Night shift work and levels of 6-sulfatoxymelatonin and cortisol in men.

PubMed

Mirick, Dana K; Bhatti, Parveen; Chen, Chu; Nordt, Frank; Stanczyk, Frank Z; Davis, Scott

2013-06-01

Night shift work is associated with cancer among men, but the biologic mechanism is unclear. We investigated whether male night shift workers showed changes in levels of melatonin and cortisol, potential biomarkers of cancer risk. Urine was collected from 185 night shift and 158 day shift-working male healthcare providers, aged 22 to 55 years, throughout work and sleep periods, and assayed for 6-sulfatoxymelatonin and cortisol. Morning serum was collected within 90 minutes of completing the night and assayed for cortisol. Night shift workers had significantly lower 6-sulfatoxymelatonin levels during daytime sleep, nighttime work, and nighttime sleep on off-nights (57%, 62%, and 40% lower, respectively), relative to the day shift workers during nighttime sleep (P < 0.0001); urinary cortisol in night shift workers was 16% higher during daytime sleep and 13% lower during nighttime sleep on off-nights (P < 0.05). Morning serum cortisol post-work and post-sleep in night shift workers were 24% and 43% lower, respectively, than post-sleep levels among day shift workers (P < 0.0001). Within-subject comparisons among the night shift workers revealed significantly lower melatonin levels and significantly higher urinary cortisol levels during daytime sleep and nighttime work, relative to nighttime sleep (P < 0.01); morning serum cortisol levels post-work were lower than those post-sleep. Night shift workers have substantially lower 6-sulfatoxymelatonin during night work and daytime sleep, and levels remain low when night shift workers sleep at night. Chronic reduction in melatonin among night shift workers may be an important carcinogenic mechanism. Cortisol secretion patterns may be impacted by night shift work, which could affect cancer risk. Shift work could be an important risk factor for many types of cancer.

Electrophoretic Mobility Shift Assay (EMSA) for Detecting Protein-Nucleic Acid Interactions

PubMed Central

Hellman, Lance M.; Fried, Michael G.

2009-01-01

The gel electrophoresis mobility shift assay (EMSA) is used to detect protein complexes with nucleic acids. It is the core technology underlying a wide range of qualitative and quantitative analyses for the characterization of interacting systems. In the classical assay, solutions of protein and nucleic acid are combined and the resulting mixtures are subjected to electrophoresis under native conditions through polyacrylamide or agarose gel. After electrophoresis, the distribution of species containing nucleic acid is determined, usually by autoradiography of 32P-labeled nucleic acid. In general, protein-nucleic acid complexes migrate more slowly than the corresponding free nucleic acid. In this article, we identify the most important factors that determine the stabilities and electrophoretic mobilities of complexes under assay conditions. A representative protocol is provided and commonly used variants are discussed. Expected outcomes are briefly described. References to extensions of the method and a troubleshooting guide are provided. PMID:17703195

A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

PubMed Central

Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

2016-01-01

Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800

Fluorescence method for enzyme analysis which couples aromatic amines with aromatic aldehydes

DOEpatents

Smith, R.E.; Dolbeare, F.A.

1980-10-21

Analysis of proteinases is accomplished using conventional amino acid containing aromatic amine substrates. Aromatic amines such as 4-methoxy-2-naphthylamine (4M2NA), 2-naphthylamine, aminoisophthalic acid dimethyl ester, p-nitroaniline, 4-methoxy-1-aminofluorene and coumarin derivatives resulting from enzymatic hydrolysis of the substrate couples with aromatic aldehydes such as 5-nitrosalicylaldehyde (5-NSA), benzaldehyde and p-nitrobenzaldehyde to produce Schiff-base complexes which are water insoluble. Certain Schiff-base complexes produce a shift from blue to orange-red (visible) fluorescence. Such complexes are useful in the assay of enzymes. No Drawings

Fluorescence method for enzyme analysis which couples aromatic amines with aromatic aldehydes

DOEpatents

Smith, Robert E. [557 Escondido Cir., Livermore, CA 94550; Dolbeare, Frank A. [5178 Diane La., Livermore, CA 94550

1980-10-21

Analysis of proteinases is accomplished using conventional amino acid containing aromatic amine substrates. Aromatic amines such as 4-methoxy-2-naphthylamine (4M2NA), 2-naphthylamine, aminoisophthalic acid dimethyl ester, p-nitroaniline, 4-methoxy-1-aminofluorene and coumarin derivatives resulting from enzymatic hydrolysis of the substrate couples with aromatic aldehydes such as 5-nitrosalicylaldehyde (5-NSA), benzaldehyde and p-nitrobenzaldehyde to produce Schiff-base complexes which are water insoluble. Certain Schiff-base complexes produce a shift from blue to orange-red (visible) fluorescence. Such complexes are useful in the assay of enzymes.

Fluorescence method for enzyme analysis which couples aromatic amines with aromatic aldehydes

DOEpatents

Smith, Robert E.; Dolbeare, Frank A.

1979-01-01

Analysis of proteinases is accomplished using conventional amino acid containing aromatic amine substrates. Aromatic amines such as 4-methoxy-2-naphthylamine (4M2NA), 2-naphthylamine, aminoisophthalic acid dimethyl ester, p-nitroaniline, 5-methoxy-1-aminofluorene and coumarin derivatives resulting from enzymatic hydrolysis of the substrate couples with aromatic aldehydes such as 5-nitrosalicylaldehyde (5-NSA), benzaldehyde and p-nitrobenzaldehyde to produce Schiff-base complexes which are water insoluble. Certain Schiff-base complexes produce a shift from blue to orange-red (visible) fluorescence. Such complexes are useful in the assay of enzymes.

Amino acids in a targeted versus a non-targeted metabolomics LC-MS/MS assay. Are the results consistent?

PubMed

Klepacki, Jacek; Klawitter, Jost; Klawitter, Jelena; Karimpour-Fard, Anis; Thurman, Joshua; Ingle, Gordon; Patel, Dharmesh; Christians, Uwe

2016-09-01

The results of plasma amino acid patterns in samples from kidney transplant patients with good and impaired renal function using a targeted LC-MS/MS amino acid assay and a non-targeted metabolomics assay were compared. EDTA plasma samples were prospectively collected at baseline, 1, 2, 4 and 6months post-transplant (n=116 patients, n=398 samples). Each sample was analyzed using both a commercial amino acid LC-MS/MS assay and a non-targeted metabolomics assay also based on MS/MS ion transitions. The results of both assays were independently statistically analyzed to identify amino acids associated with estimated glomerular filtration rates using correlation and partial least squares-discriminant analysis. Although there was overlap between the results of the targeted and non-targeted metabolomics assays (tryptophan, 1-methyl histidine), there were also substantial inconsistencies, with the non-targeted assay resulting in more "hits" than the targeted assay. Without further verification of the hits detected by the non-targeted discovery assay, this would have led to different interpretation of the results. There were also false negative results when the non-targeted assay was used (hydroxy proline). Several of said discrepancies could be explained by loss of sensitivity during analytical runs for selected amino acids (serine and threonine), retention time shifts, signals above the range of linear detector response and integration of peaks not separated from background and interferences (aspartate) when the non-targeted metabolomics assay was used. Whenever assessment of a specific pathway such as amino acids is the focus of interest, a targeted seems preferable to a non-targeted metabolomics assay. Copyright © 2016. Published by Elsevier Inc.

Biochemical analysis of NSs from different tospoviruses.

PubMed

Hedil, Marcio; de Ronde, Dryas; Kormelink, Richard

2017-10-15

Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays (EMSAs). While NSs from tomato spotted wilt virus (TSWV) and groundnut ringspot virus (GRSV) were able to bind small and long dsRNA molecules, the one from tomato yellow ring virus (TYRV), a distinct Asian tospovirus, only bound small dsRNA. Here, using bacterially expressed and purified NSs from GRSV and TYRV, it is shown that they are both able to bind to small and long dsRNA. Binding of siRNAs by NSs revealed two consecutive shifts, i.e. a first shift at low NSs concentrations followed by a second larger one at higher concentrations. When NSs of TSWV resistance inducing (RI) and resistance breaking (RB) isolates were analyzed using extracts from infected plants only a major siRNA shift was observed. In contrast, plant extracts containing the respective transiently expressed NSs proteins showed only the lower shift with NSs RI but no shift with NSs RB . The observed affinity for RNA duplexes, as well as the two-stepwise shift pattern, is discussed in light of NSs as a suppressor of silencing and its importance for tospovirus infection. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giulliani, S. E.; Frank, A. E.; Collart, F. R.

2008-12-08

We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

The Impact of Gate Width Setting and Gate Utilization Factors on Plutonium Assay in Passive Correlated Neutron Counting

DOE PAGES

Henzlova, Daniela; Menlove, Howard Olsen; Croft, Stephen; ...

2015-06-15

In the field of nuclear safeguards, passive neutron multiplicity counting (PNMC) is a method typically employed in non-destructive assay (NDA) of special nuclear material (SNM) for nonproliferation, verification and accountability purposes. PNMC is generally performed using a well-type thermal neutron counter and relies on the detection of correlated pairs or higher order multiplets of neutrons emitted by an assayed item. To assay SNM, a set of parameters for a given well-counter is required to link the measured multiplicity rates to the assayed item properties. Detection efficiency, die-away time, gate utilization factors (tightly connected to die-away time) as well as optimummore » gate width setting are among the key parameters. These parameters along with the underlying model assumptions directly affect the accuracy of the SNM assay. In this paper we examine the role of gate utilization factors and the single exponential die-away time assumption and their impact on the measurements for a range of plutonium materials. In addition, we examine the importance of item-optimized coincidence gate width setting as opposed to using a universal gate width value. Finally, the traditional PNMC based on multiplicity shift register electronics is extended to Feynman-type analysis and application of this approach to Pu mass assay is demonstrated.« less

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

PubMed

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

2011-10-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

PubMed Central

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

2011-01-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

PubMed

Rim, Jong S; Kozak, Leslie P

2002-09-13

Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

A two-fold reduction in measurement time for neutron assay: Initial tests of a prototype dual-gated shift register

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stewart, J.E.; Bourret, S.C.; Krick, M.S.

1996-09-01

Neutron coincidence counting (NCC) is used routinely around the world for nondestructive mass assay of uranium and plutonium in many forms, including waste. Compared with other methods, NCC is generally the most flexible, economic, and rapid. Many applications of NCC would benefit from a reduction in counting time required for a fixed random error. We have developed and tested the first prototype of a dual- gated, shift-register-based electronics unit that offers the potential of decreased measurement time for all passive and active NCC applications.

A two-fold reduction in measurement time for neutron assay: Initial tests of a prototype dual-gated shift register

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stewart, J.E.; Bourret, S.C.; Krick, M.S.

1996-12-31

Neutron coincidence counting (NCC) is used routinely around the world for nondestructive mass assay of uranium and plutonium in many forms, including waste. Compared with other methods, NCC is generally the most flexible, economic, and rapid. Many applications of NCC would benefit from a reduction in counting time required for a fixed random error. The authors have developed and tested the first prototype of a dual-gated, shift-register-based electronics unit that offers the potential of decreased measurement time for all passive and active NCC applications.

Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

PubMed

Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

2001-11-01

Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

Single exosome detection in serum using microtoroid optical resonators (Conference Presentation)

NASA Astrophysics Data System (ADS)

Su, Judith

2016-03-01

Recently exosomes have attracted interest due to their potential as cancer biomarkers. We report the real time, label-free sensing of single exosomes in serum using microtoroid optical resonators. We use this approach to assay the progression of tumors implanted in mice by specifically detecting low concentrations of tumor-derived exosomes. Our approach measures the adsorption of individual exosomes onto a functionalized silica microtoroid by tracking changes in the optical resonant frequency of the microtoroid. When exosomes land on the microtoroid, they perturb its refractive index in the evanescent field and thus shift its resonance frequency. Through digital frequency locking, we are able to rapidly track these shifts with accuracies of better than 10 attometers (one part in 10^11). Samples taken from tumor-implanted mice from later weeks generated larger frequency shifts than those from earlier weeks. Control samples taken from a mouse with no tumor generated no such increase in signal between subsequent weeks. Analysis of shifts from tumor-implanted mouse samples show a distribution of unitary steps, with the maximum step having a height of ~1.2 fm, corresponding to an exosome size of 44 ± 4.8 nm. This size range corresponds to that found by performing nanoparticle tracking analysis on the same samples. Our results demonstrate development towards a minimally-invasive tumor "biopsy" that eliminates the need to find and access a tumor.

Pharmacological analysis of ecto-ATPase inhibition: evidence for combined enzyme inhibition and receptor antagonism in P2X-purinoceptor ligands.

PubMed

Crack, B E; Beukers, M W; McKechnie, K C; Ijzerman, A P; Leff, P

1994-12-01

1. Previous studies have shown that suramin and FPL 66301 are competitive antagonists at the P2X-purinoceptor in the rabbit ear artery. Those studies employed alpha,beta-methylene ATP, a poorly hydrolysable ATP analogue, as the agonist. In this study these compounds have been tested using ATP as the agonist. 2. Suramin, in the concentration range 30-1000 microM, potentiated the contractile effects of ATP, producing a 3-fold leftward shift of the ATP E/[A] curves. FPL 66301, in the concentration range 100-1000 microM, produced a significant but small (approximately 3-fold) rightward shift of the ATP curves. These results are in marked contrast with previous studies using alpha,beta-methylene ATP in which 30-fold rightward shifts were achieved using the same concentration ranges of suramin and FPL 66301. 3. Suramin and FPL 66301 were tested as ecto-ATPase inhibitors in a human blood cell assay. Suramin inhibited the enzyme with a pIC50 of 4.3, FPL 66301 with a pIC50 of 3.3. 4. The pharmacological data were analysed using a theoretical model describing the action of a compound with dual enzyme inhibitory and receptor antagonistic properties on the effects of an agonist susceptible to enzymatic degradation. The model was found to fit the data well using the known pKB estimates for suramin and FPL 66301 and similar relative (but not absolute) pK1 estimates to those obtained for the compounds in the enzyme assay. 5. From this analysis it was concluded that the limited shifts of ATP E/[A] curves produced by suramin and FPL 66301 were the result of 'self-cancellation' of the potentiating (enzyme inhibitory) and rightward-shifting (receptor antagonistic) properties.6. The analysis also indicated that the presence of ecto-ATPase activity in the rabbit ear artery preparation has a marked effect on the apparent potency of ATP. The experimental p[A50] was 3.4,whereas the 'true' value, that is the value which would be obtained in the absence of ecto-ATPase activity, was 6.0, some 400-fold higher.7 Two conclusions are drawn from this study. Firstly, caution must be exercised in the use of suramin and FPL 66301 as tools for receptor classification. Absence of overt antagonism by these compounds when metabolically unstable agonists are used could lead to erroneous claims for receptor subtypes.Secondly, the agonist potency order currently used to designate P2X- purinoceptors may require modification.

Centrifugation assay for measuring adhesion of serially passaged bovine chondrocytes to polystyrene surfaces.

PubMed

Kaplan, David S; Hitchins, Victoria M; Vegella, Thomas J; Malinauskas, Richard A; Ferlin, Kimberly M; Fisher, John P; Frondoza, Carmelita G

2012-07-01

A major obstacle in chondrocyte-based therapy for cartilage repair is the limited availability of cells that maintain their original phenotype. Propagation of chondrocytes as monolayer cultures on polystyrene surfaces is used extensively for amplifying cell numbers. However, chondrocytes undergo a phenotypic shift when propagated in this manner and display characteristics of more adherent fibroblastic cells. Little information is available about the effect of this phenotypic shift on cellular adhesion properties. We evaluated changes in adhesion property as bovine chondrocytes were serially propagated up to five passages in monolayer culture using a centrifugation cell adhesion assay, which was based on counting of cells before and after being exposed to centrifugal dislodgement forces of 120 and 350 g. Chondrocytes proliferated well in a monolayer culture with doubling times of 2-3 days, but they appeared more fibroblastic and exhibited elongated cell morphology with continued passage. The centrifugation cell adhesion assay showed that chondrocytes became more adhesive with passage as the percentage of adherent cells after centrifugation increased and was not statistically different from the adhesion of the fibroblast cell line, L929, starting at passage 3. This increased adhesiveness correlated with a shift to a fibroblastic morphology and increased collagen I mRNA expression starting at passage 2. Our findings indicate that the centrifugation cell adhesion assay may serve as a reproducible tool to track alterations in chondrocyte phenotype during their extended propagation in culture.

Comparative performance of electrochemiluminescence immunoassay and EIA for HIV screening in a multiethnic region of China.

PubMed

Bi, Xiaohui; Ning, Hongxia; Wang, Tingting; Li, Dongdong; Liu, Yongming; Yang, Tingfu; Yu, Jiansheng; Tao, Chuanmin

2012-01-01

The recent approval of 4th generation HIV tests has forced many laboratories to decide whether to shift from 3rd to these tests. There are limited published studies on the comparative evaluation of these two different assays. We compare the performance of fourth-generation electrochemiluminescence immunoassay (ChIA) and third-generation enzyme linked immunosorbent assay (EIA) for human immunodeficiency virus (HIV) screening and gauge whether the shift from EIA to ChIA could be better in a multiethnic region of China. We identified a large number of routine specimens (345,492) using two different assays from Jan 2008 to Aug 2011 in a teaching hospital with high sample throughput. Of the 344,596 specimens with interpretable HIV test results, 526(0.23%) of 228,761 using EIA and 303(0.26%) of 115,835 using ChIA were HIV-1 positive. The false-positive rate of EIA was lower than that of ChIA [0.03% vs. 0.08%, odds ratio 0.33 (95% confidence interval 0.24, 0.45)]. The positive predictive value (PPV) of EIA (89.6%) was significantly higher than that of ChIA (76.1%) (<0.001), reflecting the difference between the two assays. The clinical sensitivities of two assays in this study were 99.64% for EIA and 99.88% for ChIA. Caution is needed before shifting from 3rd to 4th generation HIV tests. Since none of these tests are perfect, different geographic and ethnic area probably require different considerations with regard to HIV testing methods, taking into account the local conditions.

Methanol extract of Codium fragile inhibits tumor necrosis factor-α-induced matrix metalloproteinase-9 and invasiveness of MDA-MB-231 cells by suppressing nuclear factor-κB activation.

PubMed

Dilshara, Matharage Gayani; Jayasooriya, Rajapaksha Gedara Prasad Tharanga; Kang, Chang-Hee; Choi, Yung-Hyun; Kim, Gi-Young

2016-06-01

To evaluate whether the methanol extract of Codium fragile (MECF) regulates tumor necrosis factor-α (TNF-α)-induced invasion of human breast cancer MDA-MB-231 cells by suppressing matrix metalloproteinase-9 (MMP-9). Reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis were performed to analyze the expression of MMP-9 and nuclear factor-κB (NF-κB) subunits, p65 and p50, and IκB in MDA-MB-231 cells. 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay was used for cell viability. MMP-9 activity and invasion were measured by gelatin zymography and a matrigel invasion assay, respectively. NF-κB activity was measured by an electrophoretic mobility shift assay and luciferase activity. MECF had no effect on cell viability up to a concentration of 100 μg/mL in human breast cancer MDA-MB-231 cells regardless of the presence of TNF-α. MDA-MB-231 cells that were stimulated with TNF-α showed a marked increase of invasion compared to the untreated control, whereas pretreatment with MECF downregulated the TNF-α-induced invasion of MDA-MB-231 cells. Additionally, zymography, western blot analysis, and RT-PCR confirmed that MECF decreased TNF-α-induced MMP-9 expression and activity which is a key regulator for cancer invasion. According to an electrophoretic morbidity shift assay, pretreatment with MECF in MDA-MB-231 cells significantly decreased the TNF-α-induced DNA-binding activity of NF-κB, which is an important transcription factor for regulating cancer invasion-related genes such as MMP-9. Furthermore, treatment with MECF sustained the expression of p65 and p50 in response to TNF-α in the cytosolic compartment. The luciferase assay demonstrated that MECF attenuated TNF-α-induced NF-κB luciferase activity. MECF exhibited its anti-invasive capability by downregulating TNF-α-induced MMP-9 expression, resulting from the suppression of NF-κB activity in the human breast cancer cell line MDA-MB-231. Copyright © 2016 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

Time-gated detection of protein-protein interactions with transcriptional readout

PubMed Central

Sanchez, Mateo I; Coukos, Robert; von Zastrow, Mark

2017-01-01

Transcriptional assays, such as yeast two-hybrid and TANGO, that convert transient protein-protein interactions (PPIs) into stable expression of transgenes are powerful tools for PPI discovery, screens, and analysis of cell populations. However, such assays often have high background and lose information about PPI dynamics. We have developed SPARK (Specific Protein Association tool giving transcriptional Readout with rapid Kinetics), in which proteolytic release of a membrane-tethered transcription factor (TF) requires both a PPI to deliver a protease proximal to its cleavage peptide and blue light to uncage the cleavage site. SPARK was used to detect 12 different PPIs in mammalian cells, with 5 min temporal resolution and signal ratios up to 37. By shifting the light window, we could reconstruct PPI time-courses. Combined with FACS, SPARK enabled 51 fold enrichment of PPI-positive over PPI-negative cells. Due to its high specificity and sensitivity, SPARK has the potential to advance PPI analysis and discovery. PMID:29189201

A Multiplexed High-Content Screening Approach Using the Chromobody Technology to Identify Cell Cycle Modulators in Living Cells.

PubMed

Schorpp, Kenji; Rothenaigner, Ina; Maier, Julia; Traenkle, Bjoern; Rothbauer, Ulrich; Hadian, Kamyar

2016-10-01

Many screening hits show relatively poor quality regarding later efficacy and safety. Therefore, small-molecule screening efforts shift toward high-content analysis providing more detailed information. Here, we describe a novel screening approach to identify cell cycle modulators with low toxicity by combining the Cell Cycle Chromobody (CCC) technology with the CytoTox-Glo (CTG) cytotoxicity assay. The CCC technology employs intracellularly functional single-domain antibodies coupled to a fluorescent protein (chromobodies) to visualize the cell cycle-dependent redistribution of the proliferating cell nuclear antigen (PCNA) in living cells. This image-based cell cycle analysis was combined with determination of dead-cell protease activity in cell culture supernatants by the CTG assay. We adopted this multiplex approach to high-throughput format and screened 960 Food and Drug Administration (FDA)-approved drugs. By this, we identified nontoxic compounds, which modulate different cell cycle stages, and validated selected hits in diverse cell lines stably expressing CCC. Additionally, we independently validated these hits by flow cytometry as the current state-of-the-art format for cell cycle analysis. This study demonstrates that CCC imaging is a versatile high-content screening approach to identify cell cycle modulators, which can be multiplexed with cytotoxicity assays for early elimination of toxic compounds during screening. © 2016 Society for Laboratory Automation and Screening.

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

PubMed

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

Evaluating the antimicrobial, apoptotic, and cancer cell gene delivery properties of protein-capped gold nanoparticles synthesized from the edible mycorrhizal fungus Tricholoma crassum

NASA Astrophysics Data System (ADS)

Basu, Arpita; Ray, Sarmishtha; Chowdhury, Supriyo; Sarkar, Arnab; Mandal, Deba Prasad; Bhattacharjee, Shamee; Kundu, Surekha

2018-05-01

Biosynthesis of gold nanoparticles of distinct geometric shapes with highly functional protein coats without additional capping steps is rarely reported. This study describes green synthesis of protein-coated gold nanoparticles for the first time from the edible, mycorrhizal fungus Tricholoma crassum (Berk.) Sacc . The nanoparticles were of the size range 5-25 nm and of different shapes. Spectroscopic analysis showed red shift of the absorption maxima with longer reaction period during production and blue shift with increase in pH. These were characterized with spectroscopy, SEM, TEM, AFM, XRD, and DLS. The particle size could be altered by changing synthesis parameters. These had potent antimicrobial activity against bacteria, fungi, and multi-drug-resistant pathogenic bacteria. These also had inhibitory effect on the growth kinetics of bacteria and germination of fungal spores. These showed apoptotic properties on eukaryotic cells when tested with comet assays. Moreover, the particles are capped with a natural 40 kDa protein which was utilized as attachment sites for genes to be delivered into sarcoma cancer cells. The present work also attempted at optimizing safe dosage of these nanoparticles using hemolysis assays, for application in therapy. Large-scale production of the nanoparticles in fermentors and other possible applications of the particles have been discussed.

Using Next Generation Sequencing for Multiplexed Trait-Linked Markers in Wheat

PubMed Central

Bernardo, Amy; Wang, Shan; St. Amand, Paul; Bai, Guihua

2015-01-01

With the advent of next generation sequencing (NGS) technologies, single nucleotide polymorphisms (SNPs) have become the major type of marker for genotyping in many crops. However, the availability of SNP markers for important traits of bread wheat ( Triticum aestivum L.) that can be effectively used in marker-assisted selection (MAS) is still limited and SNP assays for MAS are usually uniplex. A shift from uniplex to multiplex assays will allow the simultaneous analysis of multiple markers and increase MAS efficiency. We designed 33 locus-specific markers from SNP or indel-based marker sequences that linked to 20 different quantitative trait loci (QTL) or genes of agronomic importance in wheat and analyzed the amplicon sequences using an Ion Torrent Proton Sequencer and a custom allele detection pipeline to determine the genotypes of 24 selected germplasm accessions. Among the 33 markers, 27 were successfully multiplexed and 23 had 100% SNP call rates. Results from analysis of "kompetitive allele-specific PCR" (KASP) and sequence tagged site (STS) markers developed from the same loci fully verified the genotype calls of 23 markers. The NGS-based multiplexed assay developed in this study is suitable for rapid and high-throughput screening of SNPs and some indel-based markers in wheat. PMID:26625271

A nonradioactive assay for poly(a)-specific ribonuclease activity by methylene blue colorimetry.

PubMed

Cheng, Yuan; Liu, Wei-Feng; Yan, Yong-Bin; Zhou, Hai-Meng

2006-01-01

A simple nonradioactive assay, which was based on the specific shift of the absorbance maximum of methylene blue induced by its intercalation into poly(A) molecules, was developed for poly(A)-specific ribonuclease (PARN). A good linear relationship was found between the absorbance at 662 nm and the poly(A) concentration. The assay conditions, including the concentration of methylene blue, the incubation temperature and time, and the poly(A) concentration were evaluated and optimized.

Arginine insertion and loss of N-linked glycosylation site in HIV-1 envelope V3 region confer CXCR4-tropism

PubMed Central

Tsuchiya, Kiyoto; Ode, Hirotaka; Hayashida, Tsunefusa; Kakizawa, Junko; Sato, Hironori; Oka, Shinichi; Gatanaga, Hiroyuki

2013-01-01

The third variable region (V3) of HIV-1 envelope glycoprotein gp120 plays a key role in determination of viral coreceptor usage (tropism). However, which combinations of mutations in V3 confer a tropism shift is still unclear. A unique pattern of mutations in antiretroviral therapy-naive HIV-1 patient was observed associated with the HIV-1 tropism shift CCR5 to CXCR4. The insertion of arginine at position 11 and the loss of the N-linked glycosylation site were indispensable for acquiring pure CXCR4-tropism, which were confirmed by cell-cell fusion assay and phenotype analysis of recombinant HIV-1 variants. The same pattern of mutations in V3 and the associated tropism shift were identified in two of 53 other patients (3.8%) with CD4+ cell count <200/mm3. The combination of arginine insertion and loss of N-linked glycosylation site usually confers CXCR4-tropism. Awareness of this rule will help to confirm the tropism prediction from V3 sequences by conventional rules. PMID:23925152

Affinity Pulldown of Biotinylated RNA for Detection of Protein-RNA Complexes.

PubMed

Panda, Amaresh C; Martindale, Jennifer L; Gorospe, Myriam

2016-12-20

RNA-binding proteins (RBPs) have recently emerged as crucial players in the regulation of gene expression. The interactions of RBPs with target mRNAs control the levels of gene products by altering different regulatory steps, including pre-mRNA splicing and maturation, nuclear mRNA export, and mRNA stability and translation (Glisovic et al. , 2008). There are several methodologies available today to identify RNAs bound to specific RBPs; some detect only recombinant molecules in vitro , others detect recombinant and endogenous molecules, while others detect only endogenous molecules. Examples include systematic evolution of ligands by exponential enrichment (SELEX), biotinylated RNA pulldown assay, RNA immunoprecipitation (RIP) assay, electrophoretic mobility shift assay (EMSA), RNA footprinting analysis, and various UV crosslinking and immunoprecipitation (CLIP) methods such as CLIP, PAR-CLIP, and iCLIP (Popova et al. , 2015). Here, we describe a simple and informative method to study and identify the RNA region of interaction between an RBP and its target transcript (Panda et al. , 2014 and 2016). Its reproducibility and ease of use make this protocol a fast and useful method to identify interactions between RBPs and specific RNAs.

Lactoferricin B Inhibits the Phosphorylation of the Two-Component System Response Regulators BasR and CreB*

PubMed Central

Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng

2012-01-01

Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly. PMID:22138548

Lactoferricin B inhibits the phosphorylation of the two-component system response regulators BasR and CreB.

PubMed

Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng

2012-04-01

Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly.

The evolving potential of companion diagnostics.

PubMed

Khoury, Joseph D

2016-01-01

The scope of companion diagnostics in cancer has undergone significant shifts in the past few years, with increased development of targeted therapies and novel testing platforms. This has provided new opportunities to effect unprecedented paradigm shifts in the application of personalized medicine principles for patients with cancer. These shifts involve assay platforms, analytes, regulations, and therapeutic approaches. As opportunities involving each of these facets of companion diagnostics expand, close collaborations between key stakeholders should be enhanced to ensure optimal performance characteristics and patient outcomes.

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

Prenatal exposure of mice to diethylstilbestrol disrupts T-cell differentiation by regulating Fas/Fas ligand expression through estrogen receptor element and nuclear factor-κB motifs.

PubMed

Singh, Narendra P; Singh, Udai P; Nagarkatti, Prakash S; Nagarkatti, Mitzi

2012-11-01

Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions.

Prenatal Exposure of Mice to Diethylstilbestrol Disrupts T-Cell Differentiation by Regulating Fas/Fas Ligand Expression through Estrogen Receptor Element and Nuclear Factor-κB Motifs

PubMed Central

Singh, Narendra P.; Singh, Udai P.; Nagarkatti, Prakash S.

2012-01-01

Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions. PMID:22888145

Fiber-optic Fourier transform infrared (FO-FTIR) spectroscopy for detecting endotoxin contamination in ophthalmic viscosurgical devices (OVDS) (Conference Presentation)

NASA Astrophysics Data System (ADS)

Hassan, Moinuddin; Ilev, Ilko

2016-03-01

Ophthalmic Viscosurgical Devices (OVDs) in clinical setting are a major health risk factor for potential endotoxin contamination in the eye, due to their extensive applications in cataract surgery for space creation, stabilization and protection of intraocular tissue and intraocular lens (IOL) during implantation. Endotoxin contamination of OVDs is implicated in toxic anterior syndrome (TASS), a severe complication of cataract surgery that leads to intraocular damage and even blindness. Current standard methods for endotoxin contamination detection utilize rabbit assay or Limulus amoebocyte lysate (LAL) assays. These endotoxin detection strategies are extremely difficult for gel-like type devices such as OVDs. To overcome the endotoxin detection limitations in OVDs, we have developed an alternative optical detection methodology for label-free and real-time sensing of bacterial endotoxin in OVDs, based on fiber-optic Fourier transform infrared (FO-FTIR) transmission spectrometry in the mid-IR spectral range from 2.5 micron to 12 micron. Endotoxin contaminated OVD test samples were prepared by serial dilutions of endotoxins on OVDs. The major results of this study revealed two salient spectral peak shifts (in the regions 2925 to 2890 cm^-1 and 1125 to 1100 cm^-1), which are associated with endotoxin in OVDs. In addition, FO-FTIR experimental results processed using a multivariate analysis confirmed the observed specific peak shifts associated with endotoxin contamination in OVDs. Thus, employing the FO-FTIR sensing methodology integrated with a multivariate analysis could potentially be used as an alternative endotoxin detection technique in OVD.

Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

PubMed

Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

1998-01-01

The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

Aluminium-induced excessive ROS causes cellular damage and metabolic shifts in black gram Vigna mungo (L.) Hepper.

PubMed

Chowra, Umakanta; Yanase, Emiko; Koyama, Hiroyuki; Panda, Sanjib Kumar

2017-01-01

Aluminium-induced oxidative damage caused by excessive ROS production was evaluated in black gram pulse crop. Black gram plants were treated with different aluminium (Al 3+ ) concentrations (10, 50 and 100 μM with pH 4.7) and further the effects of Al 3+ were characterised by means of root growth inhibition, histochemical assay, ROS content analysis, protein carbonylation quantification and 1 H-NMR analysis. The results showed that aluminium induces excessive ROS production which leads to cellular damage, root injury, stunt root growth and other metabolic shifts. In black gram, Al 3+ induces cellular damage at the earliest stage of stress which was characterised from histochemical analysis. From this study, it was observed that prolonged stress can activate certain aluminium detoxification defence mechanism. Probably excessive ROS triggers such defence mechanism in black gram. Al 3+ can induce excessive ROS initially in the root region then transported to other parts of the plant. As much as the Al 3+ concentration increases, the rate of cellular injury and ROS production also increases. But after 72 h of stress, plants showed a lowered ROS level and cellular damage which indicates the upregulation of defensive mechanisms. Metabolic shift analysis also showed that the black gram plant under stress has less metabolic content after 24 h of treatment, but gradually, it was increased after 72 h of treatment. It was assumed that ROS played the most important role as a signalling molecule for aluminium stress in black gram.

Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

PubMed

Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

2018-06-01

To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

Habituation as an adaptive shift in response strategy mediated by neuropeptides

NASA Astrophysics Data System (ADS)

Ardiel, Evan L.; Yu, Alex J.; Giles, Andrew C.; Rankin, Catharine H.

2017-08-01

Habituation is a non-associative form of learning characterized by a decremented response to repeated stimulation. It is typically framed as a process of selective attention, allowing animals to ignore irrelevant stimuli in order to free up limited cognitive resources. However, habituation can also occur to threatening and toxic stimuli, suggesting that habituation may serve other functions. Here we took advantage of a high-throughput Caenorhabditis elegans learning assay to investigate habituation to noxious stimuli. Using real-time computer vision software for automated behavioral tracking and optogenetics for controlled activation of a polymodal nociceptor, ASH, we found that neuropeptides mediated habituation and performed an RNAi screen to identify candidate receptors. Through subsequent mutant analysis and cell-type-specific gene expression, we found that pigment-dispersing factor (PDF) neuropeptides function redundantly to promote habituation via PDFR-1-mediated cAMP signaling in both neurons and muscles. Behavioral analysis during learning acquisition suggests that response habituation and sensitization of locomotion are parts of a shifting behavioral strategy orchestrated by pigment dispersing factor signaling to promote dispersal away from repeated aversive stimuli.

The regulation of the SARK promoter activity by hormones and environmental signals.

PubMed

Delatorre, Carla A; Cohen, Yuval; Liu, Li; Peleg, Zvi; Blumwald, Eduardo

2012-09-01

The Senescence Associated Receptor Protein Kinase (P(SARK)) promoter, fused to isopentenyltransferase (IPT) gene has been shown to promote drought tolerance in crops. We dissected P(SARK) in order to understand the various elements associated with its activation and suppression. The activity of P(SARK) was higher in mature and early senescing leaves, and abiotic stress induced its activity in mature leaves. Bioinformatics analysis suggests the interactions of multiple cis-acting elements in the control of P(SARK) activity. In vitro gel shift assays and yeast one hybrid system revealed interactions of P(SARK) with transcription factors related to abscisic acid and cytokinin response. Deletion analysis of P(SARK), fused to GUS-reporter gene was used to identify specific regions regulating transcription under senescence or during drought stress. Effects of exogenous hormonal treatments were characterized in entire plants and in leaf disk assays, and regions responsive to various hormones were defined. Our results indicate a complex interaction of plant hormones and additional factors modulating P(SARK) activity under stress resulting in a transient induction of expression. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Morphometric Characterization of Rat and Human Alveolar Macrophage Cell Models and their Response to Amiodarone using High Content Image Analysis.

PubMed

Hoffman, Ewelina; Patel, Aateka; Ball, Doug; Klapwijk, Jan; Millar, Val; Kumar, Abhinav; Martin, Abigail; Mahendran, Rhamiya; Dailey, Lea Ann; Forbes, Ben; Hutter, Victoria

2017-12-01

Progress to the clinic may be delayed or prevented when vacuolated or "foamy" alveolar macrophages are observed during non-clinical inhalation toxicology assessment. The first step in developing methods to study this response in vitro is to characterize macrophage cell lines and their response to drug exposures. Human (U937) and rat (NR8383) cell lines and primary rat alveolar macrophages obtained by bronchoalveolar lavage were characterized using high content fluorescence imaging analysis quantification of cell viability, morphometry, and phospholipid and neutral lipid accumulation. Cell health, morphology and lipid content were comparable (p < 0.05) for both cell lines and the primary macrophages in terms of vacuole number, size and lipid content. Responses to amiodarone, a known inducer of phospholipidosis, required analysis of shifts in cell population profiles (the proportion of cells with elevated vacuolation or lipid content) rather than average population data which was insensitive to the changes observed. A high content image analysis assay was developed and used to provide detailed morphological characterization of rat and human alveolar-like macrophages and their response to a phospholipidosis-inducing agent. This provides a basis for development of assays to predict or understand macrophage vacuolation following inhaled drug exposure.

Protein-ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI).

PubMed

Grøftehauge, Morten K; Hajizadeh, Nelly R; Swann, Marcus J; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein-ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

PubMed Central

Grøftehauge, Morten K.; Hajizadeh, Nelly R.; Swann, Marcus J.; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography. PMID:25615858

Promoter mapping of the mouse Tcp-10bt gene in transgenic mice identifies essential male germ cell regulatory sequences.

PubMed

Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C

1996-03-01

Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.

Quantification of mRNA expression by competitive PCR using non-homologous competitors containing a shifted restriction site

PubMed Central

Watzinger, Franz; Hörth, Elfriede; Lion, Thomas

2001-01-01

Despite the recent introduction of real-time PCR methods, competitive PCR techniques continue to play an important role in nucleic acid quantification because of the significantly lower cost of equipment and consumables. Here we describe a shifted restriction-site competitive PCR (SRS-cPCR) assay based on a modified type of competitor. The competitor fragments are designed to contain a recognition site for a restriction endonuclease that is also present in the target sequence to be quantified, but in a different position. Upon completion of the PCR, the amplicons are digested in the same tube with a single restriction enzyme, without the need to purify PCR products. The generated competitor- and target-specific restriction fragments display different sizes, and can be readily separated by electrophoresis and quantified by image analysis. Suboptimal digestion affects competitor- and target-derived amplicons to the same extent, thus eliminating the problem of incorrect quantification as a result of incomplete digestion of PCR products. We have established optimized conditions for a panel of 20 common restriction endonucleases permitting efficient digestion in PCR buffer. It is possible, therefore, to find a suitable restriction site for competitive PCR in virtually any sequence of interest. The assay presented is inexpensive, widely applicable, and permits reliable and accurate quantification of nucleic acid targets. PMID:11376164

The Feynman-Y Statistic in Relation to Shift-Register Neutron Coincidence Counting: Precision and Dead Time

DOE Office of Scientific and Technical Information (OSTI.GOV)

Croft, Stephen; Santi, Peter A.; Henzlova, Daniela

The Feynman-Y statistic is a type of autocorrelation analysis. It is defined as the excess variance-to-mean ratio, Y = VMR - 1, of the number count distribution formed by sampling a pulse train using a series of non-overlapping gates. It is a measure of the degree of correlation present on the pulse train with Y = 0 for Poisson data. In the context of neutron coincidence counting we show that the same information can be obtained from the accidentals histogram acquired using the multiplicity shift-register method, which is currently the common autocorrelation technique applied in nuclear safeguards. In the casemore » of multiplicity shift register analysis however, overlapping gates, either triggered by the incoming pulse stream or by a periodic clock, are used. The overlap introduces additional covariance but does not alter the expectation values. In this paper we discuss, for a particular data set, the relative merit of the Feynman and shift-register methods in terms of both precision and dead time correction. Traditionally the Feynman approach is applied with a relatively long gate width compared to the dieaway time. The main reason for this is so that the gate utilization factor can be taken as unity rather than being treated as a system parameter to be determined at characterization/calibration. But because the random trigger interval gate utilization factor is slow to saturate this procedure requires a gate width many times the effective 1/e dieaway time. In the traditional approach this limits the number of gates that can be fitted into a given assay duration. We empirically show that much shorter gates, similar in width to those used in traditional shift register analysis can be used. Because the way in which the correlated information present on the pulse train is extracted is different for the moments based method of Feynman and the various shift register based approaches, the dead time losses are manifested differently for these two approaches. The resulting estimates for the dead time corrected first and second order reduced factorial moments should be independent of the method however and this allows the respective dead time formalism to be checked. We discuss how to make dead time corrections in both the shift register and the Feynman approaches.« less

Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay

PubMed Central

Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei

2006-01-01

A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592

Gel shift analysis of the empA promoter region in Vibrio anguillarum.

PubMed

Denkin, Steven M; Sekaric, Pedja; Nelson, David R

2004-10-29

The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG)-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20), nine salts solution + 200 microg/ml mucus (NSSM), 3M (marine minimal medium), or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. The data demonstrate that protein extracts of V. anguillarum NB10 cells contain a protein that binds to a 50 bp oligomer containing the empA promoter-lux box-like region. NB10 cells express empA during stationary phase in all growth conditions. The DNA binding protein is not present in M93Sm extracts. M93Sm cells express protease activity only when incubated at high cell density in fish gastrointestinal mucus. The gel shift observed with NB10 cells is not due to VanT binding. The data also suggest that the DNA binding protein is responsible for the less restrictive expression of empA in NB10 compared to M93Sm.

Mechanisms of diminished natural killer cell activity in pregnant women and neonates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baley, J.E.; Schacter, B.Z.

1985-05-01

Because alterations in natural killer (NK) activity in the perinatal period may be important in the maintenance of a healthy pregnancy, the mechanisms by which these alterations are mediated in neonates and in pregnant and postpartum women was examined. NK activity, as measured in a 4-hr /sup 51/Cr-release assay and compared with adult controls, is significantly diminished in all three trimesters of pregnancy and in immediately postpartum women. In postpartum women, NK activity appears to be higher than in pregnant women, although this does not reach statistical significance. Pregnant and postpartum women have normal numbers of large granular lymphocytes andmore » normal target cell binding in an agarose single cell assay but decreased lysis of the bound target cells. NK activity of mononuclear cells from postpartum women, in addition, demonstrate a shift in distribution to higher levels of resistance to gamma-irradiation. Further, sera from postpartum women cause a similar shift to increased radioresistance in mononuclear cells from adult controls. Because radioresistance is a property of interleukin 2-stimulated NK, the shift to radioresistance may represent lymphokine-mediated stimulation occurring during parturition. In contrast, cord blood cells have a more profound decrease in NK activity as determined by /sup 51/Cr-release assay and decreases in both binding and lysis of bound target cells in the single cell assay. The resistance of NK activity in cord cells to gamma-irradiation is also increased, as seen in postpartum women. Cord blood serum, however, did not alter radioresistance or inhibit NK activity. The results suggest that the observed diminished NK activity in pregnant women and neonates arise by different mechanisms: an absence of mature NK cells in the neonate and an alteration of the NK cell in pregnancy leading to decreased killing.« less

Isolation and characterization of a bactericidal withanolide from Physalis virginiana.

PubMed

Gibson, Kathleen A; Reese, R Neil; Halaweish, Fathi T; Ren, Yulin

2012-01-01

Physalis virginiana (Virginia Groundcherry) is a member of the family Solenaceae. Several species of the Physalis genus have been used traditionally by American Indians as medicinal treatments. This study investigated the antibacterial activity of chemicals extracted from P. virginiana through antibacterial disc and cytotoxicity assays. Isolation and purification of an antimicrobial compound was achieved through flash chromatography and preparative HPLC. Finally, identification of chemical structure was determined from (1)H and (13)C NMR and MS. Disc assays showed that crude ethanol extracts were effective antibacterial agents against one gram-negative and seven gram-positive bacterial strains. Cytotoxicity assays indicated that it is less toxic than gentamicin controls. Isolation of the active component showed it to be a relatively polar compound. (1)H and (13)C NMR chemical shifts together with HRMS indicated a similar structure to withanolides previously identified from Physalis angulata. HRMS analysis showed a molecular mass of 472.2857 which corresponds to a molecular formula C(28)H(40)O(6). An antibacterial withanolide was isolated from P. virginiana using flash chromatography and HPLC separations. The chemical structure was determined by NMR and MS to be the withanolide physagulin V.

Histone deacetylase inhibitors induce growth arrest and differentiation in uveal melanoma

PubMed Central

Landreville, Solange; Agapova, Olga A.; Matatall, Katie A.; Kneass, Zachary T.; Onken, Michael D.; Lee, Ryan S.; Bowcock, Anne M.; Harbour, J. William

2011-01-01

Purpose Metastasis is responsible for the death of most cancer patients, yet few therapeutic agents are available which specifically target the molecular events that lead to metastasis. We recently showed that inactivating mutations in the tumor suppressor gene BAP1 are closely associated with loss of melanocytic differentiation in uveal melanoma and metastasis (UM). The purpose of this study was to identify therapeutic agents that reverse the phenotypic effects of BAP1 loss in UM. Experimental Design In silico screens were performed to identify therapeutic compounds predicted to differentiate UM cells using Gene Set Enrichment Analysis and Connectivity Map databases. Valproic acid, trichostatin A, LBH-589 and suberoylanilide hydroxamic acid were evaluated for their effects on UM cells using morphologic evaluation, MTS viability assays, BrdU incorporation, flow cytometry, clonogenic assays, gene expression profiling, histone acetylation and ubiquitination assays, and a murine xenograft tumorigenicity model. Results HDAC inhibitors induced morphologic differentiation, cell cycle exit, and a shift to a differentiated, melanocytic gene expression profile in cultured UM cells. Valproic acid inhibited the growth of UM tumors in vivo. Conclusions These findings suggest that HDAC inhibitors may have therapeutic potential for inducing differentiation and prolonged dormancy of micrometastatic disease in UM. PMID:22038994

Unlabeled oligonucleotides as internal temperature controls for genotyping by amplicon melting.

PubMed

Seipp, Michael T; Durtschi, Jacob D; Liew, Michael A; Williams, Jamie; Damjanovich, Kristy; Pont-Kingdon, Genevieve; Lyon, Elaine; Voelkerding, Karl V; Wittwer, Carl T

2007-07-01

Amplicon melting is a closed-tube method for genotyping that does not require probes, real-time analysis, or allele-specific polymerase chain reaction. However, correct differentiation of homozygous mutant and wild-type samples by melting temperature (Tm) requires high-resolution melting and closely controlled reaction conditions. When three different DNA extraction methods were used to isolate DNA from whole blood, amplicon Tm differences of 0.03 to 0.39 degrees C attributable to the extractions were observed. To correct for solution chemistry differences between samples, complementary unlabeled oligonucleotides were included as internal temperature controls to shift and scale the temperature axis of derivative melting plots. This adjustment was applied to a duplex amplicon melting assay for the methylenetetrahydrofolate reductase variants 1298A>C and 677C>T. High- and low-temperature controls bracketing the amplicon melting region decreased the Tm SD within homozygous genotypes by 47 to 82%. The amplicon melting assay was 100% concordant to an adjacent hybridization probe (HybProbe) melting assay when temperature controls were included, whereas a 3% error rate was observed without temperature correction. In conclusion, internal temperature controls increase the accuracy of genotyping by high-resolution amplicon melting and should also improve results on lower resolution instruments.

Isolation and characterization of a bactericidal withanolide from Physalis virginiana

PubMed Central

Gibson, Kathleen A.; Reese, R. Neil; Halaweish, Fathi T.; Ren, Yulin

2012-01-01

Background: Physalis virginiana (Virginia Groundcherry) is a member of the family Solenaceae. Several species of the Physalis genus have been used traditionally by American Indians as medicinal treatments. Materials and Methods: This study investigated the antibacterial activity of chemicals extracted from P. virginiana through antibacterial disc and cytotoxicity assays. Isolation and purification of an antimicrobial compound was achieved through flash chromatography and preparative HPLC. Finally, identification of chemical structure was determined from 1H and 13C NMR and MS. Results: Disc assays showed that crude ethanol extracts were effective antibacterial agents against one gram-negative and seven gram-positive bacterial strains. Cytotoxicity assays indicated that it is less toxic than gentamicin controls. Isolation of the active component showed it to be a relatively polar compound. 1H and 13C NMR chemical shifts together with HRMS indicated a similar structure to withanolides previously identified from Physalis angulata. HRMS analysis showed a molecular mass of 472.2857 which corresponds to a molecular formula C28H40O6. Conclusion: An antibacterial withanolide was isolated from P. virginiana using flash chromatography and HPLC separations. The chemical structure was determined by NMR and MS to be the withanolide physagulin V. PMID:22438659

A Novel Heat Shock Element (HSE) in Entamoeba histolytica that Regulates the Transcriptional Activation of the EhPgp5 Gene in the Presence of Emetine Drug.

PubMed

Nieto, Alma; Pérez Ishiwara, David G; Orozco, Esther; Sánchez Monroy, Virginia; Gómez García, Consuelo

2017-01-01

Transcriptional regulation of the multidrug resistance EhPgp5 gene in Entamoeba histolytica is induced by emetine stress. EhPgp5 overexpression alters the chloride-dependent currents that cause trophozoite swelling, diminishing induced programmed cell death (PCD) susceptibility. In contrast, antisense inhibition of P-glycoprotein (PGP) expression produces synchronous death of trophozoites and the enhancement of the biochemical and morphological characteristics of PCD induced by G418. Transcriptional gene regulation analysis identified a 59 bp region at position -170 to -111 bp promoter as putative emetine response elements (EREs). However, insights into transcription factors controlling EhPgp5 gene transcription are missing; to fill this knowledge gap, we used deletion studies and transient CAT activity assays. Our findings suggested an activating motif (-151 to -136 bp) that corresponds to a heat shock element (HSE). Gel-shift assays, UV-crosslinking, binding protein purification, and western blotting assays revealed proteins of 94, 66, 62, and 51 kDa binding to the EhPgp5 HSE that could be heat shock-like transcription factors that regulate the transcriptional activation of the EhPgp5 gene in the presence of emetine drug.

A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

PubMed Central

Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

2017-01-01

Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

Femtomole-Scale High-Throughput Screening of Protein Ligands with Droplet-Based Thermal Shift Assay.

PubMed

Liu, Wen-Wen; Zhu, Ying; Fang, Qun

2017-06-20

There is a great demand to measure protein-ligand interactions in rapid and low cost way. Here, we developed a microfluidic droplet-based thermal shift assay (dTSA) system for high-throughput screening of small-molecule protein ligands. The system is composed of a nanoliter droplet array chip, a microfluidic droplet robot, and a real-time fluorescence detection system. Total 324 assays could be performed in parallel in a single chip with an 18 × 18 droplet array. The consumption of dTSA for each protein or ligand sample was only 5 nL (femtomole scale), which is significantly reduced by over 3 orders of magnitude compared with those in 96- or 384-well plate-based systems. We also observed the implementation of TSA in nanoliter droplet format could substantially improve assay precision with relative standard deviation (RSD) of 0.2% (n = 50), which can be ascribed to the enhanced thermal conduction in small volume reactors. The dTSA system was optimized by studying the effect of droplet volumes, as well as protein and fluorescent dye (SYPRO Orange) concentrations. To demonstrate its potential in drug discovery, we applied the dTSA system in screening inhibitors of human thrombin with a commercial library containing 100 different small molecule compounds, and two inhibitors were successfully identified and confirmed.

Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene.

PubMed

Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen

2016-01-01

The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5'-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5'-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5'-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle.

Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene

PubMed Central

Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen

2016-01-01

The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5’-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5’-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5’-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle. PMID:27379520

Diaphorase Coupling Protocols for Red-Shifting Dehydrogenase Assays

PubMed Central

Davis, Mindy I.; Shen, Min; Simeonov, Anton

2016-01-01

Abstract Dehydrogenases are an important target for the development of cancer therapeutics. Dehydrogenases either produce or consume NAD(P)H, which is fluorescent but at a wavelength where many compounds found in chemical libraries are also fluorescent. By coupling dehydrogenases to diaphorase, which utilizes NAD(P)H to produce the fluorescent molecule resorufin from resazurin, the assay can be red-shifted into a spectral region that reduces interference from compound libraries. Dehydrogenases that produce NAD(P)H, such as isocitrate dehydrogenase 1 (IDH1), can be read in kinetic mode. Dehydrogenases that consume NAD(P)H, such as mutant IDH1 R132H, can be read in endpoint mode. Here, we report protocols for robust and miniaturized 1,536-well assays for WT IDH1 and IDH1 R132H coupled to diaphorase, and the counterassays used to further detect compound interference with the coupling reagents. This coupling technique is applicable to dehydrogenases that either produce or consume NAD(P)H, and the examples provided here can act as guidelines for the development of high-throughput screens against this enzyme class. PMID:27078681

Live Cell Visualization of Multiple Protein-Protein Interactions with BiFC Rainbow.

PubMed

Wang, Sheng; Ding, Miao; Xue, Boxin; Hou, Yingping; Sun, Yujie

2018-05-18

As one of the most powerful tools to visualize PPIs in living cells, bimolecular fluorescence complementation (BiFC) has gained great advancement during recent years, including deep tissue imaging with far-red or near-infrared fluorescent proteins or super-resolution imaging with photochromic fluorescent proteins. However, little progress has been made toward simultaneous detection and visualization of multiple PPIs in the same cell, mainly due to the spectral crosstalk. In this report, we developed novel BiFC assays based on large-Stokes-shift fluorescent proteins (LSS-FPs) to detect and visualize multiple PPIs in living cells. With the large excitation/emission spectral separation, LSS-FPs can be imaged together with normal Stokes shift fluorescent proteins to realize multicolor BiFC imaging using a simple illumination scheme. We also further demonstrated BiFC rainbow combining newly developed BiFC assays with previously established mCerulean/mVenus-based BiFC assays to achieve detection and visualization of four PPI pairs in the same cell. Additionally, we prove that with the complete spectral separation of mT-Sapphire and CyOFP1, LSS-FP-based BiFC assays can be readily combined with intensity-based FRET measurement to detect ternary protein complex formation with minimal spectral crosstalk. Thus, our newly developed LSS-FP-based BiFC assays not only expand the fluorescent protein toolbox available for BiFC but also facilitate the detection and visualization of multiple protein complex interactions in living cells.

GATA-1 directly regulates Nanog in mouse embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100

2015-09-25

Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

PubMed

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

Comprehensive comparative analysis of 5'-end RNA-sequencing methods.

PubMed

Adiconis, Xian; Haber, Adam L; Simmons, Sean K; Levy Moonshine, Ami; Ji, Zhe; Busby, Michele A; Shi, Xi; Jacques, Justin; Lancaster, Madeline A; Pan, Jen Q; Regev, Aviv; Levin, Joshua Z

2018-06-04

Specialized RNA-seq methods are required to identify the 5' ends of transcripts, which are critical for studies of gene regulation, but these methods have not been systematically benchmarked. We directly compared six such methods, including the performance of five methods on a single human cellular RNA sample and a new spike-in RNA assay that helps circumvent challenges resulting from uncertainties in annotation and RNA processing. We found that the 'cap analysis of gene expression' (CAGE) method performed best for mRNA and that most of its unannotated peaks were supported by evidence from other genomic methods. We applied CAGE to eight brain-related samples and determined sample-specific transcription start site (TSS) usage, as well as a transcriptome-wide shift in TSS usage between fetal and adult brain.

Molecular Cloning, Functional Characterization, and Evolutionary Analysis of Vitamin D Receptors Isolated from Basal Vertebrates

PubMed Central

Kollitz, Erin M.; Zhang, Guozhu; Hawkins, Mary Beth; Whitfield, G. Kerr; Reif, David M.; Kullman, Seth W.

2015-01-01

The vertebrate genome is a result of two rapid and successive rounds of whole genome duplication, referred to as 1R and 2R. Furthermore, teleost fish have undergone a third whole genome duplication (3R) specific to their lineage, resulting in the retention of multiple gene paralogs. The more recent 3R event in teleosts provides a unique opportunity to gain insight into how genes evolve through specific evolutionary processes. In this study we compare molecular activities of vitamin D receptors (VDR) from basal species that diverged at key points in vertebrate evolution in order to infer derived and ancestral VDR functions of teleost paralogs. Species include the sea lamprey (Petromyzon marinus), a 1R jawless fish; the little skate (Leucoraja erinacea), a cartilaginous fish that diverged after the 2R event; and the Senegal bichir (Polypterus senegalus), a primitive 2R ray-finned fish. Saturation binding assays and gel mobility shift assays demonstrate high affinity ligand binding and classic DNA binding characteristics of VDR has been conserved across vertebrate evolution. Concentration response curves in transient transfection assays reveal EC50 values in the low nanomolar range, however maximum transactivational efficacy varies significantly between receptor orthologs. Protein-protein interactions were investigated using co-transfection, mammalian 2-hybrid assays, and mutations of coregulator activation domains. We then combined these results with our previous study of VDR paralogs from 3R teleosts into a bioinformatics analysis. Our results suggest that 1, 25D3 acts as a partial agonist in basal species. Furthermore, our bioinformatics analysis suggests that functional differences between VDR orthologs and paralogs are influenced by differential protein interactions with essential coregulator proteins. We speculate that we may be observing a change in the pharmacodynamics relationship between VDR and 1, 25D3 throughout vertebrate evolution that may have been driven by changes in protein-protein interactions between VDR and essential coregulators. PMID:25855982

Microbiota and Metatranscriptome Changes Accompanying the Onset of Gingivitis

PubMed Central

2018-01-01

ABSTRACT Over half of adults experience gingivitis, a mild yet treatable form of periodontal disease caused by the overgrowth of oral microbes. Left untreated, gingivitis can progress to a more severe and irreversible disease, most commonly chronic periodontitis. While periodontal diseases are associated with a shift in the oral microbiota composition, it remains unclear how this shift impacts microbiota function early in disease progression. Here, we analyzed the transition from health to gingivitis through both 16S v4-v5 rRNA amplicon and metatranscriptome sequencing of subgingival plaque samples from individuals undergoing an experimental gingivitis treatment. Beta-diversity analysis of 16S rRNA reveals that samples cluster based on disease severity and patient but not by oral hygiene status. Significant shifts in the abundance of several genera occurred during disease transition, suggesting a dysbiosis due to development of gingivitis. Comparing taxonomic abundance with transcriptomic activity revealed concordance of bacterial diversity composition between the two quantification assays in samples originating from both healthy and diseased teeth. Metatranscriptome sequencing analysis indicates that during the early stages of transition to gingivitis, a number of virulence-related transcripts were significantly differentially expressed in individual and across pooled patient samples. Upregulated genes include those involved in proteolytic and nucleolytic processes, while expression levels of those involved in surface structure assembly and other general virulence functions leading to colonization or adaptation within the host are more dynamic. These findings help characterize the transition from health to periodontal disease and identify genes associated with early disease. PMID:29666288

Recurrent isolation of extremotolerant bacteria from the clean room where Phoenix spacecraft components were assembled.

PubMed

Ghosh, Sudeshna; Osman, Shariff; Vaishampayan, Parag; Venkateswaran, Kasthuri

2010-04-01

The microbial burden of the Phoenix spacecraft assembly environment was assessed in a systematic manner via several cultivation-based techniques and a suite of NASA-certified, cultivation-independent biomolecule-based detection assays. Extremotolerant bacteria that could potentially survive conditions experienced en route to Mars or on the planet's surface were isolated with a series of cultivation-based assays that promoted the growth of a variety of organisms, including spore formers, mesophilic heterotrophs, anaerobes, thermophiles, psychrophiles, alkaliphiles, and bacteria resistant to UVC radiation and hydrogen peroxide exposure. Samples were collected from the clean room where Phoenix was housed at three different time points, before (1P), during (2P), and after (3P) Phoenix's presence at the facility. There was a reduction in microbial burden of most bacterial groups, including spore formers, in samples 2P and 3P. Analysis of 262 isolates from the facility demonstrated that there was also a shift in predominant cultivable bacterial populations accompanied by a reduction in diversity during 2P and 3P. It is suggested that this shift was a result of increased cleaning when Phoenix was present in the assembly facility and that certain species, such as Acinetobacter johnsonii and Brevundimonas diminuta, may be better adapted to environmental conditions found during 2P and 3P. In addition, problematic bacteria resistant to multiple extreme conditions, such as Bacillus pumilus, were able to survive these periods of increased cleaning.

Threading the Needle: Small-Molecule Targeting of a Xenobiotic Receptor to Ablate Escherichia coli Polysaccharide Capsule Expression Without Altering Antibiotic Resistance.

PubMed

Arshad, Mehreen; Goller, Carlos C; Pilla, Danielle; Schoenen, Frank J; Seed, Patrick C

2016-04-15

Uropathogenic Escherichia coli (UPEC), a leading cause of urinary tract and invasive infections worldwide, is rapidly acquiring multidrug resistance, hastening the need for selective new anti-infective agents. Here we demonstrate the molecular target of DU011, our previously discovered potent, nontoxic, small-molecule inhibitor of UPEC polysaccharide capsule biogenesis and virulence. Real-time polymerase chain reaction analysis and a target-overexpression drug-suppressor screen were used to localize the putative inhibitor target. A thermal shift assay quantified interactions between the target protein and the inhibitor, and a novel DNase protection assay measured chemical inhibition of protein-DNA interactions. Virulence of a regulatory target mutant was assessed in a murine sepsis model. MprA, a MarR family transcriptional repressor, was identified as the putative target of the DU011 inhibitor. Thermal shift measurements indicated the formation of a stable DU011-MprA complex, and DU011 abrogated MprA binding to its DNA promoter site. Knockout of mprA had effects similar to that of DU011 treatment of wild-type bacteria: a loss of encapsulation and complete attenuation in a murine sepsis model, without any negative change in antibiotic resistance. MprA regulates UPEC polysaccharide encapsulation, is essential for UPEC virulence, and can be targeted without inducing antibiotic resistance. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

EMSA Analysis of DNA Binding By Rgg Proteins

PubMed Central

LaSarre, Breah; Federle, Michael J.

2016-01-01

In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004

EMSA Analysis of DNA Binding By Rgg Proteins.

PubMed

LaSarre, Breah; Federle, Michael J

2013-08-20

In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).

Gel shift analysis of the empA promoter region in Vibrio anguillarum

PubMed Central

Denkin, Steven M; Sekaric, Pedja; Nelson, David R

2004-01-01

Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG)-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20), nine salts solution + 200 μg/ml mucus (NSSM), 3M (marine minimal medium), or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V. anguillarum NB10 cells contain a protein that binds to a 50 bp oligomer containing the empA promoter-lux box-like region. NB10 cells express empA during stationary phase in all growth conditions. The DNA binding protein is not present in M93Sm extracts. M93Sm cells express protease activity only when incubated at high cell density in fish gastrointestinal mucus. The gel shift observed with NB10 cells is not due to VanT binding. The data also suggest that the DNA binding protein is responsible for the less restrictive expression of empA in NB10 compared to M93Sm. PMID:15516264

Detection of DNA damage in workers exposed to JP-8 jet fuel.

PubMed

Krieg, Edward F; Mathias, Patricia I; Toennis, Christine A; Clark, John C; Marlow, Kate L; B'hymer, Clayton; Singh, Narendra P; Gibson, Roger L; Butler, Mary Ann

2012-09-18

The genotoxicity of jet propulsion fuel 8 (JP-8) was assessed in the leukocytes of archived blood specimens from U.S. Air Force personnel using the comet assay. No differences in mean comet assay measurements were found between low, moderate, and high exposure groups before or after a 4h work shift. Before the work shift, mean tail DNA and mean tail (Olive) moment increased as the concentration of benzene measured in end-exhaled breath increased, indicating that prior environmental or work-related exposures to benzene produced DNA damage. The number of cells with highly damaged DNA decreased as the pre-shift benzene concentration in breath increased. It is not clear why the decrease is occurring. Mean tail DNA and mean tail (Olive) moment decreased as the concentrations of benzene and naphthalene measured in breath immediately after the work shift increased. These inverse relationships may reflect a slower rate of absorption or a faster rate of expiration of benzene in the lung. The number of cells with highly damaged DNA increased as the concentration of urinary (2-methoxyethoxy)acetic acid (MEAA) increased. This relationship was not seen in urinary MEAA adjusted for creatinine. MEAA is a metabolite of the deicing agent 2-(2-methoxyethoxy)ethanol contained in JP-8. MEAA or a component of JP-8 correlated with MEAA may have a toxic effect on DNA. Published by Elsevier B.V.

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

A novel hsp110-related gene, apg-1, that is abundantly expressed in the testis responds to a low temperature heat shock rather than the traditional elevated temperatures.

PubMed

Kaneko, Y; Nishiyama, H; Nonoguchi, K; Higashitsuji, H; Kishishita, M; Fujita, J

1997-01-31

We isolated a novel hsp110-related gene, apg-1, from a testis cDNA library. The apg-1 transcripts were constitutively expressed in the testicular germ cells and, in some degree, most tissues examined. In a mouse TAMA26 Sertoli cell line, apg-1 transcripts were induced in 2 h by a temperature shift from 32 to 39 degrees C, but not by a shift from 37 to 42 degrees C, the traditional heat stress, or a shift from 32 to 42 degrees C. The heat response pattern of hsp110 expression was similar to that of apg-1. Although induction of a hsp70 transcript was observed in 2 h by a shift from 32 to 39 degrees C, the induction was more apparent by a shift from 37 to 42 degrees C or from 32 to 42 degrees C. Essentially similar differential response patterns were observed among these genes in NIH/3T3 fibroblasts as well. The nuclear run-on assay and the native gel mobility shift assay demonstrated that, by the 32 to 39 degrees C temperature shift, the apg-1 gene was transcriptionally activated, and heat shock factor 1 bound to the heat shock elements in the 5'-flanking region of the apg-1 gene. These results demonstrated that expressions of apg-1, hsp110, and hsp70 could be heat-induced at a temperature lower than the traditional elevated temperatures in somatic cells of both testis and nontestis origin and suggest that the mechanisms regulating the transcript levels of apg-1 and hsp110 are different from those of hsp70. Furthermore, the constitutive expression in germ cells suggests that APG-1 plays a specific role in spermatogenesis as well as in stress response.

Identification of squid species by melting temperature shifts on fluorescence melting curve analysis (FMCA) using single dual-labeled probe

NASA Astrophysics Data System (ADS)

Koh, Eunjung; Song, Ha Jeong; Kwon, Na Young; Kim, Gi Won; Lee, Kwang Ho; Jo, Soyeon; Park, Sujin; Park, Jihyun; Park, Eun Kyeong; Hwang, Seung Yong

2017-06-01

Real time PCR is a standard method for identification of species. One of limitations of the qPCR is that there would be false-positive result due to mismatched hybridization between target sequence and probe depending on the annealing temperature in the PCR condition. As an alternative, fluorescence melting curve analysis (FMCA) could be applied for species identification. FMCA is based on a dual-labeled probe. Even with subtle difference of target sequence, there are visible melting temperature (Tm) shift. One of FMCA applications is distinguishing organisms distributed and consumed globally as popular food ingredients. Their prices are set by species or country of origin. However, counterfeiting or distributing them without any verification procedure are becoming social problems and threatening food safety. Besides distinguishing them in naked eye is very difficult and almost impossible in any processed form. Therefore, it is necessary to identify species in molecular level. In this research three species of squids which have 1-2 base pair differences each are selected as samples since they have the same issue. We designed a probe which perfectly matches with one species and the others mismatches 2 and 1 base pair respectively and labeled with fluorophore and quencher. In an experiment with a single probe, we successfully distinguished them by Tm shift depending on the difference of base pair. By combining FMCA and qPCR chip, smaller-scale assay with higher sensitivity and resolution could be possible, andc furthermore, enabling results analysis with smart phone would realize point-of-care testing (POCT).

Basic Helix-Loop-Helix Transcription Factor Bmsage Is Involved in Regulation of fibroin H-chain Gene via Interaction with SGF1 in Bombyx mori

PubMed Central

Li, Qiong-Yan; Hu, Wen-Bo; Zhou, Meng-Ting; Nie, Hong-Yi; Zhang, Yin-Xia; Peng, Zhang-Chuan; Zhao, Ping; Xia, Qing-You

2014-01-01

Silk glands are specialized in the synthesis of several secretory proteins. Expression of genes encoding the silk proteins in Bombyx mori silk glands with strict territorial and developmental specificities is regulated by many transcription factors. In this study, we have characterized B. mori sage, which is closely related to sage in the fruitfly Drosophila melanogaster. It is termed Bmsage; it encodes transcription factor Bmsage, which belongs to the Mesp subfamily, containing a basic helix–loop–helix motif. Bmsage transcripts were detected specifically in the silk glands of B. mori larvae through RT-PCR analysis. Immunoblotting analysis confirmed the Bmsage protein existed exclusively in B. mori middle and posterior silk gland cells. Bmsage has a low level of expression in the 4th instar molting stages, which increases gradually in the 5th instar feeding stages and then declines from the wandering to the pupation stages. Quantitative PCR analysis suggested the expression level of Bmsage in a high silk strain was higher compared to a lower silk strain on day 3 of the larval 5th instar. Furthermore, far western blotting and co-immunoprecipitation assays showed the Bmsage protein interacted with the fork head transcription factor silk gland factor 1 (SGF1). An electrophoretic mobility shift assay showed the complex of Bmsage and SGF1 proteins bound to the A and B elements in the promoter of fibroin H-chain gene(fib-H), respectively. Luciferase reporter gene assays confirmed the complex of Bmsage and SGF1 proteins increased the expression of fib-H. Together, these results suggest Bmsage is involved in the regulation of the expression of fib-H by being together with SGF1 in B. mori PSG cells. PMID:24740008

Leveraging the contribution of thermodynamics in drug discovery with the help of fluorescence-based thermal shift assays.

PubMed

Hau, Jean Christophe; Fontana, Patrizia; Zimmermann, Catherine; De Pover, Alain; Erdmann, Dirk; Chène, Patrick

2011-06-01

The development of new drugs with better pharmacological and safety properties mandates the optimization of several parameters. Today, potency is often used as the sole biochemical parameter to identify and select new molecules. Surprisingly, thermodynamics, which is at the core of any interaction, is rarely used in drug discovery, even though it has been suggested that the selection of scaffolds according to thermodynamic criteria may be a valuable strategy. This poor integration of thermodynamics in drug discovery might be due to difficulties in implementing calorimetry experiments despite recent technological progress in this area. In this report, the authors show that fluorescence-based thermal shift assays could be used as prescreening methods to identify compounds with different thermodynamic profiles. This approach allows a reduction in the number of compounds to be tested in calorimetry experiments, thus favoring greater integration of thermodynamics in drug discovery.

"Off-on" red-emitting fluorescent probes with large Stokes shifts for nitric oxide imaging in living cells.

PubMed

Chen, Jian-Bo; Zhang, Hui-Xian; Guo, Xiao-Feng; Wang, Hong; Zhang, Hua-Shan

2013-09-01

Fluorescent probes with larger Stokes shifts in the far-visible and near-infrared spectral region (600-900 nm) are more superior for cellular imaging and biological analysis due to avoiding light scattering interference, reducing autofluorescence from biological sample and encouraging deeper tissue penetration in vivo imaging. In this work, two bis-methoxyphenyl-BODIPY fluorescent probes for the detection of nitric oxide (NO) have been firstly synthesized. Under physiological conditions, these probes can react with NO to form the corresponding triazoles with 250- and 70-fold turn-on fluorescence emitting at 590 and 620 nm, respectively. Moreover, the triazole forms of these probes have large Stokes shifts of 38 nm, in contrast to 10 nm of existing BODIPY probes for NO. Excellent selectivity has been observed against other reactive oxygen/nitrogen species, ascorbic acid and biological matrix. After the evaluation of MTT assay, new fluorescent probes have been successfully applied to fluorescence imaging of NO released from RAW 264.7 macrophages by co-stimulation of lipopolysaccharide and interferon-γ. The experimental results indicate that our fluorescent probes can be powerful candidates for fluorescence imaging of NO due to the low background interference and high detection sensitivity.

Quantitation of proteins using a dye-metal-based colorimetric protein assay.

PubMed

Antharavally, Babu S; Mallia, Krishna A; Rangaraj, Priya; Haney, Paul; Bell, Peter A

2009-02-15

We describe a dye-metal (polyhydroxybenzenesulfonephthalein-type dye and a transition metal) complex-based total protein determination method. The binding of the complex to protein causes a shift in the absorption maximum of the dye-metal complex from 450 to 660 nm. The dye-metal complex has a reddish brown color that changes to green on binding to protein. The color produced from this reaction is stable and increases in a proportional manner over a broad range of protein concentrations. The new Pierce 660 nm Protein Assay is very reproducible, rapid, and more linear compared with the Coomassie dye-based Bradford assay. The assay reagent is room temperature stable, and the assay is a simple and convenient mix-and-read format. The assay has a moderate protein-to-protein variation and is compatible with most detergents, reducing agents, and other commonly used reagents. This is an added advantage for researchers needing to determine protein concentrations in samples containing both detergents and reducing agents.

The bZIP transcription factor MdHY5 regulates anthocyanin accumulation and nitrate assimilation in apple.

PubMed

An, Jian-Ping; Qu, Feng-Jia; Yao, Ji-Fang; Wang, Xiao-Na; You, Chun-Xiang; Wang, Xiao-Fei; Hao, Yu-Jin

2017-01-01

The basic leucine zipper (bZIP) transcription factor HY5 plays a multifaceted role in plant growth and development. Here the apple MdHY5 gene was cloned based on its homology with Arabidopsis HY5 . Expression analysis demonstrated that MdHY5 transcription was induced by light and abscisic acid treatments. Electrophoretic mobility shift assays and transient expression assays subsequently showed that MdHY5 positively regulated both its own transcription and that of MdMYB10 by binding to E-box and G-box motifs, respectively. Furthermore, we obtained transgenic apple calli that overexpressed the MdHY5 gene, and apple calli coloration assays showed that MdHY5 promoted anthocyanin accumulation by regulating expression of the MdMYB10 gene and downstream anthocyanin biosynthesis genes. In addition, the transcript levels of a series of nitrate reductase genes and nitrate uptake genes in both wild-type and transgenic apple calli were detected. In association with increased nitrate reductase activities and nitrate contents, the results indicated that MdHY5 might be an important regulator in nutrient assimilation. Taken together, these results indicate that MdHY5 plays a vital role in anthocyanin accumulation and nitrate assimilation in apple.

Unlabeled Oligonucleotides as Internal Temperature Controls for Genotyping by Amplicon Melting

PubMed Central

Seipp, Michael T.; Durtschi, Jacob D.; Liew, Michael A.; Williams, Jamie; Damjanovich, Kristy; Pont-Kingdon, Genevieve; Lyon, Elaine; Voelkerding, Karl V.; Wittwer, Carl T.

2007-01-01

Amplicon melting is a closed-tube method for genotyping that does not require probes, real-time analysis, or allele-specific polymerase chain reaction. However, correct differentiation of homozygous mutant and wild-type samples by melting temperature (Tm) requires high-resolution melting and closely controlled reaction conditions. When three different DNA extraction methods were used to isolate DNA from whole blood, amplicon Tm differences of 0.03 to 0.39°C attributable to the extractions were observed. To correct for solution chemistry differences between samples, complementary unlabeled oligonucleotides were included as internal temperature controls to shift and scale the temperature axis of derivative melting plots. This adjustment was applied to a duplex amplicon melting assay for the methylenetetrahydrofolate reductase variants 1298A>C and 677C>T. High- and low-temperature controls bracketing the amplicon melting region decreased the Tm SD within homozygous genotypes by 47 to 82%. The amplicon melting assay was 100% concordant to an adjacent hybridization probe (HybProbe) melting assay when temperature controls were included, whereas a 3% error rate was observed without temperature correction. In conclusion, internal temperature controls increase the accuracy of genotyping by high-resolution amplicon melting and should also improve results on lower resolution instruments. PMID:17591926

Clinical validation of the 50 gene AmpliSeq Cancer Panel V2 for use on a next generation sequencing platform using formalin fixed, paraffin embedded and fine needle aspiration tumour specimens.

PubMed

Rathi, Vivek; Wright, Gavin; Constantin, Diana; Chang, Siok; Pham, Huong; Jones, Kerryn; Palios, Atha; Mclachlan, Sue-Anne; Conron, Matthew; McKelvie, Penny; Williams, Richard

2017-01-01

The advent of massively parallel sequencing has caused a paradigm shift in the ways cancer is treated, as personalised therapy becomes a reality. More and more laboratories are looking to introduce next generation sequencing (NGS) as a tool for mutational analysis, as this technology has many advantages compared to conventional platforms like Sanger sequencing. In Australia all massively parallel sequencing platforms are still considered in-house in vitro diagnostic tools by the National Association of Testing Authorities (NATA) and a comprehensive analytical validation of all assays, and not just mere verification, is a strict requirement before accreditation can be granted for clinical testing on these platforms. Analytical validation of assays on NGS platforms can prove to be extremely challenging for pathology laboratories. Although there are many affordable and easily accessible NGS instruments available, there are no standardised guidelines as yet for clinical validation of NGS assays. We present an accreditation development procedure that was both comprehensive and applicable in a setting of hospital laboratory for NGS services. This approach may also be applied to other NGS applications in service laboratories. Copyright © 2016 Royal College of Pathologists of Australasia. Published by Elsevier B.V. All rights reserved.

A Novel Heat Shock Element (HSE) in Entamoeba histolytica that Regulates the Transcriptional Activation of the EhPgp5 Gene in the Presence of Emetine Drug

PubMed Central

Nieto, Alma; Pérez Ishiwara, David G.; Orozco, Esther; Sánchez Monroy, Virginia; Gómez García, Consuelo

2017-01-01

Transcriptional regulation of the multidrug resistance EhPgp5 gene in Entamoeba histolytica is induced by emetine stress. EhPgp5 overexpression alters the chloride-dependent currents that cause trophozoite swelling, diminishing induced programmed cell death (PCD) susceptibility. In contrast, antisense inhibition of P-glycoprotein (PGP) expression produces synchronous death of trophozoites and the enhancement of the biochemical and morphological characteristics of PCD induced by G418. Transcriptional gene regulation analysis identified a 59 bp region at position −170 to −111 bp promoter as putative emetine response elements (EREs). However, insights into transcription factors controlling EhPgp5 gene transcription are missing; to fill this knowledge gap, we used deletion studies and transient CAT activity assays. Our findings suggested an activating motif (−151 to −136 bp) that corresponds to a heat shock element (HSE). Gel-shift assays, UV-crosslinking, binding protein purification, and western blotting assays revealed proteins of 94, 66, 62, and 51 kDa binding to the EhPgp5 HSE that could be heat shock-like transcription factors that regulate the transcriptional activation of the EhPgp5 gene in the presence of emetine drug. PMID:29238701

The hURAT1 rs559946 polymorphism and the incidence of gout in Han Chinese men.

PubMed

Li, C; Yu, Q; Han, L; Wang, C; Chu, N; Liu, S

2014-01-01

Our previous study identified rs559946, a human urate transporter 1 (hURAT1) single nucleotide polymorphism (SNP), as being significantly associated with risk of primary hyperuricaemia (HUA) in a Han Chinese population. In the current study we aimed to identify the genetic effects of rs559946 on gout susceptibility in Han Chinese men. A total of 335 patients with gout and 376 healthy controls were recruited for a case-control association study. To examine the functional effect of rs559946, we performed luciferase reporter assays and an electrophoretic mobility shift assay (EMSA). rs559946 was found to be significantly associated with gout susceptibility (p = 0.004), with T-allele carriers showing a decreased risk of gout [odds ratio (OR) 0.70, 95% confidence interval (CI) 0.55-0.89]. Multiple linear regression analysis identified a significant association between rs559946 genotypes and tophi. Luciferase reporter assays show increased transcriptional activity of the hURAT1 promoter with the C allele of rs559946. EMSA detected binding of nuclear proteins to both the T and C alleles, although increased binding was observed with the T allele. Cold competition assays suggest that rs559946 may bind within a glucocorticoid receptor (GR) binding motif. Our study suggests that the rs559946 polymorphism is associated with increased HUA risk and may also contribute to gout development in Han Chinese men. The T to C substitution within rs559946 increased the transcriptional activity, and potentially increases gout susceptibility.

Detection and Spatial Mapping of Mercury Contamination in Water Samples Using a Smart-Phone

DTIC Science & Technology

2014-01-20

Au NP) and aptamer based colorimetric transmission assay that is implemented in disposable test tubes. With this smart-phone attachment that weighs...detection . colorimetric sensor . gold nanoparticles . aptamers A RTIC LE Terms of Use WEI ET AL. VOL. 8 ’ NO. 2 ’ 1121–1129 ’ 2014 www.acsnano.org 1122...a colorimetric assay utilizing citrate-stabilized plasmonic AuNPs and aptamers (Apt) mixed within disposable test tubes. Due to the shift in the

Expression, purification, and functional analysis of the C-terminal domain of Herbaspirillum seropedicae NifA protein.

PubMed

Monteiro, Rose A; Souza, Emanuel M; Geoffrey Yates, M; Steffens, M Berenice R; Pedrosa, Fábio O; Chubatsu, Leda S

2003-02-01

The Herbaspirillum seropedicae NifA protein is responsible for nif gene expression. The C-terminal domain of the H. seropedicae NifA protein, fused to a His-Tag sequence (His-Tag-C-terminal), was over-expressed and purified by metal-affinity chromatography to yield a highly purified and active protein. Band-shift assays showed that the NifA His-Tag-C-terminal bound specifically to the H. seropedicae nifB promoter region in vitro. In vivo analysis showed that this protein inhibited the Central + C-terminal domains of NifA protein from activating the nifH promoter of K. pneumoniae in Escherichia coli, indicating that the protein must be bound to the NifA-binding site (UAS site) at the nifH promoter region to activate transcription. Copyright 2002 Elsevier Science (USA)

Physiological Conjunction of Allelochemicals and Desert Plants

PubMed Central

Dudai, Nativ; Rachmilevitch, Shimon

2013-01-01

Plants exchange signals with other physical and biological entities in their habitat, a form of communication termed allelopathy. The underlying principles of allelopathy and secondary-metabolite production are still poorly understood, especially in desert plants. The coordination and role of secondary metabolites were examined as a cause of allelopathy in plants thriving under arid and semiarid soil conditions. Desert plant species, Origanum dayi, Artemisia sieberi and Artemisia judaica from two different sources (cultivar cuttings and wild seeds) were studied in their natural habitats. Growth rate, relative water content, osmotic potential, photochemical efficiency, volatile composition and vital factors of allelopathy were analyzed at regular intervals along four seasons with winter showing optimum soil water content and summer showing water deficit conditions. A comprehensive analysis of the volatile composition of the leaves, ambient air and soil in the biological niche of the plants under study was carried out to determine the effects of soil water conditions and sample plants on the surrounding flora. Significant morpho-physiological changes were observed across the seasons and along different soil water content. Metabolic analysis showed that water deficit was the key for driving selective metabolomic shifts. A. judaica showed the least metabolic shifts, while A. sieberi showed the highest shifts. All the species exhibited high allelopathic effects; A. judaica displayed relatively higher growth-inhibition effects, while O. dayi showed comparatively higher germination-inhibition effects in germination assays. The current study may help in understanding plant behavior, mechanisms underlying secondary-metabolite production in water deficit conditions and metabolite-physiological interrelationship with allelopathy in desert plants, and can help cull economic benefits from the produced volatiles. PMID:24339945

Mutation Analysis in Cultured Cells of Transgenic Rodents

PubMed Central

Zheng, Albert; Bates, Steven E.; Tommasi, Stella

2018-01-01

To comply with guiding principles for the ethical use of animals for experimental research, the field of mutation research has witnessed a shift of interest from large-scale in vivo animal experiments to small-sized in vitro studies. Mutation assays in cultured cells of transgenic rodents constitute, in many ways, viable alternatives to in vivo mutagenicity experiments in the corresponding animals. A variety of transgenic rodent cell culture models and mutation detection systems have been developed for mutagenicity testing of carcinogens. Of these, transgenic Big Blue® (Stratagene Corp., La Jolla, CA, USA, acquired by Agilent Technologies Inc., Santa Clara, CA, USA, BioReliance/Sigma-Aldrich Corp., Darmstadt, Germany) mouse embryonic fibroblasts and the λ Select cII Mutation Detection System have been used by many research groups to investigate the mutagenic effects of a wide range of chemical and/or physical carcinogens. Here, we review techniques and principles involved in preparation and culturing of Big Blue® mouse embryonic fibroblasts, treatment in vitro with chemical/physical agent(s) of interest, determination of the cII mutant frequency by the λ Select cII assay and establishment of the mutation spectrum by DNA sequencing. We describe various approaches for data analysis and interpretation of the results. Furthermore, we highlight representative studies in which the Big Blue® mouse cell culture model and the λ Select cII assay have been used for mutagenicity testing of diverse carcinogens. We delineate the advantages of this approach and discuss its limitations, while underscoring auxiliary methods, where applicable. PMID:29337872

Human pluripotent stem cells on artificial microenvironments: a high content perspective

PubMed Central

Viswanathan, Priyalakshmi; Gaskell, Terri; Moens, Nathalie; Culley, Oliver J.; Hansen, Darrick; Gervasio, Mia K. R.; Yeap, Yee J.; Danovi, Davide

2014-01-01

Self-renewing stem cell populations are increasingly considered as resources for cell therapy and tools for drug discovery. Human pluripotent stem (hPS) cells in particular offer a virtually unlimited reservoir of homogeneous cells and can be differentiated toward diverse lineages. Many diseases show impairment in self-renewal or differentiation, abnormal lineage choice or other aberrant cell behavior in response to chemical or physical cues. To investigate these responses, there is a growing interest in the development of specific assays using hPS cells, artificial microenvironments and high content analysis. Several hurdles need to be overcome that can be grouped into three areas: (i) availability of robust, homogeneous, and consistent cell populations as a starting point; (ii) appropriate understanding and use of chemical and physical microenvironments; (iii) development of assays that dissect the complexity of cell populations in tissues while mirroring specific aspects of their behavior. Here we review recent progress in the culture of hPS cells and we detail the importance of the environment surrounding the cells with a focus on synthetic material and suitable high content analysis approaches. The technologies described, if properly combined, have the potential to create a paradigm shift in the way diseases are modeled and drug discovery is performed. PMID:25071572

Inhibition of Mycobacterium tuberculosis dihydrodipicolinate synthase by alpha-ketopimelic acid and its other structural analogues

PubMed Central

Shrivastava, Priyanka; Navratna, Vikas; Silla, Yumnam; Dewangan, Rikeshwer P.; Pramanik, Atreyi; Chaudhary, Sarika; Rayasam, GeethaVani; Kumar, Anuradha; Gopal, Balasubramanian; Ramachandran, Srinivasan

2016-01-01

The Mycobacterium tuberculosis dihydrodipicolinate synthase (Mtb-dapA) is an essential gene. Mtb-DapA catalyzes the aldol condensation between pyruvate and L-aspartate-beta-semialdehyde (ASA) to yield dihydrodipicolinate. In this work we tested the inhibitory effects of structural analogues of pyruvate on recombinant Mtb-DapA (Mtb-rDapA) using a coupled assay with recombinant dihydrodipicolinate reductase (Mtb-rDapB). Alpha-ketopimelic acid (α-KPA) showed maximum inhibition of 88% and IC50 of 21 μM in the presence of pyruvate (500 μM) and ASA (400 μM). Competition experiments with pyruvate and ASA revealed competition of α-KPA with pyruvate. Liquid chromatography-mass spectrometry (LC-MS) data with multiple reaction monitoring (MRM) showed that the relative abundance peak of final product, 2,3,4,5-tetrahydrodipicolinate, was decreased by 50%. Thermal shift assays showed 1 °C Tm shift of Mtb-rDapA upon binding α-KPA. The 2.4 Å crystal structure of Mtb-rDapA-α-KPA complex showed the interaction of critical residues at the active site with α-KPA. Molecular dynamics simulations over 500 ns of pyruvate docked to Mtb-DapA and of α-KPA-bound Mtb-rDapA revealed formation of hydrogen bonds with pyruvate throughout in contrast to α-KPA. Molecular descriptors analysis showed that ligands with polar surface area of 91.7 Å2 are likely inhibitors. In summary, α-hydroxypimelic acid and other analogues could be explored further as inhibitors of Mtb-DapA. PMID:27501775

A Novel Methodology for Bioenergetic Analysis of Plasmodium falciparum Reveals a Glucose-Regulated Metabolic Shift and Enables Mode of Action Analyses of Mitochondrial Inhibitors.

PubMed

Sakata-Kato, Tomoyo; Wirth, Dyann F

2016-12-09

Given that resistance to all drugs in clinical use has arisen, discovery of new antimalarial drug targets is eagerly anticipated. The Plasmodium mitochondrion has been considered a promising drug target largely based on its significant divergence from the host organelle as well as its involvement in ATP production and pyrimidine biosynthesis. However, the functions of Plasmodium mitochondrial protein complexes and associated metabolic pathways are not fully characterized. Here, we report the development of novel and robust bioenergetic assay protocols for Plasmodium falciparum asexual parasites utilizing a Seahorse Bioscience XFe24 Extracellular Flux Analyzer. These protocols allowed us to simultaneously assess the direct effects of metabolites and inhibitors on mitochondrial respiration and glycolytic activity in real-time with the readout of oxygen consumption rate and extracellular acidification rate. Using saponin-freed parasites at the schizont stage, we found that succinate, malate, glycerol-3-phosphate, and glutamate, but not pyruvate, were able to increase the oxygen consumption rate and that glycerol-3-phosphate dehydrogenase had the largest potential as an electron donor among tested mitochondrial dehydrogenases. Furthermore, we revealed the presence of a glucose-regulated metabolic shift between oxidative phosphorylation and glycolysis. We measured proton leak and reserve capacity and found bioenergetic evidence for oxidative phosphorylation in erythrocytic stage parasites but at a level much lower than that observed in mammalian cells. Lastly, we developed an assay platform for target identification and mode of action studies of mitochondria-targeting antimalarials. This study provides new insights into the bioenergetics and metabolomics of the Plasmodium mitochondria.

Characterization of the rat RALDH1 promoter. A functional CCAAT and octamer motif are critical for basal promoter activity.

PubMed

Guimond, Julie; Devost, Dominic; Brodeur, Helene; Mader, Sylvie; Bhat, Pangala V

2002-12-12

Retinal dehydrogenase type 1 (RALDH1) catalyzes the oxidation of retinal to retinoic acid (RA), a metabolite of vitamin A important for embryogenesis and tissue differentiation. Rat RALDH1 is expressed to high levels in developing kidney, and in stomach, intestine epithelia. To understand the mechanisms of the transcriptional regulation of rat RALDH1, we cloned a 1360-base pair (bp) 5'-flanking region of RALDH1 gene. Using luciferase reporter constructs transfected into HEK 293 and LLCPK (kidney-derived) cells, basal promoter activity was associated with sequences between -80 and +43. In this minimal promoter region, TATA and CCAAT cis-acting elements as well as SP1, AP1 and octamer (Oct)-binding sites were present. The CCAAT box and Oct-binding site, located between positions -72 and -68 and -56 and -49, respectively, were shown by deletion analysis and site-directed mutation to be critical for promoter activity. Nuclear extracts from kidney cells contain proteins specifically binding the Oct and CCAAT sequences, resulting in the formation of six complexes, while different patterns of complexes were observed with non-kidney cell extracts. Gel shift assays using either single or double mutations of the Oct and CCAAT sequences as well as super shift assays demonstrated single and double occupancy of these two sites by Oct-1 and CBF-A. In addition, unidentified proteins also bound the Oct motif specifically in the absence of CBF-A binding. These results demonstrate specific involvement of Oct and CCAAT-binding proteins in the regulation of RALDH1 gene.

New use for CETSA: monitoring innate immune receptor stability via post-translational modification by OGT.

PubMed

Drake, Walter R; Hou, Ching-Wen; Zachara, Natasha E; Grimes, Catherine Leimkuhler

2018-06-01

O-GlcNAcylation is a dynamic and functionally diverse post-translational modification shown to affect thousands of proteins, including the innate immune receptor nucleotide-binding oligomerization domain-containing protein 2 (Nod2). Mutations of Nod2 (R702W, G908R and 1007 fs) are associated with Crohn's disease and have lower stabilities compared to wild type. Cycloheximide (CHX)-chase half-life assays have been used to show that O-GlcNAcylation increases the stability and response of both wild type and Crohn's variant Nod2, R702W. A more rapid method to assess stability afforded by post-translational modifications is necessary to fully comprehend the correlation between NLR stability and O-GlcNAcylation. Here, a recently developed cellular thermal shift assay (CETSA) that is typically used to demonstrate protein-ligand binding was adapted to detect shifts in protein stabilization upon increasing O-GlcNAcylation levels in Nod2. This assay was used as a method to predict if other Crohn's associated Nod2 variants were O-GlcNAcylated, and also identified the modification on another NLR, Nod1. Classical immunoprecipitations and NF-κB transcriptional assays were used to confirm the presence and effect of this modification on these proteins. The results presented here demonstrate that CETSA is a convenient method that can be used to detect the stability effect of O-GlcNAcylation on O-GlcNAc-transferase (OGT) client proteins and will be a powerful tool in studying post-translational modification.

Amino acid distribution in meteorites: diagenesis, extraction methods, and standard metrics in the search for extraterrestrial biosignatures.

PubMed

McDonald, Gene D; Storrie-Lombardi, Michael C

2006-02-01

The relative abundance of the protein amino acids has been previously investigated as a potential marker for biogenicity in meteoritic samples. However, these investigations were executed without a quantitative metric to evaluate distribution variations, and they did not account for the possibility of interdisciplinary systematic error arising from inter-laboratory differences in extraction and detection techniques. Principal component analysis (PCA), hierarchical cluster analysis (HCA), and stochastic probabilistic artificial neural networks (ANNs) were used to compare the distributions for nine protein amino acids previously reported for the Murchison carbonaceous chondrite, Mars meteorites (ALH84001, Nakhla, and EETA79001), prebiotic synthesis experiments, and terrestrial biota and sediments. These techniques allowed us (1) to identify a shift in terrestrial amino acid distributions secondary to diagenesis; (2) to detect differences in terrestrial distributions that may be systematic differences between extraction and analysis techniques in biological and geological laboratories; and (3) to determine that distributions in meteoritic samples appear more similar to prebiotic chemistry samples than they do to the terrestrial unaltered or diagenetic samples. Both diagenesis and putative interdisciplinary differences in analysis complicate interpretation of meteoritic amino acid distributions. We propose that the analysis of future samples from such diverse sources as meteoritic influx, sample return missions, and in situ exploration of Mars would be less ambiguous with adoption of standardized assay techniques, systematic inclusion of assay standards, and the use of a quantitative, probabilistic metric. We present here one such metric determined by sequential feature extraction and normalization (PCA), information-driven automated exploration of classification possibilities (HCA), and prediction of classification accuracy (ANNs).

The impact of chronotype on melatonin levels among shift workers.

PubMed

Bhatti, Parveen; Mirick, Dana K; Davis, Scott

2014-03-01

The association between shift work and cancer, which is thought to be mediated by effects on circulating melatonin levels, may be modified by chronotype (ie, the inherent preference for activity in the morning or the evening); however, few studies have examined the potential impact of chronotype on the carcinogenic effects of shift work. The authors analysed the impact of chronotype on previously reported differences in melatonin levels among healthcare workers that exclusively worked night or day shifts. The cross-sectional study included 664 men and women (310 day shift and 354 night shift workers) from which urine samples were collected throughout work and sleep periods and were assayed for 6-sulfatoxymelatonin. Participants also completed the Composite Scale of Morningness, a questionnaire used to assess chronotype. Among both morning and evening-type night shift workers, 6-sulfatoxymelatonin levels were constitutively lower during daytime sleep, night-time sleep and night work compared with day shift workers during night-time sleep. However, morning-type night shift workers consistently showed 6-sulfatoxymelatonin levels that were closer to levels in day shift workers than did evening-type night shift workers. Differences in 6-sulfatoxymelatonin levels between morning-type and evening-type night shift workers relative to day shift workers were statistically significant in every instance (p<0.05). These results suggest that morning-type night shift workers may be better able to maintain a 'normal' circadian pattern of melatonin production as compared with evening-type night shift workers. The impact of this chronotype effect on cancer risk among shift workers requires further study.

Isolation of a 5-Kilodalton Actin-Sequestering Peptide from Human Blood Platelets

NASA Astrophysics Data System (ADS)

Safer, Daniel; Golla, Rajasree; Nachmias, Vivianne T.

1990-04-01

Resting human platelets contain ≈0.3 mM unpolymerized actin. When freshly drawn and washed platelets are treated with saponin, 85-90% of the unpolymerized actin diffuses out. Analysis by polyacrylamide gel electrophoresis under nondenaturing conditions shows that the bulk of this unpolymerized actin migrates with a higher mobility than does pure G-actin, profilactin, or actin-gelsolin complex. When muscle G-actin is added to fresh or boiled saponin extract, the added muscle actin is shifted to the high-mobility form. The saponin extract contains an acidic peptide having a molecular mass in the range of 5 kDa, which has been purified to homogeneity by reverse-phase HPLC. This peptide also shifts muscle actin to the high-mobility form. Addition of either boiled saponin extract or the purified peptide to muscle G-actin also strongly and stoichiometrically inhibits salt-induced polymerization, as assayed by falling-ball viscometry and by sedimentation. We conclude that this peptide binds to the bulk of the unpolymerized actin in platelets and prevents it from polymerizing.

Interactions between the nuclear matrix and an enhancer of the tryptophan oxygenase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaneoka, Hidenori; Miyake, Katsuhide, E-mail: miyake@nubio.nagoya-u.ac.jp; Iijima, Shinji

2009-10-02

The gene for tryptophan oxygenase (TO) is expressed in adult hepatocytes in a tissue- and differentiation-specific manner. The TO promoter has two glucocorticoid-responsive elements (GREs), and its expression is regulated by glucocorticoid hormone in the liver. We found a novel GRE in close proximity to a scaffold/matrix attachment region (S/MAR) that was located around -8.5 kb from the transcriptional start site of the TO gene by electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) assays. A combination of nuclear fractionation and quantitative PCR analysis showed that the S/MAR was tethered to the nuclear matrix in both fetal and adult hepatocytes. ChIPmore » assay showed that, in adult hepatocytes, the S/MAR-GRE and the promoter proximal regions interacted with lamin and heterogeneous nuclear ribonucleoprotein U in a dexamethasone dependent manner, but this was not the case in fetal cells, suggesting that developmental stage-specific expression of the TO gene might rely on the binding of the enhancer (the -8.5 kb S/MAR-GRE) and the promoter to the inner nuclear matrix.« less

A functional polymorphism of the TNF-{alpha} gene that is associated with type 2 DM

DOE Office of Scientific and Technical Information (OSTI.GOV)

Susa, Shinji; Daimon, Makoto; Sakabe, Jun-Ichi

2008-05-09

To examine the association of the tumor necrosis factor-{alpha} (TNF-{alpha}) gene region with type 2 diabetes (DM), 11 single-nucleotide polymorphisms (SNPs) of the region were analyzed. The initial study using a sample set (148 cases vs. 227 controls) showed a significant association of the SNP IVS1G + 123A of the TNF-{alpha} gene with DM (p = 0.0056). Multiple logistic regression analysis using an enlarged sample set (225 vs. 716) revealed the significant association of the SNP with DM independently of any clinical traits examined (OR: 1.49, p = 0.014). The functional relevance of the SNP were examined by the electrophoreticmore » mobility shift assays using nuclear extracts from the U937 and NIH3T3 cells and luciferase assays in these cells with Simian virus 40 promoter- and TNF-{alpha} promoter-reporter gene constructs. The functional analyses showed that YY1 transcription factor bound allele-specifically to the SNP region and, the IVS1 + 123A allele had an increase in luciferase expression compared with the G allele.« less

Bisphenol A induces corticotropin-releasing hormone expression in the placental cells JEG-3.

PubMed

Huang, Hui; Tan, Wenjuan; Wang, C C; Leung, Lai K

2012-11-01

Bisphenol A is utilized to make polycarbonate plastics and is an environmental pollutant. Recent research has indicated that it is an endocrine disruptor and may interfere with reproduction. Placental corticotrophin-releasing hormone (CRH) is a peptide hormone which is involved in fetal development. Increased plasma CRH is associated with elevated risk of premature delivery. In the present study, we demonstrated that bisphenol A increased CRH mRNA expression in the placental JEG-3 cells at or above 25μM. Reporter gene assay also demonstrated that bisphenol A could induce CRH gene transactivity. Since cyclic AMP response element (CRE) is a major regulatory element located in CRH promoter, the sequence-specific binding activity was investigated by using electrophoretic mobility shift assay. Our data indicated that bisphenol A increased the CRE binding activity. Western analysis further illustrated that PKA could be the signal triggering the CRE binding and CRH gene transactivation. In summary, the present study demonstrated that bisphenol A could induce CRH expression in placental cells and the underlying signal transduction pathway was also described. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Targeting TMPRSS2 ERG in Prostate Cancer

DTIC Science & Technology

2016-09-01

Assay development for surface Plasmon resonance with purified ERG protein (months 31-36, completed July 2016) 7c. Perform thermal shift and...surface Plasmon resonance on compounds and determine binding constants (months 37-42, completed July 2016) Task 8. Identify FDA approved drugs that

The Impact of Chronotype on Melatonin Levels Among Shift Workers

PubMed Central

Bhatti, Parveen; Mirick, Dana K.; Davis, Scott

2015-01-01

Objectives The association between shift work and cancer, which is thought to be mediated by effects on circulating melatonin levels, may be modified by chronotype (i.e. the inherent preference for activity in the morning or the evening); however, few studies have examined the potential impact of chronotype on the carcinogenic effects of shift work. The authors analyzed the impact of chronotype on previously reported differences in melatonin levels among healthcare workers that exclusively worked night or day shifts. Methods The cross-sectional study included 664 men and women (310 day shift and 354 night shift workers) from which urine samples were collected throughout work and sleep periods and were assayed for 6-sulfatoxymelatonin. Participants also completed the Composite Scale of Morningness, a questionnaire used to assess chronotype. Results Among both morning and evening-type night shift workers, 6-sulfatoxymelatonin levels were constitutively lower during daytime sleep, nighttime sleep and night work compared to dayshift workers during nighttime sleep. However, morning-type shift workers consistently showed 6-sulfatoxymelatonin levels that were closer to levels in day shift workers than did evening-type night shift workers. Differences in 6-sulfatoxymelatonin levels between morning-type and evening-type night shift workers relative to day shift workers were statistically significant in every instance (p < 0.05). Conclusion These results suggest that morning-type night shift workers may be better able to maintain a ‘normal’ circadian pattern of melatonin production as compared to evening-type night shift workers. The impact of this chronotype effect on cancer risk among shift workers requires further study. PMID:24399070

Complex conductivity response to microbial growth and biofilm formation on phenanthrene spiked medium

NASA Astrophysics Data System (ADS)

Albrecht, Remy; Gourry, Jean Christophe; Simonnot, Marie-Odile; Leyval, Corinne

2011-11-01

Several laboratory studies have recently demonstrated the utility of geophysical methods for the investigation of microbial-induced changes over contaminated sites. However, it remains difficult to distinguish the effects due to the new physical properties imparted by microbial processes, to bacterial growth, or to the development of bacterial biofilm. We chose to study the influence of biofilm formation on geophysical response using complex conductivity measurements (0.1-1000 Hz) in phenanthrene-contaminated media. Biotic assays were conducted with two phenanthrene (PHE) degrading bacterial strains: Burkholderia sp (NAH1), which produced biofilm and Stenophomonas maltophilia (MATE10), which did not, and an abiotic control. Results showed that bacterial densities for NAH1 and MATE10 strains continuously increased at the same rate during the experiment. However, the complex conductivity signature showed noticeable differences between the two bacteria, with a phase shift of 50 mrad at 4 Hz for NAH1, which produced biofilm. Biofilm volume was quantified by Scanning Confocal Laser Microscopy (SCLM). Significant correlations were established between phase shift decrease and biofilm volume for NAH1 assays. Results suggest that complex conductivity measurements, specifically phase shift, can be a useful indicator of biofilm formation inside the overall signal of microbial activity on contaminated sites.

Impact of Work Task-Related Acute Occupational Smoke ...

EPA Pesticide Factsheets

Objective: A repeated measures study was used to assess the effect of work tasks on select proinflammatory biomarkers in firefighters working at prescribed burns. Methods: Ten firefighters and two volunteers were monitored for particulate matter and carbon monoxide on workdays, January-July 2015. Before and after work-shift dried blood spots were analyzed for inflammatory mediators using the Meso Scale Discovery assay, while blood smears were used to assess leukocyte parameters. Results: Firefighters lighting with drip-torches had higher cross-work-shift increases in interleukin-8, C-reactive protein, and serum amyloid A compared to holding, a task involving management of fire boundaries. A positive association between interleukin-8 and segmented-neutrophil was observed. Conclusion: Results from this study suggest that intermittent occupational diesel exposures contribute to cross-work-shift changes in host systemic innate inflammation as indicated by elevated interleukin-8 levels and peripheral blood segmented-neutrophils. The decision whether to perform a prescribed burn balances land use, risk of fire and potential health impacts. Understanding the latter requires a quick non intrusive assay which can be used to monitor the health of those exposed to smoke. This is first study to use blood smears to assess changes in systemic differential leukocyte cell populations following wood smoke exposure from prescribed burn. This research is useful for understandi

BiQ Analyzer HT: locus-specific analysis of DNA methylation by high-throughput bisulfite sequencing

PubMed Central

Lutsik, Pavlo; Feuerbach, Lars; Arand, Julia; Lengauer, Thomas; Walter, Jörn; Bock, Christoph

2011-01-01

Bisulfite sequencing is a widely used method for measuring DNA methylation in eukaryotic genomes. The assay provides single-base pair resolution and, given sufficient sequencing depth, its quantitative accuracy is excellent. High-throughput sequencing of bisulfite-converted DNA can be applied either genome wide or targeted to a defined set of genomic loci (e.g. using locus-specific PCR primers or DNA capture probes). Here, we describe BiQ Analyzer HT (http://biq-analyzer-ht.bioinf.mpi-inf.mpg.de/), a user-friendly software tool that supports locus-specific analysis and visualization of high-throughput bisulfite sequencing data. The software facilitates the shift from time-consuming clonal bisulfite sequencing to the more quantitative and cost-efficient use of high-throughput sequencing for studying locus-specific DNA methylation patterns. In addition, it is useful for locus-specific visualization of genome-wide bisulfite sequencing data. PMID:21565797

Detection and Composition of Bacterial Communities in Waters using RNA-based Methods

EPA Science Inventory

In recent years, microbial water quality assessments have shifted from solely relying on pure culture-based methods to monitoring bacterial groups of interest using molecular assays such as PCR and qPCR. Furthermore, coupling next generation sequencing technologies with ribosomal...

Crosslinking transcription factors to their recognition sequences with PtII complexes

NASA Technical Reports Server (NTRS)

Chu, B. C.; Orgel, L. E.

1992-01-01

We have prepared phosphorothioate-containing cyclic oligodeoxynucleotides that fold into 'dumbbells' containing CRE and TRE sequences, the binding sequences for the CREB and JUN proteins, respectively. Six phosphorothioate residues were introduced into each of the recognition sequences. K2PtCl4 crosslinks CRE to CREB and TRE to JUN. The extent of crosslinking is about eight times greater than that observed with standard oligodeoxynucleotides and amounts to 30-50% of the efficiency of non-covalent association as estimated by gel-shift assays. Crosslinking is reversed by incubation with NaCN. The crosslinking reaction is specific--a dumbbell oligonucleotide with six phosphorothioate groups introduced into the Sp1 recognition sequence could not be crosslinked efficiently to CREB or JUN proteins with K2PtCl4. The binding of TRE to CREB is not strong enough for effective detection by gel-shift assays, but the TRE-CREB complex is crosslinked efficiently by K2PtCl4 and can then readily be detected.

Structure and Self-Assembly of the Calcium Binding Matrix Protein of Human Metapneumovirus

PubMed Central

Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T.; Grimes, Jonathan M.

2014-01-01

Summary The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca2+ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca2+ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. PMID:24316400

An Alternative Thiol-Reactive Dye to Analyze Ligand Interactions with the Chemokine Receptor CXCR2 Using a New Thermal Shift Assay Format.

PubMed

Bergsdorf, Christian; Fiez-Vandal, Cédric; Sykes, David A; Bernet, Pascal; Aussenac, Sonia; Charlton, Steven J; Schopfer, Ulrich; Ottl, Johannes; Duckely, Myriam

2016-03-01

Integral membrane proteins (IMPs) play an important role in many cellular events and are involved in numerous pathological processes. Therefore, understanding the structure and function of IMPs is a crucial prerequisite to enable successful targeting of these proteins with low molecular weight (LMW) ligands early on in the discovery process. To optimize IMP purification/crystallization and to identify/characterize LMW ligand-target interactions, robust, reliable, high-throughput, and sensitive biophysical methods are needed. Here, we describe a differential scanning fluorimetry (DSF) screening method using the thiol-reactive BODIPY FL-cystine dye to monitor thermal unfolding of the G-protein-coupled receptor (GPCR), CXCR2. To validate this method, the seven-transmembrane protein CXCR2 was analyzed with a set of well-characterized antagonists. This study showed that the new DSF assay assessed reliably the stability of CXCR2 in a 384-well format. The analysis of 14 ligands with a potency range over 4 log units demonstrated the detection/characterization of LMW ligands binding to the membrane protein target. Furthermore, DSF results cross-validated with the label-free differential static light scattering (DSLS) thermal denaturation method. These results underline the potential of the BODIPY assay format as a general tool to investigate membrane proteins and their interaction partners. © 2015 Society for Laboratory Automation and Screening.

AutA and AutR, Two Novel Global Transcriptional Regulators, Facilitate Avian Pathogenic Escherichia coli Infection.

PubMed

Zhuge, Xiangkai; Tang, Fang; Zhu, Hongfei; Mao, Xiang; Wang, Shaohui; Wu, Zongfu; Lu, Chengping; Dai, Jianjun; Fan, Hongjie

2016-04-26

Bacteria can change its lifestyle during inhabiting in host niches where they survive and replicate by rapidly altering gene expression pattern to accommodate the new environment. In this study, two novel regulators in avian pathogenic Escherichia coli (APEC) were identified and designated as AutA and AutR. RT-PCR and β-galactosidase assay results showed that AutA and AutR co-regulated the expression of adhesin UpaB in APEC strain DE205B. Electrophoretic mobility shift assay showed that AutA and AutR could directly bind the upaB promoter DNA. In vitro transcription assay indicated that AutA could activate the upaB transcription, while AutR inhibited the upaB transcription due to directly suppressing the activating effect of AutA on UpaB expression. Transcriptome analysis showed that AutA and AutR coherently affected the expression of hundreds of genes. Our study confirmed that AutA and AutR co-regulated the expression of DE205B K1 capsule and acid resistance systems in E. coli acid fitness island (AFI). Moreover, phenotypic heterogeneity in expression of K1 capsule and acid resistance systems in AFI during host-pathogen interaction was associated with the regulation of AutA and AutR. Collectively speaking, our studies presented that AutA and AutR are involved in APEC adaptive lifestyle change to facilitate its infection.

Opposing effects of bile acids deoxycholic acid and ursodeoxycholic acid on signal transduction pathways in oesophageal cancer cells.

PubMed

Abdel-Latif, Mohamed M; Inoue, Hiroyasu; Reynolds, John V

2016-09-01

Ursodeoxycholic acid (UDCA) was reported to reduce bile acid toxicity, but the mechanisms underlying its cytoprotective effects are not fully understood. The aim of the present study was to examine the effects of UDCA on the modulation of deoxycholic acid (DCA)-induced signal transduction in oesophageal cancer cells. Nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) activity was assessed using a gel shift assay. NF-κB activation and translocation was performed using an ELISA-based assay and immunofluorescence analysis. COX-2 expression was analysed by western blotting and COX-2 promoter activity was assessed by luciferase assay. DCA induced NF-κB and AP-1 DNA-binding activities in SKGT-4 and OE33 cells. UDCA pretreatment inhibited DCA-induced NF-κB and AP-1 activation and NF-κB translocation. This inhibitory effect was coupled with a blockade of IκB-α degradation and inhibition of phosphorylation of IKK-α/β and ERK1/2. Moreover, UDCA pretreatment inhibited COX-2 upregulation. Using transient transfection of the COX-2 promoter, UDCA pretreatment abrogated DCA-induced COX-2 promoter activation. In addition, UDCA protected oesophageal cells from the apoptotic effects of deoxycholate. Our findings indicate that UDCA inhibits DCA-induced signalling pathways in oesophageal cancer cells. These data indicate a possible mechanistic role for the chemopreventive actions of UDCA in oesophageal carcinogenesis.

Levey-Jennings Analysis Uncovers Unsuspected Causes of Immunohistochemistry Stain Variability.

PubMed

Vani, Kodela; Sompuram, Seshi R; Naber, Stephen P; Goldsmith, Jeffrey D; Fulton, Regan; Bogen, Steven A

Almost all clinical laboratory tests use objective, quantitative measures of quality control (QC), incorporating Levey-Jennings analysis and Westgard rules. Clinical immunohistochemistry (IHC) testing, in contrast, relies on subjective, qualitative QC review. The consequences of using Levey-Jennings analysis for QC assessment in clinical IHC testing are not known. To investigate this question, we conducted a 1- to 2-month pilot test wherein the QC for either human epidermal growth factor receptor 2 (HER-2) or progesterone receptor (PR) in 3 clinical IHC laboratories was quantified and analyzed with Levey-Jennings graphs. Moreover, conventional tissue controls were supplemented with a new QC comprised of HER-2 or PR peptide antigens coupled onto 8 μm glass beads. At institution 1, this more stringent analysis identified a decrease in the HER-2 tissue control that had escaped notice by subjective evaluation. The decrement was due to heterogeneity in the tissue control itself. At institution 2, we identified a 1-day sudden drop in the PR tissue control, also undetected by subjective evaluation, due to counterstain variability. At institution 3, a QC shift was identified, but only with 1 of 2 controls mounted on each slide. The QC shift was due to use of the instrument's selective reagent drop zones dispense feature. None of these events affected patient diagnoses. These case examples illustrate that subjective QC evaluation of tissue controls can detect gross assay failure but not subtle changes. The fact that QC issues arose from each site, and in only a pilot study, suggests that immunohistochemical stain variability may be an underappreciated problem.

Night shift work and hormone levels in women.

PubMed

Davis, Scott; Mirick, Dana K; Chen, Chu; Stanczyk, Frank Z

2012-04-01

Night shift work may disrupt the normal nocturnal rise in melatonin, resulting in increased breast cancer risk, possibly through increased reproductive hormone levels. We investigated whether night shift work is associated with decreased levels of urinary 6-sulfatoxymelatonin, the primary metabolite of melatonin, and increased urinary reproductive hormone levels. Participants were 172 night shift and 151 day shift-working nurses, aged 20-49 years, with regular menstrual cycles. Urine samples were collected throughout work and sleep periods and assayed for 6-sulfatoxymelatonin, luteinizing hormone (LH), follicle-stimulating hormone (FSH), and estrone conjugate (E1C). 6-Sulfatoxymelatonin levels were 62% lower and FSH and LH were 62% and 58% higher, respectively, in night shift-working women during daytime sleep than in day shift-working women during nighttime sleep (P ≤ 0.0001). Nighttime sleep on off-nights was associated with 42% lower 6-sulfatoxymelatonin levels among the night shift workers, relative to the day shift workers (P < 0.0001); no significant differences in LH or FSH were observed. 6-Sulfatoxymelatonin levels during night work were approximately 69% lower and FSH and LH were 35% and 38% higher, compared with day shift workers during nighttime sleep. No differences in E1C levels between night and day shift workers were observed. Within night shift workers, 6-sulfatoxymelatonin levels were lower and reproductive hormone levels were higher during daytime sleep and nighttime work, relative to nighttime sleep (P < 0.05). These results indicate that night shift workers have substantially reduced 6-sulfatoxymelatonin levels during night work and daytime sleep and that levels remain low even when a night shift worker sleeps at night. Shift work could be an important risk factor for many other cancers in addition to breast cancer. ©2012 AACR.

Developmental Effects of the ToxCast™ Phase I and Phase II Chemicals in Caenorhabditis elegans and Corresponding Responses in Zebrafish, Rats, and Rabbits

PubMed Central

Boyd, Windy A.; Smith, Marjolein V.; Co, Caroll A.; Pirone, Jason R.; Rice, Julie R.; Shockley, Keith R.; Freedman, Jonathan H.

2015-01-01

Background: Modern toxicology is shifting from an observational to a mechanistic science. As part of this shift, high-throughput toxicity assays are being developed using alternative, nonmammalian species to prioritize chemicals and develop prediction models of human toxicity. Methods: The nematode Caenorhabditis elegans (C. elegans) was used to screen the U.S. Environmental Protection Agency’s (EPA’s) ToxCast™ Phase I and Phase II libraries, which contain 292 and 676 chemicals, respectively, for chemicals leading to decreased larval development and growth. Chemical toxicity was evaluated using three parameters: a biologically defined effect size threshold, half-maximal activity concentration (AC50), and lowest effective concentration (LEC). Results: Across both the Phase I and Phase II libraries, 62% of the chemicals were classified as active ≤ 200 μM in the C. elegans assay. Chemical activities and potencies in C. elegans were compared with those from two zebrafish embryonic development toxicity studies and developmental toxicity data for rats and rabbits. Concordance of chemical activity was higher between C. elegans and one zebrafish assay across Phase I chemicals (79%) than with a second zebrafish assay (59%). Using C. elegans or zebrafish to predict rat or rabbit developmental toxicity resulted in balanced accuracies (the average value of the sensitivity and specificity for an assay) ranging from 45% to 53%, slightly lower than the concordance between rat and rabbit (58%). Conclusions: Here, we present an assay that quantitatively and reliably describes the effects of chemical toxicants on C. elegans growth and development. We found significant overlap in the activity of chemicals in the ToxCast™ libraries between C. elegans and zebrafish developmental screens. Incorporating C. elegans toxicological assays as part of a battery of in vitro and in vivo assays provides additional information for the development of models to predict a chemical’s potential toxicity to humans. Citation: Boyd WA, Smith MV, Co CA, Pirone JR, Rice JR, Shockley KR, Freedman JH. 2016. Developmental effects of the ToxCast™ Phase I and II chemicals in Caenorhabditis elegans and corresponding responses in zebrafish, rats, and rabbits. Environ Health Perspect 124:586–593; http://dx.doi.org/10.1289/ehp.1409645 PMID:26496690

Two MCAT elements of the SM alpha-actin promoter function differentially in SM vs. non-SM cells.

PubMed

Swartz, E A; Johnson, A D; Owens, G K

1998-08-01

Transcriptional activity of the smooth muscle (SM) alpha-actin gene is differentially regulated in SM vs. non-SM cells. Contained within the rat SM alpha-actin promoter are two MCAT motifs, binding sites for transcription enhancer factor 1 (TEF-1) transcriptional factors implicated in the regulation of many muscle-specific genes. Transfections of SM alpha-actin promoter-CAT constructs containing wild-type or mutagenized MCAT elements were performed to evaluate their functional significance. Mutation of the MCAT elements resulted in increased transcriptional activity in SM cells, whereas these mutations either had no effect or decreased activity in L6 myotubes or endothelial cells. High-resolution gel shift assays resolved several complexes of different mobilities that were formed between MCAT oligonucleotides and nuclear extracts from the different cell types, although no single band was unique to SM. Western blot analysis of nuclear extracts with polyclonal antibodies to conserved domains of the TEF-1 gene family revealed multiple reactive bands, some that were similar and others that differed between SM and non-SM. Supershift assays with a polyclonal antibody to the TEF-related protein family demonstrated that TEF-1 or TEF-1-related proteins were contained in the shifted complexes. Results suggest that the MCAT elements may contribute to cell type-specific regulation of the SM alpha-actin gene. However, it remains to be determined whether the differential transcriptional activity of MCAT elements in SM vs. non-SM is due to differences in expression of TEF-1 or TEF-1-related proteins or to unique (cell type specific) combinatorial interactions of the MCAT elements with other cis-elements and trans-factors.

Microbial Extracellular Enzyme Activity and Community Assembly Processes Post Fire Disturbance Amanda Labrado, University of Texas at El Paso; Emily B. Graham, University of Colorado Boulder; Joseph E. Knelman, University of Colorado Boulder; Scott Ferrenberg, University of Colorado Boulder; Diana R. Nemergut, University of Colorado Boulder

NASA Astrophysics Data System (ADS)

Labrdo, A.; Knelman, J. E.; Graham, E. B.; Ferrenberg, S.; Nemergut, D. R.

2013-12-01

Microbes control major biogeochemical cycles and can directly impact the carbon, nitrogen, and phosphorus pools and fluxes of soils. However, many questions remain regarding when and where data on microbial community structure are necessary to accurately predict biogeochemical processes. In particular, it is unknown how shifts in microbial assembly processes may relate to changes in the relationship between community structure and ecosystem function. Here, we examine soil microbial community assembly processes and extracellular enzyme activity (EEA) at 4-weeks and 16-weeks after the Fourmile Canyon Fire in Boulder, CO in order to determine the effects of disturbance on community assembly and EEA. Microbial community structure was determined from 16S rRNA gene pyrosequencing, edaphic properties were determined using standard biogeochemical assays, and extracellular enzyme activity for β-1, 4-glucosidase (BG) and β-1, 4-N-acetylglucosaminidase (NAG) enzymes were determined using fluorimetric assays. Stepwise linear regressions were used to determine the effects of microbial community structure and edaphic factors on EEA. We determined that in 4-week post fire samples EEA was only correlated with microbial predictors. However, we observed a shift with 16-week samples in which EEA was significantly related to edaphic predictors. Null derivation analysis of community assembly revealed that communities in the 4-week samples were more neutrally assembled than communities in the 16-week samples. Together, these results support a conceptual model in which the relationship between edaphic factors and ecosystem processes is somewhat decoupled in more neutrally assembled communities, and data on microbial community structure is important to most accurately predict function.

Water Mass Bio-optical Properties in the Monterey Bay Region: Fluorescence-based Inference of Shifts in Phytoplankton Photophysiology

DTIC Science & Technology

2012-07-26

bottle rosette. Macronutrient and chlorophyll assays were performed using methods detailed in Pennington and Chavez [2000]. High Performance Liquid...S = 33.28) Niskin bottle sample contained 10.6 /<M nitrate. Other macronutrients (phosphate, silicilic acid) were detected and generally abundant

Arabidopsis miR171-Targeted Scarecrow-Like Proteins Bind to GT cis-Elements and Mediate Gibberellin-Regulated Chlorophyll Biosynthesis under Light Conditions

PubMed Central

Ma, Zhaoxue; Hu, Xupeng; Cai, Wenjuan; Huang, Weihua; Zhou, Xin; Luo, Qian; Yang, Hongquan; Wang, Jiawei; Huang, Jirong

2014-01-01

An extraordinarily precise regulation of chlorophyll biosynthesis is essential for plant growth and development. However, our knowledge on the complex regulatory mechanisms of chlorophyll biosynthesis is very limited. Previous studies have demonstrated that miR171-targeted scarecrow-like proteins (SCL6/22/27) negatively regulate chlorophyll biosynthesis via an unknown mechanism. Here we showed that SCLs inhibit the expression of the key gene encoding protochlorophyllide oxidoreductase (POR) in light-grown plants, but have no significant effect on protochlorophyllide biosynthesis in etiolated seedlings. Histochemical analysis of β-glucuronidase (GUS) activity in transgenic plants expressing pSCL27::rSCL27-GUS revealed that SCL27-GUS accumulates at high levels and suppresses chlorophyll biosynthesis at the leaf basal proliferation region during leaf development. Transient gene expression assays showed that the promoter activity of PORC is indeed regulated by SCL27. Consistently, chromatin immunoprecipitation and quantitative PCR assays showed that SCL27 binds to the promoter region of PORC in vivo. An electrophoretic mobility shift assay revealed that SCL27 is directly interacted with G(A/G)(A/T)AA(A/T)GT cis-elements of the PORC promoter. Furthermore, genetic analysis showed that gibberellin (GA)-regulated chlorophyll biosynthesis is mediated, at least in part, by SCLs. We demonstrated that SCL27 interacts with DELLA proteins in vitro and in vivo by yeast-two-hybrid and coimmunoprecipitation analysis and found that their interaction reduces the binding activity of SCL27 to the PORC promoter. Additionally, we showed that SCL27 activates MIR171 gene expression, forming a feedback regulatory loop. Taken together, our data suggest that the miR171-SCL module is critical for mediating GA-DELLA signaling in the coordinate regulation of chlorophyll biosynthesis and leaf growth in light. PMID:25101599

Interactions of cisplatin analogues with lysozyme: a comparative analysis.

PubMed

Ferraro, Giarita; De Benedictis, Ilaria; Malfitano, Annamaria; Morelli, Giancarlo; Novellino, Ettore; Marasco, Daniela

2017-10-01

The biophysical characterization of drug binding to proteins plays a key role in structural biology and in the discovery and optimization of drug discovery processes. The search for optimal combinations of biophysical techniques that can correctly and efficiently identify and quantify binding of metal-based drugs to their final target is challenging, due to the physicochemical properties of these agents. Different cisplatin derivatives have shown different citotoxicities in most common cancer lines, suggesting that they exert their biological activity via different mechanisms of action. Here we carried out a comparative analysis, by studying the behaviours of three Pt-compounds under the same experimental conditions and binding assays to properly deepen the determinants of the different MAOs. Indeed we compared the results obtained using surface plasmon resonance, isothermal titration calorimetry, fluorescence spectroscopy and thermal shift assays based on circular dichroism experiments in the characterization of the formation of adducts obtained upon reaction of cisplatin, carboplatin and iodinated analogue of cisplatin, cis-Pt (NH 3 ) 2 I 2 , with the model protein hen egg white lysozyme, both at neutral and acid pHs. Further we reasoned on the applicability of employed techniques for the study the thermodynamics and kinetics of the reaction of a metallodrug with a protein and to reveal which information can be obtained using a combination of these analyses. Data were discussed on the light of the existing structural data collected on the platinated protein.

Alterations of p53 in tumorigenic human bronchial epithelial cells correlate with metastatic potential

NASA Technical Reports Server (NTRS)

Piao, C. Q.; Willey, J. C.; Hei, T. K.; Hall, E. J. (Principal Investigator)

1999-01-01

The cellular and molecular mechanisms of radiation-induced lung cancer are not known. In the present study, alterations of p53 in tumorigenic human papillomavirus-immortalized human bronchial epithelial (BEP2D) cells induced by a single low dose of either alpha-particles or 1 GeV/nucleon (56)Fe were analyzed by PCR-single-stranded conformation polymorphism (SSCP) coupled with sequencing analysis and immunoprecipitation assay. A total of nine primary and four secondary tumor cell lines, three of which were metastatic, together with the parental BEP2D and primary human bronchial epithelial (NHBE) cells were studied. The immunoprecipitation assay showed overexpression of mutant p53 proteins in all the tumor lines but not in NHBE and BEP2D cells. PCR-SSCP and sequencing analysis found band shifts and gene mutations in all four of the secondary tumors. A G-->T transversion in codon 139 in exon 5 that replaced Lys with Asn was detected in two tumor lines. One mutation each, involving a G-->T transversion in codon 215 in exon 6 (Ser-->lle) and a G-->A transition in codon 373 in exon 8 (Arg-->His), was identified in the remaining two secondary tumors. These results suggest that p53 alterations correlate with tumorigenesis in the BEP2D cell model and that mutations in the p53 gene may be indicative of metastatic potential.

LmaPA2G4, a Homolog of Human Ebp1, Is an Essential Gene and Inhibits Cell Proliferation in L. major

PubMed Central

Joyce, Michelle V.; Morales, Miguel A.

2014-01-01

We have identified LmaPA2G4, a homolog of the human proliferation-associated 2G4 protein (also termed Ebp1), in a phosphoproteomic screening. Multiple sequence alignment and cluster analysis revealed that LmaPA2G4 is a non-peptidase member of the M24 family of metallopeptidases. This pseudoenzyme is structurally related to methionine aminopeptidases. A null mutant system based on negative selection allowed us to demonstrate that LmaPA2G4 is an essential gene in Leishmania major. Over-expression of LmaPA2G4 did not alter cell morphology or the ability to differentiate into metacyclic and amastigote stages. Interestingly, the over-expression affected cell proliferation and virulence in mouse footpad analysis. LmaPA2G4 binds a synthetic double-stranded RNA polyriboinosinic polyribocytidylic acid [poly(I∶C)] as shown in an electrophoretic mobility shift assay (EMSA). Quantitative proteomics revealed that the over-expression of LmaPA2G4 led to accumulation of factors involved in translation initiation and elongation. Significantly, we found a strong reduction of de novo protein biosynthesis in transgenic parasites using a non-radioactive metabolic labeling assay. In conclusion, LmaPA2G4 is an essential gene and is potentially implicated in fundamental biological mechanisms, such as translation, making it an attractive target for therapeutic intervention. PMID:24421916

How to report and discuss ADME data in medicinal chemistry publications: in vitro data or in vivo extrapolations?

PubMed

Svennebring, Andreas M

2015-01-01

Early drug discovery projects often utilize data from ADME (absorption, distribution, metabolism, elimination) assays to benchmark data and guide discussion, rather than the predicted in vivo consequences of these data. Here, the two paradigms are compared, using evaluations of metabolic stability based on either microsomal clearance assay data or from the predicted in vivo hepatic clearance and half-life calculated through the combination of the venous well-stirred model and Øie-Tozer's model. The need for a shift in paradigm is presented, and its implications discussed. It is suggested that discussions about ADME data should revolve around potential clinical problems that are most likely to surface during the development phase, each benchmarked with a suitable variable derived from the assay data.

Clear distinction between Burkholderia mallei and Burkholderia pseudomallei using fluorescent motB primers.

PubMed

Schmoock, Gernot; Elschner, Mandy; Sprague, Lisa D

2015-03-07

A frame-shift mutation in the flagellum motor gene motB coding for the chemotaxis MotB protein of Burkholderia mallei has been utilized to design a conventional duplex PCR assay with fluorescent labelled primers. Species specificity was tested with a panel of 13 Burkholderia type strains. A total of 41 B. mallei field strains, 36 B. pseudomallei field strains, and 1 B. thailandensis field strain from different geographic regions were tested and correctly identified. Testing of 55 non-Burkholderia bacterial species revealed 100% specificity of the assay. The minimum detection limit was 1 pg DNA or 160 GE for B. mallei and 130 GE for B. pseudomallei, respectively. This assay enables the clear distinction between B. mallei and B. pseudomallei/B. thailandensis.

hnRNP L binds to CA repeats in the 3'UTR of bcl-2 mRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Dong-Hyoung; Lim, Mi-Hyun; Youn, Dong-Ye

We previously reported that the CA-repeat sequence in the 3'-untranslated region (3'UTR) of bcl-2 mRNA is involved in the decay of bcl-2 mRNA. However, the trans-acting factor for the CA element in bcl-2 mRNA remains unidentified. The heterogeneous nuclear ribonucleoprotein L (hnRNP L), an intron splicing factor, has been reported to bind to CA repeats and CA clusters in the 3'UTR of several genes. We reported herein that the CA repeats of bcl-2 mRNA have the potential to form a distinct ribonuclear protein complex in cytoplasmic extracts of MCF-7 cells, as evidenced by RNA electrophoretic mobility shift assays (REMSA). Amore » super-shift assay using the hnRNP L antibody completely shifted the complex. Immunoprecipitation with the hnRNP L antibody and MCF-7 cells followed by RT-PCR revealed that hnRNP L interacts with endogenous bcl-2 mRNA in vivo. Furthermore, the suppression of hnRNP L in MCF-7 cells by the transfection of siRNA for hnRNP L resulted in a delay in the degradation of RNA transcripts including CA repeats of bcl-2 mRNA in vitro, suggesting that the interaction between hnRNPL and CA repeats of bcl-2 mRNA participates in destabilizing bcl-2 mRNA.« less

Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

PubMed

Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

1996-01-19

Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

PubMed

Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

2014-11-28

We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

External quality assurance of malaria nucleic acid testing for clinical trials and eradication surveillance.

PubMed

Murphy, Sean C; Hermsen, Cornelus C; Douglas, Alexander D; Edwards, Nick J; Petersen, Ines; Fahle, Gary A; Adams, Matthew; Berry, Andrea A; Billman, Zachary P; Gilbert, Sarah C; Laurens, Matthew B; Leroy, Odile; Lyke, Kristen E; Plowe, Christopher V; Seilie, Annette M; Strauss, Kathleen A; Teelen, Karina; Hill, Adrian V S; Sauerwein, Robert W

2014-01-01

Nucleic acid testing (NAT) for malaria parasites is an increasingly recommended diagnostic endpoint in clinical trials of vaccine and drug candidates and is also important in surveillance of malaria control and elimination efforts. A variety of reported NAT assays have been described, yet no formal external quality assurance (EQA) program provides validation for the assays in use. Here, we report results of an EQA exercise for malaria NAT assays. Among five centers conducting controlled human malaria infection trials, all centers achieved 100% specificity and demonstrated limits of detection consistent with each laboratory's pre-stated expectations. Quantitative bias of reported results compared to expected results was generally <0.5 log10 parasites/mL except for one laboratory where the EQA effort identified likely reasons for a general quantitative shift. The within-laboratory variation for all assays was low at <10% coefficient of variation across a range of parasite densities. Based on this study, we propose to create a Molecular Malaria Quality Assessment program that fulfills the need for EQA of malaria NAT assays worldwide.

Finite Element Analysis and Vibration Control of Lorry’s Shift Mechanism

NASA Astrophysics Data System (ADS)

Qiangwei, Li

2017-11-01

The transmission is one of the important parts of the automobile’s transmission system, Shift mechanism’s main function of transmission is to adjust the position of the shift fork, toggle the synchronizer’s tooth ring, so that the gears are separated and combined to achieve the shift. Therefore, in order to ensure the reliability and stability of the shift process, the vibration characteristics of the shift mechanism cannot be ignored. The static analysis of the shift fork is carried out, and the stress distribution of the shift fork is obtained according to the operating characteristics of the shift mechanism of the lorry transmission in this paper. The modal analysis of the shift mechanism shows the low-order vibration frequencies and the corresponding modal vibration shapes, and the vibration control analysis is carried out according to the simulation results. The simulation results provide the theoretical basis for the reasonable optimization design of the shift mechanism of the lorry transmission.

Use of a 17-Gene Prognostic Assay in Contemporary Urologic Practice: Results of an Interim Analysis in an Observational Cohort.

PubMed

Eure, Gregg; Germany, Raymond; Given, Robert; Lu, Ruixiao; Shindel, Alan W; Rothney, Megan; Glowacki, Richard; Henderson, Jonathan; Richardson, Tim; Goldfischer, Evan; Febbo, Phillip G; Denes, Bela S

2017-09-01

To study the impact of genomic testing in shared decision making for men with clinically low-risk prostate cancer (PCa). Patients with clinically low-risk PCa were enrolled in a prospective, multi-institutional study of a validated 17-gene tissue-based reverse transcription polymerase chain reaction assay (Genomic Prostate Score [GPS]). In this paper we report on outcomes in the first 297 patients enrolled in the study with valid 17-gene assay results and decision-change data. The primary end points were shared decision on initial management and persistence on active surveillance (AS) at 1 year post diagnosis. AS utilization and persistence were compared with similar end points in a group of patients who did not have genomic testing (baseline cohort). Secondary end points included perceived utility of the assay and patient decisional conflict before and after testing. One-year results were available on 258 patients. Shift between initial recommendation and shared decision occurred in 23% of patients. Utilization of AS was higher in the GPS-tested cohort than in the untested baseline cohort (62% vs 40%). The proportion of men who selected and persisted on AS at 1 year was 55% and 34% in the GPS and baseline cohorts, respectively. Physicians reported that GPS was useful in 90% of cases. Mean decisional conflict scores declined in patients after GPS testing. Patients who received GPS testing were more likely to select and persist on AS for initial management compared with a matched baseline group. These data indicate that GPS help guide shared decisions in clinically low-risk PCa. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Modification of Kolmogorov-Smirnov test for DNA content data analysis through distribution alignment.

PubMed

Huang, Shuguang; Yeo, Adeline A; Li, Shuyu Dan

2007-10-01

The Kolmogorov-Smirnov (K-S) test is a statistical method often used for comparing two distributions. In high-throughput screening (HTS) studies, such distributions usually arise from the phenotype of independent cell populations. However, the K-S test has been criticized for being overly sensitive in applications, and it often detects a statistically significant difference that is not biologically meaningful. One major reason is that there is a common phenomenon in HTS studies that systematic drifting exists among the distributions due to reasons such as instrument variation, plate edge effect, accidental difference in sample handling, etc. In particular, in high-content cellular imaging experiments, the location shift could be dramatic since some compounds themselves are fluorescent. This oversensitivity of the K-S test is particularly overpowered in cellular assays where the sample sizes are very big (usually several thousands). In this paper, a modified K-S test is proposed to deal with the nonspecific location-shift problem in HTS studies. Specifically, we propose that the distributions are "normalized" by density curve alignment before the K-S test is conducted. In applications to simulation data and real experimental data, the results show that the proposed method has improved specificity.

Pigment epithelium-derived factor stimulates skeletal muscle glycolytic activity through NADPH oxidase-dependent reactive oxygen species production.

PubMed

Carnagarin, Revathy; Carlessi, Rodrigo; Newsholme, Philip; Dharmarajan, Arun M; Dass, Crispin R

2016-09-01

Pigment epithelium-derived factor is a multifunctional serpin implicated in insulin resistance in metabolic disorders. Recent evidence suggests that exposure of peripheral tissues such as skeletal muscle to PEDF has profound metabolic consequences with predisposition towards chronic conditions such as obesity, type 2 diabetes, metabolic syndrome and polycystic ovarian syndrome. Chronic inflammation shifts muscle metabolism towards increased glycolysis and decreased oxidative metabolism. In the present study, we demonstrate a novel effect of PEDF on cellular metabolism in mouse cell line (C2C12) and human primary skeletal muscle cells. PEDF addition to skeletal muscle cells induced enhanced phospholipase A2 activity. This was accompanied with increased production of reactive oxygen species in a nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-dependent manner that triggered a shift towards a more glycolytic phenotype. Extracellular flux analysis and glucose consumption assays demonstrated that PEDF treatment resulted in enhanced glycolysis but did not change mitochondrial respiration. Our results demonstrate that skeletal muscle cells express a PEDF-inducible oxidant generating system that enhances glycolysis but is sensitive to antioxidants and NADPH oxidase inhibition. Copyright © 2016 Elsevier Ltd. All rights reserved.

A millennial-scale chronicle of evolutionary responses to cultural eutrophication in Daphnia.

PubMed

Frisch, Dagmar; Morton, Philip K; Chowdhury, Priyanka Roy; Culver, Billy W; Colbourne, John K; Weider, Lawrence J; Jeyasingh, Punidan D

2014-03-01

For an accurate assessment of the anthropogenic impacts on evolutionary change in natural populations, we need long-term environmental, genetic and phenotypic data that predate human disturbances. Analysis of c. 1600 years of history chronicled in the sediments of South Center Lake, Minnesota, USA, revealed major environmental changes beginning c. 120 years ago coinciding with the initiation of industrialised agriculture in the catchment area. Population genetic structure, analysed using DNA from dormant eggs of the keystone aquatic herbivore, Daphnia pulicaria, suggested no change for c. 1500 years prior to striking shifts associated with anthropogenic environmental alterations. Furthermore, phenotypic assays on the oldest resurrected metazoan genotypes (potentially as old as c. 700 years) indicate significant shifts in phosphorus utilisation rates compared to younger genotypes. Younger genotypes show steeper reaction norms with high growth under high phosphorus (P), and low growth under low P, while 'ancient' genotypes show flat reaction norms, yet higher growth efficiency under low P. Using this resurrection ecology approach, environmental, genetic and phenotypic data spanning pre- and post-industrialised agricultural eras clearly reveal the evolutionary consequences of anthropogenic environmental change. © 2014 John Wiley & Sons Ltd/CNRS.

BrWRKY65, a WRKY Transcription Factor, Is Involved in Regulating Three Leaf Senescence-Associated Genes in Chinese Flowering Cabbage.

PubMed

Fan, Zhong-Qi; Tan, Xiao-Li; Shan, Wei; Kuang, Jian-Fei; Lu, Wang-Jin; Chen, Jian-Ye

2017-06-08

Plant-specific WRKY transcription factors (TFs) have been implicated to function as regulators of leaf senescence, but their association with postharvest leaf senescence of economically important leafy vegetables, is poorly understood. In this work, the characterization of a Group IIe WRKY TF, BrWRKY65, from Chinese flowering cabbage ( Brassica rapa var. parachinensis) is reported. The expression of BrWRKY65 was up-regulated following leaf chlorophyll degradation and yellowing during postharvest senescence. Subcellular localization and transcriptional activation assays showed that BrWRKY65 was localized in the nucleus and exhibited trans-activation ability. Further electrophoretic mobility shift assay (EMSA) and transient expression analysis clearly revealed that BrWRKY65 directly bound to the W-box motifs in the promoters of three senescence-associated genes ( SAGs ) such as BrNYC1 and BrSGR1 associated with chlorophyll degradation, and BrDIN1 , and subsequently activated their expressions. These findings demonstrate that BrWRKY65 may be positively associated with postharvest leaf senescence, at least partially, by the direct activation of SAGs . Taken together, these findings provide new insights into the transcriptional regulatory mechanism of postharvest leaf senescence in Chinese flowering cabbage.

Specific labeling of zinc finger proteins using noncanonical amino acids and copper-free click chemistry.

PubMed

Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A; Schroeder, Charles M

2012-09-19

Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays, and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry.

Specific Labeling of Zinc Finger Proteins using Non-canonical Amino Acids and Copper-free Click Chemistry

PubMed Central

Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A.

2012-01-01

Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry. PMID:22871171

High affinity γPNA sandwich hybridization assay for rapid detection of short nucleic acid targets with single mismatch discrimination.

PubMed

Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W

2013-07-08

Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.

Involvement of the Global Crp Regulator in Cyclic AMP-Dependent Utilization of Aromatic Amino Acids by Pseudomonas putida

PubMed Central

Herrera, M. Carmen; Daddaoua, Abdelali; Fernández-Escamilla, Ana

2012-01-01

The phhAB operon encodes a phenylalanine hydroxylase involved in the conversion of l-phenylalanine into l-tyrosine in Pseudomonas putida. The phhAB promoter is transcribed by RNA polymerase sigma-70 and is unusual in that the specific regulator PhhR acts as an enhancer protein that binds to two distant upstream sites (−75 to −92 and −132 to −149). There is an integration host factor (IHF) binding site that overlaps the proximal PhhR box, and, consequently, IHF acts as an inhibitor of transcription. Use of l-phenylalanine is compromised in a crp-deficient background due to reduced expression from the phhAB promoter. Electrophoretic mobility shift assays and DNase I footprinting assays reveal that Crp binds at a site centered at −109 only in the presence of cyclic AMP (cAMP). We show, using circular permutation analysis, that the simultaneous binding of Crp/cAMP and PhhR bends DNA to bring positive regulators and RNA polymerase into close proximity. This nucleoprotein complex promotes transcription from phhA only in response to l-phenylalanine. PMID:22081386

Analysis of E2F factors during epidermal differentiation.

PubMed

Chang, Wing Y; Dagnino, Lina

2005-01-01

The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

Cell proteins bind to multiple sites within the 5' untranslated region of poliovirus RNA.

PubMed Central

del Angel, R M; Papavassiliou, A G; Fernández-Tomás, C; Silverstein, S J; Racaniello, V R

1989-01-01

The 5' noncoding region of poliovirus RNA contains sequences necessary for translation and replication. These functions are probably carried out by recognition of poliovirus RNA by cellular and/or viral proteins. Using a mobility-shift electrophoresis assay and 1,10-phenanthroline/Cu+ footprinting, we demonstrate specific binding of cytoplasmic factors with a sequence from nucleotides 510-629 within the 5' untranslated region (UTR). Complex formation was also observed with a second sequence (nucleotides 97-182) within the 5' UTR. These two regions of the 5' UTR appear to be recognized by distinct cell factors as determined by competition analysis and the effects of ionic strength on complex formation. However, both complexes contain eukaryotic initiation factor 2 alpha, as revealed by their reaction with specific antibody. Images PMID:2554308

Characterization of biomolecular nanoconjugates by high-throughput delivery and spectroscopic difference

PubMed Central

DeLong, Robert K; Risor, Azure; Kanomata, Masaaki; Laymon, Amanda; Jones, Brooke; Zimmerman, Scott D; Williams, Joseph; Witkowski, Colette; Warner, Mathew; Ruff, Michael; Garrad, Richard; Fallon, John K; Hickey, Anthony J; Sedaghat-Herati, Reza

2013-01-01

Aims Nanoparticle conjugates have the potential for delivering siRNA, splice-shifting oligomers or nucleic acid vaccines, and can be applicable to anticancer therapeutics. This article compares tripartite conjugates with gold nanoparticles or synthetic methoxypoly(ethylene glycol)-block-polyamidoamine dendrimers. Materials & methods Interactions with model liposomes of a 1:1 molar ratio of tripalmitin:cholesterol or phospholipid:cholesterol were investigated by high-throughput absorbance, as well as fluorescence difference and cellular luminescence assays. Results Spectral differences and dynamic light-scattering spectroscopy shifts demonstrated the interaction of conjugates with liposomes. Biological activity was demonstrated by upregulation of gene expression via splice-shifting oligomers, delivery of anti-B-Raf siRNA in cultured human cancer cells or tuberculosis antigen 85B plasmid expression vector in a coculture model of antigen presentation. Conclusion The data suggests that gold nanoparticles and methoxypoly(ethylene glycol)-block-polyamidoamine dendrimer nanoconjugates may have potential for binding, stabilization and delivery of splice-shifting oligomers, siRNA and nucleic acid vaccines for preclinical trials. PMID:22943129

New Real-Time PCR Assays for Detection of Inducible and Acquired Clarithromycin Resistance in the Mycobacterium abscessus Group.

PubMed

Shallom, Shamira J; Moura, Natalia S; Olivier, Kenneth N; Sampaio, Elizabeth P; Holland, Steven M; Zelazny, Adrian M

2015-11-01

Members of the Mycobacterium abscessus group (MAG) cause lung, soft tissue, and disseminated infections. The oral macrolides clarithromycin and azithromycin are commonly used for treatment. MAG can display clarithromycin resistance through the inducible erm(41) gene or via acquired mutations in the rrl (23S rRNA) gene. Strains harboring a truncation or a T28C substitution in erm(41) lose the inducible resistance trait. Phenotypic detection of clarithromycin resistance requires extended incubation (14 days), highlighting the need for faster methods to detect resistance. Two real-time PCR-based assays were developed to assess inducible and acquired clarithromycin resistance and tested on a total of 90 clinical and reference strains. A SYBR green assay was designed to distinguish between a full-length and truncated erm(41) gene by temperature shift in melting curve analysis. Single nucleotide polymorphism (SNP) allele discrimination assays were developed to distinguish T or C at position 28 of erm(41) and 23S rRNA rrl gene mutations at position 2058 and/or 2059. Truncated and full-size erm(41) genes were detected in 21/90 and 69/90 strains, respectively, with 64/69 displaying T at nucleotide position 28 and 5/69 containing C at that position. Fifteen isolates showed rrl mutations conferring clarithromycin resistance, including A2058G (11 isolates), A2058C (3 isolates), and A2059G (1 isolate). Targeted sequencing and phenotypic assessment of resistance concurred with molecular assay results. Interestingly, we also noted cooccurring strains harboring an active erm(41), inactive erm(41), and/or acquired mutational resistance, as well as slowly growing MAG strains and also strains displaying an inducible resistance phenotype within 5 days, long before the recommended 14-day extended incubation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Assessing HTS Performance Using BioAssay Ontology: Screening and Analysis of a Bacterial Phospho-N-Acetylmuramoyl-Pentapeptide Translocase Campaign

PubMed Central

Moberg, Andreas; Hansson, Eva; Boyd, Helen

2014-01-01

Abstract With the public availability of biochemical assays and screening data constantly increasing, new applications for data mining and method analysis are evolving in parallel. One example is BioAssay Ontology (BAO) for systematic classification of assays based on screening setup and metadata annotations. In this article we report a high-throughput screening (HTS) against phospho-N-acetylmuramoyl-pentapeptide translocase (MraY), an attractive antibacterial drug target involved in peptidoglycan synthesis. The screen resulted in novel chemistry identification using a fluorescence resonance energy transfer assay. To address a subset of the false positive hits, a frequent hitter analysis was performed using an approach in which MraY hits were compared with hits from similar assays, previously used for HTS. The MraY assay was annotated according to BAO and three internal reference assays, using a similar assay design and detection technology, were identified. Analyzing the assays retrospectively, it was clear that both MraY and the three reference assays all showed a high false positive rate in the primary HTS assays. In the case of MraY, false positives were efficiently identified by applying a method to correct for compound interference at the hit-confirmation stage. Frequent hitter analysis based on the three reference assays with similar assay method identified additional false actives in the primary MraY assay as frequent hitters. This article demonstrates how assays annotated using BAO terms can be used to identify closely related reference assays, and that analysis based on these assays clearly can provide useful data to influence assay design, technology, and screening strategy. PMID:25415593

Probing the Intermediacy of Covalent RNA Enzyme Complexes in RNA Modification Enzymes

PubMed Central

Chervin, Stephanie M.; Kittendorf, Jeffrey D.; Garcia, George A.

2009-01-01

Within the large and diverse group of RNA-modifying enzymes, a number of enzymes seem to form stable covalent linkages to their respective RNA substrates. A complete understanding of the chemical and kinetic mechanisms of these enzymes, some of which have identified pathological roles, is lacking. As part of our ongoing work studying the posttranscriptional modification of tRNA with queuine, we wish to understand fully the chemical and kinetic mechanisms involved in this key transglycosylation reaction. In our previous investigations, we have used a gel mobility-shift assay to characterize an apparent covalent enzyme-RNA intermediate believed to be operative in the catalytic pathway. However, the simple observation of a covalent complex is not sufficient to prove intermediacy. To be a true intermediate, the complex must be both chemically and kinetically competent. As a case study for the proof of intermediacy, we report the use of this gel-shift assay under mildly denaturing conditions to probe the kinetic competency of the covalent association between RNA and the tRNA modifying enzyme tRNA-guanine transglycosylase (TGT). PMID:17673081

Dye-binding protein assay using a long-wave-absorbing cyanine probe.

PubMed

Zheng, Hong; Mao, Yu Xia; Li, Dong Hui; Zhu, Chang Qing

2003-07-01

A simple and fast protein assay that involves the binding of water-soluble sulfonate heptamethylene cyanine to protein is described. The binding of the dye to protein causes a shift in the absorption maximum of the dye from 778 to 904 nm, and the increase in absorption at 904 nm is monitored. This assay is very reproducible, of good color stability for at least 80 min, and sensitive at the 100 ng/mL level of human serum albumin (HSA) when a spectrophotometer with near-infrared wavelength is used to measure absorbance. Few chemicals except ionic surfactants such as cetyltrimethylammonium bromide and sodium dodecyl sulfonate interfere with the assay. Purified proteins have different capacities to interact with the dye; under the experimental conditions, the linear ranges of bovine serum albumin (BSA), HSA and gamma-IgG were 200-2000, 100-2400, and 200-3000 ng/mL, respectively. The relative standard deviation for the five replicate determinations of 1200 ng/mL BSA is 2.1%.

Depth investigation of rapid sand filters for drinking water production reveals strong stratification in nitrification biokinetic behavior.

PubMed

Tatari, K; Smets, B F; Albrechtsen, H-J

2016-09-15

The biokinetic behavior of NH4(+) removal was investigated at different depths of a rapid sand filter treating groundwater for drinking water preparation. Filter materials from the top, middle and bottom layers of a full-scale filter were exposed to various controlled NH4(+) loadings in a continuous-flow lab-scale assay. NH4(+) removal capacity, estimated from short term loading up-shifts, was at least 10 times higher in the top than in the middle and bottom filter layers, consistent with the stratification of Ammonium Oxidizing Bacteria (AOB). AOB density increased consistently with the NH4(+) removal rate, indicating their primarily role in nitrification under the imposed experimental conditions. The maximum AOB cell specific NH4(+) removal rate observed at the bottom was at least 3 times lower compared to the top and middle layers. Additionally, a significant up-shift capacity (4.6 and 3.5 times) was displayed from the top and middle layers, but not from the bottom layer at increased loading conditions. Hence, AOB with different physiological responses were active at the different depths. The biokinetic analysis predicted that despite the low NH4(+) removal capacity at the bottom layer, the entire filter is able to cope with a 4-fold instantaneous loading increase without compromising the effluent NH4(+). Ultimately, this filter up-shift capacity was limited by the density of AOB and their biokinetic behavior, both of which were strongly stratified. Copyright © 2016 Elsevier Ltd. All rights reserved.

Step-wise addition of disulfide bridge in firefly luciferase controls color shift through a flexible loop: a thermodynamic perspective.

PubMed

Nazari, Mahboobeh; Hosseinkhani, Saman; Hassani, Leila

2013-02-01

Multi-color bioluminescence is developed using the introduction of single/double disulfide bridges in firefly luciferase. The bioluminescence reaction, which uses luciferin, Mg(2+)-ATP and molecular oxygen to yield an electronically excited oxyluciferin, is carried out by the luciferase and emits visible light. The bioluminescence color of firefly luciferases is determined by the luciferase sequence and assay conditions. It has been proposed that the stability of a protein may increase through the introduction of a disulfide bridge that decreases the configurational entropy of unfolding. Single and double disulfide bridges are introduced into Photinus pyralis firefly luciferase to make separate mutant enzymes with a single/double bridge (C(81)-A(105)C, L(306)C-L(309)C, P(451)C-V(469)C; C(81)-A(105)C/P(451)C-V(469)C, and A(296)C-A(326)C/P(451)C-V(469)C). By introduction of disulfide bridges using site-directed mutagenesis in Photinus pyralis luciferase the color of emitted light was changed to red or kept in different extents. The bioluminescence color shift occurred with displacement of a critical loop in the luciferase structure without any change in green emitter mutants. Thermodynamic analysis revealed that among mutants, L(306)C-L(309)C shows a remarkable stability against urea denaturation and also a considerable increase in kinetic stability and a clear shift in bioluminescence spectra towards red.

On the mechanism of Cr (VI)-induced carcinogenesis: dose dependence of uptake and cellular responses.

PubMed

Liu, K; Husler, J; Ye, J; Leonard, S S; Cutler, D; Chen, F; Wang, S; Zhang, Z; Ding, M; Wang, L; Shi, X

2001-06-01

Cr (VI) compounds are widely used industrial chemicals and are recognized human carcinogens. The mechanisms of carcinogenesis associated with these compounds remain to be investigated. The present study focused on dose-dependence of Cr (VI)-induced uptake and cellular responses. The results show that Cr (VI) is able to enter the cells (human lung epithelial cell line A549) at low concentration (< 10 microM) and that the Cr (VI) uptake appears to be a combination of saturable transport and passive diffusion. Electron spin resonance (ESR) trapping measurements showed that upon stimulation with Cr (VI), A549 cells were able to generate reactive oxygen species (ROS). The amount of ROS generated depended on the Cr (VI) concentration. ROS generation involved NADPH-dependent flavoenzymes. Cr (VI) affected the following cellular parameters in a dose-dependent manner, (a) activation of nuclear transcription factors NF-kappaB, and p53, (b) DNA damage, (c) induction of cell apoptosis, and (d) inhibition of cell proliferation. The activation of transcription factors was assessed by electrophoretic mobility shift assay and western blot analysis, DNA damage by single cell gel electrophoresis assay, cell apoptosis by DNA fragmentation assay, and cell proliferation by a non-radioactive ELISA kit. At the concentration range used in the present study, no thresholds were found in all of these cell responses to Cr (VI). The results may guide further research to better understand and evaluate the risk of Cr (VI)-induced carcinogenesis at low levels of exposure.

The "Transport Specificity Ratio": a structure-function tool to search the protein fold for loci that control transition state stability in membrane transport catalysis

PubMed Central

King, Steven C

2004-01-01

Background In establishing structure-function relationships for membrane transport proteins, the interpretation of phenotypic changes can be problematic, owing to uncertainties in protein expression levels, sub-cellular localization, and protein-folding fidelity. A dual-label competitive transport assay called "Transport Specificity Ratio" (TSR) analysis has been developed that is simple to perform, and circumvents the "expression problem," providing a reliable TSR phenotype (a constant) for comparison to other transporters. Results Using the Escherichia coli GABA (4-aminobutyrate) permease (GabP) as a model carrier, it is demonstrated that the TSR phenotype is largely independent of assay conditions, exhibiting: (i) indifference to the particular substrate concentrations used, (ii) indifference to extreme changes (40-fold) in transporter expression level, and within broad limits (iii) indifference to assay duration. The theoretical underpinnings of TSR analysis predict all of the above observations, supporting that TSR has (i) applicability in the analysis of membrane transport, and (ii) particular utility in the face of incomplete information on protein expression levels and initial reaction rate intervals (e.g., in high-throughput screening situations). The TSR was used to identify gab permease (GabP) variants that exhibit relative changes in catalytic specificity (kcat/Km) for [14C]GABA (4-aminobutyrate) versus [3H]NA (nipecotic acid). Conclusions The TSR phenotype is an easily measured constant that reflects innate molecular properties of the transition state, and provides a reliable index of the difference in catalytic specificity that a carrier exhibits toward a particular pair of substrates. A change in the TSR phenotype, called a Δ(TSR), represents a specificity shift attributable to underlying changes in the intrinsic substrate binding energy (ΔGb) that translocation catalysts rely upon to decrease activation energy (). TSR analysis is therefore a structure-function tool that enables parsimonious scanning for positions in the protein fold that couple to the transition state, creating stability and thereby serving as functional determinants of catalytic power (efficiency, or specificity). PMID:15548327

A localized surface plasmon resonance (LSPR) immunosensor for CRP detection using 4-chloro-1-naphtol (4-CN) precipitation

NASA Astrophysics Data System (ADS)

Ha, Su-Ji; Park, Jin-Ho; Byun, Ju-Young; Ahn, Young-Deok; Kim, Min-Gon

2017-07-01

In this study, C-reactive protein (CRP) was detected by monitoring of LSPR shift promoted by precipitation of 4-chloro-1-naphthol (4-CN). The precipitation occurred by horseradish peroxide (HRP) catalyst which is modified at CRP-detection antibody utilized in sandwich enzyme-linked immunosorbent assay (ELISA) on gold nano bipyramid (GNBP) substrate. Due to 4-CN precipitates which are located nearby the surface of GNBP, local refractive index (RI) and molecular density were greatly increased. This phenomenon eventually induced strong spectral red-shift of absorption band of GNBP. An excellent linear relationship (R2=0.9895) between the LSPR shift and CRP concentration was obtained in the range from 100 pg/mL to 100 ng/mL and limit of detection (LOD) was reached to 87 pg/mL.

UV damage-specific DNA-binding protein in xeroderma pigmentosum complementation group E

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kataoka, H.; Fujiwara, Y.

1991-03-29

The gel mobility shift assay method revealed a specifically ultraviolet (UV) damage recognizing, DNA-binding protein in nuclear extracts of normal human cells. The resulted DNA/protein complexes caused the two retarded mobility shifts. Four xeroderma pigmentosum complementation group E (XPE) fibroblast strains derived from unrelated Japanese families were not deficient in such a DNA damage recognition/binding protein because of the normal complex formation and gel mobility shifts, although we confirmed the reported lack of the protein in the European XPE (XP2RO and XP3RO) cells. Thus, the absence of this binding protein is not always commonly observed in all the XPE strains,more » and the partially repair-deficient and intermediately UV-hypersensitive phenotype of XPE cells are much similar whether or not they lack the protein.« less

Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

PubMed

Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

2015-08-01

Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Structure and self-assembly of the calcium binding matrix protein of human metapneumovirus.

PubMed

Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T; Grimes, Jonathan M

2014-01-07

The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca²⁺ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca²⁺ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Studies on water soluble polysaccharides from Pithecellobium dulce (Roxb.) Benth. seeds.

PubMed

Bagchi, S; Kumar, K Jayaram

2016-03-15

In this existing experimental work, water soluble PDP polysaccharides were secluded from Pithecellobium dulce (Roxb.) Benth. seeds. The physicochemical properties were analyzed in terms of swelling power, solubility, pH and water holding capacity. Micromeretic studies proved the polysaccharide may be used a potential pharmaceutical adjuvant. The polysaccharide was characterized by FT-IR, SEM, TGA and NMR techniques. Methylation analysis confirmed that the polysaccharide is composed of Arabinose (Araf) units. The chemical shifts of anomeric proton region were found in the region of 4.4-5.5ppm. Thermogravimetric analysis showed that PDP polysaccharide was thermally stable. The in vitro antioxidant capacities of the polysaccharide were investigated in terms of scavenging of hydroxyl radicals, 2, 2-diphenyl-1-picrylhydrazyl (DPPH) radicals, hydrogen peroxide (H2O2) and reducing power assay. The polysaccharide fractions showed activity in a concentration dependent manner which was comparable to the standard, ascorbic acid. Copyright © 2015 Elsevier Ltd. All rights reserved.

The clpB gene of Bifidobacterium breve UCC 2003: transcriptional analysis and first insights into stress induction.

PubMed

Ventura, Marco; Kenny, John G; Zhang, Ziding; Fitzgerald, Gerald F; van Sinderen, Douwe

2005-09-01

The so-called clp genes, which encode components of the Clp proteolytic complex, are widespread among bacteria. The Bifidobacterium breve UCC 2003 genome contains a clpB gene with significant homology to predicted clpB genes from other members of the Actinobacteridae group. The heat- and osmotic-inducibility of the B. breve UCC 2003 clpB homologue was verified by slot-blot analysis, while Northern blot and primer extension analyses showed that the clpB gene is transcribed as a monocistronic unit with a single promoter. The role of a hspR homologue, known to control the regulation of clpB and dnaK gene expression in other high G+C content bacteria was investigated by gel mobility shift assays. Moreover the predicted 3D structure of HspR provides further insight into the binding mode of this protein to the clpB promoter region, and highlights the key amino acid residues believed to be involved in the protein-DNA interaction.

Characterization of a Smad motif similar to Drosophila mad in the mouse Msx 1 promoter.

PubMed

Alvarez Martinez, Cristina E; Binato, Renata; Gonzalez, Sayonara; Pereira, Monica; Robert, Benoit; Abdelhay, Eliana

2002-03-01

Mouse Msx 1 gene, orthologous of the Drosophila msh, is involved in several developmental processes. BMP family members are major proteins in the regulation of Msx 1 expression. BMP signaling activates Smad 1/5/8 proteins, which associate to Smad 4 before translocating to the nucleus. Analysis of Msx 1 promoter revealed the presence of three elements similar to the consensus established for Mad, the Smad 1 Drosophila counterpart. Notably, such an element was identified in an enhancer important for Msx 1 regulation. Gel shift analysis demonstrated that proteins from 13.5 dpc embryo associate to this enhancer. Remarkably, supershift assays showed that Smad proteins are present in the complex. Purified Smad 1 and 4 also bind to this fragment. We demonstrate that functional binding sites in this enhancer are confined to the Mad motif and flanking region. Our data suggest that this Mad motif may be functional in response to BMP signaling. ©2002 Elsevier Science (USA).

Associations of rotational shift work and night shift status with hypertension: a systematic review and meta-analysis.

PubMed

Manohar, Sandhya; Thongprayoon, Charat; Cheungpasitporn, Wisit; Mao, Michael A; Herrmann, Sandra M

2017-10-01

The reported risks of hypertension (HTN) in rotating shift and night shift workers are controversial. The objective of this meta-analysis was to assess the association between shift work status and HTN. A literature search was performed using MEDLINE, EMBASE and Cochrane Database from inception through October 2016. Studies that reported odds ratios (OR) comparing the risk of HTN in shift workers were included. A prespecified subgroup analysis by rotating shift and night shift statuses were also performed. Pooled OR and 95% confidence interval (CI) were calculated using a random-effect, generic inverse variance method. The protocol for this study is registered with International Prospective Register of Systematic Reviews; no. CRD42016051843. Twenty-seven observational studies (nine cohort and 18 cross-sectional studies) with a total of 394 793 individuals were enrolled. The pooled ORs of HTN in shift workers in cohort and cross-sectional studies were 1.31 (95% CI, 1.07-1.60) and 1.10 (95% CI, 1.00-1.20), respectively. When meta-analysis was restricted only to cohort studies in rotating shift, the pooled OR of HTN in rotating shift workers was 1.34 (95% CI, 1.08-1.67). The data regarding night shift and HTN in cohort studies was limited. The pooled OR of HTN in night shift workers in cross-sectional studies was 1.07 (95% CI, 0.85-1.35). Based on the findings of our meta-analysis, shiftwork status may play an important role in HTN, as there is a significant association between rotating shift work and HTN. However, there is no significant association between night shift status and risk of HTN.

Development of methods to detect occurrence and effects of endocrine-disrupting chemicals: A fundamental shift in regulatory ecotoxicology

EPA Science Inventory

This is an editorial in ET&C describing the newer pathway-specific test methods for EDCs and their effect on ecotoxicology. Work conducted to support the development and application of these types of assays promises to be an important catalyst to advance the field of ecotoxicolo...

Transcriptional regulation of the cytosolic chaperonin theta subunit gene, Cctq, by Ets domain transcription factors Elk-1, Sap-1a, and Net in the absence of serum response factor.

PubMed

Yamazaki, Yuji; Kubota, Hiroshi; Nozaki, Masami; Nagata, Kazuhiro

2003-08-15

The chaperonin-containing t-complex polypeptide 1 (CCT) is a molecular chaperone that facilitates protein folding in eukaryotic cytosol, and the expression of CCT is highly dependent on cell growth. We show here that transcription of the gene encoding the theta subunit of mouse CCT, Cctq, is regulated by the ternary complex factors (TCFs), Elk-1, Sap-1a, and Net (Sap-2). Reporter gene assay using HeLa cells indicated that the Cctq gene promoter contains a cis-acting element of the CCGGAAGT sequence (CQE1) at -36 bp. The major CQE1-binding proteins in HeLa cell nuclear extract was recognized by anti-Elk-1 or anti-Sap-1a antibodies in electrophoretic mobility shift assay, and recombinant Elk-1, Sap-1a, or Net specifically recognized CQE1. The CQE1-dependent transcriptional activity in HeLa cells was virtually abolished by overexpression of the DNA binding domains of TCFs. Overexpression of full-length TCFs with Ras indicated that exogenous TCFs can regulate the CQE1-dependent transcription in a Ras-dependent manner. PD98059, an inhibitor of MAPK, significantly repressed the CQE1-dependent transcription. However, no serum response factor was detected by electrophoretic mobility shift assay using the CQE1 element. These results indicate that transcription of the Cctq gene is regulated by TCFs under the control of the Ras/MAPK pathway, probably independently of serum response factor.

Monitoring multiple myeloma patients treated with daratumumab: teasing out monoclonal antibody interference.

PubMed

McCudden, Christopher; Axel, Amy E; Slaets, Dominique; Dejoie, Thomas; Clemens, Pamela L; Frans, Sandy; Bald, Jaime; Plesner, Torben; Jacobs, Joannes F M; van de Donk, Niels W C J; Moreau, Philippe; Schecter, Jordan M; Ahmadi, Tahamtan; Sasser, A Kate

2016-06-01

Monoclonal antibodies are promising anti-myeloma treatments. As immunoglobulins, monoclonal antibodies have the potential to be identified by serum protein electrophoresis (SPE) and immunofixation electrophoresis (IFE). Therapeutic antibody interference with standard clinical SPE and IFE can confound the use of these tests for response assessment in clinical trials and disease monitoring. To discriminate between endogenous myeloma protein and daratumumab, a daratumumab-specific immunofixation electrophoresis reflex assay (DIRA) was developed using a mouse anti-daratumumab antibody. To evaluate whether anti-daratumumab bound to and shifted the migration pattern of daratumumab, it was spiked into daratumumab-containing serum and resolved by IFE/SPE. The presence (DIRA positive) or absence (DIRA negative) of residual M-protein in daratumumab-treated patient samples was evaluated using predetermined assessment criteria. DIRA was evaluated for specificity, limit of sensitivity, and reproducibility. In all of the tested samples, DIRA distinguished between daratumumab and residual M-protein in commercial serum samples spiked with daratumumab and in daratumumab-treated patient samples. The DIRA limit of sensitivity was 0.2 g/L daratumumab, using spiking experiments. Results from DIRA were reproducible over multiple days, operators, and assays. The anti-daratumumab antibody was highly specific for daratumumab and did not shift endogenous M-protein. As the treatment of myeloma evolves to incorporate novel monoclonal antibodies, additional solutions will be needed for clinical monitoring of patient responses to therapeutic regimens. In the interim, assays such as DIRA can inform clinical outcomes by distinguishing daratumumab from endogenous M-protein by IFE.

A rhodium(III)-based inhibitor of autotaxin with antiproliferative activity.

PubMed

Kang, Tian-Shu; Wang, Wanhe; Zhong, Hai-Jing; Liang, Jia-Xin; Ko, Chung-Nga; Lu, Jin-Jian; Chen, Xiu-Ping; Ma, Dik-Lung; Leung, Chung-Hang

2017-02-01

Cancer of the skin is by far the most common of all cancers. Melanoma accounts for only about 1% of skin cancers but causes a large majority of skin cancer deaths. Autotaxin (ATX), also known as ectonucleotide pyrophosphatase/phosphodiesterase 2 (ENPP2), regulates physiological and pathological functions of lysophosphatidic acid (LPA), and is thus an important therapeutic target. We synthesized ten metal-based complexes and a novel cyclometalated rhodium(III) complex 1 was identified as an ATX enzymatic inhibitor using multiple methods, including ATX enzymatic assay, thermal shift assay, western immunoblotting and so on. Protein thermal shift assays showed that 1 increased the melting temperature (T m ) of ATX by 3.5°C. 1 also reduced ATX-LPA mediated downstream survival signal pathway proteins such as ERK and AKT, and inhibited the activation of the transcription factor nuclear factor κB (NF-κB) and signal transducer and activator of transcription 3 (STAT3). 1 also exhibited strong anti-proliferative activity against A2058 melanoma cells (IC 50 =0.58μM). Structure-activity relationship indicated that both the rhodium(III) center and the auxiliary ligands of complex 1 are important for bioactivity. 1 represents a promising scaffold for the development of small-molecule ATX inhibitors for anti-tumor applications. To our knowledge, complex 1 is the first metal-based ATX inhibitor reported to date. Rhodium complexes will have the increased attention in therapeutic and bioanalytical applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Unattended Multiplicity Shift Register

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newell, Matt; Jones, David C.

2017-01-16

The Unattended Multiplicity Shift Register (UMSR) is a specialized pulse counter used primarily to count neutron events originating in neutron detection instruments. While the counter can be used to count any TTL input pulses, its unique ability to record time correlated events and the multiplicity distributions of these events makes it an ideal instrument for counting neutron events in the nuclear fields of material safeguards, waste assay and process monitoring and control. The UMSR combines the Los Alamos National Laboratory (LANL) simple and robust shift register design with a Commercial-Off-The-Shelf (COTS) processor and Ethernet communications. The UMSR is fully compatiblemore » with existing International Atomic Energy Agency (IAEA) neutron data acquisition instruments such as the Advance Multiplicity Shift Register (AMSR) and JSR-15. The UMSR has three input channels: a multiplicity shift register input and two auxiliary inputs. The UMSR provides 0V to 2kV of programmable High Voltage (HV) bias and both a 12V and a 5V detector power supply output. A serial over USB communication line to the UMSR allows the use of existing versions of INCC or MIC software while the Ethernet port is compatible with the new IAEA RAINSTORM communication protocol.« less

Is Shift Work Associated with Lipid Disturbances and Increased Insulin Resistance?

PubMed

Alefishat, Eman; Abu Farha, Rana

2015-11-01

Shift work is associated with higher risk of metabolic disturbances and cardiovascular diseases. There are contradictory reports on the effect of shift work on lipid parameters in the literature. No studies have investigated any possible association between shift work and the ratio of serum triglyceride to high density lipoprotein cholesterol (TG/HDL-C ratio). This ratio can be used as a predictor for insulin resistance. The main aim of the present cross-sectional study was to investigate the association between shift work and serum TG/HDL-C ratio, TG level, and HDL-C level. One hundred and forty adult Jordanian employees were recruited. Demographic data, lifestyle habits, clinical parameters, and working patterns data were documented through a well-structured questionnaire. Serum TG and HDL-C levels were measured after at least 9 hours fasting using enzymatic assay procedure. Compared with daytime workers (58 subjects), shift workers (82 subjects) displayed higher TG/HDL-C ratio (r = 0.217, P = 0.013), higher serum TG levels (r = 0.220, P = 0.012), and lower HDL-C levels (r = -0.200, P = 0.016). Among shift workers, 30.5% were found to have a TG/HDL-C ratio >3.5 compared with 8.6% of daytime workers (P = 0.002). In the present study, shift work was shown to be associated with higher TG/HDL-C ratio, higher serum TG, and lower HDL-C levels. These findings might indicate that shift work is associated with increased insulin resistance and consequently higher risk of metabolic syndrome and cardiovascular diseases.

Synthesis and characterization of novel 2, 2'-bipyrimidine fluorescent derivative for protein binding

PubMed Central

2011-01-01

Background Fluorescent dyes with biocompatible functional group and good fluorescence behavior are used as biosensor for monitoring different biological processes as well as detection of protein assay. All reported fluorophore used as sensors are having high selectivity and sensitivity but till there is more demand to synthesized new fluorophore which have improved fluorescence properties and good biocompatibility. Results Novel 4, 4'-(1, 1'-(5-(2-methoxyphenoxy)-[2, 2'-bipyrimidine]-4, 6-diyl)bis(1H-pyrazol-3, 1-diyl)) dianiline fluorescent dye was synthesized by multistep synthesis from 2-phenylacetonitrile, 2-chloropyrimidine and 2-methoxyphenol. This dye has absorption at 379 nm with intense single emission at 497 nm having fairly good quantum yield (0.375) and Stokes shift. The intermediates and dye were characterized by FT-IR, 1H NMR, 13C NMR and Mass spectral analysis. The pyrazole bipyrimidine based fluorescent dye possessing two amino groups suitable for binding with protein is reported. Its utility as a biocompatible conjugate was explained by conjugation with bovine serum albumin. The method is based on direct fluorescence detection of fluorophore-labelled protein before and after conjugation. Purified fluorescent conjugate was subsequently analyzed by fluorimetry. The analysis showed that the tested conjugation reaction yielded fluorescent conjugates of the dye through carbodiimide chemistry. Conclusion In summery synthesized fluorophore pyrazole-bipyrimidine has very good interaction towards protein bovine serum albumin and it acts as good candidate for protein assay. PMID:22067202

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Characteristics and Expression Profile of KRT71 Screened by Suppression Subtractive Hybridization cDNA Library in Curly Fleece Chinese Tan Sheep.

PubMed

Kang, Xiaolong; Liu, Yufang; Zhang, Jibin; Xu, Qinqin; Liu, Chengkun; Fang, Meiying

2017-07-01

As an important commercial trait for sheep, curly fleece has a great economic impact on production costs and efficiency in sheep industry. To identify genes that are important for curly fleece formation in mammals, a suppression subtractive hybridization analysis was performed on the shoulder skin tissues exposed to two different growth stages of Chinese Tan sheep with different phenotypes (curly fleece and noncurling fleece). BLAST analysis identified 67 differentially expressed genes, of which 31 were expressed lower and 36 were expressed higher in lambs than in adult sheep. Differential expressions of seven randomly selected genes were verified using quantitative real-time polymerase chain reaction (qRT-PCR). KRT71 gene was selected for further study due to its high correlation with the curly hair phenotype in various mammal species. Semi-qPCR showed distinctively high expression of KRT71 in skin tissues. Moreover, qPCR result showed a significantly higher expression of KRT71 in curly fleece than noncurling Tan sheep. The luciferase assay and electrophoresis mobility shift assay showed that there were transcription factor binding sites in the promoter region of KRT71 related to the differential expression of KRT71 at the two growth stages of Tan sheep. Online bioinformation tools predicted MFZ1 as a transcriptional factor that regulates the expression of KRT71. These studies on KRT71 gene revealed some mechanisms underlying the relationship between the KRT71 gene and the curly fleece phenotype of Tan sheep.

Autoregulation of the Bacillus subtilis response regulator gene degU is coupled with the proteolysis of DegU-P by ClpCP.

PubMed

Ogura, Mitsuo; Tsukahara, Kensuke

2010-03-01

The response regulator DegU and its cognate kinase DegS constitute a two-component system in Bacillus subtilis that regulates many cellular processes, including exoprotease production and competence development. Using DNA footprint assay, gel shift assay and mutational analyses of P3degU-lacZ fusions, we showed that phosphorylated DegU (DegU-P) binds to two direct repeats (DR1 and DR2) of the consensus DegU-binding sequence in the P3degU promoter. The alteration of chromosomal DR2 severely decreased degU expression, demonstrating its importance in positive autoregulation of degU. Observation of DegU protein levels suggested that DegU is degraded. Western blot analysis of DegU in disruption mutants of genes encoding various ATP-dependent proteases strongly suggested that ClpCP degrades DegU. Moreover, when de novo protein synthesis was blocked, DegU was rapidly degraded in the wild-type but not in the clpC and clpP strains, and DegU with a mutated phosphorylation site was much stable. These results suggested preferential degradation of DegU-P by ClpCP, but not of unphosphorylated DegU. We confirmed that DegU-P was degraded preferentially using an in vitro ClpCP degradation system. Furthermore, a mutational analysis showed that the N-terminal region of DegU is important for proteolysis.

Perilipin, a critical regulator of fat storage and breakdown, is a target gene of estrogen receptor-related receptor {alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko

2008-04-11

Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less

In vivo phosphorylation of a peptide tag for protein purification.

PubMed

Goux, Marine; Fateh, Amina; Defontaine, Alain; Cinier, Mathieu; Tellier, Charles

2016-05-01

To design a new system for the in vivo phosphorylation of proteins in Escherichia coli using the co-expression of the α-subunit of casein kinase II (CKIIα) and a target protein, (Nanofitin) fused with a phosphorylatable tag. The level of the co-expressed CKIIα was controlled by the arabinose promoter and optimal phosphorylation was obtained with 2 % (w/v) arabinose as inductor. The effectiveness of the phosphorylation system was demonstrated by electrophoretic mobility shift assay (NUT-PAGE) and staining with a specific phosphoprotein-staining gel. The resulting phosphorylated tag was also used to purify the phosphoprotein by immobilized metal affinity chromatography, which relies on the specific interaction of phosphate moieties with Fe(III). The use of a single tag for both the purification and protein array anchoring provides a simple and straightforward system for protein analysis.

Surprisal analysis characterizes the free energy time course of cancer cells undergoing epithelial-to-mesenchymal transition.

PubMed

Zadran, Sohila; Arumugam, Rameshkumar; Herschman, Harvey; Phelps, Michael E; Levine, R D

2014-09-09

The epithelial-to-mesenchymal transition (EMT) initiates the invasive and metastatic behavior of many epithelial cancers. Mechanisms underlying EMT are not fully known. Surprisal analysis of mRNA time course data from lung and pancreatic cancer cells stimulated to undergo TGF-β1-induced EMT identifies two phenotypes. Examination of the time course for these phenotypes reveals that EMT reprogramming is a multistep process characterized by initiation, maturation, and stabilization stages that correlate with changes in cell metabolism. Surprisal analysis characterizes the free energy time course of the expression levels throughout the transition in terms of two state variables. The landscape of the free energy changes during the EMT for the lung cancer cells shows a stable intermediate state. Existing data suggest this is the previously proposed maturation stage. Using a single-cell ATP assay, we demonstrate that the TGF-β1-induced EMT for lung cancer cells, particularly during the maturation stage, coincides with a metabolic shift resulting in increased cytosolic ATP levels. Surprisal analysis also characterizes the absolute expression levels of the mRNAs and thereby examines the homeostasis of the transcription system during EMT.

A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

PubMed

Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

1997-09-05

To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.

The timing of the human circadian clock is accurately represented by the core body temperature rhythm following phase shifts to a three-cycle light stimulus near the critical zone

NASA Technical Reports Server (NTRS)

Jewett, M. E.; Duffy, J. F.; Czeisler, C. A.

2000-01-01

A double-stimulus experiment was conducted to evaluate the phase of the underlying circadian clock following light-induced phase shifts of the human circadian system. Circadian phase was assayed by constant routine from the rhythm in core body temperature before and after a three-cycle bright-light stimulus applied near the estimated minimum of the core body temperature rhythm. An identical, consecutive three-cycle light stimulus was then applied, and phase was reassessed. Phase shifts to these consecutive stimuli were no different from those obtained in a previous study following light stimuli applied under steady-state conditions over a range of circadian phases similar to those at which the consecutive stimuli were applied. These data suggest that circadian phase shifts of the core body temperature rhythm in response to a three-cycle stimulus occur within 24 h following the end of the 3-day light stimulus and that this poststimulus temperature rhythm accurately reflects the timing of the underlying circadian clock.

Buffer Optimization of Thermal Melt Assays of Plasmodium Proteins for Detection of Small-Molecule Ligands

PubMed Central

Crowther, Gregory J.; Napuli, Alberto J.; Thomas, Andrew P.; Chung, Diana J.; Kovzun, Kuzma V.; Leibly, David J.; Castaneda, Lisa J.; Bhandari, Janhavi; Damman, Christopher J.; Hui, Raymond; Hol, Wim G. J.; Buckner, Frederick S.; Verlinde, Christophe L. M. J.; Zhang, Zhongsheng; Fan, Erkang; Van Voorhis, Wesley C.

2010-01-01

In the last decade, thermal melt/thermal shift assays have become a common tool for identifying ligands and other factors that stabilize specific proteins. Increased stability is indicated by an increase in the protein's melting temperature (Tm). In optimizing the assays for subsequent screening of compound libraries, it is important to minimize the variability of Tm measurements so as to maximize the assay's ability to detect potential ligands. Here we present an investigation of Tm variability in recombinant proteins from Plasmodium parasites. Ligands of Plasmodium proteins are particularly interesting as potential starting points for drugs for malaria, and new drugs are urgently needed. A single standard buffer (100 mM HEPES, pH 7.5, 150 mM NaCl) permitted estimation of Tm for 58 of 61 Plasmodium proteins tested. However, with several proteins, Tm could not be measured with a consistency suitable for high-throughput screening unless alternative protein-specific buffers were employed. We conclude that buffer optimization to minimize variability in Tm measurements increases the success of thermal melt screens involving proteins for which a standard buffer is suboptimal. PMID:19470714

One Question, Multiple Answers: Biochemical and Biophysical Screening Methods Retrieve Deviating Fragment Hit Lists.

PubMed

Schiebel, Johannes; Radeva, Nedyalka; Köster, Helene; Metz, Alexander; Krotzky, Timo; Kuhnert, Maren; Diederich, Wibke E; Heine, Andreas; Neumann, Lars; Atmanene, Cedric; Roecklin, Dominique; Vivat-Hannah, Valérie; Renaud, Jean-Paul; Meinecke, Robert; Schlinck, Nina; Sitte, Astrid; Popp, Franziska; Zeeb, Markus; Klebe, Gerhard

2015-09-01

Fragment-based lead discovery is gaining momentum in drug development. Typically, a hierarchical cascade of several screening techniques is consulted to identify fragment hits which are then analyzed by crystallography. Because crystal structures with bound fragments are essential for the subsequent hit-to-lead-to-drug optimization, the screening process should distinguish reliably between binders and non-binders. We therefore investigated whether different screening methods would reveal similar collections of putative binders. First we used a biochemical assay to identify fragments that bind to endothiapepsin, a surrogate for disease-relevant aspartic proteases. In a comprehensive screening approach, we then evaluated our 361-entry library by using a reporter-displacement assay, saturation-transfer difference NMR, native mass spectrometry, thermophoresis, and a thermal shift assay. While the combined results of these screening methods retrieve 10 of the 11 crystal structures originally predicted by the biochemical assay, the mutual overlap of individual hit lists is surprisingly low, highlighting that each technique operates on different biophysical principles and conditions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Age-Related Shifts in the Density and Distribution of Genetic Marker Water Quality Indicators in Cow and Calf Feces (Journal)

EPA Science Inventory

Calves (≤ 226 kg body mass) make up about 16% of the current bovine population in the United States and can excrete high levels of human pathogens. We describe the density and distribution of genetic markers from 11 PCR- and real-time quantitative PCR-based assays including CF...

A comprehensive company database analysis of biological assay variability.

PubMed

Kramer, Christian; Dahl, Göran; Tyrchan, Christian; Ulander, Johan

2016-08-01

Analysis of data from various compounds measured in diverse biological assays is a central part of drug discovery research projects. However, no systematic overview of the variability in biological assays has been published and judgments on assay quality and robustness of data are often based on personal belief and experience within the drug discovery community. To address this we performed a reproducibility analysis of all biological assays at AstraZeneca between 2005 and 2014. We found an average experimental uncertainty of less than a twofold difference and no technologies or assay types had higher variability than others. This work suggests that robust data can be obtained from the most commonly applied biological assays. Copyright © 2016. Published by Elsevier Ltd.

Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

PubMed

Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

2007-08-15

In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

A fully-integrated aptamer-based affinity assay platform for monitoring astronaut health in space.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xianbin; Durland, Ross H.; Hecht, Ariel H.

2010-07-01

Here we demonstrate the suitability of robust nucleic acid affinity reagents in an integrated point-of-care diagnostic platform for monitoring proteomic biomarkers indicative of astronaut health in spaceflight applications. A model thioaptamer targeting nuclear factor-kappa B (NF-{kappa}B) is evaluated in an on-chip electrophoretic gel-shift assay for human serum. Key steps of (i) mixing sample with the aptamer, (ii) buffer exchange, and (iii) preconcentration of sample were successfully integrated upstream of fluorescence-based detection. Challenges due to (i) nonspecific interactions with serum, and (ii) preconcentration at a nanoporous membrane are discussed and successfully resolved to yield a robust, rapid, and fully-integrated diagnostic system.

Simplified 2,4-dinitrophenylhydrazine spectrophotometric assay for quantification of carbonyls in oxidized proteins.

PubMed

Mesquita, Cristina S; Oliveira, Raquel; Bento, Fátima; Geraldo, Dulce; Rodrigues, João V; Marcos, João C

2014-08-01

This work proposes a modification of the 2,4-dinitrophenylhydrazine (DNPH) spectrophotometric assay commonly used to evaluate the concentration of carbonyl groups in oxidized proteins. In this approach NaOH is added to the protein solution after the addition of DNPH, shifting the maximum absorbance wavelength of the derivatized protein from 370 to 450nm. This reduces the interference of DNPH and allows the direct quantification in the sample solution without the need for the precipitation, washing, and resuspension steps that are carried out in the traditional DNPH method. The two methods were compared under various conditions and are statistically equivalent. Copyright © 2014 Elsevier Inc. All rights reserved.

Differential regulation of ParaHox genes by retinoic acid in the invertebrate chordate amphioxus (Branchiostoma floridae).

PubMed

Osborne, Peter W; Benoit, Gérard; Laudet, Vincent; Schubert, Michael; Ferrier, David E K

2009-03-01

The ParaHox cluster is the evolutionary sister to the Hox cluster. Like the Hox cluster, the ParaHox cluster displays spatial and temporal regulation of the component genes along the anterior/posterior axis in a manner that correlates with the gene positions within the cluster (a feature called collinearity). The ParaHox cluster is however a simpler system to study because it is composed of only three genes. We provide a detailed analysis of the amphioxus ParaHox cluster and, for the first time in a single species, examine the regulation of the cluster in response to a single developmental signalling molecule, retinoic acid (RA). Embryos treated with either RA or RA antagonist display altered ParaHox gene expression: AmphiGsx expression shifts in the neural tube, and the endodermal boundary between AmphiXlox and AmphiCdx shifts its anterior/posterior position. We identified several putative retinoic acid response elements and in vitro assays suggest some may participate in RA regulation of the ParaHox genes. By comparison to vertebrate ParaHox gene regulation we explore the evolutionary implications. This work highlights how insights into the regulation and evolution of more complex vertebrate arrangements can be obtained through studies of a simpler, unduplicated amphioxus gene cluster.

Real-time monitoring of metabolic function in liver-on-chip microdevices tracks the dynamics of mitochondrial dysfunction

PubMed Central

Bavli, Danny; Prill, Sebastian; Ezra, Elishai; Levy, Gahl; Cohen, Merav; Vinken, Mathieu; Vanfleteren, Jan; Jaeger, Magnus; Nahmias, Yaakov

2016-01-01

Microfluidic organ-on-a-chip technology aims to replace animal toxicity testing, but thus far has demonstrated few advantages over traditional methods. Mitochondrial dysfunction plays a critical role in the development of chemical and pharmaceutical toxicity, as well as pluripotency and disease processes. However, current methods to evaluate mitochondrial activity still rely on end-point assays, resulting in limited kinetic and prognostic information. Here, we present a liver-on-chip device capable of maintaining human tissue for over a month in vitro under physiological conditions. Mitochondrial respiration was monitored in real time using two-frequency phase modulation of tissue-embedded phosphorescent microprobes. A computer-controlled microfluidic switchboard allowed contiguous electrochemical measurements of glucose and lactate, providing real-time analysis of minute shifts from oxidative phosphorylation to anaerobic glycolysis, an early indication of mitochondrial stress. We quantify the dynamics of cellular adaptation to mitochondrial damage and the resulting redistribution of ATP production during rotenone-induced mitochondrial dysfunction and troglitazone (Rezulin)-induced mitochondrial stress. We show troglitazone shifts metabolic fluxes at concentrations previously regarded as safe, suggesting a mechanism for its observed idiosyncratic effect. Our microfluidic platform reveals the dynamics and strategies of cellular adaptation to mitochondrial damage, a unique advantage of organ-on-chip technology. PMID:27044092

Periplasmic binding protein-based detection of maltose using liposomes: a new class of biorecognition elements in competitive assays.

PubMed

Edwards, Katie A; Baeumner, Antje J

2013-03-05

A periplasmic binding protein (PBP) was investigated as a novel binding species in a similar manner to an antibody in a competitive enzyme linked immunosorbent assay (ELISA), resulting in a highly sensitive and specific assay utilizing liposome-based signal amplification. PBPs are located at high concentrations (10(-4) M) between the inner and outer membranes of gram negative bacteria and are involved in the uptake of solutes and chemotaxis of bacteria toward nutrient sources. Previous sensors relying on PBPs took advantage of the change in local environment or proximity of site-specific fluorophore labels resulting from the significant conformational shift of these proteins' two globular domains upon target binding. Here, rather than monitoring conformational shifts, we have instead utilized the maltose binding protein (MBP) in lieu of an antibody in an ELISA. To our knowledge, this is the first PBP-based sensor without the requirement for engineering site-specific modifications within the protein. MBP conjugated fluorescent dye-encapsulating liposomes served to provide recognition and signal amplification in a competitive assay for maltose using amylose magnetic beads in a microtiter plate-based format. The development of appropriate binding buffers and competitive surfaces are described, with general observations expected to extend to PBPs for other analytes. The resulting assay was specific for d-(+)-maltose versus other sugar analogs including d-(+)-raffinose, sucrose, d-trehalose, d-(+)-xylose, d-fructose, 1-thio-β-d-glucose sodium salt, d-(+)-galactose, sorbitol, glycerol, and dextrose. Cross-reactivity with d-lactose and d-(+)-glucose occurred only at concentrations >10(4)-fold greater than d-(+)-maltose. The limit of detection was 78 nM with a dynamic range covering over 3 orders of magnitude. Accurate detection of maltose as an active ingredient in a pharmaceutical preparation was demonstrated. This method offers a significant improvement over existing enzymatic detection approaches that cannot discriminate between maltose and glucose and over existing fluorescence resonance energy transfer (FRET)-based detection methods that are sensitivity limited. In addition, it opens up a new strategy for the development of biosensors to difficult analytes refractory to immunological detection.

3,3'-Diindolylmethane inhibits VEGF expression through the HIF-1α and NF-κB pathways in human retinal pigment epithelial cells under chemical hypoxic conditions.

PubMed

Park, Hongzoo; Lee, Dae-Sung; Yim, Mi-Jin; Choi, Yung Hyun; Park, Saegwang; Seo, Su-Kil; Choi, Jung Sik; Jang, Won Hee; Yea, Sung Su; Park, Won Sun; Lee, Chang-Min; Jung, Won-Kyo; Choi, Il-Whan

2015-07-01

Oxidative stress in the retinal pigment epithelium (RPE) can lead to the pathological causes of age-related macular degeneration (AMD). Hypoxia induces oxidative damage in retinal pigment epithelial cells (RPE cells). In this study, we investigated the capacity of 3,3'-diindolylmethane (DIM) to reduce the expression of vascular endothelial growth factor (VEGF) under hypoxic conditions, as well as the molecular mechanisms involved. Human RPE cells (ARPE-19 cells) were treated with cobalt chloride (CoCl2, 200 µM) and/or DIM (10 and 20 µM). The production of VEGF was measured by enzyme-linked immunosorbent assay. The translocation of hypoxia-inducible factor-1α (HIF-1α) and nuclear factor-κB (NF-κB) was determined by western blot analysis. The binding activity of HIF-1α and NF-κB was analyzed by electrophoretic mobility shift assay. The phosphorylation levels of mitogen-activated protein kinases (MAPKs) were measured by western blot analysis. The levels of mitochondrial reactive oxygen species (ROS) were detected by fluorescence microplate assay. The results revealed that DIM significantly attenuated the CoCl2-induced expression of VEGF in the ARPE-19 cells. The CoCl2-induced translocation and activation of HIF-1α and NF-κB were also attenuated by treatment with DIM. In addition, DIM inhibited the CoCl2-induced activation of p38 MAPK in the ARPE-19 cells. Pre-treatment with YCG063, a mitochondrial ROS inhibitor, led to the downregulation of the CoCl2-induced production of VEGF by suppressing HIF-1α and NF-κB activity. Taken together, the findings of our study demonstrate that DIM inhibits the CoCl2-induced production of VEGF by suppressing mitochondrial ROS production, thus attenuating the activation of HIF-1α and p38 MAPK/NF-κB.

Hepatic nuclear factor 3 and nuclear factor 1 regulate 5-aminolevulinate synthase gene expression and are involved in insulin repression.

PubMed

Scassa, María E; Guberman, Alejandra S; Ceruti, Julieta M; Cánepa, Eduardo T

2004-07-02

Although the negative regulation of gene expression by insulin has been widely studied, the transcription factors responsible for the insulin effect are still unknown. The purpose of this work was to explore the molecular mechanisms involved in the insulin repression of the 5-aminolevulinate synthase (ALAS) gene. Deletion analysis of the 5'-regulatory region allowed us to identify an insulin-responsive region located at -459 to -354 bp. This fragment contains a highly homologous insulin-responsive (IRE) sequence. By transient transfection assays, we determined that hepatic nuclear factor 3 (HNF3) and nuclear factor 1 (NF1) are necessary for an appropriate expression of the ALAS gene. Insulin overrides the HNF3beta or HNF3beta plus NF1-mediated stimulation of ALAS transcriptional activity. Electrophoretic mobility shift assay and Southwestern blotting indicate that HNF3 binds to the ALAS promoter. Mutational analysis of this region revealed that IRE disruption abrogates insulin action, whereas mutation of the HNF3 element maintains hormone responsiveness. This dissociation between HNF3 binding and insulin action suggests that HNF3beta is not the sole physiologic mediator of insulin-induced transcriptional repression. Furthermore, Southwestern blotting assay shows that at least two polypeptides other than HNF3beta can bind to ALAS promoter and that this binding is dependent on the integrity of the IRE. We propose a model in which insulin exerts its negative effect through the disturbance of HNF3beta binding or transactivation potential, probably due to specific phosphorylation of this transcription factor by Akt. In this regard, results obtained from transfection experiments using kinase inhibitors support this hypothesis. Due to this event, NF1 would lose accessibility to the promoter. The posttranslational modification of HNF3 would allow the binding of a protein complex that recognizes the core IRE. These results provide a potential mechanism for the insulin-mediated repression of IRE-containing promoters.

A basic leucine zipper transcription factor, AabZIP1, connects abscisic acid signaling with artemisinin biosynthesis in Artemisia annua.

PubMed

Zhang, Fangyuan; Fu, Xueqing; Lv, Zongyou; Lu, Xu; Shen, Qian; Zhang, Ling; Zhu, Mengmeng; Wang, Guofeng; Sun, Xiaofen; Liao, Zhihua; Tang, Kexuan

2015-01-01

Artemisinin is a sesquiterpenoid especially synthesized in the Chinese herbal plant, Artemisia annua, which is widely used in the treatment of malaria. Artemisinin accumulation can be enhanced by exogenous abscisic acid (ABA) treatment. However, it is not known how ABA signaling regulates artemisinin biosynthesis. A global expression profile and phylogenetic analysis as well as the dual-LUC screening revealed that a basic leucine zipper family transcription factor from A. annua (namely AabZIP1) was involved in ABA signaling to regulate artemisinin biosynthesis. AabZIP1 had a higher expression level in the inflorescences than in other tissues; ABA treatment, drought, and salt stress strongly induced the expression of AabZIP1. Yeast one-hybrid assay and electrophoretic mobility shift assay (EMSA) showed that AabZIP1 bound to the ABA-responsive elements (ABRE) in the promoter regions of the amorpha-4,11-diene synthase (ADS) gene and CYP71AV1, which are two key structural genes of the artemisinin biosynthetic pathway. A mutagenesis assay showed that the C1 domain in the N-terminus of AabZIP1 was important for its transactivation activity. Furthermore, the activation of ADS and CYP71AV1 promoters by AabZIP1 was enhanced by ABA treatment in transient dual-LUC analysis. The AabZIP1 variant with C1 domain deletion lost the ability to activate ADS and CYP71AV1 promoters regardless of ABA treatment. Notably, overexpression of AabZIP1 in A. annua resulted in significantly increased accumulation of artemisinin. Our results indicate that ABA promotes artemisinin biosynthesis, likely through 1 activation of ADS and CYP71AV1 expression by AabZIP in A. annua. Meanwhile, our findings reveal the potential value of AabZIP1 in genetic engineering of artemisinin production. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

Functional Analysis of the Epidermal-Specific MYB Genes CAPRICE and WEREWOLF in Arabidopsis[W

PubMed Central

Tominaga, Rumi; Iwata, Mineko; Okada, Kiyotaka; Wada, Takuji

2007-01-01

Epidermis cell differentiation in Arabidopsis thaliana is a model system for understanding the developmental end state of plant cells. Two types of MYB transcription factors, R2R3-MYB and R3-MYB, are involved in cell fate determination. To examine the molecular basis of this process, we analyzed the functional relationship of the R2R3-type MYB gene WEREWOLF (WER) and the R3-type MYB gene CAPRICE (CPC). Chimeric constructs made from the R3 MYB regions of WER and CPC used in reciprocal complementation experiments showed that the CPC R3 region cannot functionally substitute for the WER R3 region in the differentiation of hairless cells. However, WER R3 can substantially substitute for CPC R3. There are no differences in yeast interaction assays of WER or WER chimera proteins with GLABRA3 (GL3) or ENHANCER OF GLABRA3 (EGL3). CPC and CPC chimera proteins also have similar activity in preventing GL3 WER and EGL3 WER interactions. Furthermore, we showed by gel mobility shift assays that WER chimera proteins do not bind to the GL2 promoter region. However, a CPC chimera protein, which harbors the WER R3 motif, still binds to the GL2 promoter region. PMID:17644729

Functional analysis of the epidermal-specific MYB genes CAPRICE and WEREWOLF in Arabidopsis.

PubMed

Tominaga, Rumi; Iwata, Mineko; Okada, Kiyotaka; Wada, Takuji

2007-07-01

Epidermis cell differentiation in Arabidopsis thaliana is a model system for understanding the developmental end state of plant cells. Two types of MYB transcription factors, R2R3-MYB and R3-MYB, are involved in cell fate determination. To examine the molecular basis of this process, we analyzed the functional relationship of the R2R3-type MYB gene WEREWOLF (WER) and the R3-type MYB gene CAPRICE (CPC). Chimeric constructs made from the R3 MYB regions of WER and CPC used in reciprocal complementation experiments showed that the CPC R3 region cannot functionally substitute for the WER R3 region in the differentiation of hairless cells. However, WER R3 can substantially substitute for CPC R3. There are no differences in yeast interaction assays of WER or WER chimera proteins with GLABRA3 (GL3) or ENHANCER OF GLABRA3 (EGL3). CPC and CPC chimera proteins also have similar activity in preventing GL3 WER and EGL3 WER interactions. Furthermore, we showed by gel mobility shift assays that WER chimera proteins do not bind to the GL2 promoter region. However, a CPC chimera protein, which harbors the WER R3 motif, still binds to the GL2 promoter region.

The Staphylococcus aureus AirSR Two-Component System Mediates Reactive Oxygen Species Resistance via Transcriptional Regulation of Staphyloxanthin Production.

PubMed

Hall, Jeffrey W; Yang, Junshu; Guo, Haiyong; Ji, Yinduo

2017-02-01

Staphylococcus aureus is an important opportunistic pathogen and is the etiological agent of many hospital- and community-acquired infections. The golden pigment, staphyloxanthin, of S. aureus colonies distinguishes it from other staphylococci and related Gram-positive cocci. Staphyloxanthin is the product of a series of biosynthetic steps that produce a unique membrane-embedded C 30 golden carotenoid and is an important antioxidant. We observed that a strain with an inducible airR overexpression cassette had noticeably increased staphyloxanthin production compared to the wild-type strain under aerobic culturing conditions. Further analysis revealed that depletion or overproduction of the AirR response regulator resulted in a corresponding decrease or increase in staphyloxanthin production and susceptibility to killing by hydrogen peroxide, respectively. Furthermore, the genetic elimination of staphyloxanthin during AirR overproduction abolished the protective phenotype of increased staphyloxanthin production in a whole-blood survival assay. Promoter reporter and gel shift assays determined that the AirR response regulator is a direct positive regulator of the staphyloxanthin-biosynthetic operon, crtOPQMN, but is epistatic to alternative sigma factor B. Taken together, these data indicate that AirSR positively regulates the staphyloxanthin-biosynthetic operon crtOPQMN, promoting survival of S. aureus in the presence of oxidants. Copyright © 2017 American Society for Microbiology.

Quantitative analysis of TALE-DNA interactions suggests polarity effects.

PubMed

Meckler, Joshua F; Bhakta, Mital S; Kim, Moon-Soo; Ovadia, Robert; Habrian, Chris H; Zykovich, Artem; Yu, Abigail; Lockwood, Sarah H; Morbitzer, Robert; Elsäesser, Janett; Lahaye, Thomas; Segal, David J; Baldwin, Enoch P

2013-04-01

Transcription activator-like effectors (TALEs) have revolutionized the field of genome engineering. We present here a systematic assessment of TALE DNA recognition, using quantitative electrophoretic mobility shift assays and reporter gene activation assays. Within TALE proteins, tandem 34-amino acid repeats recognize one base pair each and direct sequence-specific DNA binding through repeat variable di-residues (RVDs). We found that RVD choice can affect affinity by four orders of magnitude, with the relative RVD contribution in the order NG > HD ≈ NN > NI > NK. The NN repeat preferred the base G over A, whereas the NK repeat bound G with 10(3)-fold lower affinity. We compared AvrBs3, a naturally occurring TALE that recognizes its target using some atypical RVD-base combinations, with a designed TALE that precisely matches 'standard' RVDs with the target bases. This comparison revealed unexpected differences in sensitivity to substitutions of the invariant 5'-T. Another surprising observation was that base mismatches at the 5' end of the target site had more disruptive effects on affinity than those at the 3' end, particularly in designed TALEs. These results provide evidence that TALE-DNA recognition exhibits a hitherto un-described polarity effect, in which the N-terminal repeats contribute more to affinity than C-terminal ones.

Novel dual ligand co-functionalized fluorescent gold nanoclusters as a versatile probe for sensitive analysis of Hg(2+) and oxytetracycline.

PubMed

Xu, Shenghao; Li, Xiaolin; Mao, Yaning; Gao, Teng; Feng, Xiuying; Luo, Xiliang

2016-04-01

In this work, we present a direct one-step strategy for rapidly preparing dual ligand co-functionalized fluorescent Au nanoclusters (NCs) by using threonine (Thr) and 11-mercaptoundecanoic acid (MUA) as assorted reductants and capping agents in aqueous solution at room temperature. Fluorescence spectra, high-resolution transmission electron microscopy (HRTEM), X-ray photoelectron spectroscopy (XPS), dynamic light scattering (DLS), and infrared (IR) spectroscopy were performed to demonstrate the optical properties and chemical composition of the as-prepared AuNCs. They possess many attractive features such as near-infrared emission (λem = 606 nm), a large Stoke's shift (>300 nm), high colloidal stability (pH, temperature, salt, and time stability), and water dispersibility. Subsequently, the as-prepared AuNCs were used as a versatile probe for "turn off" sensing of Hg(2+) based on aggregation-induced fluorescence quenching and for "turn-on" sensing of oxytetracycline (OTC). This assay provided good linearity ranging from 37.5 to 3750 nM for Hg(2+) and from 0.375 to 12.5 μM for OTC, with detection limits of 8.6 nM and 0.15 μM, respectively. Moreover, the practical application of this assay was further validated by detecting OTC in human serum samples.

Molecular mechanism for sphingosine-induced Pseudomonas ceramidase expression through the transcriptional regulator SphR

PubMed Central

Okino, Nozomu; Ito, Makoto

2016-01-01

Pseudomonas aeruginosa, an opportunistic, but serious multidrug-resistant pathogen, secretes a ceramidase capable of cleaving the N-acyl linkage of ceramide to generate fatty acids and sphingosine. We previously reported that the secretion of P. aeruginosa ceramidase was induced by host-derived sphingolipids, through which phospholipase C-induced hemolysis was significantly enhanced. We herein investigated the gene(s) regulating sphingolipid-induced ceramidase expression and identified SphR, which encodes a putative AraC family transcriptional regulator. Disruption of the sphR gene in P. aeruginosa markedly decreased the sphingomyelin-induced secretion of ceramidase, reduced hemolytic activity, and resulted in the loss of sphingomyelin-induced ceramidase expression. A microarray analysis confirmed that sphingomyelin significantly induced ceramidase expression in P. aeruginosa. Furthermore, an electrophoretic mobility shift assay revealed that SphR specifically bound free sphingoid bases such as sphingosine, dihydrosphingosine, and phytosphingosine, but not sphingomyelin or ceramide. A β-galactosidase-assisted promoter assay showed that sphingosine activated ceramidase expression through SphR at a concentration of 100 nM. Collectively, these results demonstrated that sphingosine induces the secretion of ceramidase by promoting the mRNA expression of ceramidase through SphR, thereby enhancing hemolytic phospholipase C-induced cytotoxicity. These results facilitate understanding of the physiological role of bacterial ceramidase in host cells. PMID:27941831

Photon upconversion in homogeneous fluorescence-based bioanalytical assays.

PubMed

Soukka, Tero; Rantanen, Terhi; Kuningas, Katri

2008-01-01

Upconverting phosphors (UCPs) are very attractive reporters for fluorescence resonance energy transfer (FRET)-based bioanalytical assays. The large anti-Stokes shift and capability to convert near-infrared to visible light via sequential absorption of multiple photons enable complete elimination of autofluorescence, which commonly impairs the performance of fluorescence-based assays. UCPs are ideal donors for FRET, because their very narrow-banded emission allows measurement of the sensitized acceptor emission, in principle, without any crosstalk from the donor emission at a wavelength just tens of nanometers from the emission peak of the donor. In addition, acceptor dyes emitting at visible wavelengths are essentially not excited by near-infrared, which further emphasizes the unique potential of upconversion FRET (UC-FRET). These characteristics result in favorable assay performance using detection instrumentation based on epifluorometer configuration and laser diode excitation. Although UC-FRET is a recently emerged technology, it has already been applied in both immunoassays and nucleic acid hybridization assays. The technology is also compatible with optically difficult biological samples, such as whole blood. Significant advances in assay performance are expected using upconverting lanthanide-doped nanocrystals, which are currently under extensive research. UC-FRET, similarly to other fluorescence techniques based on resonance energy transfer, is strongly distance dependent and may have limited applicability, for example in sandwich-type assays for large biomolecules, such as viruses. In this article, we summarize the essentials of UC-FRET, describe its current applications, and outline the expectations for its future potential.

Lose-Shift Responding in Humans Is Promoted by Increased Cognitive Load

PubMed Central

Ivan, Victorita E.; Banks, Parker J.; Goodfellow, Kris; Gruber, Aaron J.

2018-01-01

The propensity of animals to shift choices immediately after unexpectedly poor reinforcement outcomes is a pervasive strategy across species and tasks. We report here on the memory supporting such lose-shift responding in humans, assessed using a binary choice task in which random responding is the optimal strategy. Participants exhibited little lose-shift responding when fully attending to the task, but this increased by 30%–40% in participants that performed with additional cognitive load that is known to tax executive systems. Lose-shift responding in the cognitively loaded adults persisted throughout the testing session, despite being a sub-optimal strategy, but was less likely as the time increased between reinforcement and the subsequent choice. Furthermore, children (5–9 years old) without load performed similarly to the cognitively loaded adults. This effect disappeared in older children aged 11–13 years old. These data provide evidence supporting our hypothesis that lose-shift responding is a default and reflexive strategy in the mammalian brain, likely mediated by a decaying memory trace, and is normally suppressed by executive systems. Reducing the efficacy of executive control by cognitive load (adults) or underdevelopment (children) increases its prevalence. It may therefore be an important component to consider when interpreting choice data, and may serve as an objective behavioral assay of executive function in humans that is easy to measure. PMID:29568264

Direct detection of hyaluronidase in urine using cationic gold nanoparticles: a potential diagnostic test for bladder cancer.

PubMed

Nossier, Ahmed Ibrahim; Eissa, Sanaa; Ismail, Manal Fouad; Hamdy, Mohamed Ahmed; Azzazy, Hassan Mohamed El-Said

2014-04-15

Hyaluronidase (HAase) was reported as a urinary marker of bladder cancer. In this study, a simple colorimetric gold nanoparticle (AuNP) assay was developed for rapid and sensitive detection of urinary HAase activity. Charge interaction between polyanionic hyaluronic acid (HA) and cationic AuNPs stabilized with cetyl trimethyl ammonium bromide (CTAB) led to formation of gold aggregates and a red to blue color shift. HAase digests HA into small fragments preventing the aggregation of cationic AuNPs. The nonspecific aggregation of AuNPs in urine samples was overcome by pre-treatment of samples with the polycationic chitosan that was able to agglomerate all negatively charged interfering moieties before performing the assay. The developed AuNP assay was compared with zymography for qualitative detection of urinary HAase activity in 40 bladder carcinoma patients, 11 benign bladder lesions patients and 15 normal individuals, the assay sensitivity was 82.5% vs. 65% for zymography, while the specificity for both assays was 96.1%. The absorption ratio, A530/A620 of the reacted AuNP solution was used to quantify the HAase activity. The best cut off value was 93.5 μU/ng protein, at which the sensitivity was 90% and the specificity was 80.8%.The developed colorimetric AuNP HAase assay is simple, inexpensive, and can aid noninvasive diagnosis of bladder cancer. © 2013 Elsevier B.V. All rights reserved.

Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lake, April D.; Novak, Petr; Shipkova, Petia

2013-04-15

Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids are observed in NASH. ► Hepatic bile acid synthesis shifts toward the alternative pathway in NASH.« less

Epistatic interactions influence terrestrial–marine functional shifts in cetacean rhodopsin

PubMed Central

2017-01-01

Like many aquatic vertebrates, whales have blue-shifting spectral tuning substitutions in the dim-light visual pigment, rhodopsin, that are thought to increase photosensitivity in underwater environments. We have discovered that known spectral tuning substitutions also have surprising epistatic effects on another function of rhodopsin, the kinetic rates associated with light-activated intermediates. By using absorbance spectroscopy and fluorescence-based retinal release assays on heterologously expressed rhodopsin, we assessed both spectral and kinetic differences between cetaceans (killer whale) and terrestrial outgroups (hippo, bovine). Mutation experiments revealed that killer whale rhodopsin is unusually resilient to pleiotropic effects on retinal release from key blue-shifting substitutions (D83N and A292S), largely due to a surprisingly specific epistatic interaction between D83N and the background residue, S299. Ancestral sequence reconstruction indicated that S299 is an ancestral residue that predates the evolution of blue-shifting substitutions at the origins of Cetacea. Based on these results, we hypothesize that intramolecular epistasis helped to conserve rhodopsin's kinetic properties while enabling blue-shifting spectral tuning substitutions as cetaceans adapted to aquatic environments. Trade-offs between different aspects of molecular function are rarely considered in protein evolution, but in cetacean and other vertebrate rhodopsins, may underlie multiple evolutionary scenarios for the selection of specific amino acid substitutions. PMID:28250185

Inflammatory bowel diseases phenotype, C. difficile and NOD2 genotype are associated with shifts in human ileum associated microbial composition.

PubMed

Li, Ellen; Hamm, Christina M; Gulati, Ajay S; Sartor, R Balfour; Chen, Hongyan; Wu, Xiao; Zhang, Tianyi; Rohlf, F James; Zhu, Wei; Gu, Chi; Robertson, Charles E; Pace, Norman R; Boedeker, Edgar C; Harpaz, Noam; Yuan, Jeffrey; Weinstock, George M; Sodergren, Erica; Frank, Daniel N

2012-01-01

We tested the hypothesis that Crohn's disease (CD)-related genetic polymorphisms involved in host innate immunity are associated with shifts in human ileum-associated microbial composition in a cross-sectional analysis of human ileal samples. Sanger sequencing of the bacterial 16S ribosomal RNA (rRNA) gene and 454 sequencing of 16S rRNA gene hypervariable regions (V1-V3 and V3-V5), were conducted on macroscopically disease-unaffected ileal biopsies collected from 52 ileal CD, 58 ulcerative colitis and 60 control patients without inflammatory bowel diseases (IBD) undergoing initial surgical resection. These subjects also were genotyped for the three major NOD2 risk alleles (Leu1007fs, R708W, G908R) and the ATG16L1 risk allele (T300A). The samples were linked to clinical metadata, including body mass index, smoking status and Clostridia difficile infection. The sequences were classified into seven phyla/subphyla categories using the Naïve Bayesian Classifier of the Ribosome Database Project. Centered log ratio transformation of six predominant categories was included as the dependent variable in the permutation based MANCOVA for the overall composition with stepwise variable selection. Polymerase chain reaction (PCR) assays were conducted to measure the relative frequencies of the Clostridium coccoides - Eubacterium rectales group and the Faecalibacterium prausnitzii spp. Empiric logit transformations of the relative frequencies of these two microbial groups were included in permutation-based ANCOVA. Regardless of sequencing method, IBD phenotype, Clostridia difficile and NOD2 genotype were selected as associated (FDR ≤ 0.05) with shifts in overall microbial composition. IBD phenotype and NOD2 genotype were also selected as associated with shifts in the relative frequency of the C. coccoides--E. rectales group. IBD phenotype, smoking and IBD medications were selected as associated with shifts in the relative frequency of F. prausnitzii spp. These results indicate that the effects of genetic and environmental factors on IBD are mediated at least in part by the enteric microbiota.

Inflammatory Bowel Diseases Phenotype, C. difficile and NOD2 Genotype Are Associated with Shifts in Human Ileum Associated Microbial Composition

PubMed Central

Li, Ellen; Hamm, Christina M.; Gulati, Ajay S.; Sartor, R. Balfour; Chen, Hongyan; Wu, Xiao; Zhang, Tianyi; Rohlf, F. James; Zhu, Wei; Gu, Chi; Robertson, Charles E.; Pace, Norman R.; Boedeker, Edgar C.; Harpaz, Noam; Yuan, Jeffrey; Weinstock, George M.; Sodergren, Erica; Frank, Daniel N.

2012-01-01

We tested the hypothesis that Crohn’s disease (CD)-related genetic polymorphisms involved in host innate immunity are associated with shifts in human ileum–associated microbial composition in a cross-sectional analysis of human ileal samples. Sanger sequencing of the bacterial 16S ribosomal RNA (rRNA) gene and 454 sequencing of 16S rRNA gene hypervariable regions (V1–V3 and V3–V5), were conducted on macroscopically disease-unaffected ileal biopsies collected from 52 ileal CD, 58 ulcerative colitis and 60 control patients without inflammatory bowel diseases (IBD) undergoing initial surgical resection. These subjects also were genotyped for the three major NOD2 risk alleles (Leu1007fs, R708W, G908R) and the ATG16L1 risk allele (T300A). The samples were linked to clinical metadata, including body mass index, smoking status and Clostridia difficile infection. The sequences were classified into seven phyla/subphyla categories using the Naïve Bayesian Classifier of the Ribosome Database Project. Centered log ratio transformation of six predominant categories was included as the dependent variable in the permutation based MANCOVA for the overall composition with stepwise variable selection. Polymerase chain reaction (PCR) assays were conducted to measure the relative frequencies of the Clostridium coccoides – Eubacterium rectales group and the Faecalibacterium prausnitzii spp. Empiric logit transformations of the relative frequencies of these two microbial groups were included in permutation-based ANCOVA. Regardless of sequencing method, IBD phenotype, Clostridia difficile and NOD2 genotype were selected as associated (FDR ≤0.05) with shifts in overall microbial composition. IBD phenotype and NOD2 genotype were also selected as associated with shifts in the relative frequency of the C. coccoides – E. rectales group. IBD phenotype, smoking and IBD medications were selected as associated with shifts in the relative frequency of F. prausnitzii spp. These results indicate that the effects of genetic and environmental factors on IBD are mediated at least in part by the enteric microbiota. PMID:22719818

Endotoxin exposure and changes in short-term pulmonary function among sewage workers.

PubMed

Cyprowski, Marcin; Sobala, Wojciech; Buczyńska, Alina; Szadkowska-Stańczyk, Irena

2015-01-01

The inhaled endotoxin is considered as a causative factor in the process of acute bronchial obstruction, which can be measured by a decrease in forced expiratory volume in 1 s (FEV1). The aim of this study was to assess endotoxin exposure among sewage treatment plant workers (STPW) and its effect on across-shift changes in respiratory airflow. A group of 78 STPW from a large sewage treatment plant was studied. Inhalable dust for endotoxin assessment was collected using personal aerosol samplers. Endotoxin was assayed with the kinetic, chromogenic Limulus amebocyte lysate test. Across-shift spirometric measurements were performed on Mondays, after 2-days absence from work, with the use of portable spirometer. The forced vital capacity (FVC), and FEV1 parameters were analyzed. Multifactor regression modeling was performed to determine parameters significantly associated with endotoxin exposure. The concentration of inhalable dust and endotoxin ranged from 0.01-1.38 mg/m3 and 0.68-214 endotoxin units per cubic meter of air (EU/m3), respectively. Endotoxins were characterized with the skewed distribution (arithmetic mean (AM) = 38.8 EU/m3, geometric mean (GM) = 15.4 EU/m3, geometric standard deviation (GSD) = 4.21). Through the use of multifactor analysis, which excluded the main confounders (inhalable dust and smoking habit) it was found that, despite low levels of endotoxin, it had significant impact on the observed across-shift decline in FEV1 (p = 0.044). For this parameter, the regression slope was additionally calculated (r = -0.017, p = 0.071). Relatively low levels of endotoxin among sewage treatment plant workers may cause small, but significant across-shift declines in FEV1. The observed relationship was independent of organic dust concentrations and smoking habit. The respiratory protection should be provided for STPW. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

Emergence of Competitive Dominant Ammonia-Oxidizing Bacterial Populations in a Full-Scale Industrial Wastewater Treatment Plant

PubMed Central

Layton, Alice C.; Dionisi, Hebe; Kuo, H.-W.; Robinson, Kevin G.; Garrett, Victoria M.; Meyers, Arthur; Sayler, Gary S.

2005-01-01

Ammonia-oxidizing bacterial populations in an industrial wastewater treatment plant were investigated with amoA and 16S rRNA gene real-time PCR assays. Nitrosomonas nitrosa initially dominated, but over time RI-27-type ammonia oxidizers, also within the Nitrosomonas communis lineage, increased from below detection to codominance. This shift occurred even though nitrification remained constant. PMID:15691975

Influence of shifting cultivation practices on soil-plant-beetle interactions.

PubMed

Ibrahim, Kalibulla Syed; Momin, Marcy D; Lalrotluanga, R; Rosangliana, David; Ghatak, Souvik; Zothansanga, R; Kumar, Nachimuthu Senthil; Gurusubramanian, Guruswami

2016-08-01

Shifting cultivation (jhum) is a major land use practice in Mizoram. It was considered as an eco-friendly and efficient method when the cycle duration was long (15-30 years), but it poses the problem of land degradation and threat to ecology when shortened (4-5 years) due to increased intensification of farming systems. Studying beetle community structure is very helpful in understanding how shifting cultivation affects the biodiversity features compared to natural forest system. The present study examines the beetle species diversity and estimates the effects of shifting cultivation practices on the beetle assemblages in relation to change in tree species composition and soil nutrients. Scarabaeidae and Carabidae were observed to be the dominant families in the land use systems studied. Shifting cultivation practice significantly (P < 0.05) affected the beetle and tree species diversity as well as the soil nutrients as shown by univariate (one-way analysis of variance (ANOVA), correlation and regression, diversity indices) and multivariate (cluster analysis, principal component analysis (PCA), detrended correspondence analysis (DCA), canonical variate analysis (CVA), permutational multivariate analysis of variance (PERMANOVA), permutational multivariate analysis of dispersion (PERMDISP)) statistical analyses. Besides changing the tree species composition and affecting the soil fertility, shifting cultivation provides less suitable habitat conditions for the beetle species. Bioindicator analysis categorized the beetle species into forest specialists, anthropogenic specialists (shifting cultivation habitat specialist), and habitat generalists. Molecular analysis of bioindicator beetle species was done using mitochondrial cytochrome oxidase subunit I (COI) marker to validate the beetle species and describe genetic variation among them in relation to heterogeneity, transition/transversion bias, codon usage bias, evolutionary distance, and substitution pattern. The present study revealed the fact that shifting cultivation practice significantly affects the beetle species in terms of biodiversity pattern as well as evolutionary features. Spatiotemporal assessment of soil-plant-beetle interactions in shifting cultivation system and their influence in land degradation and ecology will be helpful in making biodiversity conservation decisions in the near future.

Altering the orientation of a fused protein to the RNA-binding ribosomal protein L7Ae and its derivatives through circular permutation.

PubMed

Ohuchi, Shoji J; Sagawa, Fumihiko; Sakamoto, Taiichi; Inoue, Tan

2015-10-23

RNA-protein complexes (RNPs) are useful for constructing functional nano-objects because a variety of functional proteins can be displayed on a designed RNA scaffold. Here, we report circular permutations of an RNA-binding protein L7Ae based on the three-dimensional structure information to alter the orientation of the displayed proteins on the RNA scaffold. An electrophoretic mobility shift assay and atomic force microscopy (AFM) analysis revealed that most of the designed circular permutants formed an RNP nano-object. Moreover, the alteration of the enhanced green fluorescent protein (EGFP) orientation was confirmed with AFM by employing EGFP on the L7Ae permutant on the RNA. The results demonstrate that targeted fine-tuning of the stereo-specific fixation of a protein on a protein-binding RNA is feasible by using the circular permutation technique. Copyright © 2015 Elsevier Inc. All rights reserved.

FlyRNAi.org—the database of the Drosophila RNAi screening center and transgenic RNAi project: 2017 update

PubMed Central

Hu, Yanhui; Comjean, Aram; Roesel, Charles; Vinayagam, Arunachalam; Flockhart, Ian; Zirin, Jonathan; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2017-01-01

The FlyRNAi database of the Drosophila RNAi Screening Center (DRSC) and Transgenic RNAi Project (TRiP) at Harvard Medical School and associated DRSC/TRiP Functional Genomics Resources website (http://fgr.hms.harvard.edu) serve as a reagent production tracking system, screen data repository, and portal to the community. Through this portal, we make available protocols, online tools, and other resources useful to researchers at all stages of high-throughput functional genomics screening, from assay design and reagent identification to data analysis and interpretation. In this update, we describe recent changes and additions to our website, database and suite of online tools. Recent changes reflect a shift in our focus from a single technology (RNAi) and model species (Drosophila) to the application of additional technologies (e.g. CRISPR) and support of integrated, cross-species approaches to uncovering gene function using functional genomics and other approaches. PMID:27924039

Altering the orientation of a fused protein to the RNA-binding ribosomal protein L7Ae and its derivatives through circular permutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohuchi, Shoji J.; Sagawa, Fumihiko; Sakamoto, Taiichi

RNA-protein complexes (RNPs) are useful for constructing functional nano-objects because a variety of functional proteins can be displayed on a designed RNA scaffold. Here, we report circular permutations of an RNA-binding protein L7Ae based on the three-dimensional structure information to alter the orientation of the displayed proteins on the RNA scaffold. An electrophoretic mobility shift assay and atomic force microscopy (AFM) analysis revealed that most of the designed circular permutants formed an RNP nano-object. Moreover, the alteration of the enhanced green fluorescent protein (EGFP) orientation was confirmed with AFM by employing EGFP on the L7Ae permutant on the RNA. Themore » results demonstrate that targeted fine-tuning of the stereo-specific fixation of a protein on a protein-binding RNA is feasible by using the circular permutation technique.« less

Sedative Effect of Sophora flavescens and Matrine

PubMed Central

Lee, Hyun-ju; Lee, Sun-young; Jang, Daehyuk; Chung, Sun-Yong; Shim, Insop

2017-01-01

The present study investigated the sedative effects of Sophora flavescens (SF) and its bioactive compound, matrine through performing locomotor activity test and the electroencephalography (EEG) analysis in the rat. The underlying neural mechanism of their beneficial effects was determined by assessing c-Fos immunoreactivity and serotonin (5-HT) in the brain utilizing immunohistochemical method and enzyme-linked immunosorbent assay. The results showed that SF and matrine administration had an effect on normalization of caffeine-induced hyperactivity and promoting a shift toward non-rapid eye movement (NREM) sleep. c-Fos-immunoreactivity and 5-HT level in the ventrolateral preoptic nucleus (VLPO), a sleep promoting region, were increased in the both SF and matrine-injected groups. In conclusion, SF and its bioactive compound, matrine alleviated caffeine-induced hyperactivity and promoted NREM sleep by activating VLPO neurons and modulating serotonergic transmission. It is suggested that SF might be a useful natural alternatives for hypnotic medicine. PMID:28190318

Sedative Effect of Sophora flavescens and Matrine.

PubMed

Lee, Hyun-Ju; Lee, Sun-Young; Jang, Daehyuk; Chung, Sun-Yong; Shim, Insop

2017-07-01

The present study investigated the sedative effects of Sophora flavescens (SF) and its bioactive compound, matrine through performing locomotor activity test and the electroencephalography (EEG) analysis in the rat. The underlying neural mechanism of their beneficial effects was determined by assessing c-Fos immunoreactivity and serotonin (5-HT) in the brain utilizing immunohistochemical method and enzyme-linked immunosorbent assay. The results showed that SF and matrine administration had an effect on normalization of caffeine-induced hyperactivity and promoting a shift toward non-rapid eye movement (NREM) sleep. c-Fos-immunoreactivity and 5-HT level in the ventrolateral preoptic nucleus (VLPO), a sleep promoting region, were increased in the both SF and matrine-injected groups. In conclusion, SF and its bioactive compound, matrine alleviated caffeine-induced hyperactivity and promoted NREM sleep by activating VLPO neurons and modulating serotonergic transmission. It is suggested that SF might be a useful natural alternatives for hypnotic medicine.

Identification of a novel prophage-like gene cluster actively expressed in both virulent and avirulent strains of Leptospira interrogans serovar Lai.

PubMed

Qin, Jin-Hong; Zhang, Qing; Zhang, Zhi-Ming; Zhong, Yi; Yang, Yang; Hu, Bao-Yu; Zhao, Guo-Ping; Guo, Xiao-Kui

2008-06-01

DNA microarray analysis was used to compare the differential gene expression profiles between Leptospira interrogans serovar Lai type strain 56601 and its corresponding attenuated strain IPAV. A 22-kb genomic island covering a cluster of 34 genes (i.e., genes LA0186 to LA0219) was actively expressed in both strains but concomitantly upregulated in strain 56601 in contrast to that of IPAV. Reverse transcription-PCR assays proved that the gene cluster comprised five transcripts. Gene annotation of this cluster revealed characteristics of a putative prophage-like remnant with at least 8 of 34 sequences encoding prophage-like proteins, of which the LA0195 protein is probably a putative prophage CI-like regulator. The transcription initiation activities of putative promoter-regulatory sequences of transcripts I, II, and III, all proximal to the LA0195 gene, were further analyzed in the Escherichia coli promoter probe vector pKK232-8 by assaying the reporter chloramphenicol acetyltransferase (CAT) activities. The strong promoter activities of both transcripts I and II indicated by the E. coli CAT assay were well correlated with the in vitro sequence-specific binding of the recombinant LA0195 protein to the corresponding promoter probes detected by the electrophoresis mobility shift assay. On the other hand, the promoter activity of transcript III was very low in E. coli and failed to show active binding to the LA0195 protein in vitro. These results suggested that the LA0195 protein is likely involved in the transcription of transcripts I and II. However, the identical complete DNA sequences of this prophage remnant from these two strains strongly suggests that possible regulatory factors or signal transduction systems residing outside of this region within the genome may be responsible for the differential expression profiling in these two strains.

Monitoring of DNA breakage in embryonic stages of the African catfish Clarias gariepinus (Burchell, 1822) after exposure to lead nitrate using alkaline comet assay.

PubMed

Osman, Alaa G M; Mekkawy, Imam A; Verreth, Johan; Wuertz, Sven; Kloas, Werner; Kirschbaum, Frank

2008-12-01

Increasing lead contamination in Egyptian ecosystems and high lead concentrations in food items have raised concern for human health and stimulated studies on monitoring ecotoxicological impact of lead-caused genotoxicity. In this work, the alkaline comet assay was modified for monitoring DNA strand breakage in sensitive early life stages of the African catfish Clarias gariepinus. Following exposure to 100, 300, and 500 microg/L lead nitrate, DNA strand breakage was quantified in embryos at 30, 48, 96, 144, and 168 h post-fertilization (PFS). For quantitative analysis, four commonly used parameters (tail % DNA, %TDNA; head % DNA, %HDNA; tail length, TL; tail moment, TM) were analyzed in 96 nuclei (in triplicates) at each sampling point. The parameter %TDNA revealed highest resolution and lowest variation. A strong correlation between lead concentration, time of exposure, and DNA strand breakage was observed. Here, genotoxicity detected by comet assay preceded the manifested malformations assessed with conventional histology. Qualitative evaluation was carried out using five categories are as follows: undamaged (%TDNA < or = 10%), low damaged (10% < %TDNA < or = 25%), median damaged (25 < %TDNA < or = 50%), highly damaged (50 < %TDNA < or = 75%), and extremely damaged (%TDNA > 75%) nuclei confirming a dose and time-dependent shift towards increased frequencies of highly and extremely damaged nuclei. A protective capacity provided by a hardened chorion is a an interesting finding in this study as DNA damage in the prehatching stages 30 h-PFS and 48 h-PFS was low in all treatments (qualitative and quantitative analyses). These results clearly show that the comet assay is a sensitive tool for the detection of genotoxicity in vulnerable early life stages of the African catfish and is a method more sensitive than histological parameters for monitoring genotoxic effects. 2008 Wiley Periodicals, Inc.

Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

PubMed

Wang, F; Samudio, I; Safe, S

2001-01-01

The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

Bezafibrate induces a mitochondrial derangement in human cell lines: a PPAR-independent mechanism for a peroxisome proliferator.

PubMed

Scatena, R; Bottoni, P; Vincenzoni, F; Messana, I; Martorana, G E; Nocca, G; De Sole, P; Maggiano, N; Castagnola, M; Giardina, B

2003-11-01

Bezafibrate is a hypolipidemic drug that belongs to the group of peroxisome proliferators because it binds to peroxisome proliferator-activated receptors type alpha (PPARs). Peroxisome proliferators produce a myriad of extraperoxisomal effects, which are not necessarily dependent on their interaction with PPARs. An investigation on the peculiar activities of bezafibrate could clarify some of the molecular events and the relationship with the biochemical and pharmacological properties of this class of compounds. In this view, the human acute promyelocytic leukemia HL-60 cell line and human rabdomiosarcoma TE-671 cell line were cultured in media containing bezafibrate and a number of observations such as spectrophotometric analysis of mitochondrial respiratory chain enzymes, NMR metabolite determinations, phosphofructokinase enzymatic analysis, and differentiation assays were carried on. Bezafibrate induced a derangement of NADH cytochrome c reductase activity accompanied by metabolic alterations, mainly a shift to anaerobic glycolysis and an increase of fatty acid oxidation, as shown by NMR analysis of culture supernatants where acetate, lactate, and alanine levels increased. On the whole, the present results suggest a biochemical profile and a therapeutic role of this class of PPARs ligands more complex than those previously proposed.

Hypothermia-induced increase of oligodendrocyte precursor cells: Possible involvement of plasmalemmal voltage-dependent anion channel 1.

PubMed

Imada, Shinya; Yamamoto, Masahiro; Tanaka, Kayoko; Seiwa, Chika; Watanabe, Kenji; Kamei, Yoshimasa; Kozuma, Shiro; Taketani, Yuji; Asou, Hiroaki

2010-12-01

Hypothermia is believed to suppress cell proliferation by inducing apoptosis/necrosis and phase-specific/nonspecific cell cycle arrest, which are, directly or indirectly, related to a reduced energy supply. Intriguingly, hypothermia is known to improve neurological recovery of animals and humans exposed to focal brain hypoxic-ischemic injury. The underlying mechanism of the neuroprotective effect of hypothermia is unclear, although the prevention of neural cell apoptosis is thought to play a role. Herein we demonstrate that in vitro cell culture of oligodendrocyte precursor cells (OPCs) under conditions of mild hypothermia (31.5°C) results in an increase in cell number relative to cells cultured under normothermic conditions (37°C). Cell cycle analysis, immunoblotting of cyclins, TUNEL assay, and immunocytochemistry of OPC differentiation markers suggest that hypothermia shifts the balance between proliferation and apoptosis/differentiation toward proliferation. A combination of transcriptome analysis, pharmacological intervention, and immunoaffinity-based assays suggests a possible involvement of the Gα13-Rho GTPase Cdc42-ERK1/2 signaling cascade and voltage-dependent anion channel 1 (VDAC1), which associate or dissociate with Gα13 protein at 37°C and 31.5°C, respectively. Immunoelectron microscopy revealed the presence of VDAC1 in the plasma membrane of OPCs. Furthermore, the exogenous addition of impermeable VDAC1 inhibitors enhanced proliferation of OPCs at 37°C. These results may contribute to the elucidation of the mechanism of hypothermic neuroprotection as well as the possible novel role of plasmalemmal VDAC1. Copyright © 2010 Wiley-Liss, Inc.

Colorimetric detection for paper-based biosensing applications

NASA Astrophysics Data System (ADS)

Brink, C.; Joubert, T.-H.

2016-02-01

Research on affordable point-of-care health diagnostics is rapidly advancing1. Colorimetric biosensor applications are typically qualitative, but recently the focus has been shifted to quantitative measurements2,3. Although numerous qualitative point-of-care (POC) health diagnostic devices are available, the challenge exists of developing a quantitative colorimetric array reader system that complies with the ASSURED (Affordable, Sensitive, Specific, User-friendly, Rapid and Robust, Equipment-free, Deliverable to end-users) principles of the World Health Organization4. This paper presents a battery powered 8-bit tonal resolution colorimetric sensor circuit for paper microfluidic assays using low cost photo-detection circuitry and a low-power LED light source. A colorimetric 3×3-pixel array reader was developed for rural environments where resources and personnel are limited. The device sports an ultralow-power E-ink paper display. The colorimetric device includes integrated GPS functionality and EEPROM memory to log measurements with geo-tags for possible analysis of regional trends. The device competes with colour intensity measurement techniques using smartphone cameras, but proves to be a cheaper solution, compensating for the typical performance variations between cameras of different brands of smartphones. Inexpensive methods for quantifying bacterial assays have been shown using desktop scanners, which are not portable, and cameras, which suffer severely from changes in ambient light in different environments. Promising colorimetric detection results have been demonstrated using devices such as video cameras5, digital colour analysers6, flatbed scanners7 or custom portable readers8. The major drawback of most of these methods is the need for specialized instrumentation and for image analysis on a computer.

Cytotoxic effect of disulfiram/copper on human glioblastoma cell lines and ALDH-positive cancer-stem-like cells

PubMed Central

Liu, P; Brown, S; Goktug, T; Channathodiyil, P; Kannappan, V; Hugnot, J-P; Guichet, P-O; Bian, X; Armesilla, A L; Darling, J L; Wang, W

2012-01-01

Background: Glioblastoma multiforme (GBM) cells are resistant to anticancer drugs. Cancer stem cells (CSCs) are a key mediator of chemoresistance. We have reported that disulfiram (DS), an aldehyde dehydrogenase (ALDH) inhibitor, targets breast CSC-like cells. In this study, the effect of DS and combination of DS and gemcitabine (dFdC) on GBM cells and GBM stem-like cells was investigated. Methods: 1-(4,5-Dimethylthiazol-2-yl)-3,5-diphenylformazan (MTT), combination index (CI)-isobologram, western blot, luciferase reporter gene assay, electrophoretic mobility-shift assay and ALDH analysis were used in this study. Results: Disulfiram is cytotoxic in GBM cell lines in a copper (Cu)-dependent manner. Disulfiram/copper enhances the cytotoxicity of dFdC. Combination index-isobologram analysis indicates a synergistic effect between DS/Cu and dFdC. Disulfiram/copper induces reactive oxygen species (ROS), activates JNK and p38 pathways and inhibits nuclear factor-kappa B activity in GBM cell lines. Disulfiram/copper may trigger intrinsic apoptotic pathway via modulation of the Bcl2 family. Disulfiram/copper abolishes stem-like cell population in GBM cell lines. Conclusion: Our findings indicate that the cytotoxicity of DS/Cu and the enhancing effect of DS/Cu on the cytotoxicity of dFdC in GBM stem-like cells may be caused by induction of ROS and inhibition of both ALDH and the NFkB pathway. Both DS and dFdC can traverse the blood–brain barrier. Further study may lead them into GBM chemotherapy. PMID:23033007

Hyper-expression of PAX2 in human metastatic prostate tumors and its role as a cancer promoter in an in vitro invasion model.

PubMed

Ueda, Takashi; Ito, Saya; Shiraishi, Takumi; Kulkarni, Prakash; Ueno, Akihisa; Nakagawa, Hideo; Kimura, Yasunori; Hongo, Fumiya; Kamoi, Kazumi; Kawauchi, Akihiro; Miki, Tsuneharu

2013-09-01

Metastasis is a consequence of many biological events, during which cancer stem cells are shifted into a malignant state. Among these events, invasion of prostate cancer cells into host tissues is possible to be assessed by means of an in vitro invasion model, and is thought to be coupled to altered expression of membrane proteins. Dysregulated functions of the factors regulating organogenesis during embryogenesis are known to facilitate metastasis of many types of cancers. PAX2 (paired box 2) is a member of the PAX transcription factor family, which regulates prostatic ductal growth and branching in organogenesis of mammalian prostates. However, the role of PAX2 in prostate cancer development remains to be determined. PAX2 expression in human prostate cancers and normal prostate epithelium were examined by quantitative RT-PCR and immunohistochemistry. Matrigel invasion assay and a gene array analysis were performed using prostate cancer cell lines transfected with either control or PAX2 siRNA. In human prostate cancers, PAX2 was hyper-expressed in metastatic cancers, but was expressed at lower levels in non-metastatic cancers. Consistent with this, PAX2 knockdown repressed cell growth and invasion in a Matrigel invasion assay. Gene ontology analysis revealed that many cell membrane proteins were downregulated after PAX2 knockdown. Our data suggested that PAX2 hyper-expression promotes the development of the metastatic state in prostate cancer cells, presumably through upregulating the expression of cell membrane proteins. Copyright © 2013 Wiley Periodicals, Inc.

High-efficiency single cell encapsulation and size selective capture of cells in picoliter droplets based on hydrodynamic micro-vortices.

PubMed

Kamalakshakurup, Gopakumar; Lee, Abraham P

2017-12-05

Single cell analysis has emerged as a paradigm shift in cell biology to understand the heterogeneity of individual cells in a clone for pathological interrogation. Microfluidic droplet technology is a compelling platform to perform single cell analysis by encapsulating single cells inside picoliter-nanoliter (pL-nL) volume droplets. However, one of the primary challenges for droplet based single cell assays is single cell encapsulation in droplets, currently achieved either randomly, dictated by Poisson statistics, or by hydrodynamic techniques. In this paper, we present an interfacial hydrodynamic technique which initially traps the cells in micro-vortices, and later releases them one-to-one into the droplets, controlled by the width of the outer streamline that separates the vortex from the flow through the streaming passage adjacent to the aqueous-oil interface (d gap ). One-to-one encapsulation is achieved at a d gap equal to the radius of the cell, whereas complete trapping of the cells is realized at a d gap smaller than the radius of the cell. The unique feature of this technique is that it can perform 1. high efficiency single cell encapsulations and 2. size-selective capturing of cells, at low cell loading densities. Here we demonstrate these two capabilities with a 50% single cell encapsulation efficiency and size selective separation of platelets, RBCs and WBCs from a 10× diluted blood sample (WBC capture efficiency at 70%). The results suggest a passive, hydrodynamic micro-vortex based technique capable of performing high-efficiency single cell encapsulation for cell based assays.

Transcriptional regulation of the novel monoamine oxidase renalase: Crucial roles of transcription factors Sp1, STAT3, and ZBP89.

PubMed

Sonawane, Parshuram J; Gupta, Vinayak; Sasi, Binu K; Kalyani, Ananthamohan; Natarajan, Bhargavi; Khan, Abrar A; Sahu, Bhavani S; Mahapatra, Nitish R

2014-11-11

Renalase, a novel monoamine oxidase, is emerging as an important regulator of cardiovascular, metabolic, and renal diseases. However, the mechanism of transcriptional regulation of this enzyme remains largely unknown. We undertook a systematic analysis of the renalase gene to identify regulatory promoter elements and transcription factors. Computational analysis coupled with transfection of human renalase promoter/luciferase reporter plasmids (5'-promoter-deletion constructs) into various cell types (HEK-293, IMR32, and HepG2) identified two crucial promoter domains at base pairs -485 to -399 and -252 to -150. Electrophoretic mobility shift assays using renalase promoter oligonucleotides with and without potential binding sites for transcription factors Sp1, STAT3, and ZBP89 displayed formation of specific complexes with HEK-293 nuclear proteins. Consistently, overexpression of Sp1, STAT3, and ZBP89 augmented renalase promoter activity; additionally, siRNA-mediated downregulation of Sp1, STAT3, and ZBP89 reduced the level of endogenous renalase transcription as well as the transfected renalase promoter activity. In addition, chromatin immunoprecipitation assays showed in vivo interactions of these transcription factors with renalase promoter. Interestingly, renalase promoter activity was augmented by nicotine and catecholamines; while Sp1 and STAT3 synergistically activated the nicotine-induced effect, Sp1 appeared to enhance epinephrine-evoked renalase transcription. Moreover, renalase transcript levels in mouse models of human essential hypertension were concomitantly associated with endogenous STAT3 and ZBP89 levels, suggesting crucial roles for these transcription factors in regulating renalase gene expression in cardiovascular pathological conditions.

Comparison of the Chiron Quantiplex branched DNA (bDNA) assay and the Abbott Genostics solution hybridization assay for quantification of hepatitis B viral DNA.

PubMed

Kapke, G E; Watson, G; Sheffler, S; Hunt, D; Frederick, C

1997-01-01

Several assays for quantification of DNA have been developed and are currently used in research and clinical laboratories. However, comparison of assay results has been difficult owing to the use of different standards and units of measurements as well as differences between assays in dynamic range and quantification limits. Although a few studies have compared results generated by different assays, there has been no consensus on conversion factors and thorough analysis has been precluded by small sample size and limited dynamic range studied. In this study, we have compared the Chiron branched DNA (bDNA) and Abbott liquid hybridization assays for quantification of hepatitis B virus (HBV) DNA in clinical specimens and have derived conversion factors to facilitate comparison of assay results. Additivity and variance stabilizing (AVAS) regression, a form of non-linear regression analysis, was performed on assay results for specimens from HBV clinical trials. Our results show that there is a strong linear relationship (R2 = 0.96) between log Chiron and log Abbott assay results. Conversion factors derived from regression analyses were found to be non-constant and ranged from 6-40. Analysis of paired assay results below and above each assay's limit of quantification (LOQ) indicated that a significantly (P < 0.01) larger proportion of observations were below the Abbott assay LOQ but above the Chiron assay LOQ, indicating that the Chiron assay is significantly more sensitive than the Abbott assay. Testing of replicate specimens showed that the Chiron assay consistently yielded lower per cent coefficients of variance (% CVs) than the Abbott assay, indicating that the Chiron assay provides superior precision.

Science & Technology Review May 2006

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aufderheide III, M B

2006-04-03

This month's issue has the following articles: (1) Science and Technology Help the Nation Counter Terrorism--Commentary by Raymond J. Juzaitis; (2) Imagers Provide Eyes to See Gamma Rays--Gamma-ray imagers provide increased radiation detection capabilities and enhance the nation's arsenal for homeland security; (3) Protecting the Nation's Livestock--Foot-and-mouth disease could devastate America's livestock; a new assay provides a rapid means to detect it; (4) Measures for Measures--Laboratory physicists combine emissivity and reflectivity to achieve highly accurate temperature measurements of metal foils; and (5) Looping through the Lamb Shift--Livermore scientists measured a small perturbation in the spectra of highly ionized uranium--the firstmore » measurement of the two-loop Lamb shift in a bound state.« less

The social impacts of the energy shortage, behavioral and attitude shifts

DOT National Transportation Integrated Search

1975-09-01

An analysis of the social impacts of the energy shortage; specifically, an : analysis of shifts in social behavior, or trip-making characteristics, and : shifts in social attitudes towards the energy shortage and conservation policies, : Data were ob...

Night Shift Work and Risk of Depression: Meta-analysis of Observational Studies.

PubMed

Lee, Aeyoung; Myung, Seung Kwon; Cho, Jung Jin; Jung, Yu Jin; Yoon, Jong Lull; Kim, Mee Young

2017-07-01

This study aimed to assess whether night shift work is associated with the risk of depression by using a meta-analysis of observational studies. We searched PubMed and EMBASE in August, 2016 to locate eligible studies and investigated the association between night shift work and the risk of depression, reporting outcome measures with adjusted odds ratios (ORs) or relative risks (RRs) and 95% confidence intervals (CIs). In the meta-analysis of a total of 11 observational studies with 9 cross-sectional study, 1 longitudinal study, and 1 cohort study, night shift work was significantly associated with an increased risk of depression (OR/RR, 1.43; 95% CI, 1.24-1.64; I² = 78.0%). Also, subgroup meta-analyses by gender, night shift work duration, type of occupation, continent, and type of publication showed that night shift work was consistently associated with the increased risk of depression. The current meta-analysis suggests that night shift work is associated with the increased risk of depression. However, further large prospective cohort studies are needed to confirm this association. © 2017 The Korean Academy of Medical Sciences.

Night Shift Work and Risk of Depression: Meta-analysis of Observational Studies

PubMed Central

2017-01-01

This study aimed to assess whether night shift work is associated with the risk of depression by using a meta-analysis of observational studies. We searched PubMed and EMBASE in August, 2016 to locate eligible studies and investigated the association between night shift work and the risk of depression, reporting outcome measures with adjusted odds ratios (ORs) or relative risks (RRs) and 95% confidence intervals (CIs). In the meta-analysis of a total of 11 observational studies with 9 cross-sectional study, 1 longitudinal study, and 1 cohort study, night shift work was significantly associated with an increased risk of depression (OR/RR, 1.43; 95% CI, 1.24–1.64; I2 = 78.0%). Also, subgroup meta-analyses by gender, night shift work duration, type of occupation, continent, and type of publication showed that night shift work was consistently associated with the increased risk of depression. The current meta-analysis suggests that night shift work is associated with the increased risk of depression. However, further large prospective cohort studies are needed to confirm this association. PMID:28581264

A novel DNA/histone H4 peptide complex detects autoantibodies in systemic lupus erythematosus sera.

PubMed

Panza, Filomena; Alcaro, Maria Claudia; Petrelli, Fiorella; Angelotti, Francesca; Pratesi, Federico; Rovero, Paolo; Migliorini, Paola

2016-10-04

The detection of anti-dsDNA antibodies is critical for the diagnosis and follow-up of systemic lupus erythematosus (SLE) patients. The presently available assays are characterized by a non-optimal specificity (solid phase assays) or sensitivity (Crithidia Luciliae immunofluorescence test (CLIFT)). To overcome the limits of CLIFT and solid phase chromatin assays, we explored the diagnostic potential of an assay based on plasmid DNA containing a highly bent fragment of 211 bp from Crithidia Luciliae minicircles, complexed with histone peptides. Electrically neutral complexes of PK201/CAT plasmid (PK) DNA and histone 4 (H4) peptides were evaluated by electromobility shift assay. Complexes of H4 peptides and PK were absorbed to the solid phase to detect specific immunoglobulin G (IgG) in sera. Sera from 109 SLE patients, 100 normal healthy subjects, and 169 disease controls were tested. H4(14-34) containing the consensus sequence for DNA binding interacts with PK, retarding its migration. H4(14-34)/PK complexes were used to test sera by ELISA. Anti-H4-PK antibodies were detected in 56 % of SLE sera (more frequently in patients with skin or joint involvement) versus 5.9 % in disease controls; inhibition assays show that sera react with epitopes present on DNA or on the complex, not on the peptide. Antibody titer is correlated with European Consensus Lupus Activity Measurement (ECLAM) score and anti-complement component 1q (C1q) antibodies, negatively with C3 levels. Anti-H4-PK antibodies compared with CLIFT and solid phase dsDNA assays display moderate concordance. The H4/PK assay is a simple and reliable test which is useful for the differential diagnosis and evaluation of disease activity in SLE patients.

FunShift: a database of function shift analysis on protein subfamilies

PubMed Central

Abhiman, Saraswathi; Sonnhammer, Erik L. L.

2005-01-01

Members of a protein family normally have a general biochemical function in common, but frequently one or more subgroups have evolved a slightly different function, such as different substrate specificity. It is important to detect such function shifts for a more accurate functional annotation. The FunShift database described here is a compilation of function shift analysis performed between subfamilies in protein families. It consists of two main components: (i) subfamilies derived from protein domain families and (ii) pairwise subfamily comparisons analyzed for function shift. The present release, FunShift 12, was derived from Pfam 12 and consists of 151 934 subfamilies derived from 7300 families. We carried out function shift analysis by two complementary methods on families with up to 500 members. From a total of 179 210 subfamily pairs, 62 384 were predicted to be functionally shifted in 2881 families. Each subfamily pair is provided with a markup of probable functional specificity-determining sites. Tools for searching and exploring the data are provided to make this database a valuable resource for protein function annotation. Knowledge of these functionally important sites will be useful for experimental biologists performing functional mutation studies. FunShift is available at http://FunShift.cgb.ki.se. PMID:15608176

NRF2 Orchestrates the Metabolic Shift during Induced Pluripotent Stem Cell Reprogramming

PubMed Central

Hawkins, Kate E.; Joy, Shona; Delhove, Juliette M.K.M.; Kotiadis, Vassilios N.; Fernandez, Emilio; Fitzpatrick, Lorna M.; Whiteford, James R.; King, Peter J.; Bolanos, Juan P.; Duchen, Michael R.; Waddington, Simon N.; McKay, Tristan R.

2016-01-01

Summary The potential of induced pluripotent stem cells (iPSCs) in disease modeling and regenerative medicine is vast, but current methodologies remain inefficient. Understanding the cellular mechanisms underlying iPSC reprogramming, such as the metabolic shift from oxidative to glycolytic energy production, is key to improving its efficiency. We have developed a lentiviral reporter system to assay longitudinal changes in cell signaling and transcription factor activity in living cells throughout iPSC reprogramming of human dermal fibroblasts. We reveal early NF-κB, AP-1, and NRF2 transcription factor activation prior to a temporal peak in hypoxia inducible factor α (HIFα) activity. Mechanistically, we show that an early burst in oxidative phosphorylation and elevated reactive oxygen species generation mediates increased NRF2 activity, which in turn initiates the HIFα-mediated glycolytic shift and may modulate glucose redistribution to the pentose phosphate pathway. Critically, inhibition of NRF2 by KEAP1 overexpression compromises metabolic reprogramming and results in reduced efficiency of iPSC colony formation. PMID:26904936

tRNA Shifts the G-quadruplex-Hairpin Conformational Equilibrium in RNA towards the Hairpin Conformer.

PubMed

Rode, Ambadas B; Endoh, Tamaki; Sugimoto, Naoki

2016-11-07

Non-coding RNAs play important roles in cellular homeostasis and are involved in many human diseases including cancer. Intermolecular RNA-RNA interactions are the basis for the diverse functions of many non-coding RNAs. Herein, we show how the presence of tRNA influences the equilibrium between hairpin and G-quadruplex conformations in the 5' untranslated regions of oncogenes and model sequences. Kinetic and equilibrium analyses of the hairpin to G-quadruplex conformational transition of purified RNA as well as during co-transcriptional folding indicate that tRNA significantly shifts the equilibrium toward the hairpin conformer. The enhancement of relative translation efficiency in a reporter gene assay is shown to be due to the tRNA-mediated shift in hairpin-G-quadruplex equilibrium of oncogenic mRNAs. Our findings suggest that tRNA is a possible therapeutic target in diseases in which RNA conformational equilibria is dysregulated. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The T4 Phage DNA Mimic Protein Arn Inhibits the DNA Binding Activity of the Bacterial Histone-like Protein H-NS*

PubMed Central

Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H.-J.

2014-01-01

The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties. PMID:25118281

Visible micro-Raman spectroscopy for determining glucose content in beverage industry.

PubMed

Delfino, I; Camerlingo, C; Portaccio, M; Ventura, B Della; Mita, L; Mita, D G; Lepore, M

2011-07-15

The potential of Raman spectroscopy with excitation in the visible as a tool for quantitative determination of single components in food industry products was investigated by focusing the attention on glucose content in commercial sport drinks. At this aim, micro-Raman spectra in the 600-1600cm(-1) wavenumber shift region of four sport drinks were recorded, showing well defined and separated vibrational fingerprints of the various contained sugars (glucose, fructose and sucrose). By profiting of the spectral separation of some peculiar peaks, glucose content was quantified by using a multivariate statistical analysis based on the interval Partial Least Square (iPLS) approach. The iPLS model needed for data analysis procedure was built by using glucose aqueous solutions at known sugar concentrations as calibration data. This model was then applied to sport drink spectra and gave predicted glucose concentrations in good agreement with the values obtained by using a biochemical assay. These results represent a significant step towards the development of a fast and simple method for the on-line glucose quantification in products of food and beverage industry. Copyright © 2011 Elsevier Ltd. All rights reserved.

Shift Work and Cognitive Flexibility: Decomposing Task Performance.

PubMed

Cheng, Philip; Tallent, Gabriel; Bender, Thomas John; Tran, Kieulinh Michelle; Drake, Christopher L

2017-04-01

Deficits in cognitive functioning associated with shift work are particularly relevant to occupational performance; however, few studies have examined how cognitive functioning is associated with specific components of shift work. This observational study examined how circadian phase, nocturnal sleepiness, and daytime insomnia in a sample of shift workers ( N = 30) were associated with cognitive flexibility during the night shift. Cognitive flexibility was measured using a computerized task-switching paradigm, which produces 2 indexes of flexibility: switch cost and set inhibition. Switch cost represents the additional cognitive effort required in switching to a different task and can impact performance when multitasking is involved. Set inhibition is the efficiency in returning to previously completed tasks and represents the degree of cognitive perseveration, which can lead to reduced accuracy. Circadian phase was measured via melatonin assays, nocturnal sleepiness was assessed using the Multiple Sleep Latency Test, and daytime insomnia was assessed using the Insomnia Severity Index. Results indicated that those with an earlier circadian phase, insomnia, and sleepiness exhibited reduced cognitive flexibility; however, specific components of cognitive flexibility were differentially associated with circadian phase, insomnia, and sleepiness. Individuals with an earlier circadian phase (thus more misaligned to the night shift) exhibited larger switch costs, which was also associated with reduced task efficiency. Shift workers with more daytime insomnia demonstrated difficulties with cognitive inhibition, whereas nocturnal sleepiness was associated with difficulties in reactivating previous tasks. Deficits in set inhibition were also related to reduced accuracy and increased perseverative errors. Together, this study indicates that task performance deficits in shift work are complex and are variably impacted by different mechanisms. Future research may examine phenotypic differences in shift work and the associated consequences. Results also suggest that fatigue risk management strategies may benefit from increased scope and specificity in assessment of sleep, sleepiness, and circadian rhythms in shift workers.

Rational Methods for the Selection of Diverse Screening Compounds

PubMed Central

Huggins, David J.; Venkitaraman, Ashok R.; Spring, David R.

2016-01-01

Traditionally a pursuit of large pharmaceutical companies, high-throughput screening assays are becoming increasingly common within academic and government laboratories. This shift has been instrumental in enabling projects that have not been commercially viable, such as chemical probe discovery and screening against high risk targets. Once an assay has been prepared and validated, it must be fed with screening compounds. Crafting a successful collection of small molecules for screening poses a significant challenge. An optimized collection will minimize false positives whilst maximizing hit rates of compounds that are amenable to lead generation and optimization. Without due consideration of the relevant protein targets and the downstream screening assays, compound filtering and selection can fail to explore the great extent of chemical diversity and eschew valuable novelty. Herein, we discuss the different factors to be considered and methods that may be employed when assembling a structurally diverse compound screening collection. Rational methods for selecting diverse chemical libraries are essential for their effective use in high-throughput screens. PMID:21261294

Identification of eukaryotic UDP-galactopyranose mutase inhibitors using the ThermoFAD assay.

PubMed

Martín Del Campo, Julia S; Eckshtain-Levi, Meital; Sobrado, Pablo

2017-11-04

Aspergillus fumigatus is a human pathogen responsible for deadly infections in immune-compromised patients. A potential strategy for treating A. fumigatus infections is by targeting the biosynthesis of cell wall components, such as galactofuranase, which is absent in humans. Galactofuranose biosynthesis is initiated by the flavoenzyme UDP-galactopyranose mutase (UGM), which converts UDP-galactopyranose (UDP-Galp) to UDP-galactofuranose (UDP-Galf). UGM requires the reduced form of the flavin for activity, which is obtained by reacting with NADPH. We aimed to identify inhibitors of UGM by screening a kinase inhibitor library using ThermoFAD, a flavin fluorescence thermal shift assay. The screening assay identified flavopiridol as a compound that increased the melting temperature of A. fumigatus UGM. Further characterization showed that flavopiridol is a non-competitive inhibitor of UGM and docking studies suggest that it binds in the active site. This compound does not inhibit the prokaryotic UGM from Mycobacteria tuberculosis. Copyright © 2017 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Danno, Hirosuke; Ishii, Kiyo-aki; Nakagawa, Yoshimi

To elucidate the physiological role of CREBH, the hepatic mRNA and protein levels of CREBH were estimated in various feeding states of wild and obesity mice. In the fast state, the expression of CREBH mRNA and nuclear protein were high and profoundly suppressed by refeeding in the wild-type mice. In ob/ob mice, the refeeding suppression was impaired. The diet studies suggested that CREBH expression was activated by fatty acids. CREBH mRNA levels in the mouse primary hepatocytes were elevated by addition of the palmitate, oleate and eicosapenonate. It was also induced by PPAR{alpha} agonist and repressed by PPAR{alpha} antagonist. Luciferasemore » reporter gene assays indicated that the CREBH promoter activity was induced by fatty acids and co-expression of PPAR{alpha}. Deletion studies identified the PPRE for PPAR{alpha} activation. Electrophoretic mobility shift assay and chromatin immunoprecipitation (ChIP) assay confirmed that PPAR{alpha} directly binds to the PPRE. Activation of CREBH at fasting through fatty acids and PPAR{alpha} suggest that CREBH is involved in nutritional regulation.« less

Comparison of colorimetric assays with quantitative amino acid analysis for protein quantification of Generalized Modules for Membrane Antigens (GMMA).

PubMed

Rossi, Omar; Maggiore, Luana; Necchi, Francesca; Koeberling, Oliver; MacLennan, Calman A; Saul, Allan; Gerke, Christiane

2015-01-01

Genetically induced outer membrane particles from Gram-negative bacteria, called Generalized Modules for Membrane Antigens (GMMA), are being investigated as vaccines. Rapid methods are required for estimating the protein content for in-process assays during production. Since GMMA are complex biological structures containing lipid and polysaccharide as well as protein, protein determinations are not necessarily straightforward. We compared protein quantification by Bradford, Lowry, and Non-Interfering assays using bovine serum albumin (BSA) as standard with quantitative amino acid (AA) analysis, the most accurate currently available method for protein quantification. The Lowry assay has the lowest inter- and intra-assay variation and gives the best linearity between protein amount and absorbance. In all three assays, the color yield (optical density per mass of protein) of GMMA was markedly different from that of BSA with a ratio of approximately 4 for the Bradford assay, and highly variable between different GMMA; and approximately 0.7 for the Lowry and Non-Interfering assays, highlighting the need for calibrating the standard used in the colorimetric assay against GMMA quantified by AA analysis. In terms of a combination of ease, reproducibility, and proportionality of protein measurement, and comparability between samples, the Lowry assay was superior to Bradford and Non-Interfering assays for GMMA quantification.

A new blue-shifted luciferase from the Brazilian Amydetes fanestratus (Coleoptera: Lampyridae) firefly: molecular evolution and structural/functional properties.

PubMed

Viviani, Vadim R; Amaral, Danilo; Prado, Rogilene; Arnoldi, Frederico G C

2011-12-01

Firefly luciferases usually produce bioluminescence in the yellow-green region, with colors in the green and yellow-orange extremes of the spectrum being less common. Several firefly luciferases have already been cloned and sequenced, and site-directed mutagenesis studies have already identified important regions and residues for bioluminescence colors. However the structural determinants and mechanisms of bioluminescence colors turned out to be elusive, mainly when comparing luciferases with a high degree of divergence. Thus comparison of more similar luciferases producing colors in the two extremes of the spectrum could be revealing. The South-American fauna of fireflies remains largely unstudied, with some unique taxa that are not found anywhere else in the world and that produce a wide range of bioluminescence colors. Among them, fireflies of the genus Amydetes are especially interesting because its taxonomical status as an independent subfamily or as a tribe is not yet solved, and because they usually produce a continuous bright blue-shifted bioluminescence. In this work we cloned the cDNA for the luciferase of the Atlantic rain forest Amydetes fanestratus firefly, which is found near Sorocaba municipality (São Paulo, Brazil). Despite showing a higher degree of identity with the South-American Cratomorphus, the European Lampyris and the Asiatic Pyrocoelia, phylogenetical analysis of the luciferase sequence support the inclusion of Amydetes as an independent subfamily. Amydetes luciferase displays one of the most blue-shifted emission spectra (λ(max) = 538 nm) among beetle luciferases, with lower pH-sensitivity and higher affinity for ATP when compared to other luciferases, making this luciferase attractive for sensitive ATP and reporter assays.

Cross-shift changes in blood inflammatory markers occur in the absence of airway obstruction in workers exposed to grain dust.

PubMed

Borm, P J; Schins, R P; Derhaag, T J; Kant, I; Jorna, T H

1996-04-01

Grain dust is well known to cause both acute and chronic respiratory disorders, and endotoxins are considered key components in this. Since endotoxins are known to elicit proinflammatory mediators, we investigated cytokine (tumor necrosis factor [TNF], interleukin-6, interleukin-8) release and a number of proinflammatory and anti-inflammatory proteins (soluble TNF receptors, lipopolysaccharide (LPS) binding protein, bactericidal permeability increasing protein (BPI), C-reactive protein) in plasma of workers exposed to grain dust. In two surveys during 1 week, lung function was measured daily before and after the shift, using flow-volume curves and/or forced oscillation measurements. On Monday and Friday, blood samples (30 mL) were drawn and cytokine release was determined by enzyme-linked immunosorbent assay in supernatant of isolated monocytes or whole blood culture, either unstimulated or on the ex vivo stimulation with 3 ng/mL or 1,000 ng/mL endotoxin. Individual exposures were determined from stationary dust measurements at every workplace combined with personal task analysis during all shifts. In both surveys, no cross-week change in lung function parameters was observed. In the first survey (average exposure: 20.2 mg/m3), monocyte spontaneous TNF release was increased sevenfold cross week (p<0.001) and was significantly related both to individual dust exposure (r=0.62) of that week and the increase in soluble TNF receptor 75 kD (r=0.85). In the second survey, where average exposure was much lower (3.67 mg/m3), impedance parameters indicated a significant improvement of airway function, and cross-week changes in inflammatory markers were minimal. Therefore, we conclude that inflammatory events can be used to monitor adverse respiratory effects of moderate grain dust exposure.

Meta-analysis on shift work and risks of specific obesity types.

PubMed

Sun, M; Feng, W; Wang, F; Li, P; Li, Z; Li, M; Tse, G; Vlaanderen, J; Vermeulen, R; Tse, L A

2018-01-01

This systematic review and meta-analysis evaluated the associations between shift work patterns and risks of specific types of obesity. PubMed was searched until March 2017 for observational studies that examined the relationships between shift work patterns and obesity. Odds ratio for obesity was extracted using a fixed-effects or random-effects model. Subgroup meta-analyses were carried out for study design, specific obesity types and characteristics of shift work pattern. A total of 28 studies were included in this meta-analysis. The overall odds ratio of night shift work was 1.23 (95% confidence interval = 1.17-1.29) for risk of obesity/overweight. Cross-sectional studies showed a higher risk of 1.26 than those with the cohort design (risk ratio = 1.10). Shift workers had a higher frequency of developing abdominal obesity (odds ratio = 1.35) than other obesity types. Permanent night workers demonstrated a 29% higher risk than rotating shift workers (odds ratio 1.43 vs. 1.14). This meta-analysis confirmed the risks of night shift work for the development of overweight and obesity with a potential gradient association suggested, especially for abdominal obesity. Modification of working schedules is recommended, particularly for prolonged permanent night work. More accurate and detailed measurements on shift work patterns should be conducted in future research. © 2017 World Obesity Federation.

Safer Nanomaterials and Nanomanufacturing

DTIC Science & Technology

2013-02-01

groups focused on the tracking and effects of gold nanoparticles (AuNPs) within biological systems. Most of the research was conducted in Drosophila ...results, and we decided to shift our focus away from in vitro assays, towards studying the effect of AuNPs on adult Drosophila in vivo. In vivo...investigations of AuNP effects on adult Drosophila melanogaster In vivo effects of AuNPs on adult flies were tested for two routes of exposure

Review and Implementation of Technology for Solid Radioactive Waste Volume Reduction

DTIC Science & Technology

1999-10-15

were shifted to Project 1.1 for spent nuclear fuel cask development to accelerate that project. Those funds should be repaid to Project 1.3 in the... transported between the shipyards such as Nerpa, and other intermediate storage sites such as Gremikha and Andreeva Bay. At these sites the largest...waste source and allow pretreatment unit operations using commercially available technologies of contaminant assaying, cutting/shearing, sorting

Crocetin shifts autophagic cell survival to death of breast cancer cells in chemotherapy.

PubMed

Zhang, Ailian; Li, Jincheng

2017-03-01

The chemotherapy with fluorouracil is not always effective, in which some breast cancer cells may survive the fluorouracil treatment through enhanced autophagy. Crocetin is the major constituent of saffron, a Chinese traditional herb, which has recently found to have multiple pharmacological effects, including anticancer. However, the effects of Crocetin on the outcome of fluorouracil therapy for breast cancer have not been studied. Here, we showed that fluorouracil treatment inhibited the growth of breast cancer cells, in either a Cell Counting Kit-8 assay or an MTT assay. Inhibition of autophagy further suppressed breast cancer cell growth, suggesting that the breast cancer cells increased autophagic cell survival during fluorouracil treatment. However, Crocetin significantly increased the suppressive effects of fluorouracil on breast cancer cell growth, without affecting either cell apoptosis or autophagy. Inhibition of autophagy at the presence of Crocetin partially abolished the suppressive effects on breast cancer cell growth, suggesting that Crocetin may increase autophagic cell death in fluorouracil-treated breast cancer cells. Furthermore, Crocetin decreased Beclin-1 levels but increased ATG1 levels in fluorouracil-treated breast cancer cells. Together, these data suggest that Crocetin may shift autophagic cell survival to autophagic cell death in fluorouracil-treated breast cancer cells, possibly through modulation of the expression of ATG1 and Beclin-1.

Redox states of Desulfovibrio vulgaris DsrC, a key protein in dissimilatory sulfite reduction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venceslau, Sofia S.; Cort, John R.; Baker, Erin S.

2013-11-29

Highlights: •DsrC is known to interact with the dissimilatory sulfite reductase enzyme (DsrAB). •We show that, however, most cellular DsrC is not associated with DsrAB. •A gel-shift assay was developed that allows monitoring of the DsrC redox state. •The DsrC intramolecularly oxidized state could only be produced by arginine treatment. -- Abstract: Dissimilatory reduction of sulfite is carried out by the siroheme enzyme DsrAB, with the involvement of the protein DsrC, which has two conserved redox-active cysteines. DsrC was initially believed to be a third subunit of DsrAB. Here, we report a study of the distribution of DsrC in cellmore » extracts to show that, in the model sulfate reducer Desulfovibrio vulgaris, the majority of DsrC is not associated with DsrAB and is thus free to interact with other proteins. In addition, we developed a cysteine-labelling gel-shift assay to monitor the DsrC redox state and behaviour, and procedures to produce the different redox forms. The oxidized state of DsrC with an intramolecular disulfide bond, which is proposed to be a key metabolic intermediate, could be successfully produced for the first time by treatment with arginine.« less

Regulatory single nucleotide polymorphisms (rSNPs) at the promoters 1A and 1B of the human APC gene.

PubMed

Matveeva, Marina Yu; Kashina, Elena V; Reshetnikov, Vasily V; Bryzgalov, Leonid O; Antontseva, Elena V; Bondar, Natalia P; Merkulova, Tatiana I

2016-12-22

Germline mutations in the coding sequence of the tumour suppressor APC gene give rise to familial adenomatous polyposis (which leads to colorectal cancer) and are associated with many other oncopathologies. The loss of APC function because of deletion of putative promoter 1A or 1B also results in the development of colorectal cancer. Since the regions of promoters 1A and 1B contain many single nucleotide polymorphisms (SNPs), the aim of this study was to perform functional analysis of some of these SNPs by means of an electrophoretic mobility shift assay (EMSA) and a luciferase reporter assay. First, it was shown that both putative promoters of APC (1A and 1B) drive transcription in an in vitro reporter experiment. From eleven randomly selected SNPs of promoter 1A and four SNPs of promoter 1B, nine and two respectively showed differential patterns of binding of nuclear proteins to oligonucleotide probes corresponding to alternative alleles. The luciferase reporter assay showed that among the six SNPs tested, the rs75612255 C allele and rs113017087 C allele in promoter 1A as well as the rs138386816 T allele and rs115658307 T allele in promoter 1B significantly increased luciferase activity in the human erythromyeloblastoid leukaemia cell line K562. In human colorectal cancer HCT-116 cells, none of the substitutions under study had any effect, with the exception of minor allele G of rs79896135 in promoter 1B. This allele significantly decreased the luciferase reporter's activity CONCLUSION: Our results indicate that many SNPs in APC promoters 1A and 1B are functionally relevant and that allele G of rs79896135 may be associated with the predisposition to colorectal cancer.

Suppression of survivin promoter activity by YM155 involves disruption of Sp1-DNA interaction in the survivin core promoter

PubMed Central

Cheng, Qiuying; Ling, Xiang; Haller, Andrew; Nakahara, Takahito; Yamanaka, Kentaro; Kita, Aya; Koutoku, Hiroshi; Takeuchi, Masahiro; Brattain, Michael G; Li, Fengzhi

2012-01-01

YM155, a novel survivin suppressant, shows potent antitumor activity against various human cancers and is currently in phase II clinical trials. In this study, we investigated whether YM155 selectively inhibits survivin transcription. We hypothesize that inhibition of survivin transcription plays a role in YM155-mediated survivin inhibition. We found that YM155 inhibited survivin promoter activity, while it showed minimal inhibitory effect on four control gene promoters in transfection and luciferase activity assay experiments, indicating its selectivity. Transfection of various survivin promoter-luciferase constructs followed by luciferase assays revealed that the survivin core promoter (269 bp) plays a major role in YM155-mediated inhibitory effects. However, flow cytometry analysis indicated that inhibition of survivin promoter activity by YM155 is cell cycle-independent without G1 cell arrests. Electrophoretic mobility shift assays (EMSA) identified that YM155 abrogates nuclear proteins binding to the region of -149 to -71, in which Sp1 is a major candidate, and that YM155 treatment induces Sp1 re-subcellular localization without inhibiting its expression. Forced expression of Sp1 neutralized YM155-mediated downregulation of survivin promoter activity. Consistently, mutation of the identified Sp1 sites in the oligonucleotide probe diminished DNA-protein interactions in EMSA experiments, and mutation of the Sp1 sites in the survivin promoter-luciferase construct diminished survivin promoter activity. These findings indicate that YM155 inhibition of survivin expression is at least in part through its inhibition of survivin transcription by disruption of Sp1 interaction with the region of -149 to -71 in the survivin core promoter. PMID:22773958

Lidocaine attenuates lipopolysaccharide-induced inflammatory responses in microglia.

PubMed

Yuan, Tong; Li, Zhiwen; Li, Xinbai; Yu, Gaoqi; Wang, Na; Yang, Xige

2014-11-01

Lidocaine has been used as a local anesthetic with anti-inflammatory properties, but its effects on neuroinflammation have not been well defined. In the present study, we investigated the prophylactic effects of lidocaine on lipopolysaccharide (LPS)-activated microglia and explored the underlying mechanisms. Microglial cells were incubated with or without 1 μg/mL LPS in the presence or absence of lidocaine, a p38 mitogen-activated protein kinase (p38 MAPK) inhibitor (SB203580), a nuclear factor-kappa B (NF-κB) inhibitor (pyrrolidine dithiocarbamate), or small interfering RNA. The protein and expression levels of inflammatory mediators, such as monocyte chemotactic protein 1, nitric oxide, prostaglandin E2, interleukin 1β, and tumor necrosis factor α were measured using enzyme-linked immunosorbent assays and real-time polymerase chain reaction. The effect of lidocaine on NF-κB and p38 MAPK activation was evaluated using enzyme-linked immunosorbent assays, Western blot analysis, and electrophoretic mobility shift assay. Lidocaine (≥2 μg/mL) significantly inhibited the release and expression of nitric oxide, monocyte chemotactic protein 1, prostaglandin E2, interleukin 1β, and tumor necrosis factor α in LPS-activated microglia. Treatment with lidocaine also significantly inhibited the phosphorylation of p38 MAPK and the nuclear translocation of NF-κB p50/p65, increased the protein levels of inhibitor kappa B-α. Furthermore, our study shows that the LPS-induced release of inflammatory mediators was suppressed by SB203580, pyrrolidine dithiocarbamate, and small interfering RNA. Prophylactic treatment with lidocaine inhibits LPS-induced release of inflammatory mediators from microglia, and these effects may be mediated by blockade of p38 MAPK and NF-κB signaling pathways. Copyright © 2014 Elsevier Inc. All rights reserved.

Amino-terminal enhancer of split (AES) interacts with the oncoprotein NUP98-HOXA9 and enhances its transforming ability.

PubMed

Sarma, Nayan J; Yaseen, Nabeel R

2011-11-11

NUP98-HOXA9 is the prototype of NUP98 fusion oncoproteins that cause acute myeloid leukemia. It consists of an N-terminal FG-rich portion of the nucleoporin NUP98 fused to the homeodomain region of the homeobox protein HOXA9, and acts as an aberrant transcription factor. To identify interacting partners of NUP98-HOXA9, we used a cytoplasmic yeast two-hybrid assay to avoid the nonspecific trans-activation that would occur with the traditional yeast two-hybrid assay due to the transactivating properties of NUP98-HOXA9. We identified amino-terminal enhancer of split (AES), a transcriptional regulator of the transducin-like enhancer/Groucho family as a novel interaction partner of NUP98-HOXA9. The interaction was confirmed by in vitro pulldown and co-immunoprecipitation assays and was shown to require the FG repeat region of NUP98-HOXA9. Immunofluorescence analysis showed that AES localizes primarily to the interior of the nucleus. AES also showed a strong interaction with wild-type NUP98. AES augmented the transcriptional activity of NUP98-HOXA9. In the presence of NUP98-HOXA9, AES caused an increase in long-term proliferation of primary human CD34+ cells with a marked increase in the numbers of primitive cells. These effects of AES were not observed in the absence of NUP98-HOXA9. AES knockdown diminished the transcriptional and proliferative effects of NUP98-HOXA9. AES caused a shift away from the erythroid lineage in cells expressing NUP98-HOXA9. These data establish AES as an interacting partner of NUP98-HOXA9 and show that it cooperates with NUP98-HOXA9 in transcriptional regulation and cell transformation.

Amino-terminal Enhancer of Split (AES) Interacts with the Oncoprotein NUP98-HOXA9 and Enhances Its Transforming Ability*

PubMed Central

Sarma, Nayan J.; Yaseen, Nabeel R.

2011-01-01

NUP98-HOXA9 is the prototype of NUP98 fusion oncoproteins that cause acute myeloid leukemia. It consists of an N-terminal FG-rich portion of the nucleoporin NUP98 fused to the homeodomain region of the homeobox protein HOXA9, and acts as an aberrant transcription factor. To identify interacting partners of NUP98-HOXA9, we used a cytoplasmic yeast two-hybrid assay to avoid the nonspecific trans-activation that would occur with the traditional yeast two-hybrid assay due to the transactivating properties of NUP98-HOXA9. We identified amino-terminal enhancer of split (AES), a transcriptional regulator of the transducin-like enhancer/Groucho family as a novel interaction partner of NUP98-HOXA9. The interaction was confirmed by in vitro pulldown and co-immunoprecipitation assays and was shown to require the FG repeat region of NUP98-HOXA9. Immunofluorescence analysis showed that AES localizes primarily to the interior of the nucleus. AES also showed a strong interaction with wild-type NUP98. AES augmented the transcriptional activity of NUP98-HOXA9. In the presence of NUP98-HOXA9, AES caused an increase in long-term proliferation of primary human CD34+ cells with a marked increase in the numbers of primitive cells. These effects of AES were not observed in the absence of NUP98-HOXA9. AES knockdown diminished the transcriptional and proliferative effects of NUP98-HOXA9. AES caused a shift away from the erythroid lineage in cells expressing NUP98-HOXA9. These data establish AES as an interacting partner of NUP98-HOXA9 and show that it cooperates with NUP98-HOXA9 in transcriptional regulation and cell transformation. PMID:21937451

An Extended Structure–Activity Relationship of Nondioxin-Like PCBs Evaluates and Supports Modeling Predictions and Identifies Picomolar Potency of PCB 202 Towards Ryanodine Receptors

PubMed Central

Feng, Wei; Zheng, Jing; Dong, Yao; Li, Xueshu; Lehmler, Hans-Joachim; Pessah, Isaac N.

2017-01-01

Nondioxin-like polychlorinated biphenyls (NDL PCBs) activate ryanodine-sensitive Ca2+ channels (RyRs) and this activation has been associated with neurotoxicity in exposed animals. RyR-active congeners follow a distinct structure–activity relationship and a quantitative structure–activity relationship (QSAR) predicts that a large number of PCBs likely activate the receptor, which requires validation. Additionally, previous structural based conclusions have been established using receptor ligand binding assays but the impact of varying PCB structures on ion channel gating behavior is not understood. We used [3H]Ryanodine ([3H]Ry) binding to assess the RyR-activity of 14 previously untested PCB congeners evaluating the predictability of the QSAR. Congeners determined to display widely varying potency were then assayed with single channel voltage clamp analysis to assess direct influences on channel gating kinetics. The RyR-activity of individual PCBs assessed in in vitro assays followed the general pattern predicted by the QSAR but binding and lipid bilayer experiments demonstrated higher potency than predicted. Of the 49 congeners tested to date, tetra-ortho PCB 202 was found to be the most potent RyR-active congener increasing channel open probability at 200 pM. Shifting meta-substitutions to the para-position resulted in a > 100-fold reduction in potency as seen with PCB 197. Non-ortho PCB 11 was found to lack activity at the receptor supporting a minimum mono-ortho substitution for PCB RyR activity. These findings expand and support previous SAR assessments; where out of the 49 congeners tested to date 42 activate the receptor demonstrating that the RyR is a sensitive and common target of PCBs. PMID:27655348

Aspirin counteracts cancer stem cell features, desmoplasia and gemcitabine resistance in pancreatic cancer

PubMed Central

Zhang, Yiyao; Liu, Li; Fan, Pei; Bauer, Nathalie; Gladkich, Jury; Ryschich, Eduard; Bazhin, Alexandr V.; Giese, Nathalia A.; Strobel, Oliver; Hackert, Thilo; Hinz, Ulf; Gross, Wolfgang; Fortunato, Franco; Herr, Ingrid

2015-01-01

Pancreatic ductal adenocarcinoma (PDA) is characterized by an extremely poor prognosis. An inflammatory microenvironment triggers the pronounced desmoplasia, the selection of cancer stem-like cells (CSCs) and therapy resistance. The anti-inflammatory drug aspirin is suggested to lower the risk for PDA and to improve the treatment, although available results are conflicting and the effect of aspirin to CSC characteristics and desmoplasia in PDA has not yet been investigated. We characterized the influence of aspirin on CSC features, stromal reactions and gemcitabine resistance. Four established and 3 primary PDA cell lines, non-malignant cells, 3 patient tumor-derived CSC-enriched spheroidal cultures and tissues from patients who did or did not receive aspirin before surgery were analyzed using MTT assays, flow cytometry, colony and spheroid formation assays, Western blot analysis, antibody protein arrays, electrophoretic mobility shift assays (EMSAs), immunohistochemistry and in vivo xenotransplantation. Aspirin significantly induced apoptosis and reduced the viability, self-renewal potential, and expression of proteins involved in inflammation and stem cell signaling. Aspirin also reduced the growth and invasion of tumors in vivo, and it significantly prolonged the survival of mice with orthotopic pancreatic xenografts in combination with gemcitabine. This was associated with a decreased expression of markers for progression, inflammation and desmoplasia. These findings were confirmed in tissue samples obtained from patients who had or had not taken aspirin before surgery. Importantly, aspirin sensitized cells that were resistant to gemcitabine and thereby enhanced the therapeutic efficacy. Aspirin showed no obvious toxic effects on normal cells, chick embryos or mice. These results highlight aspirin as an effective, inexpensive and well-tolerated co-treatment to target inflammation, desmoplasia and CSC features PDA. PMID:25846752

The homeodomain transcription factors antennapedia and POU-M2 regulate the transcription of the steroidogenic enzyme gene Phantom in the silkworm.

PubMed

Meng, Meng; Cheng, Dao-Jun; Peng, Jian; Qian, Wen-Liang; Li, Jia-Rui; Dai, Dan-Dan; Zhang, Tian-Lei; Xia, Qing-You

2015-10-02

The steroid hormone ecdysone, which controls insect molting and metamorphosis, is synthesized in the prothoracic gland (PG), and several steroidogenic enzymes that are expressed specifically in the PG are involved in ecdysteroidogenesis. In this study, we identified new regulators that are involved in the transcriptional control of the silkworm steroidogenic enzyme genes. In silico analysis predicted several potential cis-regulatory elements (CREs) for the homeodomain transcription factors Antennapedia (Antp) and POU-M2 in the proximal promoters of steroidogenic enzyme genes. Antp and POU-M2 are expressed dynamically in the PG during larval development, and their overexpression in silkworm embryo-derived (BmE) cells induced the expression of steroidogenic enzyme genes. Importantly, luciferase reporter analyses, electrophoretic mobility shift assays, and chromatin immunoprecipitation assays revealed that Antp and POU-M2 promote the transcription of the silkworm steroidogenic enzyme gene Phantom (Phm) by binding directly to specific motifs within overlapping CREs in the Phm promoter. Mutations of these CREs in the Phm promoter suppressed the transcriptional activities of both Antp and POU-M2 in BmE cells and decreased the activities of mutated Phm promoters in the silkworm PG. In addition, pulldown and co-immunoprecipitation assays demonstrated that Antp can interact with POU-M2. Moreover, RNA interference-mediated down-regulation of either Antp or POU-M2 during silkworm wandering not only decreased the ecdysone titer but also led to the failure of metamorphosis. In summary, our results suggest that Antp and POU-M2 coordinate the transcription of the silkworm Phm gene directly, indicating new roles for homeodomain proteins in regulating insect ecdysteroidogenesis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Effect of Shift Work on Sleep, Health, and Quality of Life of Health-care Workers.

PubMed

Nena, Evangelia; Katsaouni, Maria; Steiropoulos, Paschalis; Theodorou, Evangelos; Constantinidis, Theodoros C; Tripsianis, Grigorios

2018-01-01

Shift work is associated with sleep disruption, impaired quality of life, and is a risk factor for several health conditions. Aim of this study was to investigate the impact of shift work on sleep and quality of life of health-care workers (HCW). Tertiary University hospital in Greece. Cross-sectional study. Included were HCW, working either in an irregular shift system or exclusively in morning shifts. All participants answered the WHO-5 Well-Being Index (WHO-5) and a questionnaire on demographics and medical history. Shift workers filled the Shift Work Disorders Screening Questionnaire (SWDSQ). Descriptive statistics, Student's t -test, one-way analysis of variance (ANOVA), Pearson's r correlation coefficient, and multivariate stepwise linear regression analysis were applied. Included were 312 employees (87.9% females), 194 working in irregular shift system and 118 in morning shifts. Most shift-workers (58.2%) were somehow or totally dissatisfied with their sleep quality. Regression analysis revealed the following independent determinants for sleep impairment: parenthood ( P < 0.001), age 36-45 years ( P < 0.001), >3 night shifts/week ( P < 0.001), work >5 years in an irregular shift system ( P < 0.001). Diabetes mellitus was the most common medical condition reported by shift workers ( P = 0.008). Comparison between the two groups revealed a significantly impairment in WHO-5 total score, as well as in 4 of 5 of its items ( P < 0.001). Shift-work impairs quality of life, whereas its duration and frequency, along with age and family status of employees can have adverse effects on sleep.

An analysis of clock-shift experiments: is scatter increased and deflection reduced in clock-shifted homing pigeons?

PubMed

Chappell

1997-01-01

Clock-shifting (altering the phase of the internal clock) in homing pigeons leads to a deflection in the vanishing bearing of the clock-shifted group relative to controls. However, two unexplained phenomena are common in clock-shift experiments: the vanishing bearings of the clock-shifted group are often more scattered (with a shorter vector length) than those of the control group, and the deflection of the mean bearing of the clock-shifted group from that of the controls is often smaller than expected theoretically. Here, an analysis of 55 clock-shift experiments performed in four countries over 21 years is reported. The bearings of the clock-shifted groups were significantly more scattered than those of controls and less deflected than expected, but these effects were not significantly different at familiar and unfamiliar sites. The possible causes of the effects are discussed and evaluated with reference to this analysis and other experiments. The most likely causes appear to be conflict between the directions indicated by the sun compass and either unshifted familiar visual landmarks (at familiar sites only) or the unshifted magnetic compass (possible at both familiar and unfamiliar sites).

Extreme sensitive metasensor for targeted biomarkers identification using colloidal nanoparticles-integrated plasmonic unit cells

PubMed Central

Ahmadivand, Arash; Gerislioglu, Burak; Tomitaka, Asahi; Manickam, Pandiaraj; Kaushik, Ajeet; Bhansali, Shekhar; Nair, Madhavan; Pala, Nezih

2018-01-01

Engineered terahertz (THz) plasmonic metamaterials have emerged as promising platforms for quick infection diagnosis, cost-effective and real-time pharmacology applications owing to their non-destructive and harmless interaction with biological tissues in both in vivo and in vitro assays. As a recent member of THz metamaterials family, toroidal metamaterials have been demonstrated to be supporting high-quality sharp resonance modes. Here we introduce a THz metasensor based on a plasmonic surface consisting of metamolecules that support ultra-narrow toroidal resonances excited by the incident radiation and demonstrate detection of an ultralow concertation targeted biomarker. The toroidal plasmonic metasurface was designed and optimized through extensive numerical studies and fabricated by standard microfabrication techniques. The surface then functionalized by immobilizing the antibody for virus-envelope proteins (ZIKV-EPs) for selective sensing. We sensed and quantified the ZIKV-EP in the assays by measuring the spectral shifts of the toroidal resonances while varying the concentration. In an improved protocol, we introduced gold nanoparticles (GNPs) decorated with the same antibodies onto the metamolecules and monitored the resonance shifts for the same concentrations. Our studies verified that the presence of GNPs enhances capturing of biomarker molecules in the surrounding medium of the metamaterial. By measuring the shift of the toroidal dipolar momentum (up to Δω~0.35 cm−1) for different concentrations of the biomarker proteins, we analyzed the sensitivity, repeatability, and limit of detection (LoD) of the proposed toroidal THz metasensor. The results show that up to 100-fold sensitivity enhancement can be obtained by utilizing plasmonic nanoparticles-integrated toroidal metamolecules in comparison to analogous devices. This approach allows for detection of low molecular-weight biomolecules (≈13 kDa) in diluted solutions using toroidal THz plasmonic unit cells. PMID:29552379

Extreme sensitive metasensor for targeted biomarkers identification using colloidal nanoparticles-integrated plasmonic unit cells.

PubMed

Ahmadivand, Arash; Gerislioglu, Burak; Tomitaka, Asahi; Manickam, Pandiaraj; Kaushik, Ajeet; Bhansali, Shekhar; Nair, Madhavan; Pala, Nezih

2018-02-01

Engineered terahertz (THz) plasmonic metamaterials have emerged as promising platforms for quick infection diagnosis, cost-effective and real-time pharmacology applications owing to their non-destructive and harmless interaction with biological tissues in both in vivo and in vitro assays. As a recent member of THz metamaterials family, toroidal metamaterials have been demonstrated to be supporting high-quality sharp resonance modes. Here we introduce a THz metasensor based on a plasmonic surface consisting of metamolecules that support ultra-narrow toroidal resonances excited by the incident radiation and demonstrate detection of an ultralow concertation targeted biomarker. The toroidal plasmonic metasurface was designed and optimized through extensive numerical studies and fabricated by standard microfabrication techniques. The surface then functionalized by immobilizing the antibody for virus-envelope proteins (ZIKV-EPs) for selective sensing. We sensed and quantified the ZIKV-EP in the assays by measuring the spectral shifts of the toroidal resonances while varying the concentration. In an improved protocol, we introduced gold nanoparticles (GNPs) decorated with the same antibodies onto the metamolecules and monitored the resonance shifts for the same concentrations. Our studies verified that the presence of GNPs enhances capturing of biomarker molecules in the surrounding medium of the metamaterial. By measuring the shift of the toroidal dipolar momentum (up to Δ ω ~0.35 cm -1 ) for different concentrations of the biomarker proteins, we analyzed the sensitivity, repeatability, and limit of detection (LoD) of the proposed toroidal THz metasensor. The results show that up to 100-fold sensitivity enhancement can be obtained by utilizing plasmonic nanoparticles-integrated toroidal metamolecules in comparison to analogous devices. This approach allows for detection of low molecular-weight biomolecules (≈13 kDa) in diluted solutions using toroidal THz plasmonic unit cells.

In Vitro Functional Characterization of GET73 as Possible Negative Allosteric Modulator of Metabotropic Glutamate Receptor 5.

PubMed

Beggiato, Sarah; Borelli, Andrea C; Tomasini, Maria C; Castelli, M Paola; Pintori, Nicholas; Cacciaglia, Roberto; Loche, Antonella; Ferraro, Luca

2018-01-01

The present study was aimed to further characterize the pharmacological profile of N-[4-(trifluoromethyl) benzyl]-4-methoxybutyramide (GET73), a putative negative allosteric modulator (NAM) of metabotropic glutamate subtype 5 receptor (mGluR5) under development as a novel medication for the treatment of alcohol dependence. This aim has been accomplished by means of a series of in vitro functional assays. These assays include the measure of several down-stream signaling [intracellular Ca ++ levels, inositol phosphate (IP) formation and CREB phosphorylation (pCREB)] which are generally affected by mGluR5 ligands. In particular, GET73 (0.1 nM-10 μM) was explored for its ability to displace the concentration-response curve of some mGluR5 agonists/probes (glutamate, L-quisqualate, CHPG) in different native preparations. GET73 produced a rightward shift of concentration-response curves of glutamate- and CHPG-induced intracellular Ca ++ levels in primary cultures of rat cortical astrocytes. The compound also induced a rightward shift of concentration response curve of glutamate- and L-quisqualate-induced increase in IP turnover in rat hippocampus slices, along with a reduction of CHPG (10 mM)-induced increase in IP formation. Moreover, GET73 produced a rightward shift of concentration-response curve of glutamate-, CHPG- and L-quisqualate-induced pCREB levels in rat cerebral cortex neurons. Although the engagement of other targets cannot be definitively ruled out, these data support the view that GET73 acts as an mGluR5 NAM and support the significance of further investigating the possible mechanism of action of the compound.

Sulforaphane and alpha-lipoic acid upregulate the expression of the pi class of glutathione S-transferase through c-jun and Nrf2 activation.

PubMed

Lii, Chong-Kuei; Liu, Kai-Li; Cheng, Yi-Ping; Lin, Ai-Hsuan; Chen, Haw-Wen; Tsai, Chia-Wen

2010-05-01

The anticarcinogenic effect of dietary organosulfur compounds has been partly attributed to their modulation of the activity and expression of phase II detoxification enzymes. Our previous studies indicated that garlic allyl sulfides upregulate the expression of the pi class of glutathione S-transferase (GSTP) through the activator protein-1 pathway. Here, we examined the modulatory effect of sulforaphane (SFN) and alpha-lipoic acid (LA) or dihydrolipoic acid (DHLA) on GSTP expression in rat Clone 9 liver cells. Cells were treated with LA or DHLA (50-600 micromol/L) or SFN (0.2-5 micromol/L) for 24 h. Immunoblots and real-time PCR showed that SFN, LA, and DHLA dose dependently induced GSTP protein and mRNA expression. Compared with the induction by the garlic organosulfur compound diallyl trisulfide (DATS), the effectiveness was in the order of SFN > DATS > LA = DHLA. The increase in GSTP enzyme activity in cells treated with 5 micromol/L SFN, 50 micromol/L DATS, and 600 micromol/L LA and DHLA was 172, 75, 122, and 117%, respectively (P < 0.05). A reporter assay showed that the GSTP enhancer I (GPEI) was required for GSTP induction by the organosulfur compounds. Electromobility gel shift assays showed that the DNA binding of GPEI to nuclear proteins reached a maximum at 0.5-1 h after SFN, LA, and DHLA treatment. Super-shift assay revealed that the transcription factors c-jun and nuclear factor erythroid-2 related factor 2 (Nrf2) were bound to GPEI. These results suggest that SFN and LA in either its oxidized or reduced form upregulate the transcription of the GSTP gene by activating c-jun and Nrf2 binding to the enhancer element GPEI.

The Vibrio parahaemolyticus small RNA RyhB promotes production of the siderophore vibrioferrin by stabilizing the polycistronic mRNA.

PubMed

Tanabe, Tomotaka; Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo

2013-08-01

High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938-6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5'-untranslated region of pvsOp mRNA (pvsOp 5'-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5'-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5'-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5'-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target.

Claudin-1 has tumor suppressive activity and is a direct target of RUNX3 in gastric epithelial cells.

PubMed

Chang, Ti Ling; Ito, Kosei; Ko, Tun Kiat; Liu, Qiang; Salto-Tellez, Manuel; Yeoh, Khay Guan; Fukamachi, Hiroshi; Ito, Yoshiaki

2010-01-01

The transcription factor RUNX3 is a gastric tumor suppressor. Tumorigenic Runx3(-/-) gastric epithelial cells attach weakly to each other, compared with nontumorigenic Runx3(+/+) cells. We aimed to identify RUNX3 target genes that promote cell-cell contact to improve our understanding of RUNX3's role in suppressing gastric carcinogenesis. We compared gene expression profiles of Runx3(+/+) and Runx3(-/-) cells and observed down-regulation of genes associated with cell-cell adhesion in Runx3(-/-) cells. Reporter, mobility shift, and chromatin immunoprecipitation assays were used to examine the regulation of these genes by RUNX3. Tumorigenesis assays and immunohistological analyses of human gastric tumors were performed to confirm the role of the candidate genes in gastric tumor development. Mobility shift and chromatin immunoprecipitation assays revealed that the promoter activity of the gene that encodes the tight junction protein claudin-1 was up-regulated via the binding of RUNX3 to the RUNX consensus sites. The tumorigenicity of gastric epithelial cells from Runx3(-/-) mice was significantly reduced by restoration of claudin-1 expression, whereas knockdown of claudin-1 increased the tumorigenicity of human gastric cancer cells. Concomitant expression of RUNX3 and claudin-1 was observed in human normal gastric epithelium and cancers. The tight junction protein claudin-1 has gastric tumor suppressive activity and is a direct transcriptional target of RUNX3. Claudin-1 is down-regulated during the epithelial-mesenchymal transition; RUNX3 might therefore act as a tumor suppressor to antagonize the epithelial-mesenchymal transition. Copyright 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

The g.763G>C SNP of the bovine FASN gene affects its promoter activity via Sp-mediated regulation: implications for the bovine lactating mammary gland.

PubMed

Ordovás, Laura; Roy, Rosa; Pampín, Sandra; Zaragoza, Pilar; Osta, Rosario; Rodríguez-Rey, Jose Carlos; Rodellar, Clementina

2008-07-15

Fatty acid synthase (FASN) is an enzyme that catalyzes de novo synthesis of fatty acids in cells. The bovine FASN gene maps to BTA 19, where several quantitative trait loci for fat-related traits have been described. Our group recently reported the identification of a single nucleotide polymorphism (SNP), g.763G>C, in the bovine FASN 5' flanking region that was significantly associated with milk fat content in dairy cattle. The g.763G>C SNP was part of a GC-rich region that may constitute a cis element for members of the Sp transcription factor family. Thus the SNP could alter the transcription factor binding ability of the FASN promoter and consequently affect the promoter activity of the gene. However, the functional consequences of the SNP on FASN gene expression are unknown. The present study was therefore directed at elucidating the underlying molecular mechanism that could explain the association of the SNP with milk fat content. Three cellular lines (3T3L1, HepG2, and MCF-7) were used to test the promoter and the transcription factor binding activities by luciferase reporter assays and electrophoretic mobility shift assays, respectively. Band shift assays were also carried out with nuclear extracts from lactating mammary gland (LMG) to further investigate the role of the SNP in this tissue. Our results demonstrate that the SNP alters the bovine FASN promoter activity in vitro and the Sp1/Sp3 binding ability of the sequence. In bovine LMG, the specific binding of Sp3 may account for the association with milk fat content.

High throughput analysis of red wine and grape phenolics-adaptation and validation of methyl cellulose precipitable tannin assay and modified Somers color assay to a rapid 96 well plate format.

PubMed

Mercurio, Meagan D; Dambergs, Robert G; Herderich, Markus J; Smith, Paul A

2007-06-13

The methyl cellulose precipitable (MCP) tannin assay and a modified version of the Somers and Evans color assay were adapted to high-throughput (HTP) analysis. To improve efficiency of the MCP tannin assay, a miniaturized 1 mL format and a HTP format using 96 well plates were developed. The Somers color assay was modified to allow the standardization of pH and ethanol concentrations of wine samples in a simple one-step dilution with a buffer solution, thus removing inconsistencies between wine matrices prior to analysis and allowing for its adaptation to a HTP format. Validation studies showed that all new formats were efficient, and results were reproducible and analogous to the original formats.

The SNPforID Assay as a Supplementary Method in Kinship and Trace Analysis

PubMed Central

Schwark, Thorsten; Meyer, Patrick; Harder, Melanie; Modrow, Jan-Hendrick; von Wurmb-Schwark, Nicole

2012-01-01

Objective Short tandem repeat (STR) analysis using commercial multiplex PCR kits is the method of choice for kinship testing and trace analysis. However, under certain circumstances (deficiency testing, mutations, minute DNA amounts), STRs alone may not suffice. Methods We present a 50-plex single nucleotide polymorphism (SNP) assay based on the SNPs chosen by the SNPforID consortium as an additional method for paternity and for trace analysis. The new assay was applied to selected routine paternity and trace cases from our laboratory. Results and Conclusions Our investigation shows that the new SNP multiplex assay is a valuable method to supplement STR analysis, and is a powerful means to solve complicated genetic analyses. PMID:22851934

The PedR transcriptional regulator interacts with thioredoxin to connect photosynthesis with gene expression in cyanobacteria.

PubMed

Horiuchi, Mayumi; Nakamura, Kinu; Kojima, Kouji; Nishiyama, Yoshitaka; Hatakeyama, Wakako; Hisabori, Toru; Hihara, Yukako

2010-10-01

The redox state of the photosynthetic electron transport chain acts as a critical sensing mechanism by regulating the transcription of key genes involved in the acclimation response to a change in the environment. In the present study we show that the small LuxR-type regulator PedR interacts with Trx (thioredoxin) to achieve photosynthetic electron-transport-dependent transcriptional regulation in the cyanobacterium Synechocystis sp. PCC 6803. TrxM, an isoform of Trx, was isolated as an interacting factor of PedR by pull-down assays. In vitro analysis revealed that the intermolecular disulfide bond formed between Cys80 residues of the PedR homodimer was reduced by both TrxM and TrxX. It has been shown previously that, although PedR is active under low-light conditions, it becomes transiently inactivated following a shift to high-light conditions, with a concomitant conformational change [Nakamura and Hihara (2006) J. Biol. Chem. 281, 36758-36766]. In the present study, we found that the conformational change of PedR and the change in the transcript level of its target gene were minimal when mutants of Synechocystis that lack ferredoxin-Trx reductase or NADPH-Trx reductase were exposed to high levels of light. These results indicate that the reduction of PedR by Trx causes transient inactivation of PedR upon the shift of cyanobacterial cells to high-light conditions.

Novel red fluorescence protein based microplate assay for drug screening against dormant Mycobacterium tuberculosis by using paraffin.

PubMed

Yeware, Amar; Sarkar, Dhiman

2018-05-01

The hypoxia model of dormancy is widely used in drug screening programs to identify novel inhibitors against latent Mycobacterium tuberculosis disease. In earlier reported microplate assays, hypoxia was maintained by either sealing the microplate or shifting in an anaerobic chamber to develop dormant phenotype. In these assays, inhibitors were added during inoculation, which mainly represents the active stage inhibitors instead of the dormant ones. Herein, the culture was covered with paraffin to develop hypoxia condition and consequently providing the advantage of adding compounds at any stage during incubation of 96-well plate. The stable expression of the red fluorescent protein in the bacilli under both actively growing as well as dormant conditions also facilitate the reliable estimation of growth and inhibition kinetics of bacilli in medium. Furthermore, S/N ratio and Z' factor of this assay were found to be > 27 and 0.91-0.94 respectively, which confirm the robustness of the protocol. This newly developed drug-screening assay offers an easy, inexpensive, safe and high throughput-screening tool to search novel antitubercular inhibitors against both active and dormant bacilli. The red fluorescent H37Ra strain is a suitable surrogate for the more virulent H37Rv strain, and thus this effort will help in combating latent tuberculosis. Copyright © 2018 Elsevier Ltd. All rights reserved.

A novel cerium oxide nanoparticles-based colorimetric sensor using tetramethyl benzidine reagent for antioxidant activity assay.

PubMed

Ozdemir Olgun, F Ayca; Üzer, Ayşem; Ozturk, Birsen Demirata; Apak, Reşat

2018-05-15

Antioxidant activity (AOA) assays using nanotechnology are recently developed utilizing nanoparticles of transition metal oxides, especially nanoceria that can switch between trivalent and tetravalent oxidation states of cerium. Cerium oxide nanoparticles (CeO-NPs) may act as both an oxidant and an antioxidant, depending on the preparation method and particle size. A novel colorimetric sensor for AOA assay is proposed with the use of poly(acrylic acid) sodium salt (PAANa)-coated CeO-NPs. PAANa-coated CeO-NPs oxidized tetramethyl benzidine (TMB), a peroxidase substrate, in a slightly acidic solution at pH 4.0 to a blue charge-transfer complex. Antioxidants decreased the color intensity of the nanoceria suspension, and were indirectly determined by absorbance difference. Detection limits, linearity, additivity and precision were calculated, e.g., quercetin quantification with the proposed assay showed a detection limit of 8.25 × 10 -9 mol L -1 . The trolox equivalent antioxidant capacities of hydrophilic and lipophilic antioxidants were compatible with those of conventional antioxidant assays. Potential interferents such as glucose, citric acid, mannitol, sorbitol and benzoic acid did not adversely affect AOA determination. The developed sensor is more sensitive and selective than similar colorimetric sensors relying on the intrinsic color change of nanoceria. The measurement wavelength is sufficiently red-shifted, preventing possible interferences from plant pigments. Copyright © 2018 Elsevier B.V. All rights reserved.

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

The glucose oxidase-peroxidase assay for glucose

USDA-ARS?s Scientific Manuscript database

The glucose oxidase-peroxidase assay for glucose has served as a very specific, sensitive, and repeatable assay for detection of glucose in biological samples. It has been used successfully for analysis of glucose in samples from blood and urine, to analysis of glucose released from starch or glycog...

Identification of moesin as NKCC2-interacting protein and analysis of its functional role in the NKCC2 apical trafficking.

PubMed

Carmosino, Monica; Rizzo, Federica; Procino, Giuseppe; Zolla, Lello; Timperio, Anna Maria; Basco, Davide; Barbieri, Claudia; Torretta, Silvia; Svelto, Maria

2012-11-01

The renal Na(+) -K(+) -2Cl(-) co-transporter (NKCC2) is expressed in kidney thick ascending limb cells, where it mediates NaCl re-absorption regulating body salt levels and blood pressure. In this study, we used a well-characterised NKCC2 construct (c-NKCC2) to identify NKCC2-interacting proteins by an antibody shift assay coupled with blue native/SDS-PAGE and mass spectrometry. Among the interacting proteins, we identified moesin, a protein belonging to ezrin, eadixin and moesin family. Co-immunoprecipitation experiments confirmed that c-NKCC2 interacts with the N-terminal domain of moesin in LLC-PK1 cells. Moreover, c-NKCC2 accumulates in intracellular and sub-apical vesicles in cells transfected with a moesin dominant negative green fluorescent protien (GFP)-tagged construct. In addition, moesin knock-down by short interfering RNA decreases by about 50% c-NKCC2 surface expression. Specifically, endocytosis and exocytosis assays showed that moesin knock-down does not affect c-NKCC2 internalisation but strongly reduces exocytosis of the co-transporter. Our data clearly demonstrate that moesin plays a critical role in apical membrane insertion of NKCC2, suggesting a possible involvement of moesin in regulation of Na(+) and Cl(-) absorption in the kidney. Copyright © 2012 Soçiété Francaise des Microscopies and Société de Biologie Cellulaire de France.

Promotion of stem cell proliferation by vegetable peptone.

PubMed

Lee, J; Lee, J; Hwang, H; Jung, E; Huh, S; Hyun, J; Park, D

2009-10-01

Technical limitations and evolution of therapeutic applications for cell culture-derived products have accelerated elimination of animal-derived constituents from such products to minimize inadvertent introduction of microbial contaminants, such as fungi, bacteria or viruses. The study described here was conducted to investigate the proliferative effect of vegetable peptone on adult stem cells in the absence of serum, and its possible mechanisms of action. Cell viability and proliferation were determined using the MTT assay and Click-iT EdU flow cytometry, respectively. In addition, changes in expression of cytokine genes were analysed using MILLIPLEX human cytokine enzyme-linked immunosorbent assay kit. Viability of cord blood-derived mesenchymal stem cells (CB-MSC) and adipose tissue-derived stem cells (ADSC) increased significantly when treated with the peptone. In addition, median value of the group treated with peptone shifted to the right when compared to the untreated control group. Furthermore, quantitative analysis of the cytokines revealed that production of vascular endothelial growth factor (VEGF), transforming growth factor-beta1 (TGF-beta1), and interleukin-6 (IL-6) increased significantly in response to treatment with our vegetable peptone in both CB-MSCs and ADSCs. Our findings revealed that the vegetable peptone promotes proliferation of CB-MSCs and ADSCs. In addition, results of this study suggest that induction of stem cell proliferation by vegetable peptone is likely to be related to its induction of VEGF, TGF-beta1, and IL-6 expression.

Resveratrol-induced transcriptional up-regulation of ASMase (SMPD1) of human leukemia and cancer cells.

PubMed

Mizutani, Naoki; Omori, Yukari; Kawamoto, Yoshiyuki; Sobue, Sayaka; Ichihara, Masatoshi; Suzuki, Motoshi; Kyogashima, Mamoru; Nakamura, Mitsuhiro; Tamiya-Koizumi, Keiko; Nozawa, Yoshinori; Murate, Takashi

2016-02-19

Resveratrol (RSV) is a plant-derived phytoalexin present in plants, whose pleiotropic effects for health benefits have been previously reported. Its anti-cancer activity is among the current topics for novel cancer treatment. Here, effects of RSV on cell proliferation and the sphingolipid metabolism of K562, a human leukemia cell line, were analyzed. Some experiments were also performed in HCT116, a human colon cancer cell line. RSV inhibited cell proliferation of both cell lines. Increased cellular ceramide and decreased sphingomyelin and S1P by RSV were observed in RSV-treated K562 cells. Further analysis revealed that acid sphingomyelinase mRNA and enzyme activity levels were increased by RSV. Desipramine, a functional ASMase inhibitor, prevented RSV-induced ceramide increase. RSV increased ATF3, EGR1, EGR3 proteins and phosphorylated c-Jun and FOXO3. However, co-transfection using these transcription factor expression vectors and ASMase promoter reporter vector revealed positive effects of EGR1 and EGR3 but not others. Electrophoresis mobility shift assay (EMSA) and Chromatin immunoprecipitation (ChIP) assay demonstrated the direct binding of EGR1/3 transcription factors with ASMase 5'-promoter. These results indicate that increased EGR1/3 and ASMase expression play an important role in cellular ceramide increase by RSV treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

Conditions Affecting Social Space in Drosophila melanogaster.

PubMed

McNeil, Alison R; Jolley, Sam N; Akinleye, Adesanya A; Nurilov, Marat; Rouzyi, Zulekha; Milunovich, Austin J; Chambers, Moria C; Simon, Anne F

2015-11-05

The social space assay described here can be used to quantify social interactions of Drosophila melanogaster - or other small insects - in a straightforward manner. As we previously demonstrated (1), in a two-dimensional chamber, we first force the flies to form a tight group, subsequently allowing them to take their preferred distance from each other. After the flies have settled, we measure the distance to the closest neighbor (or social space), processing a static picture with free online software (ImageJ). The analysis of the distance to the closest neighbor allows researchers to determine the effects of genetic and environmental factors on social interaction, while controlling for potential confounding factors. Diverse factors such as climbing ability, time of day, sex, and number of flies, can modify social spacing of flies. We thus propose a series of experimental controls to mitigate these confounding effects. This assay can be used for at least two purposes. First, researchers can determine how their favorite environmental shift (such as isolation, temperature, stress or toxins) will impact social spacing (1,2). Second, researchers can dissect the genetic and neural underpinnings of this basic form of social behavior (1,3). Specifically, we used it as a diagnostic tool to study the role of orthologous genes thought to be involved in social behavior in other organisms, such as candidate genes for autism in humans (4).

STAT3-activated CD36 facilitates fatty acid uptake in chronic lymphocytic leukemia cells

PubMed Central

Rozovski, Uri; Harris, David M.; Li, Ping; Liu, Zhiming; Jain, Preetesh; Ferrajoli, Alessandra; Burger, Jan; Thompson, Phillip; Jain, Nitin; Wierda, William; Keating, Michael J.; Estrov, Zeev

2018-01-01

Although several studies established that unlike normal B cells chronic lymphocytic leukemia (CLL) cells metabolize fatty acids (FA), how CLL cells internalize FA is poorly understood. Because in various cell types CD36 facilitates FA uptake, we wondered whether a similar mechanism is operative CLL. We found that CD36 levels are higher in CLL cells than in normal B cells, and that small interfering RNA, CD36 neutralizing antibodies or sulfosuccinimidyl oleate (SSO) that inhibits CD36 significantly reduced the oxygen consumption of CLL cells incubated with FA. Because CD36 is oeverexpressed and STAT3 is constitutively activated in CLL cells, we wondered whether STAT3 induces CD36 expression. Sequence analysis identified putative STAT3 binding sites in the CD36 gene promoter. Chromatin immunoprecipitation and an electrophoretic mobility shift assay revealed that STAT3 binds to the CD36 gene promoter. A luciferase assay and STAT3-small hairpin RNA, that significantly decreased the levels of CD36 in CLL cells, established that STAT3 activates the transcription of the CD36 gene. Furthermore, SSO induced a dose-dependent apoptosis of CLL cells. Taken together, our data suggest that STAT3 activates CD36 and that CD36 facilitates FA uptake in CLL cells. Whether CD36 inhibition would provide clinical benefits in CLL remains to be determined. PMID:29765537

The kinetics-based enzyme-linked immunosorbent assay for coronavirus antibodies in cats: calibration to the indirect immunofluorescence assay and computerized standardization of results through normalization to control values.

PubMed Central

Barlough, J E; Jacobson, R H; Downing, D R; Lynch, T J; Scott, F W

1987-01-01

The computer-assisted, kinetics-based enzyme-linked immunosorbent assay for coronavirus antibodies in cats was calibrated to the conventional indirect immunofluorescence assay by linear regression analysis and computerized interpolation (generation of "immunofluorescence assay-equivalent" titers). Procedures were developed for normalization and standardization of kinetics-based enzyme-linked immunosorbent assay results through incorporation of five different control sera of predetermined ("expected") titer in daily runs. When used with such sera and with computer assistance, the kinetics-based enzyme-linked immunosorbent assay minimized both within-run and between-run variability while allowing also for efficient data reduction and statistical analysis and reporting of results. PMID:3032390

The kinetics-based enzyme-linked immunosorbent assay for coronavirus antibodies in cats: calibration to the indirect immunofluorescence assay and computerized standardization of results through normalization to control values.

PubMed

Barlough, J E; Jacobson, R H; Downing, D R; Lynch, T J; Scott, F W

1987-01-01

The computer-assisted, kinetics-based enzyme-linked immunosorbent assay for coronavirus antibodies in cats was calibrated to the conventional indirect immunofluorescence assay by linear regression analysis and computerized interpolation (generation of "immunofluorescence assay-equivalent" titers). Procedures were developed for normalization and standardization of kinetics-based enzyme-linked immunosorbent assay results through incorporation of five different control sera of predetermined ("expected") titer in daily runs. When used with such sera and with computer assistance, the kinetics-based enzyme-linked immunosorbent assay minimized both within-run and between-run variability while allowing also for efficient data reduction and statistical analysis and reporting of results.

Association between rotating night shift work and metabolic syndrome in Korean workers: differences between 8-hour and 12-hour rotating shift work.

PubMed

Oh, Jae-Il; Yim, Hyeon Woo

2018-02-07

This study aimed to analyze the association between the shift work schedule and metabolic syndrome (MetS). This is a retrospective longitudinal study based on the 2015 health checkup data of 2,090 workers evaluated for MetS in 2010 at a general hospital in Korea. The participants were divided according to their shift work schedule into daytime, three-shift (8-h rotation), and two-shift (12-h rotation) workers. The index that indicates the association between the shift work schedule and MetS is the odds ratio (OR) calculated using multivariate logistic regression. The analysis for the entire group of workers indicated that there was positive association between two-shift rotation and MetS (OR=1.58, 95% confidence interval [CI]: 1.09, 2.29). In the analysis of rotating night-shift workers, the years of rotating night shifts, frequency of night-shift work, and sleep disturbance were added to the confounding variables, and two-shift work remained positively associated with MetS (OR=1.72, 95% CI: 1.10, 2.70). The risk of MetS differs based on the shift work schedules they engage in. Hence, structural changes to the shift work schedules are required to prevent MetS in night-shift workers.

Association between rotating night shift work and metabolic syndrome in Korean workers: differences between 8-hour and 12-hour rotating shift work

PubMed Central

OH, Jae-Il; YIM, Hyeon Woo

2017-01-01

This study aimed to analyze the association between the shift work schedule and metabolic syndrome (MetS). This is a retrospective longitudinal study based on the 2015 health checkup data of 2,090 workers evaluated for MetS in 2010 at a general hospital in Korea. The participants were divided according to their shift work schedule into daytime, three-shift (8-h rotation), and two-shift (12-h rotation) workers. The index that indicates the association between the shift work schedule and MetS is the odds ratio (OR) calculated using multivariate logistic regression. The analysis for the entire group of workers indicated that there was positive association between two-shift rotation and MetS (OR=1.58, 95% confidence interval [CI]: 1.09, 2.29). In the analysis of rotating night-shift workers, the years of rotating night shifts, frequency of night-shift work, and sleep disturbance were added to the confounding variables, and two-shift work remained positively associated with MetS (OR=1.72, 95% CI: 1.10, 2.70). The risk of MetS differs based on the shift work schedules they engage in. Hence, structural changes to the shift work schedules are required to prevent MetS in night-shift workers. PMID:29046489

A meta-analysis including dose-response relationship between night shift work and the risk of colorectal cancer.

PubMed

Wang, Xiao; Ji, Alin; Zhu, Yi; Liang, Zhen; Wu, Jian; Li, Shiqi; Meng, Shuai; Zheng, Xiangyi; Xie, Liping

2015-09-22

A meta-analysis was conducted to quantitatively evaluate the correlation between night shift work and the risk of colorectal cancer. We searched for publications up to March 2015 using PubMed, Web of Science, Cochrane Library, EMBASE and the Chinese National Knowledge Infrastructure databases, and the references of the retrieved articles and relevant reviews were also checked. OR and 95% CI were used to assess the degree of the correlation between night shift work and risk of colorectal cancer via fixed- or random-effect models. A dose-response meta-analysis was performed as well. The pooled OR estimates of the included studies illustrated that night shift work was correlated with an increased risk of colorectal cancer (OR = 1.318, 95% CI 1.121-1.551). No evidence of publication bias was detected. In the dose-response analysis, the rate of colorectal cancer increased by 11% for every 5 years increased in night shift work (OR = 1.11, 95% CI 1.03-1.20). In conclusion, this meta-analysis indicated that night shift work was associated with an increased risk of colorectal cancer. Further researches should be conducted to confirm our findings and clarify the potential biological mechanisms.

EPA protects against muscle damage in the mdx mouse model of Duchenne muscular dystrophy by promoting a shift from the M1 to M2 macrophage phenotype.

PubMed

Carvalho, Samara Camaçari de; Apolinário, Leticia Montanholi; Matheus, Selma Maria Michelin; Santo Neto, Humberto; Marques, Maria Julia

2013-11-15

In dystrophic mdx mice and in Duchenne muscular dystrophy, inflammation contributes to myonecrosis. Previously, we demonstrated that eicosapentaenoic acid (EPA) decreased inflammation and necrosis in dystrophic muscle. In the present study, we examined the effects of EPA and the corticoid deflazacort (DFZ) as modulators of M1 (iNOS-expressing cells) and M2 (CD206-expressing cells) macrophages. Mdx mice (14 days old) received EPA or DFZ for 16 days. The diaphragm, biceps brachii and quadriceps muscles were studied. Immunofluorescence, immunoblotting and ELISA assays showed that EPA increased interleucin-10, reduced interferon-γ and was more effective than DFZ in promoting a shift from M1 to M2. © 2013.

Comparison of human immunodeficiency virus type 1 tropism profiles in clinical samples by the Trofile and MT-2 assays.

PubMed

Coakley, Eoin; Reeves, Jacqueline D; Huang, Wei; Mangas-Ruiz, Marga; Maurer, Irma; Harskamp, Agnes M; Gupta, Soumi; Lie, Yolanda; Petropoulos, Christos J; Schuitemaker, Hanneke; van 't Wout, Angélique B

2009-11-01

The recent availability of CCR5 antagonists as anti-human immunodeficiency virus (anti-HIV) therapeutics has highlighted the need to accurately identify CXCR4-using variants in patient samples when use of this new drug class is considered. The Trofile assay (Monogram Biosciences) has become the method that is the most widely used to define tropism in the clinic prior to the use of a CCR5 antagonist. By comparison, the MT-2 assay has been used since early in the HIV epidemic to define tropism in clinical specimens. Given that there are few data from direct comparisons of these two assays, we evaluated the performance of the plasma-based Trofile assay and the peripheral blood mononuclear cell (PBMC)-based MT-2 assay for the detection of CXCR4 use in defining the tropism of HIV isolates derived from clinical samples. The various samples used for this comparison were derived from participants of the Amsterdam Cohort Studies on HIV infection and AIDS who underwent consecutive MT-2 assay testing of their PBMCs at approximately 3-month intervals. This unique sample set was specifically selected because consecutive MT-2 assays had demonstrated a shift from negative to positive in PBMCs, reflecting the first emergence of CXCR4-using virus in PBMCs above the level of detection of the assay in these individuals. Trofile testing was performed with clonal HIV type 1 (HIV-1) variants (n = 21), MT-2 cell culture-derived cells (n = 20) and supernatants (n = 42), and plasma samples (n = 76). Among the clonal HIV-1 variants and MT-2 cell culture-derived samples, the results of the Trofile and MT-2 assays demonstrated a high degree of concordance (95% to 98%). Among consecutive plasma samples, detection of CXCR4-using virus was at or before the time of first detection by the MT-2 assay in 5/10 patients by the original Trofile assay and in 9/10 patients by the enhanced-sensitivity Trofile assay. Differences in the time to the first detection of CXCR4 use between the MT-2 assay (PBMCs) and the original Trofile assay (plasma) were greatly reduced by the enhanced-sensitivity Trofile assay, suggesting that sensitivity for the detection of minor CXCR4-using variants may be a more important determinant of discordant findings than compartmentalization. The similarities in performance of the enhanced-sensitivity Trofile and MT-2 assays suggest that either may be an appropriate methodology to define tropism in patient specimens.

Multi-platform metabolomics assays for human lung lavage fluids in an air pollution exposure study.

PubMed

Surowiec, Izabella; Karimpour, Masoumeh; Gouveia-Figueira, Sandra; Wu, Junfang; Unosson, Jon; Bosson, Jenny A; Blomberg, Anders; Pourazar, Jamshid; Sandström, Thomas; Behndig, Annelie F; Trygg, Johan; Nording, Malin L

2016-07-01

Metabolomics protocols are used to comprehensively characterize the metabolite content of biological samples by exploiting cutting-edge analytical platforms, such as gas chromatography (GC) or liquid chromatography (LC) coupled to mass spectrometry (MS) assays, as well as nuclear magnetic resonance (NMR) assays. We have developed novel sample preparation procedures combined with GC-MS, LC-MS, and NMR metabolomics profiling for analyzing bronchial wash (BW) and bronchoalveolar lavage (BAL) fluid from 15 healthy volunteers following exposure to biodiesel exhaust and filtered air. Our aim was to investigate the responsiveness of metabolite profiles in the human lung to air pollution exposure derived from combustion of biofuels, such as rapeseed methyl ester biodiesel, which are increasingly being promoted as alternatives to conventional fossil fuels. Our multi-platform approach enabled us to detect the greatest number of unique metabolites yet reported in BW and BAL fluid (82 in total). All of the metabolomics assays indicated that the metabolite profiles of the BW and BAL fluids differed appreciably, with 46 metabolites showing significantly different levels in the corresponding lung compartments. Furthermore, the GC-MS assay revealed an effect of biodiesel exhaust exposure on the levels of 1-monostearylglycerol, sucrose, inosine, nonanoic acid, and ethanolamine (in BAL) and pentadecanoic acid (in BW), whereas the LC-MS assay indicated a shift in the levels of niacinamide (in BAL). The NMR assay only identified lactic acid (in BW) as being responsive to biodiesel exhaust exposure. Our findings demonstrate that the proposed multi-platform approach is useful for wide metabolomics screening of BW and BAL fluids and can facilitate elucidation of metabolites responsive to biodiesel exhaust exposure. Graphical Abstract Graphical abstract illustrating the study workflow. NMR Nuclear Magnetic Resonance, LC-TOFMS Liquid chromatography-Time Of Flight Mass Spectrometry, GC Gas Chromatography-Mass spectrometry.

A complementation assay for in vivo protein structure/function analysis in Physcomitrella patens (Funariaceae)

DOE PAGES

Scavuzzo-Duggan, Tess R.; Chaves, Arielle M.; Roberts, Alison W.

2015-07-14

Here, a method for rapid in vivo functional analysis of engineered proteins was developed using Physcomitrella patens. A complementation assay was designed for testing structure/function relationships in cellulose synthase (CESA) proteins. The components of the assay include (1) construction of test vectors that drive expression of epitope-tagged PpCESA5 carrying engineered mutations, (2) transformation of a ppcesa5 knockout line that fails to produce gametophores with test and control vectors, (3) scoring the stable transformants for gametophore production, (4) statistical analysis comparing complementation rates for test vectors to positive and negative control vectors, and (5) analysis of transgenic protein expression by Westernmore » blotting. The assay distinguished mutations that generate fully functional, nonfunctional, and partially functional proteins. In conclusion, compared with existing methods for in vivo testing of protein function, this complementation assay provides a rapid method for investigating protein structure/function relationships in plants.« less

The Role ERG and CXCR4 in Prostate Cancer Progression

DTIC Science & Technology

2011-06-01

axis functions in PC progression to enhance invasion and metastasis. To address the regulation of CXCR4 expression, we identified several putative ERG...interaction between ERG factor and CXCR4 gene promoter and link these activities with TMPRSS2-ERG translocations and enhanced metastasis of tumor cells via...and increased VCaP nuclear extract protein in assay enhanced the intensity of bands (Figure 1D). Inclusion of anti-ERG antibodies super shifted

Genomic Instability and Breast Cancer

DTIC Science & Technology

2011-06-01

Survival Assay—Atotal of 1 103 cells were seeded onto a 60-mm dish in triplicate. Twenty-four hours after seeding, cells were irradiated by using a JL...ShepherdMark I-68A 137Cs- irradiator at indicated doses and incubated for 14 days. Result- ing colonies were fixed and stainedwithCoomassie Blue. Num...antibodies, cell culture, transfection and siRNAs, DNA substrates protein purification in insect cells, electrophoretic mobility shift assay and the ATPase

Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

PubMed

Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

2008-01-01

Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

Fluidics platform and method for sample preparation and analysis

DOEpatents

Benner, W. Henry; Dzenitis, John M.; Bennet, William J.; Baker, Brian R.

2014-08-19

Herein provided are fluidics platform and method for sample preparation and analysis. The fluidics platform is capable of analyzing DNA from blood samples using amplification assays such as polymerase-chain-reaction assays and loop-mediated-isothermal-amplification assays. The fluidics platform can also be used for other types of assays and analyzes. In some embodiments, a sample in a sealed tube can be inserted directly. The following isolation, detection, and analyzes can be performed without a user's intervention. The disclosed platform may also comprises a sample preparation system with a magnetic actuator, a heater, and an air-drying mechanism, and fluid manipulation processes for extraction, washing, elution, assay assembly, assay detection, and cleaning after reactions and between samples.

Oxidative stress: a key regulator of leiomyoma cell survival.

PubMed

Fletcher, Nicole M; Abusamaan, Mohammed S; Memaj, Ira; Saed, Mohammed G; Al-Hendy, Ayman; Diamond, Michael P; Saed, Ghassan M

2017-06-01

To determine the effects of attenuating oxidative stress with the use of dichloroacetate (DCA) on the expression of key redox enzymes myeloperoxidase (MPO) and inducible nitric oxide synthase (iNOS) as well as on apoptosis. Prospective experimental study. University medical center. Cells established from myometrium and uterine fibroid from the same patients. Cells were exposed to normal (20% O 2 ) or hypoxic (2% O 2 ) conditions for 24 hours with or without DCA (20 μg/mL), a metabolic modulator that shifts anaerobic to aerobic metabolism. Nitrate/nitrite (iNOS activity indicator), iNOS, Bcl-2/Bax ratio, MPO, and caspase-3 activities and levels were determined by means of Greiss assay, real-time reverse-transcription polymerase chain reaction, and ELISA. Data were analyzed with the use of SPSS by means of one-way analysis of variance with Tukey post hoc analysis and independent t tests. MPO, iNOS, and nitrate/nitrite expression were higher in leiomyoma than in myometrial cells, and they were further enhanced by hypoxia in myometrial cells. Treatment with the use of DCA decreased MPO, iNOS, and nitrate/nitrite levels and negated the effect of hypoxia in both types of cells. Leiomyoma cells showed less apoptosis, as indicated by both caspase-3 activity and the Bcl-2/Bax ratio, than myometrial cells. Hypoxia further decreased apoptosis in myometrial cells with no further effect on leiomyoma cells. Treatment with DCA resulted in increased apoptosis in both types of cells, even in the presence of hypoxia. Shifting anaerobic to aerobic metabolism with the use of DCA resulted in an increase in apoptosis in leiomyoma cells and protected myometrial cells from the acquisition of the leiomyoma-like phenotype. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Two-dimensional tracking of ncd motility by back focal plane interferometry.

PubMed Central

Allersma, M W; Gittes, F; deCastro, M J; Stewart, R J; Schmidt, C F

1998-01-01

A technique for detecting the displacement of micron-sized optically trapped probes using far-field interference is introduced, theoretically explained, and used to study the motility of the ncd motor protein. Bead motions in the focal plane relative to the optical trap were detected by measuring laser intensity shifts in the back-focal plane of the microscope condenser by projection on a quadrant diode. This detection method is two-dimensional, largely independent of the position of the trap in the field of view and has approximately 10-micros time resolution. The high resolution makes it possible to apply spectral analysis to measure dynamic parameters such as local viscosity and attachment compliance. A simple quantitative theory for back-focal-plane detection was derived that shows that the laser intensity shifts are caused primarily by a far-field interference effect. The theory predicts the detector response to bead displacement, without adjustable parameters, with good accuracy. To demonstrate the potential of the method, the ATP-dependent motility of ncd, a kinesin-related motor protein, was observed with an in vitro bead assay. A fusion protein consisting of truncated ncd (amino acids 195-685) fused with glutathione-S-transferase was adsorbed to silica beads, and the axial and lateral motions of the beads along the microtubule surface were observed with high spatial and temporal resolution. The average axial velocity of the ncd-coated beads was 230 +/- 30 nm/s (average +/- SD). Spectral analysis of bead motion showed the increase in viscous drag near the surface; we also found that any elastic constraints of the moving motors are much smaller than the constraints due to binding in the presence of the nonhydrolyzable nucleotide adenylylimidodiphosphate. PMID:9533719

Pharmacological and biochemical analysis of FPL 67156, a novel, selective inhibitor of ecto-ATPase.

PubMed Central

Crack, B E; Pollard, C E; Beukers, M W; Roberts, S M; Hunt, S F; Ingall, A H; McKechnie, K C; IJzerman, A P; Leff, P

1995-01-01

1. FPL 67156 (6-N,N-diethyl-beta, gamma-dibromomethylene-D-ATP), is a newly synthesized analogue of ATP. 2. In a rabbit isolated tracheal epithelium preparation, measuring P2U-purinoceptor-dependent chloride secretion, FPL 67156 was discovered to potentiate the responses to UTP but not those to ATP-gamma-S. UTP agonist-concentration effect (E/[A]) curves were shifted to the left by 5-fold in the presence of 100 microM FPL 67156. The differential effect of FPL 67156 on UTP and ATP-gamma-S was hypothesized to be due to the greater susceptibility of UTP to enzymatic dephosphorylation and the ability of FPL 67156 to inhibit this process. 3. FPL 67156 was tested as an ecto-ATPase inhibitor in a human blood cell assay, measuring [gamma 32P]-ATP dephosphorylation. The compound inhibited [gamma 32P]-ATP degradation with a pIC50 of 4.6. 4. FPL 67156 was then tested for its effects on ATP and alpha, beta-methylene-ATP responses at P2X-purinoceptors in the rabbit isolated ear artery. In the concentration range 30 microM-1 mM, the compound potentiated the contractile effects of ATP but not those of alpha, beta-methylene-ATP. At 1 mM, FPL 67156 produced a 34-fold leftward shift of ATP E/[A] curves. 5. The effects of FPL 67156 on ATP E/[A] curves in the rabbit ear artery were analyzed using a theoretical model (Furchgott, 1972) describing the action of an enzyme inhibitor on the effects of a metabolically unstable agonist. This analysis provided an estimate of the pKi for FPL 67156 as an ecto-ATPase inhibitor of 5.2.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7533620

3D printed conformal microfluidics for isolation and profiling of biomarkers from whole organs.

PubMed

Singh, Manjot; Tong, Yuxin; Webster, Kelly; Cesewski, Ellen; Haring, Alexander P; Laheri, Sahil; Carswell, Bill; O'Brien, Timothy J; Aardema, Charles H; Senger, Ryan S; Robertson, John L; Johnson, Blake N

2017-07-25

The ability to interface microfluidic devices with native complex biological architectures, such as whole organs, has the potential to shift the paradigm for the study and analysis of biological tissue. Here, we show 3D printing can be used to fabricate bio-inspired conformal microfluidic devices that directly interface with the surface of whole organs. Structured-light scanning techniques enabled the 3D topographical matching of microfluidic device geometry to porcine kidney anatomy. Our studies show molecular species are spontaneously transferred from the organ cortex to the conformal microfluidic device in the presence of fluid flow through the organ-conforming microchannel. Large animal studies using porcine kidneys (n = 32 organs) revealed the profile of molecular species in the organ-conforming microfluidic stream was dependent on the organ preservation conditions. Enzyme-linked immunosorbent assay (ELISA) studies revealed conformal microfluidic devices isolate clinically relevant metabolic and pathophysiological biomarkers from whole organs, including heat shock protein 70 (HSP-70) and kidney injury molecule-1 (KIM-1), which were detected in the microfluidic device as high as 409 and 12 pg mL -1 , respectively. Overall, these results show conformal microfluidic devices enable a novel minimally invasive 'microfluidic biopsy' technique for isolation and profiling of biomarkers from whole organs within a clinically relevant interval. This achievement could shift the paradigm for whole organ preservation and assessment, thereby helping to relieve the organ shortage crisis through increased availability and quality of donor organs. Ultimately, this work provides a major advance in microfluidics through the design and manufacturing of organ-conforming microfluidic devices and a novel technique for microfluidic-based analysis of whole organs.

Molecular Diagnosis for Nodal Metastasis in Endoscopically Managed Cervical Cancer: The Accuracy of the APTIMA Test to Detect High-risk Human Papillomavirus Messenger RNA in Sentinel Lymph Nodes.

PubMed

Köhler, Christhardt; Le, Xin; Dogan, Nasuh Utku; Pfiffer, Tatiana; Schneider, Achim; Marnitz, Simone; Bertolini, Julia; Favero, Giovanni

2016-01-01

To evaluate the feasibility and accuracy of a commercially available test to detect E6/E7 mRNA of 14 subtypes of high-risk HPVs (APTIMA; Hologic, Bedford, MA) in the sentinel lymph nodes of CC patients laparoscopically operated. Prospective pilot study. The study was conducted in the Department of Advanced Operative and Oncologic Gynecology, Asklepios Hospital, Hamburg, Germany. 54 women with HPV-positive CC submitted to laparoscopic sentinel node biopsy alone or sentinel node biopsy followed by systematic pelvic and/or para-aortic endoscopic lymphadenectomy. All removed sentinel lymph nodes (SLNs) underwent sample collection by cytobrush for the APTIMA assay before frozen section. Results obtained with the HPV mRNA test were compared with the definitive histopathological analysis of the SLNs and additional lymph nodes removed. A total of 125 SLNs (119 pelvic and 6 paraaortic) were excised with a mean number of 2.3 SLNs per patient. Final histopathologic analysis confirmed nodal metastases in 10 SLNs from 10 different patients (18%). All the histologically confirmed metastatic lymph nodes were also HPV E6/E7 mRNA positive, resulting in a sensitivity of 100%. Four histologically free sentinel nodes were positive for HPV E6/E7 mRNA, resulting in a specificity of 96.4%. The HPV E6/E7 mRNA assay in the SLNs of patients with CC is feasible and highly accurate. The detection of HPV mRNA in 4 women with negative SLNs might denote a shift from microscopic identification of metastasis to the molecular level. The prognostic value of this findings awaits further verification. Copyright © 2016. Published by Elsevier Inc.

Stage-specific control of connective tissue growth factor (CTGF/CCN2) expression in chondrocytes by Sox9 and beta-catenin.

PubMed

Huang, Bau-Lin; Brugger, Sean M; Lyons, Karen M

2010-09-03

CCN2/connective tissue growth factor is highly expressed in hypertrophic chondrocytes and is required for chondrogenesis. However, the transcriptional mechanisms controlling its expression in cartilage are largely unknown. The activity of the Ccn2 promoter was, therefore, investigated in osteochondro-progenitor cells and hypertrophic chondrocytes to ascertain these mechanisms. Sox9 and T-cell factor (TCF) x lymphoid enhancer factor (LEF) factors contain HMG domains and bind to related consensus sites. TCF x LEF factors are normally repressive but when bound to DNA in a complex with beta-catenin become activators of gene expression. In silico analysis of the Ccn2 proximal promoter identified multiple consensus TCF x LEF elements, one of which was also a consensus binding site for Sox9. Using luciferase reporter constructs, the TCF x LEF x Sox9 site was found to be involved in stage-specific expression of Ccn2. Luciferase, electrophoretic mobility shift assay (EMSA), and ChIP analysis revealed that Sox9 represses Ccn2 expression by binding to the consensus TCF x LEF x Sox9 site. On the other hand, the same assays showed that in hypertrophic chondrocytes, TCF x LEF x beta-catenin complexes occupy the consensus TCF x LEF x Sox9 site and activate Ccn2 expression. Furthermore, transgenic mice in which lacZ expression is driven under the control of the proximal Ccn2 promoter revealed that the proximal Ccn2 promoter responded to Wnt signaling in cartilage. Hence, we propose that differential occupancy of the TCF x LEF x Sox9 site by Sox9 versus beta-catenin restricts high levels of Ccn2 expression to hypertrophic chondrocytes.

p16 Protein and Gigaxonin Are Associated with the Ubiquitination of NFκB in Cisplatin-induced Senescence of Cancer Cells*

PubMed Central

Veena, Mysore S.; Wilken, Reason; Zheng, Jun-Ying; Gholkar, Ankur; Venkatesan, Natarajan; Vira, Darshni; Ahmed, Sameer; Basak, Saroj K.; Dalgard, Clifton L.; Ravichandran, Sandhiya; Batra, Raj K.; Kasahara, Noriyuki; Elashoff, David; Fishbein, Michael C.; Whitelegge, Julian P.; Torres, Jorge Z.; Wang, Marilene B.; Srivatsan, Eri S.

2014-01-01

The molecular mechanism of p16-mediated senescence in cisplatin-treated cancer cells is not fully understood. Here we show that cisplatin treatment of head and neck cancer cells results in nuclear transport of p16 leading to a molecular modification of NFκB. Chromatin immunoprecipitation assays show that this modification is associated with the inhibition of NFκB interacting with its DNA binding sequences, leading to decreased expression of NFκB-transcribed proteins. LCMS proteomic analysis of LAP-TAP-purified proteins from HeLa cells containing a tetracycline-inducible GFP-S peptide-NFκB expression system identified gigaxonin, an ubiquitin E3 ligase adaptor, as an NFκB-interacting protein. Immunoblotting and siRNA studies confirmed the NFκB-gigaxonin interaction and the dependence of this binding on p16-NFκB binding. Using gel shift assays, we have confirmed p16-NFκB and gigaxonin-NFκB interactions. Furthermore, we have observed increased NFκB ubiquitination with cisplatin treatment that is abolished in the absence of p16 and gigaxonin expression. Analysis of 103 primary tumors has shown that increased nuclear p16 expression correlates with enhanced survival of head and neck cancer patients (p < 0.0000542), indicating the importance of nuclear p16 expression in prognosis. Finally, p16 expression is associated with reduced cytokine expression and the presence of human papilloma virus in chemoradiation-sensitive basaloid tumors. However, the absence of p16 expression is associated with enhanced cytokine expression and the absence of human papilloma virus in aggressive tumors. These results clearly demonstrate that nuclear p16 and gigaxonin play an important role in chemosensitivity of head and neck cancers through ubiquitination of NFκB. PMID:25331947

Central alpha/sub 2/ adrenergic receptors in the rat cerebral cortex: repopulation kinetics and receptor reserve

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adler, C.H.

1986-01-01

The alpha/sub 2/ adrenergic receptor subtype is thought to play a role in the mechanism of action of antidepressant and antihypertensive drugs. This thesis has attempted to shed light on the regulation of central alpha/sub 2/ adrenergic receptors in the rat cerebral cortex. Repopulation kinetics analysis allows for the determination of the rate of receptor production, rate constant of degradation, and half-life of the receptor. This analysis was carried out using both radioligand binding and functional receptor assays at various times following the irreversible inactivation of central alpha/sub 2/ adrenergic receptors by in vivo administration of N-ethoxycarbonyl-2-ethyoxy-1,2-dihydroquinoline (EEDQ). Both alpha/submore » 2/ agonist and antagonist ligand binding sites recovered with a t/sub 1/2/ equal to approximately 4 days. The function of alpha/sub 2/ adrenergic autoreceptors, which inhibit stimulation-evoked release of /sup 3/H-norepinephrine (/sup 3/H-NE) and alpha/sub 2/ adrenergic heteroreceptors which inhibit stimulation-evoked release of /sup 3/H-serotonin (/sup 3/H-5-HT) were assayed. The t/sub 1/2/ for recovery of maximal autoreceptor and heteroreceptor function was 2.4 days and 4.6 days, respectively. The demonstration of a receptor reserve is critical to the interpretation of past and future studies of the alpha/sub 2/ adrenergic receptor since it demonstrates that: (1) alterations in the number of alpha/sub 2/ adrenergic receptor binding sites cannot be extrapolated to the actual function of the alpha/sub 2/ adrenergic receptor; and (2) alterations in the number of alpha/sub 2/ receptors is not necessarily accompanied by a change in the maximum function being studied, but may only result in shifting of the dose-response curve.« less

Mechanism of enhanced responses after combination photodynamic therapy (cPDT) in carcinoma cells involves C/EBP-mediated transcriptional upregulation of the coproporphyrinogen oxidase (CPO) gene

NASA Astrophysics Data System (ADS)

Anand, Sanjay; Hasan, Tayyaba; Maytin, Edward V.

2013-03-01

Photodynamic therapy (PDT) with aminolevulinate (ALA) is widely accepted as an effective treatment for superficial carcinomas and pre-cancers. However, PDT is still suboptimal for deeper tumors, mainly due to inadequate ALA penetration and subsequent conversion to PpIX. We are interested in improving the effectiveness of photodynamic therapy (PDT) for deep tumors, using a combination approach (cPDT) in which target protoporphyrin (PpIX) levels are significantly enhanced by differentiation caused by giving Vitamin D or methotrexate (MTX) for 3 days prior to ALAPDT. In LNCaP and MEL cells, a strong correlation between inducible differentiation and expression of C/EBP transcription factors, as well as between differentiation and mRNA levels of CPO (a key heme-synthetic enzyme), indicates the possibility of CPO transcriptional regulation by the C/EBPs. Sequence analysis of the first 1300 base pairs of the murine CPO upstream region revealed 15 consensus C/EBP binding sites. Electrophoretic Mobility Shift Assays (EMSA) proved that these sites form specific complexes that have strong, moderate or weak affinities for C/EBPs. However, in the context of the full-length CPO promoter, inactivation of any type of site (strong or weak) reduced CPO promoter activity (luciferase assay) to nearly the same extent, suggesting cooperative interactions. A comparative analysis of murine and human CPO promoters revealed possible protein-protein interactions between C/EBPs and several neighboring transcription factors such as NFkB, Sp1, AP-1, CBP/p300 and CREB (an enhanceosome complex). Overall, these results confirm that C/EBP's are important for CPO expression via complex mechanisms which upregulate PpIX and enhance the outcome of cPDT.

Isolation and characterization of an RNA aptamer for the HPV-16 E7 oncoprotein.

PubMed

Toscano-Garibay, Julia D; Benítez-Hess, María L; Alvarez-Salas, Luis M

2011-02-01

Cervical cancer is a common neoplastic disease affecting women worldwide. Expression of human papillomavirus type 16 (HPV-16) E6/E7 genes is frequently associated with cervical cancer, representing ideal targets for diagnostic and therapeutic strategies. Aptamers are oligonucleotide ligands capable of binding with high affinity and specificity to relevant markers in therapeutics and disease detection. The aim of the study was to isolate an RNA aptamer specific for the HPV-16 E7 protein. Aptamers were selected from a randomized oligonucleotide library using a modified SELEX method and recombinant HPV-16 E7 protein. Isolated aptamers were cloned and sequenced for in silico analysis. Interaction and electromobility shift assays (EMSA) were performed to establish aptamer specificity and affinity for E7. RNase footprinting and serial deletions of the aptamer and the E7 protein were made to characterize the aptamer-protein complex. Sandwich slot-blot assays were used for K(D) determination. After several rounds of SELEX, an aptamer (G5α3N.4) exhibited specificity for E7 using cell-free and protein extracts. G5α3N.4 binding yielded a K(D) comparable to aptamers directed to other small targets. Enzymatic and genetic analysis of G5α3N.4 binding showed a secondary structure with two stem-loop domains joined by single-stranded region contacting E7 in a clamp-like manner. The G5α3N.4 aptamer also produced specific complexes in HPV-positive cervical carcinoma cells. The affinity and specificity of G5α3N.4 binding domains for the HPV-16 E7 protein may be used for the detection of papillomavirus infection and cervical cancer. Copyright © 2011 IMSS. Published by Elsevier Inc. All rights reserved.

R1, a novel repressor of the human monoamine oxidase A.

PubMed

Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

2005-03-25

Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

Prevention and treatment of colon cancer by peroral administration of HAMLET (human α-lactalbumin made lethal to tumour cells).

PubMed

Puthia, Manoj; Storm, Petter; Nadeem, Aftab; Hsiung, Sabrina; Svanborg, Catharina

2014-01-01

Most colon cancers start with dysregulated Wnt/β-catenin signalling and remain a major therapeutic challenge. Examining whether HAMLET (human α-lactalbumin made lethal to tumour cells) may be used for colon cancer treatment is logical, based on the properties of the complex and its biological context. To investigate if HAMLET can be used for colon cancer treatment and prevention. Apc(Min)(/+) mice, which carry mutations relevant to hereditary and sporadic human colorectal tumours, were used as a model for human disease. HAMLET was given perorally in therapeutic and prophylactic regimens. Tumour burden and animal survival of HAMLET-treated and sham-fed mice were compared. Tissue analysis focused on Wnt/β-catenin signalling, proliferation markers and gene expression, using microarrays, immunoblotting, immunohistochemistry and ELISA. Confocal microscopy, reporter assay, immunoprecipitation, immunoblotting, ion flux assays and holographic imaging were used to determine effects on colon cancer cells. Peroral HAMLET administration reduced tumour progression and mortality in Apc(Min)(/+) mice. HAMLET accumulated specifically in tumour tissue, reduced β-catenin and related tumour markers. Gene expression analysis detected inhibition of Wnt signalling and a shift to a more differentiated phenotype. In colon cancer cells with APC mutations, HAMLET altered β-catenin integrity and localisation through an ion channel-dependent pathway, defining a new mechanism for controlling β-catenin signalling. Remarkably, supplying HAMLET to the drinking water from the time of weaning also significantly prevented tumour development. These data identify HAMLET as a new, peroral agent for colon cancer prevention and treatment, especially needed in people carrying APC mutations, where colon cancer remains a leading cause of death.

Prevention and treatment of colon cancer by peroral administration of HAMLET (human α-lactalbumin made lethal to tumour cells)

PubMed Central

Puthia, Manoj; Storm, Petter; Nadeem, Aftab; Hsiung, Sabrina; Svanborg, Catharina

2014-01-01

Background Most colon cancers start with dysregulated Wnt/β-catenin signalling and remain a major therapeutic challenge. Examining whether HAMLET (human α-lactalbumin made lethal to tumour cells) may be used for colon cancer treatment is logical, based on the properties of the complex and its biological context. Objective To investigate if HAMLET can be used for colon cancer treatment and prevention. ApcMin/+ mice, which carry mutations relevant to hereditary and sporadic human colorectal tumours, were used as a model for human disease. Method HAMLET was given perorally in therapeutic and prophylactic regimens. Tumour burden and animal survival of HAMLET-treated and sham-fed mice were compared. Tissue analysis focused on Wnt/β-catenin signalling, proliferation markers and gene expression, using microarrays, immunoblotting, immunohistochemistry and ELISA. Confocal microscopy, reporter assay, immunoprecipitation, immunoblotting, ion flux assays and holographic imaging were used to determine effects on colon cancer cells. Results Peroral HAMLET administration reduced tumour progression and mortality in ApcMin/+ mice. HAMLET accumulated specifically in tumour tissue, reduced β-catenin and related tumour markers. Gene expression analysis detected inhibition of Wnt signalling and a shift to a more differentiated phenotype. In colon cancer cells with APC mutations, HAMLET altered β-catenin integrity and localisation through an ion channel-dependent pathway, defining a new mechanism for controlling β-catenin signalling. Remarkably, supplying HAMLET to the drinking water from the time of weaning also significantly prevented tumour development. Conclusions These data identify HAMLET as a new, peroral agent for colon cancer prevention and treatment, especially needed in people carrying APC mutations, where colon cancer remains a leading cause of death. PMID:23348960

Comparison of Human Immunodeficiency Virus Type 1 Tropism Profiles in Clinical Samples by the Trofile and MT-2 Assays▿

PubMed Central

Coakley, Eoin; Reeves, Jacqueline D.; Huang, Wei; Mangas-Ruiz, Marga; Maurer, Irma; Harskamp, Agnes M.; Gupta, Soumi; Lie, Yolanda; Petropoulos, Christos J.; Schuitemaker, Hanneke; van 't Wout, Angélique B.

2009-01-01

The recent availability of CCR5 antagonists as anti-human immunodeficiency virus (anti-HIV) therapeutics has highlighted the need to accurately identify CXCR4-using variants in patient samples when use of this new drug class is considered. The Trofile assay (Monogram Biosciences) has become the method that is the most widely used to define tropism in the clinic prior to the use of a CCR5 antagonist. By comparison, the MT-2 assay has been used since early in the HIV epidemic to define tropism in clinical specimens. Given that there are few data from direct comparisons of these two assays, we evaluated the performance of the plasma-based Trofile assay and the peripheral blood mononuclear cell (PBMC)-based MT-2 assay for the detection of CXCR4 use in defining the tropism of HIV isolates derived from clinical samples. The various samples used for this comparison were derived from participants of the Amsterdam Cohort Studies on HIV infection and AIDS who underwent consecutive MT-2 assay testing of their PBMCs at approximately 3-month intervals. This unique sample set was specifically selected because consecutive MT-2 assays had demonstrated a shift from negative to positive in PBMCs, reflecting the first emergence of CXCR4-using virus in PBMCs above the level of detection of the assay in these individuals. Trofile testing was performed with clonal HIV type 1 (HIV-1) variants (n = 21), MT-2 cell culture-derived cells (n = 20) and supernatants (n = 42), and plasma samples (n = 76). Among the clonal HIV-1 variants and MT-2 cell culture-derived samples, the results of the Trofile and MT-2 assays demonstrated a high degree of concordance (95% to 98%). Among consecutive plasma samples, detection of CXCR4-using virus was at or before the time of first detection by the MT-2 assay in 5/10 patients by the original Trofile assay and in 9/10 patients by the enhanced-sensitivity Trofile assay. Differences in the time to the first detection of CXCR4 use between the MT-2 assay (PBMCs) and the original Trofile assay (plasma) were greatly reduced by the enhanced-sensitivity Trofile assay, suggesting that sensitivity for the detection of minor CXCR4-using variants may be a more important determinant of discordant findings than compartmentalization. The similarities in performance of the enhanced-sensitivity Trofile and MT-2 assays suggest that either may be an appropriate methodology to define tropism in patient specimens. PMID:19687240

Analysis of the temperature and pressure dependence of the 129Xe NMR chemical shift and signal intensity for the derivation of basic parameters of adsorption as applied to zeolite ZSM-5.

PubMed

Kawata, Yoko; Adachi, Yuko; Haga, Saori; Fukutomi, Junko; Imai, Hirohiko; Kimura, Atsuomi; Fujiwara, Hideaki

2007-12-01

Temperature and pressure dependences of the 129Xe NMR chemical shift and the signal intensity have been investigated using ZSM-5 as an adsorbent under routine conditions without using any high-pressure or especially high-temperature facilities. The use of a rigorously shielded system and a calibration sample for the signal intensity was found to be valuable to obtain reliable data about the chemical shift and the signal intensity. The 129Xe NMR data obtained between 0.05 and 1.5 atm and from 24 to 80 degrees C were analyzed based on the Dubinin-Radushkevich equation as well as the Langmuir type equation. In both analyses, chemical shift data succeeded only partially in providing the profile of adsorption, such as energetic aspects, surface area, saturated amount of Xe adsorption and specific parameters of 129Xe chemical shift. It was shown that the reliable total analysis was achieved when the chemical shift data were used together with the intensity data. Such an analysis of the chemical shift data, aided by the intensity data, will be useful in performing nano-material analysis on 129Xe NMR without invoking the traditional methodology of gravimetric or volumetric adsorption experiments.

OpenComet: An automated tool for comet assay image analysis

PubMed Central

Gyori, Benjamin M.; Venkatachalam, Gireedhar; Thiagarajan, P.S.; Hsu, David; Clement, Marie-Veronique

2014-01-01

Reactive species such as free radicals are constantly generated in vivo and DNA is the most important target of oxidative stress. Oxidative DNA damage is used as a predictive biomarker to monitor the risk of development of many diseases. The comet assay is widely used for measuring oxidative DNA damage at a single cell level. The analysis of comet assay output images, however, poses considerable challenges. Commercial software is costly and restrictive, while free software generally requires laborious manual tagging of cells. This paper presents OpenComet, an open-source software tool providing automated analysis of comet assay images. It uses a novel and robust method for finding comets based on geometric shape attributes and segmenting the comet heads through image intensity profile analysis. Due to automation, OpenComet is more accurate, less prone to human bias, and faster than manual analysis. A live analysis functionality also allows users to analyze images captured directly from a microscope. We have validated OpenComet on both alkaline and neutral comet assay images as well as sample images from existing software packages. Our results show that OpenComet achieves high accuracy with significantly reduced analysis time. PMID:24624335

OpenComet: an automated tool for comet assay image analysis.

PubMed

Gyori, Benjamin M; Venkatachalam, Gireedhar; Thiagarajan, P S; Hsu, David; Clement, Marie-Veronique

2014-01-01

Reactive species such as free radicals are constantly generated in vivo and DNA is the most important target of oxidative stress. Oxidative DNA damage is used as a predictive biomarker to monitor the risk of development of many diseases. The comet assay is widely used for measuring oxidative DNA damage at a single cell level. The analysis of comet assay output images, however, poses considerable challenges. Commercial software is costly and restrictive, while free software generally requires laborious manual tagging of cells. This paper presents OpenComet, an open-source software tool providing automated analysis of comet assay images. It uses a novel and robust method for finding comets based on geometric shape attributes and segmenting the comet heads through image intensity profile analysis. Due to automation, OpenComet is more accurate, less prone to human bias, and faster than manual analysis. A live analysis functionality also allows users to analyze images captured directly from a microscope. We have validated OpenComet on both alkaline and neutral comet assay images as well as sample images from existing software packages. Our results show that OpenComet achieves high accuracy with significantly reduced analysis time.

Something Old, Something New: MBA Program Evaluation Using Shift-Share Analysis and Google Trends

ERIC Educational Resources Information Center

Davis, Sarah M.; Rodriguez, A. E.

2014-01-01

Shift-share analysis is a decomposition technique that is commonly used to measure attributes of regional change. In this method, regional change is decomposed into its relevant functional and competitive parts. This paper introduces traditional shift-share method and its extensions with examples of its applicability and usefulness for program…

Mannan-Binding Lectin Inhibits Candida albicans-Induced Cellular Responses in PMA-Activated THP-1 Cells through Toll-Like Receptor 2 and Toll-Like Receptor 4

PubMed Central

Yang, Jianbin; Zhao, Dongfang; Wang, Hongpo; Shao, Feng; Wang, Wenjun; Sun, Ruili; Ling, Mingzhi; Zhai, Jingjing; Song, Shijun

2013-01-01

Background Candida albicans (C. albicans), the most common human fungal pathogen, can cause fatal systemic infections under certain circumstances. Mannan-binding lectin (MBL),a member of the collectin family in the C-type lectin superfamily, is an important serum component associated with innate immunity. Toll-like receptors (TLRs) are expressed extensively, and have been shown to be involved in C. albicans-induced cellular responses. We first examined whether MBL modulated heat-killed (HK) C. albicans-induced cellular responses in phorbol 12-myristate 13-acetate (PMA)-activated human THP-1 macrophages. We then investigated the possible mechanisms of its inhibitory effect. Methodology/Principal Finding Enzyme-linked immunosorbent assay (ELISA) and reverse transcriptasepolymerase chain reaction (RT-PCR) analysis showed that MBL at higher concentrations (10–20 µg/ml) significantly attenuated C. albicans-induced chemokine (e.g., IL-8) and proinflammatory cytokine (e.g., TNF-α) production from PMA-activated THP-1 cells at both protein and mRNA levels. Electrophoretic mobility shift assay (EMSA) and Western blot (WB) analysis showed that MBL could inhibit C. albicans-induced nuclear factor-κB (NF-κB) DNA binding and its translocation in PMA-activated THP-1 cells. MBL could directly bind to PMA-activated THP-1 cells in the presence of Ca2+, and this binding decreased TLR2 and TLR4 expressions in C. albicans-induced THP-1 macrophages. Furthermore, the binding could be partially inhibited by both anti-TLR2 monoclonal antibody (clone TL2.1) and anti-TLR4 monoclonal antibody (clone HTA125). In addition, co-immunoprecipitation experiments and microtiter wells assay showed that MBL could directly bind to the recombinant soluble form of extracellular TLR2 domain (sTLR2) and sTLR4. Conclusions/Significance Our study demonstrates that MBL can affect proinflammatory cytokine and chemokine expressions by modifying C. albicans-/TLR-signaling pathways. This study supports an important role for MBL on the regulation of C. albicans-induced cellular responses. PMID:24391778

Targeted proteomic assays for quantitation of proteins identified by proteogenomic analysis of ovarian cancer

DOE PAGES

Song, Ehwang; Gao, Yuqian; Wu, Chaochao; ...

2017-07-19

Here, mass spectrometry (MS) based targeted proteomic methods such as selected reaction monitoring (SRM) are becoming the method of choice for preclinical verification of candidate protein biomarkers. The Clinical Proteomic Tumor Analysis Consortium (CPTAC) of the National Cancer Institute has investigated the standardization and analytical validation of the SRM assays and demonstrated robust analytical performance on different instruments across different laboratories. An Assay Portal has also been established by CPTAC to provide the research community a resource consisting of large set of targeted MS-based assays, and a depository to share assays publicly, providing that assays meet the guidelines proposed bymore » CPTAC. Herein, we report 98 SRM assays covering 70 candidate protein biomarkers previously reported as associated with ovarian cancer that have been thoroughly characterized according to the CPTAC Assay Characterization Guidance Document. The experiments, methods and results for characterizing these SRM assays for their MS response, repeatability, selectivity, stability, and reproducible detection of endogenous analytes are described in detail.« less

The importance of pollen chemistry in evolutionary host shifts of bees

PubMed Central

Vanderplanck, Maryse; Vereecken, Nicolas J.; Grumiau, Laurent; Esposito, Fabiana; Lognay, Georges; Wattiez, Ruddy; Michez, Denis

2017-01-01

Although bee-plant associations are generally maintained through speciation processes, host shifts have occurred during evolution. Understanding shifts between both phylogenetically and morphologically unrelated plants (i.e., host-saltation) is especially important since they could have been key processes in the origin and radiation of bees. Probably far from being a random process, such host-saltation might be driven by hidden constraints associated with plant traits. We selected two clades of oligolectic bees (i.e., Colletes succinctus group and Melitta leporina group) foraging on co-flowering but unrelated host-plants to test this hypothesis. We analyzed floral scent, floral color and chemical composition of pollen from host and non-host plants of these two clades. We did not find evidence for host-plant evolution in the Melitta leporina group driven by one of the assayed floral traits. On the contrary, hosts of the C. succinctus group display similar primary nutritive content of pollen (i.e., amino acids and sterols) but not similar floral scent or color, suggesting that shared pollen chemistry probably mediates saltation in this clade. Our study revealed that constraints shaping floral associations are diverse and clearly depend on species life-history traits, but evidence suggests that pollen chemistry may act as a major floral filter and guide evolutionary host-shifts. PMID:28216663

A meta-analysis including dose-response relationship between night shift work and the risk of colorectal cancer

PubMed Central

Wang, Xiao; Ji, Alin; Zhu, Yi; Liang, Zhen; Wu, Jian; Li, Shiqi; Meng, Shuai; Zheng, Xiangyi; Xie, Liping

2015-01-01

A meta-analysis was conducted to quantitatively evaluate the correlation between night shift work and the risk of colorectal cancer. We searched for publications up to March 2015 using PubMed, Web of Science, Cochrane Library, EMBASE and the Chinese National Knowledge Infrastructure databases, and the references of the retrieved articles and relevant reviews were also checked. OR and 95% CI were used to assess the degree of the correlation between night shift work and risk of colorectal cancer via fixed- or random-effect models. A dose-response meta-analysis was performed as well. The pooled OR estimates of the included studies illustrated that night shift work was correlated with an increased risk of colorectal cancer (OR = 1.318, 95% CI 1.121–1.551). No evidence of publication bias was detected. In the dose-response analysis, the rate of colorectal cancer increased by 11% for every 5 years increased in night shift work (OR = 1.11, 95% CI 1.03–1.20). In conclusion, this meta-analysis indicated that night shift work was associated with an increased risk of colorectal cancer. Further researches should be conducted to confirm our findings and clarify the potential biological mechanisms. PMID:26208480

Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay.

PubMed

Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin

2015-05-15

It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

How well can morphology assess cell death modality? A proteomics study

PubMed Central

Chernobrovkin, Alexey L; Zubarev, Roman A

2016-01-01

While the focus of attempts to classify cell death programs has finally shifted in 2010s from microscopy-based morphological characteristics to biochemical assays, more recent discoveries have put the underlying assumptions of many such assays under severe stress, mostly because of the limited specificity of the assays. On the other hand, proteomics can quantitatively measure the abundances of thousands of proteins in a single experiment. Thus proteomics could develop a modern alternative to both semiquantitative morphology assessment as well as single-molecule biochemical assays. Here we tested this hypothesis by analyzing the proteomes of cells dying after been treated with various chemical agents. The most striking finding is that, for a multivariate model based on the proteome changes in three cells lines, the regulation patterns of the 200–500 most abundant proteins typically attributed to household type more accurately reflect that of the proteins directly interacting with the drug than any other protein subset grouped by common function or biological process, including cell death. This is in broad agreement with the 'rigid cell death mechanics' model where drug action mechanism and morphological changes caused by it are bijectively linked. This finding, if confirmed, will open way for a broad use of proteomics in death modality assessment. PMID:27752363

Cellular and Biophysical Pipeline for the Screening of Peroxisome Proliferator-Activated Receptor Beta/Delta Agonists: Avoiding False Positives

PubMed Central

Batista, Fernanda Aparecida Heleno

2018-01-01

Peroxisome proliferator-activated receptor beta/delta (PPARß/δ) is considered a therapeutic target for metabolic disorders, cancer, and cardiovascular diseases. Here, we developed one pipeline for the screening of PPARß/δ agonists, which reduces the cost, time, and false-positive hits. The first step is an optimized 3-day long cellular transactivation assay based on reporter-gene technology, which is supported by automated liquid-handlers. This primary screening is followed by a confirmatory transactivation assay and by two biophysical validation methods (thermal shift assay (TSA) and (ANS) fluorescence quenching), which allow the calculation of the affinity constant, giving more information about the selected hits. All of the assays were validated using well-known commercial agonists providing trustworthy data. Furthermore, to validate and test this pipeline, we screened a natural extract library (560 extracts), and we found one plant extract that might be interesting for PPARß/δ modulation. In conclusion, our results suggested that we developed a cheaper and more robust pipeline that goes beyond the single activation screening, as it also evaluates PPARß/δ tertiary structure stabilization and the ligand affinity constant, selecting only molecules that directly bind to the receptor. Moreover, this approach might improve the effectiveness of the screening for agonists that target PPARß/δ for drug development.

Gelatin-modified gold nanoparticles for direct detection of urinary total gelatinase activity: Diagnostic value in bladder cancer.

PubMed

Nossier, Ahmed I; Mohammed, Ola S; Fakhr El-Deen, Rasha R; Zaghloul, Ashraf S; Eissa, Sanaa

2016-12-01

Matrix metalloproteinases (MMPs), in particularly gelatinases (MMP-2 and MMP-9) were reported as urinary markers of bladder cancer. In this work, we developed a simple colorimetric gold nanoparticle (AuNP) assay for rapid and sensitive detection of urinary total gelatinase activity based on the surface plasmon resonance (SPR) property of AuNPs. Gelatin-modified AuNPs were stably suspended in solution even upon addition of an aggregation inducer as 6-mercaptohexan-1-ol (6-MCH). Gelatinases digest gelatin capping. Subsequently, addition of 6-MCH leads to AuNPs aggregation with red to blue color shift. In a pilot study, results of the developed AuNP assay were consistent with zymography for qualitative detection of urinary total gelatinase activity. The sensitivity and specificity of both assays were 80% and 90.9% respectively. The absorption ratios, A 625 /A 530 of the reacted AuNP solutions were used to quantify the total gelatinase concentration. The best cut off value was 0.01895ng/μg protein, at which the sensitivity was 87.5% and the specificity was 86.4%. The developed AuNP assay is simple, low-cost and can aid non-invasive diagnosis of bladder cancer. Copyright © 2016 Elsevier B.V. All rights reserved.

Evaluation of genome damage in subjects occupationally exposed to possible carcinogens.

PubMed

Zeljezic, Davor; Mladinic, Marin; Kopjar, Nevenka; Radulovic, Azra Hursidic

2016-09-01

In occupational exposures, populations are simultaneously exposed to a mixture of chemicals. We aimed to evaluate DNA damage due to possible carcinogen exposure (phenylhydrazine, ethylene oxide, dichloromethane, and 1,2-dichloroethane) in lymphocytes of pharmaceutical industry workers from the same production line. Population comprised 16 subjects (9 females and 7 males) who were exposed to multiple chemicals for 8 months. Genome damage was assessed using alkaline comet assay, micronucleus assay, and comet assay coupled with fluorescent in situ hybridization (comet-FISH). After 8 months of exposure, the issue of irregular use of all available personal protective equipment (PPE) came into light. To decrease the risk of exposure, strict use of PPE was enforced. After 8 months of strict PPE use, micronuclei frequency and comet assay parameters in lymphocytes of pharmaceutical workers significantly decreased compared with prior period of irregular PPE use. Comet-FISH results indicated a significant shift in distribution of signals for the TP 53 gene toward a more frequent occurrence in the comet tail. Prolonged exposure to possible carcinogens may hinder DNA repair mechanisms and affect structural integrity of TP 53 Two indicators of loss of TP 53 gene integrity have risen, namely, TP 53 fragmentation rate in lymphocytes with persistently elevated primary damage and incidence of TP 53 deletions in undamaged lymphocytes. © The Author(s) 2015.

Alcohols which have been in contact with any plastics may interfere in radioimmunoassays of progesterone.

PubMed

Ocvirk, Rok; Bisson, Jennifer M; Murphy, Beverley E Pearson

2009-01-01

In recent years there has been increasing use of plastic rather than glass containers for many liquids, including wine. However we have found that residue from commercially obtained 'pure' ethanol dispensed in plastic bottles interferes in some biochemical assays. We have observed a volume-dependent decrease in maximally bound ligand in radioimmunoassays of progesterone. The resulting shift in the standard curve leads to an underestimation of the analyte concentrations and to altered estimation of cross reactivity by competing ligands. These effects became apparent in assays with high sensitivity (500 pg or less). All sources of ethanol obtainable in Quebec contained impurities. A similar effect was also produced by 'pure' methanol. The reduction in maximally bound ligand was amplified when the alcohol was aliquoted using plastic pipette tips. We conclude that alcohols which have had any contact with plastics are not safe to use in immunoassays of progesterone (or its metabolites as estimated according to cross-reactivity after HPLC) and may affect other assays. If the use of alcohol and plastic tips cannot be avoided, the amount of alcohol used should be reduced to 1% or less. This can be accomplished by preparing steroid standards in assay buffers containing albumin or gelatin, which enhance the solubility of steroids in aqueous media.

Coelenterazine-v ligated to Ca2+-triggered coelenterazine-binding protein is a stable and efficient substrate of the red-shifted mutant of Renilla muelleri luciferase.

PubMed

Stepanyuk, Galina A; Unch, James; Malikova, Natalia P; Markova, Svetlana V; Lee, John; Vysotski, Eugene S

2010-10-01

It has been shown that the coelenterazine analog, coelenterazine-v, is an efficient substrate for a reaction catalyzed by Renilla luciferase. The resulting bioluminescence emission maximum is shifted to a longer wavelength up to 40 nm, which allows the use of some "yellow" Renilla luciferase mutants for in vivo imaging. However, the utility of coelenterazine-v in small-animal imaging has been hampered by its instability in solution and in biological tissues. To overcome this drawback, we ligated coelenterazine-v to Ca(2+)-triggered coelenterazine-binding protein from Renilla muelleri, which apparently functions in the organism for stabilizing and protecting coelenterazine from oxidation. The coelenterazine-v bound within coelenterazine-binding protein has revealed a greater long-term stability at both 4 and 37 °C. In addition, the coelenterazine-binding protein ligated by coelenterazine-v yields twice the total light over free coelenterazine-v as a substrate for the red-shifted R. muelleri luciferase. These findings suggest the possibility for effective application of coelenterazine-v in various in vitro assays.

Development of a Multianalyte Enzyme-Linked Immunosorbent Assay for Permethrin and Aroclors and Its Implementation for Analysis of Soil/Sediment and House Dust ExtractsExtracts

EPA Science Inventory

Development of a multianalyte enzyme-linked immunosorbent assay (ELISA) for detection of permethrin and aroclors 1248 or 1254, and implementation of the assay for analysis of soil/sediment samples are described. The feasibility of using the multianalyte ELISA to monitor aroclors ...

Time dependent analysis of assay comparability: a novel approach to understand intra- and inter-site variability over time

NASA Astrophysics Data System (ADS)

Winiwarter, Susanne; Middleton, Brian; Jones, Barry; Courtney, Paul; Lindmark, Bo; Page, Ken M.; Clark, Alan; Landqvist, Claire

2015-09-01

We demonstrate here a novel use of statistical tools to study intra- and inter-site assay variability of five early drug metabolism and pharmacokinetics in vitro assays over time. Firstly, a tool for process control is presented. It shows the overall assay variability but allows also the following of changes due to assay adjustments and can additionally highlight other, potentially unexpected variations. Secondly, we define the minimum discriminatory difference/ratio to support projects to understand how experimental values measured at different sites at a given time can be compared. Such discriminatory values are calculated for 3 month periods and followed over time for each assay. Again assay modifications, especially assay harmonization efforts, can be noted. Both the process control tool and the variability estimates are based on the results of control compounds tested every time an assay is run. Variability estimates for a limited set of project compounds were computed as well and found to be comparable. This analysis reinforces the need to consider assay variability in decision making, compound ranking and in silico modeling.

Assays for Determination of Protein Concentration.

PubMed

Olson, Bradley J S C

2016-06-01

Biochemical analysis of proteins relies on accurate quantification of protein concentration. Detailed in this appendix are some commonly used methods for protein analysis, e.g., Lowry, Bradford, bicinchoninic acid (BCA), UV spectroscopic, and 3-(4-carboxybenzoyl)quinoline-2-carboxaldehyde (CBQCA) assays. The primary focus of this report is assay selection, emphasizing sample and buffer compatibility. The fundamentals of generating protein assay standard curves and of data processing are considered, as are high-throughput adaptations of the more commonly used protein assays. Also included is a rapid, inexpensive, and reliable BCA assay of total protein in SDS-PAGE sample buffer that is used for equal loading of SDS-PAGE gels. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

High-content image analysis (HCIA) assay has the highest correlation with direct counting cell suspension compared to the ATP, WST-8 and Alamar blue assays for measurement of cytotoxicity.

PubMed

Tahara, Haruna; Matsuda, Shun; Yamamoto, Yusuke; Yoshizawa, Hiroe; Fujita, Masaharu; Katsuoka, Yasuhiro; Kasahara, Toshihiko

2017-11-01

Various cytotoxicity assays measuring indicators such as enzyme activity, dye uptake, or cellular ATP content are often performed using 96-well microplates. However, recent reports show that cytotoxicity assays such as the ATP assay and MTS assay underestimate cytotoxicity when compounds such as anti-cancer drugs or mutagens induce cell hypertrophy whilst increasing intracellular ATP content. Therefore, we attempted to evaluate the reliability of a high-content image analysis (HCIA) assay to count cell number in a 96-well microplate automatically without using a cell-number indicator. We compared cytotoxicity results of 25 compounds obtained from ATP, WST-8, Alamar blue, and HCIA assays with those directly measured using an automatic cell counter, and repeating individual experiments thrice. The number of compounds showing low correlation in cell viability measured using cytotoxicity assays compared to automatic cell counting (r 2 <0.8, at least 2 of 3 experiments) were follows: ATP assay; 7; WST-8 assay, 2; Alamar blue assay, 3; HCIA cytotoxicity assay, 0. Compounds for which correlation was poor in 3 assays, except the HCIA assay, induced an increase in nuclear and cell size. However, correlation between cell viability measured by automatic cell counter and the HCIA assay was strong regardless of nuclear and cell size. Additionally, correlation coefficients between IC 50 values obtained from automatic cell counter and from cytotoxicity assays were as follows: ATP assay, 0.80; WST-8 assay, 0.84; Alamar blue assay, 0.84; and HCIA assay, 0.98. From the above, we showed that the HCIA cytotoxicity assay produces similar data to the automatic cell counter and is highly accurate in measuring cytotoxicity. Copyright © 2017 Elsevier Inc. All rights reserved.

Track lateral shift : fundamentals and state-of-the-art review

DOT National Transportation Integrated Search

1996-02-01

This report presents a review of the state of the art of track lateral shift analysis, with improved concepts for safety evaluation of high speed trains generating track shift forces. The mechanics of track shift and the resulting track failure modes...

Isolation and characterization of chromosome-gain and increase-in-ploidy mutants in yeast.

PubMed

Chan, C S; Botstein, D

1993-11-01

We have developed a colony papillation assay for monitoring the copy number of genetically marked chromosomes II and III in Saccharomyces cerevisiae. The unique feature of this assay is that it allows detection of a gain of the marked chromosomes even if there is a gain of the entire set of chromosomes (increase-in-ploidy). This assay was used to screen for chromosome-gain or increase-in-ploidy mutants. Five complementation groups have been defined for recessive mutations that confer an increase-in-ploidy (ipl) phenotype, which, in each case, cosegregates with a temperature-sensitive growth phenotype. Four new alleles of CDC31, which is required for spindle pole body duplication, were also recovered from this screen. Temperature-shift experiments with ipl1 cells show that they suffer severe nondisjunction at 37 degrees. Similar experiments with ipl2 cells show that they gain entire sets of chromosomes and become arrested as unbudded cells at 37 degrees. Molecular cloning and genetic mapping show that IPL1 is a newly identified gene, whereas IPL2 is allelic to BEM2, which is required for normal bud growth.

Association of Serum Concentration of Different Trace Elements with Biomarkers of Systemic Oxidant Status in Dairy Cattle.

PubMed

Abuelo, Angel; Hernandez, Joaquín; Alves-Nores, Víctor; Benedito, José L; Castillo, Cristina

2016-12-01

There has been some recent criticism about the reliability of the assays commonly used to measure oxidant status in cattle, because some recent publications suggested that the concentration of different trace elements influences the results of these assays. The aim of this study was to test the correlation in 502 bovine serum samples between the concentration of several trace elements (Br, Co, Cr, Cu, Fe, I, Mn, Mo, Ni, Se, Sr, V and Zn) and markers of oxidant status (reactive oxygen species (ROS) and total serum antioxidant capacity (SAC)). The Oxidative Stress index (OSi) was also calculated as ROS/SAC. Some significant correlations were found, although weak (|ρ| < 0.50). Therefore, the relationships observed might be attributed to the different pro- and antioxidant effect of the different elements rather than to the assays detecting these elements instead of the oxidised molecules or total antioxidant potential, respectively. The OSi was poorly correlated (|ρ| ≤ 0.36) with the concentration of the studied trace elements, and therefore, its use is recommended to assess shifts in the systemic redox balance.

The rat's not for turning: Dissociating the psychological components of cognitive inflexibility☆

PubMed Central

Nilsson, Simon R.O.; Alsiö, Johan; Somerville, Elizabeth M.; Clifton, Peter G.

2015-01-01

Executive function is commonly assessed by assays of cognitive flexibility such as reversal learning and attentional set-shifting. Disrupted performance in these assays, apparent in many neuropsychiatric disorders, is frequently interpreted as inability to overcome prior associations with reward. However, non-rewarded or irrelevant associations may be of considerable importance in both discrimination learning and cognitive flexibility. Non-rewarded associations can have greater influence on choice behaviour than rewarded associations in discrimination learning. Pathology-related deficits in cognitive flexibility can produce selective disruptions to both the processing of irrelevant associations and associations with reward. Genetic and pharmacological animal models demonstrate that modulation of reversal learning may result from alterations in either rewarded or non-rewarded associations. Successful performance in assays of cognitive flexibility can therefore depend on a combination of rewarded, non-rewarded, and irrelevant associations derived from previous learning, accounting for some inconsistencies observed in the literature. Taking this combination into account may increase the validity of animal models and may also reveal pathology-specific differences in problem solving and executive function. PMID:26112128

Sp1-mediated transcription regulation of TAF-Ialpha gene encoding a histone chaperone.

PubMed

Asaka, Masamitsu N; Murano, Kensaku; Nagata, Kyosuke

2008-11-28

TAF-I, one of histone chaperones, consists of two subtypes, TAF-Ialpha and TAF-Ibeta. The histone chaperone activity of TAF-I is regulated by dimer patterns of these subtypes. TAF-Ibeta is expressed ubiquitously, while the expression level of TAF-Ialpha with less activity than TAF-Ibeta differs among cell types. It is, therefore, assumed that the expression level of TAF-Ialpha in a cell is important for the TAF-I activity level. Here, we found that TAF-Ialpha and TAF-Ibeta genes are under the control of distinct promoters. Reporter assays and gel shift assays demonstrated that Sp1 binds to three regions in the TAF-Ialpha promoter and two or all mutaions of the three Sp1 binding regions reduced the TAF-Ialpha promoter activity. ChIP assays demonstrated that Sp1 binds to the TAF-Ialpha promoter in vivo. Furthermore, the expression level of TAF-Ialpha mRNA was reduced by knockdown of Sp1 using siRNA method. These studies indicated that the TAF-Ialpha promoter is under the control of Sp1.

Noninvasive prenatal diagnosis for single gene disorders.

PubMed

Allen, Stephanie; Young, Elizabeth; Bowns, Benjamin

2017-04-01

Noninvasive prenatal diagnosis for single gene disorders is coming to fruition in its clinical utility. The presence of cell-free DNA in maternal plasma has been recognized for many years, and a number of applications have developed from this. Noninvasive prenatal diagnosis for single gene disorders has lagged behind due to complexities of technology development, lack of investment and the need for validation samples for rare disorders. Publications are emerging demonstrating a variety of technical approaches and feasibility of clinical application. Techniques for analysis of cell-free DNA including digital PCR, next-generation sequencing and relative haplotype dosage have been used most often for assay development. Analysis of circulating fetal cells in the maternal blood is still being investigated as a viable alternative and more recently transcervical trophoblast cells. Studies exploring ethical and social issues are generally positive but raise concerns around the routinization of prenatal testing. Further work is necessary to make testing available to all patients with a pregnancy at risk of a single gene disorder, and it remains to be seen if the development of more powerful technologies such as isolation and analysis of single cells will shift the emphasis of noninvasive prenatal diagnosis. As testing becomes possible for a wider range of conditions, more ethical questions will become relevant.

cDNA cloning and characterization of mouse DTEF-1 and ETF, members of the TEA/ATTS family of transcription factors.

PubMed

Yockey, C E; Shimizu, N

1998-02-01

Members of the TEA/ATTS family of transcription factors have been found in most representative eukaryotic organisms. In vertebrates, the TEA family contains at least four members, which share overlapping DNA-binding specificity and have similar transcriptional activation properties. In this article, we describe the cDNA cloning and characterization of the murine TEA proteins DTEF-1 (mDTEF-1) and ETF. Using in situ hybridization analysis of mouse embryos, we found that mDTEF-1 and ETF transcript distributions substantially overlap. ETF is expressed throughout the embryo except in the myocardium early in development, whereas late in development, it is enriched in lung and neuroectoderm. Mouse DTEF-1 is expressed at a much lower level throughout development and is substantially enriched in ectoderm and skin, as well as in the developing pituitary at midgestation. Northern blot analysis of adult mouse tissue total RNA showed that both ETF and mDTEF-1 are abundant in uterus and lung relative to other tissues. Using gel mobility shift assays and GAL4-fusion protein analysis, we demonstrated that the full coding sequences of ETF and mDTEF-1 encode M-CAT/GT-IIC-binding proteins containing activation domains.

Determination of the DNA-binding kinetics of three related but heteroimmune bacteriophage repressors using EMSA and SPR analysis

PubMed Central

Henriksson-Peltola, Petri; Sehlén, Wilhelmina; Haggård-Ljungquist, Elisabeth

2007-01-01

Bacteriophages P2, P2 Hy dis and WΦ are very similar but heteroimmune Escherichia coli phages. The structural genes show over 96% identity, but the repressors show between 43 and 63% identities. Furthermore, the operators, which contain two directly repeated sequences, vary in sequence, length, location relative to the promoter and spacing between the direct repeats. We have compared the in vivo effects of the wild type and mutated operators on gene expression with the complexes formed between the repressors and their wild type or mutated operators using electrophoretic mobility shift assay (EMSA), and real-time kinetics of the protein–DNA interactions using surface plasmon resonance (SPR) analysis. Using EMSA, the repressors formed different protein–DNA complexes, and only WΦ was significantly affected by point mutations. However, SPR analysis showed a reduced association rate constant and an increased dissociation rate constant for P2 and WΦ operator mutants. The association rate constants of P2 Hy dis was too fast to be determined. The P2 Hy dis dissociation response curves were shown to be triphasic, while both P2 and WΦ C were biphasic. Thus, the kinetics of complex formation and the nature of the complexes formed differ extensively between these very closely related phages. PMID:17412705

Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia

PubMed Central

Martin, Jaclyn; Carrillo, Yisel; Talley, Justin L.; Ochoa-Corona, Francisco M.

2018-01-01

Background The importance of tick and flea-borne rickettsia infections is increasingly recognized worldwide. While increased focus has shifted in recent years to the development of point-of-care diagnostics for various vector-borne diseases in humans and animals, little research effort has been devoted to their integration into vector surveillance and control programs, particularly in resource-challenged countries. One technology which may be helpful for large scale vector surveillance initiatives is loop-mediated isothermal amplification (LAMP). The aim of this study was to develop a LAMP assay to detect spotted fever group (SFG) rickettsia DNA from field-collected ticks and fleas and compare with published end-point PCR results. Methodology/Principal findings A Spotted Fever Group rickettsia-specific loop-mediated isothermal amplification (SFGR-LAMP) assay was developed using primers based on a region of the R. rickettsii 17kDa protein gene. The sensitivity, specificity, and reproducibility of the assay were evaluated. The assay was then compared with the results of end-point PCR assays for pooled tick and flea samples obtained from field-based surveillance studies. The sensitivity of the SFGR-LAMP assay was 0.00001 ng/μl (25μl volume) which was 10 times more sensitive than the 17kDa protein gene end-point PCR used as the reference method. The assay only recognized gDNA from SFG and transitional group (TRG) rickettsia species tested but did not detect gDNA from typhus group (TG) rickettsia species or closely or distantly related bacterial species. The SFGR-LAMP assay detected the same positives from a set of pooled tick and flea samples detected by end-point PCR in addition to two pooled flea samples not detected by end-point PCR. Conclusions/significance To our knowledge, this is the first study to develop a functional LAMP assay to initially screen for SFG and TRG rickettsia pathogens in field-collected ticks and fleas. With a high sensitivity and specificity, the results indicate the potential use as a field-based surveillance tool for tick and flea-borne rickettsial pathogens in resource-challenged countries. PMID:29390021

Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia.

PubMed

Noden, Bruce H; Martin, Jaclyn; Carrillo, Yisel; Talley, Justin L; Ochoa-Corona, Francisco M

2018-01-01

The importance of tick and flea-borne rickettsia infections is increasingly recognized worldwide. While increased focus has shifted in recent years to the development of point-of-care diagnostics for various vector-borne diseases in humans and animals, little research effort has been devoted to their integration into vector surveillance and control programs, particularly in resource-challenged countries. One technology which may be helpful for large scale vector surveillance initiatives is loop-mediated isothermal amplification (LAMP). The aim of this study was to develop a LAMP assay to detect spotted fever group (SFG) rickettsia DNA from field-collected ticks and fleas and compare with published end-point PCR results. A Spotted Fever Group rickettsia-specific loop-mediated isothermal amplification (SFGR-LAMP) assay was developed using primers based on a region of the R. rickettsii 17kDa protein gene. The sensitivity, specificity, and reproducibility of the assay were evaluated. The assay was then compared with the results of end-point PCR assays for pooled tick and flea samples obtained from field-based surveillance studies. The sensitivity of the SFGR-LAMP assay was 0.00001 ng/μl (25μl volume) which was 10 times more sensitive than the 17kDa protein gene end-point PCR used as the reference method. The assay only recognized gDNA from SFG and transitional group (TRG) rickettsia species tested but did not detect gDNA from typhus group (TG) rickettsia species or closely or distantly related bacterial species. The SFGR-LAMP assay detected the same positives from a set of pooled tick and flea samples detected by end-point PCR in addition to two pooled flea samples not detected by end-point PCR. To our knowledge, this is the first study to develop a functional LAMP assay to initially screen for SFG and TRG rickettsia pathogens in field-collected ticks and fleas. With a high sensitivity and specificity, the results indicate the potential use as a field-based surveillance tool for tick and flea-borne rickettsial pathogens in resource-challenged countries.

Insects Overshoot the Expected Upslope Shift Caused by Climate Warming

PubMed Central

Bässler, Claus; Hothorn, Torsten; Brandl, Roland; Müller, Jörg

2013-01-01

Along elevational gradients, climate warming may lead to an upslope shift of the lower and upper range margin of organisms. A recent meta-analysis concluded that these shifts are species specific and considerably differ among taxonomic lineages. We used the opportunity to compare upper range margins of five lineages (plants, beetles, flies, hymenoptera, and birds) between 1902–1904 and 2006–2007 within one region (Bavarian Forest, Central Europe). Based on the increase in the regional mean annual temperature during this period and the regional lapse rate, the upslope shift is expected to be between 51 and 201 m. Averaged across species within lineages, the range margin of all animal lineages shifted upslope, but that of plants did not. For animals, the observed shifts were probably due to shifts in temperature and not to changes in habitat conditions. The range margin of plants is therefore apparently not constrained by temperature, a result contrasting recent findings. The mean shift of birds (165 m) was within the predicted range and consistent with a recent global meta-analysis. However, the upslope shift of the three insect lineages (>260 m) exceeded the expected shift even after considering several sources of uncertainty, which indicated a non-linear response to temperature. Our analysis demonstrated broad differences among lineages in their response to climate change even within one region. Furthermore, on the considered scale, the response of ectothermic animals was not consistent with expectations based on shifts in the mean annual temperature. Irrespective of the reasons for the overshooting of the response of the insects, these shifts lead to reorganizations in the composition of assemblages with consequences for ecosystem processes. PMID:23762439

Insects overshoot the expected upslope shift caused by climate warming.

PubMed

Bässler, Claus; Hothorn, Torsten; Brandl, Roland; Müller, Jörg

2013-01-01

Along elevational gradients, climate warming may lead to an upslope shift of the lower and upper range margin of organisms. A recent meta-analysis concluded that these shifts are species specific and considerably differ among taxonomic lineages. We used the opportunity to compare upper range margins of five lineages (plants, beetles, flies, hymenoptera, and birds) between 1902-1904 and 2006-2007 within one region (Bavarian Forest, Central Europe). Based on the increase in the regional mean annual temperature during this period and the regional lapse rate, the upslope shift is expected to be between 51 and 201 m. Averaged across species within lineages, the range margin of all animal lineages shifted upslope, but that of plants did not. For animals, the observed shifts were probably due to shifts in temperature and not to changes in habitat conditions. The range margin of plants is therefore apparently not constrained by temperature, a result contrasting recent findings. The mean shift of birds (165 m) was within the predicted range and consistent with a recent global meta-analysis. However, the upslope shift of the three insect lineages (>260 m) exceeded the expected shift even after considering several sources of uncertainty, which indicated a non-linear response to temperature. Our analysis demonstrated broad differences among lineages in their response to climate change even within one region. Furthermore, on the considered scale, the response of ectothermic animals was not consistent with expectations based on shifts in the mean annual temperature. Irrespective of the reasons for the overshooting of the response of the insects, these shifts lead to reorganizations in the composition of assemblages with consequences for ecosystem processes.

Manufacturing of a novel double-function ssDNA aptamer for sensitive diagnosis and efficient neutralization of SEA.

PubMed

Sedighian, Hamid; Halabian, Raheleh; Amani, Jafar; Heiat, Mohammad; Taheri, Ramezan Ali; Imani Fooladi, Abbas Ali

2018-05-01

Staphylococcal enterotoxin A (SEA) is an enterotoxin produced mainly by Staphylococcus aureus. In recent years, it has become the most prevalent compound for staphylococcal food poisoning (SFP) around the world. In this study, we isolate new dual-function single-stranded DNA (ssDNA) aptamers by using some new methods, such as the Taguchi method, by focusing on the detection and neutralization of SEA enterotoxin in food and clinical samples. For the asymmetric polymerase chain reaction (PCR) optimization of each round of systematic evolution of ligands by exponential enrichment (SELEX), we use Taguchi L9 orthogonal arrays, and the aptamer mobility shift assay (AMSA) is used for initial evaluation of the protein-DNA interactions on the last SELEX round. In our investigation the dissociation constant (K D ) value and the limit of detection (LOD) of the candidate aptamer were found to be 8.5 ± 0.91 of nM and 5 ng/ml using surface plasmon resonance (SPR). In the current study, the Taguchi and mobility shift assay methods were innovatively harnessed to improve the selection process and evaluate the protein-aptamer interactions. To the best of our knowledge, this is the first report on employing these two methods in aptamer technology especially against bacterial toxin. Copyright © 2018 Elsevier Inc. All rights reserved.

Utilisation of Quartz Crystal Microbalance Sensors with Dissipation (QCM-D) for a Clauss Fibrinogen Assay in Comparison with Common Coagulation Reference Methods.

PubMed

Oberfrank, Stephanie; Drechsel, Hartmut; Sinn, Stefan; Northoff, Hinnak; Gehring, Frank K

2016-02-24

The determination of fibrinogen levels is one of the most important coagulation measurements in medicine. It plays a crucial part in diagnostic and therapeutic decisions, often associated with time-critical conditions. The commonly used measurement is the Clauss fibrinogen assay (CFA) where plasma is activated by thrombin reagent and which is conducted by mechanical/turbidimetric devices. As quartz crystal microbalance sensors with dissipation (QCM-D) based devices have a small footprint, can be operated easily and allow measurements independently from sample transportation time, laboratory location, availability and opening hours, they offer a great opportunity to complement laboratory CFA measurements. Therefore, the objective of the work was to (1) transfer the CFA to the QCM-D method; (2) develop an easy, time- and cost-effective procedure and (3) compare the results with references. Different sensor coatings (donor's own plasma; gold surface) and different QCM-D parameters (frequency signal shift; its calculated turning point; dissipation signal shift) were sampled. The results demonstrate the suitability for a QCM-D-based CFA in physiological fibrinogen ranges. Results were obtained in less than 1 min and in very good agreement with a standardized reference (Merlin coagulometer). The results provide a good basis for further investigation and pave the way to a possible application of QCM-D in clinical and non-clinical routine in the medical field.

Behavioral effects of Splenda, Equal and sucrose: clues from planarians on sweeteners

PubMed Central

Ouyang, Kevin; Nayak, Sunil; Lee, Young; Kim, Erin; Wu, Michael; Tallarida, Christopher S.; Rawls, Scott M.

2016-01-01

Sweetened diets share commonalities with drugs of abuse, but studies comparing behavioral effects of different sweeteners are lacking. Common table sugar produces rewarding and withdrawal effects in planarians. We postulated that Splenda and Equal would produce similar responses and used a tetrad of behavioral assays to test this hypothesis. Acute exposure to a relatively high concentration (10%) of each sweetener produced stereotyped responses (C-shapes) and reduced motility, with Equal producing greater motor effects than sucrose or Splenda. In experiments testing for anxiogenic-like effects, planarians withdrawn from Splenda (1, 3%) or sucrose (1, 3%), but not Equal, and placed into a petri dish with dark and light compartments spent more time in the dark compared to water controls. In place conditioning experiments, both Splenda (0.01%) and sucrose (0.01%) produced an environmental preference shift. Maltodextrin (0.1%), a principal ingredient of Splenda and Equal, produced a significant preference shift. In contrast, sucralose, an indigestible polysaccharide contained in Splenda and Equal, was ineffective. Our data reveal that Splenda produces sucrose-like rewarding and withdrawal effects in planarians that may be dependent on maltodextrin and dextrose. The ineffectiveness of Equal may be due to the presence of aspartame, which is too water insoluble to test in our planarian assay, or to its bitter aftertaste that could mask any rewarding effects produce by maltodextrin or dextrose. PMID:27845240

The change of nuclear LC3 distribution in acute myeloid leukemia cells.

PubMed

Guo, Wenjian; Jin, Jingrui; Pan, Jiajia; Yao, Rongxing; Li, Xia; Huang, Xin; Ma, Zhixing; Huang, Sujuan; Yan, Xiao; Jin, Jie; Dong, Aishu

2018-05-09

Making sure the change of nuclear LC3 distribution in the autophagy of acute myeloid leukemia (AML) cell and finding out the regulation mechanism may lead to a breakthrough for killing AML cells. Western blots were performed to assess the expression of autophagy proteins. Changes in the LC3 distribution were monitored by immunofluorescence assays together with western blots, and the expression levels of Sirt1, DOR, Beclin1, HMGB1, and AMPK mRNA were detected via fluorescent quantitative PCR. The effects of Sirt1 and DOR on cell proliferation and survival were analyzed by MTT, flow cytometry, and western blotting assays. We found that treating AML cells with Ara-c or Sorafenib resulted in autophagy enhancement, and when autophagy was enhanced, nuclear LC3 moved into the cytoplasm. Notably, when autophagy was inhibited by blocking the nuclear LC3 shift, the cytotoxicity of drugs was enhanced. Our results also identified Sirt1 and DOR as regulatory molecules for the observed nuclear LC3 shift, and these molecules further affected the expression of Beclin1, HMGB1, and AMPK. Our results suggest the distribution of nuclear LC3 can be a novel way for further studying death of AML cells,and the regulatory molecules may be new targets for treating AML. Copyright © 2018 Elsevier Inc. All rights reserved.

Utilisation of Quartz Crystal Microbalance Sensors with Dissipation (QCM-D) for a Clauss Fibrinogen Assay in Comparison with Common Coagulation Reference Methods

PubMed Central

Oberfrank, Stephanie; Drechsel, Hartmut; Sinn, Stefan; Northoff, Hinnak; Gehring, Frank K.

2016-01-01

The determination of fibrinogen levels is one of the most important coagulation measurements in medicine. It plays a crucial part in diagnostic and therapeutic decisions, often associated with time-critical conditions. The commonly used measurement is the Clauss fibrinogen assay (CFA) where plasma is activated by thrombin reagent and which is conducted by mechanical/turbidimetric devices. As quartz crystal microbalance sensors with dissipation (QCM-D) based devices have a small footprint, can be operated easily and allow measurements independently from sample transportation time, laboratory location, availability and opening hours, they offer a great opportunity to complement laboratory CFA measurements. Therefore, the objective of the work was to (1) transfer the CFA to the QCM-D method; (2) develop an easy, time- and cost-effective procedure and (3) compare the results with references. Different sensor coatings (donor’s own plasma; gold surface) and different QCM-D parameters (frequency signal shift; its calculated turning point; dissipation signal shift) were sampled. The results demonstrate the suitability for a QCM-D-based CFA in physiological fibrinogen ranges. Results were obtained in less than 1 min and in very good agreement with a standardized reference (Merlin coagulometer). The results provide a good basis for further investigation and pave the way to a possible application of QCM-D in clinical and non-clinical routine in the medical field. PMID:26927107

Behavioral effects of Splenda, Equal and sucrose: Clues from planarians on sweeteners.

PubMed

Ouyang, Kevin; Nayak, Sunil; Lee, Young; Kim, Erin; Wu, Michael; Tallarida, Christopher S; Rawls, Scott M

2017-01-01

Sweetened diets share commonalities with drugs of abuse, but studies comparing behavioral effects of different sweeteners are lacking. Common table sugar produces rewarding and withdrawal effects in planarians. We postulated that Splenda and Equal would produce similar responses and used a tetrad of behavioral assays to test this hypothesis. Acute exposure to a relatively high concentration (10%) of each sweetener produced stereotyped responses (C-shapes) and reduced motility, with Equal producing greater motor effects than sucrose or Splenda. In experiments testing for anxiogenic-like effects, planarians withdrawn from Splenda (1, 3%) or sucrose (1, 3%), but not Equal, and placed into a petri dish with dark and light compartments spent more time in the dark compared to water controls. In place conditioning experiments, both Splenda (0.01%) and sucrose (0.01%) produced an environmental preference shift. Maltodextrin (0.1%), a principal ingredient of Splenda and Equal, produced a significant preference shift. In contrast, sucralose, an indigestible polysaccharide contained in Splenda and Equal, was ineffective. Our data reveal that Splenda produces sucrose-like rewarding and withdrawal effects in planarians that may be dependent on maltodextrin and dextrose. The ineffectiveness of Equal may be due to the presence of aspartame, which is too water insoluble to test in our planarian assay, or to its bitter aftertaste that could mask any rewarding effects produce by maltodextrin or dextrose. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Regulation of glycerolipid metabolism in Tetrahymena species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jones, C.R.

1988-01-01

A simplified extraction system was developed to study the in vivo incorporation of 1-{sup 14}C-acetate into the glycerolipids of Tetrahymena. Cells incubated in the presence of 1-{sup 14}C-sodium acetate were spotted onto pre-acidified TLC plate and extracted by developing the plates in ethanol, and thereafter developing with 90:10:1 (v:v:v) hexane-ether-acetic acid. The synthesis of glycerolipids in Tetrahymena thermophila and Tetrahymena furgasoni, was studied using the above assay system. The level of triacylglycerol was elevated at stationary phase, whereas phospholipid levels were depressed. A shift from phospholipid synthesis to triacylglycerol synthesis occurred when growth was inhibited in Tetrahymena thermophila. The signalmore » for this shift in Tetrahymena thermophila is apparently a decrease in protein synthesis due either to culture age, the presence of cycloheximide, or the removal of amino acid from the synthetic medium. In exponentially growing Tetrahymena thermophila cycloheximide stimulated the incorporation of 1-{sup 14}C-acetate into triacylglycerol and decreased the incorporation into phospholipid, while stopping the incorporation of 1-{sup 14}C-serine into TCA precipitable material from the cells. Similar alterations in glycerolipid synthesis were obtained when amino acids were deleted from the medium. An in vitro assay system was developed to measure the incorporation of 1-{sup 14}C-palmitic acid into triacylglycerol and phospholipid using conditions similar to those of the in vivo studies.« less

Structure of human IFIT1 with capped RNA reveals adaptable mRNA binding and mechanisms for sensing N1 and N2 ribose 2′-O methylations

PubMed Central

Laudenbach, Beatrice Theres; Martínez-Montero, Saúl; Cencic, Regina; Habjan, Matthias; Pichlmair, Andreas; Damha, Masad J.; Pelletier, Jerry; Nagar, Bhushan

2017-01-01

IFIT1 (IFN-induced protein with tetratricopeptide repeats-1) is an effector of the host innate immune antiviral response that prevents propagation of virus infection by selectively inhibiting translation of viral mRNA. It relies on its ability to compete with the translation initiation factor eIF4F to specifically recognize foreign capped mRNAs, while remaining inactive against host mRNAs marked by ribose 2′-O methylation at the first cap-proximal nucleotide (N1). We report here several crystal structures of RNA-bound human IFIT1, including a 1.6-Å complex with capped RNA. IFIT1 forms a water-filled, positively charged RNA-binding tunnel with a separate hydrophobic extension that unexpectedly engages the cap in multiple conformations (syn and anti) giving rise to a relatively plastic and nonspecific mode of binding, in stark contrast to eIF4E. Cap-proximal nucleotides encircled by the tunnel provide affinity to compete with eIF4F while allowing IFIT1 to select against N1 methylated mRNA. Gel-shift binding assays confirm that N1 methylation interferes with IFIT1 binding, but in an RNA-dependent manner, whereas translation assays reveal that N1 methylation alone is not sufficient to prevent mRNA recognition at high IFIT1 concentrations. Structural and functional analysis show that 2′-O methylation at N2, another abundant mRNA modification, is also detrimental for RNA binding, thus revealing a potentially synergistic role for it in self- versus nonself-mRNA discernment. Finally, structure-guided mutational analysis confirms the importance of RNA binding for IFIT1 restriction of a human coronavirus mutant lacking viral N1 methylation. Our structural and biochemical analysis sheds new light on the molecular basis for IFIT1 translational inhibition of capped viral RNA. PMID:28251928

The Influence of Power Shifts in Data Collection and Analysis Stages: A Focus on Qualitative Research Interview

ERIC Educational Resources Information Center

Anyan, Frederick

2013-01-01

This paper analyzes the power relation between the interviewer and the interviewee in the qualitative research interview methodology. The paper sets out to grapple with the extent to which the dynamisms in power shifts influence data collection and analysis in the interview methodology. The exploration of power shifts in the qualitative research…

Clinical and economic impact of the introduction of a nucleic acid amplification assay for Clostridium difficile.

PubMed

Guinta, Margaret M; Bunnell, Kristen; Harrington, Amanda; Bleasdale, Susan; Danziger, Larry; Wenzler, Eric

2017-12-04

The clinical outcomes and cost implications of a diagnostic shift from an EIA- to PCR-based assay for Clostridium difficile infection (CDI) have not been completely described in the literature. The impact of the PCR-based assay on the incidence and duration of CDI therapy was compared to the EIA assay for patients with a negative CDI diagnostic result. Secondary clinical and economic outcomes were also evaluated. Independent predictors of receipt of antibiotic therapy were assessed via logistic regression. 141 EIA and 140 PCR patients were included. Significantly more patients were started or continued on anti-CDI antibiotic therapy after a known negative assay result in the EIA group (26 patients vs. 8 patients, P = 0.002). Duration of antibiotic therapy after a known negative result was significantly shorter in the PCR group (1 vs. 4 days, P = 0.029) and a 23% reduction in the number of tests obtained per patient was observed (1.41 ± 0.86 vs. 1.82 ± 1.35, P = 0.007). The over fourfold difference in per-test cost of the EIA assay ($8.33 vs. $42.86, P < 0.0001) was offset by the overall medication costs required for the increased treatment in the EIA group ($546.60 vs. $188.96, P = 0.191). Utilization of the EIA-based CDI assay was associated with increased odds of CDI treatment after a negative test (aOR 4.71, 95% CI 1.93-11.46, P = 0.001). The transition from an EIA to PCR-based assay for diagnosing CDI resulted in a significant decrease in the number of patients treated and the duration of treatment in response to a negative test result. This significant decrease in treatment resulted in decreased costs offsetting the utilization of a more expensive molecular test for patients with a negative CDI diagnostic result.

Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

NASA Astrophysics Data System (ADS)

Zhang, Z.; Birkedal, V.; Gothelf, K. V.

2016-05-01

The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

E4bp4 regulates carboxylesterase 2 enzymes through repression of the nuclear receptor Rev-erbα in mice.

PubMed

Zhao, Mengjing; Zhang, Tianpeng; Yu, Fangjun; Guo, Lianxia; Wu, Baojian

2018-06-01

Carboxylesterases (CES) are a family of phase I enzymes that play an important role in xenobiotic clearance and lipid metabolism. Here, we investigate a potential role of E4 promoter-binding protein 4 (E4bp4) in regulation of Ces and CPT-11 (irinotecan, a first-line drug for treating colorectal cancer) pharmacokinetics in mice. Mouse hepatoma Hepa-1c1c7 cells were transfected with Rev-erbα expression plasmid or siRNA targeting E4bp4. The relative mRNA and protein levels of Ces enzymes in the cells or the livers of wild-type and E4bp4-deficient (E4bp4 -/- ) mice were determined by qPCR and Western blotting, respectively. Transcriptional regulation of Ces by E4bp4/Rev-erbα were investigated using luciferase reporter, mobility shift, and co-immunoprecipitation (Co-IP) assays. Pharmacokinetic studies were performed with wild-type and E4bp4 -/- mice after intraperitoneal injection of CPT-11. E4bp4 ablation down-regulated an array of hepatic Ces genes in mice. E4bp4 -/- mice also showed reduced Ces-mediated metabolism and elevated systemic exposure of CPT-11, a well-known Ces substrate. Consistently, E4bp4 knockdown reduced the expression of Ces genes (Ces2b, Ces2e and Ces2f) in Hepa-1c1c7 cells. Furthermore, Rev-erbα repressed the transcription of Ces2b, whereas E4bp4 antagonized this repressive action. Co-IP experiment confirmed a direct interaction between E4bp4 and Rev-erbα. Through a combination of promoter analysis and mobility shift assays, we demonstrated that Rev-erbα trans-repressed Ces (Ces2b) through its specific binding to the -767 to-754 bp promoter region. In conclusion, E4bp4 regulates Ces enzymes through inhibition of the transrepression activity of Rev-erbα, thereby impacting the metabolism and pharmacokinetics of Ces substrates. Copyright © 2018 Elsevier Inc. All rights reserved.

Quality Improvement to Demonstrate the Lack of Reliability of the Human Papillomavirus mRNA Assay to Identify Women With Latent Human Papillomavirus Infections.

PubMed

Cotton, Sarah; Brown, Robert E; Nugent, Elizabeth K; Robazetti, Sonia C; Berens, Pamela D; Smith, Judith A

2018-04-01

To assess the consistency between human papillomavirus (HPV) mRNA testing in women with a history of previous HPV infections diagnosed by HPV DNA assay and the potential effects on follow-up HPV screening. This was a quality improvement study that used data from a pathology laboratory software database reviewed from November 2014 to June 2016 to identify female patients aged 30 years or older with greater than one HPV-positive result, including one or more HPV mRNA assay results and one or more documented HPV DNA assay results for comparison. Previous correlative cytology and colposcopic histopathology were also documented. American College of Obstetricians and Gynecologists' cervical cancer screening guidelines were used to compare potential differences in follow-up recommendations. Four hundred twenty-five charts for female patients 30 years of age or older were identified with one or more prior high-risk HPV infections by DNA assay. There was a 69.3% difference in HPV mRNA results compared with previous HPV DNA-positive results. There was a potential change in follow-up for 71.7% of patients with one prior high-risk-HPV-positive result and 60.0% of patients with two or more prior high-risk HPV-positive results. There were 231 colposcopy reports evaluated in this study. Of these, 62 (26.8%) were abnormal colposcopy reports, including 45 low-grade squamous intraepithelial lesions, 15 high-grade squamous intraepithelial lesions, and two cancers. Twenty-five (40.3%) abnormal colposcopy findings were in patients with a history of at least than two prior HPV DNA-positive results and a report of currently being HPV-negative with the mRNA assay. The HPV mRNA assays are less sensitive for detection of latent HPV infections compared with HPV DNA assays. Based on these data and the potential change in follow-up care, the HPV mRNA assay should not be used for a primary screening tool for cervical cancer. Many pathology laboratories have shifted to using the HPV mRNA assay without clear discussion with gynecologists about the effects on patient follow-up. The type of HPV assay being used should be documented and any HPV mRNA result confirmed by HPV DNA assay.

Current Protocols in Protein Science

PubMed Central

Huynh, Kathy

2015-01-01

The purification of recombinant proteins for biochemical assays and structural studies is time-consuming and presents inherent difficulties that depend on the optimization of protein stability. The use of dyes to monitor thermal denaturation of proteins with sensitive fluorescence detection enables the rapid and inexpensive determination of protein stability using real-time PCR instruments. By screening a wide range of solution conditions and additives in 96-well format, the thermal shift assay easily identifies conditions that significantly enhance the stability of recombinant proteins. The same approach can be used as a low cost, initial screen to discover new protein:ligand interactions by capitalizing on increases in protein stability that typically occur upon ligand binding. This unit presents a methodological workflow for the small-scale, high-throughout thermal denaturation of recombinant proteins in the presence of SYPRO Orange dye. PMID:25640896

Rational design of gold nanoparticle toxicology assays: a question of exposure scenario, dose and experimental setup.

PubMed

Taylor, Ulrike; Rehbock, Christoph; Streich, Carmen; Rath, Detlef; Barcikowski, Stephan

2014-09-01

Many studies have evaluated the toxicity of gold nanoparticles, although reliable predictions based on these results are rare. In order to overcome this problem, this article highlights strategies to improve comparability and standardization of nanotoxicological studies. To this end, it is proposed that we should adapt the nanomaterial to the addressed exposure scenario, using ligand-free nanoparticle references in order to differentiate ligand effects from size effects. Furthermore, surface-weighted particle dosing referenced to the biologically relevant parameter (e.g., cell number or organ mass) is proposed as the gold standard. In addition, it is recommended that we should shift the focus of toxicological experiments from 'live-dead' assays to the assessment of cell function, as this strategy allows observation of bioresponses at lower doses that are more relevant for in vivo scenarios.

SWATH Mass Spectrometry Performance Using Extended Peptide MS/MS Assay Libraries.

PubMed

Wu, Jemma X; Song, Xiaomin; Pascovici, Dana; Zaw, Thiri; Care, Natasha; Krisp, Christoph; Molloy, Mark P

2016-07-01

The use of data-independent acquisition methods such as SWATH for mass spectrometry based proteomics is usually performed with peptide MS/MS assay libraries which enable identification and quantitation of peptide peak areas. Reference assay libraries can be generated locally through information dependent acquisition, or obtained from community data repositories for commonly studied organisms. However, there have been no studies performed to systematically evaluate how locally generated or repository-based assay libraries affect SWATH performance for proteomic studies. To undertake this analysis, we developed a software workflow, SwathXtend, which generates extended peptide assay libraries by integration with a local seed library and delivers statistical analysis of SWATH-quantitative comparisons. We designed test samples using peptides from a yeast extract spiked into peptides from human K562 cell lysates at three different ratios to simulate protein abundance change comparisons. SWATH-MS performance was assessed using local and external assay libraries of varying complexities and proteome compositions. These experiments demonstrated that local seed libraries integrated with external assay libraries achieve better performance than local assay libraries alone, in terms of the number of identified peptides and proteins and the specificity to detect differentially abundant proteins. Our findings show that the performance of extended assay libraries is influenced by the MS/MS feature similarity of the seed and external libraries, while statistical analysis using multiple testing corrections increases the statistical rigor needed when searching against large extended assay libraries. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

SWATH Mass Spectrometry Performance Using Extended Peptide MS/MS Assay Libraries*

PubMed Central

Wu, Jemma X.; Song, Xiaomin; Pascovici, Dana; Zaw, Thiri; Care, Natasha; Krisp, Christoph; Molloy, Mark P.

2016-01-01

The use of data-independent acquisition methods such as SWATH for mass spectrometry based proteomics is usually performed with peptide MS/MS assay libraries which enable identification and quantitation of peptide peak areas. Reference assay libraries can be generated locally through information dependent acquisition, or obtained from community data repositories for commonly studied organisms. However, there have been no studies performed to systematically evaluate how locally generated or repository-based assay libraries affect SWATH performance for proteomic studies. To undertake this analysis, we developed a software workflow, SwathXtend, which generates extended peptide assay libraries by integration with a local seed library and delivers statistical analysis of SWATH-quantitative comparisons. We designed test samples using peptides from a yeast extract spiked into peptides from human K562 cell lysates at three different ratios to simulate protein abundance change comparisons. SWATH-MS performance was assessed using local and external assay libraries of varying complexities and proteome compositions. These experiments demonstrated that local seed libraries integrated with external assay libraries achieve better performance than local assay libraries alone, in terms of the number of identified peptides and proteins and the specificity to detect differentially abundant proteins. Our findings show that the performance of extended assay libraries is influenced by the MS/MS feature similarity of the seed and external libraries, while statistical analysis using multiple testing corrections increases the statistical rigor needed when searching against large extended assay libraries. PMID:27161445

Multiplex tandem mass spectrometry assay for newborn screening of X-linked adrenoleukodystrophy, biotinidase deficiency, and galactosemia with flexibility to assay other enzyme assays and biomarkers.

PubMed

Hong, Xinying; Kumar, Arun Babu; Ronald Scott, C; Gelb, Michael H

2018-03-29

All States screen for biotinidase deficiency and galactosemia, and X-linked adrenoleukodystrophy (X-ALD) has recently been added to the Recommended Uniform Screening Panel (RUSP).We sought to consolidate these tests by combining them into a single multiplex tandem mass spectrometry assay as well as to improve the current protocol for newborn screening of galactosemia.A 3 mm punch of a dried blood spot (DBS) was extracted with organic solvent for analysis of the C26:0-lysophosphatidylcholine biomarker for X-ALD.An additional punch was used to assay galactose-1-phosphate uridyltransferase (GALT) and biotinidase.All assays were combined for a single injection for analysis by liquid chromatography-tandem mass spectrometry (LC-MS/MS) (2.3 min per sample).The GALT LC-MS/MS assay does not give a false positive for galactosemia if glucose-6-phosphate dehydrogenase is deficient.The multiplex assay shows acceptable reproducibility and provides for rapid analysis of X-ALD, biotinidase deficiency, and galactosemia.The throughput and ease of sample preparation are acceptable for newborn screening laboratories.We also show that the LC-MS/MS assay is expandable to include several other diseases including Pompe and Hurler diseases (enzymatic activities and biomarkers).Because of consolidation of assays, less manpower is needed compared to running individual assays on separate platforms.The flexibility of the LC-MS/MS platform allows each newborn screening laboratory to analyze the set of diseases offered in their panel. Copyright © 2018 Elsevier Inc. All rights reserved.

Effect of the mass center shift for force-free flexible spacecraft

NASA Technical Reports Server (NTRS)

Meirovitch, L.; Juang, J.-N.

1975-01-01

For a spinning flexible spacecraft the mass center generally shifts relative to the nominal undeformed position. It is thought that this shift of center complicates spacecraft stability analysis. It is proved, on the basis of results achieved by Meirovitch and Calico (1972), that for the general class of force-free single-spin flexible spacecraft it is possible to ignore this shift of center without affecting the stability criteria in any significant way. A new theorem on inequalities for quadratic forms is proved to demonstrate the validity of the stability analysis.

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

Coexisting properties of thermostability and ultraviolet radiation resistance in the main S-layer complex of Deinococcus radiodurans.

PubMed

Farci, Domenica; Slavov, Chavdar; Piano, Dario

2018-01-17

Deinococcus radiodurans is well known for its unusual resistance to different environmental stresses. Recently, we have described a novel complex composed of the surface (S)-layer protein DR_2577 and the carotenoid deinoxanthin. We also showed a role of this complex in the UV resistance under desiccation. Both these properties, UV and desiccation resistance, suggest a selective pressure generated by Sun irradiation. In order to confirm this hypothesis we checked whether this S-layer Deinoxanthin Binding Complex (SDBC) has features of thermo-resistance, a property also expected in proteins evolved under solar irradiative pressure. We performed the spectroscopic characterization of the SDBC by means of thermal shift assay, circular dichroism and related in silico analysis. Our findings identify a stability typical of thermo-adapted proteins and provide a new insight into the origin of specific S-layer types. The results are discussed in terms of co-evolutionary mechanisms related to Sun-induced desiccation and heat.

Regulation of matrix metalloproteinase-9 expression between gingival fibroblast cells from old and young rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Su-Jung; Chung, Yong-Koo; Chung, Tae-Wook

2009-01-09

Gingival fibroblast cells (rGF) from aged rats have an age-related decline in proliferative capacity compared with young rats. We investigated G1 phase cell cycle regulation and MMP-9 expression in both young and aged rGF. G1 cell cycle protein levels and activity were significantly reduced in response to interleukin-1{beta} (IL-1{beta}) stimulation with increasing in vitro age. Tumor necrosis factor-{alpha} (TNF-{alpha})-induced matrix metalloproteinase-9 (MMP-9) expression was also decreased in aged rGF in comparison with young rGF. Mutational analysis and gel shift assays demonstrated that the lower MMP-9 expression in aged rGF is associated with lower activities of transcription factors NF-{kappa}B and AP-1.more » These results suggest that cell cycle dysregulation and down-regulation of MMP-9 expression in rGF may play a role in gingival remodeling during in vitro aging.« less

Properties and Biocompatibility of Chitosan and Silk Fibroin Blend Films for Application in Skin Tissue Engineering

PubMed Central

Luangbudnark, Witoo; Viyoch, Jarupa; Laupattarakasem, Wiroon; Surakunprapha, Palakorn; Laupattarakasem, Pisamai

2012-01-01

Chitosan/silk fibroin (CS/SF) blend films were prepared and evaluated for feasibility of using the films as biomaterial for skin tissue engineering application. Fourier transform infrared spectroscopy and differential scanning calorimetry analysis indicated chemical interaction between chitosan and fibroin. Chitosan enhanced β-sheet conformation of fibroin and resulted in shifting of thermal degradation of the films. Flexibility, swelling index, and enzyme degradation were also increased by the chitosan content of the blend films. Biocompatibility of the blend films was determined by cultivation with fibroblast cells. All films showed no cytotoxicity by XTT assay. Fibroblast cells spread on CS/SF films via dendritic extensions, and cell-cell interactions were noted. Cell proliferation on CS/SF films was also demonstrated, and their phenotype was examined by the expression of collagen type I gene. These results showed possibility of using the CS/SF films as a supporting material for further study on skin tissue engineering. PMID:22701367

Rice homeobox transcription factor HOX1a positively regulates gibberellin responses by directly suppressing EL1.

PubMed

Wen, Bi-Qing; Xing, Mei-Qing; Zhang, Hua; Dai, Cheng; Xue, Hong-Wei

2011-11-01

Homeobox transcription factors are involved in various aspects of plant development, including maintenance of the biosynthesis and signaling pathways of different hormones. However, few direct targets of homeobox proteins have been identified. We here show that overexpression of rice homeobox gene HOX1a resulted in enhanced gibberellin (GA) response, indicating a positive effect of HOX1a in GA signaling. HOX1a is induced by GA and encodes a homeobox transcription factor with transcription repression activity. In addition, HOX1a suppresses the transcription of early flowering1 (EL1), a negative regulator of GA signaling, and further electrophoretic mobility shift assay and chromatin immunoprecipitation analysis revealed that HOX1a directly bound to the promoter region of EL1 to suppress its expression and stimulate GA signaling. These results demonstrate that HOX1a functions as a positive regulator of GA signaling by suppressing EL1, providing informative hints on the study of GA signaling. © 2011 Institute of Botany, Chinese Academy of Sciences.

Rapid quantitation of atorvastatin in process pharmaceutical powder sample using Raman spectroscopy and evaluation of parameters related to accuracy of analysis.

PubMed

Lim, Young-Il; Han, Janghee; Woo, Young-Ah; Kim, Jaejin; Kang, Myung Joo

2018-07-05

The purpose of this study was to determine the atorvastatin (ATV) content in process pharmaceutical powder sample using Raman spectroscopy. To establish the analysis method, the influence of the type of Raman measurements (back-scattering or transmission mode), preparation of calibration sample (simple admixing or granulation), sample pre-treatment (pelletization), and spectral pretreatment on the Raman spectra was investigated. The characteristic peak of the active compound was more distinctively detected in transmission Raman mode with a laser spot size of 4mm than in the back-scattering method. Preparation of calibration samples by wet granulation, identical to the actual manufacturing process, provided unchanged spectral patterns for the in process sample, with no changes and/or shifts in the spectrum. Pelletization before Raman analysis remarkably improved spectral reproducibility by decreasing the difference in density between the samples. Probabilistic quotient normalization led to accurate and consistent quantification of the ATV content in the calibration samples (standard error of cross validation: 1.21%). Moreover, the drug content in the granules obtained from five commercial batches were reliably quantified, with no statistical difference (p=0.09) with that obtained by HPLC assay. From these findings, we suggest that transmission Raman analysis may be a fast and non-invasive method for the quantification of ATV in actual manufacturing processes. Copyright © 2018 Elsevier B.V. All rights reserved.

Rapid quantitation of atorvastatin in process pharmaceutical powder sample using Raman spectroscopy and evaluation of parameters related to accuracy of analysis

NASA Astrophysics Data System (ADS)

Lim, Young-Il; Han, Janghee; Woo, Young-Ah; Kim, Jaejin; Kang, Myung Joo

2018-07-01

The purpose of this study was to determine the atorvastatin (ATV) content in process pharmaceutical powder sample using Raman spectroscopy. To establish the analysis method, the influence of the type of Raman measurements (back-scattering or transmission mode), preparation of calibration sample (simple admixing or granulation), sample pre-treatment (pelletization), and spectral pretreatment on the Raman spectra was investigated. The characteristic peak of the active compound was more distinctively detected in transmission Raman mode with a laser spot size of 4 mm than in the back-scattering method. Preparation of calibration samples by wet granulation, identical to the actual manufacturing process, provided unchanged spectral patterns for the in process sample, with no changes and/or shifts in the spectrum. Pelletization before Raman analysis remarkably improved spectral reproducibility by decreasing the difference in density between the samples. Probabilistic quotient normalization led to accurate and consistent quantification of the ATV content in the calibration samples (standard error of cross validation: 1.21%). Moreover, the drug content in the granules obtained from five commercial batches were reliably quantified, with no statistical difference (p = 0.09) with that obtained by HPLC assay. From these findings, we suggest that transmission Raman analysis may be a fast and non-invasive method for the quantification of ATV in actual manufacturing processes.

Inter-laboratory comparison of the in vivo comet assay including three image analysis systems.

PubMed

Plappert-Helbig, Ulla; Guérard, Melanie

2015-12-01

To compare the extent of potential inter-laboratory variability and the influence of different comet image analysis systems, in vivo comet experiments were conducted using the genotoxicants ethyl methanesulfonate and methyl methanesulfonate. Tissue samples from the same animals were processed and analyzed-including independent slide evaluation by image analysis-in two laboratories with extensive experience in performing the comet assay. The analysis revealed low inter-laboratory experimental variability. Neither the use of different image analysis systems, nor the staining procedure of DNA (propidium iodide vs. SYBR® Gold), considerably impacted the results or sensitivity of the assay. In addition, relatively high stability of the staining intensity of propidium iodide-stained slides was found in slides that were refrigerated for over 3 months. In conclusion, following a thoroughly defined protocol and standardized routine procedures ensures that the comet assay is robust and generates comparable results between different laboratories. © 2015 Wiley Periodicals, Inc.

Linking Task Analysis with Student Learning.

ERIC Educational Resources Information Center

Sherman, Thomas M.; Wildman, Terry M.

An examination of task analysis from several perspectives in order to identify some of its purposes and advantages reveals that, as the interest in learning theory has shifted from a predominately behavioral perspective to a more cognitive orientation, the purpose of task analysis has also shifted. Formerly the purpose of task analysis was to aid…

Comparison of Abbott and Da-an real-time PCR for quantitating serum HBV DNA.

PubMed

Qiu, Ning; Li, Rui; Yu, Jian-Guo; Yang, Wen; Zhang, Wei; An, Yong; Li, Tong; Liu, Xue-En; Zhuang, Hui

2014-09-07

To compare the performance of the Da-an real-time hepatitis B virus (HBV) DNA assay and Abbott RealTime HBV assay. HBV DNA standards as well as a total of 180 clinical serum samples from patients with chronic hepatitis B were measured using the Abbott and Da-an real-time polymerase chain reaction (PCR) assays. Correlation and Bland-Altman plot analysis was used to compare the performance of the Abbott and Da-an assays. The HBV DNA levels were logarithmically transformed for analysis. All statistical analyses were performed using SPSS for Windows version 18.0. The correlation between the two assays was analyzed by Pearson's correlation and linear regression. The Bland-Altman plots were used for the analysis of agreement between the two assays. A P value of < 0.05 was considered statistically significant. The HBV DNA values measured by the Abbott or Da-an assay were significantly correlated with the expected values of HBV DNA standards (r = 0.999, for Abbott; r = 0.987, for Da-an, P < 0.001). A Bland-Altman plot showed good agreement between these two assays in detecting HBV DNA standards. Among the 180 clinical serum samples, 126 were quantifiable by both assays. Fifty-two samples were detectable by the Abbott assay but below the detection limit of the Da-an assay. Moreover, HBV DNA levels measured by the Abbott assay were significantly higher than those of the Da-an assay (6.23 ± 1.76 log IU/mL vs 5.46 ± 1.55 log IU/mL, P < 0.001). A positive correlation was observed between HBV DNA concentrations determined by the two assays in 126 paired samples (r = 0.648, P < 0.001). One hundred and fifteen of 126 (91.3%) specimens tested with both assays were within mean difference ± 1.96 SD of HBV DNA levels. The Da-an assay presented lower sensitivity and a narrower linear range as compared to the Abbott assay, suggesting the need to be improved.

Ratiometric analysis of Acridine Orange staining in the study of acidic organelles and autophagy.

PubMed

Thomé, Marcos P; Filippi-Chiela, Eduardo C; Villodre, Emilly S; Migliavaca, Celina B; Onzi, Giovana R; Felipe, Karina B; Lenz, Guido

2016-12-15

Acridine Orange is a cell-permeable green fluorophore that can be protonated and trapped in acidic vesicular organelles (AVOs). Its metachromatic shift to red fluorescence is concentration-dependent and, therefore, Acridine Orange fluoresces red in AVOs, such as autolysosomes. This makes Acridine Orange staining a quick, accessible and reliable method to assess the volume of AVOs, which increases upon autophagy induction. Here, we describe a ratiometric analysis of autophagy using Acridine Orange, considering the red-to-green fluorescence intensity ratio (R/GFIR) to quantify flow cytometry and fluorescence microscopy data of Acridine-Orange-stained cells. This method measured with accuracy the increase in autophagy induced by starvation or rapamycin, and the reduction in autophagy produced by bafilomycin A1 or the knockdown of Beclin1 or ATG7. Results obtained with Acridine Orange, considering R/GFIR, correlated with the conversion of the unlipidated form of LC3 (LC3-I) into the lipidated form (LC3-II), SQSTM1 degradation and GFP-LC3 puncta formation, thus validating this assay to be used as an initial and quantitative method for evaluating the late step of autophagy in individual cells, complementing other methods. © 2016. Published by The Company of Biologists Ltd.

Population genetic structure and vocal dialects in an amazon parrot.

PubMed Central

Wright, T F; Wilkinson, G S

2001-01-01

The relationship between cultural and genetic evolution was examined in the yellow-naped amazon Amazona auropalliata. This species has previously been shown to have regional dialects defined by large shifts in the acoustic structure of its learned contact call. Mitochondrial DNA sequence variation from a 680 base pair segment of the first domain of the control region was assayed in 41 samples collected from two neighbouring dialects in Costa Rica. The relationship of genetic variation to vocal variation was examined using haplotype analysis, genetic distance analysis, a maximum-likelihood estimator of migration rates and phylogenetic reconstructions. All analyses indicated a high degree of gene flow and, thus, individual dispersal across dialect boundaries. Calls sampled from sound libraries suggested that temporally stable contact call dialects occur throughout the range of the yellow-naped amazon, while the presence of similar dialects in the sister species Amazona ochrocephala suggests that the propensity to form dialects is ancestral in this clade. These results indicate that genes and culture are not closely associated in the yellow-naped amazon. Rather, they suggest that regional diversity in vocalizations is maintained by selective pressures that promote social learning and allow individual repertoires to conform to local call types. PMID:11297178

NMR structural study of the intracellular loop 3 of the serotonin 5-HT(1A) receptor and its interaction with calmodulin.

PubMed

Chen, Angela Shuyi; Kim, Young Mee; Gayen, Shovanlal; Huang, Qiwei; Raida, Manfred; Kang, Congbao

2011-09-01

The serotonin (5-HT(1A)) receptor, a G-protein-coupled receptor (GPCR), plays important roles in serotonergic signaling in the central nervous system. The third intracellular loop (ICL3) of the 5-HT(1A) receptor has been shown to be important for the regulation of this receptor through interactions with proteins such as G-proteins and calmodulin. In this study, the ICL3 of 5-HT(1A) receptor was expressed in E. coli and purified. Gel filtration and mass spectrometry were used to confirm the molecular weight of the purified ICL3. Secondary structure analysis using circular dichroism (CD) demonstrated the presence of α-helical structures. Backbone assignment of ICL3 was achieved using three-dimensional experiments. A chemical shift index and Talos+ analysis showed that residues E326 to R339 form α-helical structure. Residues G256 to S269 of ICL3 were shown to be a novel region that has a molecular interaction with calmodulin in titration assays. Peptide derived from the ICL3 containing residues from G256 to S269 also showed molecular interaction with calmodulin. Copyright © 2011 Elsevier B.V. All rights reserved.

Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.

PubMed

Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio

2011-08-01

Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.

Variation of nonylphenol-degrading gene abundance and bacterial community structure in bioaugmented sediment microcosm.

PubMed

Wang, Zhao; Yang, Yuyin; Sun, Weimin; Dai, Yu; Xie, Shuguang

2015-02-01

Nonylphenol (NP) can accumulate in river sediment. Bioaugmentation is an attractive option to dissipate heavy NP pollution in river sediment. In this study, two NP degraders were isolated from crude oil-polluted soil and river sediment. Microcosms were constructed to test their ability to degrade NP in river sediment. The shift in the proportion of NP-degrading genes and bacterial community structure in sediment microcosms were characterized using quantitative PCR assay and terminal restriction fragment length polymorphism analysis, respectively. Phylogenetic analysis indicated that the soil isolate belonged to genus Stenotrophomonas, while the sediment isolate was a Sphingobium species. Both of them could almost completely clean up a high level of NP in river sediment (150 mg/kg NP) in 10 or 14 days after inoculation. An increase in the proportion of alkB and sMO genes was observed in sediment microcosms inoculated with Stenotrophomonas strain Y1 and Sphingobium strain Y2, respectively. Moreover, bioaugmentation using Sphingobium strain Y2 could have a strong impact on sediment bacterial community structure, while inoculation of Stenotrophomonas strain Y1 illustrated a weak impact. This study can provide some new insights towards NP biodegradation and bioremediation.

A Unifying Review of Bioassay-Guided Fractionation, Effect-Directed Analysis and Related Techniques

PubMed Central

Weller, Michael G.

2012-01-01

The success of modern methods in analytical chemistry sometimes obscures the problem that the ever increasing amount of analytical data does not necessarily give more insight of practical relevance. As alternative approaches, toxicity- and bioactivity-based assays can deliver valuable information about biological effects of complex materials in humans, other species or even ecosystems. However, the observed effects often cannot be clearly assigned to specific chemical compounds. In these cases, the establishment of an unambiguous cause-effect relationship is not possible. Effect-directed analysis tries to interconnect instrumental analytical techniques with a biological/biochemical entity, which identifies or isolates substances of biological relevance. Successful application has been demonstrated in many fields, either as proof-of-principle studies or even for complex samples. This review discusses the different approaches, advantages and limitations and finally shows some practical examples. The broad emergence of effect-directed analytical concepts might lead to a true paradigm shift in analytical chemistry, away from ever growing lists of chemical compounds. The connection of biological effects with the identification and quantification of molecular entities leads to relevant answers to many real life questions. PMID:23012539

A shell regeneration assay to identify biomineralization candidate genes in mytilid mussels.

PubMed

Hüning, Anne K; Lange, Skadi M; Ramesh, Kirti; Jacob, Dorrit E; Jackson, Daniel J; Panknin, Ulrike; Gutowska, Magdalena A; Philipp, Eva E R; Rosenstiel, Philip; Lucassen, Magnus; Melzner, Frank

2016-06-01

Biomineralization processes in bivalve molluscs are still poorly understood. Here we provide an analysis of specifically expressed sequences from a mantle transcriptome of the blue mussel, Mytilus edulis. We then developed a novel, integrative shell injury assay to test, whether biomineralization candidate genes highly expressed in marginal and pallial mantle could be induced in central mantle tissue underlying the damaged shell areas. This experimental approach makes it possible to identify gene products that control the chemical micro-environment during calcification as well as organic matrix components. This is unlike existing methodological approaches that work retroactively to characterize calcification relevant molecules and are just able to examine organic matrix components that are present in completed shells. In our assay an orthogonal array of nine 1mm holes was drilled into the left valve, and mussels were suspended in net cages for 20, 29 and 36days to regenerate. Structural observations using stereo-microscopy, SEM and Raman spectroscopy revealed organic sheet synthesis (day 20) as the first step of shell-repair followed by the deposition of calcite crystals (days 20 and 29) and aragonite tablets (day 36). The regeneration period was characterized by time-dependent shifts in gene expression in left central mantle tissue underlying the injured shell, (i) increased expression of two tyrosinase isoforms (TYR3: 29-fold and TYR6: 5-fold) at day 20 with a decline thereafter, (ii) an increase in expression of a gene encoding a nacrein-like protein (max. 100-fold) on day 29. The expression of an acidic Asp-Ser-rich protein was enhanced during the entire regeneration process. This proof-of-principle study demonstrates that genes that are specifically expressed in pallial and marginal mantle tissue can be induced (4 out of 10 genes) in central mantle following experimental injury of the overlying shell. Our findings suggest that regeneration assays can be used systematically to better characterize gene products that are essential for distinct phases of the shell formation process, particularly those that are not incorporated into the organic shell matrix. Copyright © 2016 Elsevier B.V. All rights reserved.

A novel 96-well gel-based assay for determining antifungal activity against filamentous fungi.

PubMed

Troskie, Anscha Mari; Vlok, Nicolas Maré; Rautenbach, Marina

2012-12-01

In recent years the global rise in antibiotic resistance and environmental consciousness lead to a renewed fervour to find and develop novel antibiotics, including antifungals. However, the influence of the environment on antifungal activity is often disregarded and many in vitro assays may cause the activity of certain antifungals to be overestimated or underestimated. The general antifungal test assays that are economically accessible to the majority of scientists primarily rely on visual examination or on spectrophotometric analysis. The effect of certain morphogenic antifungals, which may lead to hyperbranching of filamentous fungi, unfortunately renders these methods unreliable. To minimise the difficulties experienced as a result of hyperbranching, we developed a straightforward, economical 96-well gel-based method, independent of spectrophotometric analysis, for highly repeatable determination of antifungal activity. For the calculation of inhibition parameters, this method relies on the visualisation of assay results by digitisation. The antifungal activity results from our novel micro-gel dilution assay are comparable to that of the micro-broth dilution assay used as standard reference test of The Clinical and Laboratory Standard Institute. Furthermore, our economical assay is multifunctional as it permits microscopic analysis of the preserved assay results, as well as rendering highly reliable data. Copyright © 2012 Elsevier B.V. All rights reserved.

A single secreted luciferase-based gene reporter assay.

PubMed

Barriscale, Kathy A; O'Sullivan, Sharon A; McCarthy, Tommie V

2014-05-15

Promoter analysis typically employs a reporter gene fused to a test promoter combined with a second reporter fused to a control promoter that is used for normalization purposes. However, this approach is not valid when experimental conditions affect the control promoter. We have developed and validated a single secreted luciferase reporter (SSLR) assay for promoter analysis that avoids the use of a control reporter. The approach uses an early level of expression of a secreted luciferase linked to a test promoter as an internal normalization control for subsequent analysis of the same promoter. Comparison of the SSLR assay with the dual luciferase reporter (DLR) assay using HMGCR (3-hydroxy-3-methylglutaryl-coenzyme A reductase) and LDLR (low-density lipoprotein receptor) promoter constructs, which are down-regulated by 25-hydroxycholesterol, show that both assays yield similar results. Comparison of the response of the HMGCR promoter in SSLR transient assays compared very favorably with the response of the same promoter in the stable cell line. Overall, the SSLR assay proved to be a valid alternative to the DLR assay for certain applications and had significant advantages in that measurement of only one luciferase is required and monitoring can be continuous because cell lysis is not necessary. Copyright © 2014 Elsevier Inc. All rights reserved.

Quantitative phase imaging of human red blood cells using phase-shifting white light interference microscopy with colour fringe analysis

NASA Astrophysics Data System (ADS)

Singh Mehta, Dalip; Srivastava, Vishal

2012-11-01

We report quantitative phase imaging of human red blood cells (RBCs) using phase-shifting interference microscopy. Five phase-shifted white light interferograms are recorded using colour charge coupled device camera. White light interferograms were decomposed into red, green, and blue colour components. The phase-shifted interferograms of each colour were then processed by phase-shifting analysis and phase maps for red, green, and blue colours were reconstructed. Wavelength dependent refractive index profiles of RBCs were computed from the single set of white light interferogram. The present technique has great potential for non-invasive determination of refractive index variation and morphological features of cells and tissues.

Heritability of Nociception IV: Neuropathic pain assays are genetically distinct across methods of peripheral nerve injury

PubMed Central

Young, Erin E.; Costigan, Michael; Herbert, Teri A.; Lariviere, William R.

2013-01-01

Prior genetic correlation analysis of 22 heritable behavioral measures of nociception and hypersensitivity in the mouse identified five genetically distinct pain types. In the present study, we reanalyzed that dataset and included the results of an additional nine assays of nociception and hypersensitivity to: 1) replicate the previously identified five pain types; 2) test whether any of the newly added pain assays represent novel genetically distinct pain types; 3) test the level of genetic relatedness among nine commonly employed neuropathic pain assays. Multivariate analysis of pairwise correlations between assays shows that the newly added zymosan-induced heat hypersensitivity assay does not conform to the two previously identified groups of heat hypersensitivity assays and cyclophosphamide-induced cystitis, the first organ-specific visceral pain model examined, is genetically distinct from other inflammatory assays. The four included mechanical hypersensitivity assays are genetically distinct, and do not comprise a single pain type as previously reported. Among the nine neuropathic pain assays including autotomy, chemotherapy, nerve ligation and spared nerve injury assays, at least four genetically distinct types of neuropathic sensory abnormalities were identified, corresponding to differences in nerve injury method. In addition, two itch assays and Comt genotype were compared to the expanded set of nociception and hypersensitivity assays. Comt genotype was strongly related only to spontaneous inflammatory nociception assays. These results indicate the priority for continued investigation of genetic mechanisms in several assays newly identified to represent genetically distinct pain types. PMID:24071598

Metabolic Model-Based Integration of Microbiome Taxonomic and Metabolomic Profiles Elucidates Mechanistic Links between Ecological and Metabolic Variation.

PubMed

Noecker, Cecilia; Eng, Alexander; Srinivasan, Sujatha; Theriot, Casey M; Young, Vincent B; Jansson, Janet K; Fredricks, David N; Borenstein, Elhanan

2016-01-01

Multiple molecular assays now enable high-throughput profiling of the ecology, metabolic capacity, and activity of the human microbiome. However, to date, analyses of such multi-omic data typically focus on statistical associations, often ignoring extensive prior knowledge of the mechanisms linking these various facets of the microbiome. Here, we introduce a comprehensive framework to systematically link variation in metabolomic data with community composition by utilizing taxonomic, genomic, and metabolic information. Specifically, we integrate available and inferred genomic data, metabolic network modeling, and a method for predicting community-wide metabolite turnover to estimate the biosynthetic and degradation potential of a given community. Our framework then compares variation in predicted metabolic potential with variation in measured metabolites' abundances to evaluate whether community composition can explain observed shifts in the community metabolome, and to identify key taxa and genes contributing to the shifts. Focusing on two independent vaginal microbiome data sets, each pairing 16S community profiling with large-scale metabolomics, we demonstrate that our framework successfully recapitulates observed variation in 37% of metabolites. Well-predicted metabolite variation tends to result from disease-associated metabolism. We further identify several disease-enriched species that contribute significantly to these predictions. Interestingly, our analysis also detects metabolites for which the predicted variation negatively correlates with the measured variation, suggesting environmental control points of community metabolism. Applying this framework to gut microbiome data sets reveals similar trends, including prediction of bile acid metabolite shifts. This framework is an important first step toward a system-level multi-omic integration and an improved mechanistic understanding of the microbiome activity and dynamics in health and disease. Studies characterizing both the taxonomic composition and metabolic profile of various microbial communities are becoming increasingly common, yet new computational methods are needed to integrate and interpret these data in terms of known biological mechanisms. Here, we introduce an analytical framework to link species composition and metabolite measurements, using a simple model to predict the effects of community ecology on metabolite concentrations and evaluating whether these predictions agree with measured metabolomic profiles. We find that a surprisingly large proportion of metabolite variation in the vaginal microbiome can be predicted based on species composition (including dramatic shifts associated with disease), identify putative mechanisms underlying these predictions, and evaluate the roles of individual bacterial species and genes. Analysis of gut microbiome data using this framework recovers similar community metabolic trends. This framework lays the foundation for model-based multi-omic integrative studies, ultimately improving our understanding of microbial community metabolism.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noecker, Cecilia; Eng, Alexander; Srinivasan, Sujatha

ABSTRACT Multiple molecular assays now enable high-throughput profiling of the ecology, metabolic capacity, and activity of the human microbiome. However, to date, analyses of such multi-omic data typically focus on statistical associations, often ignoring extensive prior knowledge of the mechanisms linking these various facets of the microbiome. Here, we introduce a comprehensive framework to systematically link variation in metabolomic data with community composition by utilizing taxonomic, genomic, and metabolic information. Specifically, we integrate available and inferred genomic data, metabolic network modeling, and a method for predicting community-wide metabolite turnover to estimate the biosynthetic and degradation potential of a given community.more » Our framework then compares variation in predicted metabolic potential with variation in measured metabolites’ abundances to evaluate whether community composition can explain observed shifts in the community metabolome, and to identify key taxa and genes contributing to the shifts. Focusing on two independent vaginal microbiome data sets, each pairing 16S community profiling with large-scale metabolomics, we demonstrate that our framework successfully recapitulates observed variation in 37% of metabolites. Well-predicted metabolite variation tends to result from disease-associated metabolism. We further identify several disease-enriched species that contribute significantly to these predictions. Interestingly, our analysis also detects metabolites for which the predicted variation negatively correlates with the measured variation, suggesting environmental control points of community metabolism. Applying this framework to gut microbiome data sets reveals similar trends, including prediction of bile acid metabolite shifts. This framework is an important first step toward a system-level multi-omic integration and an improved mechanistic understanding of the microbiome activity and dynamics in health and disease. IMPORTANCEStudies characterizing both the taxonomic composition and metabolic profile of various microbial communities are becoming increasingly common, yet new computational methods are needed to integrate and interpret these data in terms of known biological mechanisms. Here, we introduce an analytical framework to link species composition and metabolite measurements, using a simple model to predict the effects of community ecology on metabolite concentrations and evaluating whether these predictions agree with measured metabolomic profiles. We find that a surprisingly large proportion of metabolite variation in the vaginal microbiome can be predicted based on species composition (including dramatic shifts associated with disease), identify putative mechanisms underlying these predictions, and evaluate the roles of individual bacterial species and genes. Analysis of gut microbiome data using this framework recovers similar community metabolic trends. This framework lays the foundation for model-based multi-omic integrative studies, ultimately improving our understanding of microbial community metabolism.« less

Metabolic Model-Based Integration of Microbiome Taxonomic and Metabolomic Profiles Elucidates Mechanistic Links between Ecological and Metabolic Variation

PubMed Central

Noecker, Cecilia; Eng, Alexander; Srinivasan, Sujatha; Theriot, Casey M.; Young, Vincent B.; Jansson, Janet K.; Fredricks, David N.

2016-01-01

ABSTRACT Multiple molecular assays now enable high-throughput profiling of the ecology, metabolic capacity, and activity of the human microbiome. However, to date, analyses of such multi-omic data typically focus on statistical associations, often ignoring extensive prior knowledge of the mechanisms linking these various facets of the microbiome. Here, we introduce a comprehensive framework to systematically link variation in metabolomic data with community composition by utilizing taxonomic, genomic, and metabolic information. Specifically, we integrate available and inferred genomic data, metabolic network modeling, and a method for predicting community-wide metabolite turnover to estimate the biosynthetic and degradation potential of a given community. Our framework then compares variation in predicted metabolic potential with variation in measured metabolites’ abundances to evaluate whether community composition can explain observed shifts in the community metabolome, and to identify key taxa and genes contributing to the shifts. Focusing on two independent vaginal microbiome data sets, each pairing 16S community profiling with large-scale metabolomics, we demonstrate that our framework successfully recapitulates observed variation in 37% of metabolites. Well-predicted metabolite variation tends to result from disease-associated metabolism. We further identify several disease-enriched species that contribute significantly to these predictions. Interestingly, our analysis also detects metabolites for which the predicted variation negatively correlates with the measured variation, suggesting environmental control points of community metabolism. Applying this framework to gut microbiome data sets reveals similar trends, including prediction of bile acid metabolite shifts. This framework is an important first step toward a system-level multi-omic integration and an improved mechanistic understanding of the microbiome activity and dynamics in health and disease. IMPORTANCE Studies characterizing both the taxonomic composition and metabolic profile of various microbial communities are becoming increasingly common, yet new computational methods are needed to integrate and interpret these data in terms of known biological mechanisms. Here, we introduce an analytical framework to link species composition and metabolite measurements, using a simple model to predict the effects of community ecology on metabolite concentrations and evaluating whether these predictions agree with measured metabolomic profiles. We find that a surprisingly large proportion of metabolite variation in the vaginal microbiome can be predicted based on species composition (including dramatic shifts associated with disease), identify putative mechanisms underlying these predictions, and evaluate the roles of individual bacterial species and genes. Analysis of gut microbiome data using this framework recovers similar community metabolic trends. This framework lays the foundation for model-based multi-omic integrative studies, ultimately improving our understanding of microbial community metabolism. PMID:27239563

Diagnostic value of immunoglobulin κ light chain gene rearrangement analysis in B-cell lymphomas.

PubMed

Kokovic, Ira; Jezersek Novakovic, Barbara; Novakovic, Srdjan

2015-03-01

Analysis of the immunoglobulin κ light chain (IGK) gene is an alternative method for B-cell clonality assessment in the diagnosis of mature B-cell proliferations in which the detection of clonal immunoglobulin heavy chain (IGH) gene rearrangements fails. The aim of the present study was to evaluate the added value of standardized BIOMED-2 assay for the detection of clonal IGK gene rearrangements in the diagnostic setting of suspected B-cell lymphomas. With this purpose, 92 specimens from 80 patients with the final diagnosis of mature B-cell lymphoma (37 specimens), mature T-cell lymphoma (26 specimens) and reactive lymphoid proliferation (29 specimens) were analyzed for B-cell clonality. B-cell clonality analysis was performed using the BIOMED-2 IGH and IGK gene clonality assays. The determined sensitivity of the IGK assay was 67.6%, while the determined sensitivity of the IGH assay was 75.7%. The sensitivity of combined IGH+IGK assay was 81.1%. The determined specificity of the IGK assay was 96.2% in the group of T-cell lymphomas and 96.6% in the group of reactive lesions. The determined specificity of the IGH assay was 84.6% in the group of lymphomas and 86.2% in the group of reactive lesions. The comparison of GeneScan (GS) and heteroduplex pretreatment-polyacrylamide gel electrophoresis (HD-PAGE) methods for the analysis of IGK gene rearrangements showed a higher efficacy of GS analysis in a series of 27 B-cell lymphomas analyzed by both methods. In the present study, we demonstrated that by applying the combined IGH+IGK clonality assay the overall detection rate of B-cell clonality was increased by 5.4%. Thus, we confirmed the added value of the standardized BIOMED-2 IGK assay for assessment of B-cell clonality in suspected B-cell lymphomas with inconclusive clinical and cyto/histological diagnosis.

Racial Differences in the Association Between Night Shift Work and Melatonin Levels Among Women

PubMed Central

Bhatti, Parveen; Mirick, Dana K.; Davis, Scott

2013-01-01

Reduced suppression of melatonin in response to working the night shift among people of Asian ancestry has been suggested as a possible explanation for the null results observed in a recent analysis of shift work and breast cancer risk in a Chinese cohort. The authors analyzed the impact of Asian versus white race on previously reported differences in urinary 6-sulfatoxymelatonin levels in a 2003–2008 study in Seattle, Washington, of female health-care workers that exclusively worked night or day shifts. A total of 225 white and 51 Asian participants were included in the analysis. Although 6-sulfatoxymelatonin levels were affected by night shift work in both racial groups, Asian night shift workers consistently showed 6-sulfatoxymelatonin levels that were closer to levels in day shift workers than did white night shift workers. Furthermore, differences in 6-sulfatoxymelatonin levels between white and Asian night shift workers relative to day shift workers were statistically significant in every instance (P < 0.05). These results suggest that Asians may be better able to maintain a “normal” circadian pattern of melatonin production compared with whites and suggest a biological mechanism by which Asian night shift workers may be at a reduced risk of cancer. PMID:23380044

Shift-invariant optical associative memories

NASA Astrophysics Data System (ADS)

Psaltis, Demetri; Hong, John

1987-01-01

Shift invariance in the context of associative memories is discussed. Two optical systems that exhibit shift invariance are described in detail with attention given to the analysis of storage capacities. It is shown that full shift invariance cannot be achieved with systems that employ only linear interconnections to store the associations.

Use of statistical analysis to validate ecogenotoxicology findings arising from various comet assay components.

PubMed

Hussain, Bilal; Sultana, Tayyaba; Sultana, Salma; Al-Ghanim, Khalid Abdullah; Masoud, Muhammad Shahreef; Mahboob, Shahid

2018-04-01

Cirrhinus mrigala, Labeo rohita, and Catla catla are economically important fish for human consumption in Pakistan, but industrial and sewage pollution has drastically reduced their population in the River Chenab. Statistics are an important tool to analyze and interpret comet assay results. The specific aims of the study were to determine the DNA damage in Cirrhinus mrigala, Labeo rohita, and Catla catla due to chemical pollution and to assess the validity of statistical analyses to determine the viability of the comet assay for a possible use with these freshwater fish species as a good indicator of pollution load and habitat degradation. Comet assay results indicated a significant (P < 0.05) degree of DNA fragmentation in Cirrhinus mrigala followed by Labeo rohita and Catla catla in respect to comet head diameter, comet tail length, and % DNA damage. Regression analysis and correlation matrices conducted among the parameters of the comet assay affirmed the precision and the legitimacy of the results. The present study, therefore, strongly recommends that genotoxicological studies conduct appropriate analysis of the various components of comet assays to offer better interpretation of the assay data.

Development of parallel line analysis criteria for recombinant adenovirus potency assay and definition of a unit of potency.

PubMed

Ogawa, Yasushi; Fawaz, Farah; Reyes, Candice; Lai, Julie; Pungor, Erno

2007-01-01

Parameter settings of a parallel line analysis procedure were defined by applying statistical analysis procedures to the absorbance data from a cell-based potency bioassay for a recombinant adenovirus, Adenovirus 5 Fibroblast Growth Factor-4 (Ad5FGF-4). The parallel line analysis was performed with a commercially available software, PLA 1.2. The software performs Dixon outlier test on replicates of the absorbance data, performs linear regression analysis to define linear region of the absorbance data, and tests parallelism between the linear regions of standard and sample. Width of Fiducial limit, expressed as a percent of the measured potency, was developed as a criterion for rejection of the assay data and to significantly improve the reliability of the assay results. With the linear range-finding criteria of the software set to a minimum of 5 consecutive dilutions and best statistical outcome, and in combination with the Fiducial limit width acceptance criterion of <135%, 13% of the assay results were rejected. With these criteria applied, the assay was found to be linear over the range of 0.25 to 4 relative potency units, defined as the potency of the sample normalized to the potency of Ad5FGF-4 standard containing 6 x 10(6) adenovirus particles/mL. The overall precision of the assay was estimated to be 52%. Without the application of Fiducial limit width criterion, the assay results were not linear over the range, and an overall precision of 76% was calculated from the data. An absolute unit of potency for the assay was defined by using the parallel line analysis procedure as the amount of Ad5FGF-4 that results in an absorbance value that is 121% of the average absorbance readings of the wells containing cells not infected with the adenovirus.

Reduced osteoblast activity in the mice lacking TR4 nuclear receptor leads to osteoporosis.

PubMed

Lin, Shin-Jen; Ho, Hsin-Chiu; Lee, Yi-Fen; Liu, Ning-Chun; Liu, Su; Li, Gonghui; Shyr, Chih-Rong; Chang, Chawnshang

2012-06-07

Early studies suggested that TR4 nuclear receptor might play important roles in the skeletal development, yet its detailed mechanism remains unclear. We generated TR4 knockout mice and compared skeletal development with their wild type littermates. Primary bone marrow cells were cultured and we assayed bone differentiation by alkaline phosphatase and alizarin red staining. Primary calvaria were cultured and osteoblastic marker genes were detected by quantitative PCR. Luciferase reporter assays, chromatin immunoprecipitation (ChIP) assays, and electrophoretic mobility shift assays (EMSA) were performed to demonstrate TR4 can directly regulate bone differentiation marker osteocalcin. We first found mice lacking TR4 might develop osteoporosis. We then found that osteoblast progenitor cells isolated from bone marrow of TR4 knockout mice displayed reduced osteoblast differentiation capacity and calcification. Osteoblast primary cultures from TR4 knockout mice calvaria also showed higher proliferation rates indicating lower osteoblast differentiation ability in mice after loss of TR4. Mechanism dissection found the expression of osteoblast markers genes, such as ALP, type I collagen alpha 1, osteocalcin, PTH, and PTHR was dramatically reduced in osteoblasts from TR4 knockout mice as compared to those from TR4 wild type mice. In vitro cell line studies with luciferase reporter assay, ChIP assay, and EMSA further demonstrated TR4 could bind directly to the promoter region of osteocalcin gene and induce its gene expression at the transcriptional level in a dose dependent manner. Together, these results demonstrate TR4 may function as a novel transcriptional factor to play pathophysiological roles in maintaining normal osteoblast activity during the bone development and remodeling, and disruption of TR4 function may result in multiple skeletal abnormalities.

Implementation and Operational Research: Programmatic Feasibility of Dried Blood Spots for the Virological Follow-up of Patients on Antiretroviral Treatment in Nord Kivu, Democratic Republic of the Congo

PubMed Central

Serrano, Laetitia; Muwonga, Jeremie; Kabuayi, Jean Pierre; Kambale, Alain; Mutaka, Fidèle; Fujiwara, Paula I.; Decosas, Josef; Peeters, Martine; Delaporte, Eric

2016-01-01

Background: As part of its policy to shift monitoring of antiretroviral therapy (ART) to primary health care (PHC) workers, the Ministry of Health of the Democratic Republic of Congo (DRC) tested the feasibility of using dried blood spots (DBS) for viral load (VL) quantification and genotypic drug resistance testing in off-site high-throughput laboratories. Methods: DBS samples from adults on ART were collected in 13 decentralized PHC facilities in the Nord-Kivu province and shipped during program quarterly supervision to a reference laboratory 2000 km away, where VL was quantified with a commercial assay (m2000rt, Abbott). A second DBS was sent to a World Health Organization (WHO)-accredited laboratory for repeat VL quantification on a subset of samples with a generic assay (Biocentric) and genotypic drug resistance testing when VL >1000 copies per milliliter. Findings: Constraints arose because of an interruption in national laboratory funding rather than to technical or logistic problems. All samples were assessed by both VL assays to allow ART adjustment. Median DBS turnaround time was 37 days (interquartile range: 9–59). Assays performed unequally with DBS, impacting clinical decisions, quality assurance, and overall cost-effectiveness. Based on m2000rt or generic assay, 31.3% of patients were on virological failure (VF) and 14.8% presented resistance mutations versus 50.3% and 15.4%, respectively. Conclusion: This study confirms that current technologies involving DBS make virological monitoring of ART possible at PHC level, including in challenging environments, provided organizational issues are addressed. Adequate core funding of HIV laboratories and adapted choice of VL assays require urgent attention to control resistance to ART as coverage expands. PMID:26413848

A G-quadruplex-selective luminescent iridium(III) complex and its application by long lifetime.

PubMed

Lin, Sheng; Lu, Lihua; Liu, Jin-Biao; Liu, Chenfu; Kang, Tian-Shu; Yang, Chao; Leung, Chung-Hang; Ma, Dik-Lung

2017-05-01

The G-quadruplex motif has been widely used for the construction of analytical detection platforms due to its rich structural polymorphism and flexibility. Luminescent assays are often limited due to the interference from endogenous fluorophores in biological samples. To address this challenge, a novel long lifetime iridium(III) complex 1 was synthesized and used to construct a G-quadruplex-based assay for detecting prostate specific antigen (PSA) in aqueous solution. PSA is a common biomarker in serum and used as a model for demonstration in this work. The PSA assay has achieved a detection limit of 40.8pg·mL -1 , and shows high selectivity towards PSA over other proteins. Additionally, the assay could function in diluted human serum by using time-resolved luminescent spectroscopy, with good linearity from 1 to 10ng·mL -1 of PSA, which is adequate to detect the PSA levels for physiological (<4ng·mL -1 ) and clinical (4-10ng·mL -1 ) applications. The assay was successfully constructed. As revealed from time-resolved method, the long lifetime property of iridium(III) complex 1 plays an important role in distinguishing phosphorescence signals from short-life auto-fluorescence of human serum. Luminescent transition metal complexes offer several advantages over other widely used organic fluorophores, such as long phosphorescence lifetime, large Stokes shift and modular syntheses. In addition, the assay could work effectively in diluted human serum using time-resolved luminescent spectroscopy, it therefore could be potentially developed to monitor PSA in biological samples. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.

Andrographolide Sensitizes Ras-Transformed Cells to Radiation in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hung, Shih-Kai; Department of Radiation Oncology, Buddhist Dalin Tzu Chi General Hospital, Chiayi, Taiwan; Tzu Chi University School of Medicine, Hualian, Taiwan

2010-07-15

Purpose: Increasing the sensitivity of tumor cells to radiation is a major goal of radiotherapy. The present study investigated the radiosensitizing effects of andrographolide and examined the molecular mechanisms of andrographolide-mediated radiosensitization. Methods and Materials: An H-ras-transformed rat kidney epithelial (RK3E) cell line was used to measure the radiosensitizing effects of andrographolide in clonogenic assays, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H tetrazolium bromide assays, and a xenograft tumor growth model. The mechanism of andrographolide-sensitized cell death was analyzed using annexin V staining, caspase 3 activity assays, and terminal transferase uridyl nick end labeling assays. The roles of nuclear factor kappa B (NF-{kappa}B) and Akt inmore » andrographolide-mediated sensitization were examined using reporter assays, electrophoretic mobility shift assays, and Western blotting. Results: Concurrent andrographolide treatment (10 {mu}M, 3 h) sensitized Ras-transformed cells to radiation in vitro (sensitizer enhancement ratio, 1.73). Andrographolide plus radiation (one dose of 300 mg/kg peritumor andrographolide and one dose of 6 Gy radiation) resulted in significant tumor growth delay (27 {+-} 2.5 days) compared with radiation alone (22 {+-} 1.5 days; p <.05). Radiation induced apoptotic markers (e.g., caspase-3, membrane reversion, DNA fragmentation), and andrographolide treatment did not promote radiation-induced apoptosis. However, the protein level of activated Akt was significantly reduced by andrographolide. NF-{kappa}B activity was elevated in irradiated Ras-transformed cells, and andrographolide treatment significantly reduced radiation-induced NF-{kappa}B activity. Conclusion: Andrographolide sensitized Ras-transformed cells to radiation both in vitro and in vivo. Andrographolide-mediated radiosensitization was associated with downregulation of Akt and NF-{kappa}B activity. These observations indicate that andrographolide is a novel radiosensitizing agent with potential application in cancer radiotherapy.« less

ANKRD1 Acts as a Transcriptional Repressor of MMP13 via the AP-1 Site

PubMed Central

Almodóvar-García, Karinna; Kwon, Minjae; Samaras, Susan E.

2014-01-01

The transcriptional cofactor ANKRD1 is sharply induced during wound repair, and its overexpression enhances healing. We recently found that global deletion of murine Ankrd1 impairs wound contraction and enhances necrosis of ischemic wounds. A quantitative PCR array of Ankrd1−/− (KO) fibroblasts indicated that ANKRD1 regulates MMP genes. Yeast two-hybrid and coimmunoprecipitation analyses associated ANKRD1 with nucleolin, which represses AP-1 activation of MMP13. Ankrd1 deletion enhanced both basal and phorbol 12-myristate 13-acetate (PMA)-induced MMP13 promoter activity; conversely, Ankrd1 overexpression in control cells decreased PMA-induced MMP13 promoter activity. Ankrd1 reconstitution in KO fibroblasts decreased MMP13 mRNA, while Ankrd1 knockdown increased these levels. MMP13 mRNA and protein were elevated in intact skin and wounds of KO versus Ankrd1fl/fl (FLOX) mice. Electrophoretic mobility shift assay gel shift patterns suggested that additional transcription factors bind to the MMP13 AP-1 site in the absence of Ankrd1, and this concept was reinforced by chromatin immunoprecipitation analysis as greater binding of c-Jun to the AP-1 site in extracts from FLOX versus KO fibroblasts. We propose that ANKRD1, in association with factors such as nucleolin, represses MMP13 transcription. Ankrd1 deletion additionally relieved MMP10 transcriptional repression. Nuclear ANKRD1 appears to modulate extracellular matrix remodeling by MMPs. PMID:24515436

Green Synthesis, Spectrofluorometric Characterization and Antibacterial Activity of Heterocyclic Compound from Chalcone on the Basis of in Vitro and Quantum Chemistry Calculation.

PubMed

Khan, Salman A

2017-05-01

2-amino-4-(4-bromophenyl)-8-methoxy-5,6-dihydrobenzo[h]quinoline-3-carbonitrile (ABDC) was synthesized by the reaction of (2E)-2-(4 bromobenzylidene) - 6 -methoxy-3,4-dihydronaphthalen-1(2H)-one (Chalcone) with malononitrile and ammonium acetate under microwave irradiation. Chalcone was synthesised by the reaction 4-bromobenzaldehyd, 6-methoxy-1,2,3,4-tetrahydro-naphthalin-1-one under the same condition. Structure of ABDC was conformed by 1 H and 13 C NMR, FT-IR, EI-MS spectral studies and elemental analysis. The electronic absorption and fluorescence spectra of ABDC have been studied in solvents of different polarities, and the data were used to study the solvatochromic properties such as excitation coefficient, stokes shift, oscillator strength, transition dipole moment and fluorescence quantum yield. The absorption maximum and fluorescence emission maximum was observed red shift when increase solvent polarity n-Hexane to DMSO. ABDC undergoes solubilization in different micelles and may be used as a probe and quencher to determine the critical micelle concentration (CMC) of CTAB and SDS. The anti-bacterial activity of chalcone and its cyclized product ABDC was tested in vitro by the disk diffusion assay against two Gram-positive and two Gram-negative bacteria was determined with the reference of standard drug Tetracycline. Results showed that the ABDC is better anti-bacterial agent as compared to chalcone. The anti-bacterial activity was further supported by the quantum chemistry calculation.

Structural Characterization of a Novel Polysaccharide from Lepidium meyenii (Maca) and Analysis of Its Regulatory Function in Macrophage Polarization in Vitro.

PubMed

Zhang, Mengmeng; Wu, Wenjia; Ren, Yao; Li, Xiaofeng; Tang, Yuqian; Min, Tian; Lai, Furao; Wu, Hui

2017-02-15

In our previous study, three novel polysaccharides, named MC-1, MC-2, and MC-3, were separated from the roots of maca (Lepidium meyenii), which is a food source from the Andes region. The structural information and immunomodulatory activity of MC-1 were then investigated. The structure and activity of MC-2 are still unknown. In this study, structural characterization revealed that MC-2 has an average molecular weight of 9.83 kDa and is composed of arabinose (20.9%), mannose (4.5%), glucose (71.9%), and galactose (2.7%). The main linkage types of MC-2 were proven to be (1→5)-α-l-Ara, (1→3)-α-l-Man, (1→)-α-d-Glc, (1→4)-α-d-Glc, (1→6)-α-d-Glc, and (1→6)-β-d-Gal by methylation and NMR analyses. Congo red assay showed that MC-2 possesses a triple-helix conformation. Immunostimulating assays indicated that MC-2 could induce M1 polarization of original macrophages and convert M2 macrophages into M1 phenotype. Although MC-2 could not shift M1 macrophages into M2, it could still inhibit inflammatory reactions induced by lipopolysaccharide. Furthermore, Toll-like receptor 2, tTll-like receptor 4, complement receptor 3, and mannose receptor were confirmed as the membrane receptors for MC-2 on macrophages. These results indicate that MC-2 could potentially be used toward hypoimmunity and tumor therapies.

Induction of dystrophin Dp71 expression during neuronal differentiation: opposite roles of Sp1 and AP2alpha in Dp71 promoter activity.

PubMed

Morales-Lázaro, Sara Luz; González-Ramírez, Ricardo; Gómez, Pablo; Tapia-Ramírez, Victor; de León, Mario Bermúdez; Cisneros, Bulmaro

2010-01-01

In this study, we delineated the molecular mechanisms that modulate Dp71 expression during neuronal differentiation, using the N1E-115 cell line. We demonstrated that Dp71 expression is up-regulated in response to cAMP-mediated neuronal differentiation of these cells, and that this induction is controlled at promoter level. Functional deletion analysis of the Dp71 promoter revealed that a 5'-flanking 159-bp DNA fragment that contains Sp1 and AP2 binding sites is necessary and sufficient for basal expression of this TATA-less promoter, as well as for its induction during neuronal differentiation. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that Sp1 and AP2alpha bind to their respective DNA elements within the Dp71 basal promoter. Overall, mutagenesis assays on the Sp1 and AP2 binding sites, over-expression of Sp1 and AP2alpha, as well as knock-down experiments on Sp1 and AP2alpha gene expression established that Dp71 basal expression is controlled by the combined action of Sp1 and AP2alpha, which act as activator and repressor, respectively. Furthermore, we demonstrated that induction of Dp71 expression in differentiated cells is the result of the maintenance of positive regulation exerted by Sp1, as well as of the loss of AP2alpha binding, which ultimately releases the promoter from repression.

Selective inhibition of CYP2C8 by fisetin and its methylated metabolite, geraldol, in human liver microsomes.

PubMed

Shrestha, Riya; Kim, Ju-Hyun; Nam, Wongshik; Lee, Hye Suk; Lee, Jae-Mok; Lee, Sangkyu

2018-04-01

Fisetin is a flavonol compound commonly found in edible vegetables and fruits. It has anti-tumor, antioxidant, and anti-inflammatory effects. Geraldol, the O-methyl metabolite of fisetin in mice, is reported to suppress endothelial cell migration and proliferation. Although the in vivo and in vitro effects of fisetin and its metabolites are frequently reported, studies on herb-drug interactions have not yet been performed. This study was designed to investigate the inhibitory effect of fisetin and geraldol on eight isoforms of human cytochrome P450 (CYP) by using cocktail assay and LC-MS/MS analysis. The selective inhibition of CYP2C8-catalyzed paclitaxel hydroxylation by fisetin and geraldol were confirmed in pooled human liver microsomes (HLMs). In addition, an IC 50 shift assay under different pre-incubation conditions confirmed that fisetin and geraldol shows a reversible concentration-dependent, but not mechanism-based, inhibition of CYP2C8. Moreover, Michaelis-Menten, Lineweaver-burk plots, Dixon and Eadie-Hofstee showed a non-competitive inhibition mode with an equilibrium dissociation constant of 4.1 μM for fisetin and 11.5 μM for geraldol, determined from secondary plot of the Lineweaver-Burk plot. In conclusion, our results indicate that fisetin showed selective reversible and non-competitive inhibition of CYP2C8 more than its main metabolite, geraldol, in HLMs. Copyright © 2018 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.

Simulation of Rate-Related (Dead-Time) Losses In Passive Neutron Multiplicity Counting Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evans, L.G.; Norman, P.I.; Leadbeater, T.W.

Passive Neutron Multiplicity Counting (PNMC) based on Multiplicity Shift Register (MSR) electronics (a form of time correlation analysis) is a widely used non-destructive assay technique for quantifying spontaneously fissile materials such as Pu. At high event rates, dead-time losses perturb the count rates with the Singles, Doubles and Triples being increasingly affected. Without correction these perturbations are a major source of inaccuracy in the measured count rates and assay values derived from them. This paper presents the simulation of dead-time losses and investigates the effect of applying different dead-time models on the observed MSR data. Monte Carlo methods have beenmore » used to simulate neutron pulse trains for a variety of source intensities and with ideal detection geometry, providing an event by event record of the time distribution of neutron captures within the detection system. The action of the MSR electronics was modelled in software to analyse these pulse trains. Stored pulse trains were perturbed in software to apply the effects of dead-time according to the chosen physical process; for example, the ideal paralysable (extending) and non-paralysable models with an arbitrary dead-time parameter. Results of the simulations demonstrate the change in the observed MSR data when the system dead-time parameter is varied. In addition, the paralysable and non-paralysable models of deadtime are compared. These results form part of a larger study to evaluate existing dead-time corrections and to extend their application to correlated sources. (authors)« less

DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression.

PubMed

Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi

2017-01-01

The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5'-UTR of phenylalanine ammonia-lyase 2 ( PAL2 ). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5'-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica .

DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression

PubMed Central

Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi

2017-01-01

The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5′-UTR of phenylalanine ammonia-lyase 2 (PAL2). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5′-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica. PMID:28740500

Molecular characterization of the sweet potato peroxidase SWPA4 promoter which responds to abiotic stresses and pathogen infection.

PubMed

Ryu, Sun-Hwa; Kim, Yun-Hee; Kim, Cha Young; Park, Soo-Young; Kwon, Suk-Yoon; Lee, Haeng-Soon; Kwak, Sang-Soo

2009-04-01

Previously, the swpa4 peroxidase gene has been shown to be inducible by a variety of abiotic stresses and pathogenic infections in sweet potato (Ipomoea batatas). To elucidate its regulatory mechanism at the transcriptional level under various stress conditions, we isolated and characterized the promoter region (2374 bp) of swpa4 (referred to as SWPA4). We performed a transient expression assay in tobacco protoplasts with deletions from the 5'-end of SWPA4 promoter fused to the beta-glucuronidase (GUS) reporter gene. The -1408 and -374 bp deletions relative to the transcription start site (+1) showed 8 and 4.5 times higher GUS expression than the cauliflower mosaic virus 35S promoter, respectively. In addition, transgenic tobacco plants expressing GUS under the control of -2374, -1408 or -374 bp region of SWPA4 promoter were generated and studied in various tissues under abiotic stresses and pathogen infection. Gel mobility shift assays revealed that nuclear proteins from sweet potato cultured cells specifically interacted with 60-bp fragment (-178/-118) in -374 bp promoter region. In silico analysis indicated that four kinds of cis-acting regulatory sequences, reactive oxygen species-related element activator protein 1 (AP1), CCAAT/enhancer-binding protein alpha element, ethylene-responsive element (ERE) and heat-shock element, are present in the -60 bp region (-178/-118), suggesting that the -60 bp region might be associated with stress inducibility of the SWPA4 promoter.

Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

PubMed Central

Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

2007-01-01

Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

PubMed

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Ebselen: Mechanisms of Glutamate Dehydrogenase and Glutaminase Enzyme Inhibition.

PubMed

Yu, Yan; Jin, Yanhong; Zhou, Jie; Ruan, Haoqiang; Zhao, Han; Lu, Shiying; Zhang, Yue; Li, Di; Ji, Xiaoyun; Ruan, Benfang Helen

2017-12-15

Ebselen modulates target proteins through redox reactions with selenocysteine/cysteine residues, or through binding to the zinc finger domains. However, a recent contradiction in ebselen inhibition of kidney type glutaminase (KGA) stimulated our interest in investigating its inhibition mechanism with glutamate dehydrogenase (GDH), KGA, thioredoxin reductase (TrxR), and glutathione S-transferase. Fluorescein- or biotin-labeled ebselen derivatives were synthesized for mechanistic analyses. Biomolecular interaction analyses showed that only GDH, KGA, and TrxR proteins can bind to the ebselen derivative, and the binding to GDH and KGA could be competed off by glutamine or glutamate. From the gel shift assays, the fluorescein-labeled ebselen derivative could co-migrate with hexameric GDH and monomeric/dimeric TrxR in a dose-dependent manner; it also co-migrated with KGA but disrupted the tetrameric form of the KGA enzyme at a high compound concentration. Further proteomic analysis demonstrated that the ebselen derivative could cross-link with proteins through a specific cysteine at the active site of GDH and TrxR proteins, but for KGA protein, the binding site is at the N-terminal appendix domain outside of the catalytic domain, which might explain why ebselen is not a potent KGA enzyme inhibitor in functional assays. In conclusion, ebselen could inhibit enzyme activity by binding to the catalytic domain or disruption of the protein complex. In addition, ebselen is a relatively potent selective GDH inhibitor that might provide potential therapeutic opportunities for hyperinsulinism-hyperammonemia syndrome patients who have the mutational loss of GTP inhibition.

HLA-E: Presentation of a Broader Peptide Repertoire Impacts the Cellular Immune Response-Implications on HSCT Outcome.

PubMed

Kraemer, Thomas; Celik, Alexander A; Huyton, Trevor; Kunze-Schumacher, Heike; Blasczyk, Rainer; Bade-Döding, Christina

2015-01-01

The HLA-E locus encodes a nonclassical class Ib molecule that serves many immune functions from inhibiting NK cells to activating CTLs. Structural analysis of HLA-E/NKG2A complexes visualized fine-tuning of protective immune responses through AA interactions between HLA-E, the bound peptide, and NKG2A/CD94. A loss of cellular protection through abrogation of the HLA-E/NKG2A engagement is dependent on the HLA-E bound peptide. The role of HLA-E in posttransplant outcomes is not well understood but might be attributed to its peptide repertoire. To investigate the self-peptide repertoire of HLA-E (∗) 01:01 in the absence of protective HLA class I signal peptides, we utilized soluble HLA technology in class I negative LCL cells in order to characterize HLA-E (∗) 01:01-bound ligands by mass-spectrometry. To understand the immunological impact of these analyzed ligands on NK cell reactivity, we performed cellular assays. Synthesized peptides were loaded onto recombinant T2 cells expressing HLA-E (∗) 01:01 molecules and applied in cytotoxicity assays using the leukemia derived NK cell line (NKL) as effector. HLA-E in complex with the self-peptides demonstrated a shift towards cytotoxicity and a loss of cell protection. Our data highlights the fact that the HLA-E-peptidome is not as restricted as previously thought and support the suggestion of a posttransplant role for HLA-E.

RNAi High-Throughput Screening of Single- and Multi-Cell-Type Tumor Spheroids: A Comprehensive Analysis in Two and Three Dimensions.

PubMed

Fu, Jiaqi; Fernandez, Daniel; Ferrer, Marc; Titus, Steven A; Buehler, Eugen; Lal-Nag, Madhu A

2017-06-01

The widespread use of two-dimensional (2D) monolayer cultures for high-throughput screening (HTS) to identify targets in drug discovery has led to attrition in the number of drug targets being validated. Solid tumors are complex, aberrantly growing microenvironments that harness structural components from stroma, nutrients fed through vasculature, and immunosuppressive factors. Increasing evidence of stromally-derived signaling broadens the complexity of our understanding of the tumor microenvironment while stressing the importance of developing better models that reflect these interactions. Three-dimensional (3D) models may be more sensitive to certain gene-silencing events than 2D models because of their components of hypoxia, nutrient gradients, and increased dependence on cell-cell interactions and therefore are more representative of in vivo interactions. Colorectal cancer (CRC) and breast cancer (BC) models composed of epithelial cells only, deemed single-cell-type tumor spheroids (SCTS) and multi-cell-type tumor spheroids (MCTS), containing fibroblasts were developed for RNAi HTS in 384-well microplates with flat-bottom wells for 2D screening and round-bottom, ultra-low-attachment wells for 3D screening. We describe the development of a high-throughput assay platform that can assess physiologically relevant phenotypic differences between screening 2D versus 3D SCTS, 3D SCTS, and MCTS in the context of different cancer subtypes. This assay platform represents a paradigm shift in how we approach drug discovery that can reduce the attrition rate of drugs that enter the clinic.

A dimer of the lymphoid protein RAG1 recognizes the recombination signal sequence and the complex stably incorporates the high mobility group protein HMG2.

PubMed

Rodgers, K K; Villey, I J; Ptaszek, L; Corbett, E; Schatz, D G; Coleman, J E

1999-07-15

RAG1 and RAG2 are the two lymphoid-specific proteins required for the cleavage of DNA sequences known as the recombination signal sequences (RSSs) flanking V, D or J regions of the antigen-binding genes. Previous studies have shown that RAG1 alone is capable of binding to the RSS, whereas RAG2 only binds as a RAG1/RAG2 complex. We have expressed recombinant core RAG1 (amino acids 384-1008) in Escherichia coli and demonstrated catalytic activity when combined with RAG2. This protein was then used to determine its oligomeric forms and the dissociation constant of binding to the RSS. Electrophoretic mobility shift assays show that up to three oligomeric complexes of core RAG1 form with a single RSS. Core RAG1 was found to exist as a dimer both when free in solution and as the minimal species bound to the RSS. Competition assays show that RAG1 recognizes both the conserved nonamer and heptamer sequences of the RSS. Zinc analysis shows the core to contain two zinc ions. The purified RAG1 protein overexpressed in E.coli exhibited the expected cleavage activity when combined with RAG2 purified from transfected 293T cells. The high mobility group protein HMG2 is stably incorporated into the recombinant RAG1/RSS complex and can increase the affinity of RAG1 for the RSS in the absence of RAG2.

Purely aqueous PLGA nanoparticulate formulations of curcumin exhibit enhanced anticancer activity with dependence on the combination of the carrier.

PubMed

Nair, K Lekha; Thulasidasan, Arun Kumar T; Deepa, G; Anto, Ruby John; Kumar, G S Vinod

2012-04-04

Curcumin, a yellow pigment present in turmeric, possess potential anti-proliferative and anti-inflammatory activities but poor aqueous solubility limits its applications. In this study we report a novel comparative study of the formulation and characterization of curcumin nanoparticles (nanocurcumin) using two poly (lactide-co-glycolide) (PLGA) combinations, 50:50 and 75:25 having different lactide to glycolide ratios. Nanocurcumin 50:50 showed smaller size with higher encapsulation efficiency. Thermal evaluation suggested the presence of curcumin in molecular dispersion form which supported its sustained release up to a week where nanocurcumin 50:50 showed faster release. Cellular uptake studies in human epithelial cervical cancer cells (HeLa) exhibited enhanced intracellular fluorescence with nanocurcumin when compared to free curcumin, when both given in purely aqueous media. Antiproliferative studies using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay, Annexin V/propidium iodide staining, poly (ADP-ribose) polymerase (PARP) cleavage and downregulation of clonogenic potential of HeLa cells proved the better antitumor activity of nanocurcumin 50:50 administered in aqueous media. Superior efficacy of nanocurcumin 50:50 in comparison to free curcumin was further demonstrated by electrophoretic mobility shift assay and immunocytochemical analysis. In conclusion, the enhanced aqueous solubility and higher anticancer efficacy of nanocurcumin administered in aqueous media clearly demonstrates its potential against cancer chemotherapy, with dependence on the combination of PLGA. Copyright © 2012. Published by Elsevier B.V.

Necrosis and apoptosis pathways of cell death at photodynamic treatment in vitro as revealed by digital holographic microscopy

NASA Astrophysics Data System (ADS)

Semenova, I. V.; Belashov, A. V.; Belyaeva, T. N.; Kornilova, E. S.; Salova, A. V.; Zhikhoreva, A. A.; Vasyutinskii, O. S.

2018-02-01

Monitoring of variations in morphological characteristics of cultured HeLa cells after photodynamic treatment with Radachlorin photosensitizer is performed by means of digital holographic microscopy. The observed dose-dependent post-treatment variations of phase shift evidence threshold effect of photodynamic treatment and allow for distinguishing between necrotic or apoptotic pathways of cell death. Results obtained by holographic microscopy were confirmed by means of far-field optical microscopy and confocal fluorescence microscopy with commonly used test assays.

Role of Human DNA Polymerase and its Accessory Proteins in Breast Cancer.

DTIC Science & Technology

1999-09-01

by W estern blotting. Total mRNA was isolated from the Ac.in mRNA cells using RNA-STAT 60 (Tel- Test .t .... Inc) and subjected to Northern blotting...p53 expression on the activity of the POLDI promoter were tested using the 1.8 kb-luciferase POLD1 promoter construct in SAOS-2 cells which do not...activity. In preliminary studies using gel mobility shift assays we tested ds oligonucleotides corresponding to all five sites (P1-P5). The results

Evaluation of the Aptima HBV Quant assay vs. the COBAS TaqMan HBV test using the high pure system for the quantitation of HBV DNA in plasma and serum samples.

PubMed

Schalasta, Gunnar; Börner, Anna; Speicher, Andrea; Enders, Martin

2018-03-28

Proper management of patients with chronic hepatitis B virus (HBV) infection requires monitoring of plasma or serum HBV DNA levels using a highly sensitive nucleic acid amplification test. Because commercially available assays differ in performance, we compared herein the performance of the Hologic Aptima HBV Quant assay (Aptima) to that of the Roche Cobas TaqMan HBV test for use with the high pure system (HPS/CTM). Assay performance was assessed using HBV reference panels as well as plasma and serum samples from chronically HBV-infected patients. Method correlation, analytical sensitivity, precision/reproducibility, linearity, bias and influence of genotype were evaluated. Data analysis was performed using linear regression, Deming correlation analysis and Bland-Altman analysis. Agreement between the assays for the two reference panels was good, with a difference in assay values vs. target <0.5 log. Qualitative assay results for 159 clinical samples showed good concordance (88.1%; κ=0.75; 95% confidence interval: 0.651-0.845). For the 106 samples quantitated by both assays, viral load results were highly correlated (R=0.92) and differed on average by 0.09 log, with 95.3% of the samples being within the 95% limit of agreement of the assays. Linearity for viral loads 1-7 log was excellent for both assays (R2>0.98). The two assays had similar bias and precision across the different genotypes tested at low viral loads (25-1000 IU/mL). Aptima has a performance comparable with that of HPS/CTM, making it suitable for use for HBV infection monitoring. Aptima runs on a fully automated platform (the Panther system) and therefore offers a significantly improved workflow compared with HPS/CTM.

A high-throughput screening system for barley/powdery mildew interactions based on automated analysis of light micrographs.

PubMed

Ihlow, Alexander; Schweizer, Patrick; Seiffert, Udo

2008-01-23

To find candidate genes that potentially influence the susceptibility or resistance of crop plants to powdery mildew fungi, an assay system based on transient-induced gene silencing (TIGS) as well as transient over-expression in single epidermal cells of barley has been developed. However, this system relies on quantitative microscopic analysis of the barley/powdery mildew interaction and will only become a high-throughput tool of phenomics upon automation of the most time-consuming steps. We have developed a high-throughput screening system based on a motorized microscope which evaluates the specimens fully automatically. A large-scale double-blind verification of the system showed an excellent agreement of manual and automated analysis and proved the system to work dependably. Furthermore, in a series of bombardment experiments an RNAi construct targeting the Mlo gene was included, which is expected to phenocopy resistance mediated by recessive loss-of-function alleles such as mlo5. In most cases, the automated analysis system recorded a shift towards resistance upon RNAi of Mlo, thus providing proof of concept for its usefulness in detecting gene-target effects. Besides saving labor and enabling a screening of thousands of candidate genes, this system offers continuous operation of expensive laboratory equipment and provides a less subjective analysis as well as a complete and enduring documentation of the experimental raw data in terms of digital images. In general, it proves the concept of enabling available microscope hardware to handle challenging screening tasks fully automatically.

Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms

PubMed Central

Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

2016-01-01

Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called ‘rain’. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based ‘experience matrix’ that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The droplet separation value allows for easy and reproducible assay performance evaluation. The combination of separation value with the experience matrix simplifies the choice of adequate assay parameters for a given GMO event. PMID:27077048

Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms.

PubMed

Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

2016-03-01

Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The droplet separation value allows for easy and reproducible assay performance evaluation. The combination of separation value with the experience matrix simplifies the choice of adequate assay parameters for a given GMO event.

The Diagnostic Performance of Stool DNA Testing for Colorectal Cancer: A Systematic Review and Meta-Analysis.

PubMed

Zhai, Rong-Lin; Xu, Fei; Zhang, Pei; Zhang, Wan-Li; Wang, Hui; Wang, Ji-Liang; Cai, Kai-Lin; Long, Yue-Ping; Lu, Xiao-Ming; Tao, Kai-Xiong; Wang, Guo-Bin

2016-02-01

This meta-analysis was designed to evaluate the diagnostic performance of stool DNA testing for colorectal cancer (CRC) and compare the performance between single-gene and multiple-gene tests.MEDLINE, Cochrane, EMBASE databases were searched using keywords colorectal cancers, stool/fecal, sensitivity, specificity, DNA, and screening. Sensitivity analysis, quality assessments, and performance bias were performed for the included studies.Fifty-three studies were included in the analysis with a total sample size of 7524 patients. The studies were heterogeneous with regard to the genes being analyzed for fecal genetic biomarkers of CRC, as well as the laboratory methods being used for each assay. The sensitivity of the different assays ranged from 2% to 100% and the specificity ranged from 81% to 100%. The meta-analysis found that the pooled sensitivities for single- and multigene assays were 48.0% and 77.8%, respectively, while the pooled specificities were 97.0% and 92.7%. Receiver operator curves and diagnostic odds ratios showed no significant difference between both tests with regard to sensitivity or specificity.This meta-analysis revealed that using assays that evaluated multiple genes compared with single-gene assays did not increase the sensitivity or specificity of stool DNA testing in detecting CRC.

Influence of OPD in wavelength-shifting interferometry

NASA Astrophysics Data System (ADS)

Wang, Hongjun; Tian, Ailing; Liu, Bingcai; Dang, Juanjuan

2009-12-01

Phase-shifting interferometry is a powerful tool for high accuracy optical measurement. It operates by change the optical path length in the reference arm or test arm. This method practices by move optical device. So it has much problem when the optical device is very large and heavy. For solve this problem, the wavelength-shifting interferometry was put forwarded. In wavelength-shifting interferometry, the phase shifting angle was achieved by change the wavelength of optical source. The phase shifting angle was decided by wavelength and OPD (Optical Path Difference) between test and reference wavefront. So the OPD is an important factor to measure results. But in measurement, because the positional error and profile error of under testing optical element is exist, the phase shifting angle is different in different test point when wavelength scanning, it will introduce phase shifting angle error, so it will introduce optical surface measure error. For analysis influence of OPD on optical surface error, the relation between surface error and OPD was researched. By simulation, the relation between phase shifting error and OPD was established. By analysis, the error compensation method was put forward. After error compensation, the measure results can be improved to great extend.

Influence of OPD in wavelength-shifting interferometry

NASA Astrophysics Data System (ADS)

Wang, Hongjun; Tian, Ailing; Liu, Bingcai; Dang, Juanjuan

2010-03-01

Phase-shifting interferometry is a powerful tool for high accuracy optical measurement. It operates by change the optical path length in the reference arm or test arm. This method practices by move optical device. So it has much problem when the optical device is very large and heavy. For solve this problem, the wavelength-shifting interferometry was put forwarded. In wavelength-shifting interferometry, the phase shifting angle was achieved by change the wavelength of optical source. The phase shifting angle was decided by wavelength and OPD (Optical Path Difference) between test and reference wavefront. So the OPD is an important factor to measure results. But in measurement, because the positional error and profile error of under testing optical element is exist, the phase shifting angle is different in different test point when wavelength scanning, it will introduce phase shifting angle error, so it will introduce optical surface measure error. For analysis influence of OPD on optical surface error, the relation between surface error and OPD was researched. By simulation, the relation between phase shifting error and OPD was established. By analysis, the error compensation method was put forward. After error compensation, the measure results can be improved to great extend.

Optimizing Fire Department Operations Through Work Schedule Analysis, Alternative Staffing, and Nonproductive Time Reduction

DTIC Science & Technology

2014-09-01

hour work shift. A longer shift offers more time off between shifts, which can improve the employee’s family life , and personal emotional stress . On...Enhancing Work / Life Balance ,” Conn.L.Rev. 42 (2010): 1081–1527. 19 Nicole Jansen et al., “Need for Recovery from Work : Evaluating Short-Term Effects...24-hour work shift. A longer shift offers more time off between shifts that can improve the employee’s family life and personal emotional stress

Rapid Adjustment of Circadian Clocks to Simulated Travel to Time Zones across the Globe.

PubMed

Harrison, Elizabeth M; Gorman, Michael R

2015-12-01

Daily rhythms in mammalian physiology and behavior are generated by a central pacemaker located in the hypothalamic suprachiasmatic nuclei (SCN), the timing of which is set by light from the environment. When the ambient light-dark cycle is shifted, as occurs with travel across time zones, the SCN and its output rhythms must reset or re-entrain their phases to match the new schedule-a sluggish process requiring about 1 day per hour shift. Using a global assay of circadian resetting to 6 equidistant time-zone meridians, we document this characteristically slow and distance-dependent resetting of Syrian hamsters under typical laboratory lighting conditions, which mimic summer day lengths. The circadian pacemaker, however, is additionally entrainable with respect to its waveform (i.e., the shape of the 24-h oscillation) allowing for tracking of seasonally varying day lengths. We here demonstrate an unprecedented, light exposure-based acceleration in phase resetting following 2 manipulations of circadian waveform. Adaptation of circadian waveforms to long winter nights (8 h light, 16 h dark) doubled the shift response in the first 3 days after the shift. Moreover, a bifurcated waveform induced by exposure to a novel 24-h light-dark-light-dark cycle permitted nearly instant resetting to phase shifts from 4 to 12 h in magnitude, representing a 71% reduction in the mismatch between the activity rhythm and the new photocycle. Thus, a marked enhancement of phase shifting can be induced via nonpharmacological, noninvasive manipulation of the circadian pacemaker waveform in a model species for mammalian circadian rhythmicity. Given the evidence of conserved flexibility in the human pacemaker waveform, these findings raise the promise of flexible resetting applicable to circadian disruption in shift workers, frequent time-zone travelers, and any individual forced to adjust to challenging schedules. © 2015 The Author(s).

CPTAC Assay Portal: a repository of targeted proteomic assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whiteaker, Jeffrey R.; Halusa, Goran; Hoofnagle, Andrew N.

2014-06-27

To address these issues, the Clinical Proteomic Tumor Analysis Consortium (CPTAC) of the National Cancer Institute (NCI) has launched an Assay Portal (http://assays.cancer.gov) to serve as a public repository of well-characterized quantitative, MS-based, targeted proteomic assays. The purpose of the CPTAC Assay Portal is to facilitate widespread adoption of targeted MS assays by disseminating SOPs, reagents, and assay characterization data for highly characterized assays. A primary aim of the NCI-supported portal is to bring together clinicians or biologists and analytical chemists to answer hypothesis-driven questions using targeted, MS-based assays. Assay content is easily accessed through queries and filters, enabling investigatorsmore » to find assays to proteins relevant to their areas of interest. Detailed characterization data are available for each assay, enabling researchers to evaluate assay performance prior to launching the assay in their own laboratory.« less

Quantitative digital image analysis of chromogenic assays for high throughput screening of alpha-amylase mutant libraries.

PubMed

Shankar, Manoharan; Priyadharshini, Ramachandran; Gunasekaran, Paramasamy

2009-08-01

An image analysis-based method for high throughput screening of an alpha-amylase mutant library using chromogenic assays was developed. Assays were performed in microplates and high resolution images of the assay plates were read using the Virtual Microplate Reader (VMR) script to quantify the concentration of the chromogen. This method is fast and sensitive in quantifying 0.025-0.3 mg starch/ml as well as 0.05-0.75 mg glucose/ml. It was also an effective screening method for improved alpha-amylase activity with a coefficient of variance of 18%.

Impact of Work Task-Related Acute Occupational Smoke Exposures on Select Proinflammatory Immune Parameters in Wildland Firefighters.

PubMed

Adetona, Anna M; Adetona, Olorunfemi; Gogal, Robert M; Diaz-Sanchez, David; Rathbun, Stephen L; Naeher, Luke P

2017-07-01

A repeated measures study was used to assess the effect of work tasks on select proinflammatory biomarkers in firefighters working at prescribed burns. Ten firefighters and two volunteers were monitored for particulate matter and carbon monoxide on workdays, January to July 2015. Before and after workshift dried blood spots were analyzed for inflammatory mediators using the Meso Scale Discovery assay, while blood smears were used to assess leukocyte parameters. Firefighters lighting with drip-torches had higher cross-work-shift increases in interleukin-8, C-reactive protein, and serum amyloid A compared with holding, a task involving management of fire boundaries. A positive association between interleukin-8 and segmented-neutrophil was observed. Results from this study suggest that intermittent occupational diesel exposures contribute to cross-work-shift changes in host systemic innate inflammation as indicated by elevated interleukin-8 levels and peripheral blood segmented-neutrophils.

Chemically cued suppression of coral reef resilience: Where is the tipping point?

NASA Astrophysics Data System (ADS)

Brooker, Rohan M.; Hay, Mark E.; Dixson, Danielle L.

2016-12-01

Coral reefs worldwide are shifting from high-diversity, coral-dominated communities to low-diversity systems dominated by seaweeds. This shift can impact essential recovery processes such as larval recruitment and ecosystem resilience. Recent evidence suggests that chemical cues from certain corals attract, and from certain seaweeds suppress, recruitment of juvenile fishes, with loss of coral cover and increases in seaweed cover creating negative feedbacks that prevent reef recovery and sustain seaweed dominance. Unfortunately, the level of seaweed increase and coral decline that creates this chemically cued tipping point remains unknown, depriving managers of data-based targets to prevent damaging feedbacks. We conducted flume and field assays that suggest juvenile fishes sense and respond to cues produced by low levels of seaweed cover. However, the herbivore species we tested was more tolerant of degraded reef cues than non-herbivores, possibly providing some degree of resilience if these fishes recruit, consume macroalgae, and diminish negative cues.

Shifted Golgi targeting of glycosyltransferases and α-mannosidase IA from giantin to GM130-GRASP65 results in formation of high mannose N-glycans in aggressive prostate cancer cells.

PubMed

Bhat, Ganapati; Hothpet, Vishwanath-Reddy; Lin, Ming-Fong; Cheng, Pi-Wan

2017-11-01

There is a pressing need for biomarkers that can distinguish indolent from aggressive prostate cancer to prevent over-treatment of patients with indolent tumor. Golgi targeting of glycosyltransferases was characterized by confocal microscopy after knockdown of GM130, giantin, or both. N-glycans on a trans-Golgi enzyme β4galactosyltransferase-1 isolated by immunoprecipitation from androgen-sensitive and independent prostate cancer cells were determined by matrix-assisted laser desorption-time of flight-mass spectrometry. In situ proximity ligation assay was employed to determine co-localization of (a) α-mannosidase IA, an enzyme required for processing Man 8 GlcNAc 2 down to Man 5 GlcNAc 2 to enable synthesis of complex-type N-glycans, with giantin, GM130, and GRASP65, and (b) trans-Golgi glycosyltransferases with high mannose N-glycans terminated with α3-mannose. Defective giantin in androgen-independent prostate cancer cells results in a shift of Golgi targeting of glycosyltransferases and α-mannosidase IA from giantin to GM130-GRASP65. Consequently, trans-Golgi enzymes and cell surface glycoproteins acquire high mannose N-glycans, which are absent in cells with functional giantin. In situ proximity ligation assays of co-localization of α-mannosidase IA with GM130 and GRASP65, and trans-Golgi glycosyltransferases with high mannose N-glycans are negative in androgen-sensitive LNCaP C-33 cells but positive in androgen-independent LNCaP C-81 and DU145 cells, and LNCaP C-33 cells devoid of giantin. In situ proximity ligation assays of Golgi localization of α-mannosidase IA at giantin versus GM130-GRASP65 site, and absence or presence of N-glycans terminated with α3-mannose on trans-Golgi glycosyltransferases may be useful for distinguishing indolent from aggressive prostate cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

The Vibrio parahaemolyticus Small RNA RyhB Promotes Production of the Siderophore Vibrioferrin by Stabilizing the Polycistronic mRNA

PubMed Central

Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo

2013-01-01

High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938–6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5′-untranslated region of pvsOp mRNA (pvsOp 5′-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5′-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5′-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5′-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target. PMID:23772063

Tube-Forming Assays.

PubMed

Brown, Ryan M; Meah, Christopher J; Heath, Victoria L; Styles, Iain B; Bicknell, Roy

2016-01-01

Angiogenesis involves the generation of new blood vessels from the existing vasculature and is dependent on many growth factors and signaling events. In vivo angiogenesis is dynamic and complex, meaning assays are commonly utilized to explore specific targets for research into this area. Tube-forming assays offer an excellent overview of the molecular processes in angiogenesis. The Matrigel tube forming assay is a simple-to-implement but powerful tool for identifying biomolecules involved in angiogenesis. A detailed experimental protocol on the implementation of the assay is described in conjunction with an in-depth review of methods that can be applied to the analysis of the tube formation. In addition, an ImageJ plug-in is presented which allows automatic quantification of tube images reducing analysis times while removing user bias and subjectivity.

Cell Density Affects the Detection of Chk1 Target Engagement by the Selective Inhibitor V158411.

PubMed

Geneste, Clara C; Massey, Andrew J

2018-02-01

Understanding drug target engagement and the relationship to downstream pharmacology is critical for drug discovery. Here we have evaluated target engagement of Chk1 by the small-molecule inhibitor V158411 using two different target engagement methods (autophosphorylation and cellular thermal shift assay [CETSA]). Target engagement measured by these methods was subsequently related to Chk1 inhibitor-dependent pharmacology. Inhibition of autophosphorylation was a robust method for measuring V158411 Chk1 target engagement. In comparison, while target engagement determined using CETSA appeared robust, the V158411 CETSA target engagement EC 50 values were 43- and 19-fold greater than the autophosphorylation IC 50 values. This difference was attributed to the higher cell density in the CETSA assay configuration. pChk1 (S296) IC 50 values determined using the CETSA assay conditions were 54- and 33-fold greater than those determined under standard conditions and were equivalent to the CETSA EC 50 values. Cellular conditions, especially cell density, influenced the target engagement of V158411 for Chk1. The effects of high cell density on apparent compound target engagement potency should be evaluated when using target engagement assays that necessitate high cell densities (such as the CETSA conditions used in this study). In such cases, the subsequent relation of these data to downstream pharmacological changes should therefore be interpreted with care.

Transcriptional regulation of human MUC4 gene: identification of a novel inhibitory element and its nuclear binding protein.

PubMed

Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi

2013-08-01

The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.

REGULATION OF INFLAMMATORY TRANSCRIPTION FACTORS BY HEAT SHOCK PROTEIN 70 IN PRIMARY CULTURED ASTROCYTES EXPOSED TO OXYGEN–GLUCOSE DEPRIVATION

PubMed Central

KIM, J. Y.; YENARI, M. A.; LEE, J. E.

2018-01-01

Inflammation is an important event in ischemic injury. These immune responses begin with the expression of pro-inflammatory genes modulating transcription factors, such as nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and signal transducers and activator of transcription-1 (STAT-1). The 70-kDa heat shock protein (Hsp70) can both induce and arrest inflammatory reactions and lead to improved neurological outcome in experimental brain injury and ischemia. Since Hsp70 are induced under heat stress, we investigated the link between Hsp70 neuroprotection and phosphorylation of inhibitor of κB (IκB), c-Jun N-terminal kinases (JNK) and p38 through co-immunoprecipitation and enzyme-linked immunosorbent assay (ELISA) assay. Transcription factors and pro-inflammatory genes were quantified by immunoblotting, electrophoretic-mobility shift assay and reverse transcription-polymerase chain reaction assays. The results showed that heat stress led to Hsp70 overexpression which rendered neuroprotection after ischemia-like injury. Overexpression Hsp70 also interrupts the phosphorylation of IκB, JNK and p38 and bluntsDNA binding of their transcription factors (NF-κB, AP-1 and STAT-1), effectively downregulating the expression of pro-inflammatory genes inheat-pretreatedastrocytes. Takentogether, these results suggest that overexpression of Hsp70 may protect against brain ischemia via an anti-inflammatory mechanism by interrupting the phosphorylation of upstream of transcription factors. PMID:25485480

A meta-analysis on dose-response relationship between night shift work and the risk of breast cancer.

PubMed

Wang, F; Yeung, K L; Chan, W C; Kwok, C C H; Leung, S L; Wu, C; Chan, E Y Y; Yu, I T S; Yang, X R; Tse, L A

2013-11-01

This study aimed to conduct a systematic review to sum up evidence of the associations between different aspects of night shift work and female breast cancer using a dose-response meta-analysis approach. We systematicly searched all cohort and case-control studies published in English on MEDLINE, Embase, PSYCInfo, APC Journal Club and Global Health, from January 1971 to May 2013. We extracted effect measures (relative risk, RR; odd ratio, OR; or hazard ratio, HR) from individual studies to generate pooled results using meta-analysis approaches. A log-linear dose-response regression model was used to evaluate the relationship between various indicators of exposure to night shift work and breast cancer risk. Downs and Black scale was applied to assess the methodological quality of included studies. Ten studies were included in the meta-analysis. A pooled adjusted relative risk for the association between 'ever exposed to night shift work' and breast cancer was 1.19 [95% confidence interval (CI) 1.05-1.35]. Further meta-analyses on dose-response relationship showed that every 5-year increase of exposure to night shift work would correspondingly enhance the risk of breast cancer of the female by 3% (pooled RR = 1.03, 95% CI 1.01-1.05; Pheterogeneity < 0.001). Our meta-analysis also suggested that an increase in 500-night shifts would result in a 13% (RR = 1.13, 95% CI 1.07-1.21; Pheterogeneity = 0.06) increase in breast cancer risk. This systematic review updated the evidence that a positive dose-response relationship is likely to present for breast cancer with increasing years of employment and cumulative shifts involved in the work.

Nuclear factor I-A represses expression of the cell adhesion molecule L1

PubMed Central

2009-01-01

Background The neural cell adhesion molecule L1 plays a crucial role in development and plasticity of the nervous system. Neural cells thus require precise control of L1 expression. Results We identified a full binding site for nuclear factor I (NFI) transcription factors in the regulatory region of the mouse L1 gene. Electrophoretic mobility shift assay (EMSA) showed binding of nuclear factor I-A (NFI-A) to this site. Moreover, for a brain-specific isoform of NFI-A (NFI-A bs), we confirmed the interaction in vivo using chromatin immunoprecipitation (ChIP). Reporter gene assays showed that in neuroblastoma cells, overexpression of NFI-A bs repressed L1 expression threefold. Conclusion Our findings suggest that NFI-A, in particular its brain-specific isoform, represses L1 gene expression, and might act as a second silencer of L1 in addition to the neural restrictive silencer factor (NRSF). PMID:20003413

Improving the photostability of bright monomeric orange and red fluorescent proteins.

PubMed

Shaner, Nathan C; Lin, Michael Z; McKeown, Michael R; Steinbach, Paul A; Hazelwood, Kristin L; Davidson, Michael W; Tsien, Roger Y

2008-06-01

All organic fluorophores undergo irreversible photobleaching during prolonged illumination. Although fluorescent proteins typically bleach at a substantially slower rate than many small-molecule dyes, in many cases the lack of sufficient photostability remains an important limiting factor for experiments requiring large numbers of images of single cells. Screening methods focusing solely on brightness or wavelength are highly effective in optimizing both properties, but the absence of selective pressure for photostability in such screens leads to unpredictable photobleaching behavior in the resulting fluorescent proteins. Here we describe an assay for screening libraries of fluorescent proteins for enhanced photostability. With this assay, we developed highly photostable variants of mOrange (a wavelength-shifted monomeric derivative of DsRed from Discosoma sp.) and TagRFP (a monomeric derivative of eqFP578 from Entacmaea quadricolor) that maintain most of the beneficial qualities of the original proteins and perform as reliably as Aequorea victoria GFP derivatives in fusion constructs.

Identification of insulin as a novel retinoic acid receptor-related orphan receptor α target gene.

PubMed

Kuang, Jiangying; Hou, Xiaoming; Zhang, Jinlong; Chen, Yulong; Su, Zhiguang

2014-03-18

Insulin plays an important role in regulation of lipid and glucose metabolism. Retinoic acid receptor-related orphan receptor α (RORα) modulates physiopathological processes such as dyslipidemia and diabetes. In this study, we found overexpression of RORα in INS1 cells resulted in increased expression and secretion of insulin. Suppression of endogenous RORα caused a decrease of insulin expression. Luciferase and electrophoretic mobility shift assay (EMSA) assays demonstrated that RORα activated insulin transcription via direct binding to its promoter. RORα was also observed to regulate BETA2 expression, which is one of the insulin active transfactors. In vivo analyses showed that the insulin transcription is increased by the synthetic RORα agonist SR1078. These findings identify RORα as a transcriptional activator of insulin and suggest novel therapeutic opportunities for management of the disease. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Multicolor Fluorescence Detection for Droplet Microfluidics Using Optical Fibers

PubMed Central

Cole, Russell H.; Gartner, Zev J.; Abate, Adam R.

2016-01-01

Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as multiplex assays, enzyme evolution, and molecular biology enhanced cell sorting require the detection of two or more colors of fluorescence. Standard multicolor detection systems that couple free space lasers to epifluorescence microscopes are bulky, expensive, and difficult to maintain. In this paper, we describe a scheme to perform multicolor detection by exciting discrete regions of a microfluidic channel with lasers coupled to optical fibers. Emitted light is collected by an optical fiber coupled to a single photodetector. Because the excitation occurs at different spatial locations, the identity of emitted light can be encoded as a temporal shift, eliminating the need for more complicated light filtering schemes. The system has been used to detect droplet populations containing four unique combinations of dyes and to detect sub-nanomolar concentrations of fluorescein. PMID:27214249

The Human Splicing Factor ASF/SF2 can Specifically Recognize Pre-mRNA 5' Splice Sites

NASA Astrophysics Data System (ADS)

Zuo, Ping; Manley, James L.

1994-04-01

ASF/SF2 is a human protein previously shown to function in in vitro pre-mRNA splicing as an essential factor necessary for all splices and also as an alternative splicing factor, capable of switching selection of 5' splice sites. To begin to study the protein's mechanism of action, we have investigated the RNA binding properties of purified recombinant ASF/SF2. Using UV crosslinking and gel shift assays, we demonstrate that the RNA binding region of ASF/SF2 can interact with RNA in a sequence-specific manner, recognizing the 5' splice site in each of two different pre-mRNAs. Point mutations in the 5' splice site consensus can reduce binding by as much as a factor of 100, with the largest effects observed in competition assays. These findings support a model in which ASF/SF2 aids in the recognition of pre-mRNA 5' splice sites.

Development of rapid and sensitive high throughput pharmacologic assays for marine phycotoxins.

PubMed

Van Dolah, F M; Finley, E L; Haynes, B L; Doucette, G J; Moeller, P D; Ramsdell, J S

1994-01-01

The lack of rapid, high throughput assays is a major obstacle to many aspects of research on marine phycotoxins. Here we describe the application of microplate scintillation technology to develop high throughput assays for several classes of marine phycotoxin based on their differential pharmacologic actions. High throughput "drug discovery" format microplate receptor binding assays developed for brevetoxins/ciguatoxins and for domoic acid are described. Analysis for brevetoxins/ciguatoxins is carried out by binding competition with [3H] PbTx-3 for site 5 on the voltage dependent sodium channel in rat brain synaptosomes. Analysis of domoic acid is based on binding competition with [3H] kainic acid for the kainate/quisqualate glutamate receptor using frog brain synaptosomes. In addition, a high throughput microplate 45Ca flux assay for determination of maitotoxins is described. These microplate assays can be completed within 3 hours, have sensitivities of less than 1 ng, and can analyze dozens of samples simultaneously. The assays have been demonstrated to be useful for assessing algal toxicity and for assay-guided purification of toxins, and are applicable to the detection of biotoxins in seafood.

The Risky Shift in Policy Decision Making: A Comparative Analysis

ERIC Educational Resources Information Center

Wilpert, B.; And Others

1976-01-01

Based on analysis of data on 432 decision-makers from around the world, this study examines the decision-making phenomenon that individuals tend to move toward riskier decisions after group discussion. Findings of the analysis contradicted earlier studies, showing a consistent shift toward greater risk avoidance. Available from Elsevier Scientific…

A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

PubMed

Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

2017-06-01

For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

Research Techniques Made Simple: Analysis of Collective Cell Migration Using the Wound Healing Assay.

PubMed

Grada, Ayman; Otero-Vinas, Marta; Prieto-Castrillo, Francisco; Obagi, Zaidal; Falanga, Vincent

2017-02-01

Collective cell migration is a hallmark of wound repair, cancer invasion and metastasis, immune responses, angiogenesis, and embryonic morphogenesis. Wound healing is a complex cellular and biochemical process necessary to restore structurally damaged tissue. It involves dynamic interactions and crosstalk between various cell types, interaction with extracellular matrix molecules, and regulated production of soluble mediators and cytokines. In cutaneous wound healing, skin cells migrate from the wound edges into the wound to restore skin integrity. Analysis of cell migration in vitro is a useful assay to quantify alterations in cell migratory capacity in response to experimental manipulations. Although several methods exist to study cell migration (such as Boyden chamber assay, barrier assays, and microfluidics-based assays), in this short report we will explain the wound healing assay, also known as the "in vitro scratch assay" as a simple, versatile, and cost-effective method to study collective cell migration and wound healing. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Comparative evaluation of the Aptima HIV-1 Quant Dx assay and COBAS TaqMan HIV-1 v2.0 assay using the Roche High Pure System for the quantification of HIV-1 RNA in plasma.

PubMed

Schalasta, Gunnar; Börner, Anna; Speicher, Andrea; Enders, Martin

2016-03-01

Quantification of human immunodeficiency virus type 1 (HIV-1) RNA in plasma has become the standard of care in the management of HIV-infected patients. There are several commercially available assays that have been implemented for the detection of HIV-1 RNA in plasma. Here, the new Hologic Aptima® HIV-1 Quant Dx assay (Aptima HIV) was compared to the Roche COBAS® TaqMan® HIV-1 Test v2.0 for use with the High Pure System (HPS/CTM). The performance characteristics of the assays were assessed using commercially available HIV reference panels, dilution of the WHO 3rd International HIV-1 RNA International Standard (WHO-IS) and plasma from clinical specimens. Assay performance was determined by linear regression, Deming correlation analysis and Bland-Altman analysis. Testing of HIV-1 reference panels revealed excellent agreement. The 61 clinical specimens quantified in both assays were linearly associated and strongly correlated. The Aptima HIV assay offers performance comparable to that of the HPS/CTM assay and, as it is run on a fully automated platform, a significantly improved workflow.

Quantitation of sperm bindable IgA and IgG in seminal fluid.

PubMed

Howe, S E; Lynch, D M

1986-05-01

Seminal fluid and serum from 95 infertile males were assayed for sperm bindable immunoglobulins using an indirect ELISA with whole target sperm. The ELISA method was compared to seminal fluid and serum immobilization and agglutination assays (functional assays). In this infertile group, the ELISA assay was positive in 22% of seminal fluids (greater than 1.2 fg IgA/sperm and greater than 0.3 fg IgG/sperm). The seminal fluid antibodies were IgA and had an accompanying elevated IgG component in 78% of patients. There was a 96% correlation between negative seminal fluid functional assays and negative ELISA, and a 95% correlation between positive seminal fluid functional assays and positive ELISA. Positive serum sperm antibody tests were found in 71% of the infertile males with positive seminal fluid sperm antibodies, but 29% of the infertile males with strongly positive IgA seminal fluid sperm antibodies showed normal levels of serum sperm antibodies by either ELISA or functional assays. The ELISA method gives reproducible quantitation of sperm antibodies in seminal fluid and correlates well with accepted functional assays. Comparisons with serum sperm antibody assays suggests that seminal fluid sperm antibody analysis complements the serum analysis of sperm antibodies.

Investigation on the toxic potential of Tribulus terrestris in vitro.

PubMed

Abudayyak, M; Jannuzzi, A T; Özhan, G; Alpertunga, B

2015-04-01

Tribulus terrestris L. (Zygophyllaceae) has been commonly used to energize, vitalize, and improve sexual function and physical performance in men. This study investigates the potential cytotoxic and genotoxic, and endocrine disrupting activities of T. terrestris in vitro. The whole T. terrestris plant was extracted with water, methanol, and chloroform. The genotoxic potential of T. terrestris extracts at 3-2400 µg/mL was assessed by Comet assay in a rat kidney cell line (NRK-52E) and by Ames assay in Salmonella typhimurium TA98 and TA100 strains. Endocrine disrupting effects of the extracts at concentrations of 0.22-25 000 µg/mL were assessed by YES/YAS assay in Saccharomyces cerevisiae. Cytotoxic activity of the extracts was determined by the MTT test in NRK-52E cells. The different exposure times were used for four tests (3-48 h). The methanol extract of T. terrestris IC50 value was 160 µg/mL. The other extracts did not show cytotoxic effects. In the Comet and Ames genotoxicity assays, none of the extracts possessed genotoxic activities at concentrations of 0-2400 µg/mL. Only the water extract of T. terrestris induced frame shift mutations after metabolic activation. The water extract also showed estrogenic activity by YES/YAS assay in S. cerevisiae at concentrations ≥27 µg/mL (≥2.6-fold), while the other T. terrestris extracts had anti-estrogenic properties. Tribulus terrestris had estrogenic and genotoxic activities. The study was useful in determining its toxicological effects and the precautions regarding consumption.

A coupled photometric assay for characterization of S-adenosyl-l-homocysteine hydrolases in the physiological hydrolytic direction.

PubMed

Kailing, Lyn L; Bertinetti, Daniela; Herberg, Friedrich W; Pavlidis, Ioannis V

2017-10-25

S-Adenosyl-l-homocysteine hydrolases (SAHases) are important metabolic enzymes and their dysregulation is associated with some severe diseases. In vivo they catalyze the hydrolysis of S-adenosyl-l-homocysteine (SAH), the by-product of methylation reactions in various organisms. SAH is a potent inhibitor of methyltransferases, thus its removal from the equilibrium is an important requirement for methylation reactions. SAH hydrolysis is also the first step in the cellular regeneration process of the methyl donor S-adenosyl-l-methionine (SAM). However, in vitro the equilibrium lies towards the synthetic direction. To enable characterization of SAHases in the physiologically relevant direction, we have developed a coupled photometric assay that shifts the equilibrium towards hydrolysis by removing the product adenosine, using a high affinity adenosine kinase (AK). This converts adenosine to AMP and thereby forms equimolar amounts of ADP, which is phosphorylated by a pyruvate kinase (PK), in turn releasing pyruvate. The readout of the assay is the consumption of NADH during the lactate dehydrogenase (LDH) catalyzed reduction of pyruvate to lactic acid. The applicability of the assay is showcased for the determination of the kinetic constants of an SAHase from Bradyrhizobium elkanii (K M,SAH 41±5μM, v max,SAH 25±1μM/min with 0.13mg/mL enzyme). This assay is a valuable tool for in vitro characterization of SAHases with biotechnological potential, and for monitoring SAHase activity in diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

Bacteriophage-based assays for the rapid detection of rifampicin resistance in Mycobacterium tuberculosis: a meta-analysis.

PubMed

Pai, Madhukar; Kalantri, Shriprakash; Pascopella, Lisa; Riley, Lee W; Reingold, Arthur L

2005-10-01

To summarize, using meta-analysis, the accuracy of bacteriophage-based assays for the detection of rifampicin resistance in Mycobacterium tuberculosis. By searching multiple databases and sources we identified a total of 21 studies eligible for meta-analysis. Of these, 14 studies used phage amplification assays (including eight studies on the commercial FASTPlaque-TB kits), and seven used luciferase reporter phage (LRP) assays. Sensitivity, specificity, and agreement between phage assay and reference standard (e.g. agar proportion method or BACTEC 460) results were the main outcomes of interest. When performed on culture isolates (N=19 studies), phage assays appear to have relatively high sensitivity and specificity. Eleven of 19 (58%) studies reported sensitivity and specificity estimates > or =95%, and 13 of 19 (68%) studies reported > or =95% agreement with reference standard results. Specificity estimates were slightly lower and more variable than sensitivity; 5 of 19 (26%) studies reported specificity <90%. Only two studies performed phage assays directly on sputum specimens; although one study reported sensitivity and specificity of 100 and 99%, respectively, another reported sensitivity of 86% and specificity of 73%. Current evidence is largely restricted to the use of phage assays for the detection of rifampicin resistance in culture isolates. When used on culture isolates, these assays appear to have high sensitivity, but variable and slightly lower specificity. In contrast, evidence is lacking on the accuracy of these assays when they are directly applied to sputum specimens. If phage-based assays can be directly used on clinical specimens and if they are shown to have high accuracy, they have the potential to improve the diagnosis of MDR-TB. However, before phage assays can be successfully used in routine practice, several concerns have to be addressed, including unexplained false positives in some studies, potential for contamination and indeterminate results.

PSK Shift Timing Information Detection Using Image Processing and a Matched Filter

DTIC Science & Technology

2009-09-01

phase shifts are enhanced.  Develop, design, and test the resulting phase shift identification scheme. xx  Develop, design, and test an optional...and the resulting phase shift identification algorithm is investigated for SNR levels in the range -2dB to 12 dB. Detection performances are derived...test the resulting phase shift identification scheme.  Develop, design, and test an optional analysis window overlapping technique to improve phase

Automated Analysis of a Nematode Population-based Chemosensory Preference Assay

PubMed Central

Chai, Cynthia M.; Cronin, Christopher J.; Sternberg, Paul W.

2017-01-01

The nematode, Caenorhabditis elegans' compact nervous system of only 302 neurons underlies a diverse repertoire of behaviors. To facilitate the dissection of the neural circuits underlying these behaviors, the development of robust and reproducible behavioral assays is necessary. Previous C. elegans behavioral studies have used variations of a "drop test", a "chemotaxis assay", and a "retention assay" to investigate the response of C. elegans to soluble compounds. The method described in this article seeks to combine the complementary strengths of the three aforementioned assays. Briefly, a small circle in the middle of each assay plate is divided into four quadrants with the control and experimental solutions alternately placed. After the addition of the worms, the assay plates are loaded into a behavior chamber where microscope cameras record the worms' encounters with the treated regions. Automated video analysis is then performed and a preference index (PI) value for each video is generated. The video acquisition and automated analysis features of this method minimizes the experimenter's involvement and any associated errors. Furthermore, minute amounts of the experimental compound are used per assay and the behavior chamber's multi-camera setup increases experimental throughput. This method is particularly useful for conducting behavioral screens of genetic mutants and novel chemical compounds. However, this method is not appropriate for studying stimulus gradient navigation due to the close proximity of the control and experimental solution regions. It should also not be used when only a small population of worms is available. While suitable for assaying responses only to soluble compounds in its current form, this method can be easily modified to accommodate multimodal sensory interaction and optogenetic studies. This method can also be adapted to assay the chemosensory responses of other nematode species. PMID:28745641

An Extended Structure-Activity Relationship of Nondioxin-Like PCBs Evaluates and Supports Modeling Predictions and Identifies Picomolar Potency of PCB 202 Towards Ryanodine Receptors.

PubMed

Holland, Erika B; Feng, Wei; Zheng, Jing; Dong, Yao; Li, Xueshu; Lehmler, Hans-Joachim; Pessah, Isaac N

2017-01-01

Nondioxin-like polychlorinated biphenyls (NDL PCBs) activate ryanodine-sensitive Ca 2+  channels (RyRs) and this activation has been associated with neurotoxicity in exposed animals. RyR-active congeners follow a distinct structure-activity relationship and a quantitative structure-activity relationship (QSAR) predicts that a large number of PCBs likely activate the receptor, which requires validation. Additionally, previous structural based conclusions have been established using receptor ligand binding assays but the impact of varying PCB structures on ion channel gating behavior is not understood. We used [ 3 H]Ryanodine ([ 3 H]Ry) binding to assess the RyR-activity of 14 previously untested PCB congeners evaluating the predictability of the QSAR. Congeners determined to display widely varying potency were then assayed with single channel voltage clamp analysis to assess direct influences on channel gating kinetics. The RyR-activity of individual PCBs assessed in in vitro assays followed the general pattern predicted by the QSAR but binding and lipid bilayer experiments demonstrated higher potency than predicted. Of the 49 congeners tested to date, tetra-ortho PCB 202 was found to be the most potent RyR-active congener increasing channel open probability at 200 pM. Shifting meta-substitutions to the para-position resulted in a > 100-fold reduction in potency as seen with PCB 197. Non-ortho PCB 11 was found to lack activity at the receptor supporting a minimum mono-ortho substitution for PCB RyR activity. These findings expand and support previous SAR assessments; where out of the 49 congeners tested to date 42 activate the receptor demonstrating that the RyR is a sensitive and common target of PCBs. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

dsRNA binding characterization of full length recombinant wild type and mutants Zaire ebolavirus VP35.

PubMed

Zinzula, Luca; Esposito, Francesca; Pala, Daniela; Tramontano, Enzo

2012-03-01

The Ebola viruses (EBOVs) VP35 protein is a multifunctional major virulence factor involved in EBOVs replication and evasion of the host immune system. EBOV VP35 is an essential component of the viral RNA polymerase, it is a key participant of the nucleocapsid assembly and it inhibits the innate immune response by antagonizing RIG-I like receptors through its dsRNA binding function and, hence, by suppressing the host type I interferon (IFN) production. Insights into the VP35 dsRNA recognition have been recently revealed by structural and functional analysis performed on its C-terminus protein. We report the biochemical characterization of the Zaire ebolavirus (ZEBOV) full-length recombinant VP35 (rVP35)-dsRNA binding function. We established a novel in vitro magnetic dsRNA binding pull down assay, determined the rVP35 optimal dsRNA binding parameters, measured the rVP35 equilibrium dissociation constant for heterologous in vitro transcribed dsRNA of different length and short synthetic dsRNA of 8bp, and validated the assay for compound screening by assessing the inhibitory ability of auryntricarboxylic acid (IC(50) value of 50μg/mL). Furthermore, we compared the dsRNA binding properties of full length wt rVP35 with those of R305A, K309A and R312A rVP35 mutants, which were previously reported to be defective in dsRNA binding-mediated IFN inhibition, showing that the latter have measurably increased K(d) values for dsRNA binding and modified migration patterns in mobility shift assays with respect to wt rVP35. Overall, these results provide the first characterization of the full-length wt and mutants VP35-dsRNA binding functions. Copyright © 2012 Elsevier B.V. All rights reserved.

A Decision Making Analysis of Persuasive Argumentation and the Choice Shift Effect

ERIC Educational Resources Information Center

Vinokur, Amiram; And Others

1975-01-01

A subjective expected utility (SEU) decision-making analysis was performed on the content of arguments generated by subjects privately or during group discussion in response to choice-dilemmas shown to shift toward risk and caution. (Editor)

Operation, Modeling and Analysis of the Reverse Water Gas Shift Process

NASA Technical Reports Server (NTRS)

Whitlow, Jonathan E.

2001-01-01

The Reverse Water Gas Shift process is a candidate technology for water and oxygen production on Mars under the In-Situ Propellant Production project. This report focuses on the operation and analysis of the Reverse Water Gas Shift (RWGS) process, which has been constructed at Kennedy Space Center. A summary of results from the initial operation of the RWGS, process along with an analysis of these results is included in this report. In addition an evaluation of a material balance model developed from the work performed previously under the summer program is included along with recommendations for further experimental work.

Comparative study of anti-angiogenic activities of luteolin, lectin and lupeol biomolecules.

PubMed

Ambasta, Rashmi K; Jha, Saurabh Kumar; Kumar, Dhiraj; Sharma, Renu; Jha, Niraj Kumar; Kumar, Pravir

2015-09-18

Angiogenesis is a hallmark feature in the initiation, progression and growth of tumour. There are various factors for promotion of angiogenesis on one hand and on the other hand, biomolecules have been reported to inhibit cancer through anti-angiogenesis mechanism. Biomolecules, for instance, luteolin, lectin and lupeol are known to suppress cancer. This study aims to compare and evaluate the biomolecule(s) like luteolin, lupeol and lectin on CAM assay and HT-29 cell culture to understand the efficacy of these drugs. The biomolecules have been administered on CAM assay, HT-29 cell culture, cell migration assay. Furthermore, bioinformatics analysis of the identified targets of these biomolecules have been performed. Luteolin has been found to be better in inhibiting angiogenesis on CAM assay in comparison to lupeol and lectin. In line with this study when biomolecules was administered on cell migration assay via scratch assay method. We provided evidence that Luteolin was again found to be better in inhibiting HT-29 cell migration. In order to identify the target sites of luteolin for inhibition, we used software analysis for identifying the best molecular targets of luteolin. Using software analysis best target protein molecule of these biomolecules have been identified. VEGF was found to be one of the target of luteolin. Studies have found several critical point mutation in VEGF A, B and C. Hence docking analysis of all biomolecules with VEGFR have been performed. Multiple allignment result have shown that the receptors are conserved at the docking site. Therefore, it can be concluded that luteolin is not only comparatively better in inhibiting blood vessel in CAM assay, HT-29 cell proliferation and cell migration assay rather the domain of VEGFR is conserved to be targeted by luteolin, lupeol and lectin.

A European multicientre study on the comparison of HIV-1 viral loads between VERIS HIV-1 Assay and Roche COBAS® TAQMAN® HIV-1 test, Abbott RealTime HIV-1 Assay, and Siemens VERSANT HIV-1 Assay.

PubMed

Braun, Patrick; Delgado, Rafael; Drago, Monica; Fanti, Diana; Fleury, Hervé; Hofmann, Jörg; Izopet, Jacques; Kühn, Sebastian; Lombardi, Alessandra; Mancon, Alessandro; Marcos, Mª Angeles; Mileto, Davide; Sauné, Karine; O'Shea, Siobhan; Pérez-Rivilla, Alfredo; Ramble, John; Trimoulet, Pascale; Vila, Jordi; Whittaker, Duncan; Artus, Alain; Rhodes, Daniel

2017-07-01

Viral load monitoring is essential for patients under treatment for HIV. Beckman Coulter has developed the VERIS HIV-1 Assay for use on the novel, automated DxN VERIS Molecular Diagnostics System. ¥ OBJECTIVES: Evaluation of the clinical performance of the new quantitative VERIS HIV-1 Assay at multiple EU laboratories. Method comparison with the VERIS HIV-1 Assay was performed with 415 specimens at 5 sites tested with COBAS ® AmpliPrep/COBAS ® TaqMan ® HIV-1 Test, v2.0, 169 specimens at 3 sites tested with RealTime HIV-1 Assay, and 202 specimens from 2 sites tested with VERSANT HIV-1 Assay. Patient monitoring sample results from 4 sites were also compared. Bland-Altman analysis showed the average bias between VERIS HIV-1 Assay and COBAS HIV-1 Test, RealTime HIV-1 Assay, and VERSANT HIV-1 Assay to be 0.28, 0.39, and 0.61 log 10 cp/mL, respectively. Bias at low end levels below 1000cp/mL showed predicted bias to be <0.3 log 10 cp/mL for VERIS HIV-1 Assay versus COBAS HIV-1 Test and RealTime HIV-1 Assay, and <0.5 log 10 cp/mL versus VERSANT HIV-1 Assay. Analysis on 174 specimens tested with the 0.175mL volume VERIS HIV-1 Assay and COBAS HIV-1 Test showed average bias of 0.39 log 10 cp/mL. Patient monitoring results using VERIS HIV-1 Assay demonstrated similar viral load trends over time to all comparators. The VERIS HIV-1 Assay for use on the DxN VERIS System demonstrated comparable clinical performance to COBAS ® HIV-1 Test, RealTime HIV-1 Assay, and VERSANT HIV-1 Assay. Copyright © 2017 Elsevier B.V. All rights reserved.

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow.

PubMed

Suryawanshi, Gajendra W; Xu, Song; Xie, Yiming; Chou, Tom; Kim, Namshin; Chen, Irvin S Y; Kim, Sanggu

2017-06-14

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

Multidirectional abundance shifts among North American birds and the relative influence of multifaceted climate factors.

PubMed

Huang, Qiongyu; Sauer, John R; Dubayah, Ralph O

2017-09-01

Shifts in species distributions are major fingerprint of climate change. Examining changes in species abundance structures at a continental scale enables robust evaluation of climate change influences, but few studies have conducted these evaluations due to limited data and methodological constraints. In this study, we estimate temporal changes in abundance from North American Breeding Bird Survey data at the scale of physiographic strata to examine the relative influence of different components of climatic factors and evaluate the hypothesis that shifting species distributions are multidirectional in resident bird species in North America. We quantify the direction and velocity of the abundance shifts of 57 permanent resident birds over 44 years using a centroid analysis. For species with significant abundance shifts in the centroid analysis, we conduct a more intensive correlative analysis to identify climate components most strongly associated with composite change of abundance within strata. Our analysis focus on two contrasts: the relative importance of climate extremes vs. averages, and of temperature vs. precipitation in strength of association with abundance change. Our study shows that 36 species had significant abundance shifts over the study period. The average velocity of the centroid is 5.89 km·yr -1 . The shifted distance on average covers 259 km, 9% of range extent. Our results strongly suggest that the climate change fingerprint in studied avian distributions is multidirectional. Among 6 directions with significant abundance shifts, the northwestward shift was observed in the largest number of species (n = 13). The temperature/average climate model consistently has greater predictive ability than the precipitation/extreme climate model in explaining strata-level abundance change. Our study shows heterogeneous avian responses to recent environmental changes. It highlights needs for more species-specific approaches to examine contributing factors to recent distributional changes and for comprehensive conservation planning for climate change adaptation. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

Development of multicomponent hybrid density functional theory with polarizable continuum model for the analysis of nuclear quantum effect and solvent effect on NMR chemical shift.

PubMed

Kanematsu, Yusuke; Tachikawa, Masanori

2014-04-28

We have developed the multicomponent hybrid density functional theory [MC_(HF+DFT)] method with polarizable continuum model (PCM) for the analysis of molecular properties including both nuclear quantum effect and solvent effect. The chemical shifts and H/D isotope shifts of the picolinic acid N-oxide (PANO) molecule in chloroform and acetonitrile solvents are applied by B3LYP electron exchange-correlation functional for our MC_(HF+DFT) method with PCM (MC_B3LYP/PCM). Our MC_B3LYP/PCM results for PANO are in reasonable agreement with the corresponding experimental chemical shifts and isotope shifts. We further investigated the applicability of our method for acetylacetone in several solvents.

Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

PubMed Central

Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

1988-01-01

Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

Harnessing Raman spectroimmunoassay for detection of serological breast cancer markers (Conference Presentation)

NASA Astrophysics Data System (ADS)

Barman, Ishan; Li, Ming

2017-02-01

Two critical, unmet needs in breast cancer are the early detection of cancer metastasis and recurrence, and the sensitive assessment of temporal changes in tumor burden in response to therapy. The present research is directed towards developing a non-invasive, ultrasensitive and specific tool that provides a comprehensive real-time picture of the metastatic tumor burden and provides a radically new route to address these overarching challenges. As the continuing search for better diagnostic and prognostic clues has shifted away from a singular focus on primary tumor lesions, circulating and disseminated biomarkers have surfaced as attractive candidates due to the intrinsic advantages of a non-invasive, repeatable "liquid biopsy" procedure. However, a reproducible, facile blood-based test for diagnosis and follow-up of breast cancer has yet to be incorporated into a clinical laboratory assay due to the limitations of existing assays in terms of sensitivity, extensive sample processing requirements and, importantly, multiplexing capability. Here, by architecting nano-structured probes for detection of specific molecular species, we engineer a novel plasmon-enhanced Raman spectroscopic platform that offers a paradigmatic shift from the capabilities of today's diagnostic test platforms. Specifically, quantitative single-droplet serum tests reveal ultrasensitive and multiplexed detection of three key breast cancer biomarkers, cancer antigen 15-3 (CA15-3), CA27-29 and carcinoembryonic antigen (CEA), over several order of magnitude range of biomarker concentration and clear segmentation of the sera between normal and metastatic cancer levels.

[Relationship between shift work and overweight/obesity in male steel workers].

PubMed

Xiao, M Y; Wang, Z Y; Fan, H M; Che, C L; Lu, Y; Cong, L X; Gao, X J; Liu, Y J; Yuan, J X; Li, X M; Hu, B; Chen, Y P

2016-11-10

Objective: To investigate the relationship between shift work and overweight/obesity in male steel workers. Methods: A questionnaire survey was conducted among the male steel workers selected during health examination in Tangshan Steel Company from March 2015 to March 2016. The relationship between shift work and overweight/obesity in the male steel workers were analyzed by using logistic regression model and restricted cubic splinemodel. Results: A total of 7 262 male steel workers were surveyed, the overall prevalence of overweight/obesitywas 64.5% (4 686/7 262), the overweight rate was 34.3% and the obesity rate was 30.2%, respectively. After adjusting for age, educational level and average family income level per month by multivariable logistic regression analysis, shift work was associated with overweight/obesity and obesity in the male steel workers. The OR was 1.19(95% CI : 1.05-1.35) and 1.15(95% CI : 1.00-1.32). Restricted cubic spline model analysis showed that the relationship between shift work years and overweight/obesity in the male steel workers was a nonlinear dose response one (nonlinear test χ 2 =7.43, P <0.05). Restricted cubic spline model analysis showed that the relationship between shift work years and obesity in the male steel workers was a nonlinear dose response one (nonlinear test χ 2 =10.48, P <0.05). Conclusion: Shift work was associated with overweight and obesity in the male steel workers, and shift work years and overweight/obesity had a nonlinear relationship.

Simultaneous detection of antibodies to five Actinobacillus pleuropneumoniae serovars using bead-based multiplex analysis.

PubMed

Berger, Sanne Schou; Lauritsen, Klara Tølbøll; Boas, Ulrik; Lind, Peter; Andresen, Lars Ole

2017-11-01

We developed and made a preliminary validation of a bead-based multiplexed immunoassay for simultaneous detection of porcine serum antibodies to Actinobacillus pleuropneumoniae serovars 1, 2, 6, 7, and 12. Magnetic fluorescent beads were coupled with A. pleuropneumoniae antigens and tested with a panel of serum samples from experimentally infected pigs and with serum samples from uninfected and naturally infected pigs. The multiplex assay was compared to in-house ELISAs and complement fixation (CF) tests, which have been used for decades as tools for herd classification in the Danish Specific Pathogen Free system. Assay specificities and sensitivities as well as the corresponding cutoff values were determined using receiver operating characteristic (ROC) curve analysis, and the A. pleuropneumoniae multiplex assay showed good correlation with the in-house ELISAs and CF tests with areas under ROC curves ≥ 0.988. Benefits of multiplexed assays compared to ELISAs and CF tests include reduced serum sample volumes needed for analysis, less labor, and shorter assay time.

Comparative genome analysis identifies novel nucleic acid diagnostic targets for use in the specific detection of Haemophilus influenzae.

PubMed

Coughlan, Helena; Reddington, Kate; Tuite, Nina; Boo, Teck Wee; Cormican, Martin; Barrett, Louise; Smith, Terry J; Clancy, Eoin; Barry, Thomas

2015-10-01

Haemophilus influenzae is recognised as an important human pathogen associated with invasive infections, including bloodstream infection and meningitis. Currently used molecular-based diagnostic assays lack specificity in correctly detecting and identifying H. influenzae. As such, there is a need to develop novel diagnostic assays for the specific identification of H. influenzae. Whole genome comparative analysis was performed to identify putative diagnostic targets, which are unique in nucleotide sequence to H. influenzae. From this analysis, we identified 2H. influenzae putative diagnostic targets, phoB and pstA, for use in real-time PCR diagnostic assays. Real-time PCR diagnostic assays using these targets were designed and optimised to specifically detect and identify all 55H. influenzae strains tested. These novel rapid assays can be applied to the specific detection and identification of H. influenzae for use in epidemiological studies and could also enable improved monitoring of invasive disease caused by these bacteria. Copyright © 2015 Elsevier Inc. All rights reserved.

Changes in precipitation regime in the Baltic countries in 1966-2015

NASA Astrophysics Data System (ADS)

Jaagus, Jaak; Briede, Agrita; Rimkus, Egidijus; Sepp, Mait

2018-01-01

The aim of the study was to analyse trends and regime shifts in time series of monthly, seasonal and annual precipitation in the eastern Baltic countries (Lithuania, Latvia, Estonia) during 1966-2015. Data from 54 stations with nearly homogeneous series were used. The Mann-Kendall test was used for trend analysis and the Rodionov test for the analysis of regime shifts. Rather few statistically significant trends ( p < 0.05) and regime shifts were determined. The highest increase (by approximately 10 mm per decade) was observed in winter precipitation when a significant trend was found at the large majority of stations. For monthly precipitation, increasing trends were detected at many stations in January, February and June. Weak negative trends revealed at few stations in April and September. Annual precipitation has generally increased, but the trend is mostly insignificant. The analysis of regime shifts revealed some significant abrupt changes, the most important of which were upward shifts in winter, in January and February precipitation at many stations since 1990 or in some other years (1989, 1995). A return shift in the time series of February precipitation occurred since 2003. The most significant increase in precipitation was determined in Latvia and the weakest increase in Lithuania.

Development of recombinase polymerase amplification assays for the rapid detection of peste des petits ruminants virus.

PubMed

Zhang, Yongning; Wang, Jianchang; Zhang, Zhou; Mei, Lin; Wang, Jinfeng; Wu, Shaoqiang; Lin, Xiangmei

2018-04-01

Peste des petits ruminants (PPR) is a severe infectious disease of small ruminants caused by PPR virus (PPRV). Rapid and sensitive detection of PPRV is critical for controlling PPR. This report describes the development and evaluation of a conventional reverse transcription recombinase polymerase amplification (RT-RPA) assay and a real-time RT-RPA assay, targeting the PPRV N gene. Sensitivity analysis revealed that the conventional RT-RPA assay could detect 852 copies of standard PPRV RNA per reaction at 95% probability within 20 min at 41 °C, and the real-time RT-RPA assay could detect 103 copies of RNA molecules per reaction at 95% probability. Specificity analysis showed that both assays have no cross-reactivity with nucleic acid templates prepared from other selected viruses or common pathogens. Clinical evaluation using 162 ovine and hircine serum and nasal swab samples showed that the performance of both the real-time RT-RPA assay and the conventional RT-RPA assay were comparable to that of real-time RT-PCR. The overall agreements between real-time RT-PCR and real-time RT-RPA, and conventional RT-RPA were 99.4% (161/162) and 98.8% (160/162), respectively. The R 2 value of real-time RT-RPA and real-time RT-PCR was 0.900 by linear regression analysis. Our results suggest that both RT-RPA assays have a potential application in the rapid, sensitive and specific detection of PPRV. Copyright © 2018 Elsevier B.V. All rights reserved.

Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

NASA Astrophysics Data System (ADS)

Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

Selection of homeotic proteins for binding to a human DNA replication origin.

PubMed

de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G

2000-06-09

We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.

Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju

Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determinedmore » by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.« less

Isolation and Characterization of Chromosome-Gain and Increase-in-Ploidy Mutants in Yeast

PubMed Central

Chan, CSM.; Botstein, D.

1993-01-01

We have developed a colony papillation assay for monitoring the copy number of genetically marked chromosomes II and III in Saccharomyces cerevisiae. The unique feature of this assay is that it allows detection of a gain of the marked chromosomes even if there is a gain of the entire set of chromosomes (increase-in-ploidy). This assay was used to screen for chromosome-gain or increase-in-ploidy mutants. Five complementation groups have been defined for recessive mutations that confer an increase-in-ploidy (ipl) phenotype, which, in each case, cosegregates with a temperature-sensitive growth phenotype. Four new alleles of CDC31, which is required for spindle pole body duplication, were also recovered from this screen. Temperature-shift experiments with ipl1 cells show that they suffer severe nondisjunction at 37°. Similar experiments with ipl2 cells show that they gain entire sets of chromosomes and become arrested as unbudded cells at 37°. Molecular cloning and genetic mapping show that IPL1 is a newly identified gene, whereas IPL2 is allelic to BEM2, which is required for normal bud growth. PMID:8293973

Highly sensitive detection of caspase-3 activities via a nonconjugated gold nanoparticle-quantum dot pair mediated by an inner-filter effect.

PubMed

Li, Jingwen; Li, Xinming; Shi, Xiujuan; He, Xuewen; Wei, Wei; Ma, Nan; Chen, Hong

2013-10-09

We describe here a simple fluorometric assay for the highly sensitive detection of caspase-3 activities on the basis of the inner-filter effect of gold nanoparticles (AuNPs) on CdTe quantum dots (QDs). The method takes advantage of the high molar absorptivity of the plasmon band of gold nanoparticles as well as the large absorption band shift from 520 to 680 nm upon nanoparticle aggregation. When labeled with a peptide possessing the caspase-3 cleavage sequence (DEVD), the monodispersed Au-Ps (peptide-modified AuNPs) exhibited a tendency to aggregate when exposed to caspase-3, which induced the absorption band transition from 520 to 680 nm and turned on the fluorescence of the CdTe QDs for caspase-3 sensing. Under optimum conditions, a high sensitivity towards caspase-3 was achieved with a detection limit as low as 18 pM, which was much lower than the corresponding assays based on absorbance or other approaches. Overall, we demonstrated a facile and sensitive approach for caspase-3 detection, and we expected that this method could be potentially generalized to design more fluorescent assays for sensing other bioactive entities.

Assessment of Neutrophil Function in Patients with Septic Shock: Comparison of Methods

PubMed Central

Wenisch, C.; Fladerer, P.; Patruta, S.; Krause, R.; Hörl, W.

2001-01-01

Patients with septic shock are shown to have decreased neutrophil phagocytic function by multiple assays, and their assessment by whole-blood assays (fluorescence-activated cell sorter analysis) correlates with assays requiring isolated neutrophils (microscopic and spectrophotometric assays). For patients with similar underlying conditions but without septic shock, this correlation does not occur. PMID:11139215

Analysis of drugs by microcalorimetry Isothermal power-conduction calorimetry and thermometric titrimetry.

PubMed

Chowdhry, B Z; Beezer, A E; Greenhow, E J

1983-04-01

Microcalorimetric analysis has been the subject of a few review's in recent years, but these reviews have mainly dealt with the wide-ranging capabilities of calorimetric assay. This review, however, discusses the experimental basis and practical exploitation of the method in the particularly important area of pharmaceuticals. This field of analysis embraces both conventional chemical assays and bioassays which involve living microbial species. The review highlights the design of calorimetric instruments appropriate for study of microbial metabolism and interaction with drug substances. For comprehensiveness, both microcalorimetric and thermometric assay systems are discussed and critically assessed.

NCI Launches Proteomics Assay Portal | Office of Cancer Clinical Proteomics Research

Cancer.gov

In a paper recently published by the journal Nature Methods, Investigators from the National Cancer Institute’s Clinical Proteomic Tumor Analysis Consortium (NCI-CPTAC) announced the launch of a proteomics Assay Portal for multiple reaction monitoring-mass spectrometry (MRM-MS) assays.  This community web-based repository for well-characterized quantitative proteomic assays currently consists of 456 unique peptide assays to 282 unique proteins and ser

Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

PubMed

Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

2016-10-15

Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is found as the side chain of the rhamnogalacturonan type I complex in pectin, has remained partially studied. Here, we investigated the galactan utilization system consisting of the ganSPQAB operon and its regulator ganR This study improves our knowledge of the carbohydrate degradation systems of B. subtilis, especially the pectin degradation systems. Moreover, the galactan-degrading enzymes may be exploited for the production of galacto-oligosaccharides, which are used as prebiotic substances in the food industry. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Stereospecific assignment of the asparagine and glutamine sidechain amide protons in proteins from chemical shift analysis.

PubMed

Harsch, Tobias; Schneider, Philipp; Kieninger, Bärbel; Donaubauer, Harald; Kalbitzer, Hans Robert

2017-02-01

Side chain amide protons of asparagine and glutamine residues in random-coil peptides are characterized by large chemical shift differences and can be stereospecifically assigned on the basis of their chemical shift values only. The bimodal chemical shift distributions stored in the biological magnetic resonance data bank (BMRB) do not allow such an assignment. However, an analysis of the BMRB shows, that a substantial part of all stored stereospecific assignments is not correct. We show here that in most cases stereospecific assignment can also be done for folded proteins using an unbiased artificial chemical shift data base (UACSB). For a separation of the chemical shifts of the two amide resonance lines with differences ≥0.40 ppm for asparagine and differences ≥0.42 ppm for glutamine, the downfield shifted resonance lines can be assigned to H δ21 and H ε21 , respectively, at a confidence level >95%. A classifier derived from UASCB can also be used to correct the BMRB data. The program tool AssignmentChecker implemented in AUREMOL calculates the Bayesian probability for a given stereospecific assignment and automatically corrects the assignments for a given list of chemical shifts.

Feedback from the European Bioanalysis Forum: focus workshop on current analysis of immunogenicity: best practices and regulatory hurdles.

PubMed

Goodman, Joanne; Cowen, Simon; Devanarayan, Viswanath; Egging, David; Emrich, Thomas; Golob, Michaela; Kramer, Daniel; McNally, Jim; Munday, James; Nelson, Robert; Pedras-Vasconcelos, João A; Piironen, Timo; Sickert, Denise; Skibeli, Venke; Fjording, Marianne Scheel; Timmerman, Philip

2018-02-01

European Bioanalysis Forum Workshop, Lisbon, Portugal, September 2016: At the recent European Bioanalysis Forum Focus Workshop, 'current analysis of immunogenicity: best practices and regulatory hurdles', several important challenges facing the bioanalytical community in relation to immunogenicity assays were discussed through a mixture of presentations and panel sessions. The main areas of focus were the evolving regulatory landscape, challenges of assay interferences from either drug or target, cut-point setting and whether alternative assays can be used to replace neutralizing antibody assays. This workshop report captures discussions and potential solutions and/or recommendations made by the speakers and delegates.

Relationship between shift work and peripheral total and differential leukocyte counts in Chinese steel workers.

PubMed

Lu, Li-Fen; Wang, Chao-Ping; Tsai, I-Ting; Hung, Wei-Chin; Yu, Teng-Hung; Wu, Cheng-Ching; Hsu, Chia-Chang; Lu, Yung-Chuan; Chung, Fu-Mei; Jean, Mei-Chu Yen

2016-01-01

Even though shift work has been suspected to be a risk factor for cardiovascular disease, little research has been done to determine the logical underlying inflammation mechanisms. This study investigated the association between shift work and circulating total and differential leukocyte counts among Chinese steel workers. The subjects were 1,654 line workers in a steel plant, who responded to a cross-sectional survey with a questionnaire on basic attributes, life style, and sleep. All workers in the plant received a periodic health checkup. Total and differential leukocytes counts were also examined in the checkup. Shift workers had higher rates of alcohol use, smoking, poor sleep, poor physical exercise, and obesity than daytime workers. In further analysis, we found that the peripheral total WBC, monocyte, neutrophil, and lymphocyte counts were also greater in shift workers than in daytime workers. When subjects were divided into quartiles according to total WBC, neutrophil, monocyte, and lymphocyte counts, increased leukocyte count was associated with shift work. Using stepwise linear regression analysis, smoking, obesity, and shift work were independently associated with total WBC, monocyte, neutrophil, and lymphocyte counts. This study indicates that peripheral total and differential leukocyte counts are significantly higher in shift workers, which suggests that shift work may be a risk factor of cardiovascular disease. Applicable intervention strategies are needed for prevention of cardiovascular disease for shift workers.

Self-assembly of silver nanoparticles as high active surface-enhanced Raman scattering substrate for rapid and trace analysis of uranyl(VI) ions

NASA Astrophysics Data System (ADS)

Wang, Shaofei; Jiang, Jiaolai; Wu, Haoxi; Jia, Jianping; Shao, Lang; Tang, Hao; Ren, Yiming; Chu, Mingfu; Wang, Xiaolin

2017-06-01

A facile surface-enhanced Raman scattering (SERS) substrate based on the self-assembly of silver nanoparticles on the modified silicon wafer was obtained, and for the first time, an advanced SERS analysis method basing on this as-prepared substrate was established for high sensitive and rapid detection of uranyl ions. Due to the weakened bond strength of Odbnd Udbnd O resulting from two kinds of adsorption of uranyl species (;strong; and ;weak; adsorption) on the substrate, the ν1 symmetric stretch vibration frequency of Odbnd Udbnd O shifted from 871 cm- 1 (normal Raman) to 720 cm- 1 and 826 cm- 1 (SERS) along with significant Raman enhancement. Effects of the hydrolysis of uranyl ions on SERS were also investigated, and the SERS band at 826 cm- 1 was first used to approximately define the constitution of uranyl species at trace quantity level. Besides, the SERS intensity was proportional to the variable concentrations of uranyl nitrate ranging from 10- 7 to 10- 3 mol L- 1 with an excellent linear relation (R2 = 0.998), and the detection limit was 10- 7 mol L- 1. Furthermore, the related SERS approach involves low-cost substrate fabrication, rapid and trace analysis simultaneously, and shows great potential applications for the field assays of uranyl ions in the nuclear fuel cycle and environmental monitoring.

An image analysis toolbox for high-throughput C. elegans assays

PubMed Central

Wählby, Carolina; Kamentsky, Lee; Liu, Zihan H.; Riklin-Raviv, Tammy; Conery, Annie L.; O’Rourke, Eyleen J.; Sokolnicki, Katherine L.; Visvikis, Orane; Ljosa, Vebjorn; Irazoqui, Javier E.; Golland, Polina; Ruvkun, Gary; Ausubel, Frederick M.; Carpenter, Anne E.

2012-01-01

We present a toolbox for high-throughput screening of image-based Caenorhabditis elegans phenotypes. The image analysis algorithms measure morphological phenotypes in individual worms and are effective for a variety of assays and imaging systems. This WormToolbox is available via the open-source CellProfiler project and enables objective scoring of whole-animal high-throughput image-based assays of C. elegans for the study of diverse biological pathways relevant to human disease. PMID:22522656

Evaluation of quantification methods for real-time PCR minor groove binding hybridization probe assays.

PubMed

Durtschi, Jacob D; Stevenson, Jeffery; Hymas, Weston; Voelkerding, Karl V

2007-02-01

Real-time PCR data analysis for quantification has been the subject of many studies aimed at the identification of new and improved quantification methods. Several analysis methods have been proposed as superior alternatives to the common variations of the threshold crossing method. Notably, sigmoidal and exponential curve fit methods have been proposed. However, these studies have primarily analyzed real-time PCR with intercalating dyes such as SYBR Green. Clinical real-time PCR assays, in contrast, often employ fluorescent probes whose real-time amplification fluorescence curves differ from those of intercalating dyes. In the current study, we compared four analysis methods related to recent literature: two versions of the threshold crossing method, a second derivative maximum method, and a sigmoidal curve fit method. These methods were applied to a clinically relevant real-time human herpes virus type 6 (HHV6) PCR assay that used a minor groove binding (MGB) Eclipse hybridization probe as well as an Epstein-Barr virus (EBV) PCR assay that used an MGB Pleiades hybridization probe. We found that the crossing threshold method yielded more precise results when analyzing the HHV6 assay, which was characterized by lower signal/noise and less developed amplification curve plateaus. In contrast, the EBV assay, characterized by greater signal/noise and amplification curves with plateau regions similar to those observed with intercalating dyes, gave results with statistically similar precision by all four analysis methods.

A rapid fluorescence assay for danofloxacin in beef muscle: effect of muscle type on limit of quantitation.

PubMed

Schneider, Marilyn J

2008-08-01

A simple, rapid fluorescence screening assay was applied to the analysis of beef muscle for danofloxacin at the U.S. tolerance level of 200 ng/g. Muscle samples were homogenized in acetic acid-acetonitrile, the resultant mixture centrifuged, and fluorescence of the supernatants was then measured. The significant difference between the fluorescence of control muscle sample extracts and extracts of samples fortified at 200 ng/g allowed for successful discrimination between the samples. Setting a threshold level at the average 200 ng/g fortified sample extract fluorescence -3sigma allowed for identification of potentially violative samples. Successful analysis of a group of blind fortified samples over a range of concentrations was accomplished in this manner, without any false-negative results. The limits of quantitation for danofloxacin, as well as enrofloxacin, using this assay were determined in three types of beef muscle (hanging tenderloin, neck, and eye round steak), as well as in serum. Significant differences in limits of quantitation were found among the three different muscle types examined, with hanging tenderloin muscle providing the lowest value. This work not only shows the potential for use of the fluorescence screening assay as an alternative to currently used microbial or antibody-based assays for the analysis of danofloxacin in beef muscle, but also suggests that assays using beef muscle may vary in performance depending on the specific muscle selected for analysis.

Influences on Dietary Choices during Day versus Night Shift in Shift Workers: A Mixed Methods Study

PubMed Central

Bonnell, Emily K.; Huggins, Catherine E.; Huggins, Chris T.; McCaffrey, Tracy A.; Palermo, Claire; Bonham, Maxine P.

2017-01-01

Shift work is associated with diet-related chronic conditions such as obesity and cardiovascular disease. This study aimed to explore factors influencing food choice and dietary intake in shift workers. A fixed mixed method study design was undertaken on a convenience sample of firefighters who continually work a rotating roster. Six focus groups (n = 41) were conducted to establish factors affecting dietary intake whilst at work. Dietary intake was assessed using repeated 24 h dietary recalls (n = 19). Interviews were audio recorded, transcribed verbatim, and interpreted using thematic analysis. Dietary data were entered into FoodWorks and analysed using Wilcoxon signed-rank test; p < 0.05 was considered significant. Thematic analysis highlighted four key themes influencing dietary intake: shift schedule; attitudes and decisions of co-workers; time and accessibility; and knowledge of the relationship between food and health. Participants reported consuming more discretionary foods and limited availability of healthy food choices on night shift. Energy intakes (kJ/day) did not differ between days that included a day or night shift but greater energy density (EDenergy, kJ/g/day) of the diet was observed on night shift compared with day shift. This study has identified a number of dietary-specific shift-related factors that may contribute to an increase in unhealthy behaviours in a shift-working population. Given the increased risk of developing chronic diseases, organisational change to support workers in this environment is warranted. PMID:28245625

Influences on Dietary Choices during Day versus Night Shift in Shift Workers: A Mixed Methods Study.

PubMed

Bonnell, Emily K; Huggins, Catherine E; Huggins, Chris T; McCaffrey, Tracy A; Palermo, Claire; Bonham, Maxine P

2017-02-26

Shift work is associated with diet-related chronic conditions such as obesity and cardiovascular disease. This study aimed to explore factors influencing food choice and dietary intake in shift workers. A fixed mixed method study design was undertaken on a convenience sample of firefighters who continually work a rotating roster. Six focus groups ( n = 41) were conducted to establish factors affecting dietary intake whilst at work. Dietary intake was assessed using repeated 24 h dietary recalls ( n = 19). Interviews were audio recorded, transcribed verbatim, and interpreted using thematic analysis. Dietary data were entered into FoodWorks and analysed using Wilcoxon signed-rank test; p < 0.05 was considered significant. Thematic analysis highlighted four key themes influencing dietary intake: shift schedule; attitudes and decisions of co-workers; time and accessibility; and knowledge of the relationship between food and health. Participants reported consuming more discretionary foods and limited availability of healthy food choices on night shift. Energy intakes (kJ/day) did not differ between days that included a day or night shift but greater energy density (ED energy , kJ/g/day) of the diet was observed on night shift compared with day shift. This study has identified a number of dietary-specific shift-related factors that may contribute to an increase in unhealthy behaviours in a shift-working population. Given the increased risk of developing chronic diseases, organisational change to support workers in this environment is warranted.

Fully Bayesian Analysis of High-throughput Targeted Metabolomics Assays

EPA Science Inventory

High-throughput metabolomic assays that allow simultaneous targeted screening of hundreds of metabolites have recently become available in kit form. Such assays provide a window into understanding changes to biochemical pathways due to chemical exposure or disease, and are usefu...

Radioreceptor assay for analysis of fentanyl and its analogs in biological samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alburges, M.E.

The assay is based on the competition of these drugs with ({sup 3}H) fentanyl for opioid receptors in membrane preparations of rat forebrain in vitro. The binding in stereospecific, reversible and saturable. Scatchard plots of saturation suggest the presence of high and low affinity binding sites. Morphine and hydromorphone complete with ({sup 3}H)fentanyl for the opioid receptor, but other morphine-like compounds were relatively weak displacers of ({sup 3}H)fentanyl. Many other commonly abused drugs do not compete with ({sup 3}H)fentanyl for the opioid receptors. Urine samples from animals injected with fentanyl, ({plus minus})-cis-3-methylfentanyl, alpha-methylfentanyl, butyrylfentanyl and benzylfentanyl were analyzed by radioreceptormore » assay, radioimmunoassay, and gas chromatography/mass spectrometry. Urinary analysis of fentanyl showed a good correlation with these three methods; however, discrepancies were observed in the analysis of fentanyl analogs. This radioreceptor assay is well-suited as an initial assay for the detection of active analogs of fentanyl in urine with good correlation with other techniques in the analysis of fentanyl; however, there is substantial disagreement between techniques in the quantitation of fentanyl analogs. The implications of these discrepancies are discussed.« less

Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.

PubMed

Xu, Xiaoli; Zhang, Song; Chen, Hui; Kong, Jilie

2009-11-15

Micro-total analysis systems (microTAS) integrate different analytical operations like sample preparation, separation and detection into a single microfabricated device. With the outstanding advantages of low cost, satisfactory analytical efficiency and flexibility in design, highly integrated and miniaturized devices from the concept of microTAS have gained widespread applications, especially in biochemical assays. Electrochemistry is shown to be quite compatible with microanalytical systems for biochemical assays, because of its attractive merits such as simplicity, rapidity, high sensitivity, reduced power consumption, and sample/reagent economy. This review presents recent developments in the integration of electrochemistry in microdevices for biochemical assays. Ingenious microelectrode design and fabrication methods, and versatility of electrochemical techniques are involved. Practical applications of such integrated microsystem in biochemical assays are focused on in situ analysis, point-of-care testing and portable devices. Electrochemical techniques are apparently suited to microsystems, since easy microfabrication of electrochemical elements and a high degree of integration with multi-analytical functions can be achieved at low cost. Such integrated microsystems will play an increasingly important role for analysis of small volume biochemical samples. Work is in progress toward new microdevice design and applications.

Comparison of a High-Resolution Melting Assay to Next-Generation Sequencing for Analysis of HIV Diversity

PubMed Central

Cousins, Matthew M.; Ou, San-San; Wawer, Maria J.; Munshaw, Supriya; Swan, David; Magaret, Craig A.; Mullis, Caroline E.; Serwadda, David; Porcella, Stephen F.; Gray, Ronald H.; Quinn, Thomas C.; Donnell, Deborah; Eshleman, Susan H.

2012-01-01

Next-generation sequencing (NGS) has recently been used for analysis of HIV diversity, but this method is labor-intensive, costly, and requires complex protocols for data analysis. We compared diversity measures obtained using NGS data to those obtained using a diversity assay based on high-resolution melting (HRM) of DNA duplexes. The HRM diversity assay provides a single numeric score that reflects the level of diversity in the region analyzed. HIV gag and env from individuals in Rakai, Uganda, were analyzed in a previous study using NGS (n = 220 samples from 110 individuals). Three sequence-based diversity measures were calculated from the NGS sequence data (percent diversity, percent complexity, and Shannon entropy). The amplicon pools used for NGS were analyzed with the HRM diversity assay. HRM scores were significantly associated with sequence-based measures of HIV diversity for both gag and env (P < 0.001 for all measures). The level of diversity measured by the HRM diversity assay and NGS increased over time in both regions analyzed (P < 0.001 for all measures except for percent complexity in gag), and similar amounts of diversification were observed with both methods (P < 0.001 for all measures except for percent complexity in gag). Diversity measures obtained using the HRM diversity assay were significantly associated with those from NGS, and similar increases in diversity over time were detected by both methods. The HRM diversity assay is faster and less expensive than NGS, facilitating rapid analysis of large studies of HIV diversity and evolution. PMID:22785188

Analysis of Gold Ores by Fire Assay

ERIC Educational Resources Information Center

Blyth, Kristy M.; Phillips, David N.; van Bronswijk, Wilhelm

2004-01-01

Students of an Applied Chemistry degree course carried out a fire-assay exercise. The analysis showed that the technique was a worthwhile quantitative analytical technique and covered interesting theory including acid-base and redox chemistry and other concepts such as inquarting and cupelling.

A Limitation of the Applicability of Interval Shift Analysis to Program Evaluation

ERIC Educational Resources Information Center

Hardy, Roy

1975-01-01

Interval Shift Analysis (ISA) is an adaptation of the linear programming model used to determine maximum benefits or minimal losses in quantifiable economics problems. ISA is applied to pre and posttest score distributions for 43 classes of second graders. (RC)

Real-time polymerase chain reaction detection of parvovirus B19 DNA in blood donations using a commercial and an in-house assay.

PubMed

Koppelman, M H G M; van Swieten, P; Cuijpers, H T M

2011-06-01

European regulations require testing of manufacturing plasma for parvovirus B19 (B19) DNA to limit the load of this virus to a maximum acceptable level of 10 IU/µL. To meet this requirement, most manufacturers introduced a test algorithm to identify and eliminate high-load donations before making large manufacturing pools of plasma units. Sanquin screens all donations using a commercial assay from Roche and an in-house assay. Between 2006 and 2009, 6.2 million donations were screened using two different polymerase chain reaction (PCR) assays targeting B19 DNA. Donations with B19 DNA loads of greater than 1 × 10(6) IU/mL showing significant differences in viral load between the two assays were further analyzed by sequencing analysis. A total of 396 donations with B19 DNA loads of greater than 1 × 10(6) IU/mL were identified. Fifteen samples (3.8%) had discordant test results; 10 samples (2.5%) were underquantified by the Roche assay, two samples (0.5%) were underquantified by the in-house assay, and three samples (0.8%) were not detected by the Roche assay. Sequencing analysis revealed mismatches in primer and probe-binding regions. Phylogenetic analysis showed that 12 samples were B19 Genotype 1. The three samples not detected by the Roche assay were B19 Genotype 2. This study shows that 3.8% of the viremic B19 DNA-positive donations are not quantified correctly by the Roche or in-house B19 DNA assays. B19 Genotype 1 isolates showing incorrect test results are more common than B19 Genotype 2 or 3 isolates. Newly designed B19 PCR assays for blood screening should preferably have multiplexed formats targeting multiple regions of the B19 genome. © 2010 American Association of Blood Banks.

Detection of methicillin-resistant Staphylococcus aureus by a duplex droplet digital PCR assay.

PubMed

Kelley, Kashonda; Cosman, Angela; Belgrader, Phillip; Chapman, Brenda; Sullivan, Donna C

2013-07-01

Health care-associated infections with methicillin-resistant Staphylococcus aureus (MRSA) contribute to significant hospitalization costs. We report here a droplet digital PCR (ddPCR) assay, which is a next-generation emulsion-based endpoint PCR assay for high-precision MRSA analysis. Reference cultures of MRSA, methicillin-susceptible S. aureus (MSSA), and confounders were included as controls. Copan swabs were used to sample cultures and collect specimens for analysis from patients at a large teaching hospital. Swab extraction and cell lysis were accomplished using magnetic-driven agitation of silica beads. Quantitative PCR (qPCR) (Roche Light Cycler 480) and ddPCR (Bio-Rad QX100 droplet digital PCR system) assays were used to detect genes for the staphylococcal protein SA0140 (SA) and the methicillin resistance (mecA) gene employing standard TaqMan chemistries. Both qPCR and ddPCR assays correctly identified culture controls for MRSA (76), MSSA (12), and confounder organisms (36) with 100% sensitivity and specificity. Analysis of the clinical samples (211 negative and 186 positive) collected during a study of MRSA nasal carriage allowed direct comparison of the qPCR and ddPCR assays to the Cepheid MRSA GeneXpert assay. A total of 397 clinical samples were examined in this study. Cepheid MRSA GeneXpert values were used to define negative and positive samples. Both the qPCR and ddPCR assays were in good agreement with the reference assay. The sensitivities for the qPCR and ddPCR assays were 96.8% (95% confidence interval [CI], 93.1 to 98.5%) and 96.8% (95% CI, 93.1 to 98.5%), respectively. Both the qPCR and ddPCR assays had specificities of 91.9% (95% CI, 87.5 to 94.9%) for qPCR and 91.0% (95% CI, 86.4 to 94.2%) for ddPCR technology.

Performance of the new automated Abbott RealTime MTB assay for rapid detection of Mycobacterium tuberculosis complex in respiratory specimens.

PubMed

Chen, J H K; She, K K K; Kwong, T-C; Wong, O-Y; Siu, G K H; Leung, C-C; Chang, K-C; Tam, C-M; Ho, P-L; Cheng, V C C; Yuen, K-Y; Yam, W-C

2015-09-01

The automated high-throughput Abbott RealTime MTB real-time PCR assay has been recently launched for Mycobacterium tuberculosis complex (MTBC) clinical diagnosis. This study would like to evaluate its performance. We first compared its diagnostic performance with the Roche Cobas TaqMan MTB assay on 214 clinical respiratory specimens. Prospective analysis of a total 520 specimens was then performed to further evaluate the Abbott assay. The Abbott assay showed a lower limit of detection at 22.5 AFB/ml, which was more sensitive than the Cobas assay (167.5 AFB/ml). The two assays demonstrated a significant difference in diagnostic performance (McNemar's test; P = 0.0034), in which the Abbott assay presented significantly higher area under curve (AUC) than the Cobas assay (1.000 vs 0.880; P = 0.0002). The Abbott assay demonstrated extremely low PCR inhibition on clinical respiratory specimens. The automated Abbott assay required only very short manual handling time (0.5 h), which could help to improve the laboratory management. In the prospective analysis, the overall estimates for sensitivity and specificity of the Abbott assay were both 100 % among smear-positive specimens, whereas the smear-negative specimens were 96.7 and 96.1 %, respectively. No cross-reactivity with non-tuberculosis mycobacterial species was observed. The superiority in sensitivity of the Abbott assay for detecting MTBC in smear-negative specimens could further minimize the risk in MTBC false-negative detection. The new Abbott RealTime MTB assay has good diagnostic performance which can be a useful diagnostic tool for rapid MTBC detection in clinical laboratories.

Quantum-mechanics-derived 13Cα chemical shift server (CheShift) for protein structure validation

PubMed Central

Vila, Jorge A.; Arnautova, Yelena A.; Martin, Osvaldo A.; Scheraga, Harold A.

2009-01-01

A server (CheShift) has been developed to predict 13Cα chemical shifts of protein structures. It is based on the generation of 696,916 conformations as a function of the φ, ψ, ω, χ1 and χ2 torsional angles for all 20 naturally occurring amino acids. Their 13Cα chemical shifts were computed at the DFT level of theory with a small basis set and extrapolated, with an empirically-determined linear regression formula, to reproduce the values obtained with a larger basis set. Analysis of the accuracy and sensitivity of the CheShift predictions, in terms of both the correlation coefficient R and the conformational-averaged rmsd between the observed and predicted 13Cα chemical shifts, was carried out for 3 sets of conformations: (i) 36 x-ray-derived protein structures solved at 2.3 Å or better resolution, for which sets of 13Cα chemical shifts were available; (ii) 15 pairs of x-ray and NMR-derived sets of protein conformations; and (iii) a set of decoys for 3 proteins showing an rmsd with respect to the x-ray structure from which they were derived of up to 3 Å. Comparative analysis carried out with 4 popular servers, namely SHIFTS, SHIFTX, SPARTA, and PROSHIFT, for these 3 sets of conformations demonstrated that CheShift is the most sensitive server with which to detect subtle differences between protein models and, hence, to validate protein structures determined by either x-ray or NMR methods, if the observed 13Cα chemical shifts are available. CheShift is available as a web server. PMID:19805131

Analysis of HIV using a high resolution melting (HRM) diversity assay: automation of HRM data analysis enhances the utility of the assay for analysis of HIV incidence.

PubMed

Cousins, Matthew M; Swan, David; Magaret, Craig A; Hoover, Donald R; Eshleman, Susan H

2012-01-01

HIV diversity may be a useful biomarker for discriminating between recent and non-recent HIV infection. The high resolution melting (HRM) diversity assay was developed to quantify HIV diversity in viral populations without sequencing. In this assay, HIV diversity is expressed as a single numeric HRM score that represents the width of a melting peak. HRM scores are highly associated with diversity measures obtained with next generation sequencing. In this report, a software package, the HRM Diversity Assay Analysis Tool (DivMelt), was developed to automate calculation of HRM scores from melting curve data. DivMelt uses computational algorithms to calculate HRM scores by identifying the start (T1) and end (T2) melting temperatures for a DNA sample and subtracting them (T2 - T1 =  HRM score). DivMelt contains many user-supplied analysis parameters to allow analyses to be tailored to different contexts. DivMelt analysis options were optimized to discriminate between recent and non-recent HIV infection and to maximize HRM score reproducibility. HRM scores calculated using DivMelt were compared to HRM scores obtained using a manual method that is based on visual inspection of DNA melting curves. HRM scores generated with DivMelt agreed with manually generated HRM scores obtained from the same DNA melting data. Optimal parameters for discriminating between recent and non-recent HIV infection were identified. DivMelt provided greater discrimination between recent and non-recent HIV infection than the manual method. DivMelt provides a rapid, accurate method of determining HRM scores from melting curve data, facilitating use of the HRM diversity assay for large-scale studies.

Analysis of HIV Using a High Resolution Melting (HRM) Diversity Assay: Automation of HRM Data Analysis Enhances the Utility of the Assay for Analysis of HIV Incidence

PubMed Central

Cousins, Matthew M.; Swan, David; Magaret, Craig A.; Hoover, Donald R.; Eshleman, Susan H.

2012-01-01

Background HIV diversity may be a useful biomarker for discriminating between recent and non-recent HIV infection. The high resolution melting (HRM) diversity assay was developed to quantify HIV diversity in viral populations without sequencing. In this assay, HIV diversity is expressed as a single numeric HRM score that represents the width of a melting peak. HRM scores are highly associated with diversity measures obtained with next generation sequencing. In this report, a software package, the HRM Diversity Assay Analysis Tool (DivMelt), was developed to automate calculation of HRM scores from melting curve data. Methods DivMelt uses computational algorithms to calculate HRM scores by identifying the start (T1) and end (T2) melting temperatures for a DNA sample and subtracting them (T2–T1 = HRM score). DivMelt contains many user-supplied analysis parameters to allow analyses to be tailored to different contexts. DivMelt analysis options were optimized to discriminate between recent and non-recent HIV infection and to maximize HRM score reproducibility. HRM scores calculated using DivMelt were compared to HRM scores obtained using a manual method that is based on visual inspection of DNA melting curves. Results HRM scores generated with DivMelt agreed with manually generated HRM scores obtained from the same DNA melting data. Optimal parameters for discriminating between recent and non-recent HIV infection were identified. DivMelt provided greater discrimination between recent and non-recent HIV infection than the manual method. Conclusion DivMelt provides a rapid, accurate method of determining HRM scores from melting curve data, facilitating use of the HRM diversity assay for large-scale studies. PMID:23240016

Preparation and characterization of solid dispersion freeze-dried efavirenz - polyvinylpyrrolidone K-30.

PubMed

Fitriani, Lili; Haqi, Alianshar; Zaini, Erizal

2016-01-01

The aim of this research is to prepare and characterize solid dispersion of efavirenz - polyvinylpyrrolidone (PVP) K-30 by freeze drying to increase its solubility. Solid dispersion of efavirenz - PVP K-30 was prepared by solvent evaporation method with ratio 2:1, 1:1, and 1:2 and dried using a freeze dryer. Characterizations were done by scanning electron microscopy (SEM), powder X-ray diffraction analysis, differential thermal analysis (DTA), and Fourier transform infrared (FT-IR) spectroscopy. Solubility test was carried out in CO2-free distilled water, and efavirenz assay was conducted using high-performance liquid chromatography with acetonitrile:acetic acid (80:20) as the mobile phases. Powder X-ray diffractogram showed a decrease in the peak intensity, which indicated the crystalline altered to amorphous phase. DTA thermal analysis showed a decrease in the melting point of the solid dispersion compared to intact efavirenz. SEM results indicated the changes in the morphology of the crystal into an amorphous form compared to pure components. FT-IR spectroscopy analysis showed a shift wavenumber of the spectrum efavirenz and PVP K-30. The solubility of solid dispersion at ratio 2:1, 1:1, and 1:2 was 6.777 μg/mL, 6.936 μg/mL, and 14,672 μg/mL, respectively, whereas the solubility of intact efavirenz was 0.250 μg/mL. In conclusion, the solubility of solid dispersion increased significantly (P < 0.05).