as well as apple Mal d 1 gene-determined allergenicity.

  14. Identification and molecular characterization of a novel circular single-stranded DNA virus associated with yerba mate in Argentina.

    PubMed

    Bejerman, Nicolás; de Breuil, Soledad; Nome, Claudia

    2018-06-06

    A single-stranded DNA (ssDNA) virus was detected in Yerba mate samples showing chlorotic linear patterns, chlorotic rings and vein yellowing. The full-genome sequences of six different isolates of this ssDNA circular virus were obtained, which share > 99% sequence identity with each other. The newly identified virus has been tentatively named as yerba mate-associated circular DNA virus (YMaCV). The 2707 nt-long viral genome has two and three open reading frame on its complementary and virion-sense strands, respectively. The coat protein is more similar to that of mastreviruses (44% identity), whereas the replication-associated protein of YMaCV is more similar (49% identity) to that encoded by a recently described, unclassified ssDNA virus isolated on trees in Brazil. This is the first report of a circular DNA virus associated with yerba mate. Its unique genome organization and phylogenetic relationships indicates that YMaCV represents a distinct evolutionary lineage within the ssDNA viruses and therefore this virus should be classified as a member of a new species within an unassigned genus or family.

  15. A novel totivirus-like virus isolated from bat guano.

    PubMed

    Yang, Xinglou; Zhang, Yunzhi; Ge, Xingyi; Yuan, Junfa; Shi, Zhengli

    2012-06-01

    Previous metagenomic analysis indicated that numerous insect viruses exist in bat guano. In this study, we isolated a novel double-stranded RNA virus, a tentative member of the family Totiviridae, designated Tianjin totivirus (ToV-TJ), from bat feces. The virus is an icosahedral particle with a diameter of 40-43 nm, and it causes cytopathic effect in Sf9, Hz, and C6/36 cell lines. Full-length genomic sequence analysis showed that ToV-TJ shares high similarity with the totivirus OMRV-AK4, which was recently isolated from mosquitoes in Japan. The full-length genome of the ToV-TJ was 7611 bp and contained two predicted non-overlapping open reading frames (ORFs): ORF1, encoding the capsid protein (CP), and ORF2, encoding an RNA-dependent RNA polymerase. Bioassay of ToV-TJ by feeding on the larvae of Spodoptera exigua and Helicoverpa armigera (Hubner) suggests that this virus is not infectious for these two larvae in vivo. Sequences similar to that of ToV-TJ have been detected in bat feces sampled in Yunnan and Hainan Provinces, suggesting that this virus is widely distributed.

  16. Transcriptome Analysis of the Entomopathogenic Oomycete Lagenidium giganteum Reveals Putative Virulence Factors

    PubMed Central

    Quiroz Velasquez, Paula F.; Abiff, Sumayyah K.; Fins, Katrina C.; Conway, Quincy B.; Salazar, Norma C.; Delgado, Ana Paula; Dawes, Jhanelle K.; Douma, Lauren G.

    2014-01-01

    A combination of 454 pyrosequencing and Sanger sequencing was used to sample and characterize the transcriptome of the entomopathogenic oomycete Lagenidium giganteum. More than 50,000 high-throughput reads were annotated through homology searches. Several selected reads served as seeds for the amplification and sequencing of full-length transcripts. Phylogenetic analyses inferred from full-length cellulose synthase alignments revealed that L giganteum is nested within the peronosporalean galaxy and as such appears to have evolved from a phytopathogenic ancestor. In agreement with the phylogeny reconstructions, full-length L. giganteum oomycete effector orthologs, corresponding to the cellulose-binding elicitor lectin (CBEL), crinkler (CRN), and elicitin proteins, were characterized by domain organizations similar to those of pathogenicity factors of plant-pathogenic oomycetes. Importantly, the L. giganteum effectors provide a basis for detailing the roles of canonical CRN, CBEL, and elicitin proteins in the infectious process of an oomycete known principally as an animal pathogen. Finally, phylogenetic analyses and genome mining identified members of glycoside hydrolase family 5 subfamily 27 (GH5_27) as putative virulence factors active on the host insect cuticle, based in part on the fact that GH5_27 genes are shared by entomopathogenic oomycetes and fungi but are underrepresented in nonentomopathogenic genomes. The genomic resources gathered from the L. giganteum transcriptome analysis strongly suggest that filamentous entomopathogens (oomycetes and fungi) exhibit convergent evolution: they have evolved independently from plant-associated microbes, have retained genes indicative of plant associations, and may share similar cores of virulence factors, such as GH5_27 enzymes, that are absent from the genomes of their plant-pathogenic relatives. PMID:25107973

  17. Xanthomonas adaptation to common bean is associated with horizontal transfers of genes encoding TAL effectors.

    PubMed

    Ruh, Mylène; Briand, Martial; Bonneau, Sophie; Jacques, Marie-Agnès; Chen, Nicolas W G

    2017-08-30

    Common bacterial blight is a devastating bacterial disease of common bean (Phaseolus vulgaris) caused by Xanthomonas citri pv. fuscans and Xanthomonas phaseoli pv. phaseoli. These phylogenetically distant strains are able to cause similar symptoms on common bean, suggesting that they have acquired common genetic determinants of adaptation to common bean. Transcription Activator-Like (TAL) effectors are bacterial type III effectors that are able to induce the expression of host genes to promote infection or resistance. Their capacity to bind to a specific host DNA sequence suggests that they are potential candidates for host adaption. To study the diversity of tal genes from Xanthomonas strains responsible for common bacterial blight of bean, whole genome sequences of 17 strains representing the diversity of X. citri pv. fuscans and X. phaseoli pv. phaseoli were obtained by single molecule real time sequencing. Analysis of these genomes revealed the existence of four tal genes named tal23A, tal20F, tal18G and tal18H, respectively. While tal20F and tal18G were chromosomic, tal23A and tal18H were carried on plasmids and shared between phylogenetically distant strains, therefore suggesting recent horizontal transfers of these genes between X. citri pv. fuscans and X. phaseoli pv. phaseoli strains. Strikingly, tal23A was present in all strains studied, suggesting that it played an important role in adaptation to common bean. In silico predictions of TAL effectors targets in the common bean genome suggested that TAL effectors shared by X. citri pv. fuscans and X. phaseoli pv. phaseoli strains target the promoters of genes of similar functions. This could be a trace of convergent evolution among TAL effectors from different phylogenetic groups, and comforts the hypothesis that TAL effectors have been implied in the adaptation to common bean. Altogether, our results favour a model where plasmidic TAL effectors are able to contribute to host adaptation by being horizontally transferred between distant lineages.

  18. Qualitative thematic analysis of consent forms used in cancer genome sequencing

    PubMed Central

    2011-01-01

    Background Large-scale whole genome sequencing (WGS) studies promise to revolutionize cancer research by identifying targets for therapy and by discovering molecular biomarkers to aid early diagnosis, to better determine prognosis and to improve treatment response prediction. Such projects raise a number of ethical, legal, and social (ELS) issues that should be considered. In this study, we set out to discover how these issues are being handled across different jurisdictions. Methods We examined informed consent (IC) forms from 30 cancer genome sequencing studies to assess (1) stated purpose of sample collection, (2) scope of consent requested, (3) data sharing protocols (4) privacy protection measures, (5) described risks of participation, (6) subject re-contacting, and (7) protocol for withdrawal. Results There is a high degree of similarity in how cancer researchers engaged in WGS are protecting participant privacy. We observed a strong trend towards both using samples for additional, unspecified research and sharing data with other investigators. IC forms were varied in terms of how they discussed re-contacting participants, returning results and facilitating participant withdrawal. Contrary to expectation, there were no consistent trends that emerged over the eight year period from which forms were collected. Conclusion Examining IC forms from WGS studies elucidates how investigators are handling ELS challenges posed by this research. This information is important for ensuring that while the public benefits of research are maximized, the rights of participants are also being appropriately respected. PMID:21771309

  19. A conserved genetic module that encodes the major virion components in both the coliphage T4 and the marine cyanophage S-PM2

    PubMed Central

    Hambly, Emma; Tétart, Francoise; Desplats, Carine; Wilson, William H.; Krisch, Henry M.; Mann, Nicholas H.

    2001-01-01

    Sequence analysis of a 10-kb region of the genome of the marine cyanomyovirus S-PM2 reveals a homology to coliphage T4 that extends as a contiguous block from gene (g)18 to g23. The order of the S-PM2 genes in this region is similar to that of T4, but there are insertions and deletions of small ORFs of unknown function. In T4, g18 codes for the tail sheath, g19, the tail tube, g20, the head portal protein, g21, the prohead core protein, g22, a scaffolding protein, and g23, the major capsid protein. Thus, the entire module that determines the structural components of the phage head and contractile tail is conserved between T4 and this cyanophage. The significant differences in the morphology of these phages must reflect the considerable divergence of the amino acid sequence of their homologous virion proteins, which uniformly exceeds 50%. We suggest that their enormous diversity in the sea could be a result of genetic shuffling between disparate phages mediated by such commonly shared modules. These conserved sequences could facilitate genetic exchange by providing partially homologous substrates for recombination between otherwise divergent phage genomes. Such a mechanism would thus expand the pool of phage genes accessible by recombination to all those phages that share common modules. PMID:11553768

  20. Genomic sequence of mandarin fish rhabdovirus with an unusual small non-transcriptional ORF.

    PubMed

    Tao, Jian-Jun; Zhou, Guang-Zhou; Gui, Jian-Fang; Zhang, Qi-Ya

    2008-03-01

    The complete genome of mandarin fish Siniperca chuatsi rhabdovirus (SCRV) was cloned and sequenced. It comprises 11,545 nucleotides and contains five genes encoding the nucleoprotein N, the phosphoprotein P, the matrix protein M, the glycoprotein G, and the RNA-dependent RNA polymerase protein L. At the 3' and 5' termini of SCRV genome, leader and trailer sequences show inverse complementarity. The N, P, M and G proteins share the highest sequence identities (ranging from 14.8 to 41.5%) with the respective proteins of rhabdovirus 903/87, the L protein has the highest identity with those of vesiculoviruses, especially with Chandipura virus (44.7%). Phylogenetic analysis of L proteins showed that SCRV clustered with spring vireamia of carp virus (SVCV) and was most closely related to viruses in the genus Vesiculovirus. In addition, an overlapping open reading frame (ORF) predicted to encode a protein similar to vesicular stomatitis virus C protein is present within the P gene of SCRV. Furthermore, an unoverlapping small ORF downstream of M ORF within M gene is predicted (tentatively called orf4). Therefore, the genomic organization of SCRV can be proposed as 3' leader-N-P/C-M-(orf4)-G-L-trailer 5'. Orf4 transcription or translation products could not be detected by northern or Western blot, respectively, though one similar mRNA band to M mRNA was found. This is the first report on one small unoverlapping ORF in M gene of a fish rhabdovirus.

  1. Similar clinical and neuroimaging features in monozygotic twin pair with mutation in progranulin

    PubMed Central

    McDade, E.; Burrus, T.M.; Boot, B.P.; Kantarci, K.; Fields, J.; Lowe, V.J.; Peller, P.; Knopman, D.; Baker, M.; Finch, N.; Rademakers, R.; Petersen, R.

    2012-01-01

    Objective: To report the phenotypic characterization of monozygotic twins with mutations encoding progranulin (PGRN). Methods: We studied a twin pair with an exon 4 gene deletion in the PGRN gene. Both twins had clinical and neuropsychological examinations as well as structural MRI and fluorodeoxyglucose PET (FDG-PET) scans. PGRN gene sequencing was performed followed by progranulin ELISA in plasma. Results: Both twins manifested symptoms within 3 years of each other, with early behavioral, language, dysexecutive, and memory problems. MRI and FDG-PET imaging demonstrated a strikingly similar topography of findings with clear left hemisphere predominance. Serum progranulin levels in both were well below those from a normal population sample. Conclusions: Compared with the heterogeneity seen in many families with PGRN mutations, these monozygotic twins demonstrated strong clinical, neuroimaging, and serum progranulin level similarities, demonstrating the importance of shared genetic profiles beyond environmental influences in the symptomatic expression of the disease. PMID:22491866

  2. Psychrobacillus gen. nov. and proposal for reclassification of Bacillus insolitus Larkin & Stokes, 1967, B. psychrotolerans Abd-El Rahman et al., 2002 and B. psychrodurans Abd-El Rahman et al., 2002 as Psychrobacillus insolitus comb. nov., Psychrobacillus psychrotolerans comb. nov. and Psychrobacillus psychrodurans comb. nov.

    PubMed

    Krishnamurthi, S; Ruckmani, A; Pukall, R; Chakrabarti, T

    2010-11-01

    The taxonomic status of three Bacillus species, Bacillus insolitus, B. psychrodurans and B. psychrotolerans was reexamined using a polyphasic approach. In our analysis, these three Bacillus species formed a cluster separate from other members of Bacillus rRNA group 2 [5] and from Bacillus sensu stricto. These three species shared high 16S rRNA gene sequence similarities between them (97.8-99.7%) and showed closest sequence similarity (95.3-96.3%) to Paenisporosarcina quisquiliarum gen. nov., sp. nov. [18]. Sequence similarities with other related genera ranged between 90.9% and 94.5%. Phylogenetic coherence of the three species was supported by phenotypic characteristics, such as growth at low temperatures, negative oxidation and assimilation of many carbohydrates, MK8 as the major isoprenoid quinine and broadly similar polar lipid profiles. All three species had a similar peptidoglycan type of the variation A4β and similar genomic G+C contents (35.7-36.6 mol% [1]). Genomic relatedness among them was shown to be less than 70% and justified their separate species status [1]. These three species could be differentiated from each other and from related taxa on the basis of phenotypic, including chemotaxonomic, characteristics and ribotype patterns. On the basis of our analysis, we propose a new genus Psychrobacillus gen. nov. and to transfer B. insolitus, B. psychrodurans and B. psychrotolerans to the new genus as Psychrobacillus insolitus comb. nov. (type species of the genus; type strain W16B(T)=DSM 5(T)), P. psychrodurans comb. nov. (type strain 68E3(T)=DSM 11713(T)) and P. psychrotolerans comb. nov. (type strain 3H1(T)=DSM 11706(T)). Copyright © 2010 Elsevier GmbH. All rights reserved.

  3. PFAAT version 2.0: a tool for editing, annotating, and analyzing multiple sequence alignments.

    PubMed

    Caffrey, Daniel R; Dana, Paul H; Mathur, Vidhya; Ocano, Marco; Hong, Eun-Jong; Wang, Yaoyu E; Somaroo, Shyamal; Caffrey, Brian E; Potluri, Shobha; Huang, Enoch S

    2007-10-11

    By virtue of their shared ancestry, homologous sequences are similar in their structure and function. Consequently, multiple sequence alignments are routinely used to identify trends that relate to function. This type of analysis is particularly productive when it is combined with structural and phylogenetic analysis. Here we describe the release of PFAAT version 2.0, a tool for editing, analyzing, and annotating multiple sequence alignments. Support for multiple annotations is a key component of this release as it provides a framework for most of the new functionalities. The sequence annotations are accessible from the alignment and tree, where they are typically used to label sequences or hyperlink them to related databases. Sequence annotations can be created manually or extracted automatically from UniProt entries. Once a multiple sequence alignment is populated with sequence annotations, sequences can be easily selected and sorted through a sophisticated search dialog. The selected sequences can be further analyzed using statistical methods that explicitly model relationships between the sequence annotations and residue properties. Residue annotations are accessible from the alignment viewer and are typically used to designate binding sites or properties for a particular residue. Residue annotations are also searchable, and allow one to quickly select alignment columns for further sequence analysis, e.g. computing percent identities. Other features include: novel algorithms to compute sequence conservation, mapping conservation scores to a 3D structure in Jmol, displaying secondary structure elements, and sorting sequences by residue composition. PFAAT provides a framework whereby end-users can specify knowledge for a protein family in the form of annotation. The annotations can be combined with sophisticated analysis to test hypothesis that relate to sequence, structure and function.

  4. Primary structure and functional characterization of a Drosophila dopamine receptor with high homology to human D1/5 receptors.

    PubMed

    Gotzes, F; Balfanz, S; Baumann, A

    1994-01-01

    Members of the superfamily of G-protein coupled receptors share significant similarities in sequence and transmembrane architecture. We have isolated a Drosophila homologue of the mammalian dopamine receptor family using a low stringency hybridization approach. The deduced amino acid sequence is approximately 70% homologous to the human D1/D5 receptors. When expressed in HEK 293 cells, the Drosophila receptor stimulates cAMP production in response to dopamine application. This effect was mimicked by SKF 38393, a specific D1 receptor agonist, but inhibited by dopaminergic antagonists such as butaclamol and flupentixol. In situ hybridization revealed that the Drosophila dopamine receptor is highly expressed in the somata of the optic lobes. This suggests that the receptor might be involved in the processing of visual information and/or visual learning in invertebrates.

  5. Molecular cloning of a novel widely expressed human 80 kDa 17 beta-hydroxysteroid dehydrogenase IV.

    PubMed Central

    Adamski, J; Normand, T; Leenders, F; Monté, D; Begue, A; Stéhelin, D; Jungblut, P W; de Launoit, Y

    1995-01-01

    Reactions of oestrogens and androgens at position C-17 are catalysed by 17 beta-hydroxysteroid dehydrogenases (17 beta-HSDs). Cloning of the cDNA of a novel human 17 beta-HSD IV and expression of its mRNA are described. A probe derived from the recently discovered porcine 17 beta-oestradiol dehydrogenase (17 beta-EDH) was used to isolate a 2.6 kb human cDNA encoding a continuous protein of 736 amino acids of high (84%) similarity to the porcine 17 beta-EDH. The calculated molecular mass of the human enzyme is 79,595 Da. Other sequence similarities shared by the two enzymes are: an N-terminal sequence which is similar to that of members of the short-chain alcohol dehydrogenase family; amino acids 343-607 which are similar to the C-terminal domains of a trifunctional Candida tropicalis enzyme and the FOX2 gene product of Saccharomyces cerevisiae; amino acids 596-736 which are similar to human sterol carrier protein 2. The previously cloned human 17 beta-HSD I, II and III are less than 25% identical with 17 beta-HSD IV. mRNA for HSD IV is a single species of 3.0 kb, present in many tissues with highest concentrations in liver, heart, prostate and testes. When over-expressed in mammalian cells, the human 17 beta-HSD IV enzyme displays a specific unidirectional oxidative 17 beta-HSD activity. Images Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7487879

  6. Comparison of Intracellular "Ca. Endomicrobium Trichonymphae" Genomovars Illuminates the Requirement and Decay of Defense Systems against Foreign DNA.

    PubMed

    Izawa, Kazuki; Kuwahara, Hirokazu; Kihara, Kumiko; Yuki, Masahiro; Lo, Nathan; Itoh, Takehiko; Ohkuma, Moriya; Hongoh, Yuichi

    2016-10-13

    "Candidatus Endomicrobium trichonymphae" (Bacteria; Elusimicrobia) is an obligate intracellular symbiont of the cellulolytic protist genus Trichonympha in the termite gut. A previous genome analysis of "Ca Endomicrobium trichonymphae" phylotype Rs-D17 (genomovar Ri2008), obtained from a Trichonympha agilis cell in the gut of the termite Reticulitermes speratus, revealed that its genome is small (1.1 Mb) and contains many pseudogenes; it is in the course of reductive genome evolution. Here we report the complete genome sequence of another Rs-D17 genomovar, Ti2015, obtained from a different T. agilis cell present in an R. speratus gut. These two genomovars share most intact protein-coding genes and pseudogenes, showing 98.6% chromosome sequence similarity. However, characteristic differences were found in their defense systems, which comprised restriction-modification and CRISPR/Cas systems. The repertoire of intact restriction-modification systems differed between the genomovars, and two of the three CRISPR/Cas loci in genomovar Ri2008 are pseudogenized or missing in genomovar Ti2015. These results suggest relaxed selection pressure for maintaining these defense systems. Nevertheless, the remaining CRISPR/Cas system in each genomovar appears to be active; none of the "spacer" sequences (112 in Ri2008 and 128 in Ti2015) were shared whereas the "repeat" sequences were identical. Furthermore, we obtained draft genomes of three additional endosymbiotic Endomicrobium phylotypes from different host protist species, and discovered multiple, intact CRISPR/Cas systems in each genome. Collectively, unlike bacteriome endosymbionts in insects, the Endomicrobium endosymbionts of termite-gut protists appear to require defense against foreign DNA, although the required level of defense has likely been reduced during their intracellular lives. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Genetic history of an archaic hominin group from Denisova Cave in Siberia

    PubMed Central

    Reich, David; Green, Richard E.; Kircher, Martin; Krause, Johannes; Patterson, Nick; Durand, Eric Y.; Viola, Bence; Briggs, Adrian W.; Stenzel, Udo; Johnson, Philip L. F.; Maricic, Tomislav; Good, Jeffrey M.; Marques-Bonet, Tomas; Alkan, Can; Fu, Qiaomei; Mallick, Swapan; Li, Heng; Meyer, Matthias; Eichler, Evan E.; Stoneking, Mark; Richards, Michael; Talamo, Sahra; Shunkov, Michael V.; Derevianko, Anatoli P.; Hublin, Jean-Jacques; Kelso, Janet; Slatkin, Montgomery; Pääbo, Svante

    2015-01-01

    Using DNA extracted from a finger bone found in Denisova Cave in southern Siberia, we have sequenced the genome of an archaic hominin to about 1.9-fold coverage. This individual is from a group that shares a common origin with Neanderthals. This population was not involved in the putative gene flow from Neanderthals into Eurasians; however, the data suggest that it contributed 4–6% of its genetic material to the genomes of present-day Melanesians. We designate this hominin population ‘Denisovans’ and suggest that it may have been widespread in Asia during the Late Pleistocene epoch. A tooth found in Denisova Cave carries a mitochondrial genome highly similar to that of the finger bone. This tooth shares no derived morphological features with Neanderthals or modern humans, further indicating that Denisovans have an evolutionary history distinct from Neanderthals and modern humans. PMID:21179161

  8. Ectocranial suture closure in Pan troglodytes and Gorilla gorilla: pattern and phylogeny.

    PubMed

    Cray, James; Meindl, Richard S; Sherwood, Chet C; Lovejoy, C Owen

    2008-08-01

    The order in which ectocranial sutures undergo fusion displays species-specific variation among primates. However, the precise relationship between suture closure and phylogenetic affinities is poorly understood. In this study, we used Guttman Scaling to determine if the modal progression of suture closure differs among Homo sapiens, Pan troglodytes, and Gorilla gorilla. Because DNA sequence homologies strongly suggest that P. troglodytes and Homo sapiens share a more recent common ancestor than either does with G. gorilla, we hypothesized that this phylogenetic relationship would be reflected in the suture closure patterns of these three taxa. Results indicated that while all three species do share a similar lateral-anterior closure pattern, G. gorilla exhibits a unique vault pattern, which, unlike humans and P. troglodytes, follows a strong posterior-to-anterior gradient. P. troglodytes is therefore more like Homo sapiens in suture synostosis. Copyright 2008 Wiley-Liss, Inc.

  9. A local duplication of the Melanocortin receptor 1 locus in Astyanax

    PubMed Central

    Gross, Joshua B.; Weagley, James; Stahl, Bethany A.; Ma, Li; Espinasa, Luis; McGaugh, Suzanne E.

    2017-01-01

    In this study, we report evidence of a novel duplication of Melanocortin receptor 1 (Mc1r) in the cavefish genome. This locus was discovered following the observation of excessive allelic diversity in a ~820 bp fragment of Mc1r amplified via degenerate PCR from a natural population of Astyanax aeneus fish from Guerrero, Mexico. The cavefish genome reveals the presence of two closely related Mc1r open reading frames separated by a 1.46 kb intergenic region. One open reading frame corresponds to the previously reported Mc1r receptor, and the other open reading frame (duplicate copy) is 975 bp in length, encoding a receptor of 325 amino acids. Sequence similarity analyses position both copies in the syntenic region of the single Mc1r locus in 16 representative craniate genomes spanning bony fish (including Astyanax) to mammals, suggesting we discovered tandem duplicates of this important gene. The two Mc1r copies share ~89% sequence similarity, and, within Astyanax, are more similar to one another compared to other melanocortin family members. Future studies will inform the precise functional significance of the duplicated Mc1r locus, and if this novel copy number variant may have adaptive significance for the Astyanax lineage. PMID:28738163

  10. Chloroplast DNA sequence of the green alga Oedogonium cardiacum (Chlorophyceae): Unique genome architecture, derived characters shared with the Chaetophorales and novel genes acquired through horizontal transfer

    PubMed Central

    Brouard, Jean-Simon; Otis, Christian; Lemieux, Claude; Turmel, Monique

    2008-01-01

    Background To gain insight into the branching order of the five main lineages currently recognized in the green algal class Chlorophyceae and to expand our understanding of chloroplast genome evolution, we have undertaken the sequencing of chloroplast DNA (cpDNA) from representative taxa. The complete cpDNA sequences previously reported for Chlamydomonas (Chlamydomonadales), Scenedesmus (Sphaeropleales), and Stigeoclonium (Chaetophorales) revealed tremendous variability in their architecture, the retention of only few ancestral gene clusters, and derived clusters shared by Chlamydomonas and Scenedesmus. Unexpectedly, our recent phylogenies inferred from these cpDNAs and the partial sequences of three other chlorophycean cpDNAs disclosed two major clades, one uniting the Chlamydomonadales and Sphaeropleales (CS clade) and the other uniting the Oedogoniales, Chaetophorales and Chaetopeltidales (OCC clade). Although molecular signatures provided strong support for this dichotomy and for the branching of the Oedogoniales as the earliest-diverging lineage of the OCC clade, more data are required to validate these phylogenies. We describe here the complete cpDNA sequence of Oedogonium cardiacum (Oedogoniales). Results Like its three chlorophycean homologues, the 196,547-bp Oedogonium chloroplast genome displays a distinctive architecture. This genome is one of the most compact among photosynthetic chlorophytes. It has an atypical quadripartite structure, is intron-rich (17 group I and 4 group II introns), and displays 99 different conserved genes and four long open reading frames (ORFs), three of which are clustered in the spacious inverted repeat of 35,493 bp. Intriguingly, two of these ORFs (int and dpoB) revealed high similarities to genes not usually found in cpDNA. At the gene content and gene order levels, the Oedogonium genome most closely resembles its Stigeoclonium counterpart. Characters shared by these chlorophyceans but missing in members of the CS clade include the retention of psaM, rpl32 and trnL(caa), the loss of petA, the disruption of three ancestral clusters and the presence of five derived gene clusters. Conclusion The Oedogonium chloroplast genome disclosed additional characters that bolster the evidence for a close alliance between the Oedogoniales and Chaetophorales. Our unprecedented finding of int and dpoB in this cpDNA provides a clear example that novel genes were acquired by the chloroplast genome through horizontal transfers, possibly from a mitochondrial genome donor. PMID:18558012

  11. Quantum Mechanical Calculations of Cytosine, Thiocytosine and Their Radical Ions

    NASA Astrophysics Data System (ADS)

    Singh, Rashmi

    2010-08-01

    The RNA and DNA are polymer that share some interesting similarities, for instance it is well known that cytosine is the one of the common nucleic acid base. The sulfur is characterized as a very reactive element and it has been used, in chemical warfare agents. Since the genetic information is based on the sequence of the nucleic acid bases. The quantum mechanical calculations of the energies, geometries, charges and vibrational characteristics of the cytosine and thiocytosine. and their corresponding radicals were carried out by using DFT method with b3lyp/6-311++g** basis set.

  12. Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes.

    PubMed

    Riechmann, J L; Heard, J; Martin, G; Reuber, L; Jiang, C; Keddie, J; Adam, L; Pineda, O; Ratcliffe, O J; Samaha, R R; Creelman, R; Pilgrim, M; Broun, P; Zhang, J Z; Ghandehari, D; Sherman, B K; Yu, G

    2000-12-15

    The completion of the Arabidopsis thaliana genome sequence allows a comparative analysis of transcriptional regulators across the three eukaryotic kingdoms. Arabidopsis dedicates over 5% of its genome to code for more than 1500 transcription factors, about 45% of which are from families specific to plants. Arabidopsis transcription factors that belong to families common to all eukaryotes do not share significant similarity with those of the other kingdoms beyond the conserved DNA binding domains, many of which have been arranged in combinations specific to each lineage. The genome-wide comparison reveals the evolutionary generation of diversity in the regulation of transcription.

  13. Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase.

    PubMed

    Bamford, Vicki A; Armour, Maria; Mitchell, Sue A; Cartron, Michaël; Andrews, Simon C; Watson, Kimberly A

    2008-09-01

    YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

  14. A carrot leucine-rich-repeat protein that inhibits ice recrystallization.

    PubMed

    Worrall, D; Elias, L; Ashford, D; Smallwood, M; Sidebottom, C; Lillford, P; Telford, J; Holt, C; Bowles, D

    1998-10-02

    Many organisms adapted to live at subzero temperatures express antifreeze proteins that improve their tolerance to freezing. Although structurally diverse, all antifreeze proteins interact with ice surfaces, depress the freezing temperature of aqueous solutions, and inhibit ice crystal growth. A protein purified from carrot shares these functional features with antifreeze proteins of fish. Expression of the carrot complementary DNA in tobacco resulted in the accumulation of antifreeze activity in the apoplast of plants grown at greenhouse temperatures. The sequence of carrot antifreeze protein is similar to that of polygalacturonase inhibitor proteins and contains leucine-rich repeats.

  15. LLNL Genomic Assessment: Viral and Bacterial Sequencing Needs for TMTI, Task 1.4.2 Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Slezak, T; Borucki, M; Lam, M

    Good progress has been made on both bacterial and viral sequencing by the TMTI centers. While access to appropriate samples is a limiting factor to throughput, excellent progress has been made with respect to getting agreements in place with key sources of relevant materials. Sharing of sequenced genomes funded by TMTI has been extremely limited to date. The April 2010 exercise should force a resolution to this, but additional managerial pressures may be needed to ensure that rapid sharing of TMTI-funded sequencing occurs, regardless of collaborator constraints concerning ultimate publication(s). Policies to permit TMTI-internal rapid sharing of sequenced genomes shouldmore » be written into all TMTI agreements with collaborators now being negotiated. TMTI needs to establish a Web-based system for tracking samples destined for sequencing. This includes metadata on sample origins and contributor, information on sample shipment/receipt, prioritization by TMTI, assignment to one or more sequencing centers (including possible TMTI-sponsored sequencing at a contributor site), and status history of the sample sequencing effort. While this system could be a component of the AFRL system, it is not part of any current development effort. Policy and standardized procedures are needed to ensure appropriate verification of all TMTI samples prior to the investment in sequencing. PCR, arrays, and classical biochemical tests are examples of potential verification methods. Verification is needed to detect miss-labeled, degraded, mixed or contaminated samples. Regular QC exercises are needed to ensure that the TMTI-funded centers are meeting all standards for producing quality genomic sequence data.« less

  16. Recombinatorial biases and convergent recombination determine interindividual TCRβ sharing in murine thymocytes.

    PubMed

    Li, Hanjie; Ye, Congting; Ji, Guoli; Wu, Xiaohui; Xiang, Zhe; Li, Yuanyue; Cao, Yonghao; Liu, Xiaolong; Douek, Daniel C; Price, David A; Han, Jiahuai

    2012-09-01

    Overlap of TCR repertoires among individuals provides the molecular basis for public T cell responses. By deep-sequencing the TCRβ repertoires of CD4+CD8+ thymocytes from three individual mice, we observed that a substantial degree of TCRβ overlap, comprising ∼10-15% of all unique amino acid sequences and ∼5-10% of all unique nucleotide sequences across any two individuals, is already present at this early stage of T cell development. The majority of TCRβ sharing between individual thymocyte repertoires could be attributed to the process of convergent recombination, with additional contributions likely arising from recombinatorial biases; the role of selection during intrathymic development was negligible. These results indicate that the process of TCR gene recombination is the major determinant of clonotype sharing between individuals.

  17. Evidence for Ancient Origins of Bowman-Birk Inhibitors from Selaginella moellendorffii

    PubMed Central

    James, Amy M.; Jayasena, Achala S.; Zhang, Jingjing; Secco, David; Knott, Gavin J.; Whelan, James

    2017-01-01

    Bowman-Birk Inhibitors (BBIs) are a well-known family of plant protease inhibitors first described 70 years ago. BBIs are known only in the legume (Fabaceae) and cereal (Poaceae) families, but peptides that mimic their trypsin-inhibitory loops exist in sunflowers (Helianthus annuus) and frogs. The disparate biosynthetic origins and distant phylogenetic distribution implies these loops evolved independently, but their structural similarity suggests a common ancestor. Targeted bioinformatic searches for the BBI inhibitory loop discovered highly divergent BBI-like sequences in the seedless, vascular spikemoss Selaginella moellendorffii. Using de novo transcriptomics, we confirmed expression of five transcripts in S. moellendorffii whose encoded proteins share homology with BBI inhibitory loops. The most highly expressed, BBI3, encodes a protein that inhibits trypsin. We needed to mutate two lysine residues to abolish trypsin inhibition, suggesting BBI3’s mechanism of double-headed inhibition is shared with BBIs from angiosperms. As Selaginella belongs to the lycopod plant lineage, which diverged ∼200 to 230 million years before the common ancestor of angiosperms, its BBI-like proteins imply there was a common ancestor for legume and cereal BBIs. Indeed, we discovered BBI sequences in six angiosperm families outside the Fabaceae and Poaceae. These findings provide the evolutionary missing links between the well-known legume and cereal BBI gene families. PMID:28298518

  18. Structures of Bacterial Biosynthetic Arginine Decarboxylases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    F Forouhar; S Lew; J Seetharaman

    2011-12-31

    Biosynthetic arginine decarboxylase (ADC; also known as SpeA) plays an important role in the biosynthesis of polyamines from arginine in bacteria and plants. SpeA is a pyridoxal-5'-phosphate (PLP)-dependent enzyme and shares weak sequence homology with several other PLP-dependent decarboxylases. Here, the crystal structure of PLP-bound SpeA from Campylobacter jejuni is reported at 3.0 {angstrom} resolution and that of Escherichia coli SpeA in complex with a sulfate ion is reported at 3.1 {angstrom} resolution. The structure of the SpeA monomer contains two large domains, an N-terminal TIM-barrel domain followed by a {beta}-sandwich domain, as well as two smaller helical domains. Themore » TIM-barrel and {beta}-sandwich domains share structural homology with several other PLP-dependent decarboxylases, even though the sequence conservation among these enzymes is less than 25%. A similar tetramer is observed for both C. jejuni and E. coli SpeA, composed of two dimers of tightly associated monomers. The active site of SpeA is located at the interface of this dimer and is formed by residues from the TIM-barrel domain of one monomer and a highly conserved loop in the {beta}-sandwich domain of the other monomer. The PLP cofactor is recognized by hydrogen-bonding, {pi}-stacking and van der Waals interactions.« less

  19. Structure of a Spumaretrovirus Gag Central Domain Reveals an Ancient Retroviral Capsid

    PubMed Central

    Dutta, Moumita; Pollard, Dominic J.; Goldstone, David C.; Ramos, Andres; Müllers, Erik; Stirnnagel, Kristin; Stanke, Nicole; Lindemann, Dirk; Taylor, William R.; Rosenthal, Peter B.

    2016-01-01

    The Spumaretrovirinae, or foamy viruses (FVs) are complex retroviruses that infect many species of monkey and ape. Despite little sequence homology, FV and orthoretroviral Gag proteins perform equivalent functions, including genome packaging, virion assembly, trafficking and membrane targeting. However, there is a paucity of structural information for FVs and it is unclear how disparate FV and orthoretroviral Gag molecules share the same function. To probe the functional overlap of FV and orthoretroviral Gag we have determined the structure of a central region of Gag from the Prototype FV (PFV). The structure comprises two all α-helical domains NtDCEN and CtDCEN that although they have no sequence similarity, we show they share the same core fold as the N- (NtDCA) and C-terminal domains (CtDCA) of archetypal orthoretroviral capsid protein (CA). Moreover, structural comparisons with orthoretroviral CA align PFV NtDCEN and CtDCEN with NtDCA and CtDCA respectively. Further in vitro and functional virological assays reveal that residues making inter-domain NtDCEN—CtDCEN interactions are required for PFV capsid assembly and that intact capsid is required for PFV reverse transcription. These data provide the first information that relates the Gag proteins of Spuma and Orthoretrovirinae and suggests a common ancestor for both lineages containing an ancient CA fold. PMID:27829070

  20. Mucilaginibacter pineti sp. nov., isolated from Pinus pinaster wood from a mixed grove of pines trees.

    PubMed

    Paiva, Gabriel; Abreu, Pedro; Proença, Diogo Neves; Santos, Susana; Nobre, Maria Fernanda; Morais, Paula V

    2014-07-01

    Bacterial strain M47C3B(T) was isolated from the endophytic microbial community of a Pinus pinaster tree branch from a mixed grove of pines. Phylogenetic analysis of 16S rRNA gene sequences showed that this organism represented one distinct branch within the family Sphingobacteriaceae, most closely related to the genus Mucilaginibacter. Strain M47C3B(T) formed a distinct lineage, closely related to Mucilaginibacter dorajii KACC 14556(T), with which it shared 97.2% 16S rRNA gene sequence similarity. The other members of the genus Mucilaginibacter included in the same clade were Mucilaginibacter lappiensis ATCC BAA-1855(T) sharing 97.0% similarity and Mucilaginibacter composti TR6-03(T) that had a lower similarity (95.7%). The novel strain was Gram-staining-negative, formed rod-shaped cells, grew optimally at 26 °C and at pH 7, and was able to grow with up to 0.3% (w/v) NaCl. The respiratory quinone was menaquinone 7 (MK-7) and the major fatty acids of the strain were summed feature 3 (C16 : 1ω7c/iso-C15 : 0 2-OH), iso-C15 : 0 and iso-C17 : 0 3-OH, representing 73.5% of the total fatty acids. The major components of the polar lipid profile of strain M47C3B(T) consisted of phosphatidylethanolamine, three unidentified aminophospholipids, one unidentified aminolipid and three unidentified polar lipids. The G+C content of the DNA was 40.6 mol%. On the basis of the phylogenetic analysis and physiological and biochemical characteristics we propose the name Mucilaginibacter pineti sp. nov. for the novel species represented by strain M47C3B(T) ( = CIP 110632(T) = LMG 28160(T)). © 2014 IUMS.

  1. Isolation and Expression Analysis of CYP9A11 and Cytochrome P450 Reductase Gene in the Beet Armyworm (Lepidoptera: Noctuidae)

    PubMed Central

    Zhao, Chunqing; Feng, Xiaoyun; Tang, Tao; Qiu, Lihong

    2015-01-01

    Cytochrome P450 monooxygenases (CYPs), as an enzyme superfamily, is widely distributed in organisms and plays a vital function in the metabolism of exogenous and endogenous compounds by interacting with its obligatory redox partner, CYP reductase (CPR). A novel CYP gene (CYP9A11) and CPR gene from the agricultural pest insect Spodoptera exigua were cloned and characterized. The complete cDNA sequences of SeCYP9A11 and SeCPR are 1,931 and 3,919 bp in length, respectively, and contain open reading frames of 1,593 and 2,070 nucleotides, respectively. Analysis of the putative protein sequences indicated that SeCYP9A11 contains a heme-binding domain and the unique characteristic sequence (SRFALCE) of the CYP9 family, in addition to a signal peptide and transmembrane segment at the N-terminal. Alignment analysis revealed that SeCYP9A11 shares the highest sequence similarity with CYP9A13 from Mamestra brassicae, which is 66.54%. The putative protein sequence of SeCPR has all of the classical CPR features, such as an N-terminal membrane anchor; three conserved domain flavin adenine dinucleotide (FAD), flavin mononucleotide (FMN), and nicotinamide adenine dinucleotide phosphate (NADPH) domain; and characteristic binding motifs. Phylogenetic analysis revealed that SeCPR shares the highest identity with HaCPR, which is 95.21%. The SeCYP9A11 and SeCPR genes were detected in the midgut, fat body, and cuticle tissues, and throughout all of the developmental stages of S. exigua. The mRNA levels of SeCYP9A11 and SeCPR decreased remarkably after exposure to plant secondary metabolites quercetin and tannin. The results regarding SeCYP9A11 and SeCPR genes in the current study provide foundation for the further study of S. exigua P450 system. PMID:26320261

  2. Extraordinary Sequence Divergence at Tsga8, an X-linked Gene Involved in Mouse Spermiogenesis

    PubMed Central

    Good, Jeffrey M.; Vanderpool, Dan; Smith, Kimberly L.; Nachman, Michael W.

    2011-01-01

    The X chromosome plays an important role in both adaptive evolution and speciation. We used a molecular evolutionary screen of X-linked genes potentially involved in reproductive isolation in mice to identify putative targets of recurrent positive selection. We then sequenced five very rapidly evolving genes within and between several closely related species of mice in the genus Mus. All five genes were involved in male reproduction and four of the genes showed evidence of recurrent positive selection. The most remarkable evolutionary patterns were found at Testis-specific gene a8 (Tsga8), a spermatogenesis-specific gene expressed during postmeiotic chromatin condensation and nuclear transformation. Tsga8 was characterized by extremely high levels of insertion–deletion variation of an alanine-rich repetitive motif in natural populations of Mus domesticus and M. musculus, differing in length from the reference mouse genome by up to 89 amino acids (27% of the total protein length). This population-level variation was coupled with striking divergence in protein sequence and length between closely related mouse species. Although no clear orthologs had previously been described for Tsga8 in other mammalian species, we have identified a highly divergent hypothetical gene on the rat X chromosome that shares clear orthology with the 5′ and 3′ ends of Tsga8. Further inspection of this ortholog verified that it is expressed in rat testis and shares remarkable similarity with mouse Tsga8 across several general features of the protein sequence despite no conservation of nucleotide sequence across over 60% of the rat-coding domain. Overall, Tsga8 appears to be one of the most rapidly evolving genes to have been described in rodents. We discuss the potential evolutionary causes and functional implications of this extraordinary divergence and the possible contribution of Tsga8 and the other four genes we examined to reproductive isolation in mice. PMID:21186189

  3. Characterization of shark complement factor I gene(s): genomic analysis of a novel shark-specific sequence.

    PubMed

    Shin, Dong-Ho; Webb, Barbara M; Nakao, Miki; Smith, Sylvia L

    2009-07-01

    Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and -d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (

  4. Characterization of shark complement factor I gene(s): genomic analysis of a novel shark-specific sequence

    PubMed Central

    Shin, Dong-Ho; Webb, Barbara M.; Nakao, Miki; Smith, Sylvia L.

    2009-01-01

    Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and –d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (≤) amino acid identities with each other, 35.4 ~ 39.6% and 62.8 ~ 65.9% with factor I of mammals and banded houndshark (Triakis scyllium), respectively. The modular structure of the GcIf is similar to that of mammals with one notable exception, the presence of a novel shark-specific sequence between the leader peptide (LP) and the factor I membrane attack complex (FIMAC) domain. The cDNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1, 2 and 3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082 bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent. PMID:19423168

  5. HMMerThread: detecting remote, functional conserved domains in entire genomes by combining relaxed sequence-database searches with fold recognition.

    PubMed

    Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine

    2011-03-10

    Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak sequence similarity. Our predictions open up new avenues for biological and medical studies. Genome-wide HMMerThread domains are available at http://vm1-hmmerthread.age.mpg.de.

  6. HMMerThread: Detecting Remote, Functional Conserved Domains in Entire Genomes by Combining Relaxed Sequence-Database Searches with Fold Recognition

    PubMed Central

    Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine

    2011-01-01

    Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak sequence similarity. Our predictions open up new avenues for biological and medical studies. Genome-wide HMMerThread domains are available at http://vm1-hmmerthread.age.mpg.de. PMID:21423752

  7. Helical Antifreeze Proteins Have Independently Evolved in Fishes on Four Occasions

    PubMed Central

    Graham, Laurie A.; Hobbs, Rod S.; Fletcher, Garth L.; Davies, Peter L.

    2013-01-01

    Alanine-rich α-helical (type I) antifreeze proteins (AFPs) are produced by a variety of fish species from three different orders to protect against freezing in icy seawater. Interspersed amongst and within these orders are fishes making AFPs that are completely different in both sequence and structure. The origin of this variety of types I, II, III and antifreeze glycoproteins (AFGPs) has been attributed to adaptation following sea-level glaciations that occurred after the divergence of most of the extant families of fish. The presence of similar types of AFPs in distantly related fishes has been ascribed to lateral gene transfer in the case of the structurally complex globular type II lectin-like AFPs and to convergent evolution for the AFGPs, which consist of a well-conserved tripeptide repeat. In this paper, we examine the genesis of the type I AFPs, which are intermediate in complexity. These predominantly α-helical peptides share many features, such as putative capping structures, Ala-richness and amphipathic character. We have added to the type I repertoire by cloning additional sequences from sculpin and have found that the similarities between the type I AFPs of the four distinct groups of fishes are not borne out at the nucleotide level. Both the non-coding sequences and the codon usage patterns are strikingly different. We propose that these AFPs arose via convergence from different progenitor helices with a weak affinity for ice and that their similarity is dictated by the propensity of specific amino acids to form helices and to align water on one side of the helix into an ice-like pattern. PMID:24324684

  8. Comparative analysis of tandem repeats from hundreds of species reveals unique insights into centromere evolution.

    PubMed

    Melters, Daniël P; Bradnam, Keith R; Young, Hugh A; Telis, Natalie; May, Michael R; Ruby, J Graham; Sebra, Robert; Peluso, Paul; Eid, John; Rank, David; Garcia, José Fernando; DeRisi, Joseph L; Smith, Timothy; Tobias, Christian; Ross-Ibarra, Jeffrey; Korf, Ian; Chan, Simon W L

    2013-01-30

    Centromeres are essential for chromosome segregation, yet their DNA sequences evolve rapidly. In most animals and plants that have been studied, centromeres contain megabase-scale arrays of tandem repeats. Despite their importance, very little is known about the degree to which centromere tandem repeats share common properties between different species across different phyla. We used bioinformatic methods to identify high-copy tandem repeats from 282 species using publicly available genomic sequence and our own data. Our methods are compatible with all current sequencing technologies. Long Pacific Biosciences sequence reads allowed us to find tandem repeat monomers up to 1,419 bp. We assumed that the most abundant tandem repeat is the centromere DNA, which was true for most species whose centromeres have been previously characterized, suggesting this is a general property of genomes. High-copy centromere tandem repeats were found in almost all animal and plant genomes, but repeat monomers were highly variable in sequence composition and length. Furthermore, phylogenetic analysis of sequence homology showed little evidence of sequence conservation beyond approximately 50 million years of divergence. We find that despite an overall lack of sequence conservation, centromere tandem repeats from diverse species showed similar modes of evolution. While centromere position in most eukaryotes is epigenetically determined, our results indicate that tandem repeats are highly prevalent at centromeres of both animal and plant genomes. This suggests a functional role for such repeats, perhaps in promoting concerted evolution of centromere DNA across chromosomes.

  9. Comparative analysis of tandem repeats from hundreds of species reveals unique insights into centromere evolution

    PubMed Central

    2013-01-01

    Background Centromeres are essential for chromosome segregation, yet their DNA sequences evolve rapidly. In most animals and plants that have been studied, centromeres contain megabase-scale arrays of tandem repeats. Despite their importance, very little is known about the degree to which centromere tandem repeats share common properties between different species across different phyla. We used bioinformatic methods to identify high-copy tandem repeats from 282 species using publicly available genomic sequence and our own data. Results Our methods are compatible with all current sequencing technologies. Long Pacific Biosciences sequence reads allowed us to find tandem repeat monomers up to 1,419 bp. We assumed that the most abundant tandem repeat is the centromere DNA, which was true for most species whose centromeres have been previously characterized, suggesting this is a general property of genomes. High-copy centromere tandem repeats were found in almost all animal and plant genomes, but repeat monomers were highly variable in sequence composition and length. Furthermore, phylogenetic analysis of sequence homology showed little evidence of sequence conservation beyond approximately 50 million years of divergence. We find that despite an overall lack of sequence conservation, centromere tandem repeats from diverse species showed similar modes of evolution. Conclusions While centromere position in most eukaryotes is epigenetically determined, our results indicate that tandem repeats are highly prevalent at centromeres of both animal and plant genomes. This suggests a functional role for such repeats, perhaps in promoting concerted evolution of centromere DNA across chromosomes. PMID:23363705

  10. Shared prefetching to reduce execution skew in multi-threaded systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eichenberger, Alexandre E; Gunnels, John A

    Mechanisms are provided for optimizing code to perform prefetching of data into a shared memory of a computing device that is shared by a plurality of threads that execute on the computing device. A memory stream of a portion of code that is shared by the plurality of threads is identified. A set of prefetch instructions is distributed across the plurality of threads. Prefetch instructions are inserted into the instruction sequences of the plurality of threads such that each instruction sequence has a separate sub-portion of the set of prefetch instructions, thereby generating optimized code. Executable code is generated basedmore » on the optimized code and stored in a storage device. The executable code, when executed, performs the prefetches associated with the distributed set of prefetch instructions in a shared manner across the plurality of threads.« less

  11. The mitochondrial genome of the gymnosperm Cycas taitungensis contains a novel family of short interspersed elements, Bpu sequences, and abundant RNA editing sites.

    PubMed

    Chaw, Shu-Miaw; Shih, Arthur Chun-Chieh; Wang, Daryi; Wu, Yu-Wei; Liu, Shu-Mei; Chou, The-Yuan

    2008-03-01

    The mtDNA of Cycas taitungensis is a circular molecule of 414,903 bp, making it 2- to 6-fold larger than the known mtDNAs of charophytes and bryophytes, but similar to the average of 7 elucidated angiosperm mtDNAs. It is characterized by abundant RNA editing sites (1,084), more than twice the number found in the angiosperm mtDNAs. The A + T content of Cycas mtDNA is 53.1%, the lowest among known land plants. About 5% of the Cycas mtDNA is composed of a novel family of mobile elements, which we designated as "Bpu sequences." They share a consensus sequence of 36 bp with 2 terminal direct repeats (AAGG) and a recognition site for the Bpu 10I restriction endonuclease (CCTGAAGC). Comparison of the Cycas mtDNA with other plant mtDNAs revealed many new insights into the biology and evolution of land plant mtDNAs. For example, the noncoding sequences in mtDNAs have drastically expanded as land plants have evolved, with abrupt increases appearing in the bryophytes, and then in the seed plants. As a result, the genomic organizations of seed plant mtDNAs are much less compact than in other plants. Also, the Cycas mtDNA appears to have been exempted from the frequent gene loss observed in angiosperm mtDNAs. Similar to the angiosperms, the 3 Cycas genes nad1, nad2, and nad5 are disrupted by 5 group II intron squences, which have brought the genes into trans-splicing arrangements. The evolutionary origin and invasion/duplication mechanism of the Bpu sequences in Cycas mtDNA are hypothesized and discussed.

  12. Characterization of full genome sequences of chicken anemia viruses circulating in Egypt reveals distinct genetic diversity and evidence of recombination.

    PubMed

    Erfan, Ahmed M; Selim, Abdullah A; Naguib, Mahmoud M

    2018-06-02

    Chicken anemia virus (CAV) is one of the commercially important diseases of poultry worldwide. In Egypt, CAV has been reported to be a potential threat to the commercial poultry sectors. Hence, this study was aimed at isolation and full genomic analysis of CAVs circulating in chicken populations in different geographical location in Egypt. A total of 42 samples were collected from broiler chicken flocks in 9 governorates in Egypt from 12 to 42 days of age. The mortality rate observed among chickens was ranging from 3% to 22%. Nineteen out of 42 farms were found positive for the CAV genome by polymerase chain reaction (PCR). Full genome sequencing was conducted for 18 positive samples. Genetic analysis revealed a high similarity of >99% in 11 viruses with the vaccine strain Del-Ros; while the other seven samples shared close similarity to CAV field strains isolated from China, Taiwan, and Brazil. The data also indicated Q139 and Q144 amino acids substitutions among the VP1 of Egyptian field strains, which are known to be important in virus replication and spread. Phylogenetic analysis of the sequenced viruses (n = 18) based on either the full gene nucleotide sequence or VP1 coding sequence, suggested the circulation of four distinct genotypes in Egypt designated as group A, B, C and D. Moreover, evidence of recombination was detected among four Egyptian CAVs located within group A. The findings of this study succeeded to elucidate the epidemiological and genetic features of CAVs circulating in Egypt, and underscores the important of CAVs surveillance. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Circular replication-associated protein encoding DNA viruses identified in the faecal matter of various animals in New Zealand.

    PubMed

    Steel, Olivia; Kraberger, Simona; Sikorski, Alyssa; Young, Laura M; Catchpole, Ryan J; Stevens, Aaron J; Ladley, Jenny J; Coray, Dorien S; Stainton, Daisy; Dayaram, Anisha; Julian, Laurel; van Bysterveldt, Katherine; Varsani, Arvind

    2016-09-01

    In recent years, innovations in molecular techniques and sequencing technologies have resulted in a rapid expansion in the number of known viral sequences, in particular those with circular replication-associated protein (Rep)-encoding single-stranded (CRESS) DNA genomes. CRESS DNA viruses are present in the virome of many ecosystems and are known to infect a wide range of organisms. A large number of the recently identified CRESS DNA viruses cannot be classified into any known viral families, indicating that the current view of CRESS DNA viral sequence space is greatly underestimated. Animal faecal matter has proven to be a particularly useful source for sampling CRESS DNA viruses in an ecosystem, as it is cost-effective and non-invasive. In this study a viral metagenomic approach was used to explore the diversity of CRESS DNA viruses present in the faeces of domesticated and wild animals in New Zealand. Thirty-eight complete CRESS DNA viral genomes and two circular molecules (that may be defective molecules or single components of multicomponent genomes) were identified from forty-nine individual animal faecal samples. Based on shared genome organisations and sequence similarities, eighteen of the isolates were classified as gemycircularviruses and twelve isolates were classified as smacoviruses. The remaining eight isolates lack significant sequence similarity with any members of known CRESS DNA virus groups. This research adds significantly to our knowledge of CRESS DNA viral diversity in New Zealand, emphasising the prevalence of CRESS DNA viruses in nature, and reinforcing the suggestion that a large proportion of CRESS DNA viruses are yet to be identified. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Diversity in VP3, NSP3, and NSP4 of rotavirus B detected from Japanese cattle.

    PubMed

    Hayashi-Miyamoto, Michiko; Murakami, Toshiaki; Minami-Fukuda, Fujiko; Tsuchiaka, Shinobu; Kishimoto, Mai; Sano, Kaori; Naoi, Yuki; Asano, Keigo; Ichimaru, Toru; Haga, Kei; Omatsu, Tsutomu; Katayama, Yukie; Oba, Mami; Aoki, Hiroshi; Shirai, Junsuke; Ishida, Motohiko; Katayama, Kazuhiko; Mizutani, Tetsuya; Nagai, Makoto

    2017-04-01

    Bovine rotavirus B (RVB) is an etiological agent of diarrhea mostly in adult cattle. Currently, a few sequences of viral protein (VP)1, 2, 4, 6, and 7 and nonstructural protein (NSP)1, 2, and 5 of bovine RVB are available in the DDBJ/EMBL/GenBank databases, and none have been reported for VP3, NSP3, and NSP4. In order to fill this gap in the genetic characterization of bovine RVB strains, we used a metagenomics approach and sequenced and analyzed the complete coding sequences (CDS) of VP3, NSP3, and NSP4 genes, as well as the partial or complete CDS of other genes of RVBs detected from Japanese cattle. VP3, NSP3, and NSP4 of bovine RVBs shared low nucleotide sequence identities (63.3-64.9% for VP3, 65.9-68.2% for NSP3, and 52.6-56.2% for NSP4) with those of murine, human, and porcine RVBs, suggesting that bovine RVBs belong to a novel genotype. Furthermore, significantly low amino acid sequence identities were observed for NSP4 (36.1-39.3%) between bovine RVBs and the RVBs of other species. In contrast, hydrophobic plot analysis of NSP4 revealed profiles similar to those of RVBs of other species and rotavirus A (RVA) strains. Phylogenetic analyses of all gene segments revealed that bovine RVB strains formed a cluster that branched distantly from other RVBs. These results suggest that bovine RVBs have evolved independently from other RVBs but in a similar manner to other rotaviruses. These findings provide insights into the evolution and diversity of RVB strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-08-01

    The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.

  16. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    PubMed

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  17. Detection of porcine circovirus type 2 in pigs imported from Indonesia.

    PubMed

    Manokaran, Gayathri; Lin, Yueh-Nuo; Soh, Moi-Lien; Lim, Elizabeth Ai-Sim; Lim, Chee-Wee; Tan, Boon-Huan

    2008-11-25

    We have detected the presence of porcine circovirus (PCV) type 2 in Indonesian pigs imported to Singapore for food consumption. A total of three viral isolates were identified, and to genetically characterise them further, their full genomes were sequenced. Each genome showed a typical organization of PCV type 2, with the three isolates sharing similar genome lengths of 1767 nucleotide (nt) at high nt identities of 99.8-100%, further indicating that the viral isolates were quite homogeneous. Sequence analysis further revealed that the ORF2 genes contain the nt sequence CCCCGC (from nt position 262 to 267) that was previously reported to be associated with PCV type 2, group 1C. The phylogenetic tree was constructed for the ORF2 genes, and the PCV type 2 isolates distributed into two distinctive groups. The Indonesian PCV type 2 clustered tightly with one China isolate, accession number AY035820, as a sub-cluster in group 1C. The sequence and phylogenetic analyses both confirmed that the three Indonesian PCV type 2 isolates belong to group 1C, and that the genetic changes for the three Indonesian isolates were very stable, possibly due to the low-scale evolution.

  18. Polypeptide p41 of a Norwalk-Like Virus Is a Nucleic Acid-Independent Nucleoside Triphosphatase

    PubMed Central

    Pfister, Thomas; Wimmer, Eckard

    2001-01-01

    Southampton virus (SHV) is a member of the Norwalk-like viruses (NLVs), one of four genera of the family Caliciviridae. The genome of SHV contains three open reading frames (ORFs). ORF 1 encodes a polyprotein that is autocatalytically processed into six proteins, one of which is p41. p41 shares sequence motifs with protein 2C of picornaviruses and superfamily 3 helicases. We have expressed p41 of SHV in bacteria. Purified p41 exhibited nucleoside triphosphate (NTP)-binding and NTP hydrolysis activities. The NTPase activity was not stimulated by single-stranded nucleic acids. SHV p41 had no detectable helicase activity. Protein sequence comparison between the consensus sequences of NLV p41 and enterovirus protein 2C revealed regions of high similarity. According to secondary structure prediction, the conserved regions were located within a putative central domain of alpha helices and beta strands. This study reveals for the first time an NTPase activity associated with a calicivirus-encoded protein. Based on enzymatic properties and sequence information, a functional relationship between NLV p41 and enterovirus 2C is discussed in regard to the role of 2C-like proteins in virus replication. PMID:11160659

  19. Electron microscopic analysis and structural characterization of novel NADP(H)-containing methanol: N,N'-dimethyl-4-nitrosoaniline oxidoreductases from the gram-positive methylotrophic bacteria Amycolatopsis methanolica and Mycobacterium gastri MB19.

    PubMed Central

    Bystrykh, L V; Vonck, J; van Bruggen, E F; van Beeumen, J; Samyn, B; Govorukhina, N I; Arfman, N; Duine, J A; Dijkhuizen, L

    1993-01-01

    The quaternary protein structure of two methanol:N,N'-dimethyl-4-nitrosoaniline (NDMA) oxidoreductases purified from Amycolatopsis methanolica and Mycobacterium gastri MB19 was analyzed by electron microscopy and image processing. The enzymes are decameric proteins (displaying fivefold symmetry) with estimated molecular masses of 490 to 500 kDa based on their subunit molecular masses of 49 to 50 kDa. Both methanol:NDMA oxidoreductases possess a tightly but noncovalently bound NADP(H) cofactor at an NADPH-to-subunit molar ratio of 0.7. These cofactors are redox active toward alcohol and aldehyde substrates. Both enzymes contain significant amounts of Zn2+ and Mg2+ ions. The primary amino acid sequences of the A. methanolica and M. gastri MB19 methanol:NDMA oxidoreductases share a high degree of identity, as indicated by N-terminal sequence analysis (63% identity among the first 27 N-terminal amino acids), internal peptide sequence analysis, and overall amino acid composition. The amino acid sequence analysis also revealed significant similarity to a decameric methanol dehydrogenase of Bacillus methanolicus C1. Images PMID:8449887

  20. Arpeggio: harmonic compression of ChIP-seq data reveals protein-chromatin interaction signatures

    PubMed Central

    Stanton, Kelly Patrick; Parisi, Fabio; Strino, Francesco; Rabin, Neta; Asp, Patrik; Kluger, Yuval

    2013-01-01

    Researchers generating new genome-wide data in an exploratory sequencing study can gain biological insights by comparing their data with well-annotated data sets possessing similar genomic patterns. Data compression techniques are needed for efficient comparisons of a new genomic experiment with large repositories of publicly available profiles. Furthermore, data representations that allow comparisons of genomic signals from different platforms and across species enhance our ability to leverage these large repositories. Here, we present a signal processing approach that characterizes protein–chromatin interaction patterns at length scales of several kilobases. This allows us to efficiently compare numerous chromatin-immunoprecipitation sequencing (ChIP-seq) data sets consisting of many types of DNA-binding proteins collected from a variety of cells, conditions and organisms. Importantly, these interaction patterns broadly reflect the biological properties of the binding events. To generate these profiles, termed Arpeggio profiles, we applied harmonic deconvolution techniques to the autocorrelation profiles of the ChIP-seq signals. We used 806 publicly available ChIP-seq experiments and showed that Arpeggio profiles with similar spectral densities shared biological properties. Arpeggio profiles of ChIP-seq data sets revealed characteristics that are not easily detected by standard peak finders. They also allowed us to relate sequencing data sets from different genomes, experimental platforms and protocols. Arpeggio is freely available at http://sourceforge.net/p/arpeggio/wiki/Home/. PMID:23873955

  1. Arpeggio: harmonic compression of ChIP-seq data reveals protein-chromatin interaction signatures.

    PubMed

    Stanton, Kelly Patrick; Parisi, Fabio; Strino, Francesco; Rabin, Neta; Asp, Patrik; Kluger, Yuval

    2013-09-01

    Researchers generating new genome-wide data in an exploratory sequencing study can gain biological insights by comparing their data with well-annotated data sets possessing similar genomic patterns. Data compression techniques are needed for efficient comparisons of a new genomic experiment with large repositories of publicly available profiles. Furthermore, data representations that allow comparisons of genomic signals from different platforms and across species enhance our ability to leverage these large repositories. Here, we present a signal processing approach that characterizes protein-chromatin interaction patterns at length scales of several kilobases. This allows us to efficiently compare numerous chromatin-immunoprecipitation sequencing (ChIP-seq) data sets consisting of many types of DNA-binding proteins collected from a variety of cells, conditions and organisms. Importantly, these interaction patterns broadly reflect the biological properties of the binding events. To generate these profiles, termed Arpeggio profiles, we applied harmonic deconvolution techniques to the autocorrelation profiles of the ChIP-seq signals. We used 806 publicly available ChIP-seq experiments and showed that Arpeggio profiles with similar spectral densities shared biological properties. Arpeggio profiles of ChIP-seq data sets revealed characteristics that are not easily detected by standard peak finders. They also allowed us to relate sequencing data sets from different genomes, experimental platforms and protocols. Arpeggio is freely available at http://sourceforge.net/p/arpeggio/wiki/Home/.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osipiuk, J.; Gornicki, P.; Maj, L.

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Angstroms. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Angstroms from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer {alpha}/{beta} sandwich with the overall shape of a cylinder and shows no structural homology to proteins of knownmore » structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the {alpha}-{beta} plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.« less

  3. An archaebacterial homologue of the essential eubacterial cell division protein FtsZ.

    PubMed

    Baumann, P; Jackson, S P

    1996-06-25

    Life falls into three fundamental domains--Archaea, Bacteria, and Eucarya (formerly archaebacteria, eubacteria, and eukaryotes,. respectively). Though Archaea lack nuclei and share many morphological features with Bacteria, molecular analyses, principally of the transcription and translation machineries, have suggested that Archaea are more related to Eucarya than to Bacteria. Currently, little is known about the archaeal cell division apparatus. In Bacteria, a crucial component of the cell division machinery is FtsZ, a GTPase that localizes to a ring at the site of septation. Interestingly, FtsZ is distantly related in sequence to eukaryotic tubulins, which also interact with GTP and are components of the eukaryotic cell cytoskeleton. By screening for the ability to bind radiolabeled nucleotides, we have identified a protein of the hyperthermophilic archaeon Pyrococcus woesei that interacts tightly and specifically with GTP. Furthermore, through screening an expression library of P. woesei genomic DNA, we have cloned the gene encoding this protein. Sequence comparisons reveal that the P. woesei GTP-binding protein is strikingly related in sequence to eubacterial FtsZ and is marginally more similar to eukaryotic tubulins than are bacterial FtsZ proteins. Phylogenetic analyses reinforce the notion that there is an evolutionary linkage between FtsZ and tubulins. These findings suggest that the archaeal cell division apparatus may be fundamentally similar to that of Bacteria and lead us to consider the evolutionary relationships between Archaea, Bacteria, and Eucarya.

  4. Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.

    PubMed

    Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A

    2001-11-01

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

  5. A plant natriuretic peptide-like gene in the bacterial pathogen Xanthomonas axonopodis may induce hyper-hydration in the plant host: a hypothesis of molecular mimicry.

    PubMed

    Nembaware, Victoria; Seoighe, Cathal; Sayed, Muhammed; Gehring, Chris

    2004-03-24

    Plant natriuretic peptides (PNPs) are systemically mobile molecules that regulate homeostasis at nanomolar concentrations. PNPs are up-regulated under conditions of osmotic stress and PNP-dependent processes include changes in ion transport and increases of H2O uptake into protoplasts and whole tissue. The bacterial citrus pathogen Xanthomonas axonopodis pv. Citri str. 306 contains a gene encoding a PNP-like protein. We hypothesise that this bacterial protein can alter plant cell homeostasis and thus is likely to represent an example of molecular mimicry that enables the pathogen to manipulate plant responses in order to bring about conditions favourable to the pathogen such as the induced plant tissue hyper-hydration seen in the wet edged lesions associated with Xanthomonas axonopodis infection. We found a Xanthomonas axonopodis PNP-like protein that shares significant sequence similarity and identical domain organisation with PNPs. We also observed a significant excess of conserved residues between the two proteins within the domain previously identified as being sufficient to induce biological activity. Structural modelling predicts identical six stranded double-psi beta barrel folds for both proteins thus supporting the hypothesis of similar modes of action. No significant similarity between the Xanthomonas axonopodis protein and other bacterial proteins from GenBank was found. Sequence similarity of the Xanthomonas axonopodis PNP-like protein with the Arabidopsis thaliana PNP (AtPNP-A), shared domain organisation and incongruent phylogeny suggest that the PNP-gene may have been acquired by the bacteria in an ancient lateral gene transfer event. Finally, activity of a recombinant Xanthomonas axonopodis protein in plant tissue and changes in symptoms induced by a Xanthomonas axonopodis mutant with a knocked-out PNP-like gene will be experimental proof of molecular mimicry. If the hypothesis is true, it could at least in part explain why the citrus pathogen Xanthomonas campestris that does not contain a PNP-like gene produces dry corky lesions while the closely related Xanthomonas axonopodis forms lesions with wet edges. It also suggests that genes typically found in the host, horizontally transferred or heterologous, can help to explain aspects of the physiology of the host-pathogen interactions.

  6. Spiroplasma species share common DNA sequences among their viruses, plasmids and genomes.

    PubMed

    Ranhand, J M; Nur, I; Rose, D L; Tully, J G

    1987-01-01

    Alkaline-Southern-blot analyses showed that a spiroplasma plasmid, pRA1, obtained from Spiroplasma citri (Maroc-R8A2), contained DNA sequences that were homologous to spiroplasma type 3 viruses (SV3) obtained from S. citri (Maroc-R8A2), S. citri (608) and S. mirum (SMCA). In addition, pRA1 and SV3(608) DNA shared common, but not necessarily related, sequences with extrachromosomal DNA derived from 11 Spiroplasma species or strains. Furthermore, SV3(608) had DNA homology with the chromosome from 6 distinct spiroplasmas but not with chromosomal DNA from eight other Spiroplasma species or strains. The biological function of these common sequences is unknown.

  7. Complete genome analysis of jasmine virus T from Jasminum sambac in China.

    PubMed

    Tang, Yajun; Gao, Fangluan; Yang, Zhen; Wu, Zujian; Yang, Liang

    2016-07-01

    The genome of a potyvirus (isolate JaVT_FZ) recovered from jasmine (Jasminum sambac L.) showing yellow ringspot symptoms in Fuzhou, China, was sequenced. JaVT_FZ is closely related to seven other potyviruses with completely sequenced genomes, with which it shares 66-70 % nucleotide and 52-56 % amino acid sequence identity. However, the coat protein (CP) gene shares 82-92 % nucleotide and 90-97 % amino acid sequence identity with those of two partially sequenced potyviruses, named jasmine potyvirus T (JaVT-jasmine) and jasmine yellow mosaic potyvirus (JaYMV-India), respectively. This suggests that JaVT_FZ, JaVT-jasmine and JaYMV-India should be regarded as members of a single potyvirus species, for which the name "Jasmine virus T" has priority.

  8. Sequence and phylogenetic analyses of novel totivirus-like double-stranded RNAs from field-collected powdery mildew fungi.

    PubMed

    Kondo, Hideki; Hisano, Sakae; Chiba, Sotaro; Maruyama, Kazuyuki; Andika, Ida Bagus; Toyoda, Kazuhiro; Fujimori, Fumihiro; Suzuki, Nobuhiro

    2016-02-02

    The identification of mycoviruses contributes greatly to understanding of the diversity and evolutionary aspects of viruses. Powdery mildew fungi are important and widely studied obligate phytopathogenic agents, but there has been no report on mycoviruses infecting these fungi. In this study, we used a deep sequencing approach to analyze the double-stranded RNA (dsRNA) segments isolated from field-collected samples of powdery mildew fungus-infected red clover plants in Japan. Database searches identified the presence of at least ten totivirus (genus Totivirus)-like sequences, termed red clover powdery mildew-associated totiviruses (RPaTVs). The majority of these sequences shared moderate amino acid sequence identity with each other (<44%) and with other known totiviruses (<59%). Nine of these identified sequences (RPaTV1a, 1b and 2-8) resembled the genome of the prototype totivirus, Saccharomyces cerevisiae virus-L-A (ScV-L-A) in that they contained two overlapping open reading frames (ORFs) encoding a putative coat protein (CP) and an RNA dependent RNA polymerase (RdRp), while one sequence (RPaTV9) showed similarity to another totivirus, Ustilago maydis virus H1 (UmV-H1) that encodes a single polyprotein (CP-RdRp fusion). Similar to yeast totiviruses, each ScV-L-A-like RPaTV contains a -1 ribosomal frameshift site downstream of a predicted pseudoknot structure in the overlapping region of these ORFs, suggesting that the RdRp is translated as a CP-RdRp fusion. Moreover, several ScV-L-A-like sequences were also found by searches of the transcriptome shotgun assembly (TSA) libraries from rust fungi, plants and insects. Phylogenetic analyses show that nine ScV-L-A-like RPaTVs along with ScV-L-A-like sequences derived from TSA libraries are clustered with most established members of the genus Totivirus, while one RPaTV forms a new distinct clade with UmV-H1, possibly establishing an additional genus in the family. Taken together, our results indicate the presence of diverse, novel totiviruses in the powdery mildew fungus populations infecting red clover plants in the field. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Description of Leifsonia kafniensis sp. nov. and Leifsonia antarctica sp. nov.

    PubMed

    Pindi, Pavan Kumar; Kishore, K Hara; Reddy, G S N; Shivaji, S

    2009-06-01

    Strains KFC-22(T) and SPC-20(T) are yellow-pigmented, Gram-positive, aerobic, non-motile, rod-shaped bacteria that were isolated from a soil sample near the Kafni glacier in the Himalayan mountain ranges in India, and from a spade core sediment sample from the Antarctic Ocean at Larsemann Hill, respectively. In both cases, the cell-wall peptidoglycan contained 2,4-diaminobutyric acid as the diamino acid, anteiso-C(15 : 0), anteiso-C(17 : 0) and iso-C(16 : 0) were the predominant fatty acids and MK-11 was the major isoprenoid quinone in the cell membrane. On the basis of the above-mentioned characteristics, both strains can be assigned to the genus Leifsonia. The strains share 16S rRNA gene sequence similarity of 97.7 % and DNA relatedness of only 10 %, indicating that they represent different species. A blast analysis indicated that Leifsonia pindariensis PON10(T) was the closest phylogenetic neighbour of strains SPC-20(T) and KFC-22(T), showing 16S rRNA gene sequence similarities of 97.3 and 97.7 %, respectively. However, at the whole-genome level, strains KFC-22(T) and SPC-20(T) shared 42 and 11 % DNA-DNA relatedness, respectively, with L. pindariensis PON10(T). In addition, both strains exhibited several phenotypic differences with respect to L. pindariensis PON10(T). Thus, on the basis of the differences that the two strains exhibited with respect to L. pindariensis, both were identified as representing novel species of the genus Leifsonia, for which the names Leifsonia kafniensis sp. nov. (type strain KFC-22(T) =NCCB 100216(T) =LMG 24362(T)) and Leifsonia antarctica sp. nov. (type strain SPC-20(T) =NCCB 100227(T) =LMG 24541(T)) are proposed.

  10. Single-Cell RNA Sequencing Reveals Expanded Clones of Islet Antigen-Reactive CD4+ T Cells in Peripheral Blood of Subjects with Type 1 Diabetes.

    PubMed

    Cerosaletti, Karen; Barahmand-Pour-Whitman, Fariba; Yang, Junbao; DeBerg, Hannah A; Dufort, Matthew J; Murray, Sara A; Israelsson, Elisabeth; Speake, Cate; Gersuk, Vivian H; Eddy, James A; Reijonen, Helena; Greenbaum, Carla J; Kwok, William W; Wambre, Erik; Prlic, Martin; Gottardo, Raphael; Nepom, Gerald T; Linsley, Peter S

    2017-07-01

    The significance of islet Ag-reactive T cells found in peripheral blood of type 1 diabetes (T1D) subjects is unclear, partly because similar cells are also found in healthy control (HC) subjects. We hypothesized that key disease-associated cells would show evidence of prior Ag exposure, inferred from expanded TCR clonotypes, and essential phenotypic properties in their transcriptomes. To test this, we developed single-cell RNA sequencing procedures for identifying TCR clonotypes and transcript phenotypes in individual T cells. We applied these procedures to analysis of islet Ag-reactive CD4 + memory T cells from the blood of T1D and HC individuals after activation with pooled immunodominant islet peptides. We found extensive TCR clonotype sharing in Ag-activated cells, especially from individual T1D subjects, consistent with in vivo T cell expansion during disease progression. The expanded clonotype from one T1D subject was detected at repeat visits spanning >15 mo, demonstrating clonotype stability. Notably, we found no clonotype sharing between subjects, indicating a predominance of "private" TCR specificities. Expanded clones from two T1D subjects recognized distinct IGRP peptides, implicating this molecule as a trigger for CD4 + T cell expansion. Although overall transcript profiles of cells from HC and T1D subjects were similar, profiles from the most expanded clones were distinctive. Our findings demonstrate that islet Ag-reactive CD4 + memory T cells with unique Ag specificities and phenotypes are expanded during disease progression and can be detected by single-cell analysis of peripheral blood. Copyright © 2017 by The American Association of Immunologists, Inc.

  11. Cofactor-binding sites in proteins of deviating sequence: comparative analysis and clustering in torsion angle, cavity, and fold space.

    PubMed

    Stegemann, Björn; Klebe, Gerhard

    2012-02-01

    Small molecules are recognized in protein-binding pockets through surface-exposed physicochemical properties. To optimize binding, they have to adopt a conformation corresponding to a local energy minimum within the formed protein-ligand complex. However, their conformational flexibility makes them competent to bind not only to homologous proteins of the same family but also to proteins of remote similarity with respect to the shape of the binding pockets and folding pattern. Considering drug action, such observations can give rise to unexpected and undesired cross reactivity. In this study, datasets of six different cofactors (ADP, ATP, NAD(P)(H), FAD, and acetyl CoA, sharing an adenosine diphosphate moiety as common substructure), observed in multiple crystal structures of protein-cofactor complexes exhibiting sequence identity below 25%, have been analyzed for the conformational properties of the bound ligands, the distribution of physicochemical properties in the accommodating protein-binding pockets, and the local folding patterns next to the cofactor-binding site. State-of-the-art clustering techniques have been applied to group the different protein-cofactor complexes in the different spaces. Interestingly, clustering in cavity (Cavbase) and fold space (DALI) reveals virtually the same data structuring. Remarkable relationships can be found among the different spaces. They provide information on how conformations are conserved across the host proteins and which distinct local cavity and fold motifs recognize the different portions of the cofactors. In those cases, where different cofactors are found to be accommodated in a similar fashion to the same fold motifs, only a commonly shared substructure of the cofactors is used for the recognition process. Copyright © 2011 Wiley Periodicals, Inc.

  12. Structure-Based Mutagenesis of Sulfolobus Turreted Icosahedral Virus B204 Reveals Essential Residues in the Virion-Associated DNA-Packaging ATPase.

    PubMed

    Dellas, Nikki; Snyder, Jamie C; Dills, Michael; Nicolay, Sheena J; Kerchner, Keshia M; Brumfield, Susan K; Lawrence, C Martin; Young, Mark J

    2015-12-23

    Sulfolobus turreted icosahedral virus (STIV), an archaeal virus that infects the hyperthermoacidophile Sulfolobus solfataricus, is one of the most well-studied viruses of the domain Archaea. STIV shares structural, morphological, and sequence similarities with viruses from other domains of life, all of which are thought to belong to the same viral lineage. Several of these common features include a conserved coat protein fold, an internal lipid membrane, and a DNA-packaging ATPase. B204 is the ATPase encoded by STIV and is thought to drive packaging of viral DNA during the replication process. Here, we report the crystal structure of B204 along with the biochemical analysis of B204 mutants chosen based on structural information and sequence conservation patterns observed among members of the same viral lineage and the larger FtsK/HerA superfamily to which B204 belongs. Both in vitro ATPase activity assays and transfection assays with mutant forms of B204 confirmed the essentiality of conserved and nonconserved positions. We also have identified two distinct particle morphologies during an STIV infection that differ in the presence or absence of the B204 protein. The biochemical and structural data presented here are not only informative for the STIV replication process but also can be useful in deciphering DNA-packaging mechanisms for other viruses belonging to this lineage. STIV is a virus that infects a host from the domain Archaea that replicates in high-temperature, acidic environments. While STIV has many unique features, there exist several striking similarities between this virus and others that replicate in different environments and infect a broad range of hosts from Bacteria and Eukarya. Aside from structural features shared by viruses from this lineage, there exists a significant level of sequence similarity between the ATPase genes carried by these different viruses; this gene encodes an enzyme thought to provide energy that drives DNA packaging into the virion during infection. The experiments described here highlight the elements of this enzyme that are essential for proper function and also provide supporting evidence that B204 is present in the mature STIV virion. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. Metagenomics of rumen bacteriophage from thirteen lactating dairy cattle

    PubMed Central

    2013-01-01

    Background The bovine rumen hosts a diverse and complex community of Eukarya, Bacteria, Archea and viruses (including bacteriophage). The rumen viral population (the rumen virome) has received little attention compared to the rumen microbial population (the rumen microbiome). We used massively parallel sequencing of virus like particles to investigate the diversity of the rumen virome in thirteen lactating Australian Holstein dairy cattle all housed in the same location, 12 of which were sampled on the same day. Results Fourteen putative viral sequence fragments over 30 Kbp in length were assembled and annotated. Many of the putative genes in the assembled contigs showed no homology to previously annotated genes, highlighting the large amount of work still required to fully annotate the functions encoded in viral genomes. The abundance of the contig sequences varied widely between animals, even though the cattle were of the same age, stage of lactation and fed the same diets. Additionally the twelve animals which were co-habited shared a number of their dominant viral contigs. We compared the functional characteristics of our bovine viromes with that of other viromes, as well as rumen microbiomes. At the functional level, we found strong similarities between all of the viral samples, which were highly distinct from the rumen microbiome samples. Conclusions Our findings suggest a large amount of between animal variation in the bovine rumen virome and that co-habiting animals may have more similar viromes than non co-habited animals. We report the deepest sequencing to date of the rumen virome. This work highlights the enormous amount of novelty and variation present in the rumen virome. PMID:24180266

  14. Insight into the evolution and origin of leprosy bacilli from the genome sequence of Mycobacterium lepromatosis

    PubMed Central

    Singh, Pushpendra; Benjak, Andrej; Schuenemann, Verena J.; Herbig, Alexander; Avanzi, Charlotte; Busso, Philippe; Nieselt, Kay; Krause, Johannes; Vera-Cabrera, Lucio; Cole, Stewart T.

    2015-01-01

    Mycobacterium lepromatosis is an uncultured human pathogen associated with diffuse lepromatous leprosy and a reactional state known as Lucio's phenomenon. By using deep sequencing with and without DNA enrichment, we obtained the near-complete genome sequence of M. lepromatosis present in a skin biopsy from a Mexican patient, and compared it with that of Mycobacterium leprae, which has undergone extensive reductive evolution. The genomes display extensive synteny and are similar in size (∼3.27 Mb). Protein-coding genes share 93% nucleotide sequence identity, whereas pseudogenes are only 82% identical. The events that led to pseudogenization of 50% of the genome likely occurred before divergence from their most recent common ancestor (MRCA), and both M. lepromatosis and M. leprae have since accumulated new pseudogenes or acquired specific deletions. Functional comparisons suggest that M. lepromatosis has lost several enzymes required for amino acid synthesis whereas M. leprae has a defective heme pathway. M. lepromatosis has retained all functions required to infect the Schwann cells of the peripheral nervous system and therefore may also be neuropathogenic. A phylogeographic survey of 227 leprosy biopsies by differential PCR revealed that 221 contained M. leprae whereas only six, all from Mexico, harbored M. lepromatosis. Phylogenetic comparisons indicate that M. lepromatosis is closer than M. leprae to the MRCA, and a Bayesian dating analysis suggests that they diverged from their MRCA approximately 13.9 Mya. Thus, despite their ancient separation, the two leprosy bacilli are remarkably conserved and still cause similar pathologic conditions. PMID:25831531

  15. Gene relocations within chloroplast genomes of Jasminum and Menodora (Oleaceae) are due to multiple, overlapping inversions.

    PubMed

    Lee, Hae-Lim; Jansen, Robert K; Chumley, Timothy W; Kim, Ki-Joong

    2007-05-01

    The chloroplast (cp) DNA sequence of Jasminum nudiflorum (Oleaceae-Jasmineae) is completed and compared with the large single-copy region sequences from 6 related species. The cp genomes of the tribe Jasmineae (Jasminum and Menodora) show several distinctive rearrangements, including inversions, gene duplications, insertions, inverted repeat expansions, and gene and intron losses. The ycf4-psaI region in Jasminum section Primulina was relocated as a result of 2 overlapping inversions of 21,169 and 18,414 bp. The 1st, larger inversion is shared by all members of the Jasmineae indicating that it occurred in the common ancestor of the tribe. Similar rearrangements were also identified in the cp genome of Menodora. In this case, 2 fragments including ycf4 and rps4-trnS-ycf3 genes were moved by 2 additional inversions of 14 and 59 kb that are unique to Menodora. Other rearrangements in the Oleaceae are confined to certain regions of the Jasminum and Menodora cp genomes, including the presence of highly repeated sequences and duplications of coding and noncoding sequences that are inserted into clpP and between rbcL and psaI. These insertions are correlated with the loss of 2 introns in clpP and a serial loss of segments of accD. The loss of the accD gene and clpP introns in both the monocot family Poaceae and the eudicot family Oleaceae are clearly independent evolutionary events. However, their genome organization is surprisingly similar despite the distant relationship of these 2 angiosperm families.

  16. Mapping the neutralizing epitopes on the glycoprotein of infectious haematopoietic necrosis virus, a fish rhabdovirus

    USGS Publications Warehouse

    Huang, C.; Chien, M.S.; Landolt, M.L.; Batts, W.; Winton, J.

    1996-01-01

    Twelve neutralizing monoclonal antibodies (MAbs) against the fish rhabdovirus, infectious haematopoietic necrosis virus (IHNV), were used to select 20 MAb escape mutants. The nucleotide sequence of the entire glycoprotein (G) gene was determined for six mutants representing differing cross-neutralization patterns and each had a single nucleotide change leading to a single amino acid substitution within one of three regions of the protein. These data were used to design nested PCR primers to amplify portions of the G gene of the 14 remaining mutants. When the PCR products from these mutants were sequenced, they also had single nucleotide substitutions coding for amino acid substitutions at the same, or nearby, locations. Of the 20 mutants for which all or part of the glycoprotein gene was sequenced, two MAbs selected mutants with substitutions at amino acids 230-231 (antigenic site I) and the remaining MAbs selected mutants with substitutions at amino acids 272-276 (antigenic site II). Two MAbs that selected mutants mapping to amino acids 272-276, selected other mutants that mapped to amino acids 78-81, raising the possibility that this portion of the N terminus of the protein was part of a discontinuous epitope defining antigenic site II. CLUSTAL alignment of the glycoproteins of rabies virus, vesicular stomatitis virus and IHNV revealed similarities in the location of the neutralizing epitopes and a high degree of conservation among cysteine residues, indicating that the glycoproteins of three different genera of animal rhabdoviruses may share a similar three-dimensional structure in spite of extensive sequence divergence.

  17. [Characterization of the genetic variability of field strains of Brucella canis isolated in Antioquia].

    PubMed

    Vidal Arboleda, Juana L; Ortiz Roman, Luisa F; Olivera Angel, Martha

    2017-12-22

    Brucella canis is a facultative intracellular pathogen responsible for canine brucellosis, a zoonotic disease that affects canines, causing abortions and reproductive failure; and the production of non-specific symptoms in humans. In 2005 the presence of B. canis in Antioquia was demonstrated and the strains were identified as type 2. The sequencing of the genome of a field strain denoted Brucella canis str. Oliveri, showed species-specific indel events, which led us to investigate the genomic characteristics of the B. canis strain isolated and to establish the phylogenetic relationships and the divergence time of B. canis str. Oliveri. Conventional PCR sequencing was performed in 30 field strains identifying 5 indel events recognized in B. canis str. Oliveri. ADN from Brucella suis, Brucella melitensis and vaccine strains from Brucella abortus were used as control, and it was determined that all of the studied field strains shared 4 out of the 5 indels of the sequenced Oliveri strain, indicating the presence of more than one strain circulating in the region. Phylogenetic analysis was performed with 24 strains of Brucella using concatenated sequences of genetic markers for species differentiation. The molecular clock hypothesis and Tajima's relative rate test were tested, showing that the Oliveri strain, similarly to other canis species, diverged from B. suis. The molecular clock hypothesis between Brucella species was rejected and an evolution rate and a similar genetic distance between the B. canis were demonstrated. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  18. Prediction of the protein components of a putative Calanus finmarchicus (Crustacea, Copepoda) circadian signaling system using a de novo assembled transcriptome

    PubMed Central

    Christie, Andrew E.; Fontanilla, Tiana M.; Nesbit, Katherine T.; Lenz, Petra H.

    2013-01-01

    Diel vertical migration and seasonal diapause are critical life history events for the copepod Calanus finmarchicus. While much is known about these behaviors phenomenologically, little is known about their molecular underpinnings. Recent studies in insects suggest that some circadian genes/proteins also contribute to the establishment of seasonal diapause. Thus, it is possible that in Calanus these distinct timing regimes share some genetic components. To begin to address this possibility, we used the well-established Drosophila melanogaster circadian system as a reference for mining clock transcripts from a 200,000+ sequence Calanus transcriptome; the proteins encoded by the identified transcripts were also deduced and characterized. Sequences encoding homologs of the Drosophila core clock proteins CLOCK, CYCLE, PERIOD and TIMELESS were identified, as was one encoding CRYPTOCHROME 2, a core clock protein in ancestral insect systems, but absent in Drosophila. Calanus transcripts encoding proteins known to modulate the Drosophila core clock were also identified and characterized, e.g. CLOCKWORK ORANGE, DOUBLETIME, SHAGGY and VRILLE. Alignment and structural analyses of the deduced Calanus proteins with their Drosophila counterparts revealed extensive sequence conservation, particularly in functional domains. Interestingly, reverse BLAST analyses of these sequences against all arthropod proteins typically revealed non-Drosophila isoforms to be most similar to the Calanus queries. This, in combination with the presence of both CRYPTOCHROME 1 (a clock input pathway protein) and CRYPTOCHROME 2 in Calanus, suggests that the organization of the copepod circadian system is an ancestral one, more similar to that of insects like Danaus plexippus than to that of Drosophila. PMID:23727418

  19. Characterization of the psychrotolerant acetogen strain SyrA5 and the emended description of the species Acetobacterium carbinolicum.

    PubMed

    Paarup, Maiken; Friedrich, Michael W; Tindall, Brian J; Finster, Kai

    2006-01-01

    A psychrotolerant, obligate anaerobic, acetogenic bacterium designated strain SyrA5 was isolated from black anoxic sediment of a brackish fjord. Cells were Gram-positive, non-sporeforming rods. The isolate utilized H(2)/CO(2), CO, fructose, glucose, ethanol, ethylene glycol, glycerol, pyruvate, lactate, betaine and the methyl-groups of several methoxylated benzoic derivatives such as syringate, trimethoxybenzoate and vallinate. The optimum temperature for growth was 29 degrees C, whilst slow growth occurred at 2 degrees C. The strain grew optimally with NaCl concentrations below 2.7% (w/v), but growth occurred up to 4.3% (w/v) NaCl. Growth was observed in the range from pH 5.9 to 8.5, optimum at pH 8. The G+C content was 44.1 mol%. Based upon 16S rRNA gene sequence analysis and DNA-DNA reassociation studies, the organism was classified in the genus Acetobacterium. Strain SyrA5 shared a 16S rRNA sequence similarity with A. carbinolicum of 100%, a fthfs gene (which codes for the N5,N10 tetrahydrofolate synthetase) sequence identity of 98.5-98.7% (amino acid sequence similarities were 99.4-100%) and a RNA-DNA hybridization homology of 64-68%. Despite a number of phenotypic differences between strain SyrA5 and A. carbinolicum we propose including strain SyrA5 as a subspecies of A. carbinolicum for which we propose the name Acetobacterium carbinolicum subspecies kysingense. The type strain is SyrA5 (=DSM 16427(T), ATCC BAA-990).

  20. Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

    PubMed

    Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

    2017-04-01

    Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

  1. Molecular characterization of Banana streak virus isolate from Musa Acuminata in China.

    PubMed

    Zhuang, Jun; Wang, Jian-Hua; Zhang, Xin; Liu, Zhi-Xin

    2011-12-01

    Banana streak virus (BSV), a member of genus Badnavirus, is a causal agent of banana streak disease throughout the world. The genetic diversity of BSVs from different regions of banana plantations has previously been investigated, but there are relatively few reports of the genetic characteristic of episomal (non-integrated) BSV genomes isolated from China. Here, the complete genome, a total of 7722bp (GenBank accession number DQ092436), of an isolate of Banana streak virus (BSV) on cultivar Cavendish (BSAcYNV) in Yunnan, China was determined. The genome organises in the typical manner of badnaviruses. The intergenic region of genomic DNA contains a large stem-loop, which may contribute to the ribosome shift into the following open reading frames (ORFs). The coding region of BSAcYNV consists of three overlapping ORFs, ORF1 with a non-AUG start codon and ORF2 encoding two small proteins are individually involved in viral movement and ORF3 encodes a polyprotein. Besides the complete genome, a defective genome lacking the whole RNA leader region and a majority of ORF1 and which encompasses 6525bp was also isolated and sequenced from this BSV DNA reservoir in infected banana plants. Sequence analyses showed that BSAcYNV has closest similarity in terms of genome organization and the coding assignments with an BSV isolate from Vietnam (BSAcVNV). The corresponding coding regions shared identities of 88% and -95% at nucleotide and amino acid levels, respectively. Phylogenetic analysis also indicated BSAcYNV shared the closest geographical evolutionary relationship to BSAcVNV among sequenced banana streak badnaviruses.

  2. Phylogenetic evidence for intratypic recombinant events in a novel human adenovirus C that causes severe acute respiratory infection in children.

    PubMed

    Wang, Yanqun; Li, Yamin; Lu, Roujian; Zhao, Yanjie; Xie, Zhengde; Shen, Jun; Tan, Wenjie

    2016-03-10

    Human adenoviruses (HAdVs) are prevalent in hospitalized children with severe acute respiratory infection (SARI). Here, we report a unique recombinant HAdV strain (CBJ113) isolated from a HAdV-positive child with SARI. The whole-genome sequence was determined using Sanger sequencing and high-throughput sequencing. A phylogenetic analysis of the complete genome indicated that the CBJ113 strain shares a common origin with HAdV-C2, HAdV-C6, HAdV-C1, HAdV-C5, and HAdV-C57 and formed a novel subclade on the same branch as other HAdV-C subtypes. BootScan and single nucleotide polymorphism analyses showed that the CBJ113 genome has an intra-subtype recombinant structure and comprises gene regions mainly originating from two circulating viral strains: HAdV-1 and HAdV-2. The parental penton base, pVI, and DBP genes of the recombinant strain clustered with the HAdV-1 prototype strain, and the E1B, hexon, fiber, and 100 K genes of the recombinant clustered within the HAdV-2 subtype, meanwhile the E4orf1 and DNA polymerase genes of the recombinant shared the greatest similarity with those of HAdV-5 and HAdV-6, respectively. All of these findings provide insight into our understanding of the dynamics of the complexity of the HAdV-C epidemic. More extensive studies should address the pathogenicity and clinical characteristics of the novel recombinant.

  3. Phylogenetic evidence for intratypic recombinant events in a novel human adenovirus C that causes severe acute respiratory infection in children

    PubMed Central

    Wang, Yanqun; Li, Yamin; Lu, Roujian; Zhao, Yanjie; Xie, Zhengde; Shen, Jun; Tan, Wenjie

    2016-01-01

    Human adenoviruses (HAdVs) are prevalent in hospitalized children with severe acute respiratory infection (SARI). Here, we report a unique recombinant HAdV strain (CBJ113) isolated from a HAdV-positive child with SARI. The whole-genome sequence was determined using Sanger sequencing and high-throughput sequencing. A phylogenetic analysis of the complete genome indicated that the CBJ113 strain shares a common origin with HAdV-C2, HAdV-C6, HAdV-C1, HAdV-C5, and HAdV-C57 and formed a novel subclade on the same branch as other HAdV-C subtypes. BootScan and single nucleotide polymorphism analyses showed that the CBJ113 genome has an intra-subtype recombinant structure and comprises gene regions mainly originating from two circulating viral strains: HAdV-1 and HAdV-2. The parental penton base, pVI, and DBP genes of the recombinant strain clustered with the HAdV-1 prototype strain, and the E1B, hexon, fiber, and 100 K genes of the recombinant clustered within the HAdV-2 subtype, meanwhile the E4orf1 and DNA polymerase genes of the recombinant shared the greatest similarity with those of HAdV-5 and HAdV-6, respectively. All of these findings provide insight into our understanding of the dynamics of the complexity of the HAdV-C epidemic. More extensive studies should address the pathogenicity and clinical characteristics of the novel recombinant. PMID:26960434

  4. A strategy for detecting the conservation of folding-nucleus residues in protein superfamilies.

    PubMed

    Michnick, S W; Shakhnovich, E

    1998-01-01

    Nucleation-growth theory predicts that fast-folding peptide sequences fold to their native structure via structures in a transition-state ensemble that share a small number of native contacts (the folding nucleus). Experimental and theoretical studies of proteins suggest that residues participating in folding nuclei are conserved among homologs. We attempted to determine if this is true in proteins with highly diverged sequences but identical folds (superfamilies). We describe a strategy based on comparisons of residue conservation in natural superfamily sequences with simulated sequences (generated with a Monte-Carlo sequence design strategy) for the same proteins. The basic assumptions of the strategy were that natural sequences will conserve residues needed for folding and stability plus function, the simulated sequences contain no functional conservation, and nucleus residues make native contacts with each other. Based on these assumptions, we identified seven potential nucleus residues in ubiquitin superfamily members. Non-nucleus conserved residues were also identified; these are proposed to be involved in stabilizing native interactions. We found that all superfamily members conserved the same potential nucleus residue positions, except those for which the structural topology is significantly different. Our results suggest that the conservation of the nucleus of a specific fold can be predicted by comparing designed simulated sequences with natural highly diverged sequences that fold to the same structure. We suggest that such a strategy could be used to help plan protein folding and design experiments, to identify new superfamily members, and to subdivide superfamilies further into classes having a similar folding mechanism.

  5. Cloning, analysis and functional annotation of expressed sequence tags from the Earthworm Eisenia fetida

    PubMed Central

    Pirooznia, Mehdi; Gong, Ping; Guan, Xin; Inouye, Laura S; Yang, Kuan; Perkins, Edward J; Deng, Youping

    2007-01-01

    Background Eisenia fetida, commonly known as red wiggler or compost worm, belongs to the Lumbricidae family of the Annelida phylum. Little is known about its genome sequence although it has been extensively used as a test organism in terrestrial ecotoxicology. In order to understand its gene expression response to environmental contaminants, we cloned 4032 cDNAs or expressed sequence tags (ESTs) from two E. fetida libraries enriched with genes responsive to ten ordnance related compounds using suppressive subtractive hybridization-PCR. Results A total of 3144 good quality ESTs (GenBank dbEST accession number EH669363–EH672369 and EL515444–EL515580) were obtained from the raw clone sequences after cleaning. Clustering analysis yielded 2231 unique sequences including 448 contigs (from 1361 ESTs) and 1783 singletons. Comparative genomic analysis showed that 743 or 33% of the unique sequences shared high similarity with existing genes in the GenBank nr database. Provisional function annotation assigned 830 Gene Ontology terms to 517 unique sequences based on their homology with the annotated genomes of four model organisms Drosophila melanogaster, Mus musculus, Saccharomyces cerevisiae, and Caenorhabditis elegans. Seven percent of the unique sequences were further mapped to 99 Kyoto Encyclopedia of Genes and Genomes pathways based on their matching Enzyme Commission numbers. All the information is stored and retrievable at a highly performed, web-based and user-friendly relational database called EST model database or ESTMD version 2. Conclusion The ESTMD containing the sequence and annotation information of 4032 E. fetida ESTs is publicly accessible at . PMID:18047730

  6. Domain Organization in Clostridium botulinum Neurotoxin Type E is Unique: Its Implication in Faster Translocation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumaran, D.; Eswaramoorthy, S; Furey, W

    2009-01-01

    Clostridium botulinum produces seven antigenically distinct neurotoxins [C. botulinum neurotoxins (BoNTs) A-G] sharing a significant sequence homology. Based on sequence and functional similarity, it was believed that their three-dimensional structures will also be similar. Indeed, the crystal structures of BoNTs A and B exhibit similar fold and domain association where the translocation domain is flanked on either side by binding and catalytic domains. Here, we report the crystal structure of BoNT E holotoxin and show that the domain association is different and unique, although the individual domains are similar to those of BoNTs A and B. In BoNT E, bothmore » the binding domain and the catalytic domain are on the same side of the translocation domain, and all three have mutual interfaces. This unique association may have an effect on the rate of translocation, with the molecule strategically positioned in the vesicle for quick entry into cytosol. Botulism, the disease caused by BoNT E, sets in faster than any other serotype because of its speedy internalization and translocation, and the present structure offers a credible explanation. We propose that the translocation domain in other BoNTs follows a two-step process to attain translocation-competent conformation as in BoNT E. We also suggest that this translocation-competent conformation in BoNT E is a probable reason for its faster toxic rate compared to BoNT A. However, this needs further experimental elucidation.« less

  7. Molecular Evidence of Chlamydia-Like Organisms in the Feces of Myotis daubentonii Bats.

    PubMed

    Hokynar, K; Vesterinen, E J; Lilley, T M; Pulliainen, A T; Korhonen, S J; Paavonen, J; Puolakkainen, M

    2017-01-15

    Chlamydia-like organisms (CLOs) are recently identified members of the Chlamydiales order. CLOs share intracellular lifestyles and biphasic developmental cycles, and they have been detected in environmental samples as well as in various hosts such as amoebae and arthropods. In this study, we screened bat feces for the presence of CLOs by molecular analysis. Using pan-Chlamydiales PCR targeting the 16S rRNA gene, Chlamydiales DNA was detected in 54% of the specimens. PCR amplification, sequencing, and phylogenetic analysis of the 16S rRNA and 23S rRNA genes were used to classify positive specimens and infer their phylogenetic relationships. Most sequences matched best with Rhabdochlamydia species or uncultured Chlamydia sequences identified in ticks. Another set of sequences matched best with sequences of the Chlamydia genus or uncultured Chlamydiales from snakes. To gain evidence of whether CLOs in bat feces are merely diet borne, we analyzed insects trapped from the same location where the bats foraged. Interestingly, the CLO sequences resembling Rhabdochlamydia spp. were detected in insect material as well, but the other set of CLO sequences was not, suggesting that this set might not originate from prey. Thus, bats represent another potential host for Chlamydiales and could harbor novel, previously unidentified members of this order. Several pathogenic viruses are known to colonize bats, and recent analyses indicate that bats are also reservoir hosts for bacterial genera. Chlamydia-like organisms (CLOs) have been detected in several animal species. CLOs have high 16S rRNA sequence similarity to Chlamydiaceae and exhibit similar intracellular lifestyles and biphasic developmental cycles. Our study describes the frequent occurrence of CLO DNA in bat feces, suggesting an expanding host species spectrum for the Chlamydiales As bats can acquire various infectious agents through their diet, prey insects were also studied. We identified CLO sequences in bats that matched best with sequences in prey insects but also CLO sequences not detected in prey insects. This suggests that a portion of CLO DNA present in bat feces is not prey borne. Furthermore, some sequences from bat droppings not originating from their diet might well represent novel, previously unidentified members of the Chlamydiales order. Copyright © 2016 American Society for Microbiology.

  8. Method of Conjugate Radii for Solving Linear and Nonlinear Systems

    NASA Technical Reports Server (NTRS)

    Nachtsheim, Philip R.

    1999-01-01

    This paper describes a method to solve a system of N linear equations in N steps. A quadratic form is developed involving the sum of the squares of the residuals of the equations. Equating the quadratic form to a constant yields a surface which is an ellipsoid. For different constants, a family of similar ellipsoids can be generated. Starting at an arbitrary point an orthogonal basis is constructed and the center of the family of similar ellipsoids is found in this basis by a sequence of projections. The coordinates of the center in this basis are the solution of linear system of equations. A quadratic form in N variables requires N projections. That is, the current method is an exact method. It is shown that the sequence of projections is equivalent to a special case of the Gram-Schmidt orthogonalization process. The current method enjoys an advantage not shared by the classic Method of Conjugate Gradients. The current method can be extended to nonlinear systems without modification. For nonlinear equations the Method of Conjugate Gradients has to be augmented with a line-search procedure. Results for linear and nonlinear problems are presented.

  9. TriAnd and its siblings: satellites of satellites in the Milky Way halo

    NASA Astrophysics Data System (ADS)

    Deason, A. J.; Belokurov, V.; Hamren, K. M.; Koposov, S. E.; Gilbert, K. M.; Beaton, R. L.; Dorman, C. E.; Guhathakurta, P.; Majewski, S. R.; Cunningham, E. C.

    2014-11-01

    We explore the Triangulum-Andromeda (TriAnd) overdensity in the SPLASH (Spectroscopic and Photometric Landscape of Andromeda's Stellar Halo) and SEGUE (the Sloan Extension for Galactic Understanding and Exploration) spectroscopic surveys. Milky Way main-sequence turn-off stars in the SPLASH survey reveal that the TriAnd overdensity and the recently discovered Pan-Andromeda Archaeological Survey (PAndAS) stream share a common heliocentric distance (D ˜ 20 kpc), position on the sky, and line-of-sight velocity (VGSR ˜ 50 km s-1). Similarly, A-type, giant, and main-sequence turn-off stars selected from the SEGUE survey in the vicinity of the Segue 2 satellite show that TriAnd is prevalent in these fields, with a velocity and distance similar to Segue 2. The coincidence of the PAndAS stream and Segue 2 satellite in positional and velocity space to TriAnd suggests that these substructures are all associated, and may be a fossil record of group-infall on to the Milky Way halo. In this scenario, the Segue 2 satellite and PAndAS stream are `satellites of satellites', and the large, metal-rich TriAnd overdensity is the remains of the group central.

  10. Unique nonstructural proteins of Pneumonia Virus of Mice (PVM) promote degradation of interferon (IFN) pathway components and IFN-stimulated gene proteins.

    PubMed

    Dhar, Jayeeta; Barik, Sailen

    2016-12-01

    Pneumonia Virus of Mice (PVM) is the only virus that shares the Pneumovirus genus of the Paramyxoviridae family with Respiratory Syncytial Virus (RSV). A deadly mouse pathogen, PVM has the potential to serve as a robust animal model of RSV infection, since human RSV does not fully replicate the human pathology in mice. Like RSV, PVM also encodes two nonstructural proteins that have been implicated to suppress the IFN pathway, but surprisingly, they exhibit no sequence similarity with their RSV equivalents. The molecular mechanism of PVM NS function, therefore, remains unknown. Here, we show that recombinant PVM NS proteins degrade the mouse counterparts of the IFN pathway components. Proteasomal degradation appears to be mediated by ubiquitination promoted by PVM NS proteins. Interestingly, NS proteins of PVM lowered the levels of several ISG (IFN-stimulated gene) proteins as well. These results provide a molecular foundation for the mechanisms by which PVM efficiently subverts the IFN response of the murine cell. They also reveal that in spite of their high sequence dissimilarity, the two pneumoviral NS proteins are functionally and mechanistically similar.

  11. Homez, a homeobox leucine zipper gene specific to the vertebrate lineage.

    PubMed

    Bayarsaihan, Dashzeveg; Enkhmandakh, Badam; Makeyev, Aleksandr; Greally, John M; Leckman, James F; Ruddle, Frank H

    2003-09-02

    This work describes a vertebrate homeobox gene, designated Homez (homeodomain leucine zipper-encoding gene), that encodes a protein with an unusual structural organization. There are several regions within Homez, including three atypical homeodomains, two leucine zipper-like motifs, and an acidic domain. The gene is ubiquitously expressed in human and murine tissues, although the expression pattern is more restricted during mouse development. Genomic analysis revealed that human and mouse genes are located at 14q11.2 and 14C, respectively, and are composed of two exons. The zebrafish and pufferfish homologs share high similarity to mammalian sequences, particularly within the homeodomain sequences. Based on homology of homeodomains and on the similarity in overall protein structure, we delineate Homez and members of ZHX family of zinc finger homeodomain factors as a subset within the superfamily of homeobox-containing proteins. The type and composition of homeodomains in the Homez subfamily are vertebrate-specific. Phylogenetic analysis indicates that Homez lineage was separated from related genes >400 million years ago before separation of ray- and lobe-finned fishes. We apply a duplication-degeneration-complementation model to explain how this family of genes has evolved.

  12. Molecular characterization of novel mucosotropic papillomaviruses from a Florida manatee (Trichechus manatus latirostris).

    PubMed

    2015-12-01

    We isolated two new manatee papillomavirus (PV) types, TmPV3 and TmPV4, from a Florida manatee (Trichechus manatus latirostris). Two PV types were previously isolated from this species. TmPV1 is widely dispersed amongst manatees and a close-to-root PV; not much is known about TmPV2. The genomes of TmPV3 and TmPV4 were 7622 and 7771 bp in size, respectively. Both PVs had a genomic organization characteristic of all PVs, with one non-coding region and seven ORFs, including the E7 ORF that is absent in other cetacean PVs. Although these PVs were isolated from separate genital lesions of the same manatee, an enlarged E2/E4 ORF was found only in the TmPV4 genome. The full genome and L1 sequence similarities between TmPV3 and TmPV4 were 63.2 and 70.3 %, respectively. These genomes shared only 49.1 and 50.2 % similarity with TmPV1. The pairwise alignment of L1 nucleotide sequences indicated that the two new PVs nested in a monophyletic group of the genus Rhopapillomavirus, together with the cutaneotropic TmPV1 and TmPV2.

  13. Insights into the Melipona scutellaris (Hymenoptera, Apidae, Meliponini) fat body transcriptome.

    PubMed

    de Sousa, Cristina Soares; Serrão, José Eduardo; Bonetti, Ana Maria; Amaral, Isabel Marques Rodrigues; Kerr, Warwick Estevam; Maranhão, Andréa Queiroz; Ueira-Vieira, Carlos

    2013-07-01

    The insect fat body is a multifunctional organ analogous to the vertebrate liver. The fat body is involved in the metabolism of juvenile hormone, regulation of environmental stress, production of immunity regulator-like proteins in cells and protein storage. However, very little is known about the molecular mechanisms involved in fat body physiology in stingless bees. In this study, we analyzed the transcriptome of the fat body from the stingless bee Melipona scutellaris. In silico analysis of a set of cDNA library sequences yielded 1728 expressed sequence tags (ESTs) and 997 high-quality sequences that were assembled into 29 contigs and 117 singlets. The BLAST X tool showed that 86% of the ESTs shared similarity with Apis mellifera (honeybee) genes. The M. scutellaris fat body ESTs encoded proteins with roles in numerous physiological processes, including anti-oxidation, phosphorylation, metabolism, detoxification, transmembrane transport, intracellular transport, cell proliferation, protein hydrolysis and protein synthesis. This is the first report to describe a transcriptomic analysis of specific organs of M. scutellaris. Our findings provide new insights into the physiological role of the fat body in stingless bees.

  14. Insights into the Melipona scutellaris (Hymenoptera, Apidae, Meliponini) fat body transcriptome

    PubMed Central

    de Sousa, Cristina Soares; Serrão, José Eduardo; Bonetti, Ana Maria; Amaral, Isabel Marques Rodrigues; Kerr, Warwick Estevam; Maranhão, Andréa Queiroz; Ueira-Vieira, Carlos

    2013-01-01

    The insect fat body is a multifunctional organ analogous to the vertebrate liver. The fat body is involved in the metabolism of juvenile hormone, regulation of environmental stress, production of immunity regulator-like proteins in cells and protein storage. However, very little is known about the molecular mechanisms involved in fat body physiology in stingless bees. In this study, we analyzed the transcriptome of the fat body from the stingless bee Melipona scutellaris. In silico analysis of a set of cDNA library sequences yielded 1728 expressed sequence tags (ESTs) and 997 high-quality sequences that were assembled into 29 contigs and 117 singlets. The BLAST X tool showed that 86% of the ESTs shared similarity with Apis mellifera (honeybee) genes. The M. scutellaris fat body ESTs encoded proteins with roles in numerous physiological processes, including anti-oxidation, phosphorylation, metabolism, detoxification, transmembrane transport, intracellular transport, cell proliferation, protein hydrolysis and protein synthesis. This is the first report to describe a transcriptomic analysis of specific organs of M. scutellaris. Our findings provide new insights into the physiological role of the fat body in stingless bees. PMID:23885214

  15. Identification and characterization of a DnaJ gene from red alga Pyropia yezoensis (Bangiales, Rhodophyta)

    NASA Astrophysics Data System (ADS)

    Liu, Jiao; Li, Xianchao; Tang, Xuexi; Zhou, Bin

    2016-03-01

    Members of the DnaJ family are proteins that play a pivotal role in various cellular processes, such as protein folding, protein transport and cellular responses to stress. In the present study, we identified and characterized the full-length DnaJ cDNA sequence from expressed sequence tags of Pyropia yezoensis ( PyDnaJ) via rapid identification of cDNA ends. This cDNA encoded a protein of 429 amino acids, which shared high sequence similarity with other identified DnaJ proteins, such as a heat shock protein 40/DnaJ from Pyropia haitanensis. The relative mRNA expression level of PyDnaJ was investigated using real-time PCR to determine its specific expression during the algal life cycle and during desiccation. The relative mRNA expression level in sporophytes was higher than that in gametophytes and significantly increased during the whole desiccation process. These results indicate that PyDnaJ is an authentic member of the DnaJ family in plants and red algae and might play a pivotal role in mitigating damage to P. yezoensis during desiccation.

  16. Sharing of photobionts in sympatric populations of Thamnolia and Cetraria lichens: evidence from high-throughput sequencing.

    PubMed

    Onuț-Brännström, Ioana; Benjamin, Mitchell; Scofield, Douglas G; Heiðmarsson, Starri; Andersson, Martin G I; Lindström, Eva S; Johannesson, Hanna

    2018-03-13

    In this study, we explored the diversity of green algal symbionts (photobionts) in sympatric populations of the cosmopolitan lichen-forming fungi Thamnolia and Cetraria. We sequenced with both Sanger and Ion Torrent High-Throughput Sequencing technologies the photobiont ITS-region of 30 lichen thalli from two islands: Iceland and Öland. While Sanger recovered just one photobiont genotype from each thallus, the Ion Torrent data recovered 10-18 OTUs for each pool of 5 lichen thalli, suggesting that individual lichens can contain heterogeneous photobiont populations. Both methods showed evidence for photobiont sharing between Thamnolia and Cetraria on Iceland. In contrast, our data suggest that on Öland the two mycobionts associate with distinct photobiont communities, with few shared OTUs revealed by Ion Torrent sequencing. Furthermore, by comparing our sequences with public data, we identified closely related photobionts from geographically distant localities. Taken together, we suggest that the photobiont composition in Thamnolia and Cetraria results from both photobiont-mycobiont codispersal and local acquisition during mycobiont establishment and/or lichen growth. We hypothesize that this is a successful strategy for lichens to be flexible in the use of the most adapted photobiont for the environment.

  17. A gene family for acidic ribosomal proteins in Schizosaccharomyces pombe: two essential and two nonessential genes.

    PubMed Central

    Beltrame, M; Bianchi, M E

    1990-01-01

    We have cloned the genes for small acidic ribosomal proteins (A-proteins) of the fission yeast Schizosaccharomyces pombe. S. pombe contains four transcribed genes for small A-proteins per haploid genome, as is the case for Saccharomyces cerevisiae. In contrast, multicellular eucaryotes contain two transcribed genes per haploid genome. The four proteins of S. pombe, besides sharing a high overall similarity, form two couples of nearly identical sequences. Their corresponding genes have a very conserved structure and are transcribed to a similar level. Surprisingly, of each couple of genes coding for nearly identical proteins, one is essential for cell growth, whereas the other is not. We suggest that the unequal importance of the four small A-proteins for cell survival is related to their physical organization in 60S ribosomal subunits. Images PMID:2325655

  18. Metamorphic style and development of the blueschist- to eclogite-facies rocks, Cyclades, Greece

    NASA Astrophysics Data System (ADS)

    Schumacher, J. C.; Brady, J. B.; Cheney, J. T.

    2008-07-01

    The island of Syros, Greece is part of the Attic-Cycladic blueschist belt, formed during Mesozoic Eurasia-Africa subduction. The rocks of Syros can be broadly divided into three tectono-stratigraphic units: (I) metamorphosed sedimentary and volcanic rocks (marble-schist sequence), (II) remnants of oceanic crust with fault-bounded packages of blueschist/eclogite-facies mafic rocks and serpentinite (mafic-ultramafic rocks) and (III) the Vari gneiss, which is a tectonic klippe. Low-temperature, high-pressure assemblages are found on several islands in the Cyclades. The best preserved of these rocks are on Syros and Sifnos islands. Mineral compositions and peak metamorphic assemblages are similar on both islands. Both islands are considered to share similar P-T histories with highest-pressure mineral assemblages reflecting conditions of at least 15 kbar and about 500°C.

  19. Analysis of Rheb in the cellular slime mold Dictyostelium discoideum: cellular localization, spatial expression and overexpression.

    PubMed

    Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta

    2014-03-01

    Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway.

  20. Complete genome sequence of Southern tomato virus naturally infecting tomatoes in Bangladesh using small RNA deep sequencing

    USDA-ARS?s Scientific Manuscript database

    The complete genome sequence of a Southern tomato virus (STV) isolate on tomato plants in a seed production field in Bangladesh was obtained for the first time using next generation sequencing. The identified isolate STV_BD-13 shares high degree of sequence identity (99%) with several known STV isol...

  1. Complete genome sequence of southern tomato virus identified from China using next generation sequencing

    USDA-ARS?s Scientific Manuscript database

    Complete genome sequence of a double-stranded RNA (dsRNA) virus, southern tomato virus (STV), on tomatoes in China, was elucidated using small RNAs deep sequencing. The identified STV_CN12 shares 99% sequence identity to other isolates from Mexico, France, Spain, and U.S. This is the first report ...

  2. Comparative genomic analysis shows that avian pathogenic Escherichia coli isolate IMT5155 (O2:K1:H5; ST complex 95, ST140) shares close relationship with ST95 APEC O1:K1 and human ExPEC O18:K1 strains.

    PubMed

    Zhu Ge, Xiangkai; Jiang, Jingwei; Pan, Zihao; Hu, Lin; Wang, Shaohui; Wang, Haojin; Leung, Frederick C; Dai, Jianjun; Fan, Hongjie

    2014-01-01

    Avian pathogenic E. coli and human extraintestinal pathogenic E. coli serotypes O1, O2 and O18 strains isolated from different hosts are generally located in phylogroup B2 and ST complex 95, and they share similar genetic characteristics and pathogenicity, with no or minimal host specificity. They are popular objects for the study of ExPEC genetic characteristics and pathogenesis in recent years. Here, we investigated the evolution and genetic blueprint of APEC pathotype by performing phylogenetic and comparative genome analysis of avian pathogenic E. coli strain IMT5155 (O2:K1:H5; ST complex 95, ST140) with other E. coli pathotypes. Phylogeny analyses indicated that IMT5155 has closest evolutionary relationship with APEC O1, IHE3034, and UTI89. Comparative genomic analysis showed that IMT5155 and APEC O1 shared significant genetic overlap/similarities with human ExPEC dominant O18:K1 strains (IHE3034 and UTI89). Furthermore, the unique PAI I5155 (GI-12) was identified and found to be conserved in APEC O2 serotype isolates. GI-7 and GI-16 encoding two typical T6SSs in IMT5155 might be useful markers for the identification of ExPEC dominant serotypes (O1, O2, and O18) strains. IMT5155 contained a ColV plasmid p1ColV5155, which defined the APEC pathotype. The distribution analysis of 10 sequenced ExPEC pan-genome virulence factors among 47 sequenced E. coli strains provided meaningful information for B2 APEC/ExPEC-specific virulence factors, including several adhesins, invasins, toxins, iron acquisition systems, and so on. The pathogenicity tests of IMT5155 and other APEC O1:K1 and O2:K1 serotypes strains (isolated in China) through four animal models showed that they were highly virulent for avian colisepticemia and able to cause septicemia and meningitis in neonatal rats, suggesting zoonotic potential of these APEC O1:K1 and O2:K1 isolates.

  3. A comparative analysis of the foamy and ortho virus capsid structures reveals an ancient domain duplication.

    PubMed

    Taylor, William R; Stoye, Jonathan P; Taylor, Ian A

    2017-04-04

    The Spumaretrovirinae (foamy viruses) and the Orthoretrovirinae (e.g. HIV) share many similarities both in genome structure and the sequences of the core viral encoded proteins, such as the aspartyl protease and reverse transcriptase. Similarity in the gag region of the genome is less obvious at the sequence level but has been illuminated by the recent solution of the foamy virus capsid (CA) structure. This revealed a clear structural similarity to the orthoretrovirus capsids but with marked differences that left uncertainty in the relationship between the two domains that comprise the structure. We have applied protein structure comparison methods in order to try and resolve this ambiguous relationship. These included both the DALI method and the SAP method, with rigorous statistical tests applied to the results of both methods. For this, we employed collections of artificial fold 'decoys' (generated from the pair of native structures being compared) to provide a customised background distribution for each comparison, thus allowing significance levels to be estimated. We have shown that the relationship of the two domains conforms to a simple linear correspondence rather than a domain transposition. These similarities suggest that the origin of both viral capsids was a common ancestor with a double domain structure. In addition, we show that there is also a significant structural similarity between the amino and carboxy domains in both the foamy and ortho viruses. These results indicate that, as well as the duplication of the double domain capsid, there may have been an even more ancient gene-duplication that preceded the double domain structure. In addition, our structure comparison methodology demonstrates a general approach to problems where the components have a high intrinsic level of similarity.

  4. The alignment of enzymatic steps reveals similar metabolic pathways and probable recruitment events in Gammaproteobacteria.

    PubMed

    Poot-Hernandez, Augusto Cesar; Rodriguez-Vazquez, Katya; Perez-Rueda, Ernesto

    2015-11-17

    It is generally accepted that gene duplication followed by functional divergence is one of the main sources of metabolic diversity. In this regard, there is an increasing interest in the development of methods that allow the systematic identification of these evolutionary events in metabolism. Here, we used a method not based on biomolecular sequence analysis to compare and identify common and variable routes in the metabolism of 40 Gammaproteobacteria species. The metabolic maps deposited in the KEGG database were transformed into linear Enzymatic Step Sequences (ESS) by using the breadth-first search algorithm. These ESS represent subsequent enzymes linked to each other, where their catalytic activities are encoded in the Enzyme Commission numbers. The ESS were compared in an all-against-all (pairwise comparisons) approach by using a dynamic programming algorithm, leaving only a set of significant pairs. From these comparisons, we identified a set of functionally conserved enzymatic steps in different metabolic maps, in which cell wall components and fatty acid and lysine biosynthesis were included. In addition, we found that pathways associated with biosynthesis share a higher proportion of similar ESS than degradation pathways and secondary metabolism pathways. Also, maps associated with the metabolism of similar compounds contain a high proportion of similar ESS, such as those maps from nucleotide metabolism pathways, in particular the inosine monophosphate pathway. Furthermore, diverse ESS associated with the low part of the glycolysis pathway were identified as functionally similar to multiple metabolic pathways. In summary, our comparisons may help to identify similar reactions in different metabolic pathways and could reinforce the patchwork model in the evolution of metabolism in Gammaproteobacteria.

  5. Hybrid threshold adaptable quantum secret sharing scheme with reverse Huffman-Fibonacci-tree coding.

    PubMed

    Lai, Hong; Zhang, Jun; Luo, Ming-Xing; Pan, Lei; Pieprzyk, Josef; Xiao, Fuyuan; Orgun, Mehmet A

    2016-08-12

    With prevalent attacks in communication, sharing a secret between communicating parties is an ongoing challenge. Moreover, it is important to integrate quantum solutions with classical secret sharing schemes with low computational cost for the real world use. This paper proposes a novel hybrid threshold adaptable quantum secret sharing scheme, using an m-bonacci orbital angular momentum (OAM) pump, Lagrange interpolation polynomials, and reverse Huffman-Fibonacci-tree coding. To be exact, we employ entangled states prepared by m-bonacci sequences to detect eavesdropping. Meanwhile, we encode m-bonacci sequences in Lagrange interpolation polynomials to generate the shares of a secret with reverse Huffman-Fibonacci-tree coding. The advantages of the proposed scheme is that it can detect eavesdropping without joint quantum operations, and permits secret sharing for an arbitrary but no less than threshold-value number of classical participants with much lower bandwidth. Also, in comparison with existing quantum secret sharing schemes, it still works when there are dynamic changes, such as the unavailability of some quantum channel, the arrival of new participants and the departure of participants. Finally, we provide security analysis of the new hybrid quantum secret sharing scheme and discuss its useful features for modern applications.

  6. Hybrid threshold adaptable quantum secret sharing scheme with reverse Huffman-Fibonacci-tree coding

    PubMed Central

    Lai, Hong; Zhang, Jun; Luo, Ming-Xing; Pan, Lei; Pieprzyk, Josef; Xiao, Fuyuan; Orgun, Mehmet A.

    2016-01-01

    With prevalent attacks in communication, sharing a secret between communicating parties is an ongoing challenge. Moreover, it is important to integrate quantum solutions with classical secret sharing schemes with low computational cost for the real world use. This paper proposes a novel hybrid threshold adaptable quantum secret sharing scheme, using an m-bonacci orbital angular momentum (OAM) pump, Lagrange interpolation polynomials, and reverse Huffman-Fibonacci-tree coding. To be exact, we employ entangled states prepared by m-bonacci sequences to detect eavesdropping. Meanwhile, we encode m-bonacci sequences in Lagrange interpolation polynomials to generate the shares of a secret with reverse Huffman-Fibonacci-tree coding. The advantages of the proposed scheme is that it can detect eavesdropping without joint quantum operations, and permits secret sharing for an arbitrary but no less than threshold-value number of classical participants with much lower bandwidth. Also, in comparison with existing quantum secret sharing schemes, it still works when there are dynamic changes, such as the unavailability of some quantum channel, the arrival of new participants and the departure of participants. Finally, we provide security analysis of the new hybrid quantum secret sharing scheme and discuss its useful features for modern applications. PMID:27515908

  7. Vibrio chromosomes share common history.

    PubMed

    Kirkup, Benjamin C; Chang, LeeAnn; Chang, Sarah; Gevers, Dirk; Polz, Martin F

    2010-05-10

    While most gamma proteobacteria have a single circular chromosome, Vibrionales have two circular chromosomes. Horizontal gene transfer is common among Vibrios, and in light of this genetic mobility, it is an open question to what extent the two chromosomes themselves share a common history since their formation. Single copy genes from each chromosome (142 genes from chromosome I and 42 genes from chromosome II) were identified from 19 sequenced Vibrionales genomes and their phylogenetic comparison suggests consistent phylogenies for each chromosome. Additionally, study of the gene organization and phylogeny of the respective origins of replication confirmed the shared history. Thus, while elements within the chromosomes may have experienced significant genetic mobility, the backbones share a common history. This allows conclusions based on multilocus sequence analysis (MLSA) for one chromosome to be applied equally to both chromosomes.

  8. A new family of cyanobacterial penicillin-binding proteins. A missing link in the evolution of class A beta-lactamases.

    PubMed

    Urbach, Carole; Fastrez, Jacques; Soumillion, Patrice

    2008-11-21

    It is largely accepted that serine beta-lactamases evolved from some ancestral DD-peptidases involved in the biosynthesis and maintenance of the bacterial peptidoglycan. DD-peptidases are also called penicillin-binding proteins (PBPs), since they form stable acyl-enzymes with beta-lactam antibiotics, such as penicillins. On the other hand, beta-lactamases react similarly with these antibiotics, but the acyl-enzymes are unstable and rapidly hydrolyzed. Besides, all known PBPs and beta-lactamases share very low sequence similarities, thus rendering it difficult to understand how a PBP could evolve into a beta-lactamase. In this study, we identified a new family of cyanobacterial PBPs featuring the highest sequence similarity with the most widespread class A beta-lactamases. Interestingly, the Omega-loop, which, in the beta-lactamases, carries an essential glutamate involved in the deacylation process, is six amino acids shorter and does not contain any glutamate residue. From this new family of proteins, we characterized PBP-A from Thermosynechococcus elongatus and discovered hydrolytic activity with synthetic thiolesters that are usually good substrates of DD-peptidases. Penicillin degradation pathways as well as acylation and deacylation rates are characteristic of PBPs. In a first attempt to generate beta-lactamase activity, a 90-fold increase in deacylation rate was obtained by introducing a glutamate in the shorter Omega-loop.

  9. Restricted N-glycan conformational space in the PDB and its implication in glycan structure modeling.

    PubMed

    Jo, Sunhwan; Lee, Hui Sun; Skolnick, Jeffrey; Im, Wonpil

    2013-01-01

    Understanding glycan structure and dynamics is central to understanding protein-carbohydrate recognition and its role in protein-protein interactions. Given the difficulties in obtaining the glycan's crystal structure in glycoconjugates due to its flexibility and heterogeneity, computational modeling could play an important role in providing glycosylated protein structure models. To address if glycan structures available in the PDB can be used as templates or fragments for glycan modeling, we present a survey of the N-glycan structures of 35 different sequences in the PDB. Our statistical analysis shows that the N-glycan structures found on homologous glycoproteins are significantly conserved compared to the random background, suggesting that N-glycan chains can be confidently modeled with template glycan structures whose parent glycoproteins share sequence similarity. On the other hand, N-glycan structures found on non-homologous glycoproteins do not show significant global structural similarity. Nonetheless, the internal substructures of these N-glycans, particularly, the substructures that are closer to the protein, show significantly similar structures, suggesting that such substructures can be used as fragments in glycan modeling. Increased interactions with protein might be responsible for the restricted conformational space of N-glycan chains. Our results suggest that structure prediction/modeling of N-glycans of glycoconjugates using structure database could be effective and different modeling approaches would be needed depending on the availability of template structures.

  10. Restricted N-glycan Conformational Space in the PDB and Its Implication in Glycan Structure Modeling

    PubMed Central

    Jo, Sunhwan; Lee, Hui Sun; Skolnick, Jeffrey; Im, Wonpil

    2013-01-01

    Understanding glycan structure and dynamics is central to understanding protein-carbohydrate recognition and its role in protein-protein interactions. Given the difficulties in obtaining the glycan's crystal structure in glycoconjugates due to its flexibility and heterogeneity, computational modeling could play an important role in providing glycosylated protein structure models. To address if glycan structures available in the PDB can be used as templates or fragments for glycan modeling, we present a survey of the N-glycan structures of 35 different sequences in the PDB. Our statistical analysis shows that the N-glycan structures found on homologous glycoproteins are significantly conserved compared to the random background, suggesting that N-glycan chains can be confidently modeled with template glycan structures whose parent glycoproteins share sequence similarity. On the other hand, N-glycan structures found on non-homologous glycoproteins do not show significant global structural similarity. Nonetheless, the internal substructures of these N-glycans, particularly, the substructures that are closer to the protein, show significantly similar structures, suggesting that such substructures can be used as fragments in glycan modeling. Increased interactions with protein might be responsible for the restricted conformational space of N-glycan chains. Our results suggest that structure prediction/modeling of N-glycans of glycoconjugates using structure database could be effective and different modeling approaches would be needed depending on the availability of template structures. PMID:23516343

  11. Evaluation of commercial soy sauce koji strains of Aspergillus oryzae for γ-aminobutyric acid (GABA) production.

    PubMed

    Ab Kadir, Safuan; Wan-Mohtar, Wan Abd Al Qadr Imad; Mohammad, Rosfarizan; Abdul Halim Lim, Sarina; Sabo Mohammed, Abdulkarim; Saari, Nazamid

    2016-10-01

    In this study, four selected commercial strains of Aspergillus oryzae were collected from soy sauce koji. These A. oryzae strains designated as NSK, NSZ, NSJ and NST shared similar morphological characteristics with the reference strain (A. oryzae FRR 1675) which confirmed them as A. oryzae species. They were further evaluated for their ability to produce γ-aminobutyric acid (GABA) by cultivating the spore suspension in a broth medium containing 0.4 % (w/v) of glutamic acid as a substrate for GABA production. The results showed that these strains were capable of producing GABA; however, the concentrations differed significantly (P < 0.05) among themselves. Based on the A. oryzae strains, highest GABA concentration was obtained from NSK (194 mg/L) followed by NSZ (63 mg/L), NSJ (51.53 mg/L) and NST (31.66 mg/L). Therefore, A. oryzae NSK was characterized and the sequence was found to be similar to A. oryzae and A. flavus with 99 % similarity. The evolutionary distance (K nuc) between sequences of identical fungal species was calculated and a phylogenetic tree prepared from the K nuc data showed that the isolate belonged to the A. oryzae species. This finding may allow the development of GABA-rich ingredients using A. oryzae NSK as a starter culture for soy sauce production.

  12. Assembling networks of microbial genomes using linear programming.

    PubMed

    Holloway, Catherine; Beiko, Robert G

    2010-11-20

    Microbial genomes exhibit complex sets of genetic affinities due to lateral genetic transfer. Assessing the relative contributions of parent-to-offspring inheritance and gene sharing is a vital step in understanding the evolutionary origins and modern-day function of an organism, but recovering and showing these relationships is a challenging problem. We have developed a new approach that uses linear programming to find between-genome relationships, by treating tables of genetic affinities (here, represented by transformed BLAST e-values) as an optimization problem. Validation trials on simulated data demonstrate the effectiveness of the approach in recovering and representing vertical and lateral relationships among genomes. Application of the technique to a set comprising Aquifex aeolicus and 75 other thermophiles showed an important role for large genomes as 'hubs' in the gene sharing network, and suggested that genes are preferentially shared between organisms with similar optimal growth temperatures. We were also able to discover distinct and common genetic contributors to each sequenced representative of genus Pseudomonas. The linear programming approach we have developed can serve as an effective inference tool in its own right, and can be an efficient first step in a more-intensive phylogenomic analysis.

  13. Nucleotide sequences and regulational analysis of genes involved in conversion of aniline to catechol in Pseudomonas putida UCC22(pTDN1).

    PubMed Central

    Fukumori, F; Saint, C P

    1997-01-01

    A 9,233-bp HindIII fragment of the aromatic amine catabolic plasmid pTDN1, isolated from a derivative of Pseudomonas putida mt-2 (UCC22), confers the ability to degrade aniline on P. putida KT2442. The fragment encodes six open reading frames which are arranged in the same direction. Their 5' upstream region is part of the direct-repeat sequence of pTDN1. Nucleotide sequence of 1.8 kb of the repeat sequence revealed only a single base pair change compared to the known sequence of IS1071 which is involved in the transposition of the chlorobenzoate genes (C. Nakatsu, J. Ng, R. Singh, N. Straus, and C. Wyndham, Proc. Natl. Acad. Sci. USA 88:8312-8316, 1991). Four open reading frames encode proteins with considerable homology to proteins found in other aromatic-compound degradation pathways. On the basis of sequence similarity, these genes are proposed to encode the large and small subunits of aniline oxygenase (tdnA1 and tdnA2, respectively), a reductase (tdnB), and a LysR-type regulatory gene (tdnR). The putative large subunit has a conserved [2Fe-2S]R Rieske-type ligand center. Two genes, tdnQ and tdnT, which may be involved in amino group transfer, are localized upstream of the putative oxygenase genes. The tdnQ gene product shares about 30% similarity with glutamine synthetases; however, a pUC-based plasmid carrying tdnQ did not support the growth of an Escherichia coli glnA strain in the absence of glutamine. TdnT possesses domains that are conserved among amidotransferases. The tdnQ, tdnA1, tdnA2, tdnB, and tdnR genes are essential for the conversion of aniline to catechol. PMID:8990291

  14. Comparison of reduced metagenome and 16S rRNA gene sequencing for determination of genetic diversity and mother-child overlap of the gut associated microbiota.

    PubMed

    Ravi, Anuradha; Avershina, Ekaterina; Angell, Inga Leena; Ludvigsen, Jane; Manohar, Prasanth; Padmanaban, Sumathi; Nachimuthu, Ramesh; Snipen, Lars; Rudi, Knut

    2018-06-01

    Use of the 16S rRNA gene in microbiota studies is limited by the lack of taxonomic and functional resolution. High resolution analyses are particularly important for understanding transmission and persistence of bacteria. The aim of our work was therefore to compare a novel reduced metagenome sequencing (RMS) approach with 16S rRNA gene sequencing to determine both the metagenome genetic diversity and the mother-to-child sharing of the microbiota in a cohort of 17 mother-child pairs. We found that although both approaches gave comparable results with respect to sample separation and taxonomy, RMS gave higher resolution and the potential for genomic-/functional assignment. Using RMS we estimated that the metagenome size increased from about 60 Mbp for 4-day-old children to about 225 Mbp for mothers. The 4-day-old children shared 7% of the metagenome sequences with the mothers, while the metagenome sequence sharing was >30% among the mothers. We found 15 genomes shared across >50% of the mothers, of which 10 belonged to Clostridia. Only Bacteroides showed a direct mother-child association, with B. vulgatus being abundant in both 4-day-old children and mothers. For the functional assignments, we identified a significant association between antibiotic usage during labor, and quantity of Fosfomycin resistance genes. In conclusion, our results show a higher functional and taxonomic resolution for RMS compared to 16S rRNA gene sequencing, where RMS enabled a detailed description of mother to child gut microbiota transmission - supporting a late recruitment of most gut bacteria and an effect of antibiotic treatment during labor on infant antibiotic resistance gene patterns. Copyright © 2018. Published by Elsevier B.V.

  15. Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

    PubMed Central

    Bamford, Vicki A.; Armour, Maria; Mitchell, Sue A.; Cartron, Michaël; Andrews, Simon C.; Watson, Kimberly A.

    2008-01-01

    YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 Å resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily. PMID:18765906

  16. Actinomycetospora rhizophila sp. nov., an actinomycete isolated from rhizosphere soil of a peace lily (Spathi phyllum Kochii).

    PubMed

    He, Hairong; Zhang, Yuejing; Ma, Zhaoxu; Li, Chuang; Liu, Chongxi; Zhou, Ying; Li, Lianjie; Wang, Xiangjing; Xiang, Wensheng

    2015-05-01

    A novel actinomycete, designated strain NEAU-B-8(T), was isolated from the rhizosphere soil of a peace lily (Spathi phyllum Kochii) collected from Heilongjiang province, north-east China. Key morphological and physiological characteristics as well as chemotaxonomic features of strain NEAU-B-8(T) were congruent with the description of the genus Actinomycetospora , such as the major fatty acids, the whole-cell hydrolysates, the predominant menaquinone and the phospholipid profile. The 16S rRNA gene sequence analysis revealed that strain NEAU-B-8(T) shared the highest sequence similarities with Actinomycetospora lutea JCM 17982(T) (99.3% 16S rRNA gene sequence similarity), Actinomycetospora chlora TT07I-57(T) (98.4 %), Actinomycetospora straminea IY07-55(T) (98.3%) and Actinomycetospora chibensis TT04-21(T) (98.2%); similarities to type strains of other species of this genus were lower than 98%. The phylogenetic tree based on 16S rRNA gene sequences showed that strain NEAU-B-8(T) formed a distinct branch with A. lutea JCM 17982(T) that was supported by a high bootstrap value of 97% in the neighbour-joining tree and was also recovered with the maximum-likelihood algorithm. However, the DNA-DNA relatedness between strain NEAU-B-8(T) and A. lutea JCM 17982(T) was found to be 50.6 ± 1.2%. Meanwhile, strain NEAU-B-8(T) differs from other most closely related strains in phenotypic properties, such as maximum NaCl tolerance, hydrolysis of aesculin and decomposition of urea. On the basis of the morphological, physiological, chemotaxonomic, phylogenetic and DNA-DNA hybridization data, we conclude that strain NEAU-B-8(T) represents a novel species of the genus Actinomycetospora , named Actinomycetospora rhizophila sp. nov. The type strain is NEAU-B-8(T). ( = CGMCC 4.7134(T) =DSM 46673(T)). © 2015 IUMS.

  17. Metabolic Pathway Assignment of Plant Genes based on Phylogenetic Profiling–A Feasibility Study

    PubMed Central

    Weißenborn, Sandra; Walther, Dirk

    2017-01-01

    Despite many developed experimental and computational approaches, functional gene annotation remains challenging. With the rapidly growing number of sequenced genomes, the concept of phylogenetic profiling, which predicts functional links between genes that share a common co-occurrence pattern across different genomes, has gained renewed attention as it promises to annotate gene functions based on presence/absence calls alone. We applied phylogenetic profiling to the problem of metabolic pathway assignments of plant genes with a particular focus on secondary metabolism pathways. We determined phylogenetic profiles for 40,960 metabolic pathway enzyme genes with assigned EC numbers from 24 plant species based on sequence and pathway annotation data from KEGG and Ensembl Plants. For gene sequence family assignments, needed to determine the presence or absence of particular gene functions in the given plant species, we included data of all 39 species available at the Ensembl Plants database and established gene families based on pairwise sequence identities and annotation information. Aside from performing profiling comparisons, we used machine learning approaches to predict pathway associations from phylogenetic profiles alone. Selected metabolic pathways were indeed found to be composed of gene families of greater than expected phylogenetic profile similarity. This was particularly evident for primary metabolism pathways, whereas for secondary pathways, both the available annotation in different species as well as the abstraction of functional association via distinct pathways proved limiting. While phylogenetic profile similarity was generally not found to correlate with gene co-expression, direct physical interactions of proteins were reflected by a significantly increased profile similarity suggesting an application of phylogenetic profiling methods as a filtering step in the identification of protein-protein interactions. This feasibility study highlights the potential and challenges associated with phylogenetic profiling methods for the detection of functional relationships between genes as well as the need to enlarge the set of plant genes with proven secondary metabolism involvement as well as the limitations of distinct pathways as abstractions of relationships between genes. PMID:29163570

  18. Paenibacillus lentus sp. nov., a β-mannanolytic bacterium isolated from mixed soil samples in a selective enrichment using guar gum as the sole carbon source.

    PubMed

    Li, Yong-Fu; Calley, John N; Ebert, Philip J; Helmes, Emily Bulian

    2014-04-01

    A novel bacterial strain, CMG1240(T), was isolated in 1988 from mixed soil samples collected from the United States and South America in a selective enrichment medium with guar gum as the sole carbon source. This microbial isolate showed β-mannanolytic activity to hydrolyse the galactomannans present in guar gum. Strain CMG1240(T) was aerobic, Gram-stain-variable, non-motile, rod-shaped and endospore-forming. It was further examined based on a combination of phenotypic, physiological and genetic characterization. On the basis of 16S rRNA gene sequence similarity, cellular lipid profile and fatty acid composition, strain CMG1240(T) was shown to belong unequivocally to the genus Paenibacillus. Quinone analysis showed that MK-7 was the only menaquinone detected. The main cell-wall sugar was xylose with trace amounts of mannose and glucose. The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, and unknown glycolipids, phospholipids, phosphoglycolipids and other lipids. The peptidoglycan structure was A1γ (meso-diaminopimelic acid-direct). The major fatty acids were anteiso-C15 : 0 and C16 : 0. The DNA G+C content was 46 mol% as determined experimentally and by analysis of the genomic sequence. The 16S rRNA gene sequence of strain CMG1240(T) shared highest similarity with that of Paenibacillus fonticola ZL(T) (97.6 %) while all other tested Paenibacillus strains showed lower sequence similarities (≤95.3 %). The results of DNA-DNA hybridization and chemotaxonomic tests enabled the genotypic and phenotypic differentiation of strain CMG1240(T) from P. fonticola. Based on these results, strain CMG1240(T) ( = ATCC BAA-2594(T) = DSM 25539(T)) should be designated the type strain of a novel species within the genus Paenibacillus, for which the name Paenibacillus lentus sp. nov. is proposed.

  19. [Application of multiple polymorphism genetic markers in determination of half sibling sharing a same mother].

    PubMed

    Que, Ting-zhi; Zhao, Shu-min; Li, Cheng-tao

    2010-08-01

    Determination strategies for half sibling sharing a same mother were investigated through the detection of autosomal and X-chromosomal STR (X-STR) loci and polymorphisms on hypervariable (HV) region of mitochondrial DNA (mtDNA). Genomic DNA were extracted from blood stain samples of the 3 full siblings and one dubious half sibling sharing the same mother with them. Fifteen autosomal STR loci were genotyped by Sinofiler kit, and 19 X-STR loci were genotyped by Mentype Argus X-8 kit and 16 plex in-house system. Polymorphisms of mtDNA HV-I and HV-II were also detected with sequencing technology. Full sibling relationship between the dubious half sibling and each of the 3 full siblings were excluded based on the results of autosomal STR genotyping and calculation of full sibling index (FSI) and half sibling index (HIS). Results of sequencing for mtDNA HV-I and HV-II showed that all of the 4 samples came from a same maternal line. X-STR genotyping results determined that the dubious half sibling shared a same mother with the 3 full siblings. It is reliable to combine three different genotyping technologies including autosomal STR, X-STR and sequencing of mtDNA HV-I and HV-II for determination of half sibling sharing a same mother.

  20. A comparative study of retrotransposons in the centromeric regions of A and B chromosomes of maize.

    PubMed

    Theuri, J; Phelps-Durr, T; Mathews, S; Birchler, J

    2005-01-01

    Bacterial Artificial Chromosomes (BACs) derived from the B chromosome, based on homology with the B specific sequence, were subcloned and sequenced. Analysis of DNA sequence data indicated the presence of 23 common retroelements, as well as novel sequences of B chromosome origin. Generally, where the same retrotransposon type was observed in both A and B chromosomes, there were more copies per unit of sequence in the B centromeric region (the major site of B repeat) than in the A centromere, except for Huck-1. Based on previous estimates of the age of the major burst of transposition into the maize genome, the oldest retrotransposons (Ji-6 and Tekay, approximately 5.0 and 5.2 million years ago, respectively) were found in the B centromere region only, while the next two oldest (Huck-1 and Opie-1) were found in both the A and B sequences. Phylogenetic analysis of Opie retroelements from both A and B centromeres indicated that some of the B Opie centromeric sequences share a more recent common ancestor with A Opie retroelements than they do with other B Opie centromeric sequences. These results imply that the supernumerary maize B chromosome has coexisted with the A chromosomes during that period of transposition. They also support the hypothesis that the B chromosome had its origins from A chromosome elements, or that alternative origins, such as being donated to the maize genome in a wide species cross, preceded six million years ago, because the spectrum of retrotransposons in the two chromosomes is quite similar.

  1. The genome sequence and transcriptome of Potentilla micrantha and their comparison to Fragaria vesca (the woodland strawberry)

    PubMed Central

    Moretto, Marco; Barghini, Elena; Mascagni, Flavia; Natali, Lucia; Brilli, Matteo; Lomsadze, Alexandre; Sonego, Paolo; Giongo, Lara; Alonge, Michael; Velasco, Riccardo; Varotto, Claudio; Šurbanovski, Nada; Borodovsky, Mark; Ward, Judson A; Engelen, Kristof; Cavallini, Andrea; Cestaro, Alessandro

    2018-01-01

    Abstract Background The genus Potentilla is closely related to that of Fragaria, the economically important strawberry genus. Potentilla micrantha is a species that does not develop berries but shares numerous morphological and ecological characteristics with Fragaria vesca. These similarities make P. micrantha an attractive choice for comparative genomics studies with F. vesca. Findings In this study, the P. micrantha genome was sequenced and annotated, and RNA-Seq data from the different developmental stages of flowering and fruiting were used to develop a set of gene predictions. A 327 Mbp sequence and annotation of the genome of P. micrantha, spanning 2674 sequence contigs, with an N50 size of 335,712, estimated to cover 80% of the total genome size of the species was developed. The genus Potentilla has a characteristically larger genome size than Fragaria, but the recovered sequence scaffolds were remarkably collinear at the micro-syntenic level with the genome of F. vesca, its closest sequenced relative. A total of 33,602 genes were predicted, and 95.1% of bench-marking universal single-copy orthologous genes were complete within the presented sequence. Thus, we argue that the majority of the gene-rich regions of the genome have been sequenced. Conclusions Comparisons of RNA-Seq data from the stages of floral and fruit development revealed genes differentially expressed between P. micrantha and F. vesca.The data presented are a valuable resource for future studies of berry development in Fragaria and the Rosaceae and they also shed light on the evolution of genome size and organization in this family. PMID:29659812

  2. The genome sequence and transcriptome of Potentilla micrantha and their comparison to Fragaria vesca (the woodland strawberry).

    PubMed

    Buti, Matteo; Moretto, Marco; Barghini, Elena; Mascagni, Flavia; Natali, Lucia; Brilli, Matteo; Lomsadze, Alexandre; Sonego, Paolo; Giongo, Lara; Alonge, Michael; Velasco, Riccardo; Varotto, Claudio; Šurbanovski, Nada; Borodovsky, Mark; Ward, Judson A; Engelen, Kristof; Cavallini, Andrea; Cestaro, Alessandro; Sargent, Daniel James

    2018-04-01

    The genus Potentilla is closely related to that of Fragaria, the economically important strawberry genus. Potentilla micrantha is a species that does not develop berries but shares numerous morphological and ecological characteristics with Fragaria vesca. These similarities make P. micrantha an attractive choice for comparative genomics studies with F. vesca. In this study, the P. micrantha genome was sequenced and annotated, and RNA-Seq data from the different developmental stages of flowering and fruiting were used to develop a set of gene predictions. A 327 Mbp sequence and annotation of the genome of P. micrantha, spanning 2674 sequence contigs, with an N50 size of 335,712, estimated to cover 80% of the total genome size of the species was developed. The genus Potentilla has a characteristically larger genome size than Fragaria, but the recovered sequence scaffolds were remarkably collinear at the micro-syntenic level with the genome of F. vesca, its closest sequenced relative. A total of 33,602 genes were predicted, and 95.1% of bench-marking universal single-copy orthologous genes were complete within the presented sequence. Thus, we argue that the majority of the gene-rich regions of the genome have been sequenced. Comparisons of RNA-Seq data from the stages of floral and fruit development revealed genes differentially expressed between P. micrantha and F. vesca.The data presented are a valuable resource for future studies of berry development in Fragaria and the Rosaceae and they also shed light on the evolution of genome size and organization in this family.

  3. Anti-infective activity of apolipoprotein domain derived peptides in vitro: identification of novel antimicrobial peptides related to apolipoprotein B with anti-HIV activity

    PubMed Central

    2010-01-01

    Background Previous reports have shown that peptides derived from the apolipoprotein E receptor binding region and the amphipathic α-helical domains of apolipoprotein AI have broad anti-infective activity and antiviral activity respectively. Lipoproteins and viruses share a similar cell biological niche, being of overlapping size and displaying similar interactions with mammalian cells and receptors, which may have led to other antiviral sequences arising within apolipoproteins, in addition to those previously reported. We therefore designed a series of peptides based around either apolipoprotein receptor binding regions, or amphipathic α-helical domains, and tested these for antiviral and antibacterial activity. Results Of the nineteen new peptides tested, seven showed some anti-infective activity, with two of these being derived from two apolipoproteins not previously used to derive anti-infective sequences. Apolipoprotein J (151-170) - based on a predicted amphipathic alpha-helical domain from apolipoprotein J - had measurable anti-HSV1 activity, as did apolipoprotein B (3359-3367) dp (apoBdp), the latter being derived from the LDL receptor binding domain B of apolipoprotein B. The more active peptide - apoBdp - showed similarity to the previously reported apoE derived anti-infective peptide, and further modification of the apoBdp sequence to align the charge distribution more closely to that of apoEdp or to introduce aromatic residues resulted in increased breadth and potency of activity. The most active peptide of this type showed similar potent anti-HIV activity, comparable to that we previously reported for the apoE derived peptide apoEdpL-W. Conclusions These data suggest that further antimicrobial peptides may be obtained using human apolipoprotein sequences, selecting regions with either amphipathic α-helical structure, or those linked to receptor-binding regions. The finding that an amphipathic α-helical region of apolipoprotein J has antiviral activity comparable with that for the previously reported apolipoprotein AI derived peptide 18A, suggests that full-length apolipoprotein J may also have such activity, as has been reported for full-length apolipoprotein AI. Although the strength of the anti-infective activity of the sequences identified was limited, this could be increased substantially by developing related mutant peptides. Indeed the apolipoprotein B-derived peptide mutants uncovered by the present study may have utility as HIV therapeutics or microbicides. PMID:20298574

  4. Complete genome sequence of a tomato infecting tomato mottle mosaic virus in New York

    USDA-ARS?s Scientific Manuscript database

    Complete genome sequence of an emerging isolate of tomato mottle mosaic virus (ToMMV) infecting experimental nicotianan benthamiana plants in up-state New York was obtained using small RNA deep sequencing. ToMMV_NY-13 shared 99% sequence identity to ToMMV isolates from Mexico and Florida. Broader d...

  5. In silico peptide-binding predictions of passerine MHC class I reveal similarities across distantly related species, suggesting convergence on the level of protein function.

    PubMed

    Follin, Elna; Karlsson, Maria; Lundegaard, Claus; Nielsen, Morten; Wallin, Stefan; Paulsson, Kajsa; Westerdahl, Helena

    2013-04-01

    The major histocompatibility complex (MHC) genes are the most polymorphic genes found in the vertebrate genome, and they encode proteins that play an essential role in the adaptive immune response. Many songbirds (passerines) have been shown to have a large number of transcribed MHC class I genes compared to most mammals. To elucidate the reason for this large number of genes, we compared 14 MHC class I alleles (α1-α3 domains), from great reed warbler, house sparrow and tree sparrow, via phylogenetic analysis, homology modelling and in silico peptide-binding predictions to investigate their functional and genetic relationships. We found more pronounced clustering of the MHC class I allomorphs (allele specific proteins) in regards to their function (peptide-binding specificities) compared to their genetic relationships (amino acid sequences), indicating that the high number of alleles is of functional significance. The MHC class I allomorphs from house sparrow and tree sparrow, species that diverged 10 million years ago (MYA), had overlapping peptide-binding specificities, and these similarities across species were also confirmed in phylogenetic analyses based on amino acid sequences. Notably, there were also overlapping peptide-binding specificities in the allomorphs from house sparrow and great reed warbler, although these species diverged 30 MYA. This overlap was not found in a tree based on amino acid sequences. Our interpretation is that convergent evolution on the level of the protein function, possibly driven by selection from shared pathogens, has resulted in allomorphs with similar peptide-binding repertoires, although trans-species evolution in combination with gene conversion cannot be ruled out.

  6. Unexpected expansion of tRNA substrate recognition by the yeast m1G9 methyltransferase Trm10.

    PubMed

    Swinehart, William E; Henderson, Jeremy C; Jackman, Jane E

    2013-08-01

    N-1 Methylation of the nearly invariant purine residue found at position 9 of tRNA is a nucleotide modification found in multiple tRNA species throughout Eukarya and Archaea. First discovered in Saccharomyces cerevisiae, the tRNA methyltransferase Trm10 is a highly conserved protein both necessary and sufficient to catalyze all known instances of m1G9 modification in yeast. Although there are 19 unique tRNA species that contain a G at position 9 in yeast, and whose fully modified sequence is known, only 9 of these tRNA species are modified with m1G9 in wild-type cells. The elements that allow Trm10 to distinguish between structurally similar tRNA species are not known, and sequences that are shared between all substrate or all nonsubstrate tRNAs have not been identified. Here, we demonstrate that the in vitro methylation activity of yeast Trm10 is not sufficient to explain the observed pattern of modification in vivo, as additional tRNA species are substrates for Trm10 m1G9 methyltransferase activity. Similarly, overexpression of Trm10 in yeast yields m1G9 containing tRNA species that are ordinarily unmodified in vivo. Thus, yeast Trm10 has a significantly broader tRNA substrate specificity than is suggested by the observed pattern of modification in wild-type yeast. These results may shed light onto the suggested involvement of Trm10 in other pathways in other organisms, particularly in higher eukaryotes that contain up to three different genes with sequence similarity to the single TRM10 gene in yeast, and where these other enzymes have been implicated in pathways beyond tRNA processing.

  7. Characterization of Am IT, an anti-insect β-toxin isolated from the venom of scorpion Androctonus mauretanicus.

    PubMed

    Oukkache, Naoual; ElJaoudi, Rachid; Chgoury, Fatima; Rocha, Marisa Teixeira; Sabatier, Jean-Marc

    2015-06-25

    In the present study, a 'novel' toxin, called Am IT from the venom of scorpion Androctonus mauretanicus is isolated and characterized. A detailed analysis of the action of Am IT on insect axonal sodium currents is reported. Am IT was purified through gel filtration followed by C18 reversed-phase HPLC. Toxicity of Am IT in vivo was assessed on male German cockroach (Blattella germanica) larvae and C57/BL6 mice. Cross-reactivity of Am IT with two β-toxins was evidenced using (125)I-iodinated toxin-based radioimmunoassays with synaptosomal preparations from rat brain. The complete amino acid sequence of Am IT was finally determined by Edman sequencing. Am IT was observed to compete with AaH IT4 purified from the venom of scorpion Androctonus australis in binding assays. It was recognized by an antibody raised against a β-type toxin, which indicated some structural similarity with β-toxins (or related toxin family). The 'novel' toxin exhibited dual activity since it competed with anti-mammal toxins in binding assays as well as showed contracting activity to insect. The toxin competed with radio-labeled β-toxin Css IV by binding to Na(+) channels of rat brain synaptosomes. Analysis of toxin amino acid sequences showed that Am IT shares high structural identity (92%) with AaH IT4. In conclusion, Am IT not only reveals an anti-insect compound properties secreted by 'Old World' scorpions, paralyzing insect larvae by binding to Na(+) channels on larvae's nerve-cell membranes, but also exerts toxic activity in mice, which is similar to anti-mammal toxins from 'New World' scorpions (North and South Americas). Therefore, Am IT appears to be structurally and functionally similar to AaH IT4.

  8. Screening for and isolation and identification of malathion-degrading bacteria: cloning and sequencing a gene that potentially encodes the malathion-degrading enzyme, carboxylestrase in soil bacteria.

    PubMed

    Goda, Sayed K; Elsayed, Iman E; Khodair, Taha A; El-Sayed, Walaa; Mohamed, Mervat E

    2010-11-01

    Five malathion-degrading bacterial strains were enriched and isolated from soil samples collected from different agricultural sites in Cairo, Egypt. Malathion was used as a sole source of carbon (50 mg/l) to enumerate malathion degraders, which were designated as IS1, IS2, IS3, IS4, and IS5. They were identified, based on their morphological and biochemical characteristics, as Pseudomonas sp., Pseudomonas putida, Micrococcus lylae, Pseudomonas aureofaciens, and Acetobacter liquefaciens, respectively. IS1 and IS2, which showed the highest degrading activity, were selected for further identification by partial sequence analysis of their 16S rRNA genes. The 16S rRNA gene of IS1 shared 99% similarity with that of Alphaprotoebacterium BAL284, while IS2 scored 100% similarity with that of Pseudomonas putida 32zhy. Malathion residues almost completely disappeared within 6 days of incubation in IS2 liquid cultures. LC/ESI-MS analysis confirmed the degradation of malathion to malathion monocarboxylic and dicarboxylic acids, which formed as a result of carboxylesterase activity. A carboxylesterase gene (CE) was amplified from the IS2 genome by using specifically designed PCR primers. The sequence analysis showed a significant similarity to a known CE gene in different Pseudomonas sp. We report here the isolation of a new malathion-degrading bacteria from soils in Egypt that may be very well adapted to the climatic and environmental conditions of the country. We also report the partial cloning of a new CE gene. Due to their high biodegradation activity, the bacteria isolated from this work merit further study as potential biological agents for the remediation of soil, water, or crops contaminated with the pesticide malathion.

  9. Acinetobacter kookii sp. nov., isolated from soil.

    PubMed

    Choi, Ji Young; Ko, Gwangpyo; Jheong, Weonghwa; Huys, Geert; Seifert, Harald; Dijkshoorn, Lenie; Ko, Kwan Soo

    2013-12-01

    Two Gram-stain-negative, non-fermentative bacterial strains, designated 11-0202(T) and 11-0607, were isolated from soil in South Korea, and four others, LUH 13522, LUH 8638, LUH 10268 and LUH 10288, were isolated from a beet field in Germany, soil in the Netherlands, and sediment of integrated fish farms in Malaysia and Thailand, respectively. Based on 16S rRNA, rpoB and gyrB gene sequences, they are considered to represent a novel species of the genus Acinetobacter. Their 16S rRNA gene sequences showed greatest pairwise similarity to Acinetobacter beijerinckii NIPH 838(T) (97.9-98.4 %). They shared highest rpoB and gyrB gene sequence similarity with Acinetobacter johnsonii DSM 6963(T) and Acinetobacter bouvetii 4B02(T) (85.4-87.6 and 78.1-82.7 %, respectively). Strain 11-0202(T) displayed low DNA-DNA reassociation values (<40 %) with the most closely related species of the genus Acinetobacter. The six strains utilized azelate, 2,3-butanediol, ethanol and dl-lactate as sole carbon sources. Cellular fatty acid analyses showed similarities to profiles of related species of the genus Acinetobacter: summed feature 3 (C16 : 1ω7c, C16 : 1ω6c; 24.3-27.2 %), C18 : 1ω9c (19.9-22.1 %), C16 : 0 (15.2-22.0 %) and C12 : 0 (9.2-14.2 %). On the basis of the current findings, it is concluded that the six strains represent a novel species, for which the name Acinetobacter kookii sp. nov. is proposed. The type strain is 11-0202(T) ( = KCTC 32033(T) = JCM 18512(T)).

  10. Structural Characterization and Oligomerization of the TssL Protein, a Component Shared by Bacterial Type VI and Type IVb Secretion Systems*

    PubMed Central

    Durand, Eric; Zoued, Abdelrahim; Spinelli, Silvia; Watson, Paul J. H.; Aschtgen, Marie-Stéphanie; Journet, Laure; Cambillau, Christian; Cascales, Eric

    2012-01-01

    The Type VI secretion system (T6SS) is a macromolecular system distributed in Gram-negative bacteria, responsible for the secretion of effector proteins into target cells. The T6SS has a broad versatility as it can target both eukaryotic and prokaryotic cells. It is therefore involved in host pathogenesis or killing neighboring bacterial cells to colonize a new niche. At the architecture level, the T6SS core apparatus is composed of 13 proteins, which assemble in two subcomplexes. One of these subcomplexes, composed of subunits that share structural similarities with bacteriophage tail and baseplate components, is anchored to the cell envelope by the membrane subcomplex. This latter is constituted of at least three proteins, TssL, TssM, and TssJ. The crystal structure of the TssJ outer membrane lipoprotein and its interaction with the inner membrane TssM protein have been recently reported. TssL and TssM share sequence homology and characteristics with two components of the Type IVb secretion system (T4bSS), IcmH/DotU and IcmF, respectively. In this study, we report the crystal structure of the cytoplasmic domain of the TssL inner membrane protein from the enteroaggregative Escherichia coli Sci-1 T6SS. It folds as a hook-like structure composed of two three-helix bundles. Two TssL molecules associate to form a functional complex. Although the TssL trans-membrane segment is the main determinant of self-interaction, contacts between the cytoplasmic domains are required for TssL function. Based on sequence homology and secondary structure prediction, we propose that the TssL structure is the prototype for the members of the TssL and IcmH/DotU families. PMID:22371492

  11. Communication pitfalls of traditional history and physical write-up documentation

    PubMed Central

    Brown, Jeffrey L

    2017-01-01

    Background An unofficial standardized “write-up” outline is commonly used for documenting history and physical examinations, giving oral presentations, and teaching clinical skills. Despite general acceptance, there is an apparent discrepancy between the way clinical encounters are conducted and how they are documented. Methods Fifteen medical school websites were randomly selected from search-engine generated lists. One example of a history and physical write-up from each of six sites, one teaching outline from each of nine additional sites, and recommendations for documentation made in two commonly used textbooks were compared for similarities and differences. Results Except for minor variations in documenting background information, all sampled materials utilized the same standardized format. When the examiners’ early perceptions of the patients’ degree of illness or level of distress were described, they were categorized as “general appearance” within the physical findings. Contrary to clinical practice, none of the examples or recommendations documented these early perceptions before chief concerns and history were presented. Discussion An examiner’s initial perceptions of a patient’s affect, degree of illness, and level of distress can influence the content of the history, triage decisions, and prioritization of likely diagnoses. When chief concerns and history are shared without benefit of this information, erroneous assumptions and miscommunications can result. Conclusion This survey confirms common use of a standardized outline for documenting, communicating, and teaching history-taking and physical examination protocol. The present outline shares early observations out of clinical sequence and may provide inadequate context for accurate interpretation of chief concerns and history. Corrective actions include modifying the documentation sequence to conform to clinical practice and teaching contextual methodology for sharing patient information. PMID:28096709

  12. Comparative analysis of the 5{prime} genomic and promoter regions between the mouse (Hdh) and human Huntington disease (HD) gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kalchman, M.; Lin, B.; Nasir, J.

    1994-09-01

    The mouse homologue of the Huntington disease gene (Hdh) has recently been cloned and mapped to a region of synteny with the human, on mouse chromosome 5. The two genes share a high degree of both coding (90% amino acid) and nucleotide (86.2%) identity. We have subsequently performed a detailed comparison of the genomic organization of the 5{prime} region of the two genes encompassing the promoter region and first five exons of both the human and mouse genes. The comparative sequence analysis of the promoter region between HD and Hdh reveals two highly conserved regions. One region (-56 to -118)more » (+1 is the ATG start codon), shared 84% nucleotide identity and another region (-130 to -206) had 81% nucleotide identity. Nine putative Sp1 sites appear in the human promoter region contrasted with only 3 in a similar region in the mouse. Furthermore, 17 and 20 base pair direct repeats present in the HD 5{prime} region are absent in the similar Hdh region. Although both the mouse and human intron/exon boundaries conform to the GT/AG rule, the intron sizes between HD and Hdh are markedly different. The first four introns in Hdh are 15, 7, 5 and 0.5 kb compared to sizes of 10, 15, 7 and 0.5 kb, respectively. Comparison between the mouse and human intronic sequences immediately adjacent to the first five exons (excluding exon 1) reveals only about 46 to 50% identity within the first 60 bp of intronic sequence. Furthermore, we have identified novel polymorphic di-, tri- and tetra-nucleotide repeats in Hdh introns of various mouse strains that are not present in the human. For example, polymorphic CT repeats are present in introns 2 and 4 of Hdh and a novel mouse 56 AAG trinucleotide repeat (interrupted by an AAGG) is also located within intron 2. This information concerning the promoter and genomic organization of both HD and Hdh is critical for designing appropriate gene targetting vectors for studying the normal function of the HD and Hdh genes in model systems.« less

  13. Domain structure, GTP-hydrolyzing activity and 7S RNA binding of Acidianus ambivalens ffh-homologous protein suggest an SRP-like complex in archaea.

    PubMed

    Moll, R; Schmidtke, S; Schäfer, G

    1999-01-01

    In this study we provide, for the first time, experimental evidence that a protein homologous to bacterial Ffh is part of an SRP-like ribonucleoprotein complex in hyperthermophilic archaea. The gene encoding the Ffh homologue in the hyperthermophilic archaeote Acidianus ambivalens has been cloned and sequenced. Recombinant Ffh protein was expressed in E. coli and subjected to biochemical and functional studies. A. ambivalens Ffh encodes a 50.4-kDa protein that is structured by three distinct regions: the N-terminal hydrophilic N-region (N), the GTP/GDP-binding domain (G) and a C-terminal located C-domain (C). The A. ambivalens Ffh sequence shares 44-46% sequence similarity with Ffh of methanogenic archaea, 34-36% similarity with eukaryal SRP54 and 30-34% similarity with bacterial Ffh. A polyclonal antiserum raised against the first two domains of A. ambivalens Ffh reacts specifically with a single protein (apparent molecular mass: 46 kDa, termed p46) present in cytosolic and in plasmamembrane cell fractions of A. ambivalens. Recombinant Ffh has a melting point of tm = 89 degreesC. Its intrinsic GTPase activity obviously depends on neutral pH and low ionic strength with a preference for chloride and acetate salts. Highest rates of GTP hydrolysis have been achieved at 81 degreesC in presence of 0.1-1 mm Mg2+. GTP hydrolysis is significantly inhibited by high glycerol concentrations, and the GTP hydrolysis rate also markedly decreases by addition of detergents. The Km for GTP is 13.7 microm at 70 degreesC and GTP hydrolysis is strongly inhibited by GDP (Ki = 8 microm). A. ambivalens Ffh, which includes an RNA-binding motif in the C-terminal domain, is shown to bind specifically to 7S RNA of the related crenarchaeote Sulfolobus solfataricus. Comparative sequence analysis reveals the presence of typical signal sequences in plasma membrane as well as extracellular proteins of hyperthermophilic crenarchaea which strongly supposes recognition events by an Ffh containing SRP-like particle in these organisms.

  14. Democratization of genetic data: connecting government approval of clinical tests with data sharing

    PubMed Central

    Ross, Theodora S.

    2015-01-01

    Abstract When a doctor orders a genetic test, patients assume that the test will yield a useful result to guide how their physicians take care of them. That assumption is frequently correct, but not always. Until recently, a genetic test only interrogated the sequence of one or two genes. Now, DNA-sequencing technologies are so fast and cheap that they have enabled clinicians to sequence panels of genes that may or may not be relevant to the patient's condition. The technology has outpaced our ability to interpret the results. Connecting approval of clinical tests to data sharing could help close this gap. PMID:27148568

  15. Using GBrowse 2.0 to visualize and share next-generation sequence data

    PubMed Central

    2013-01-01

    GBrowse is a mature web-based genome browser that is suitable for deployment on both public and private web sites. It supports most of genome browser features, including qualitative and quantitative (wiggle) tracks, track uploading, track sharing, interactive track configuration, semantic zooming and limited smooth track panning. As of version 2.0, GBrowse supports next-generation sequencing (NGS) data by providing for the direct display of SAM and BAM sequence alignment files. SAM/BAM tracks provide semantic zooming and support both local and remote data sources. This article provides step-by-step instructions for configuring GBrowse to display NGS data. PMID:23376193

  16. Democratization of genetic data: connecting government approval of clinical tests with data sharing.

    PubMed

    Ross, Theodora S

    2015-10-01

    When a doctor orders a genetic test, patients assume that the test will yield a useful result to guide how their physicians take care of them. That assumption is frequently correct, but not always. Until recently, a genetic test only interrogated the sequence of one or two genes. Now, DNA-sequencing technologies are so fast and cheap that they have enabled clinicians to sequence panels of genes that may or may not be relevant to the patient's condition. The technology has outpaced our ability to interpret the results. Connecting approval of clinical tests to data sharing could help close this gap.

  17. Gestural and symbolic development among apes and humans: support for a multimodal theory of language evolution.

    PubMed

    Gillespie-Lynch, Kristen; Greenfield, Patricia M; Lyn, Heidi; Savage-Rumbaugh, Sue

    2014-01-01

    What are the implications of similarities and differences in the gestural and symbolic development of apes and humans?This focused review uses as a starting point our recent study that provided evidence that gesture supported the symbolic development of a chimpanzee, a bonobo, and a human child reared in language-enriched environments at comparable stages of communicative development. These three species constitute a complete clade, species possessing a common immediate ancestor. Communicative behaviors observed among all species in a clade are likely to have been present in the common ancestor. Similarities in the form and function of many gestures produced by the chimpanzee, bonobo, and human child suggest that shared non-verbal skills may underlie shared symbolic capacities. Indeed, an ontogenetic sequence from gesture to symbol was present across the clade but more pronounced in child than ape. Multimodal expressions of communicative intent (e.g., vocalization plus persistence or eye-contact) were normative for the child, but less common for the apes. These findings suggest that increasing multimodal expression of communicative intent may have supported the emergence of language among the ancestors of humans. Therefore, this focused review includes new studies, since our 2013 article, that support a multimodal theory of language evolution.

  18. Characterization of the stromatolite microbiome from Little Darby Island, The Bahamas using predictive and whole shotgun metagenomic analysis.

    PubMed

    Casaburi, Giorgio; Duscher, Alexandrea A; Reid, R Pamela; Foster, Jamie S

    2016-05-01

    Modern stromatolites represent ideal ecosystems to understand the biological processes required for the precipitation of carbonate due to their long evolutionary history and occurrence in a wide range of habitats. However, most of the prior molecular work on stromatolites has focused on understanding the taxonomic complexity and not fully elucidating the functional capabilities of these systems. Here, we begin to characterize the microbiome associated with stromatolites of Little Darby Island, The Bahamas using predictive metagenomics of the 16S rRNA gene coupled with direct whole shotgun sequencing. The metagenomic analysis of the Little Darby stromatolites revealed many shared taxa and core pathways associated with biologically induced carbonate precipitation, suggesting functional convergence within Bahamian stromatolites. A comparison of the Little Darby stromatolites with other lithifying microbial ecosystems also revealed that although factors, such as geographic location and salinity, do drive some differences within the population, there are extensive similarities within the microbial populations. These results suggest that for stromatolite formation, 'who' is in the community is not as critical as metabolic activities and environmental interactions. Together, these analyses help improve our understanding of the similarities among lithifying ecosystems and provide an important first step in characterizing the shared microbiome of modern stromatolites. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  19. Characterization of the stromatolite microbiome from Little Darby Island, The Bahamas using predictive and whole shotgun metagenomic analysis

    PubMed Central

    Casaburi, Giorgio; Duscher, Alexandrea A.; Reid, R. Pamela; Foster, Jamie S.

    2018-01-01

    Summary Modern stromatolites represent ideal ecosystems to understand the biological processes required for the precipitation of carbonate due to their long evolutionary history and occurrence in a wide range of habitats. However, most of the prior molecular work on stromatolites has focused on understanding the taxonomic complexity and not fully elucidating the functional capabilities of these systems. Here, we begin to characterize the microbiome associated with stromatolites of Little Darby Island, The Bahamas using predictive metagenomics of the 16S rRNA gene coupled with direct whole shotgun sequencing. The metagenomic analysis of the Little Darby stromatolites revealed many shared taxa and core pathways associated with biologically induced carbonate precipitation, suggesting functional convergence within Bahamian stromatolites. A comparison of the Little Darby stromatolites with other lithifying microbial ecosystems also revealed that although factors, such as geographic location and salinity, do drive some differences within the population, there are extensive similarities within the microbial populations. These results suggest that for stromatolite formation, ‘who’ is in the community is not as critical as metabolic activities and environmental interactions. Together, these analyses help improve our understanding of the similarities among lithifying ecosystems and provide an important first step in characterizing the shared microbiome of modern stromatolites. PMID:26471001

  20. Gestural and symbolic development among apes and humans: support for a multimodal theory of language evolution

    PubMed Central

    Gillespie-Lynch, Kristen; Greenfield, Patricia M.; Lyn, Heidi; Savage-Rumbaugh, Sue

    2014-01-01

    What are the implications of similarities and differences in the gestural and symbolic development of apes and humans?This focused review uses as a starting point our recent study that provided evidence that gesture supported the symbolic development of a chimpanzee, a bonobo, and a human child reared in language-enriched environments at comparable stages of communicative development. These three species constitute a complete clade, species possessing a common immediate ancestor. Communicative behaviors observed among all species in a clade are likely to have been present in the common ancestor. Similarities in the form and function of many gestures produced by the chimpanzee, bonobo, and human child suggest that shared non-verbal skills may underlie shared symbolic capacities. Indeed, an ontogenetic sequence from gesture to symbol was present across the clade but more pronounced in child than ape. Multimodal expressions of communicative intent (e.g., vocalization plus persistence or eye-contact) were normative for the child, but less common for the apes. These findings suggest that increasing multimodal expression of communicative intent may have supported the emergence of language among the ancestors of humans. Therefore, this focused review includes new studies, since our 2013 article, that support a multimodal theory of language evolution. PMID:25400607

  1. Investigation of the HLA component involved in rheumatoid arthritis (RA) by using the marker association-segregation [chi][sup 2] (MASC) method: Rejection of the unifying-shared-epitope hypothesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dizier, M.H.; Eliaou, J.F.; Babron, M.C.

    In order to investigate the HLA component involved in rheumatoid arthritis (RA), the authors tested genetic models by the marker association-segregation [chi][sup 2] (MASC) method, using the HLA genotypic distribution observed in a sample of 97 RA patients. First they tested models assuming the involvement of a susceptibility gene linked to the DR locus. They showed that the present data are compatible with a simple model assuming the effect of a recessive allele of a biallelic locus linked to the DR locus and without any assumption of synergistic effect. Then they considered models assuming the direct involvement of the DRmore » allele products, and tested the unifying-shared-epitope hypothesis, which has been proposed. Under this hypothesis the DR alleles are assumed to be directly involved in the susceptibility to the disease because of the presence of similar or identical amino acid sequences in position 70-74 of the third hypervariable region of the DRBI molecules, shared by the RA-associated DR alleles DR4Dw4, DR4Dw14, and DR1. This hypothesis was strongly rejected with the present data. In the case of the direct involvement of the DR alleles, hypotheses more complex that the unifying-shared-epitope hypothesis would have to be considered. 28 refs., 2 tabs.« less

  2. Phylogenetic analysis of two goat-origin PCV2 isolates in China.

    PubMed

    Wang, Xiaomin; Li, Wenliang; Xu, Xianglan; Wang, Wei; He, Kongwang; Fan, Hongjie

    2018-04-20

    Complete genome characterization of non-porcine origin Porcine circovirus type 2 (PCV2) was first described in 2014 in China. In the present study, we first identified PCV2 nucleotides in goat samples and the prevalence of PCV2 in goat was 6.15%. However, only two new strains, Goat2014-4 and Goat2014-5, could be completely sequenced. The genome of the strain Goat2014-4, which collected from the goat infected with PPRV, contains 1766 nt; strain Goat2014-5, which originated from a healthy goat, is comprised of 1767 nt. The results showed that they shared the highest nucleotide identity with BDH and the lowest similarity with DK1980PMWSfree strain and they belonged only to genotype PCV2d. Meanwhile, they shared higher homology with porcine-origin PCV2 strains than others. Moreover, a detailed analysis of the capsid amino acid sequences revealed that there were distinct differences for goat2014-4 (708 bp) and goat2014-5 (705 bp); strain Goat2014-4 showed an elongation of two amino acids, and strains Goat2014-5 showed an elongation of one amino acid compared with other reference strains. This is the first report of the genetic analysis of goat-origin PCV2 isolates. It also provides an additional supported evidence for cross-species transmission of PCV2. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Genomic Evidence for the Evolution of Streptococcus equi: Host Restriction, Increased Virulence, and Genetic Exchange with Human Pathogens

    PubMed Central

    Paillot, Romain; Steward, Karen F.; Webb, Katy; Ainslie, Fern; Jourdan, Thibaud; Bason, Nathalie C.; Holroyd, Nancy E.; Mungall, Karen; Quail, Michael A.; Sanders, Mandy; Simmonds, Mark; Willey, David; Brooks, Karen; Aanensen, David M.; Spratt, Brian G.; Jolley, Keith A.; Maiden, Martin C. J.; Kehoe, Michael; Chanter, Neil; Bentley, Stephen D.; Robinson, Carl; Maskell, Duncan J.; Parkhill, Julian; Waller, Andrew S.

    2009-01-01

    The continued evolution of bacterial pathogens has major implications for both human and animal disease, but the exchange of genetic material between host-restricted pathogens is rarely considered. Streptococcus equi subspecies equi (S. equi) is a host-restricted pathogen of horses that has evolved from the zoonotic pathogen Streptococcus equi subspecies zooepidemicus (S. zooepidemicus). These pathogens share approximately 80% genome sequence identity with the important human pathogen Streptococcus pyogenes. We sequenced and compared the genomes of S. equi 4047 and S. zooepidemicus H70 and screened S. equi and S. zooepidemicus strains from around the world to uncover evidence of the genetic events that have shaped the evolution of the S. equi genome and led to its emergence as a host-restricted pathogen. Our analysis provides evidence of functional loss due to mutation and deletion, coupled with pathogenic specialization through the acquisition of bacteriophage encoding a phospholipase A2 toxin, and four superantigens, and an integrative conjugative element carrying a novel iron acquisition system with similarity to the high pathogenicity island of Yersinia pestis. We also highlight that S. equi, S. zooepidemicus, and S. pyogenes share a common phage pool that enhances cross-species pathogen evolution. We conclude that the complex interplay of functional loss, pathogenic specialization, and genetic exchange between S. equi, S. zooepidemicus, and S. pyogenes continues to influence the evolution of these important streptococci. PMID:19325880

  4. Simultaneous profiling of seed-associated bacteria and fungi reveals antagonistic interactions between microorganisms within a shared epiphytic microbiome on Triticum and Brassica seeds.

    PubMed

    Links, Matthew G; Demeke, Tigst; Gräfenhan, Tom; Hill, Janet E; Hemmingsen, Sean M; Dumonceaux, Tim J

    2014-04-01

    In order to address the hypothesis that seeds from ecologically and geographically diverse plants harbor characteristic epiphytic microbiota, we characterized the bacterial and fungal microbiota associated with Triticum and Brassica seed surfaces. The total microbial complement was determined by amplification and sequencing of a fragment of chaperonin 60 (cpn60). Specific microorganisms were quantified by qPCR. Bacteria and fungi corresponding to operational taxonomic units (OTU) that were identified in the sequencing study were isolated and their interactions examined. A total of 5477 OTU were observed from seed washes. Neither total epiphytic bacterial load nor community richness/evenness was significantly different between the seed types; 578 OTU were shared among all samples at a variety of abundances. Hierarchical clustering revealed that 203 were significantly different in abundance on Triticum seeds compared with Brassica. Microorganisms isolated from seeds showed 99-100% identity between the cpn60 sequences of the isolates and the OTU sequences from this shared microbiome. Bacterial strains identified as Pantoea agglomerans had antagonistic properties toward one of the fungal isolates (Alternaria sp.), providing a possible explanation for their reciprocal abundances on both Triticum and Brassica seeds. cpn60 enabled the simultaneous profiling of bacterial and fungal microbiota and revealed a core seed-associated microbiota shared between diverse plant genera. © 2014 AAFC. New Phytologist © 2014 New Phytologist Trust.

  5. Simultaneous profiling of seed-associated bacteria and fungi reveals antagonistic interactions between microorganisms within a shared epiphytic microbiome on Triticum and Brassica seeds

    PubMed Central

    Links, Matthew G; Demeke, Tigst; Gräfenhan, Tom; Hill, Janet E; Hemmingsen, Sean M; Dumonceaux, Tim J

    2014-01-01

    In order to address the hypothesis that seeds from ecologically and geographically diverse plants harbor characteristic epiphytic microbiota, we characterized the bacterial and fungal microbiota associated with Triticum and Brassica seed surfaces. The total microbial complement was determined by amplification and sequencing of a fragment of chaperonin 60 (cpn60). Specific microorganisms were quantified by qPCR. Bacteria and fungi corresponding to operational taxonomic units (OTU) that were identified in the sequencing study were isolated and their interactions examined. A total of 5477 OTU were observed from seed washes. Neither total epiphytic bacterial load nor community richness/evenness was significantly different between the seed types; 578 OTU were shared among all samples at a variety of abundances. Hierarchical clustering revealed that 203 were significantly different in abundance on Triticum seeds compared with Brassica. Microorganisms isolated from seeds showed 99–100% identity between the cpn60 sequences of the isolates and the OTU sequences from this shared microbiome. Bacterial strains identified as Pantoea agglomerans had antagonistic properties toward one of the fungal isolates (Alternaria sp.), providing a possible explanation for their reciprocal abundances on both Triticum and Brassica seeds. cpn60 enabled the simultaneous profiling of bacterial and fungal microbiota and revealed a core seed-associated microbiota shared between diverse plant genera. PMID:24444052

  6. Unveiling fungal zooflagellates as members of freshwater picoeukaryotes: evidence from a molecular diversity study in a deep meromictic lake.

    PubMed

    Lefèvre, Emilie; Bardot, Corinne; Noël, Christophe; Carrias, Jean-François; Viscogliosi, Eric; Amblard, Christian; Sime-Ngando, Télesphore

    2007-01-01

    This study presents an original 18S rRNA PCR survey of the freshwater picoeukaryote community, and was designed to detect unidentified heterotrophic picoflagellates (size range 0.6-5 microm) which are prevalent throughout the year within the heterotrophic flagellate assemblage in Lake Pavin. Four clone libraries were constructed from samples collected in two contrasting zones in the lake. Computerized statistic tools have suggested that sequence retrieval was representative of the in situ picoplankton diversity. The two sampling zones exhibited similar diversity patterns but shared only about 5% of the operational taxonomic units (OTUs). Phylogenetic analysis clustered our sequences into three taxonomic groups: Alveolates (30% of OTUs), Fungi (23%) and Cercozoa (19%). Fungi thus substantially contributed to the detected diversity, as was additionally supported by direct microscopic observations of fungal zoospores and sporangia. A large fraction of the sequences belonged to parasites, including Alveolate sequences affiliated to the genus Perkinsus known as zooparasites, and chytrids that include host-specific parasitic fungi of various freshwater phytoplankton species, primarily diatoms. Phylogenetic analysis revealed five novel clades that probably include typical freshwater environmental sequences. Overall, from the unsuspected fungal diversity unveiled, we think that fungal zooflagellates have been misidentified as phagotrophic nanoflagellates in previous studies. This is in agreement with a recent experimental demonstration that zoospore-producing fungi and parasitic activity may play an important role in aquatic food webs.

  7. Limited Genetic Diversity Preceded Extinction of the Tasmanian Tiger

    PubMed Central

    Menzies, Brandon R.; Renfree, Marilyn B.; Heider, Thomas; Mayer, Frieder; Hildebrandt, Thomas B.; Pask, Andrew J.

    2012-01-01

    The Tasmanian tiger or thylacine was the largest carnivorous marsupial when Europeans first reached Australia. Sadly, the last known thylacine died in captivity in 1936. A recent analysis of the genome of the closely related and extant Tasmanian devil demonstrated limited genetic diversity between individuals. While a similar lack of diversity has been reported for the thylacine, this analysis was based on just two individuals. Here we report the sequencing of an additional 12 museum-archived specimens collected between 102 and 159 years ago. We examined a portion of the mitochondrial DNA hyper-variable control region and determined that all sequences were on average 99.5% identical at the nucleotide level. As a measure of accuracy we also sequenced mitochondrial DNA from a mother and two offspring. As expected, these samples were found to be 100% identical, validating our methods. We also used 454 sequencing to reconstruct 2.1 kilobases of the mitochondrial genome, which shared 99.91% identity with the two complete thylacine mitochondrial genomes published previously. Our thylacine genomic data also contained three highly divergent putative nuclear mitochondrial sequences, which grouped phylogenetically with the published thylacine mitochondrial homologs but contained 100-fold more polymorphisms than the conserved fragments. Together, our data suggest that the thylacine population in Tasmania had limited genetic diversity prior to its extinction, possibly as a result of their geographic isolation from mainland Australia approximately 10,000 years ago. PMID:22530022

  8. Genomic Inbreeding and Relatedness in Wild Panda Populations.

    PubMed

    Garbe, John R; Prakapenka, Dzianis; Tan, Cheng; Da, Yang

    2016-01-01

    Inbreeding and relatedness in wild panda populations are important parameters for panda conservation. Habitat loss and fragmentation are expected to increase inbreeding but the actual inbreeding levels in natural panda habitats were unknown. Using 150,025 SNPs and 14,926 SNPs selected from published whole-genome sequences, we estimated genomic inbreeding coefficients and relatedness of 49 pandas including 34 wild pandas sampled from six habitats. Qinling and Liangshan pandas had the highest levels of inbreeding and relatedness measured by genomic inbreeding and coancestry coefficients, whereas the inbreeding levels in Qionglai and Minshan were 28-45% of those in Qinling and Liangshan. Genomic coancestry coefficients between pandas from different habitats showed that panda populations from the four largest habitats, Minshan, Qionglai, Qinling and Liangshan, were genetically unrelated. Pandas between these four habitats on average shared 66.0-69.1% common alleles and 45.6-48.6% common genotypes, whereas pandas within each habitat shared 71.8-77.0% common alleles and 51.7-60.4% common genotypes. Pandas in the smaller populations of Qinling and Liangshan were more similarly to each other than pandas in the larger populations of Qionglai and Minshan according to three genomic similarity measures. Panda genetic differentiation between these habitats was positively related to their geographical distances. Most pandas separated by 200 kilometers or more shared no common ancestral alleles. The results provided a genomic quantification of the actual levels of inbreeding and relatedness among pandas in their natural habitats, provided genomic confirmation of the relationship between genetic diversity and geographical distances, and provided genomic evidence to the urgency of habitat protection.

  9. An archaebacterial homologue of the essential eubacterial cell division protein FtsZ.

    PubMed Central

    Baumann, P; Jackson, S P

    1996-01-01

    Life falls into three fundamental domains--Archaea, Bacteria, and Eucarya (formerly archaebacteria, eubacteria, and eukaryotes,. respectively). Though Archaea lack nuclei and share many morphological features with Bacteria, molecular analyses, principally of the transcription and translation machineries, have suggested that Archaea are more related to Eucarya than to Bacteria. Currently, little is known about the archaeal cell division apparatus. In Bacteria, a crucial component of the cell division machinery is FtsZ, a GTPase that localizes to a ring at the site of septation. Interestingly, FtsZ is distantly related in sequence to eukaryotic tubulins, which also interact with GTP and are components of the eukaryotic cell cytoskeleton. By screening for the ability to bind radiolabeled nucleotides, we have identified a protein of the hyperthermophilic archaeon Pyrococcus woesei that interacts tightly and specifically with GTP. Furthermore, through screening an expression library of P. woesei genomic DNA, we have cloned the gene encoding this protein. Sequence comparisons reveal that the P. woesei GTP-binding protein is strikingly related in sequence to eubacterial FtsZ and is marginally more similar to eukaryotic tubulins than are bacterial FtsZ proteins. Phylogenetic analyses reinforce the notion that there is an evolutionary linkage between FtsZ and tubulins. These findings suggest that the archaeal cell division apparatus may be fundamentally similar to that of Bacteria and lead us to consider the evolutionary relationships between Archaea, Bacteria, and Eucarya. Images Fig. 1 Fig. 2 PMID:8692886

  10. Comparison of the aggregation of homologous β2-microglobulin variants reveals protein solubility as a key determinant of amyloid formation

    PubMed Central

    Pashley, Clare L.; Hewitt, Eric W.; Radford, Sheena E.

    2016-01-01

    The mouse and human β2-microglobulin protein orthologs are 70 % identical in sequence and share 88 % sequence similarity. These proteins are predicted by various algorithms to have similar aggregation and amyloid propensities. However, whilst human β2m (hβ2m) forms amyloid-like fibrils in denaturing conditions (e.g. pH 2.5) in the absence of NaCl, mouse β2m (mβ2m) requires the addition of 0.3 M NaCl to cause fibrillation. Here, the factors which give rise to this difference in amyloid propensity are investigated. We utilise structural and mutational analyses, fibril growth kinetics and solubility measurements under a range of pH and salt conditions, to determine why these two proteins have different amyloid propensities. The results show that, although other factors influence the fibril growth kinetics, a striking difference in the solubility of the proteins is a key determinant of the different amyloidogenicity of hβ2m and mβ2m. The relationship between protein solubility and lag time of amyloid formation is not captured by current aggregation or amyloid prediction algorithms, indicating a need to better understand the role of solubility on the lag time of amyloid formation. The results demonstrate the key contribution of protein solubility in determining amyloid propensity and lag time of amyloid formation, highlighting how small differences in protein sequence can have dramatic effects on amyloid formation. PMID:26780548

  11. Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

    PubMed

    Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

    2015-12-01

    The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.

  12. The Effects of Family, Dentition and Dental Caries on the Salivary Microbiome

    PubMed Central

    Foxman, Betsy; Luo, Ting; Srinivasan, Usha; Ramadugu, Kirtana; Wen, Ai; Goldberg, Deborah; Shedden, Kerby; Crout, Richard; McNeil, Daniel W.; Weyant, Robert; Marazita, Mary L.

    2016-01-01

    Background Family members share genes, environment and microbial communities. If there is a strong effect of family on the salivary microbiota, controlling for family will enhance identification of microbial communities associated with cariogenesis. The current study was designed to assess the similarity of the salivary microbiome among families and the association between the salivary microbiome and dental decay taking age into account. Methods We selected families (n= 49) participating in the cohort study of oral health conducted by the Center for Oral Health Research in Appalachia (COHRA). All families where at least two children and at least one parent gave a saliva sample (n=173) were included. Saliva samples were collected at least one hour after eating or drinking. Following DNA extraction, the V6 region of the 16s rRNA gene was sequenced. Paired ends were joined using FLASH, sequences were de-multiplexed and filtered using QIIME 1.9.0, and taxonomy was assigned using the RDP Classifier and sequences aligned with the CORE database using PyNAST. Results The salivary microbiome changed with age and was more similar within families than between families. There was no difference in the diversity of the salivary microbiome by dental decay. After taking into account age and family, signals of dental decay were weak in the saliva, whether examined at the phyla, genus or operational taxonomic level. Conclusions The salivary microbiome does not appear to be a good indicator of dental caries. PMID:27157862

  13. Sequencing Strategies for Population and Cancer Epidemiology Studies (SeqSPACE) Webinar Series

    Cancer.gov

    The Sequencing Strategies for Population and Cancer Epidemiology Studies (SeqSPACE) Webinar Series provides an opportunity for our grantees and other interested individuals to share lessons learned and practical information regarding the application of next generation sequencing to cancer epidemiology studies.

  14. Complete genome sequence of a new maize-associated cytorhabdovirus

    USDA-ARS?s Scientific Manuscript database

    A new 11,877 nt cytorhabdovirus sequence with 6 open reading frames has been identified in a maize sample. It shares 50 and 51% genome-wide nucleotide sequence identity with northern cereal mosaic cytorhabdovirus (NCMV) and barley yellow striate mosaic cytorhabdovirus (BYSMV), respectively....

  15. Application of representational difference analysis to identify genomic differences between Bradyrhizobium elkanii and B. Japonicum species.

    PubMed

    Soares, René Arderius; Passaglia, Luciane Maria Pereira

    2010-10-01

    Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.

  16. Microbacterium agarici sp. nov., Microbacterium humi sp. nov. and Microbacterium pseudoresistens sp. nov., isolated from the base of the mushroom Agaricus blazei.

    PubMed

    Young, C-C; Busse, H-J; Langer, S; Chu, Jiunn-Nan; Schumann, P; Arun, A B; Shen, Fo-Ting; Rekha, P D; Kämpfer, P

    2010-04-01

    Three Gram-positive, rod-shaped bacteria (strains CC-SBCK-209( T), CC-12309(T) and CC-5209(T)) were isolated from the stalk of the edible mushroom Agaricus blazei grown in the laboratory. 16S rRNA gene sequence analysis indicated that all three isolates clearly belonged to the genus Microbacterium. Strains CC-SBCK-209( T) and CC-12309(T) were most related closely to the type strain of Microbacterium halotolerans (95.9 and 96.1 % 16S rRNA gene sequence similarity, respectively). These two novel strains shared 97.9 % 16S rRNA gene sequence similarity. Levels of similarity to the type strains of all other recognized Microbacterium species were lower than 95.5 %. The third strain (CC-5209( T)) showed the highest 16S rRNA gene sequence similarity to the type strain of Microbacterium resistens (97.6 %); levels of similarity to the type strains of all other recognized Microbacterium species were lower than 96 %. The quinone systems of strains CC-SBCK-209(T), CC-12309(T) and CC-5209(T) consisted of MK-11/MK-12, MK-11/MK-10 and MK-13 as major compounds, respectively. All three strains contained ornithine in their peptidoglycan. The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol and an unknown glycolipid. The polyamine pattern consisted of spermidine and spermine as predominant components. Fatty acid profiles (anteiso-C(15 : 0), iso-C(16 : 0) and anteiso-C(17 : 0 ) as major components) supported the affiliation of all three strains to the genus Microbacterium. The results of physiological and biochemical tests and DNA-DNA hybridization experiments allowed the clear phenotypic and genotypic differentiation of strains CC-SBCK-209(T) and CC-12309( T) from M. halotolerans and other closely related Microbacterium species. Strain CC-5209(T) could be differentiated clearly from M. resistens both genotypically and phenotypically. Based on these data, the novel strains are considered to represent three novel species of the genus Microbacterium. The names proposed for these organisms are Microbacterium agarici sp. nov. [type strain CC-SBCK-209( T) (=DSM 21798(T)=CCM 7686(T))], Microbacterium humi sp. nov. [type strain CC-12309(T) (=DSM 21799(T)=CCM 7687(T))] and Microbacterium pseudoresistens sp. nov. [type strain CC-5209(T) (=DSM 22185(T)=CCM 7688(T))].

  17. Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China.

    PubMed

    Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

    2017-02-23

    Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5-80.8% nucleotide identity and 95.4-97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China.

  18. Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China

    PubMed Central

    Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

    2017-01-01

    Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5–80.8% nucleotide identity and 95.4–97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China. PMID:28230168

  19. Genome-Wide Comparative Analysis Reveals Similar Types of NBS Genes in Hybrid Citrus sinensis Genome and Original Citrus clementine Genome and Provides New Insights into Non-TIR NBS Genes

    PubMed Central

    Wang, Yunsheng; Zhou, Lijuan; Li, Dazhi; Dai, Liangying; Lawton-Rauh, Amy; Srimani, Pradip K.; Duan, Yongping; Luo, Feng

    2015-01-01

    In this study, we identified and compared nucleotide-binding site (NBS) domain-containing genes from three Citrus genomes (C. clementina, C. sinensis from USA and C. sinensis from China). Phylogenetic analysis of all Citrus NBS genes across these three genomes revealed that there are three approximately evenly numbered groups: one group contains the Toll-Interleukin receptor (TIR) domain and two different Non-TIR groups in which most of proteins contain the Coiled Coil (CC) domain. Motif analysis confirmed that the two groups of CC-containing NBS genes are from different evolutionary origins. We partitioned NBS genes into clades using NBS domain sequence distances and found most clades include NBS genes from all three Citrus genomes. This suggests that three Citrus genomes have similar numbers and types of NBS genes. We also mapped the re-sequenced reads of three pomelo and three mandarin genomes onto the C. sinensis genome. We found that most NBS genes of the hybrid C. sinensis genome have corresponding homologous genes in both pomelo and mandarin genomes. The homologous NBS genes in pomelo and mandarin suggest that the parental species of C. sinensis may contain similar types of NBS genes. This explains why the hybrid C. sinensis and original C. clementina have similar types of NBS genes in this study. Furthermore, we found that sequence variation amongst Citrus NBS genes were shaped by multiple independent and shared accelerated mutation accumulation events among different groups of NBS genes and in different Citrus genomes. Our comparative analyses yield valuable insight into the structure, organization and evolution of NBS genes in Citrus genomes. Furthermore, our comprehensive analysis showed that the non-TIR NBS genes can be divided into two groups that come from different evolutionary origins. This provides new insights into non-TIR genes, which have not received much attention. PMID:25811466

  20. Genome-wide comparative analysis reveals similar types of NBS genes in hybrid Citrus sinensis genome and original Citrus clementine genome and provides new insights into non-TIR NBS genes.

    PubMed

    Wang, Yunsheng; Zhou, Lijuan; Li, Dazhi; Dai, Liangying; Lawton-Rauh, Amy; Srimani, Pradip K; Duan, Yongping; Luo, Feng

    2015-01-01

    In this study, we identified and compared nucleotide-binding site (NBS) domain-containing genes from three Citrus genomes (C. clementina, C. sinensis from USA and C. sinensis from China). Phylogenetic analysis of all Citrus NBS genes across these three genomes revealed that there are three approximately evenly numbered groups: one group contains the Toll-Interleukin receptor (TIR) domain and two different Non-TIR groups in which most of proteins contain the Coiled Coil (CC) domain. Motif analysis confirmed that the two groups of CC-containing NBS genes are from different evolutionary origins. We partitioned NBS genes into clades using NBS domain sequence distances and found most clades include NBS genes from all three Citrus genomes. This suggests that three Citrus genomes have similar numbers and types of NBS genes. We also mapped the re-sequenced reads of three pomelo and three mandarin genomes onto the C. sinensis genome. We found that most NBS genes of the hybrid C. sinensis genome have corresponding homologous genes in both pomelo and mandarin genomes. The homologous NBS genes in pomelo and mandarin suggest that the parental species of C. sinensis may contain similar types of NBS genes. This explains why the hybrid C. sinensis and original C. clementina have similar types of NBS genes in this study. Furthermore, we found that sequence variation amongst Citrus NBS genes were shaped by multiple independent and shared accelerated mutation accumulation events among different groups of NBS genes and in different Citrus genomes. Our comparative analyses yield valuable insight into the structure, organization and evolution of NBS genes in Citrus genomes. Furthermore, our comprehensive analysis showed that the non-TIR NBS genes can be divided into two groups that come from different evolutionary origins. This provides new insights into non-TIR genes, which have not received much attention.

  1. Recapitulating phylogenies using k-mers: from trees to networks.

    PubMed

    Bernard, Guillaume; Ragan, Mark A; Chan, Cheong Xin

    2016-01-01

    Ernst Haeckel based his landmark Tree of Life on the supposed ontogenic recapitulation of phylogeny, i.e. that successive embryonic stages during the development of an organism re-trace the morphological forms of its ancestors over the course of evolution. Much of this idea has since been discredited. Today, phylogenies are often based on families of molecular sequences. The standard approach starts with a multiple sequence alignment, in which the sequences are arranged relative to each other in a way that maximises a measure of similarity position-by-position along their entire length. A tree (or sometimes a network) is then inferred. Rigorous multiple sequence alignment is computationally demanding, and evolutionary processes that shape the genomes of many microbes (bacteria, archaea and some morphologically simple eukaryotes) can add further complications. In particular, recombination, genome rearrangement and lateral genetic transfer undermine the assumptions that underlie multiple sequence alignment, and imply that a tree-like structure may be too simplistic. Here, using genome sequences of 143 bacterial and archaeal genomes, we construct a network of phylogenetic relatedness based on the number of shared k -mers (subsequences at fixed length k ). Our findings suggest that the network captures not only key aspects of microbial genome evolution as inferred from a tree, but also features that are not treelike. The method is highly scalable, allowing for investigation of genome evolution across a large number of genomes. Instead of using specific regions or sequences from genome sequences, or indeed Haeckel's idea of ontogeny, we argue that genome phylogenies can be inferred using k -mers from whole-genome sequences. Representing these networks dynamically allows biological questions of interest to be formulated and addressed quickly and in a visually intuitive manner.

  2. DNA barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera).

    PubMed

    Foottit, Robert G; Maw, Eric; Hebert, P D N

    2014-01-01

    Many studies have shown the suitability of sequence variation in the 5' region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage.

  3. Revised systematics of Holospora-like bacteria and characterization of "Candidatus Gortzia infectiva", a novel macronuclear symbiont of Paramecium jenningsi.

    PubMed

    Boscaro, Vittorio; Fokin, Sergei I; Schrallhammer, Martina; Schweikert, Michael; Petroni, Giulio

    2013-01-01

    The genus Holospora (Rickettsiales) includes highly infectious nuclear symbionts of the ciliate Paramecium with unique morphology and life cycle. To date, nine species have been described, but a molecular characterization is lacking for most of them. In this study, we have characterized a novel Holospora-like bacterium (HLB) living in the macronuclei of a Paramecium jenningsi population. This bacterium was morphologically and ultrastructurally investigated in detail, and its life cycle and infection capabilities were described. We also obtained its 16S rRNA gene sequence and developed a specific probe for fluorescence in situ hybridization experiments. A new taxon, "Candidatus Gortzia infectiva", was established for this HLB according to its unique characteristics and the relatively low DNA sequence similarities shared with other bacteria. The phylogeny of the order Rickettsiales based on 16S rRNA gene sequences has been inferred, adding to the available data the sequence of the novel bacterium and those of two Holospora species (Holospora obtusa and Holospora undulata) characterized for the purpose. Our phylogenetic analysis provided molecular support for the monophyly of HLBs and showed a possible pattern of evolution for some of their features. We suggested to classify inside the family Holosporaceae only HLBs, excluding other more distantly related and phenotypically different Paramecium endosymbionts.

  4. Linkage Study Revealed Complex Haplotypes in a Multifamily due to Different Mutations in CAPN3 Gene in an Iranian Ethnic Group.

    PubMed

    Mojbafan, Marzieh; Tonekaboni, Seyed Hassan; Abiri, Maryam; Kianfar, Soudeh; Sarhadi, Ameneh; Nilipour, Yalda; Tavakkoly-Bazzaz, Javad; Zeinali, Sirous

    2016-07-01

    Calpainopathy is an autosomal recessive form of limb girdle muscular dystrophies which is caused by mutation in CAPN3 gene. In the present study, co-segregation of this disorder was analyzed with four short tandem repeat markers linked to the CAPN3 gene. Three apparently unrelated Iranian families with same ethnicity were investigated. Haplotype analysis and sequencing of the CAPN3 gene were performed. DNA sample from one of the patients was simultaneously sent for next-generation sequencing. DNA sequencing identified two mutations. It was seen as a homozygous c.2105C>T in exon 19 in one family, a homozygous novel mutation c.380G>A in exon 3 in another family, and a compound heterozygote form of these two mutations in the third family. Next-generation sequencing also confirmed our results. It was expected that, due to the rare nature of limb girdle muscular dystrophies, affected individuals from the same ethnic group share similar mutations. Haplotype analysis showed two different homozygote patterns in two families, yet a compound heterozygote pattern in the third family as seen in the mutation analysis. This study shows that haplotype analysis would help in determining presence of different founders.

  5. DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)

    PubMed Central

    Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.

    2014-01-01

    Background Many studies have shown the suitability of sequence variation in the 5′ region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106

  6. Pistachio (Pistacia vera L.) is a new natural host of Hop stunt viroid.

    PubMed

    Elleuch, Amine; Hamdi, Imen; Ellouze, Olfa; Ghrab, Mohamed; Fkahfakh, Hatem; Drira, Noureddine

    2013-10-01

    Besides hop, Hop stunt viroid (HpSVd) infects many woody species including grapevine, citrus, peach, plum, apricot, almond, pomegranate, mulberry and jujube. Here, we report the first detection of HpSVd in pistachio (Pistacia vera L.). Samples corresponding to 16 pistachio cultivars were obtained from a nearby almond collection. From these samples, low molecular weight RNAs were extracted for double polyacrylamide gel electrophoresis, northern-blot analysis and reverse transcription polymerase chain reaction assays. HpSVd was detected in 4 of the 16 pistachio cultivars in the first year and in 6 in the second, being also detected in the almond collection. Examination of the nucleotide sequences of pistachio and almond isolates revealed 13 new sequence variants. Sequences from pistachio shared 92-96 % similarity with the first reported HpSVd sequence (GenBank X00009), and multiple alignment and phylogenetic analyses showed that one pistachio isolate (HpSVdPis67Jabari) clustered with the plum group, whereas all the others clustered with the hop, and the recombinants plum-citrus and plum-Hop/cit3 groups. By identifying pistachio as a new natural host, we confirm that HpSVd is an ubiquitous and genetically variable viroid that infects many different fruit trees cultivated worldwide.

  7. Abundant aftershock sequence of the 2015 Mw7.5 Hindu Kush intermediate-depth earthquake

    NASA Astrophysics Data System (ADS)

    Li, Chenyu; Peng, Zhigang; Yao, Dongdong; Guo, Hao; Zhan, Zhongwen; Zhang, Haijiang

    2018-05-01

    The 2015 Mw7.5 Hindu Kush earthquake occurred at a depth of 213 km beneath the Hindu Kush region of Afghanistan. While many early aftershocks were missing from the global earthquake catalogues, this sequence was recorded continuously by eight broad-band stations within 500 km. Here we use a waveform matching technique to systematically detect earthquakes around the main shock. More than 3000 events are detected within 35 d after the main shock, as compared with 42 listed in the Advanced National Seismic System catalogue (or 196 in the International Seismological Centre catalogue). The aftershock sequence generally follows the Omori's law with a decay constant p = 0.92. We also apply the recently developed double-pair double-difference technique to relocate all detected aftershocks. Most of them are located to the west of the hypocentre of the main shock, consistent with the westward propagation of the main-shock rupture. The aftershocks outline a nearly vertical southward dipping plane, which matches well with one of the nodal planes of the main shock. We conclude that the aftershock sequence of this intermediate-depth earthquake shares many similarities with those for shallow earthquakes and infer that there are some common mechanisms responsible for shallow and intermediate-depth earthquakes.

  8. First complete genome sequence of an emerging cucumber green mottle mosaic virus isolate in North America

    USDA-ARS?s Scientific Manuscript database

    The complete genome sequence (6,423 nt) of an emerging Cucumber green mottle mosaic virus (CGMMV) isolate on cucumber in North America was determined through deep sequencing of sRNA and rapid amplification of cDNA ends. It shares 99% nucleotide sequence identity to the Asian genotype, but only 90% t...

  9. Comparative genomics and prediction of conditionally dispensable sequences in legume-infecting Fusarium oxysporum formae speciales facilitates identification of candidate effectors.

    PubMed

    Williams, Angela H; Sharma, Mamta; Thatcher, Louise F; Azam, Sarwar; Hane, James K; Sperschneider, Jana; Kidd, Brendan N; Anderson, Jonathan P; Ghosh, Raju; Garg, Gagan; Lichtenzveig, Judith; Kistler, H Corby; Shea, Terrance; Young, Sarah; Buck, Sally-Anne G; Kamphuis, Lars G; Saxena, Rachit; Pande, Suresh; Ma, Li-Jun; Varshney, Rajeev K; Singh, Karam B

    2016-03-05

    Soil-borne fungi of the Fusarium oxysporum species complex cause devastating wilt disease on many crops including legumes that supply human dietary protein needs across many parts of the globe. We present and compare draft genome assemblies for three legume-infecting formae speciales (ff. spp.): F. oxysporum f. sp. ciceris (Foc-38-1) and f. sp. pisi (Fop-37622), significant pathogens of chickpea and pea respectively, the world's second and third most important grain legumes, and lastly f. sp. medicaginis (Fom-5190a) for which we developed a model legume pathosystem utilising Medicago truncatula. Focusing on the identification of pathogenicity gene content, we leveraged the reference genomes of Fusarium pathogens F. oxysporum f. sp. lycopersici (tomato-infecting) and F. solani (pea-infecting) and their well-characterised core and dispensable chromosomes to predict genomic organisation in the newly sequenced legume-infecting isolates. Dispensable chromosomes are not essential for growth and in Fusarium species are known to be enriched in host-specificity and pathogenicity-associated genes. Comparative genomics of the publicly available Fusarium species revealed differential patterns of sequence conservation across F. oxysporum formae speciales, with legume-pathogenic formae speciales not exhibiting greater sequence conservation between them relative to non-legume-infecting formae speciales, possibly indicating the lack of a common ancestral source for legume pathogenicity. Combining predicted dispensable gene content with in planta expression in the model legume-infecting isolate, we identified small conserved regions and candidate effectors, four of which shared greatest similarity to proteins from another legume-infecting ff. spp. We demonstrate that distinction of core and potential dispensable genomic regions of novel F. oxysporum genomes is an effective tool to facilitate effector discovery and the identification of gene content possibly linked to host specificity. While the legume-infecting isolates didn't share large genomic regions of pathogenicity-related content, smaller regions and candidate effector proteins were highly conserved, suggesting that they may play specific roles in inducing disease on legume hosts.

  10. Lactobacillus shenzhenensis sp. nov., isolated from a fermented dairy beverage.

    PubMed

    Zou, Yuanqiang; Liu, Feng; Fang, Chengxiang; Wan, Daiwei; Yang, Rentao; Su, Qingqing; Yang, Ruifu; Zhao, Jiao

    2013-05-01

    Two Lactobacillus strains, designated LY-73(T) and LY-30B, were isolated from a dairy beverage, sold in Shenzhen market, China. The two isolates were Gram-positive, non-spore-forming, non-motile, facultatively anaerobic rods that were heterofermentative and did not exhibit catalase activity. Sequencing of the 16S rRNA, pheS and rpoA genes revealed that the two isolates shared 99.5, 99.8 and 99.9 % sequence similarity, which indicates that they belong to the same species. Phylogenetic analysis demonstrated clustering of the two isolates with the genus Lactobacillus. Strain LY-73(T) showed highest 16S rRNA gene sequence similarities with Lactobacillus harbinensis KACC 12409(T) (97.73%), Lactobacillus perolens DSM 12744(T) (96.96 %) and Lactobacillus selangorensis DSM 13344(T) (93.10 %). Comparative analyses of their rpoA and pheS gene sequences indicated that the novel strains were significantly different from other Lactobacillus species. Low DNA-DNA reassociation values (50.5 %) were obtained between strain LY-73(T) and its phylogenetically closest neighbours. The G+C contents of the DNA of the two novel isolates were 56.1 and 56.5 mol%. Straight-chain unsaturated fatty acids C18 : 1ω9c (78.85 and 74.29 %) were the dominant components, and the cell-wall peptidoglycan was of the l-Lys-d-Asp type. Based on phenotypic characteristics, and chemotaxonomic and genotypic data, the novel strains represent a novel species of the genus Lactobacillus, for which the name Lactobacillus shenzhenensis sp. nov. is proposed, with LY-73(T) ( = CCTCC M 2011481(T) = KACC 16878(T)) as the type strain.

  11. Directional genomic hybridization for chromosomal inversion discovery and detection.

    PubMed

    Ray, F Andrew; Zimmerman, Erin; Robinson, Bruce; Cornforth, Michael N; Bedford, Joel S; Goodwin, Edwin H; Bailey, Susan M

    2013-04-01

    Chromosomal rearrangements are a source of structural variation within the genome that figure prominently in human disease, where the importance of translocations and deletions is well recognized. In principle, inversions-reversals in the orientation of DNA sequences within a chromosome-should have similar detrimental potential. However, the study of inversions has been hampered by traditional approaches used for their detection, which are not particularly robust. Even with significant advances in whole genome approaches, changes in the absolute orientation of DNA remain difficult to detect routinely. Consequently, our understanding of inversions is still surprisingly limited, as is our appreciation for their frequency and involvement in human disease. Here, we introduce the directional genomic hybridization methodology of chromatid painting-a whole new way of looking at structural features of the genome-that can be employed with high resolution on a cell-by-cell basis, and demonstrate its basic capabilities for genome-wide discovery and targeted detection of inversions. Bioinformatics enabled development of sequence- and strand-specific directional probe sets, which when coupled with single-stranded hybridization, greatly improved the resolution and ease of inversion detection. We highlight examples of the far-ranging applicability of this cytogenomics-based approach, which include confirmation of the alignment of the human genome database and evidence that individuals themselves share similar sequence directionality, as well as use in comparative and evolutionary studies for any species whose genome has been sequenced. In addition to applications related to basic mechanistic studies, the information obtainable with strand-specific hybridization strategies may ultimately enable novel gene discovery, thereby benefitting the diagnosis and treatment of a variety of human disease states and disorders including cancer, autism, and idiopathic infertility.

  12. Accurate prediction of secreted substrates and identification of a conserved putative secretion signal for type III secretion systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Samudrala, Ram; Heffron, Fred; McDermott, Jason E.

    2009-04-24

    The type III secretion system is an essential component for virulence in many Gram-negative bacteria. Though components of the secretion system apparatus are conserved, its substrates, effector proteins, are not. We have used a machine learning approach to identify new secreted effectors. The method integrates evolutionary measures, such as the pattern of homologs in a range of other organisms, and sequence-based features, such as G+C content, amino acid composition and the N-terminal 30 residues of the protein sequence. The method was trained on known effectors from Salmonella typhimurium and validated on a corresponding set of effectors from Pseudomonas syringae, aftermore » eliminating effectors with detectable sequence similarity. The method was able to identify all of the known effectors in P. syringae with a specificity of 84% and sensitivity of 82%. The reciprocal validation, training on P. syringae and validating on S. typhimurium, gave similar results with a specificity of 86% when the sensitivity level was 87%. These results show that type III effectors in disparate organisms share common features. We found that maximal performance is attained by including an N-terminal sequence of only 30 residues, which agrees with previous studies indicating that this region contains the secretion signal. We then used the method to define the most important residues in this putative secretion signal. Finally, we present novel predictions of secreted effectors in S. typhimurium, some of which have been experimentally validated, and apply the method to predict secreted effectors in the genetically intractable human pathogen Chlamydia trachomatis. This approach is a novel and effective way to identify secreted effectors in a broad range of pathogenic bacteria for further experimental characterization and provides insight into the nature of the type III secretion signal.« less

  13. Genetic analysis of H9N2 avian influenza viruses circulated in broiler flocks: a case study in Iraq in 2014-2015.

    PubMed

    Kraidi, Qayssar Ali; Madadgar, Omid; Ghalyanchi Langeroudi, Arash; Karimi, Vahid

    2017-04-01

    H9N2 avian influenza viruses (AIVs) have been recorded in Eurasian for several years. Since 2004-2005, the disease has become endemic in Iraq, causing serious economic losses in the poultry industry. The hemagglutinin (HA) and neuraminidase (NA), two out of eight protein-coding genes, play an important role during the early stage of infection and hinder virus assembling. Little is known about the genetic information of the H9N2 viruses currently circulating in Iraq; thus, gene sequences of six AIVS of the H9N2 subtype have been detected and analyzed in the period of 2014-2015 from different outbreaks of broiler flocks in five provinces situated in the middle and southern parts of Iraq. Genetic comparison of the partial sequences of HA gene indicated that all Iraqi viruses are related to each other and could be divided into two subgroups. Viruses of the first and the second subgroups demonstrated a high similar identity with Pakistani and Iranian viruses, respectively. The nucleotide sequences of the NA protein of the all studied Iraqi viruses were very similar (95.2-100% identity), and shared high nucleotide sequence identity with Iranian, Pakistani, and Lebanese strains. All six recent viruses possessed histidine, alanine, and leucine at positions 183, 190, and 226, respectively, which are the key residues in receptor-binding sites. The Iraqi viruses were closely related to viruses of G1-like lineage isolated from poultry flocks of Iran and Pakistan, suggesting that possible epidemiological links could be derived from a common origin. Further investigations are required and should include the viral isolation and full-length molecular characterization of H9N2 AIVs in this area.

  14. Verrucosispora sonchi sp. nov., a novel endophytic actinobacterium isolated from the leaves of common sowthistle (Sonchus oleraceus L.).

    PubMed

    Ma, Zhaoxu; Zhao, Shanshan; Cao, Tingting; Liu, Chongxi; Huang, Ying; Gao, Yuhang; Yan, Kai; Xiang, Wensheng; Wang, Xiangjing

    2016-12-01

    A novel actinobacterium, designated strain NEAU-QY3T, was isolated from the leaves of Sonchus oleraceus L. and examined using a polyphasic taxonomic approach. The organism formed single spores with smooth surface on substrate mycelia. Phylogenetic analysis based on the 16S rRNA gene sequence indicated that the strain had a close association with the genus Verrucosispora and shared the highest sequence similarity with Verrucosispora qiuiae RtIII47T (99.17 %), an association that was supported by a bootstrap value of 94 % in the neighbour-joining tree and also recovered with the maximum-likelihood algorithm. The strain also showed high 16S rRNA gene sequence similarities to Xiangella phaseoli NEAU-J5T (98.78 %), Jishengella endophytica 202201T (98.51 %), Micromonospora eburnea LK2-10T (98.28 %), Verrucosispora lutea YIM 013T (98.23 %) and Salinispora pacifica CNR-114T (98.23 %). Furthermore, phylogenetic analysis based on the gyrB gene sequences supported the conclusion that strain NEAU-QY3T should be assigned to the genus Verrucosispora. However, the DNA-DNA hybridization relatedness values between strain NEAU-QY3T and V. qiuiae RtIII47T and V. lutea YIM 013T were below 70 %. With reference to phenotypic characteristics, phylogenetic data and DNA-DNA hybridization results, strain NEAU-QY3T was readily distinguished from its most closely related strains and classified as a new species, for which the name Verrucosispora sonchi sp. nov. is proposed. The type strain is NEAU-QY3T (=CGMCC 4.7312T=DSM 101530T).

  15. 'Candidatus Phytoplasma noviguineense', a novel taxon associated with Bogia coconut syndrome and banana wilt disease on the island of New Guinea.

    PubMed

    Miyazaki, Akio; Shigaki, Toshiro; Koinuma, Hiroaki; Iwabuchi, Nozomu; Rauka, Gou Bue; Kembu, Alfred; Saul, Josephine; Watanabe, Kiyoto; Nijo, Takamichi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2018-01-01

    Bogia coconut syndrome (BCS) is one of the lethal yellowing (LY)-type diseases associated with phytoplasma presence that are seriously threatening coconut cultivation worldwide. It has recently emerged, and is rapidly spreading in northern parts of the island of New Guinea. BCS-associated phytoplasmas collected in different regions were compared in terms of 16S rRNA gene sequences, revealing high identity among them represented by strain BCS-Bo R . Comparative analysis of the 16S rRNA gene sequences revealed that BCS-Bo R shared less than a 97.5 % similarity with other species of 'Candidatus Phytoplasma', with a maximum value of 96.08 % (with strain LY; GenBank accession no. U18747). This result indicates the necessity and propriety of a novel taxon for BCS phytoplasmas according to the recommendations of the IRPCM. Phylogenetic analysis was also conducted on 16S rRNA gene sequences, resulting in a monophyletic cluster composed of BCS-Bo R and other LY-associated phytoplasmas. Other phytoplasmas on the island of New Guinea associated with banana wilt and arecanut yellow leaf diseases showed high similarities to BCS-Bo R and were closely related to BCS phytoplasmas. Based on the uniqueness of their 16S rRNA gene sequences, a novel taxon 'Ca.Phytoplasma noviguineense' is proposed for these phytoplasmas found on the island of New Guinea, with strain BCS-Bo R (GenBank accession no. LC228755) as the reference strain. The novel taxon is described in detail, including information on the symptoms of associated diseases and additional genetic features of the secY gene and rp operon.

  16. fusionDB: assessing microbial diversity and environmental preferences via functional similarity networks

    PubMed Central

    Zhu, Chengsheng; Miller, Maximilian

    2018-01-01

    Abstract Microbial functional diversification is driven by environmental factors, i.e. microorganisms inhabiting the same environmental niche tend to be more functionally similar than those from different environments. In some cases, even closely phylogenetically related microbes differ more across environments than across taxa. While microbial similarities are often reported in terms of taxonomic relationships, no existing databases directly link microbial functions to the environment. We previously developed a method for comparing microbial functional similarities on the basis of proteins translated from their sequenced genomes. Here, we describe fusionDB, a novel database that uses our functional data to represent 1374 taxonomically distinct bacteria annotated with available metadata: habitat/niche, preferred temperature, and oxygen use. Each microbe is encoded as a set of functions represented by its proteome and individual microbes are connected via common functions. Users can search fusionDB via combinations of organism names and metadata. Moreover, the web interface allows mapping new microbial genomes to the functional spectrum of reference bacteria, rendering interactive similarity networks that highlight shared functionality. fusionDB provides a fast means of comparing microbes, identifying potential horizontal gene transfer events, and highlighting key environment-specific functionality. PMID:29112720

  17. Common folds and transport mechanisms of secondary active transporters.

    PubMed

    Shi, Yigong

    2013-01-01

    Secondary active transporters exploit the electrochemical potential of solutes to shuttle specific substrate molecules across biological membranes, usually against their concentration gradient. Transporters of different functional families with little sequence similarity have repeatedly been found to exhibit similar folds, exemplified by the MFS, LeuT, and NhaA folds. Observations of multiple conformational states of the same transporter, represented by the LeuT superfamily members Mhp1, AdiC, vSGLT, and LeuT, led to proposals that structural changes are associated with substrate binding and transport. Despite recent biochemical and structural advances, our understanding of substrate recognition and energy coupling is rather preliminary. This review focuses on the common folds and shared transport mechanisms of secondary active transporters. Available structural information generally supports the alternating access model for substrate transport, with variations and extensions made by emerging structural, biochemical, and computational evidence.

  18. Chromosome catastrophes involve replication mechanisms generating complex genomic rearrangements

    PubMed Central

    Liu, Pengfei; Erez, Ayelet; Sreenath Nagamani, Sandesh C.; Dhar, Shweta U.; Kołodziejska, Katarzyna E.; Dharmadhikari, Avinash V.; Cooper, M. Lance; Wiszniewska, Joanna; Zhang, Feng; Withers, Marjorie A.; Bacino, Carlos A.; Campos-Acevedo, Luis Daniel; Delgado, Mauricio R.; Freedenberg, Debra; Garnica, Adolfo; Grebe, Theresa A.; Hernández-Almaguer, Dolores; Immken, LaDonna; Lalani, Seema R.; McLean, Scott D.; Northrup, Hope; Scaglia, Fernando; Strathearn, Lane; Trapane, Pamela; Kang, Sung-Hae L.; Patel, Ankita; Cheung, Sau Wai; Hastings, P. J.; Stankiewicz, Paweł; Lupski, James R.; Bi, Weimin

    2011-01-01

    SUMMARY Complex genomic rearrangements (CGR) consisting of two or more breakpoint junctions have been observed in genomic disorders. Recently, a chromosome catastrophe phenomenon termed chromothripsis, in which numerous genomic rearrangements are apparently acquired in one single catastrophic event, was described in multiple cancers. Here we show that constitutionally acquired CGRs share similarities with cancer chromothripsis. In the 17 CGR cases investigated we observed localization and multiple copy number changes including deletions, duplications and/or triplications, as well as extensive translocations and inversions. Genomic rearrangements involved varied in size and complexities; in one case, array comparative genomic hybridization revealed 18 copy number changes. Breakpoint sequencing identified characteristic features, including small templated insertions at breakpoints and microhomology at breakpoint junctions, which have been attributed to replicative processes. The resemblance between CGR and chromothripsis suggests similar mechanistic underpinnings. Such chromosome catastrophic events appear to reflect basic DNA metabolism operative throughout an organism’s life cycle. PMID:21925314

  19. Identification and characterization of thermophilic Synechococcus spp. isolates from Asian geothermal springs.

    PubMed

    Jing, Hongmei; Liu, Hongbin; Pointing, Stephen B

    2007-04-01

    Two thermophilic cyanobacterial strains, Ts and Bs, collected from Asian geothermal springs were identified morphologically and phylogenetically as Synechococcus in the order Chroococcales and were isolated into axenic cultures. In addition to the high similarities between their full 16S rRNA gene sequences, both strains also shared similar pigment profiles and fatty acid compositions but with varied ratios. Strain Ts had elevated levels of photoprotective pigments such as carotenoid and scytonemin even after prolonged culture under identical laboratory conditions, whereas strain Bs produced more chlorophyll a per unit cell volume, perhaps resulting from UV adaptation in the natural habitats. In addition, strain Ts had more content than strain Bs in terms of the total fatty acids and the proportion of unsaturated fatty acids. Neither isolate was able to fix nitrogen, and they had zero susceptibility to ampicillin and streptomycin.

  20. Structure of the uncleaved ectodomain of the paramyxovirus (hPIV3) fusion protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yin, Hsien-Sheng; Paterson, Reay G.; Wen, Xiaolin

    2010-03-08

    Class I viral fusion proteins share common mechanistic and structural features but little sequence similarity. Structural insights into the protein conformational changes associated with membrane fusion are based largely on studies of the influenza virus hemagglutinin in pre- and postfusion conformations. Here, we present the crystal structure of the secreted, uncleaved ectodomain of the paramyxovirus, human parainfluenza virus 3 fusion (F) protein, a member of the class I viral fusion protein group. The secreted human parainfluenza virus 3 F forms a trimer with distinct head, neck, and stalk regions. Unexpectedly, the structure reveals a six-helix bundle associated with the postfusionmore » form of F, suggesting that the anchor-minus ectodomain adopts a conformation largely similar to the postfusion state. The transmembrane anchor domains of F may therefore profoundly influence the folding energetics that establish and maintain a metastable, prefusion state.« less

  1. Bacterial Polysaccharide Co-Polymerases Share a Common Framework for Control of Polymer Length

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tocilj,A.; Munger, C.; Proteau, A.

    2008-01-01

    The chain length distribution of complex polysaccharides present on the bacterial surface is determined by polysaccharide co-polymerases (PCPs) anchored in the inner membrane. We report crystal structures of the periplasmic domains of three PCPs that impart substantially different chain length distributions to surface polysaccharides. Despite very low sequence similarities, they have a common protomer structure with a long central alpha-helix extending 100 Angstroms into the periplasm. The protomers self-assemble into bell-shaped oligomers of variable sizes, with a large internal cavity. Electron microscopy shows that one of the full-length PCPs has a similar organization as that observed in the crystal formore » its periplasmic domain alone. Functional studies suggest that the top of the PCP oligomers is an important region for determining polysaccharide modal length. These structures provide a detailed view of components of the bacterial polysaccharide assembly machinery.« less

  2. Assessing the similarity of mental models of operating room team members and implications for patient safety: a prospective, replicated study.

    PubMed

    Nakarada-Kordic, Ivana; Weller, Jennifer M; Webster, Craig S; Cumin, David; Frampton, Christopher; Boyd, Matt; Merry, Alan F

    2016-08-31

    Patient safety depends on effective teamwork. The similarity of team members' mental models - or their shared understanding-regarding clinical tasks is likely to influence the effectiveness of teamwork. Mental models have not been measured in the complex, high-acuity environment of the operating room (OR), where professionals of different backgrounds must work together to achieve the best surgical outcome for each patient. Therefore, we aimed to explore the similarity of mental models of task sequence and of responsibility for task within multidisciplinary OR teams. We developed a computer-based card sorting tool (Momento) to capture the information on mental models in 20 six-person surgical teams, each comprised of three subteams (anaesthesia, surgery, and nursing) for two simulated laparotomies. Team members sorted 20 cards depicting key tasks according to when in the procedure each task should be performed, and which subteam was primarily responsible for each task. Within each OR team and subteam, we conducted pairwise comparisons of scores to arrive at mean similarity scores for each task. Mean similarity score for task sequence was 87 % (range 57-97 %). Mean score for responsibility for task was 70 % (range = 38-100 %), but for half of the tasks was only 51 % (range = 38-69 %). Participants believed their own subteam was primarily responsible for approximately half the tasks in each procedure. We found differences in the mental models of some OR team members about responsibility for and order of certain tasks in an emergency laparotomy. Momento is a tool that could help elucidate and better align the mental models of OR team members about surgical procedures and thereby improve teamwork and outcomes for patients.

  3. Genome sequencing of ovine isolates of Mycobacterium avium subspecies paratuberculosis offers insights into host association

    PubMed Central

    2012-01-01

    Background The genome of Mycobacterium avium subspecies paratuberculosis (MAP) is remarkably homogeneous among the genomes of bovine, human and wildlife isolates. However, previous work in our laboratories with the bovine K-10 strain has revealed substantial differences compared to sheep isolates. To systematically characterize all genomic differences that may be associated with the specific hosts, we sequenced the genomes of three U.S. sheep isolates and also obtained an optical map. Results Our analysis of one of the isolates, MAP S397, revealed a genome 4.8 Mb in size with 4,700 open reading frames (ORFs). Comparative analysis of the MAP S397 isolate showed it acquired approximately 10 large sequence regions that are shared with the human M. avium subsp. hominissuis strain 104 and lost 2 large regions that are present in the bovine strain. In addition, optical mapping defined the presence of 7 large inversions between the bovine and ovine genomes (~ 2.36 Mb). Whole-genome sequencing of 2 additional sheep strains of MAP (JTC1074 and JTC7565) further confirmed genomic homogeneity of the sheep isolates despite the presence of polymorphisms on the nucleotide level. Conclusions Comparative sequence analysis employed here provided a better understanding of the host association, evolution of members of the M. avium complex and could help in deciphering the phenotypic differences observed among sheep and cattle strains of MAP. A similar approach based on whole-genome sequencing combined with optical mapping could be employed to examine closely related pathogens. We propose an evolutionary scenario for M. avium complex strains based on these genome sequences. PMID:22409516

  4. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

    1988-08-01

    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

  5. Brand name confusion: Subjective and objective measures of orthographic similarity.

    PubMed

    Burt, Jennifer S; McFarlane, Kimberley A; Kelly, Sarah J; Humphreys, Michael S; Weatherall, Kimberlee; Burrell, Robert G

    2017-09-01

    Determining brand name similarity is vital in areas of trademark registration and brand confusion. Students rated the orthographic (spelling) similarity of word pairs (Experiments 1, 2, and 4) and brand name pairs (Experiment 5). Similarity ratings were consistently higher when words shared beginnings rather than endings, whereas shared pronunciation of the stressed vowel had small and less consistent effects on ratings. In Experiment 3 a behavioral task confirmed the similarity of shared beginnings in lexical processing. Specifically, in a task requiring participants to decide whether 2 words presented in the clear (a probe and a later target) were the same or different, a masked prime word preceding the target shortened response latencies if it shared its initial 3 letters with the target. The ratings of students for word and brand name pairs were strongly predicted by metrics of orthographic similarity from the visual word identification literature based on the number of shared letters and their relative positions. The results indicate a potential use for orthographic metrics in brand name registration and trademark law. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  6. Placental share and hemoglobin level in relation to birth weight in twin anemia-polycythemia sequence.

    PubMed

    Zhao, D; Slaghekke, F; Middeldorp, J M; Duan, T; Oepkes, D; Lopriore, E

    2014-12-01

    Twin anemia-polycythemia sequence (TAPS) is a newly described form of chronic twin transfusion. Previous observational studies noted a discordance between birth weight and individual placental share in TAPS. The purpose of this study was to investigate if fetal growth in monochorionic (MC) twins with TAPS is determined by placental share or by the net inter-twin blood transfusion. All consecutive MC twin placentas of live-born twin pairs with and without TAPS examined at our center between June 2002 and February 2014 were included in this study. Hemoglobin (Hb) levels and individual placental share were evaluated at birth and correlated with birth weight share. We excluded MC twin pregnancies with twin-twin transfusion syndrome. A total of 270 MC twin pregnancies (TAPS group, n = 20; control group without TAPS, n = 250) were included in this study. Donors with TAPS had a lower birth weight than recipients in 90% (18/20) of cases, but a larger placental share in 65% (13/20) of cases. In the TAPS group, birth weight share was positively correlated with Hb share at birth (P < 0.01) but not with placental share (P = 0.54). In the control group without TAPS, birth weight share was strongly correlated with placental share (P < 0.01) but not with Hb share (P = 0.14). A relatively larger placental share may enable the survival of the anemic twin in TAPS. In contrast with uncomplicated MC twins, fetal growth in MC twins with TAPS is determined primarily by the net inter-twin blood transfusion instead of placental share. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. VDJServer: A Cloud-Based Analysis Portal and Data Commons for Immune Repertoire Sequences and Rearrangements.

    PubMed

    Christley, Scott; Scarborough, Walter; Salinas, Eddie; Rounds, William H; Toby, Inimary T; Fonner, John M; Levin, Mikhail K; Kim, Min; Mock, Stephen A; Jordan, Christopher; Ostmeyer, Jared; Buntzman, Adam; Rubelt, Florian; Davila, Marco L; Monson, Nancy L; Scheuermann, Richard H; Cowell, Lindsay G

    2018-01-01

    Recent technological advances in immune repertoire sequencing have created tremendous potential for advancing our understanding of adaptive immune response dynamics in various states of health and disease. Immune repertoire sequencing produces large, highly complex data sets, however, which require specialized methods and software tools for their effective analysis and interpretation. VDJServer is a cloud-based analysis portal for immune repertoire sequence data that provide access to a suite of tools for a complete analysis workflow, including modules for preprocessing and quality control of sequence reads, V(D)J gene segment assignment, repertoire characterization, and repertoire comparison. VDJServer also provides sophisticated visualizations for exploratory analysis. It is accessible through a standard web browser via a graphical user interface designed for use by immunologists, clinicians, and bioinformatics researchers. VDJServer provides a data commons for public sharing of repertoire sequencing data, as well as private sharing of data between users. We describe the main functionality and architecture of VDJServer and demonstrate its capabilities with use cases from cancer immunology and autoimmunity. VDJServer provides a complete analysis suite for human and mouse T-cell and B-cell receptor repertoire sequencing data. The combination of its user-friendly interface and high-performance computing allows large immune repertoire sequencing projects to be analyzed with no programming or software installation required. VDJServer is a web-accessible cloud platform that provides access through a graphical user interface to a data management infrastructure, a collection of analysis tools covering all steps in an analysis, and an infrastructure for sharing data along with workflows, results, and computational provenance. VDJServer is a free, publicly available, and open-source licensed resource.

  8. Analysis of the complete genome of peach chlorotic mottle virus: identification of non-AUG start codons, in vitro coat protein expression, and elucidation of serological cross-reactions.

    PubMed

    James, D; Varga, A; Croft, H

    2007-01-01

    The entire genome of peach chlorotic mottle virus (PCMV), originally identified as Prunus persica cv. Agua virus (4N6), was sequenced and analysed. PCMV cross-reacts with antisera to diverse viruses, such as plum pox virus (PPV), genus Potyvirus, family Potyviridae; and apple stem pitting virus (ASPV), genus Foveavirus, family Flexiviridae. The PCMV genome consists of 9005 nucleotides (nts), excluding a poly(A) tail at the 3' end of the genome. Five open reading frames (ORFs) were identified with four untranslated regions (UTR) including a 5', a 3', and two intergenic UTRs. The genome organisation of PCMV is similar to that of ASPV and the two genomes share a nucleotide (nt) sequence identity of 58%. PCMV ORF1 encodes the replication-associated protein complex (Mr 241,503), ORF2-ORF4 code for the triple gene block proteins (TGBp; Mr 24,802, 12,370, and 7320, respectively), and ORF5 encodes the coat protein (CP) (Mr 42,505). Two non-AUG start codons participate in the initiation of translation: 35AUC and 7676AUA initiate translation of ORF1 and ORF5. In vitro expression with subsequent Western blot analysis confirmed ORF5 as the CP-encoding gene and confirmed that the codon AUA is able to initiate translation of the CP. Expression of a truncated CP fragment (Mr 39, 689) was demonstrated, and both proteins are expressed in vivo, since both were observed in Western blot analysis of PCMV-infected peach and Nicotiana occidentalis. The expressed proteins cross-reacted with an antiserum against ASPV. The amino acid sequences of the CPs of PCMV and ASPV CP share only 37% identity, but there are 11 shared peptides 4-8 aa residues long. These may constitute linear epitopes responsible for ASPV antiserum cross reactions. No significant common linear epitopes were associated with PPV. Extensive phylogenetic analysis indicates that PCMV is closely related to ASPV and is a new and distinct member of the genus Foveavirus.

  9. Reprint of "Sequence and phylogenetic analyses of novel totivirus-like double-stranded RNAs from field-collected powdery mildew fungi".

    PubMed

    Kondo, Hideki; Hisano, Sakae; Chiba, Sotaro; Maruyama, Kazuyuki; Andika, Ida Bagus; Toyoda, Kazuhiro; Fujimori, Fumihiro; Suzuki, Nobuhiro

    2016-07-02

    The identification of mycoviruses contributes greatly to understanding of the diversity and evolutionary aspects of viruses. Powdery mildew fungi are important and widely studied obligate phytopathogenic agents, but there has been no report on mycoviruses infecting these fungi. In this study, we used a deep sequencing approach to analyze the double-stranded RNA (dsRNA) segments isolated from field-collected samples of powdery mildew fungus-infected red clover plants in Japan. Database searches identified the presence of at least ten totivirus (genus Totivirus)-like sequences, termed red clover powdery mildew-associated totiviruses (RPaTVs). The majority of these sequences shared moderate amino acid sequence identity with each other (<44%) and with other known totiviruses (<59%). Nine of these identified sequences (RPaTV1a, 1b and 2-8) resembled the genome of the prototype totivirus, Saccharomyces cerevisiae virus-L-A (ScV-L-A) in that they contained two overlapping open reading frames (ORFs) encoding a putative coat protein (CP) and an RNA dependent RNA polymerase (RdRp), while one sequence (RPaTV9) showed similarity to another totivirus, Ustilago maydis virus H1 (UmV-H1) that encodes a single polyprotein (CP-RdRp fusion). Similar to yeast totiviruses, each ScV-L-A-like RPaTV contains a -1 ribosomal frameshift site downstream of a predicted pseudoknot structure in the overlapping region of these ORFs, suggesting that the RdRp is translated as a CP-RdRp fusion. Moreover, several ScV-L-A-like sequences were also found by searches of the transcriptome shotgun assembly (TSA) libraries from rust fungi, plants and insects. Phylogenetic analyses show that nine ScV-L-A-like RPaTVs along with ScV-L-A-like sequences derived from TSA libraries are clustered with most established members of the genus Totivirus, while one RPaTV forms a new distinct clade with UmV-H1, possibly establishing an additional genus in the family. Taken together, our results indicate the presence of diverse, novel totiviruses in the powdery mildew fungus populations infecting red clover plants in the field. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. NABIC: A New Access Portal to Search, Visualize, and Share Agricultural Genomics Data.

    PubMed

    Seol, Young-Joo; Lee, Tae-Ho; Park, Dong-Suk; Kim, Chang-Kug

    2016-01-01

    The National Agricultural Biotechnology Information Center developed an access portal to search, visualize, and share agricultural genomics data with a focus on South Korean information and resources. The portal features an agricultural biotechnology database containing a wide range of omics data from public and proprietary sources. We collected 28.4 TB of data from 162 agricultural organisms, with 10 types of omics data comprising next-generation sequencing sequence read archive, genome, gene, nucleotide, DNA chip, expressed sequence tag, interactome, protein structure, molecular marker, and single-nucleotide polymorphism datasets. Our genomic resources contain information on five animals, seven plants, and one fungus, which is accessed through a genome browser. We also developed a data submission and analysis system as a web service, with easy-to-use functions and cutting-edge algorithms, including those for handling next-generation sequencing data.

  11. Mutual coordination strengthens the sense of joint agency in cooperative joint action.

    PubMed

    Bolt, Nicole K; Poncelet, Evan M; Schultz, Benjamin G; Loehr, Janeen D

    2016-11-01

    Philosophers have proposed that when people coordinate their actions with others they may experience a sense of joint agency, or shared control over actions and their effects. However, little empirical work has investigated the sense of joint agency. In the current study, pairs coordinated their actions to produce tone sequences and then rated their sense of joint agency on a scale ranging from shared to independent control. People felt more shared than independent control overall, confirming that people experience joint agency during joint action. Furthermore, people felt stronger joint agency when they (a) produced sequences that required mutual coordination compared to sequences in which only one partner had to coordinate with the other, (b) held the role of follower compared to leader, and (c) were better coordinated with their partner. Thus, the strength of joint agency is influenced by the degree to which people mutually coordinate with each other's actions. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. A novel, privacy-preserving cryptographic approach for sharing sequencing data

    PubMed Central

    Cassa, Christopher A; Miller, Rachel A; Mandl, Kenneth D

    2013-01-01

    Objective DNA samples are often processed and sequenced in facilities external to the point of collection. These samples are routinely labeled with patient identifiers or pseudonyms, allowing for potential linkage to identity and private clinical information if intercepted during transmission. We present a cryptographic scheme to securely transmit externally generated sequence data which does not require any patient identifiers, public key infrastructure, or the transmission of passwords. Materials and methods This novel encryption scheme cryptographically protects participant sequence data using a shared secret key that is derived from a unique subset of an individual’s genetic sequence. This scheme requires access to a subset of an individual’s genetic sequence to acquire full access to the transmitted sequence data, which helps to prevent sample mismatch. Results We validate that the proposed encryption scheme is robust to sequencing errors, population uniqueness, and sibling disambiguation, and provides sufficient cryptographic key space. Discussion Access to a set of an individual’s genotypes and a mutually agreed cryptographic seed is needed to unlock the full sequence, which provides additional sample authentication and authorization security. We present modest fixed and marginal costs to implement this transmission architecture. Conclusions It is possible for genomics researchers who sequence participant samples externally to protect the transmission of sequence data using unique features of an individual’s genetic sequence. PMID:23125421

  13. Comparative analysis of secretomes from Ectomycorrhizal fungi with an emphasis on small-secreted proteins

    DOE PAGES

    Pellegrin, Clement; Morin, Emmanuelle; Martin, Francis M.; ...

    2015-11-18

    Fungi are major players in the carbon cycle in forest ecosystems due to the wide range of interactions they have with plants either through soil degradation processes by litter decayers or biotrophic interactions with pathogenic and ectomycorrhizal symbionts. Secretion of fungal proteins mediates these interactions by allowing the fungus to interact with its environment and/or host. Ectomycorrhizal (ECM) symbiosis independently appeared several times throughout evolution and involves approximately 80% of trees. Despite extensive physiological studies on ECM symbionts, little is known about the composition and specificities of their secretomes. In this study, we used a bioinformatics pipeline to predict andmore » analyze the secretomes of 49 fungal species, including 11 ECM fungi, wood and soil decayers and pathogenic fungi to tackle the following questions: (1) Are there differences between the secretomes of saprophytic and ECM fungi? (2) Are small-secreted proteins (SSPs) more abundant in biotrophic fungi than in saprophytic fungi? and (3) Are there SSPs shared between ECM, saprotrophic and pathogenic fungi? We showed that the number of predicted secreted proteins is similar in the surveyed species, independently of their lifestyle. The secretome from ECM fungi is characterized by a restricted number of secreted CAZymes, but their repertoires of secreted proteases and lipases are similar to those of saprotrophic fungi. Focusing on SSPs, we showed that the secretome of ECM fungi is enriched in SSPs compared with other species. Most of the SSPs are coded by orphan genes with no known PFAM domain or similarities to known sequences in databases. Finally, based on the clustering analysis, we identified shared- and lifestyle-specific SSPs between saprotrophic and ECM fungi. The presence of SSPs is not limited to fungi interacting with living plants as the genome of saprotrophic fungi also code for numerous SSPs. As a result, ECM fungi shared lifestyle-specific SSPs likely involved in symbiosis that are good candidates for further functional analyses.« less

  14. Comparative analysis of secretomes from Ectomycorrhizal fungi with an emphasis on small-secreted proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pellegrin, Clement; Morin, Emmanuelle; Martin, Francis M.

    Fungi are major players in the carbon cycle in forest ecosystems due to the wide range of interactions they have with plants either through soil degradation processes by litter decayers or biotrophic interactions with pathogenic and ectomycorrhizal symbionts. Secretion of fungal proteins mediates these interactions by allowing the fungus to interact with its environment and/or host. Ectomycorrhizal (ECM) symbiosis independently appeared several times throughout evolution and involves approximately 80% of trees. Despite extensive physiological studies on ECM symbionts, little is known about the composition and specificities of their secretomes. In this study, we used a bioinformatics pipeline to predict andmore » analyze the secretomes of 49 fungal species, including 11 ECM fungi, wood and soil decayers and pathogenic fungi to tackle the following questions: (1) Are there differences between the secretomes of saprophytic and ECM fungi? (2) Are small-secreted proteins (SSPs) more abundant in biotrophic fungi than in saprophytic fungi? and (3) Are there SSPs shared between ECM, saprotrophic and pathogenic fungi? We showed that the number of predicted secreted proteins is similar in the surveyed species, independently of their lifestyle. The secretome from ECM fungi is characterized by a restricted number of secreted CAZymes, but their repertoires of secreted proteases and lipases are similar to those of saprotrophic fungi. Focusing on SSPs, we showed that the secretome of ECM fungi is enriched in SSPs compared with other species. Most of the SSPs are coded by orphan genes with no known PFAM domain or similarities to known sequences in databases. Finally, based on the clustering analysis, we identified shared- and lifestyle-specific SSPs between saprotrophic and ECM fungi. The presence of SSPs is not limited to fungi interacting with living plants as the genome of saprotrophic fungi also code for numerous SSPs. As a result, ECM fungi shared lifestyle-specific SSPs likely involved in symbiosis that are good candidates for further functional analyses.« less

  15. Comparative Analysis of Secretomes from Ectomycorrhizal Fungi with an Emphasis on Small-Secreted Proteins

    PubMed Central

    Pellegrin, Clement; Morin, Emmanuelle; Martin, Francis M.; Veneault-Fourrey, Claire

    2015-01-01

    Fungi are major players in the carbon cycle in forest ecosystems due to the wide range of interactions they have with plants either through soil degradation processes by litter decayers or biotrophic interactions with pathogenic and ectomycorrhizal symbionts. Secretion of fungal proteins mediates these interactions by allowing the fungus to interact with its environment and/or host. Ectomycorrhizal (ECM) symbiosis independently appeared several times throughout evolution and involves approximately 80% of trees. Despite extensive physiological studies on ECM symbionts, little is known about the composition and specificities of their secretomes. In this study, we used a bioinformatics pipeline to predict and analyze the secretomes of 49 fungal species, including 11 ECM fungi, wood and soil decayers and pathogenic fungi to tackle the following questions: (1) Are there differences between the secretomes of saprophytic and ECM fungi? (2) Are small-secreted proteins (SSPs) more abundant in biotrophic fungi than in saprophytic fungi? and (3) Are there SSPs shared between ECM, saprotrophic and pathogenic fungi? We showed that the number of predicted secreted proteins is similar in the surveyed species, independently of their lifestyle. The secretome from ECM fungi is characterized by a restricted number of secreted CAZymes, but their repertoires of secreted proteases and lipases are similar to those of saprotrophic fungi. Focusing on SSPs, we showed that the secretome of ECM fungi is enriched in SSPs compared with other species. Most of the SSPs are coded by orphan genes with no known PFAM domain or similarities to known sequences in databases. Finally, based on the clustering analysis, we identified shared- and lifestyle-specific SSPs between saprotrophic and ECM fungi. The presence of SSPs is not limited to fungi interacting with living plants as the genome of saprotrophic fungi also code for numerous SSPs. ECM fungi shared lifestyle-specific SSPs likely involved in symbiosis that are good candidates for further functional analyses. PMID:26635749

  16. Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification.

    PubMed

    Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

    2015-05-01

    Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. ivan.borozan@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  17. Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification

    PubMed Central

    Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

    2015-01-01

    Motivation: Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Results: Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. Availability and implementation: All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. Contact: ivan.borozan@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573913

  18. Discovery of Escherichia coli CRISPR sequences in an undergraduate laboratory.

    PubMed

    Militello, Kevin T; Lazatin, Justine C

    2017-05-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs) represent a novel type of adaptive immune system found in eubacteria and archaebacteria. CRISPRs have recently generated a lot of attention due to their unique ability to catalog foreign nucleic acids, their ability to destroy foreign nucleic acids in a mechanism that shares some similarity to RNA interference, and the ability to utilize reconstituted CRISPR systems for genome editing in numerous organisms. In order to introduce CRISPR biology into an undergraduate upper-level laboratory, a five-week set of exercises was designed to allow students to examine the CRISPR status of uncharacterized Escherichia coli strains and to allow the discovery of new repeats and spacers. Students started the project by isolating genomic DNA from E. coli and amplifying the iap CRISPR locus using the polymerase chain reaction (PCR). The PCR products were analyzed by Sanger DNA sequencing, and the sequences were examined for the presence of CRISPR repeat sequences. The regions between the repeats, the spacers, were extracted and analyzed with BLASTN searches. Overall, CRISPR loci were sequenced from several previously uncharacterized E. coli strains and one E. coli K-12 strain. Sanger DNA sequencing resulted in the discovery of 36 spacer sequences and their corresponding surrounding repeat sequences. Five of the spacers were homologous to foreign (non-E. coli) DNA. Assessment of the laboratory indicates that improvements were made in the ability of students to answer questions relating to the structure and function of CRISPRs. Future directions of the laboratory are presented and discussed. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):262-269, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  19. In silico identification of molecular mimics involved in the pathogenesis of Clostridium botulinum ATCC 3502 strain.

    PubMed

    Bhardwaj, Tulika; Haque, Shafiul; Somvanshi, Pallavi

    2018-05-12

    Bacterial pathogens invade and disrupt the host defense system by means of protein sequences structurally similar at global and local level both. The sharing of homologous sequences between the host and the pathogenic bacteria mediates the infection and defines the concept of molecular mimicry. In this study, various computational approaches were employed to elucidate the pathogenicity of Clostridium botulinum ATCC 3502 at genome-wide level. Genome-wide study revealed that the pathogen mimics the host (Homo sapiens) and unraveled the complex pathogenic pathway of causing infection. The comparative 'omics' approaches helped in selective screening of 'molecular mimicry' candidates followed by the qualitative assessment of the virulence potential and functional enrichment. Overall, this study provides a deep insight into the emergence and surveillance of multidrug resistant C. botulinum ATCC 3502 caused infections. This is the very first report identifying C. botulinum ATCC 3502 proteome enriched similarities to the human host proteins and resulted in the identification of 20 potential mimicry candidates, which were further characterized qualitatively by sub-cellular organization prediction and functional annotation. This study will provide a variety of avenues for future studies related to infectious agents, host-pathogen interactions and the evolution of pathogenesis process. Copyright © 2018. Published by Elsevier Ltd.

  20. Sphingomonas japonica sp. nov., isolated from the marine crustacean Paralithodes camtschatica.

    PubMed

    Romanenko, Lyudmila A; Tanaka, Naoto; Frolova, Galina M; Mikhailov, Valery V

    2009-05-01

    A Sphingomonas-like bacterium, strain KC7(T), was isolated from a marine crustacean specimen obtained from the Sea of Japan and subjected to a polyphasic study. Comparative 16S rRNA gene sequence analysis positioned the novel strain in the genus Sphingomonas as an independent lineage adjacent to a subclade containing Sphingomonas trueperi LMG 2142(T), Sphingomonas pituitosa EDIV(T) and Sphingomonas azotifigens NBRC 15497(T). Strain KC7(T) shared highest 16S rRNA gene sequence similarity (96.1 %) with S. trueperi LMG 2142(T), Sphingomonas dokdonensis DS-4(T) and S. azotifigens NBRC 15497(T); similarities to strains of other recognized Sphingomonas species were lower (96.0-93.9 %). The strain contained sphingoglycolipid and the predominant fatty acids were C(16 : 1), C(16 : 0) and C(18 : 1); 2-OH C(14 : 0) was the major 2-hydroxy fatty acid. Previously, these lipids have been found to be characteristic of members of the genus Sphingomonas sensu stricto. On the basis of phylogenetic analysis and physiological and biochemical characterization, strain KC7(T) represents a novel species of the genus Sphingomonas, for which the name Sphingomonas japonica sp. nov. is proposed. The type strain is KC7(T) (=KMM 3038(T) =NRIC 0738(T) =JCM 15438(T)).

Some links on this page may take you to non-federal websites. Their policies may differ from this site.
Top