Sample records for shift position sequence

  1. Real time simulation of computer-assisted sequencing of terminal area operations

    NASA Technical Reports Server (NTRS)

    Dear, R. G.

    1981-01-01

    A simulation was developed to investigate the utilization of computer assisted decision making for the task of sequencing and scheduling aircraft in a high density terminal area. The simulation incorporates a decision methodology termed Constrained Position Shifting. This methodology accounts for aircraft velocity profiles, routes, and weight classes in dynamically sequencing and scheduling arriving aircraft. A sample demonstration of Constrained Position Shifting is presented where six aircraft types (including both light and heavy aircraft) are sequenced to land at Denver's Stapleton International Airport. A graphical display is utilized and Constrained Position Shifting with a maximum shift of four positions (rearward or forward) is compared to first come, first serve with respect to arrival at the runway. The implementation of computer assisted sequencing and scheduling methodologies is investigated. A time based control concept will be required and design considerations for such a system are discussed.

  2. Contingent negative variation (CNV) associated with sensorimotor timing error correction.

    PubMed

    Jang, Joonyong; Jones, Myles; Milne, Elizabeth; Wilson, Daniel; Lee, Kwang-Hyuk

    2016-02-15

    Detection and subsequent correction of sensorimotor timing errors are fundamental to adaptive behavior. Using scalp-recorded event-related potentials (ERPs), we sought to find ERP components that are predictive of error correction performance during rhythmic movements. Healthy right-handed participants were asked to synchronize their finger taps to a regular tone sequence (every 600 ms), while EEG data were continuously recorded. Data from 15 participants were analyzed. Occasional irregularities were built into stimulus presentation timing: 90 ms before (advances: negative shift) or after (delays: positive shift) the expected time point. A tapping condition alternated with a listening condition in which identical stimulus sequence was presented but participants did not tap. Behavioral error correction was observed immediately following a shift, with a degree of over-correction with positive shifts. Our stimulus-locked ERP data analysis revealed, 1) increased auditory N1 amplitude for the positive shift condition and decreased auditory N1 modulation for the negative shift condition; and 2) a second enhanced negativity (N2) in the tapping positive condition, compared with the tapping negative condition. In response-locked epochs, we observed a CNV (contingent negative variation)-like negativity with earlier latency in the tapping negative condition compared with the tapping positive condition. This CNV-like negativity peaked at around the onset of subsequent tapping, with the earlier the peak, the better the error correction performance with the negative shifts while the later the peak, the better the error correction performance with the positive shifts. This study showed that the CNV-like negativity was associated with the error correction performance during our sensorimotor synchronization study. Auditory N1 and N2 were differentially involved in negative vs. positive error correction. However, we did not find evidence for their involvement in behavioral error correction. Overall, our study provides the basis from which further research on the role of the CNV in perceptual and motor timing can be developed. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. 49 CFR 571.102 - Standard No. 102; Transmission shift position sequence, starter interlock, and transmission...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... hour). S2. Application. This standard applies to passenger cars, multi-purpose passenger vehicles... positions on passenger cars. A neutral position shall be located between forward drive and reverse drive... ratio, one forward drive position shall provide a greater degree of engine braking than the highest...

  4. 49 CFR 571.102 - Standard No. 102; Transmission shift position sequence, starter interlock, and transmission...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... hour). S2. Application. This standard applies to passenger cars, multi-purpose passenger vehicles... positions on passenger cars. A neutral position shall be located between forward drive and reverse drive... ratio, one forward drive position shall provide a greater degree of engine braking than the highest...

  5. 49 CFR 571.102 - Standard No. 102; Transmission shift position sequence, starter interlock, and transmission...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... hour). S2. Application. This standard applies to passenger cars, multi-purpose passenger vehicles... positions on passenger cars. A neutral position shall be located between forward drive and reverse drive... ratio, one forward drive position shall provide a greater degree of engine braking than the highest...

  6. 49 CFR 571.102 - Standard No. 102; Transmission shift position sequence, starter interlock, and transmission...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... hour). S2. Application. This standard applies to passenger cars, multi-purpose passenger vehicles... positions on passenger cars. A neutral position shall be located between forward drive and reverse drive... ratio, one forward drive position shall provide a greater degree of engine braking than the highest...

  7. Scheduling Aircraft Landings under Constrained Position Shifting

    NASA Technical Reports Server (NTRS)

    Balakrishnan, Hamsa; Chandran, Bala

    2006-01-01

    Optimal scheduling of airport runway operations can play an important role in improving the safety and efficiency of the National Airspace System (NAS). Methods that compute the optimal landing sequence and landing times of aircraft must accommodate practical issues that affect the implementation of the schedule. One such practical consideration, known as Constrained Position Shifting (CPS), is the restriction that each aircraft must land within a pre-specified number of positions of its place in the First-Come-First-Served (FCFS) sequence. We consider the problem of scheduling landings of aircraft in a CPS environment in order to maximize runway throughput (minimize the completion time of the landing sequence), subject to operational constraints such as FAA-specified minimum inter-arrival spacing restrictions, precedence relationships among aircraft that arise either from airline preferences or air traffic control procedures that prevent overtaking, and time windows (representing possible control actions) during which each aircraft landing can occur. We present a Dynamic Programming-based approach that scales linearly in the number of aircraft, and describe our computational experience with a prototype implementation on realistic data for Denver International Airport.

  8. Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage.

    PubMed

    Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

    2017-11-01

    The DNA lesions, resulting from oxidative damage, were shown to destabilize human telomere four-repeat quadruplex and to alter its structure. Long telomere DNA, as a repetitive sequence, offers, however, other mechanisms of dealing with the lesion: extrusion of the damaged repeat into loop or shifting the quadruplex position by one repeat. Using circular dichroism and UV absorption spectroscopy and polyacrylamide electrophoresis, we studied consequences of lesions at different positions of the model five-repeat human telomere DNA sequences on the structure and stability of their quadruplexes in sodium and in potassium. The repeats affected by lesion are preferentially positioned as terminal overhangs of the core quadruplex structurally similar to the four-repeat one. Forced affecting of the inner repeats leads to presence of variety of more parallel folds in potassium. In sodium the designed models form mixture of two dominant antiparallel quadruplexes whose population varies with the position of the affected repeat. The shapes of quadruplex CD spectra, namely the height of dominant peaks, significantly correlate with melting temperatures. Lesion in one guanine tract of a more than four repeats long human telomere DNA sequence may cause re-positioning of its quadruplex arrangement associated with a shift of the structure to less common quadruplex conformations. The type of the quadruplex depends on the loop position and external conditions. The telomere DNA quadruplexes are quite resistant to the effect of point mutations due to the telomere DNA repetitive nature, although their structure and, consequently, function might be altered. Copyright © 2017. Published by Elsevier B.V.

  9. Drawing the line between constituent structure and coherence relations in visual narratives

    PubMed Central

    Cohn, Neil; Bender, Patrick

    2016-01-01

    Theories of visual narrative understanding have often focused on the changes in meaning across a sequence, like shifts in characters, spatial location, and causation, as cues for breaks in the structure of a discourse. In contrast, the theory of Visual Narrative Grammar posits that hierarchic “grammatical” structures operate at the discourse level using categorical roles for images, which may or may not co-occur with shifts in coherence. We therefore examined the relationship between narrative structure and coherence shifts in the segmentation of visual narrative sequences using a “segmentation task” where participants drew lines between images in order to divide them into sub-episodes. We used regressions to analyze the influence of the expected constituent structure boundary, narrative categories, and semantic coherence relationships on the segmentation of visual narrative sequences. Narrative categories were a stronger predictor of segmentation than linear coherence relationships between panels, though both influenced participants’ divisions. Altogether, these results support the theory that meaningful sequential images use a narrative grammar that extends above and beyond linear semantic shifts between discourse units. PMID:27709982

  10. Drawing the line between constituent structure and coherence relations in visual narratives.

    PubMed

    Cohn, Neil; Bender, Patrick

    2017-02-01

    Theories of visual narrative understanding have often focused on the changes in meaning across a sequence, like shifts in characters, spatial location, and causation, as cues for breaks in the structure of a discourse. In contrast, the theory of visual narrative grammar posits that hierarchic "grammatical" structures operate at the discourse level using categorical roles for images, which may or may not co-occur with shifts in coherence. We therefore examined the relationship between narrative structure and coherence shifts in the segmentation of visual narrative sequences using a "segmentation task" where participants drew lines between images in order to divide them into subepisodes. We used regressions to analyze the influence of the expected constituent structure boundary, narrative categories, and semantic coherence relationships on the segmentation of visual narrative sequences. Narrative categories were a stronger predictor of segmentation than linear coherence relationships between panels, though both influenced participants' divisions. Altogether, these results support the theory that meaningful sequential images use a narrative grammar that extends above and beyond linear semantic shifts between discourse units. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  11. Impact of longer-term modest climate shifts on architecture of high-frequency sequences (Cyclothems), Pennsylvanian of midcontinent U.S.A

    USGS Publications Warehouse

    Feldman, H.R.; Franseen, E.K.; Joeckel, R.M.; Heckel, P.H.

    2005-01-01

    Pennsylvanian glacioeustatic cyclothems exposed in Kansas and adjacent areas provide a unique opportunity to test models of the impact of relative sea level and climate on stratal architecture. A succession of eight of these high-frequency sequences, traced along dip for 500 km, reveal that modest climate shifts from relatively dry-seasonal to relatively wet-seasonal with a duration of several sequences (???600,000 to 1 million years) had a dominant impact on facies, sediment dispersal patterns, and sequence architecture. The climate shifts documented herein are intermediate, both in magnitude and duration, between previously documented longer-term climate shifts throughout much of the Pennsylvanian and shorter-term shifts described within individual sequences. Climate indicators are best preserved at sequence boundaries and in incised-valley fills of the lowstand systems tracts (LST). Relatively drier climate indicators include high-chroma paleosols, typically with pedogenic carbonates, and plant assemblages that are dominated by gymnosperms, mostly xerophytic walchian conifers. The associated valleys are small (4 km wide and >20 m deep), and dominated by quartz sandstones derived from distant source areas, reflecting large drainage networks. Transgressive systems tracts (TST) in all eight sequences gen erally are characterized by thin, extensive limestones and thin marine shales, suggesting that the dominant control on TST facies distribution was the sequestration of siliciclastic sediment in updip positions. Highstand systems tracts (HST) were significantly impacted by the intermediate-scale climate cycle in that HSTs from relatively drier climates consist of thin marine shales overlain by extensive, thick regressive limestones, whereas HSTs from relatively wetter climates are dominated by thick marine shales. Previously documented relative sea-level changes do not track the climate cycles, indicating that climate played a role distinct from that of relative sea-level change. These intermediate-scale modest climate shifts had a dominant impact on sequence architecture. This independent measure of climate and relative sea level may allow the testing of models of climate and sediment supply based on modern systems. Copyright ?? 2005, SEPM.

  12. 49 CFR 571.102 - Standard No. 102; Transmission shift position sequence, starter interlock, and transmission...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... position. S3.1.2Transmission braking effect. In vehicles having more than one forward transmission gear... driver has activated the vehicle's propulsion system: (a) The engine may stop and restart automatically... activated the vehicle's propulsion system if the vehicle can meet the requirements specified in paragraphs...

  13. CLASS Shifts in Modeling Instruction

    NASA Astrophysics Data System (ADS)

    Brewe, Eric; Kramer, Laird; O'Brien, George

    2008-10-01

    Among the most surprising findings in Physics Education Research is the lack of positive results on attitudinal measures, such as Colorado Learning Attitudes about Science Survey (CLASS) and Maryland Physics Expectations Survey (MPEX). The uniformity with which physics teaching manages to negatively shift attitudes toward physics learning is striking. Strategies which have been shown to improve learning, such as interactive engagement and studio format classes, provide more authentic science experiences for students, yet do not produce positive attitudinal results. Florida International University's Physics Education Research Group has implemented Modeling Instruction in University Physics classes. Using the CLASS as a pre/post measure has shown attitudinal improvements through both semesters of the introductory physics sequence. In this paper, we report positive shifts on the CLASS in two sections of Modeling Physics, one in Mechanics (N=30) and one in Electricity and Magnetism, (N=31) and examine how these results reflect on Modeling Instruction.

  14. Change from an 8-hour shift to a 12-hour shift, attitudes, sleep, sleepiness and performance.

    PubMed

    Lowden, A; Kecklund, G; Axelsson, J; Akerstedt, T

    1998-01-01

    The present study sought to evaluate the effect of a change from a rotating 3-shift (8-hour) to a 2-shift shift (12 hour) schedule on sleep, sleepiness, performance, perceived health, and well-being. Thirty-two shift workers at a chemical plant (control room operators) responded to a questionnaire a few months before a change was made in their shift schedule and 10 months after the change. Fourteen workers also filled out a diary, carried activity loggers, and carried out reaction-time tests (beginning and end of shift). Fourteen day workers served as a reference group for the questionnaires and 9 were intensively studied during a week with workdays and a free weekend. The questionnaire data showed that the shift change increased satisfaction with workhours, sleep, and time for social activities. Health, perceived accident risk, and reaction-time performance were not negatively affected. Alertness improved and subjective recovery time after night work decreased. The quick changes in the 8-hour schedule greatly increased sleep problems and fatigue. Sleepiness integrated across the entire shift cycle showed that the shift workers were less alert than the day workers, across workdays and days off (although alertness increased with the 12-hour shift). The change from 8-hour to 12-hour shifts was positive in most respects, possibly due to the shorter sequences of the workdays, the longer sequences of consecutive days off, the fewer types of shifts (easier planning), and the elimination of quick changes. The results may differ in groups with a higher work load.

  15. Revising the link between microsaccades and the spatial cueing of voluntary attention.

    PubMed

    Meyberg, Susann; Sinn, Petra; Engbert, Ralf; Sommer, Werner

    2017-04-01

    Microsaccades - i.e., small fixational saccades generated in the superior colliculus (SC) - have been linked to spatial attention. While maintaining fixation, voluntary shifts of covert attention toward peripheral targets result in a sequence of attention-aligned and attention-opposing microsaccades. In most previous studies the direction of the voluntary shift is signaled by a spatial cue (e.g., a leftwards pointing arrow) that presents the most informative part of the cue (e.g., the arrowhead) in the to-be attended visual field. Here we directly investigated the influence of cue position and tested the hypothesis that microsaccades align with cue position rather than with the attention shift. In a spatial cueing task, we presented the task-relevant part of a symmetric cue either in the to-be attended visual field or in the opposite field. As a result, microsaccades were still weakly related to the covert attention shift; however, they were strongly related to the position of the cue even if that required a movement opposite to the cued attention shift. Moreover, if microsaccades aligned with cue position, we observed stronger cueing effects on manual response times. Our interpretation of the data is supported by numerical simulations of a computational model of microsaccade generation that is based on SC properties, where we explain our findings by separate attentional mechanisms for cue localization and the cued attention shift. We conclude that during cueing of voluntary attention, microsaccades are related to both - the overt attentional selection of the task-relevant part of the cue stimulus and the subsequent covert attention shift. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

    PubMed

    Wilcox, Jennifer L; Bevilacqua, Philip C

    2013-10-22

    Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

  17. Host shifts and molecular evolution of H7 avian influenza virus hemagglutinin

    PubMed Central

    2011-01-01

    Evolutionary consequences of host shifts represent a challenge to identify the mechanisms involved in the emergence of influenza A (IA) viruses. In this study we focused on the evolutionary history of H7 IA virus in wild and domestic birds, with a particular emphasis on host shifts consequences on the molecular evolution of the hemagglutinin (HA) gene. Based on a dataset of 414 HA nucleotide sequences, we performed an extensive phylogeographic analysis in order to identify the overall genetic structure of H7 IA viruses. We then identified host shift events and investigated viral population dynamics in wild and domestic birds, independently. Finally, we estimated changes in nucleotide substitution rates and tested for positive selection in the HA gene. A strong association between the geographic origin and the genetic structure was observed, with four main clades including viruses isolated in North America, South America, Australia and Eurasia-Africa. We identified ten potential events of virus introduction from wild to domestic birds, but little evidence for spillover of viruses from poultry to wild waterbirds. Several sites involved in host specificity (addition of a glycosylation site in the receptor binding domain) and virulence (insertion of amino acids in the cleavage site) were found to be positively selected in HA nucleotide sequences, in genetically unrelated lineages, suggesting parallel evolution for the HA gene of IA viruses in domestic birds. These results highlight that evolutionary consequences of bird host shifts would need to be further studied to understand the ecological and molecular mechanisms involved in the emergence of domestic bird-adapted viruses. PMID:21711553

  18. Increased fMRI Sensitivity at Equal Data Burden Using Averaged Shifted Echo Acquisition

    PubMed Central

    Witt, Suzanne T.; Warntjes, Marcel; Engström, Maria

    2016-01-01

    There is growing evidence as to the benefits of collecting BOLD fMRI data with increased sampling rates. However, many of the newly developed acquisition techniques developed to collect BOLD data with ultra-short TRs require hardware, software, and non-standard analytic pipelines that may not be accessible to all researchers. We propose to incorporate the method of shifted echo into a standard multi-slice, gradient echo EPI sequence to achieve a higher sampling rate with a TR of <1 s with acceptable spatial resolution. We further propose to incorporate temporal averaging of consecutively acquired EPI volumes to both ameliorate the reduced temporal signal-to-noise inherent in ultra-fast EPI sequences and reduce the data burden. BOLD data were collected from 11 healthy subjects performing a simple, event-related visual-motor task with four different EPI sequences: (1) reference EPI sequence with TR = 1440 ms, (2) shifted echo EPI sequence with TR = 700 ms, (3) shifted echo EPI sequence with every two consecutively acquired EPI volumes averaged and effective TR = 1400 ms, and (4) shifted echo EPI sequence with every four consecutively acquired EPI volumes averaged and effective TR = 2800 ms. Both the temporally averaged sequences exhibited increased temporal signal-to-noise over the shifted echo EPI sequence. The shifted echo sequence with every two EPI volumes averaged also had significantly increased BOLD signal change compared with the other three sequences, while the shifted echo sequence with every four EPI volumes averaged had significantly decreased BOLD signal change compared with the other three sequences. The results indicated that incorporating the method of shifted echo into a standard multi-slice EPI sequence is a viable method for achieving increased sampling rate for collecting event-related BOLD data. Further, consecutively averaging every two consecutively acquired EPI volumes significantly increased the measured BOLD signal change and the subsequently calculated activation map statistics. PMID:27932947

  19. A Foxp2 Mutation Implicated in Human Speech Deficits Alters Sequencing of Ultrasonic Vocalizations in Adult Male Mice.

    PubMed

    Chabout, Jonathan; Sarkar, Abhra; Patel, Sheel R; Radden, Taylor; Dunson, David B; Fisher, Simon E; Jarvis, Erich D

    2016-01-01

    Development of proficient spoken language skills is disrupted by mutations of the FOXP2 transcription factor. A heterozygous missense mutation in the KE family causes speech apraxia, involving difficulty producing words with complex learned sequences of syllables. Manipulations in songbirds have helped to elucidate the role of this gene in vocal learning, but findings in non-human mammals have been limited or inconclusive. Here, we performed a systematic study of ultrasonic vocalizations (USVs) of adult male mice carrying the KE family mutation. Using novel statistical tools, we found that Foxp2 heterozygous mice did not have detectable changes in USV syllable acoustic structure, but produced shorter sequences and did not shift to more complex syntax in social contexts where wildtype animals did. Heterozygous mice also displayed a shift in the position of their rudimentary laryngeal motor cortex (LMC) layer-5 neurons. Our findings indicate that although mouse USVs are mostly innate, the underlying contributions of FoxP2 to sequencing of vocalizations are conserved with humans.

  20. A Foxp2 Mutation Implicated in Human Speech Deficits Alters Sequencing of Ultrasonic Vocalizations in Adult Male Mice

    PubMed Central

    Chabout, Jonathan; Sarkar, Abhra; Patel, Sheel R.; Radden, Taylor; Dunson, David B.; Fisher, Simon E.; Jarvis, Erich D.

    2016-01-01

    Development of proficient spoken language skills is disrupted by mutations of the FOXP2 transcription factor. A heterozygous missense mutation in the KE family causes speech apraxia, involving difficulty producing words with complex learned sequences of syllables. Manipulations in songbirds have helped to elucidate the role of this gene in vocal learning, but findings in non-human mammals have been limited or inconclusive. Here, we performed a systematic study of ultrasonic vocalizations (USVs) of adult male mice carrying the KE family mutation. Using novel statistical tools, we found that Foxp2 heterozygous mice did not have detectable changes in USV syllable acoustic structure, but produced shorter sequences and did not shift to more complex syntax in social contexts where wildtype animals did. Heterozygous mice also displayed a shift in the position of their rudimentary laryngeal motor cortex (LMC) layer-5 neurons. Our findings indicate that although mouse USVs are mostly innate, the underlying contributions of FoxP2 to sequencing of vocalizations are conserved with humans. PMID:27812326

  1. Concatenated shift registers generating maximally spaced phase shifts of PN-sequences

    NASA Technical Reports Server (NTRS)

    Hurd, W. J.; Welch, L. R.

    1977-01-01

    A large class of linearly concatenated shift registers is shown to generate approximately maximally spaced phase shifts of pn-sequences, for use in pseudorandom number generation. A constructive method is presented for finding members of this class, for almost all degrees for which primitive trinomials exist. The sequences which result are not normally characterized by trinomial recursions, which is desirable since trinomial sequences can have some undesirable randomness properties.

  2. Computer programming for nucleic acid studies. II. Total chemical shifts calculation of all protons of double-stranded helices.

    PubMed

    Giessner-Prettre, C; Ribas Prado, F; Pullman, B; Kan, L; Kast, J R; Ts'o, P O

    1981-01-01

    A FORTRAN computer program called SHIFTS is described. Through SHIFTS, one can calculate the NMR chemical shifts of the proton resonances of single and double-stranded nucleic acids of known sequences and of predetermined conformations. The program can handle RNA and DNA for an arbitrary sequence of a set of 4 out of the 6 base types A,U,G,C,I and T. Data files for the geometrical parameters are available for A-, A'-, B-, D- and S-conformations. The positions of all the atoms are calculated using a modified version of the SEQ program [1]. Then, based on this defined geometry three chemical shift effects exerted by the atoms of the neighboring nucleotides on the protons of each monomeric unit are calculated separately: the ring current shielding effect: the local atomic magnetic susceptibility effect (including both diamagnetic and paramagnetic terms); and the polarization or electric field effect. Results of the program are compared with experimental results for a gamma (ApApGpCpUpU) 2 helical duplex and with calculated results on this same helix based on model building of A'-form and B-form and on graphical procedure for evaluating the ring current effects.

  3. Anticipatory phase correction in sensorimotor synchronization.

    PubMed

    Repp, Bruno H; Moseley, Gordon P

    2012-10-01

    Studies of phase correction in sensorimotor synchronization often introduce timing perturbations that are unpredictable with regard to direction, magnitude, and position in the stimulus sequence. If participants knew any or all of these parameters in advance, would they be able to anticipate perturbations and thus regain synchrony more quickly? In Experiment 1, we asked musically trained participants to tap in synchrony with short isochronous tone sequences containing a phase shift (PS) of -100, -40, 40, or 100 ms and provided advance information about its direction, position, or both (but not about its magnitude). The first two conditions had little effect, but in the third condition participants shifted their tap in anticipation of the PS, though only by about ±40 ms on average. The phase correction response to the residual PS was also enhanced. In Experiment 2, we provided complete advance information about PSs of various magnitudes either at the time of the immediately preceding tone ("late") or at the time of the tone one position back ("early") while also varying sequence tempo. Anticipatory phase correction was generally conservative and was impeded by fast tempo in the "late" condition. At fast tempi in both conditions, advancing a tap was more difficult than delaying a tap. The results indicate that temporal constraints on anticipatory phase correction resemble those on reactive phase correction. While the latter is usually automatic, this study shows that phase correction can also be controlled consciously for anticipatory purposes. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Automatic online adaptive radiation therapy techniques for targets with significant shape change: a feasibility study.

    PubMed

    Court, Laurence E; Tishler, Roy B; Petit, Joshua; Cormack, Robert; Chin, Lee

    2006-05-21

    This work looks at the feasibility of an online adaptive radiation therapy concept that would detect the daily position and shape of the patient, and would then correct the daily treatment to account for any changes compared with planning position. In particular, it looks at the possibility of developing algorithms to correct for large complicated shape change. For co-planar beams, the dose in an axial plane is approximately associated with the positions of a single multi-leaf collimator (MLC) pair. We start with a primary plan, and automatically generate several secondary plans with gantry angles offset by regular increments. MLC sequences for each plan are calculated keeping monitor units (MUs) and number of segments constant for a given beam (fluences are different). Bulk registration (3D) of planning and daily CT images gives global shifts. Slice-by-slice (2D) registration gives local shifts and rotations about the longitudinal axis for each axial slice. The daily MLC sequence is then created for each axial slice/MLC leaf pair combination, by taking the MLC positions from the pre-calculated plan with the nearest rotation, and shifting using a beam's-eye-view calculation to account for local linear shifts. A planning study was carried out using two head and neck region MR images of a healthy volunteer which were contoured to simulate a base-of-tongue treatment: one with the head straight (used to simulate the planning image) and the other with the head tilted to the left (the daily image). Head and neck treatment was chosen to evaluate this technique because of its challenging nature, with varying internal and external contours, and multiple degrees of freedom. Shape change was significant: on a slice-by-slice basis, local rotations in the daily image varied from 2 to 31 degrees, and local shifts ranged from -0.2 to 0.5 cm and -0.4 to 0.0 cm in right-left and posterior-anterior directions, respectively. The adapted treatment gave reasonable target coverage (100%, 90% and 80% of the base-of-tongue, left nodes and right nodes, respectively, receiving the daily prescription dose), and kept the daily cord dose below the limit used in the original plan (65%, equivalent to 46 Gy over 35 fractions). Most of the loss of coverage was due to one shoulder being raised more superior relative to the other shoulder compared with the plan. This type of skew-like motion is not accounted for by the proposed ART technique. In conclusion, this technique has potential to correct for fairly extreme daily changes in patient setup, but some control of the daily position would still be necessary. Importantly, it was possible to combine treatments from different plans (MLC sequences) to correct for position and shape change.

  5. 78 FR 40546 - Nissan North America, Incorporated, Receipt of Petition for Decision of Inconsequential...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-05

    ..., buses or multipurpose passenger vehicles (MPVs) manufactured from December 20, 2010 to July 17, 2012, do not fully comply with paragraph S3.1.4.1 of Federal Motor Vehicle Safety Standard (FMVSS) No. 102, Transmission Shift Position Sequence, Starter Interlock, and Transmission Braking Effect. Nissan has filed an...

  6. Drawing the Line between Constituent Structure and Coherence Relations in Visual Narratives

    ERIC Educational Resources Information Center

    Cohn, Neil; Bender, Patrick

    2017-01-01

    Theories of visual narrative understanding have often focused on the changes in meaning across a sequence, like shifts in characters, spatial location, and causation, as cues for breaks in the structure of a discourse. In contrast, the theory of visual narrative grammar posits that hierarchic "grammatical" structures operate at the…

  7. Event Boundaries Trigger Rapid Memory Reinstatement of the Prior Events to Promote Their Representation in Long-Term Memory.

    PubMed

    Sols, Ignasi; DuBrow, Sarah; Davachi, Lila; Fuentemilla, Lluís

    2017-11-20

    Although everyday experiences unfold continuously over time, shifts in context, or event boundaries, can influence how those events come to be represented in memory [1-4]. Specifically, mnemonic binding across sequential representations is more challenging at context shifts, such that successful temporal associations are more likely to be formed within than across contexts [1, 2, 5-9]. However, in order to preserve a subjective sense of continuity, it is important that the memory system bridge temporally adjacent events, even if they occur in seemingly distinct contexts. Here, we used pattern similarity analysis to scalp electroencephalographic (EEG) recordings during a sequential learning task [2, 3] in humans and showed that the detection of event boundaries triggered a rapid memory reinstatement of the just-encoded sequence episode. Memory reactivation was detected rapidly (∼200-800 ms from the onset of the event boundary) and was specific to context shifts that were preceded by an event sequence with episodic content. Memory reinstatement was not observed during the sequential encoding of events within an episode, indicating that memory reactivation was induced specifically upon context shifts. Finally, the degree of neural similarity between neural responses elicited during sequence encoding and at event boundaries correlated positively with participants' ability to later link across sequences of events, suggesting a critical role in binding temporally adjacent events in long-term memory. Current results shed light onto the neural mechanisms that promote episodic encoding not only for information within the event, but also, importantly, in the ability to link across events to create a memory representation of continuous experience. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Electrical tweezer for highly parallelized electrorotation measurements over a wide frequency bandwidth.

    PubMed

    Rohani, Ali; Varhue, Walter; Su, Yi-Hsuan; Swami, Nathan S

    2014-07-01

    Electrorotation (ROT) is a powerful tool for characterizing the dielectric properties of cells and bioparticles. However, its application has been somewhat limited by the need to mitigate disruptions to particle rotation by translation under positive DEP and by frictional interactions with the substrate. While these disruptions may be overcome by implementing particle positioning schemes or field cages, these methods restrict the frequency bandwidth to the negative DEP range and permit only single particle measurements within a limited spatial extent of the device geometry away from field nonuniformities. Herein, we present an electrical tweezer methodology based on a sequence of electrical signals, composed of negative DEP using 180-degree phase-shifted fields for trapping and levitation of the particles, followed by 90-degree phase-shifted fields over a wide frequency bandwidth for highly parallelized electrorotation measurements. Through field simulations of the rotating electrical field under this wave-sequence, we illustrate the enhanced spatial extent for electrorotation measurements, with no limitations to frequency bandwidth. We apply this methodology to characterize subtle modifications in morphology and electrophysiology of Cryptosporidium parvum with varying degrees of heat treatment, in terms of shifts in the electrorotation spectra over the 0.05-40 MHz region. Given the single particle sensitivity and the ability for highly parallelized electrorotation measurements, we envision its application toward characterizing heterogeneous subpopulations of microbial and stem cells. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Promoter mapping of the mouse Tcp-10bt gene in transgenic mice identifies essential male germ cell regulatory sequences.

    PubMed

    Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C

    1996-03-01

    Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.

  10. The impact of shift patterns on junior doctors' perceptions of fatigue, training, work/life balance and the role of social support

    PubMed Central

    Brown, M; Rapport, F; Hutchings, H; Dahlgren, A; Davies, G; Ebden, P

    2010-01-01

    Background The organisation of junior doctors' work hours has been radically altered following the partial implementation of the European Working Time Directive. Poorly designed shift schedules cause excessive disruption to shift workers' circadian rhythms. Method Interviews and focus groups were used to explore perceptions among junior doctors and hospital managers regarding the impact of the European Working Time Directive on patient care and doctors' well-being. Results Four main themes were identified. Under “Doctors shift rotas”, doctors deliberated the merits and demerits of working seven nights in row. They also discussed the impact on fatigue of long sequences of day shifts. “Education and training” focused on concerns about reduced on-the-job learning opportunities under the new working time arrangements and also about the difficulties of finding time and energy to study. “Work/life balance” reflected the conflict between the positive aspects of working on-call or at night and the impact on life outside work. “Social support structures” focused on the role of morale and team spirit. Good support structures in the work place counteracted and compensated for the effects of negative role stressors, and arduous and unsocial work schedules. Conclusions The impact of junior doctors' work schedules is influenced by the nature of specific shift sequences, educational considerations, issues of work/life balance and by social support systems. Poorly designed shift rotas can have negative impacts on junior doctors' professional performance and educational training, with implications for clinical practice, patient care and the welfare of junior doctors. PMID:21127102

  11. The impact of shift patterns on junior doctors' perceptions of fatigue, training, work/life balance and the role of social support.

    PubMed

    Brown, M; Tucker, P; Rapport, F; Hutchings, H; Dahlgren, A; Davies, G; Ebden, P

    2010-12-01

    The organisation of junior doctors' work hours has been radically altered following the partial implementation of the European Working Time Directive. Poorly designed shift schedules cause excessive disruption to shift workers' circadian rhythms. Interviews and focus groups were used to explore perceptions among junior doctors and hospital managers regarding the impact of the European Working Time Directive on patient care and doctors' well-being. Four main themes were identified. Under "Doctors shift rotas", doctors deliberated the merits and demerits of working seven nights in row. They also discussed the impact on fatigue of long sequences of day shifts. "Education and training" focused on concerns about reduced on-the-job learning opportunities under the new working time arrangements and also about the difficulties of finding time and energy to study. "Work/life balance" reflected the conflict between the positive aspects of working on-call or at night and the impact on life outside work. "Social support structures" focused on the role of morale and team spirit. Good support structures in the work place counteracted and compensated for the effects of negative role stressors, and arduous and unsocial work schedules. The impact of junior doctors' work schedules is influenced by the nature of specific shift sequences, educational considerations, issues of work/life balance and by social support systems. Poorly designed shift rotas can have negative impacts on junior doctors' professional performance and educational training, with implications for clinical practice, patient care and the welfare of junior doctors.

  12. Method and apparatus for executing a shift in a hybrid transmission

    DOEpatents

    Gupta, Pinaki; Kaminsky, Lawrence A; Demirovic, Besim

    2013-09-03

    A method for executing a transmission shift in a hybrid transmission including first and second electric machines includes executing a shift-through-neutral sequence from an initial transmission state to a target transmission state including executing an intermediate shift to neutral. Upon detecting a change in an output torque request while executing the shift-through-neutral sequence, possible recovery shift paths are identified. Available ones of the possible recovery shift paths are identified and a shift cost for each said available recovery shift path is evaluated. The available recovery shift path having a minimum shift cost is selected as a preferred recovery shift path and is executed to achieve a non-neutral transmission state.

  13. Contacts between the factor TUF and RPG sequences.

    PubMed

    Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

    1990-08-25

    The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

  14. Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

    PubMed Central

    Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

    1988-01-01

    Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

  15. Feedback shift register sequences versus uniformly distributed random sequences for correlation chromatography

    NASA Technical Reports Server (NTRS)

    Kaljurand, M.; Valentin, J. R.; Shao, M.

    1996-01-01

    Two alternative input sequences are commonly employed in correlation chromatography (CC). They are sequences derived according to the algorithm of the feedback shift register (i.e., pseudo random binary sequences (PRBS)) and sequences derived by using the uniform random binary sequences (URBS). These two sequences are compared. By applying the "cleaning" data processing technique to the correlograms that result from these sequences, we show that when the PRBS is used the S/N of the correlogram is much higher than the one resulting from using URBS.

  16. 13C chemical-shift anisotropy of alkyl-substituted aromatic carbon in anthracene derivatives.

    PubMed

    Hoop, Cody L; Iuliucci, Robbie J

    2013-06-01

    The (13)C chemical-shift anisotropy in anthracene derivatives (9,10-dimethylanthracene, 9,10-dihydroanthracene, dianthracene, and triptycene) has been measured by the 2D FIREMAT timed pulse sequence and the corresponding set of principal values has been determined by the TIGER processing method. These molecules expand the data base of (13)C CSA measurements of fused aromatic rings some bridged by sp(3) carbon resulting in an unusual bonding configuration, which leads to distinctive aromatic (13)C CSA values. Crystal lattice distortions to the CSA were observed to change the isotropic shift by 2.5 to 3.3 ppm and changes as large as 8.3 ppm in principal components. Modeling of the CSA data by GIPAW DFT (GGA-PBE/ultrafine) shielding calculations resulted in an rms chemical-shift distance of 2.8 ppm after lattice including geometry optimization of the diffraction structures by the GIPAW method at GGA-PBE/ultrafine level. Attention is given to the substituted aromatic carbon in the phenyl groups (here forth referred to as the α-carbon) with respect to CSA modeling with electronic methods. The (13)C CSA of this position is accurately determined due to its spectral isolation of the isotropic shift that limits overlap in the FIREMAT spectrum. In cases where the bridging ring is sp(3) carbon, the current density is reduced from extending beyond the peripheral phenyl groups; this plays a significant role in the magnetic shielding of the α-position. Nuclear independent chemical-shift calculations based on GIAO DFT (B3LYP/6-31G(d)) shielding calculations were used to model the intramolecular π-interactions in dianthracene and triptycene. These NICS results estimate the isotropic shift of the α-position in dianthracene to be insignificantly affected by the presence of the neighboring aromatic rings. However, a notable change in isotropic shielding, Δσ(iso)=-2.1 ppm, is predicted for the α- position of triptycene. Experimentally, the δ22 principal component at the α-position for both dianthracene and triptycene increases by at least 12 ppm compared to 9,10-dihydroanthracene. To rationalize this change, shielding calculations in idealized structures are explored. The spatial position of the bicyclic scaffolding of the bridging ring plays a key role in the large increase in δ22 for the α-carbon. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. STELLAR ROTATION EFFECTS IN POLARIMETRIC MICROLENSING

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sajadian, Sedighe, E-mail: sajadian@ipm.ir

    2016-07-10

    It is well known that the polarization signal in microlensing events of hot stars is larger than that of main-sequence stars. Most hot stars rotate rapidly around their stellar axes. The stellar rotation creates ellipticity and gravity-darkening effects that break the spherical symmetry of the source's shape and the circular symmetry of the source's surface brightness respectively. Hence, it causes a net polarization signal for the source star. This polarization signal should be considered in polarimetric microlensing of fast rotating stars. For moderately rotating stars, lensing can magnify or even characterize small polarization signals due to the stellar rotation throughmore » polarimetric observations. The gravity-darkening effect due to a rotating source star creates asymmetric perturbations in polarimetric and photometric microlensing curves whose maximum occurs when the lens trajectory crosses the projected position of the rotation pole on the sky plane. The stellar ellipticity creates a time shift (i) in the position of the second peak of the polarimetric curves in transit microlensing events and (ii) in the peak position of the polarimetric curves with respect to the photometric peak position in bypass microlensing events. By measuring this time shift via polarimetric observations of microlensing events, we can evaluate the ellipticity of the projected source surface on the sky plane. Given the characterizations of the FOcal Reducer and low dispersion Spectrograph (FORS2) polarimeter at the Very Large Telescope, the probability of observing this time shift is very small. The more accurate polarimeters of the next generation may well measure these time shifts and evaluate the ellipticity of microlensing source stars.« less

  18. Mitochondrial DNA polymorphism in a maternal lineage of Holstein cows.

    PubMed Central

    Hauswirth, W W; Laipis, P J

    1982-01-01

    Two mitochondrial genotypes are shown to exist within one Holstein cow maternal lineage. They were detected by the appearance of an extra Hae III recognition site in one genotype. The nucleotide sequence of this region has been determined and the genotypes are distinguished by an adenine/guanine base transition which creates the new Hae III site. This point mutation occurs within an open reading frame at the third position of a glycine codon and therefore does not alter the amino acid sequence. The present pattern of genotypes within the lineage demands that multiple shifts between genotypes must have occurred within the past 20 years with the most rapid shift taking place in no more than 4 years and indicates that mitochondrial DNA polymorphism can occur between maternally related mammals. The process that gave rise to different genotypes in one lineage is clearly of fundamental importance in understanding intraspecific mitochondrial polymorphism and evolution in mammals. Several potential mechanisms for rapid mitochondrial DNA variation are discussed in light of these results. Images PMID:6289312

  19. MRS of pilocytic astrocytoma: The peak at 2 ppm may not be NAA.

    PubMed

    Tamrazi, Benita; Nelson, Marvin D; Blüml, Stefan

    2017-08-01

    To determine whether the chemical shift of residual N-acetylaspartate (NAA) signal in pilocytic astrocytomas (PA) is consistent with the position of the NAA peak in controls. MR spectra from 27 pediatric World Health Organization (WHO) grade I pilocytic astrocytoma patients, fifteen patients with WHO grade II and high-grade (III-IV) astrocytomas, and 36 controls were analyzed. All spectra were acquired with a short echo time (35 ms), single voxel point-resolved spectroscopy sequence on clinical 3 tesla scanners. Fully automated LCModel software was used for processing, which included the fitting of peak positions for NAA and creatine (Cr). The chemical shift difference between the NAA and Cr peaks was significantly smaller (by 0.016 ± 0.005 parts per million, P < 1e-10) in PAs than in controls and was also smaller than what was observed in infiltrative astrocytomas. The chemical shift position of the residual NAA peak in PAs is not consistent with NAA. The signal likely originates from an N-acetyl group of one or more other chemicals such as N-acetylated sugars. Magn Reson Med 78:452-456, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  20. Electrical detection of the biological interaction of a charged peptide via gallium arsenide junction-field-effect transistors

    PubMed Central

    Lee, Kangho; Nair, Pradeep R.; Alam, Muhammad A.; Janes, David B.; Wampler, Heeyeon P.; Zemlyanov, Dmitry Y.; Ivanisevic, Albena

    2008-01-01

    GaAs junction-field-effect transistors (JFETs) are utilized to achieve label-free detection of biological interaction between a probe transactivating transcriptional activator (TAT) peptide and the target trans-activation-responsive (TAR) RNA. The TAT peptide is a short sequence derived from the human immunodeficiency virus-type 1 TAT protein. The GaAs JFETs are modified with a mixed adlayer of 1-octadecanethiol (ODT) and TAT peptide, with the ODT passivating the GaAs surface from polar ions in physiological solutions and the TAT peptide providing selective binding sites for TAR RNA. The devices modified with the mixed adlayer exhibit a negative pinch-off voltage (VP) shift, which is attributed to the fixed positive charges from the arginine-rich regions in the TAT peptide. Immersing the modified devices into a TAR RNA solution results in a large positive VP shift (>1 V) and a steeper subthreshold slope (∼80 mV∕decade), whereas “dummy” RNA induced a small positive VP shift (∼0.3 V) without a significant change in subthreshold slopes (∼330 mV∕decade). The observed modulation of device characteristics is analyzed with analytical modeling and two-dimensional numerical device simulations to investigate the electronic interactions between the GaAs JFETs and biological molecules. PMID:19484151

  1. Stable Patterns of CENH3 Occupancy Through Maize Lineages Containing Genetically Similar Centromeres

    PubMed Central

    Gent, Jonathan I.; Wang, Kai; Jiang, Jiming; Dawe, R. Kelly

    2015-01-01

    While the approximate chromosomal position of centromeres has been identified in many species, little is known about the dynamics and diversity of centromere positions within species. Multiple lines of evidence indicate that DNA sequence has little or no impact in specifying centromeres in maize and in most multicellular organisms. Given that epigenetically defined boundaries are expected to be dynamic, we hypothesized that centromere positions would change rapidly over time, which would result in a diversity of centromere positions in isolated populations. To test this hypothesis, we used CENP-A/cenH3 (CENH3 in maize) chromatin immunoprecipitation to define centromeres in breeding pedigrees that included the B73 inbred as a common parent. While we found a diversity of CENH3 profiles for centromeres with divergent sequences that were not inherited from B73, the CENH3 profiles from centromeres that were inherited from B73 were indistinguishable from each other. We propose that specific genetic elements in centromeric regions favor or inhibit CENH3 accumulation, leading to reproducible patterns of CENH3 occupancy. These data also indicate that dramatic shifts in centromere position normally originate from accumulated or large-scale genetic changes rather than from epigenetic positional drift. PMID:26063660

  2. Genetic characterization of frameshift suppressors with new decoding properties.

    PubMed Central

    Hughes, D; Thompson, S; O'Connor, M; Tuohy, T; Nichols, B P; Atkins, J F

    1989-01-01

    Suppressor mutants that cause ribosomes to shift reading frame at specific and new sequences are described. Suppressors for trpE91, the only known suppressible -1 frameshift mutant, have been isolated in Escherichia coli and in Salmonella typhimurium. E. coli hopR acts on trpE91 within the 9-base-pair sequence GGA GUG UGA, is dominant, and is located at min 52 on the chromosome. Its Salmonella homolog maps at an equivalent position and arises as a rarer class in that organism as compared with E. coli. The Salmonella suppressor, hopE, believed to be in a duplicate copy of the same gene, maps at min 17. The +1 suppressor, sufT, acts at the nonmonotonous sequence CCGU, is dominant, and maps at min 59 on the Salmonella chromosome. PMID:2644219

  3. Domino reactions initiated by intramolecular hydride transfers from tri(di)arylmethane fragments to ketenimine and carbodiimide functions.

    PubMed

    Alajarin, Mateo; Bonillo, Baltasar; Ortin, Maria-Mar; Sanchez-Andrada, Pilar; Vidal, Angel; Orenes, Raul-Angel

    2010-10-21

    The ability of triarylmethane and diarylmethane fragments to behave as hydride donors participating in thermal [1,5]-H shift/6π-ERC tandem processes involving ketenimine and carbodiimide functions is disclosed. C-Alkyl-C-phenyl ketenimines N-substituted by a triarylmethane substructure convert into a variety of 3,3,4,4-tetrasubstituted-3,4-dihydroquinolines, as structurally related carbodiimides transform into 3,4,4-trisubstituted-3,4-dihydroquinazolines via transient ortho-azaxylylenes. The first step of these one-pot conversions, the [1,5]-H shift, is considered to be a hydride migration on the basis of the known hydricity of the tri(di)arylmethane fragment and the electrophilicity of the central heterocumulenic carbon atom, whereas the final electrocyclization involves the formation of a sterically congested C-C or C-N bond. In the cases of C,C-diphenyl substituted triarylmethane-ketenimines the usual 6π-ERC becomes prohibited by the presence of two phenyl rings at each end of the azatrienic system. This situation opens new reaction channels: (a) following the initial hydride shift, the tandem sequence continues with an alternative electrocyclization mode to give 9,10-dihydroacridines, (b) the full sequence is initiated by a rare 1,5 migration of an electron-rich aryl group, followed by a 6π-ERC which leads to 2-aryl-3,4-dihydroquinolines, or (c) a different [1,5]-H shift/6π-ERC sequence involving the initial migration of a hydrogen atom from a methyl group at the ortho position to the nitrogen atom of the ketenimine function. Diarylmethane-ketenimines bearing a methyl group at the benzylic carbon atom experience a tandem double [1,5]-H shift, the first one being the usual benzylic hydride transfer whereas the second one involves the methyl group at the initial benzylic carbon atom, the reaction products being 2-aminostyrenes. Diarylmethane-ketenimines lacking such a methyl group convert into 3,4-dihydroquinolines by the habitual tandem [1,5]-H shift/6π-ERC processes.

  4. High-speed optical phase-shifting apparatus

    DOEpatents

    Zortman, William A.

    2016-11-08

    An optical phase shifter includes an optical waveguide, a plurality of partial phase shifting elements arranged sequentially, and control circuitry electrically coupled to the partial phase shifting elements. The control circuitry is adapted to provide an activating signal to each of the N partial phase shifting elements such that the signal is delayed by a clock cycle between adjacent partial phase shifting elements in the sequence. The transit time for a guided optical pulse train between the input edges of consecutive partial phase shifting elements in the sequence is arranged to be equal to a clock cycle, thereby enabling pipelined processing of the optical pulses.

  5. Stable centromere positioning in diverse sequence contexts of complex and satellite centromeres of maize and wild relatives.

    PubMed

    Gent, Jonathan I; Wang, Na; Dawe, R Kelly

    2017-06-21

    Paradoxically, centromeres are known both for their characteristic repeat sequences (satellite DNA) and for being epigenetically defined. Maize (Zea mays mays) is an attractive model for studying centromere positioning because many of its large (~2 Mb) centromeres are not dominated by satellite DNA. These centromeres, which we call complex centromeres, allow for both assembly into reference genomes and for mapping short reads from ChIP-seq with antibodies to centromeric histone H3 (cenH3). We found frequent complex centromeres in maize and its wild relatives Z. mays parviglumis, Z. mays mexicana, and particularly Z. mays huehuetenangensis. Analysis of individual plants reveals minor variation in the positions of complex centromeres among siblings. However, such positional shifts are stochastic and not heritable, consistent with prior findings that centromere positioning is stable at the population level. Centromeres are also stable in multiple F1 hybrid contexts. Analysis of repeats in Z. mays and other species (Zea diploperennis, Zea luxurians, and Tripsacum dactyloides) reveals tenfold differences in abundance of the major satellite CentC, but similar high levels of sequence polymorphism in individual CentC copies. Deviation from the CentC consensus has little or no effect on binding of cenH3. These data indicate that complex centromeres are neither a peculiarity of cultivation nor inbreeding in Z. mays. While extensive arrays of CentC may be the norm for other Zea and Tripsacum species, these data also reveal that a wide diversity of DNA sequences and multiple types of genetic elements in and near centromeres support centromere function and constrain centromere positions.

  6. Panton-Valentine Leukocidin-Positive Staphylococcus aureus in Ireland from 2002 to 2011: 21 Clones, Frequent Importation of Clones, Temporal Shifts of Predominant Methicillin-Resistant S. aureus Clones, and Increasing Multiresistance

    PubMed Central

    Shore, Anna C.; Tecklenborg, Sarah C.; Brennan, Gráinne I.; Ehricht, Ralf; Monecke, Stefan

    2014-01-01

    There has been a worldwide increase in community-associated (CA) methicillin-resistant Staphylococcus aureus (MRSA) infections. CA-MRSA isolates commonly produce the Panton-Valentine leukocidin toxin encoded by the pvl genes lukF-PV and lukS-PV. This study investigated the clinical and molecular epidemiologies of pvl-positive MRSA and methicillin-susceptible S. aureus (MSSA) isolates identified by the Irish National MRSA Reference Laboratory (NMRSARL) between 2002 and 2011. All pvl-positive MRSA (n = 190) and MSSA (n = 39) isolates underwent antibiogram-resistogram typing, spa typing, and DNA microarray profiling for multilocus sequence type, clonal complex (CC) and/or sequence type (ST), staphylococcal cassette chromosome mec type assignment, and virulence and resistance gene detection. Where available, patient demographics and clinical data were analyzed. The prevalence of pvl-positive MRSA increased from 0.2% to 8.8%, and that of pvl-positive MSSA decreased from 20% to 2.5% during the study period. The pvl-positive MRSA and MSSA isolates belonged to 16 and 5 genotypes, respectively, with CC/ST8-MRSA-IV, CC/ST30-MRSA-IV, CC/ST80-MRSA-IV, CC1/ST772-MRSA-V, CC30-MSSA, CC22-MSSA, and CC121-MSSA predominating. Temporal shifts in the predominant pvl-positive MRSA genotypes and a 6-fold increase in multiresistant pvl-positive MRSA genotypes occurred during the study period. An analysis of patient data indicated that pvl-positive S. aureus strains, especially MRSA strains, had been imported into Ireland several times. Two hospital and six family clusters of pvl-positive MRSA were identified, and 70% of the patient isolates for which information was available were from patients in the community. This study highlights the increased burden and changing molecular epidemiology of pvl-positive S. aureus in Ireland over the last decade and the contribution of international travel to the influx of genetically diverse pvl-positive S. aureus isolates into Ireland. PMID:24371244

  7. Bacterial genomes lacking long-range correlations may not be modeled by low-order Markov chains: the role of mixing statistics and frame shift of neighboring genes.

    PubMed

    Cocho, Germinal; Miramontes, Pedro; Mansilla, Ricardo; Li, Wentian

    2014-12-01

    We examine the relationship between exponential correlation functions and Markov models in a bacterial genome in detail. Despite the well known fact that Markov models generate sequences with correlation function that decays exponentially, simply constructed Markov models based on nearest-neighbor dimer (first-order), trimer (second-order), up to hexamer (fifth-order), and treating the DNA sequence as being homogeneous all fail to predict the value of exponential decay rate. Even reading-frame-specific Markov models (both first- and fifth-order) could not explain the fact that the exponential decay is very slow. Starting with the in-phase coding-DNA-sequence (CDS), we investigated correlation within a fixed-codon-position subsequence, and in artificially constructed sequences by packing CDSs with out-of-phase spacers, as well as altering CDS length distribution by imposing an upper limit. From these targeted analyses, we conclude that the correlation in the bacterial genomic sequence is mainly due to a mixing of heterogeneous statistics at different codon positions, and the decay of correlation is due to the possible out-of-phase between neighboring CDSs. There are also small contributions to the correlation from bases at the same codon position, as well as by non-coding sequences. These show that the seemingly simple exponential correlation functions in bacterial genome hide a complexity in correlation structure which is not suitable for a modeling by Markov chain in a homogeneous sequence. Other results include: use of the (absolute value) second largest eigenvalue to represent the 16 correlation functions and the prediction of a 10-11 base periodicity from the hexamer frequencies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. ACTG: novel peptide mapping onto gene models.

    PubMed

    Choi, Seunghyuk; Kim, Hyunwoo; Paek, Eunok

    2017-04-15

    In many proteogenomic applications, mapping peptide sequences onto genome sequences can be very useful, because it allows us to understand origins of the gene products. Existing software tools either take the genomic position of a peptide start site as an input or assume that the peptide sequence exactly matches the coding sequence of a given gene model. In case of novel peptides resulting from genomic variations, especially structural variations such as alternative splicing, these existing tools cannot be directly applied unless users supply information about the variant, either its genomic position or its transcription model. Mapping potentially novel peptides to genome sequences, while allowing certain genomic variations, requires introducing novel gene models when aligning peptide sequences to gene structures. We have developed a new tool called ACTG (Amino aCids To Genome), which maps peptides to genome, assuming all possible single exon skipping, junction variation allowing three edit distances from the original splice sites, exon extension and frame shift. In addition, it can also consider SNVs (single nucleotide variations) during mapping phase if a user provides the VCF (variant call format) file as an input. Available at http://prix.hanyang.ac.kr/ACTG/search.jsp . eunokpaek@hanyang.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  9. A note on chaotic unimodal maps and applications.

    PubMed

    Zhou, C T; He, X T; Yu, M Y; Chew, L Y; Wang, X G

    2006-09-01

    Based on the word-lift technique of symbolic dynamics of one-dimensional unimodal maps, we investigate the relation between chaotic kneading sequences and linear maximum-length shift-register sequences. Theoretical and numerical evidence that the set of the maximum-length shift-register sequences is a subset of the set of the universal sequence of one-dimensional chaotic unimodal maps is given. By stabilizing unstable periodic orbits on superstable periodic orbits, we also develop techniques to control the generation of long binary sequences.

  10. Criteria to average out the chemical shift anisotropy in solid-state NMR when irradiated with BABA I, BABA II, and C7 radiofrequency pulse sequences.

    PubMed

    Stephane Mananga, Eugene

    2013-01-01

    Floquet-Magnus expansion is used to study the effect of chemical shift anisotropy in solid-state NMR of rotating solids. The chemical shift interaction is irradiated with two types of radiofrequency pulse sequences: BABA and C7. The criteria for the chemical shift anisotropy to be averaged out in each rotor period are obtained. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Sine-squared shifted pulses for recoupling interactions in solid-state NMR

    NASA Astrophysics Data System (ADS)

    Jain, Mukul G.; Rajalakshmi, G.; Equbal, Asif; Mote, Kaustubh R.; Agarwal, Vipin; Madhu, P. K.

    2017-06-01

    Rotational-Echo DOuble-Resonance (REDOR) is a versatile experiment for measuring internuclear distance between two heteronuclear spins in solid-state NMR. At slow to intermediate magic-angle spinning (MAS) frequencies, the measurement of distances between strongly coupled spins is challenging due to rapid dephasing of magnetisation. This problem can be remedied by employing the pulse-shifted version of REDOR known as Shifted-REDOR (S-REDOR) that scales down the recoupled dipolar coupling. In this study, we propose a new variant of the REDOR sequence where the positions of the π pulses are determined by a sine-squared function. This new variant has scaling properties similar to S-REDOR. We use theory, numerical simulations, and experiments to compare the dipolar recoupling efficiencies and the experimental robustness of the three REDOR schemes. The proposed variant has advantages in terms of radiofrequency field requirements at fast MAS frequencies.

  12. Molecular Evolution of Ultraspiracle Protein (USP/RXR) in Insects

    PubMed Central

    Hult, Ekaterina F.; Tobe, Stephen S.; Chang, Belinda S. W.

    2011-01-01

    Ultraspiracle protein/retinoid X receptor (USP/RXR) is a nuclear receptor and transcription factor which is an essential component of a heterodimeric receptor complex with the ecdysone receptor (EcR). In insects this complex binds ecdysteroids and plays an important role in the regulation of growth, development, metamorphosis and reproduction. In some holometabolous insects, including Lepidoptera and Diptera, USP/RXR is thought to have experienced several important shifts in function. These include the acquisition of novel ligand-binding properties and an expanded dimerization interface with EcR. In light of these recent hypotheses, we implemented codon-based likelihood methods to investigate if the proposed shifts in function are reflected in changes in site-specific evolutionary rates across functional and structural motifs in insect USP/RXR sequences, and if there is any evidence for positive selection at functionally important sites. Our results reveal evidence of positive selection acting on sites within the loop connecting helices H1 and H3, the ligand-binding pocket, and the dimer interface in the holometabolous lineage leading to the Lepidoptera/Diptera/Trichoptera. Similar analyses conducted using EcR sequences did not indicate positive selection. However, analyses allowing for variation across sites demonstrated elevated non-synonymous/synonymous rate ratios (d N/d S), suggesting relaxed constraint, within the dimerization interface of both USP/RXR and EcR as well as within the coactivator binding groove and helix H12 of USP/RXR. Since the above methods are based on the assumption that d S is constant among sites, we also used more recent models which relax this assumption and obtained results consistent with traditional random-sites models. Overall our findings support the evolution of novel function in USP/RXR of more derived holometabolous insects, and are consistent with shifts in structure and function which may have increased USP/RXR reliance on EcR for cofactor recruitment. Moreover, these findings raise important questions regarding hypotheses which suggest the independent activation of USP/RXR by its own ligand. PMID:21901121

  13. Solution 1H NMR characterization of the axial bonding of the two His in oxidized human cytoglobin

    PubMed Central

    Bondarenko, Vasyl; Dewilde, Sylvia; Moens, Luc; La Mar, Gerd N.

    2008-01-01

    Solution 1H NMR spectroscopy has been used to determine the relative strengths (covalency) of the two axial His-Fe bonds in paramagnetic, S = 1/2, human met-cytoglobin. The sequence specific assignments of crucial portions of the proximal and distal helices, together with the magnitude of hyperfine shifts and paramagnetic relaxation, establish that His81 and His113, at the canonical positions E7 and F8 in the myoglobin fold, respectively, are ligated to the iron. The characterized complex (~90%) in solution has protohemin oriented as in crystals, with the remaining ~10% exhibiting the hemin orientation rotated 180° about the α-, γ-meso axis. No evidence could be obtained for any five-coordinate complex (<1%) in equilibrium with the six-coordinate complexes. Extensive sequence-specific assignments on other dipolar shifted helical fragments and loops, together with available alternate crystal coordinates for the complex, allowed the robust determination of the orientation and anisotropies of the paramagnetic susceptibility tensor. The tilt of the major axis is controlled by the His-Fe-His vector, and the rhombic axes by the mean of the imidazole orientations for the two His. The anisotropy of the paramagnetic susceptibility tensor allowed the quantitative factoring of the hyperfine shifts for the two axial His to reveal indistinguishable pattern and magnitudes of the contact shifts or π spin densities, and hence, indistinguishable Fe-imidazole covalency for both Fe-His bonds. PMID:17002396

  14. Evolution of exceptional species richness among lineages of fleshy-fruited Myrtaceae

    PubMed Central

    Biffin, Ed; Lucas, Eve J.; Craven, Lyn A.; Ribeiro da Costa, Itayguara; Harrington, Mark G.; Crisp, Michael D.

    2010-01-01

    Background and Aims The angiosperm family Myrtaceae comprises 17 tribes with more than half of the estimated 5500 species being referred to the fleshy-fruited and predominantly rainforest associated Syzygieae and Myrteae. Previous studies suggest that fleshy fruits have evolved separately in these lineages, whereas generally shifts in fruit morphology have been variously implicated in diversification rate shifts among angiosperms. A phylogenetic hypothesis and estimate divergence times for Myrtaceae is developed as a basis to explore the evidence for, and drivers of, elevated diversification rates among the fleshy-fruited tribes of Myrtaceae. Methods Bayesian phylogenetic analyses of plastid and nuclear DNA sequences were used to estimate intertribal relationships and lineage divergence times in Myrtaceae. Focusing on the fleshy-fruited tribes, a variety of statistical approaches were used to assess diversification rates and diversification rate shifts across the family. Key Results Analyses of the sequence data provide a strongly supported phylogenetic hypothesis for Myrtaceae. Relative to previous studies, substantially younger ages for many of the clades are reported, and it is argued that the use of flexible calibrations to incorporate fossil data provides more realistic divergence estimates than the use of errorless point calibrations. It is found that Syzygieae and Myrteae have experienced elevated diversification rates relative to other lineages of Myrtaceae. Positive shifts in diversification rate have occurred separately in each lineage, associated with a shift from dry to fleshy fruit. Conclusions Fleshy fruits have evolved independently in Syzygieae and Myrteae, and this is accompanied by exceptional diversification rate shifts in both instances, suggesting that the evolution of fleshy fruits is a key innovation for rainforest Myrtaceae. Noting the scale dependency of this hypothesis, more complex explanations may be required to explain diversification rate shifts occurring within the fleshy-fruited tribes, and the suggested phylogenetic hypothesis provides an appropriate framework for this undertaking. PMID:20462850

  15. SU-E-T-315: Dosimetric Effects of Couch Top Shift On VMAT Delivery in Absence of Indexing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Islam, M; Jin, H; Ferguson, S

    2015-06-15

    Purpose: To investigate dosimetric effects of couch top shift for volumetric-modulated arc therapy (VMAT) in absence of indexing of immobilization devices. Methods: A total of twelve VMAT treatment plans were selected from three regions (lung, abdomen, and pelvis) to account for the variation of the patient position relative to the couch top. The treatment plans were generated using the Varian Eclipse system. A pinpoint ionization chamber (PTW TN31014) was placed at the center of 16-cm solid water phantom and the dose was delivered using the Varian TrueBeam STx with BrainLAB ExacTrac couch top. To simulate the day-to-day variation of themore » patient position relative to couch top, the couch top was laterally shifted up to 50 mm, with an increment of 5 mm from 0 to 20 mm; and of 10 mm afterwards, and the phantom was moved back to 0 cm shift for measurement. The dose was also delivered using a Varian tennis racket grid insert at 0 cm shift to simulate the absence of couch top. The treatment plans were delivered with 6, 10, and 15 MV photons using the same leaf sequencing to investigate the energy dependence of couch top shift. The dose difference was normalized to 0 cm shift for the regular couch top for comparison. Results: The percent difference of dose was found to increase with lateral shift for all energies; however, the average differences were close to 0% and the maximum difference was within 1% along the lateral shifts. The differences with the absence of couch top were 2.2±0.5% (6MV), 1.7±0.3% (10MV), and 1.6±0.2% (15MV), respectively. Conclusion: The inclusion of couch top is recommended in treatment planning to minimize the dosimetric uncertainty between calculated and delivered dose even in absence of indexing of immobilization devices in VMAT delivery.« less

  16. Flexible Positions, Managed Hopes: The Promissory Bioeconomy of a Whole Genome Sequencing Cancer Study

    PubMed Central

    Haase, Rachel; Michie, Marsha; Skinner, Debra

    2015-01-01

    Genomic research has rapidly expanded its scope and ambition over the past decade, promoted by both public and private sectors as having the potential to revolutionize clinical medicine. This promissory bioeconomy of genomic research and technology is generated by, and in turn generates, the hopes and expectations shared by investors, researchers and clinicians, patients, and the general public alike. Examinations of such bioeconomies have often focused on the public discourse, media representations, and capital investments that fuel these “regimes of hope,” but also crucial are the more intimate contexts of small-scale medical research, and the private hopes, dreams, and disappointments of those involved. Here we examine one local site of production in a university-based clinical research project that sought to identify novel cancer predisposition genes through whole genome sequencing in individuals at high risk for cancer. In-depth interviews with 24 adults who donated samples to the study revealed an ability to shift flexibly between positioning themselves as research participants on the one hand, and as patients or as family members of patients, on the other. Similarly, interviews with members of the research team highlighted the dual nature of their positions as researchers and as clinicians. For both parties, this dual positioning shaped their investment in the project and valuing of its possible outcomes. In their narratives, all parties shifted between these different relational positions as they managed hopes and expectations for the research project. We suggest that this flexibility facilitated study implementation and participation in the face of potential and probable disappointment on one or more fronts, and acted as a key element in the resilience of this local promissory bioeconomy. We conclude that these multiple dimensions of relationality and positionality are inherent and essential in the creation of any complex economy, “bio” or otherwise. PMID:25697637

  17. Statistical learning of music- and language-like sequences and tolerance for spectral shifts.

    PubMed

    Daikoku, Tatsuya; Yatomi, Yutaka; Yumoto, Masato

    2015-02-01

    In our previous study (Daikoku, Yatomi, & Yumoto, 2014), we demonstrated that the N1m response could be a marker for the statistical learning process of pitch sequence, in which each tone was ordered by a Markov stochastic model. The aim of the present study was to investigate how the statistical learning of music- and language-like auditory sequences is reflected in the N1m responses based on the assumption that both language and music share domain generality. By using vowel sounds generated by a formant synthesizer, we devised music- and language-like auditory sequences in which higher-ordered transitional rules were embedded according to a Markov stochastic model by controlling fundamental (F0) and/or formant frequencies (F1-F2). In each sequence, F0 and/or F1-F2 were spectrally shifted in the last one-third of the tone sequence. Neuromagnetic responses to the tone sequences were recorded from 14 right-handed normal volunteers. In the music- and language-like sequences with pitch change, the N1m responses to the tones that appeared with higher transitional probability were significantly decreased compared with the responses to the tones that appeared with lower transitional probability within the first two-thirds of each sequence. Moreover, the amplitude difference was even retained within the last one-third of the sequence after the spectral shifts. However, in the language-like sequence without pitch change, no significant difference could be detected. The pitch change may facilitate the statistical learning in language and music. Statistically acquired knowledge may be appropriated to process altered auditory sequences with spectral shifts. The relative processing of spectral sequences may be a domain-general auditory mechanism that is innate to humans. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Unravelling biology and shifting paradigms in cancer with single-cell sequencing.

    PubMed

    Baslan, Timour; Hicks, James

    2017-08-24

    The fundamental operative unit of a cancer is the genetically and epigenetically innovative single cell. Whether proliferating or quiescent, in the primary tumour mass or disseminated elsewhere, single cells govern the parameters that dictate all facets of the biology of cancer. Thus, single-cell analyses provide the ultimate level of resolution in our quest for a fundamental understanding of this disease. Historically, this quest has been hampered by technological shortcomings. In this Opinion article, we argue that the rapidly evolving field of single-cell sequencing has unshackled the cancer research community of these shortcomings. From furthering an elemental understanding of intra-tumoural genetic heterogeneity and cancer genome evolution to illuminating the governing principles of disease relapse and metastasis, we posit that single-cell sequencing promises to unravel the biology of all facets of this disease.

  19. Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

    PubMed Central

    Lo, W Y; Ting, L P

    1994-01-01

    Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

  20. Stable Patterns of CENH3 Occupancy Through Maize Lineages Containing Genetically Similar Centromeres.

    PubMed

    Gent, Jonathan I; Wang, Kai; Jiang, Jiming; Dawe, R Kelly

    2015-08-01

    While the approximate chromosomal position of centromeres has been identified in many species, little is known about the dynamics and diversity of centromere positions within species. Multiple lines of evidence indicate that DNA sequence has little or no impact in specifying centromeres in maize and in most multicellular organisms. Given that epigenetically defined boundaries are expected to be dynamic, we hypothesized that centromere positions would change rapidly over time, which would result in a diversity of centromere positions in isolated populations. To test this hypothesis, we used CENP-A/cenH3 (CENH3 in maize) chromatin immunoprecipitation to define centromeres in breeding pedigrees that included the B73 inbred as a common parent. While we found a diversity of CENH3 profiles for centromeres with divergent sequences that were not inherited from B73, the CENH3 profiles from centromeres that were inherited from B73 were indistinguishable from each other. We propose that specific genetic elements in centromeric regions favor or inhibit CENH3 accumulation, leading to reproducible patterns of CENH3 occupancy. These data also indicate that dramatic shifts in centromere position normally originate from accumulated or large-scale genetic changes rather than from epigenetic positional drift. Copyright © 2015 by the Genetics Society of America.

  1. Random sequences generation through optical measurements by phase-shifting interferometry

    NASA Astrophysics Data System (ADS)

    François, M.; Grosges, T.; Barchiesi, D.; Erra, R.; Cornet, A.

    2012-04-01

    The development of new techniques for producing random sequences with a high level of security is a challenging topic of research in modern cryptographics. The proposed method is based on the measurement by phase-shifting interferometry of the speckle signals of the interaction between light and structures. We show how the combination of amplitude and phase distributions (maps) under a numerical process can produce random sequences. The produced sequences satisfy all the statistical requirements of randomness and can be used in cryptographic schemes.

  2. A Three-Dimensional DOSY HMQC Experiment for the High-Resolution Analysis of Complex Mixtures

    NASA Astrophysics Data System (ADS)

    Barjat, Hervé; Morris, Gareth A.; Swanson, Alistair G.

    1998-03-01

    A three-dimensional experiment is described in which NMR signals are separated according to their proton chemical shift,13C chemical shift, and diffusion coefficient. The sequence is built up from a stimulated echo sequence with bipolar field gradient pulses and a conventional decoupled HMQC sequence. Results are presented for a model mixture of quinine, camphene, and geraniol in deuteriomethanol.

  3. Learning by subtraction: Hippocampal activity and effects of ethanol during the acquisition and performance of response sequences.

    PubMed

    Ketchum, Myles J; Weyand, Theodore G; Weed, Peter F; Winsauer, Peter J

    2016-05-01

    Learning is believed to be reflected in the activity of the hippocampus. However, neural correlates of learning have been difficult to characterize because hippocampal activity is integrated with ongoing behavior. To address this issue, male rats (n = 5) implanted with electrodes (n = 14) in the CA1 subfield responded during two tasks within a single test session. In one task, subjects acquired a new 3-response sequence (acquisition), whereas in the other task, subjects completed a well-rehearsed 3-response sequence (performance). Both tasks though could be completed using an identical response topography and used the same sensory stimuli and schedule of reinforcement. More important, comparing neural patterns during sequence acquisition to those during sequence performance allows for a subtractive approach whereby activity associated with learning could potentially be dissociated from the activity associated with ongoing behavior. At sites where CA1 activity was closely associated with behavior, the patterns of activity were differentially modulated by key position and the serial position of a response within the schedule of reinforcement. Temporal shifts between peak activity and responding on particular keys also occurred during sequence acquisition, but not during sequence performance. Ethanol disrupted CA1 activity while producing rate-decreasing effects in both tasks and error-increasing effects that were more selective for sequence acquisition than sequence performance. Ethanol also produced alterations in the magnitude of modulations and temporal pattern of CA1 activity, although these effects were not selective for sequence acquisition. Similar to ethanol, hippocampal micro-stimulation decreased response rate in both tasks and selectively increased the percentage of errors during sequence acquisition, and provided a more direct demonstration of hippocampal involvement during sequence acquisition. Together, these results strongly support the notion that ethanol disrupts sequence acquisition by disrupting hippocampal activity and that the hippocampus is necessary for the conditioned associations required for sequence acquisition. © 2015 Wiley Periodicals, Inc.

  4. Learning by Subtraction: Hippocampal Activity and Effects of Ethanol during the Acquisition and Performance of Response Sequences

    PubMed Central

    Ketchum, Myles J.; Weyand, Theodore G.; Weed, Peter F.; Winsauer, Peter J.

    2015-01-01

    Learning is believed to be reflected in the activity of the hippocampus. However, neural correlates of learning have been difficult to characterize because hippocampal activity is integrated with ongoing behavior. To address this issue, male rats (n=5) implanted with electrodes (n=14) in the CA1 subfield responded during two tasks within a single test session. In one task, subjects acquired a new 3-response sequence (acquisition), whereas in the other task, subjects completed a well-rehearsed 3-response sequence (performance). Both tasks though could be completed using an identical response topography and used the same sensory stimuli and schedule of reinforcement. More important, comparing neural patterns during sequence acquisition to those during sequence performance allows for a subtractive approach whereby activity associated with learning could potentially be dissociated from the activity associated with ongoing behavior. At sites where CA1 activity was closely associated with behavior, the patterns of activity were differentially modulated by key position and the serial position of a response within the schedule of reinforcement. Temporal shifts between peak activity and responding on particular keys also occurred during sequence acquisition, but not during sequence performance. Ethanol disrupted CA1 activity while producing rate-decreasing effects in both tasks and error-increasing effects that were more selective for sequence acquisition than sequence performance. Ethanol also produced alterations in the magnitude of modulations and temporal pattern of CA1 activity, although these effects were not selective for sequence acquisition. Similar to ethanol, hippocampal micro-stimulation decreased response rate in both tasks and selectively increased the percentage of errors during sequence acquisition, and provided a more direct demonstration of hippocampal involvement during sequence acquisition. Together, these results strongly support the notion that ethanol disrupts sequence acquisition by disrupting hippocampal activity and that the hippocampus is necessary for the conditioned associations required for sequence acquisition. PMID:26482846

  5. Research on respiratory motion correction method based on liver contrast-enhanced ultrasound images of single mode

    NASA Astrophysics Data System (ADS)

    Zhang, Ji; Li, Tao; Zheng, Shiqiang; Li, Yiyong

    2015-03-01

    To reduce the effects of respiratory motion in the quantitative analysis based on liver contrast-enhanced ultrasound (CEUS) image sequencesof single mode. The image gating method and the iterative registration method using model image were adopted to register liver contrast-enhanced ultrasound image sequences of single mode. The feasibility of the proposed respiratory motion correction method was explored preliminarily using 10 hepatocellular carcinomas CEUS cases. The positions of the lesions in the time series of 2D ultrasound images after correction were visually evaluated. Before and after correction, the quality of the weighted sum of transit time (WSTT) parametric images were also compared, in terms of the accuracy and spatial resolution. For the corrected and uncorrected sequences, their mean deviation values (mDVs) of time-intensity curve (TIC) fitting derived from CEUS sequences were measured. After the correction, the positions of the lesions in the time series of 2D ultrasound images were almost invariant. In contrast, the lesions in the uncorrected images all shifted noticeably. The quality of the WSTT parametric maps derived from liver CEUS image sequences were improved more greatly. Moreover, the mDVs of TIC fitting derived from CEUS sequences after the correction decreased by an average of 48.48+/-42.15. The proposed correction method could improve the accuracy of quantitative analysis based on liver CEUS image sequences of single mode, which would help in enhancing the differential diagnosis efficiency of liver tumors.

  6. Molecular epidemiology and evolution of avian infectious bronchitis virus in Spain over a fourteen-year period.

    PubMed

    Dolz, Roser; Pujols, Joan; Ordóñez, German; Porta, Ramon; Majó, Natàlia

    2008-04-25

    An in-depth molecular study of infectious bronchitis viruses (IBV) with particular interest in evolutionary aspects of IBV in Spain was carried out in the present study based on the S1 gene molecular characterization of twenty-six Spanish strains isolated over a fourteen-year period. Four genotypes were identified based on S1 gene sequence analyses and phylogenetic studies. A drastic virus population shift was demonstrated along time and the novel Italy 02 serotype was shown to have displaced the previous predominant serotype 4/91 in the field. Detailed analyses of synonymous to non-synonymous ratio of the S1 gene sequences of this new serotype Italy 02 suggested positive selection pressures might have contributed to the successful establishment of Italy 02 serotype in our country. In addition, differences on the fitness abilities of new emergent genotypes were indicated. Furthermore, intergenic sequences (IGs)-like motifs within S1 gene sequences of IBV isolates were suggested to enhance the recombination abilities of certain serotypes.

  7. Rapid and reliable protein structure determination via chemical shift threading.

    PubMed

    Hafsa, Noor E; Berjanskii, Mark V; Arndt, David; Wishart, David S

    2018-01-01

    Protein structure determination using nuclear magnetic resonance (NMR) spectroscopy can be both time-consuming and labor intensive. Here we demonstrate how chemical shift threading can permit rapid, robust, and accurate protein structure determination using only chemical shift data. Threading is a relatively old bioinformatics technique that uses a combination of sequence information and predicted (or experimentally acquired) low-resolution structural data to generate high-resolution 3D protein structures. The key motivations behind using NMR chemical shifts for protein threading lie in the fact that they are easy to measure, they are available prior to 3D structure determination, and they contain vital structural information. The method we have developed uses not only sequence and chemical shift similarity but also chemical shift-derived secondary structure, shift-derived super-secondary structure, and shift-derived accessible surface area to generate a high quality protein structure regardless of the sequence similarity (or lack thereof) to a known structure already in the PDB. The method (called E-Thrifty) was found to be very fast (often < 10 min/structure) and to significantly outperform other shift-based or threading-based structure determination methods (in terms of top template model accuracy)-with an average TM-score performance of 0.68 (vs. 0.50-0.62 for other methods). Coupled with recent developments in chemical shift refinement, these results suggest that protein structure determination, using only NMR chemical shifts, is becoming increasingly practical and reliable. E-Thrifty is available as a web server at http://ethrifty.ca .

  8. A pronounced evolutionary shift of the pseudoautosomal region boundary in house mice

    PubMed Central

    White, Michael A.; Ikeda, Akihiro; Payseur, Bret A.

    2012-01-01

    The pseudoautosomal region (PAR) is essential for the accurate pairing and segregation of the X and Y chromosomes during meiosis. Despite its functional significance, the PAR shows substantial evolutionary divergence in structure and sequence between mammalian species. An instructive example of PAR evolution is the house mouse Mus musculus domesticus (represented by the C57BL/6J strain), which has the smallest PAR among those that have been mapped. In C57BL/6J, the PAR boundary is located just ~700 kb from the distal end of the X chromosome, whereas the boundary is found at a more proximal position in Mus spretus, a species that diverged from house mice 2–4 million years ago. Here, we use a combination of genetic and physical mapping to document a pronounced shift in the PAR boundary in a second house mouse subspecies, Mus musculus castaneus (represented by the CAST/EiJ strain), ~430 kb proximal of the M. m. domesticus boundary. We demonstrate molecular evolutionary consequences of this shift, including a marked lineage-specific increase in sequence divergence within Mid1, a gene that resides entirely within the M. m. castaneus PAR but straddles the boundary in other subspecies. Our results extend observations of structural divergence in the PAR to closely related subspecies, pointing to major evolutionary changes in this functionally important genomic region over a short time period. PMID:22763584

  9. A pronounced evolutionary shift of the pseudoautosomal region boundary in house mice.

    PubMed

    White, Michael A; Ikeda, Akihiro; Payseur, Bret A

    2012-08-01

    The pseudoautosomal region (PAR) is essential for the accurate pairing and segregation of the X and Y chromosomes during meiosis. Despite its functional significance, the PAR shows substantial evolutionary divergence in structure and sequence between mammalian species. An instructive example of PAR evolution is the house mouse Mus musculus domesticus (represented by the C57BL/6J strain), which has the smallest PAR among those that have been mapped. In C57BL/6J, the PAR boundary is located just ~700 kb from the distal end of the X chromosome, whereas the boundary is found at a more proximal position in Mus spretus, a species that diverged from house mice 2-4 million years ago. In this study we used a combination of genetic and physical mapping to document a pronounced shift in the PAR boundary in a second house mouse subspecies, Mus musculus castaneus (represented by the CAST/EiJ strain), ~430 kb proximal of the M. m. domesticus boundary. We demonstrate molecular evolutionary consequences of this shift, including a marked lineage-specific increase in sequence divergence within Mid1, a gene that resides entirely within the M. m. castaneus PAR but straddles the boundary in other subspecies. Our results extend observations of structural divergence in the PAR to closely related subspecies, pointing to major evolutionary changes in this functionally important genomic region over a short time period.

  10. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

    PubMed

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-09-29

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

  11. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

    PubMed Central

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-01-01

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

  12. NMRDSP: an accurate prediction of protein shape strings from NMR chemical shifts and sequence data.

    PubMed

    Mao, Wusong; Cong, Peisheng; Wang, Zhiheng; Lu, Longjian; Zhu, Zhongliang; Li, Tonghua

    2013-01-01

    Shape string is structural sequence and is an extremely important structure representation of protein backbone conformations. Nuclear magnetic resonance chemical shifts give a strong correlation with the local protein structure, and are exploited to predict protein structures in conjunction with computational approaches. Here we demonstrate a novel approach, NMRDSP, which can accurately predict the protein shape string based on nuclear magnetic resonance chemical shifts and structural profiles obtained from sequence data. The NMRDSP uses six chemical shifts (HA, H, N, CA, CB and C) and eight elements of structure profiles as features, a non-redundant set (1,003 entries) as the training set, and a conditional random field as a classification algorithm. For an independent testing set (203 entries), we achieved an accuracy of 75.8% for S8 (the eight states accuracy) and 87.8% for S3 (the three states accuracy). This is higher than only using chemical shifts or sequence data, and confirms that the chemical shift and the structure profile are significant features for shape string prediction and their combination prominently improves the accuracy of the predictor. We have constructed the NMRDSP web server and believe it could be employed to provide a solid platform to predict other protein structures and functions. The NMRDSP web server is freely available at http://cal.tongji.edu.cn/NMRDSP/index.jsp.

  13. Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

    PubMed

    Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

    1996-01-19

    Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

  14. Multi-Stage Target Tracking with Drift Correction and Position Prediction

    NASA Astrophysics Data System (ADS)

    Chen, Xin; Ren, Keyan; Hou, Yibin

    2018-04-01

    Most existing tracking methods are hard to combine accuracy and performance, and do not consider the shift between clarity and blur that often occurs. In this paper, we propound a multi-stage tracking framework with two particular modules: position prediction and corrective measure. We conduct tracking based on correlation filter with a corrective measure module to increase both performance and accuracy. Specifically, a convolutional network is used for solving the blur problem in realistic scene, training methodology that training dataset with blur images generated by the three blur algorithms. Then, we propose a position prediction module to reduce the computation cost and make tracker more capable of fast motion. Experimental result shows that our tracking method is more robust compared to others and more accurate on the benchmark sequences.

  15. Deep Ion Torrent sequencing identifies soil fungal community shifts after frequent prescribed fires in a southeastern US forest ecosystem.

    PubMed

    Brown, Shawn P; Callaham, Mac A; Oliver, Alena K; Jumpponen, Ari

    2013-12-01

    Prescribed burning is a common management tool to control fuel loads, ground vegetation, and facilitate desirable game species. We evaluated soil fungal community responses to long-term prescribed fire treatments in a loblolly pine forest on the Piedmont of Georgia and utilized deep Internal Transcribed Spacer Region 1 (ITS1) amplicon sequencing afforded by the recent Ion Torrent Personal Genome Machine (PGM). These deep sequence data (19,000 + reads per sample after subsampling) indicate that frequent fires (3-year fire interval) shift soil fungus communities, whereas infrequent fires (6-year fire interval) permit system resetting to a state similar to that without prescribed fire. Furthermore, in nonmetric multidimensional scaling analyses, primarily ectomycorrhizal taxa were correlated with axes associated with long fire intervals, whereas soil saprobes tended to be correlated with the frequent fire recurrence. We conclude that (1) multiplexed Ion Torrent PGM analyses allow deep cost effective sequencing of fungal communities but may suffer from short read lengths and inconsistent sequence quality adjacent to the sequencing adaptor; (2) frequent prescribed fires elicit a shift in soil fungal communities; and (3) such shifts do not occur when fire intervals are longer. Our results emphasize the general responsiveness of these forests to management, and the importance of fire return intervals in meeting management objectives. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  16. Phase correction, phase resetting, and phase shifts after subliminal timing perturbations in sensorimotor synchronization.

    PubMed

    Repp, B H

    2001-06-01

    Recent studies of synchronized finger tapping have shown that perceptually subliminal phase shifts in an auditory sequence are rapidly compensated for in the motor activity (B. H. Repp, 2000a). Experiment 1 used a continuation-tapping task to confirm that this compensation is indeed a phase correction, not an adjustment of the central timekeeper period. Experiments 2-5 revealed that this phase correction occurs even when there is no ordinary sensorimotor asynchrony--when the finger taps are in antiphase or arbitrary phase relative to the auditory sequence (Experiments 2 and 3) or when the tap coinciding with the sequence phase shift is withheld (Experiments 4 and 5). The phase correction observed in the latter conditions was instantaneous, which suggests that phase resetting occurs when the motor activity is discontinuous. A prolonged phase shift suggestive of overcompensation was observed in some conditions, which poses a challenge to pure phase correction models.

  17. Performance Analysis of Direct-Sequence Code-Division Multiple-Access Communications with Asymmetric Quadrature Phase-Shift-Keying Modulation

    NASA Technical Reports Server (NTRS)

    Wang, C.-W.; Stark, W.

    2005-01-01

    This article considers a quaternary direct-sequence code-division multiple-access (DS-CDMA) communication system with asymmetric quadrature phase-shift-keying (AQPSK) modulation for unequal error protection (UEP) capability. Both time synchronous and asynchronous cases are investigated. An expression for the probability distribution of the multiple-access interference is derived. The exact bit-error performance and the approximate performance using a Gaussian approximation and random signature sequences are evaluated by extending the techniques used for uniform quadrature phase-shift-keying (QPSK) and binary phase-shift-keying (BPSK) DS-CDMA systems. Finally, a general system model with unequal user power and the near-far problem is considered and analyzed. The results show that, for a system with UEP capability, the less protected data bits are more sensitive to the near-far effect that occurs in a multiple-access environment than are the more protected bits.

  18. Vocal Generalization Depends on Gesture Identity and Sequence

    PubMed Central

    Sober, Samuel J.

    2014-01-01

    Generalization, the brain's ability to transfer motor learning from one context to another, occurs in a wide range of complex behaviors. However, the rules of generalization in vocal behavior are poorly understood, and it is unknown how vocal learning generalizes across an animal's entire repertoire of natural vocalizations and sequences. Here, we asked whether generalization occurs in a nonhuman vocal learner and quantified its properties. We hypothesized that adaptive error correction of a vocal gesture produced in one sequence would generalize to the same gesture produced in other sequences. To test our hypothesis, we manipulated the fundamental frequency (pitch) of auditory feedback in Bengalese finches (Lonchura striata var. domestica) to create sensory errors during vocal gestures (song syllables) produced in particular sequences. As hypothesized, error-corrective learning on pitch-shifted vocal gestures generalized to the same gestures produced in other sequential contexts. Surprisingly, generalization magnitude depended strongly on sequential distance from the pitch-shifted syllables, with greater adaptation for gestures produced near to the pitch-shifted syllable. A further unexpected result was that nonshifted syllables changed their pitch in the direction opposite from the shifted syllables. This apparently antiadaptive pattern of generalization could not be explained by correlations between generalization and the acoustic similarity to the pitch-shifted syllable. These findings therefore suggest that generalization depends on the type of vocal gesture and its sequential context relative to other gestures and may reflect an advantageous strategy for vocal learning and maintenance. PMID:24741046

  19. Cloning and sequencing of the gene coding for alcohol dehydrogenase of Bacillus stearothermophilus and rational shift of the optimum pH.

    PubMed

    Sakoda, H; Imanaka, T

    1992-02-01

    Using Bacillus subtilis as a host and pTB524 as a vector plasmid, we cloned the thermostable alcohol dehydrogenase (ADH-T) gene (adhT) from Bacillus stearothermophilus NCA1503 and determined its nucleotide sequence. The deduced amino acid sequence (337 amino acids) was compared with the sequences of ADHs from four different origins. The amino acid residues responsible for the catalytic activity of horse liver ADH had been clarified on the basis of three-dimensional structure. Since those catalytic amino acid residues were fairly conserved in ADH-T and other ADHs, ADH-T was inferred to have basically the same proton release system as horse liver ADH. The putative proton release system of ADH-T was elucidated by introducing point mutations at the catalytic amino acid residues, Cys-38 (cysteine at position 38), Thr-40, and His-43, with site-directed mutagenesis. The mutant enzyme Thr-40-Ser (Thr-40 was replaced by serine) showed a little lower level of activity than wild-type ADH-T did. The result indicates that the OH group of serine instead of threonine can also be used for the catalytic activity. To change the pKa value of the putative system, His-43 was replaced by the more basic amino acid arginine. As a result, the optimum pH of the mutant enzyme His-43-Arg was shifted from 7.8 (wild-type enzyme) to 9.0. His-43-Arg exhibited a higher level of activity than wild-type enzyme at the optimum pH.

  20. Cloning and sequencing of the gene coding for alcohol dehydrogenase of Bacillus stearothermophilus and rational shift of the optimum pH.

    PubMed Central

    Sakoda, H; Imanaka, T

    1992-01-01

    Using Bacillus subtilis as a host and pTB524 as a vector plasmid, we cloned the thermostable alcohol dehydrogenase (ADH-T) gene (adhT) from Bacillus stearothermophilus NCA1503 and determined its nucleotide sequence. The deduced amino acid sequence (337 amino acids) was compared with the sequences of ADHs from four different origins. The amino acid residues responsible for the catalytic activity of horse liver ADH had been clarified on the basis of three-dimensional structure. Since those catalytic amino acid residues were fairly conserved in ADH-T and other ADHs, ADH-T was inferred to have basically the same proton release system as horse liver ADH. The putative proton release system of ADH-T was elucidated by introducing point mutations at the catalytic amino acid residues, Cys-38 (cysteine at position 38), Thr-40, and His-43, with site-directed mutagenesis. The mutant enzyme Thr-40-Ser (Thr-40 was replaced by serine) showed a little lower level of activity than wild-type ADH-T did. The result indicates that the OH group of serine instead of threonine can also be used for the catalytic activity. To change the pKa value of the putative system, His-43 was replaced by the more basic amino acid arginine. As a result, the optimum pH of the mutant enzyme His-43-Arg was shifted from 7.8 (wild-type enzyme) to 9.0. His-43-Arg exhibited a higher level of activity than wild-type enzyme at the optimum pH. Images PMID:1735726

  1. Identification and analysis of multigene families by comparison of exon fingerprints.

    PubMed

    Brown, N P; Whittaker, A J; Newell, W R; Rawlings, C J; Beck, S

    1995-06-02

    Gene families are often recognised by sequence homology using similarity searching to find relationships, however, genomic sequence data provides gene architectural information not used by conventional search methods. In particular, intron positions and phases are expected to be relatively conserved features, because mis-splicing and reading frame shifts should be selected against. A fast search technique capable of detecting possible weak sequence homologies apparent at the intron/exon level of gene organization is presented for comparing spliceosomal genes and gene fragments. FINEX compares strings of exons delimited by intron/exon boundary positions and intron phases (exon fingerprint) using a global dynamic programming algorithm with a combined intron phase identity and exon size dissimilarity score. Exon fingerprints are typically two orders of magnitude smaller than their nucleic acid sequence counterparts giving rise to fast search times: a ranked search against a library of 6755 fingerprints for a typical three exon fingerprint completes in under 30 seconds on an ordinary workstation, while a worst case largest fingerprint of 52 exons completes in just over one minute. The short "sequence" length of exon fingerprints in comparisons is compensated for by the large exon alphabet compounded of intron phase types and a wide range of exon sizes, the latter contributing the most information to alignments. FINEX performs better in some searches than conventional methods, finding matches with similar exon organization, but low sequence homology. A search using a human serum albumin finds all members of the multigene family in the FINEX database at the top of the search ranking, despite very low amino acid percentage identities between family members. The method should complement conventional sequence searching and alignment techniques, offering a means of identifying otherwise hard to detect homologies where genomic data are available.

  2. Identification of helix capping and β-turn motifs from NMR chemical shifts

    PubMed Central

    Shen, Yang; Bax, Ad

    2012-01-01

    We present an empirical method for identification of distinct structural motifs in proteins on the basis of experimentally determined backbone and 13Cβ chemical shifts. Elements identified include the N-terminal and C-terminal helix capping motifs and five types of β-turns: I, II, I′, II′ and VIII. Using a database of proteins of known structure, the NMR chemical shifts, together with the PDB-extracted amino acid preference of the helix capping and β-turn motifs are used as input data for training an artificial neural network algorithm, which outputs the statistical probability of finding each motif at any given position in the protein. The trained neural networks, contained in the MICS (motif identification from chemical shifts) program, also provide a confidence level for each of their predictions, and values ranging from ca 0.7–0.9 for the Matthews correlation coefficient of its predictions far exceed that attainable by sequence analysis. MICS is anticipated to be useful both in the conventional NMR structure determination process and for enhancing on-going efforts to determine protein structures solely on the basis of chemical shift information, where it can aid in identifying protein database fragments suitable for use in building such structures. PMID:22314702

  3. Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

    PubMed

    Yousaf, Nasim; Gould, David

    2017-01-01

    Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

  4. Local adaptation of Gymnocypris przewalskii (Cyprinidae) on the Tibetan Plateau

    PubMed Central

    Zhang, Renyi; Ludwig, Arne; Zhang, Cunfang; Tong, Chao; Li, Guogang; Tang, Yongtao; Peng, Zuogang; Zhao, Kai

    2015-01-01

    Divergent selection among environments affects species distributions and can lead to speciation. In this article, we investigated the transcriptomes of two ecotypes of scaleless carp (Gymnocypris przewalskii przewalskii and G. p. ganzihonensis) from the Tibetan Plateau. We used a transcriptome sequencing approach to screen approximately 250,000 expressed sequence tags (ESTs) from the gill and kidney tissues of twelve individuals from the Ganzi River and Lake Qinghai to understand how this freshwater fish has adapted to an ecological niche shift from saline to freshwater. We identified 9,429 loci in the gill transcriptome and 12,034 loci in the kidney transcriptome with significant differences in their expression, of which 242 protein-coding genes exhibited strong positive selection (Ka/Ks > 1). Many of the genes are involved in ion channel functions (e.g., Ca2+-binding proteins), immune responses (e.g., nephrosin) or cellular water absorption functions (e.g., aquaporins). These results have potentially broad importance in understanding shifts from saline to freshwater habitats. Furthermore, this study provides the first transcriptome of G. przewalskii, which will facilitate future ecological genomics studies and aid in the identification of genes underlying adaptation and incipient ecological speciation. PMID:25944748

  5. 1,5-(H, RO, RS) shift/6π-electrocyclic ring closure tandem processes on N-[(α-heterosubstituted)-2-tolyl]ketenimines: a case study of relative migratory aptitudes and activating effects.

    PubMed

    Alajarín, Mateo; Bonillo, Baltasar; Orenes, Raúl-Angel; Ortín, María-Mar; Vidal, Angel

    2012-12-28

    A number of N-aryl ketenimines, substituted at the ortho position either with different non-cyclic acetalic functions (acetals, monothioacetals, dithioacetals) or with only one alkoxymethyl or (alkylthio)methyl group, have been prepared and submitted to thermal treatment in toluene solution. Under smooth heating the ketenimines bearing non-cyclic acetals converted into 3,4-dihydroquinolines following two competitive tandem sequences that involve the alternative 1,5 migration of a hydride or alkoxy group as the first mechanistic step, followed by subsequent 6π electrocyclic ring closure. The heterocumulenes bearing acyclic monothioacetal and dithioacetal functions converted via a unique consecutive process involving the selective migration of the alkanethiolate group. Ketenimines bearing only one ether or thioether group transformed exclusively by the tandem sequence initiated by a 1,5 hydride shift. All these transformations provided as final reaction products a variety of quinoline derivatives with a range of substitution patterns. From these experiments the following order of propensity to migration can be extracted: RS > RO > H. It was also possible to estimate the following order of relative activating activities: RO > RS > H.

  6. Cretaceous-Tertiary boundary in the Antarctic: Climatic cooling precedes biotic crisis

    NASA Technical Reports Server (NTRS)

    Stott, Lowell D.; Kennett, James P.

    1988-01-01

    Stable isotopic investigations were conducted on calcareous microfossils across two deep sea Cretaceous-Tertiary boundary sequences on Maud Rise, Weddell Sea, Antarctica. The boundary is taken at the level of massive extinctions in calcareous planktonic microfossils, and coincides with a sharp lithologic change from pure calcareous ooze to calcareous ooze with a large volcanic clay component. The uppermost Maestrichtian is marked by a long-term decrease in delta value of 0 to 18 which spans most of the lower and middle A. mayaroensis Zone and represents a warming trend which culminated in surface water temperatures of about 16 C. At approximately 3 meters below the K-T boundary this warming trend terminates abruptly and benthic and planktonic isotopic records exhibit a rapid increase in delta value of 0 to 18 that continues up to the K-T boundary. The trend towards cooler surface water temperatures stops abruptly at the K-T boundary and delta value of 0 to 18 values remain relatively stable through the Paleocene. Comparison of the Antarctic sequence with the previously documented deep sea records in the South Atlantic reveal shifts of similar magnitude in the latest Maestrichtian. It is indicated that the Southern Ocean underwent the most significant, and apparently permanent, climatic change. The latest Cretaceous oxygen isotopic shift recorded at Maud Rise and other deep sea sites is similar in magnitude to large positive delta valve of 0 to 18 shifts in the middle Eocene, at the Eocene/Oligocene boundary and in the middle Miocene that marked large scale climatic transitions which ultimately lead to cryospheric development of the Antarctic. The climatic shift at the end of the Cretaceous represents one of the most significant climatic transitions recorded in the latest Phanerozoic and had a profound effect on global climate as well as oceanic circulation.

  7. T1 weighted fat/water separated PROPELLER acquired with dual bandwidths.

    PubMed

    Rydén, Henric; Berglund, Johan; Norbeck, Ola; Avventi, Enrico; Skare, Stefan

    2018-04-24

    To describe a fat/water separated dual receiver bandwidth (rBW) spin echo PROPELLER sequence that eliminates the dead time associated with single rBW sequences. A nonuniform noise whitening by regularization of the fat/water inverse problem is proposed, to enable dual rBW reconstructions. Bipolar, flyback, and dual spin echo sequences were developed. All sequences acquire two echoes with different rBW without dead time. Chemical shift displacement was corrected by performing the fat/water separation in k-space, prior to gridding. The proposed sequences were compared to fat saturation, and single rBW sequences, in terms of SNR and CNR efficiency, using clinically relevant acquisition parameters. The impact of motion was investigated. Chemical shift correction greatly improved the image quality, especially at high resolution acquired with low rBW, and also improved motion estimates. SNR efficiency of the dual spin echo sequence was up to 20% higher than the single rBW acquisition, while CNR efficiency was 50% higher for the bipolar acquisition. Noise whitening was deemed necessary for all dual rBW acquisitions, rendering high image quality with strong and homogenous fat suppression. Dual rBW sequences eliminate the dead time present in single rBW sequences, which improves SNR efficiency. In combination with the proposed regularization, this enables highly efficient T1-weighted PROPELLER images without chemical shift displacement. © 2018 International Society for Magnetic Resonance in Medicine.

  8. Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

    NASA Astrophysics Data System (ADS)

    Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

    2016-02-01

    Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

  9. Relationship Between Audio-Vestibular Functional Tests and Inner Ear MRI in Meniere's Disease.

    PubMed

    Quatre, Raphaële; Attyé, Arnaud; Karkas, Alexandre; Job, Agnès; Dumas, Georges; Schmerber, Sébastien

    2018-04-25

    Meniere's disease is an inner ear disorder generally attributed to an endolymphatic hydrops. Different electrophysiological tests and imaging techniques have been developed to improve endolymphatic hydrops diagnosis. The goal of our study was to compare the sensitivity and the specificity of delayed inner ear magnetic resonance imaging (MRI) after intravenous injection of gadolinium with extratympanic clicks electrocochleography (EcochG), phase shift of distortion product otoacoustic emissions (shift-DPOAEs), and cervical vestibular-evoked myogenic potentials (cVEMP) for the diagnosis of Meniere's disease. Forty-one patients, with a total of 50 affected ears, were included prospectively from April 2015 to April 2016 in our institution. Patients included had definite or possible Meniere's disease based on the latest American Academy of Otolaryngology-Head and Neck Surgery guidelines revised in 2015. All patients went through delayed inner ear MRI after intravenous injection of gadolinium (three dimension-fluid attenuated inversion recovery sequences), pure-tone audiometry, extratympanic clicks EcochG, shift-DPOAEs, and cVEMP on the same day. Endolymphatic hydrops was graded on MRI using the saccule to utricle ratio inversion defined as when the saccule appeared equal or larger than the utricle. Abnormal EcochG and shift-DPOAEs in patients with definite Meniere's disease (DMD) were found in 68 and 64.5%, respectively. The two methods were significantly associated in DMD group. In DMD group, 25.7% had a positive MRI. The correlation between MRI versus EcochG and MRI versus shift-DPOAEs was not significant. MRI hydrops detection was correlated with hearing loss. Finally, 22.9% of DMD group had positive cVEMP. EcochG and shift-DPOAEs were both well correlated with clinical criteria of Meniere's disease. Inner ear MRI showed hydrops when hearing loss was higher than 35 dB. The shift-DPOAEs presented the advantage of a rapid and easy measurement if DPOAEs could be recorded (i.e., hearing threshold <60dB). In contrast, EcochG can be performed regardless of hearing loss. In combination with shift-DPOAEs, it enhances the chances to confirm the diagnosis with a better confidence.

  10. Selection of homeotic proteins for binding to a human DNA replication origin.

    PubMed

    de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G

    2000-06-09

    We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.

  11. Exploring Insight: Focus on Shifts of Attention

    ERIC Educational Resources Information Center

    Palatnik, Alik; Koichu, Boris

    2015-01-01

    The paper presents and analyses a sequence of events that preceded an insight solution to a challenging problem in the context of numerical sequences. A three­week long solution process by a pair of ninth­-grade students is analysed by means of the theory of shifts of attention. The goal for this article is to reveal the potential of this theory…

  12. Ecological genomics in Xanthomonas: the nature of genetic adaptation with homologous recombination and host shifts.

    PubMed

    Huang, Chao-Li; Pu, Pei-Hua; Huang, Hao-Jen; Sung, Huang-Mo; Liaw, Hung-Jiun; Chen, Yi-Min; Chen, Chien-Ming; Huang, Ming-Ban; Osada, Naoki; Gojobori, Takashi; Pai, Tun-Wen; Chen, Yu-Tin; Hwang, Chi-Chuan; Chiang, Tzen-Yuh

    2015-03-15

    Comparative genomics provides insights into the diversification of bacterial species. Bacterial speciation usually takes place with lasting homologous recombination, which not only acts as a cohering force between diverging lineages but brings advantageous alleles favored by natural selection, and results in ecologically distinct species, e.g., frequent host shift in Xanthomonas pathogenic to various plants. Using whole-genome sequences, we examined the genetic divergence in Xanthomonas campestris that infected Brassicaceae, and X. citri, pathogenic to a wider host range. Genetic differentiation between two incipient races of X. citri pv. mangiferaeindicae was attributable to a DNA fragment introduced by phages. In contrast to most portions of the genome that had nearly equivalent levels of genetic divergence between subspecies as a result of the accumulation of point mutations, 10% of the core genome involving with homologous recombination contributed to the diversification in Xanthomonas, as revealed by the correlation between homologous recombination and genomic divergence. Interestingly, 179 genes were under positive selection; 98 (54.7%) of these genes were involved in homologous recombination, indicating that foreign genetic fragments may have caused the adaptive diversification, especially in lineages with nutritional transitions. Homologous recombination may have provided genetic materials for the natural selection, and host shifts likely triggered ecological adaptation in Xanthomonas. To a certain extent, we observed positive selection nevertheless contributed to ecological divergence beyond host shifting. Altogether, mediated with lasting gene flow, species formation in Xanthomonas was likely governed by natural selection that played a key role in helping the deviating populations to explore novel niches (hosts) or respond to environmental cues, subsequently triggering species diversification.

  13. Cognitive and physiological effects of an acute physical activity intervention in elementary school children

    PubMed Central

    Jäger, Katja; Schmidt, Mirko; Conzelmann, Achim; Roebers, Claudia M.

    2014-01-01

    The aim of the present study was to investigate the effects of an acute physical activity intervention that included cognitive engagement on executive functions and on cortisol level in young elementary school children. Half of the 104 participating children (6–8 years old) attended a 20-min sport sequence, which included cognitively engaging and playful forms of physical activity. The other half was assigned to a resting control condition. Individual differences in children's updating, inhibition, and shifting performance as well as salivary cortisol were assessed before (pre-test), immediately after (post-test), and 40 min after (follow-up) the intervention or control condition, respectively. Results revealed a significantly stronger improvement in inhibition in the experimental group compared to the control group, while it appeared that acute physical activity had no specific effect on updating and shifting. The intervention effect on inhibition leveled out 40 min after physical activity. Salivary cortisol increased significantly more in the experimental compared to the control group between post-test and follow-up and results support partly the assumed inverted U-shaped relationship between cortisol level and cognitive performance. In conclusion, results indicate that acute physical activity that includes cognitive engagement may have immediate positive effects on inhibition, but not necessarily on updating and shifting in elementary school children. This positive effect may partly be explained through cortisol elevation after acute physical activity. PMID:25566148

  14. Late Quaternary climate and environmental reconstruction based on leaf wax analyses in the loess sequence of Möhlin, Switzerland

    NASA Astrophysics Data System (ADS)

    Wüthrich, Lorenz; Bliedtner, Marcel; Kathrin Schäfer, Imke; Zech, Jana; Shajari, Fatemeh; Gaar, Dorian; Preusser, Frank; Salazar, Gary; Szidat, Sönke; Zech, Roland

    2017-12-01

    We present the results of leaf wax analyses (long-chain n-alkanes) from the 6.8 m deep loess sequence of Möhlin, Switzerland, spanning the last ˜ 70 kyr. Leaf waxes are well preserved and occur in sufficient amounts only down to 0.4 m and below 1.8 m depth, so no paleoenvironmental reconstructions can be done for marine isotope stage (MIS) 2. Compound-specific δ2Hwax analyses yielded similar values for late MIS 3 compared to the uppermost samples, indicating that various effects (e.g., more negative values due to lower temperatures, more positive values due to an enriched moisture source) cancel each other out. A pronounced ˜ 30 ‰ shift towards more negative values probably reflects more humid conditions before ˜ 32 ka. Radiocarbon dating of the n-alkanes corroborates the stratigraphic integrity of leaf waxes and their potential for dating loess-paleosol sequences (LPS) back to ˜ 30 ka.

  15. Optimization of Brain T2 Mapping Using Standard CPMG Sequence In A Clinical Scanner

    NASA Astrophysics Data System (ADS)

    Hnilicová, P.; Bittšanský, M.; Dobrota, D.

    2014-04-01

    In magnetic resonance imaging, transverse relaxation time (T2) mapping is a useful quantitative tool enabling enhanced diagnostics of many brain pathologies. The aim of our study was to test the influence of different sequence parameters on calculated T2 values, including multi-slice measurements, slice position, interslice gap, echo spacing, and pulse duration. Measurements were performed using standard multi-slice multi-echo CPMG imaging sequence on a 1.5 Tesla routine whole body MR scanner. We used multiple phantoms with different agarose concentrations (0 % to 4 %) and verified the results on a healthy volunteer. It appeared that neither the pulse duration, the size of interslice gap nor the slice shift had any impact on the T2. The measurement accuracy was increased with shorter echo spacing. Standard multi-slice multi-echo CPMG protocol with the shortest echo spacing, also the smallest available interslice gap (100 % of slice thickness) and shorter pulse duration was found to be optimal and reliable for calculating T2 maps in the human brain.

  16. Human Genomic Loci Important in Common Infectious Diseases: Role of High-Throughput Sequencing and Genome-Wide Association Studies

    PubMed Central

    Sserwadda, Ivan; Amujal, Marion; Namatovu, Norah

    2018-01-01

    HIV/AIDS, tuberculosis (TB), and malaria are 3 major global public health threats that undermine development in many resource-poor settings. Recently, the notion that positive selection during epidemics or longer periods of exposure to common infectious diseases may have had a major effect in modifying the constitution of the human genome is being interrogated at a large scale in many populations around the world. This positive selection from infectious diseases increases power to detect associations in genome-wide association studies (GWASs). High-throughput sequencing (HTS) has transformed both the management of infectious diseases and continues to enable large-scale functional characterization of host resistance/susceptibility alleles and loci; a paradigm shift from single candidate gene studies. Application of genome sequencing technologies and genomics has enabled us to interrogate the host-pathogen interface for improving human health. Human populations are constantly locked in evolutionary arms races with pathogens; therefore, identification of common infectious disease-associated genomic variants/markers is important in therapeutic, vaccine development, and screening susceptible individuals in a population. This review describes a range of host-pathogen genomic loci that have been associated with disease susceptibility and resistant patterns in the era of HTS. We further highlight potential opportunities for these genetic markers. PMID:29755620

  17. Heterochrony and patterns of cranial suture closure in hystricognath rodents

    PubMed Central

    Wilson, Laura A B; Sánchez-Villagra, Marcelo R

    2009-01-01

    Sutures, joints that allow one bone to articulate with another through intervening fibrous connective tissue, serve as major sites of bone expansion during postnatal craniofacial growth in the vertebrate skull and represent an aspect of cranial ontogeny which may exhibit functional and phylogenetic correlates. Suture evolution among hystricognath rodents, an ecologically diverse group represented here by 26 species, is examined using sequence heterochrony methods, i.e. event pairing and parsimov. Although minor nuances in suture closure sequence exist between species, the overall sequence was found to be conserved both across the hystricognath group and, to an increasing degree, within selected clades. At species level, suture closure pattern exhibited a significant positive correlation with patterns previously reported for hominoids. Patterns for most clades revealed the first sutures to close are those contacting the exoccipital, interparietal, and palatine bones. Heterochronic shifts were found along 19 of 35 branches within the hystricognath phylogeny. The number of shifts per node ranged from one to seven events and, overall, involved 21 of 34 suture sites. The topology generated by parsimony analyses of the event pair matrix yielded only one grouping that was congruent with the evolutionary relationships, compiled from morphological and molecular studies, taken as framework. Sutures contacting the exoccipital displayed the highest levels of most complete closure across all species. Level of suture closure is negatively correlated with cranial length (P < 0.05). Differing life history and locomotory strategies are coupled in part with differing suture closure patterns among several species. PMID:19245501

  18. Measuring (19)F shift anisotropies and (1)H-(19)F dipolar interactions with ultrafast MAS NMR.

    PubMed

    Martini, Francesca; Miah, Habeeba K; Iuga, Dinu; Geppi, Marco; Titman, Jeremy J

    2015-10-01

    A new (19)F anisotropic-isotropic shift correlation experiment is described that operates with ultrafast MAS, resulting in good resolution of isotropic (19)F shifts in the detection dimension. The new experiment makes use of a recoupling sequence designed using symmetry principles that reintroduces the (19)F chemical shift anisotropy in the indirect dimension. The situations in which the new experiment is appropriate are discussed, and the (19)F shift anisotropy parameters in poly(difluoroethylene) (PVDF) are measured. In addition, similar recoupling sequences are shown to be effective for measuring (1)H-(19)F distances via the heteronuclear dipolar interaction. This is demonstrated by application to a recently synthesized zirconium phosphonate material that contains one-dimensional chains linked by H-F hydrogen bonds. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

    PubMed

    Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

    2001-11-01

    Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

  20. Arginine insertion and loss of N-linked glycosylation site in HIV-1 envelope V3 region confer CXCR4-tropism

    PubMed Central

    Tsuchiya, Kiyoto; Ode, Hirotaka; Hayashida, Tsunefusa; Kakizawa, Junko; Sato, Hironori; Oka, Shinichi; Gatanaga, Hiroyuki

    2013-01-01

    The third variable region (V3) of HIV-1 envelope glycoprotein gp120 plays a key role in determination of viral coreceptor usage (tropism). However, which combinations of mutations in V3 confer a tropism shift is still unclear. A unique pattern of mutations in antiretroviral therapy-naive HIV-1 patient was observed associated with the HIV-1 tropism shift CCR5 to CXCR4. The insertion of arginine at position 11 and the loss of the N-linked glycosylation site were indispensable for acquiring pure CXCR4-tropism, which were confirmed by cell-cell fusion assay and phenotype analysis of recombinant HIV-1 variants. The same pattern of mutations in V3 and the associated tropism shift were identified in two of 53 other patients (3.8%) with CD4+ cell count <200/mm3. The combination of arginine insertion and loss of N-linked glycosylation site usually confers CXCR4-tropism. Awareness of this rule will help to confirm the tropism prediction from V3 sequences by conventional rules. PMID:23925152

  1. Dual Regulation of Bacillus subtilis kinB Gene Encoding a Sporulation Trigger by SinR through Transcription Repression and Positive Stringent Transcription Control.

    PubMed

    Fujita, Yasutaro; Ogura, Mitsuo; Nii, Satomi; Hirooka, Kazutake

    2017-01-01

    It is known that transcription of kinB encoding a trigger for Bacillus subtilis sporulation is under repression by SinR, a master repressor of biofilm formation, and under positive stringent transcription control depending on the adenine species at the transcription initiation nucleotide (nt). Deletion and base substitution analyses of the kinB promoter (P kinB ) region using lacZ fusions indicated that either a 5-nt deletion (Δ5, nt -61/-57, +1 is the transcription initiation nt) or the substitution of G at nt -45 with A (G-45A) relieved kinB repression. Thus, we found a pair of SinR-binding consensus sequences (GTTCTYT; Y is T or C) in an inverted orientation (SinR-1) between nt -57/-42, which is most likely a SinR-binding site for kinB repression. This relief from SinR repression likely requires SinI, an antagonist of SinR. Surprisingly, we found that SinR is essential for positive stringent transcription control of P kinB . Electrophoretic mobility shift assay (EMSA) analysis indicated that SinR bound not only to SinR-1 but also to SinR-2 (nt -29/-8) consisting of another pair of SinR consensus sequences in a tandem repeat arrangement; the two sequences partially overlap the '-35' and '-10' regions of P kinB . Introduction of base substitutions (T-27C C-26T) in the upstream consensus sequence of SinR-2 affected positive stringent transcription control of P kinB , suggesting that SinR binding to SinR-2 likely causes this positive control. EMSA also implied that RNA polymerase and SinR are possibly bound together to SinR-2 to form a transcription initiation complex for kinB transcription. Thus, it was suggested in this work that derepression of kinB from SinR repression by SinI induced by Spo0A∼P and occurrence of SinR-dependent positive stringent transcription control of kinB might induce effective sporulation cooperatively, implying an intimate interplay by stringent response, sporulation, and biofilm formation.

  2. Periodic binary sequence generators: VLSI circuits considerations

    NASA Technical Reports Server (NTRS)

    Perlman, M.

    1984-01-01

    Feedback shift registers are efficient periodic binary sequence generators. Polynomials of degree r over a Galois field characteristic 2(GF(2)) characterize the behavior of shift registers with linear logic feedback. The algorithmic determination of the trinomial of lowest degree, when it exists, that contains a given irreducible polynomial over GF(2) as a factor is presented. This corresponds to embedding the behavior of an r-stage shift register with linear logic feedback into that of an n-stage shift register with a single two-input modulo 2 summer (i.e., Exclusive-OR gate) in its feedback. This leads to Very Large Scale Integrated (VLSI) circuit architecture of maximal regularity (i.e., identical cells) with intercell communications serialized to a maximal degree.

  3. 123s and ABCs: developmental shifts in logarithmic-to-linear responding reflect fluency with sequence values.

    PubMed

    Hurst, Michelle; Monahan, K Leigh; Heller, Elizabeth; Cordes, Sara

    2014-11-01

    When placing numbers along a number line with endpoints 0 and 1000, children generally space numbers logarithmically until around the age of 7, when they shift to a predominantly linear pattern of responding. This developmental shift of responding on the number placement task has been argued to be indicative of a shift in the format of the underlying representation of number (Siegler & Opfer, ). In the current study, we provide evidence from both child and adult participants to suggest that performance on the number placement task may not reflect the structure of the mental number line, but instead is a function of the fluency (i.e. ease) with which the individual can work with the values in the sequence. In Experiment 1, adult participants respond logarithmically when placing numbers on a line with less familiar anchors (1639 to 2897), despite linear responding on control tasks with standard anchors involving a similar range (0 to 1287) and a similar numerical magnitude (2000 to 3000). In Experiment 2, we show a similar developmental shift in childhood from logarithmic to linear responding for a non-numerical sequence with no inherent magnitude (the alphabet). In conclusion, we argue that the developmental trend towards linear behavior on the number line task is a product of successful strategy use and mental fluency with the values of the sequence, resulting from familiarity with endpoints and increased knowledge about general ordering principles of the sequence.A video abstract of this article can be viewed at:http://www.youtube.com/watch?v=zg5Q2LIFk3M. © 2014 John Wiley & Sons Ltd.

  4. PSP: rapid identification of orthologous coding genes under positive selection across multiple closely related prokaryotic genomes.

    PubMed

    Su, Fei; Ou, Hong-Yu; Tao, Fei; Tang, Hongzhi; Xu, Ping

    2013-12-27

    With genomic sequences of many closely related bacterial strains made available by deep sequencing, it is now possible to investigate trends in prokaryotic microevolution. Positive selection is a sub-process of microevolution, in which a particular mutation is favored, causing the allele frequency to continuously shift in one direction. Wide scanning of prokaryotic genomes has shown that positive selection at the molecular level is much more frequent than expected. Genes with significant positive selection may play key roles in bacterial adaption to different environmental pressures. However, selection pressure analyses are computationally intensive and awkward to configure. Here we describe an open access web server, which is designated as PSP (Positive Selection analysis for Prokaryotic genomes) for performing evolutionary analysis on orthologous coding genes, specially designed for rapid comparison of dozens of closely related prokaryotic genomes. Remarkably, PSP facilitates functional exploration at the multiple levels by assignments and enrichments of KO, GO or COG terms. To illustrate this user-friendly tool, we analyzed Escherichia coli and Bacillus cereus genomes and found that several genes, which play key roles in human infection and antibiotic resistance, show significant evidence of positive selection. PSP is freely available to all users without any login requirement at: http://db-mml.sjtu.edu.cn/PSP/. PSP ultimately allows researchers to do genome-scale analysis for evolutionary selection across multiple prokaryotic genomes rapidly and easily, and identify the genes undergoing positive selection, which may play key roles in the interactions of host-pathogen and/or environmental adaptation.

  5. Fast registration and reconstruction of aliased low-resolution frames by use of a modified maximum-likelihood approach.

    PubMed

    Alam, M S; Bognar, J G; Cain, S; Yasuda, B J

    1998-03-10

    During the process of microscanning a controlled vibrating mirror typically is used to produce subpixel shifts in a sequence of forward-looking infrared (FLIR) images. If the FLIR is mounted on a moving platform, such as an aircraft, uncontrolled random vibrations associated with the platform can be used to generate the shifts. Iterative techniques such as the expectation-maximization (EM) approach by means of the maximum-likelihood algorithm can be used to generate high-resolution images from multiple randomly shifted aliased frames. In the maximum-likelihood approach the data are considered to be Poisson random variables and an EM algorithm is developed that iteratively estimates an unaliased image that is compensated for known imager-system blur while it simultaneously estimates the translational shifts. Although this algorithm yields high-resolution images from a sequence of randomly shifted frames, it requires significant computation time and cannot be implemented for real-time applications that use the currently available high-performance processors. The new image shifts are iteratively calculated by evaluation of a cost function that compares the shifted and interlaced data frames with the corresponding values in the algorithm's latest estimate of the high-resolution image. We present a registration algorithm that estimates the shifts in one step. The shift parameters provided by the new algorithm are accurate enough to eliminate the need for iterative recalculation of translational shifts. Using this shift information, we apply a simplified version of the EM algorithm to estimate a high-resolution image from a given sequence of video frames. The proposed modified EM algorithm has been found to reduce significantly the computational burden when compared with the original EM algorithm, thus making it more attractive for practical implementation. Both simulation and experimental results are presented to verify the effectiveness of the proposed technique.

  6. Application of carbon isotope stratigraphy to late miocene shallow marine sediments, new zealand.

    PubMed

    Loutit, T S; Kennett, J P

    1979-06-15

    A distinct (0.5 per mil) carbon-13/carbon-12 isotopic shift in the light direction has been identified in a shallow marine sedimentary sequence of Late Miocene age at Blind River, New Zealand, and correlated with a similar shift in Late Miocene Deep Sea Drilling Project sequences throughout the Indo-Pacific. A dated piston core provides an age for the shift of 6.2 +/- 0.1 million years. Correlations based on the carbon isotopic change require a revision of the previously established magnetostratigraphy at Blind River. The carbon shift at Blind River occurs between 6.2 and 6.3 +/- 0.1 million years before present. A new chronology provides an age for the evolutionary first appearance datum of Globorotalia conomiozea at 6.1 +/- 0.1 million years, the beginning of a distinct latest Miocene cooling event associated with the Kapitean stage at 6.2 +/- 0.1 million years, and the beginning of a distinct shallowing of water depths at 6.1 +/- 0.1 million years. The Miocene-Pliocene boundary as recognized in New Zealand is now dated at 5.3 +/- 0.1 million years. Extension of carbon isotope stratigraphy to other shallow Late Miocene sequences should provide an important datum for international correlation of Late Miocene shallow and deep marine sequences.

  7. Molecular mechanisms of ribosomal protein gene coregulation

    PubMed Central

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B. Franklin

    2015-01-01

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20–50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1–TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  8. Positive selection of the peripheral B cell repertoire in gut-associated lymphoid tissues

    PubMed Central

    Rhee, Ki-Jong; Jasper, Paul J.; Sethupathi, Periannan; Shanmugam, Malathy; Lanning, Dennis; Knight, Katherine L.

    2005-01-01

    Gut-associated lymphoid tissues (GALTs) interact with intestinal microflora to drive GALT development and diversify the primary antibody repertoire; however, the molecular mechanisms that link these events remain elusive. Alicia rabbits provide an excellent model to investigate the relationship between GALT, intestinal microflora, and modulation of the antibody repertoire. Most B cells in neonatal Alicia rabbits express VHn allotype immunoglobulin (Ig)M. Within weeks, the number of VHn B cells decreases, whereas VHa allotype B cells increase in number and become predominant. We hypothesized that the repertoire shift from VHn to VHa B cells results from interactions between GALT and intestinal microflora. To test this hypothesis, we surgically removed organized GALT from newborn Alicia pups and ligated the appendix to sequester it from intestinal microflora. Flow cytometry and nucleotide sequence analyses revealed that the VHn to VHa repertoire shift did not occur, demonstrating the requirement for interactions between GALT and intestinal microflora in the selective expansion of VHa B cells. By comparing amino acid sequences of VHn and VHa Ig, we identified a putative VH ligand binding site for a bacterial or endogenous B cell superantigen. We propose that interaction of such a superantigen with VHa B cells results in their selective expansion. PMID:15623575

  9. A pilot study of durvalumab and tremelimumab and immunogenomic dynamics in metastatic breast cancer

    PubMed Central

    Santa-Maria, Cesar August; Kato, Taigo; Park, Jae-Hyun; Kiyotani, Kazuma; Rademaker, Alfred; Shah, Ami N.; Gross, Leeaht; Blanco, Luis Z.; Jain, Sarika; Flaum, Lisa; Tellez, Claudia; Stein, Regina; Uthe, Regina; Gradishar, William J.; Cristofanilli, Massimo; Nakamura, Yusuke; Giles, Francis J.

    2018-01-01

    Immune checkpoint inhibitors produce modest responses in metastatic breast cancer, however, combination approaches may improve responses. A single arm pilot study was designed to determine the overall response rate (ORR) of durvalumab and tremelimumab, and evaluate immunogenomic dynamics in metastatic endocrine receptor (ER) positive or triple negative breast cancer (TNBC). Simon two-stage design indicated at least four responses from the first 18 patients were needed to proceed with the second stage. T-cell receptor (TCR) sequencing and immune-gene expression profiling were conducted at baseline and two months, whole exome sequencing was conducted at baseline. Eighteen evaluable patients were accrued (11 ER-positive; seven TNBC). Only three patients had a response (ORR = 17%), thus the study did not proceed to the second stage. Responses were only observed in patients with TNBC (ORR = 43%). Responders versus non-responders had upregulation of CD8, granzyme A, and perforin 1 gene expression, and higher mutational and neoantigen burden. Patients with TNBC had an oligoclonal shift of the most abundant TCR-beta clonotypes compared to those with ER-positive disease, p = 0.004. We conclude responses are low in unselected metastatic breast cancer, however, higher rates of clinical benefit were observed in TNBC. Immunogenomic dynamics may help identify phenotypes most likely to respond to immunotherapy. PMID:29721177

  10. Sequence stratigraphy of the Lower Cenomanian Bahariya Formation, Bahariya Oasis, Western Desert, Egypt

    NASA Astrophysics Data System (ADS)

    Catuneanu, O.; Khalifa, M. A.; Wanas, H. A.

    2006-08-01

    The Lower Cenomanian Bahariya Formation corresponds to a second-order depositional sequence that formed within a continental shelf setting under relatively low-rate conditions of positive accommodation (< 200 m during 3-6 My). This overall trend of base-level rise was interrupted by three episodes of base-level fall that resulted in the formation of third-order sequence boundaries. These boundaries are represented by subaerial unconformities (replaced or not by younger transgressive wave ravinement surfaces), and subdivide the Bahariya Formation into four third-order depositional sequences. The construction of the sequence stratigraphic framework of the Bahariya Formation is based on the lateral and vertical changes between shelf, subtidal, coastal and fluvial facies, as well as on the nature of contacts that separate them. The internal (third-order) sequence boundaries are associated with incised valleys, which explain (1) significant lateral changes in the thickness of incised valley fill deposits, (2) the absence of third-order highstand and even transgressive systems tracts in particular areas, and (3) the abrupt facies shifts that may occur laterally over relatively short distances. Within each sequence, the concepts of lowstand, transgressive and highstand systems tracts are used to explain the observed lateral and vertical facies variability. This case study demonstrates the usefulness of sequence stratigraphic analysis in understanding the architecture and stacking patterns of the preserved rock record, and helps to identify 13 stages in the history of base-level changes that marked the evolution of the Bahariya Oasis region during the Early Cenomanian.

  11. Image encryption algorithm based on multiple mixed hash functions and cyclic shift

    NASA Astrophysics Data System (ADS)

    Wang, Xingyuan; Zhu, Xiaoqiang; Wu, Xiangjun; Zhang, Yingqian

    2018-08-01

    This paper proposes a new one-time pad scheme for chaotic image encryption that is based on the multiple mixed hash functions and the cyclic-shift function. The initial value is generated using both information of the plaintext image and the chaotic sequences, which are calculated from the SHA1 and MD5 hash algorithms. The scrambling sequences are generated by the nonlinear equations and logistic map. This paper aims to improve the deficiencies of traditional Baptista algorithms and its improved algorithms. We employ the cyclic-shift function and piece-wise linear chaotic maps (PWLCM), which give each shift number the characteristics of chaos, to diffuse the image. Experimental results and security analysis show that the new scheme has better security and can resist common attacks.

  12. Dixon quantitative chemical shift MRI for bone marrow evaluation in the lumbar spine: a reproducibility study in healthy volunteers.

    PubMed

    Maas, M; Akkerman, E M; Venema, H W; Stoker, J; Den Heeten, G J

    2001-01-01

    The purpose of this work was to explore the reproducibility of fat-fraction measurements using Dixon quantitative chemical shift imaging (QCSI) in the lumbar spine (L3, L4, and L5) of healthy volunteers. Sixteen healthy volunteers were examined at 1.5 T two times to obtain a repeated measurement in the same slice and a third time in three parallel slices. Single slice, two point Dixon SE (TR/TE 2,500/22.3) sequences were used, from which fat-fraction images were calculated. The fat-fraction results are presented as averages over regions of interest, which were derived from the contours of the vertebrae. Reproducibility measures related to repeated measurements on different days, slice position, and contour drawing were calculated. The mean fat fraction was 0.37 (SD 0.08). The SD due to repeated measurement was small (sigmaR = 0.013-0.032), almost all of which can be explained by slice-(re)-positioning errors. When used to evaluate the same person longitudinally in time, Dixon QCSI fat-fraction measurement has an excellent reproducibility. It is a powerful noninvasive tool in the evaluation of bone marrow composition.

  13. Flexibility of centromere and kinetochore structures

    PubMed Central

    Burrack, Laura S.; Berman, Judith

    2012-01-01

    Centromeres, and the kinetochores that assemble on them, are essential for accurate chromosome segregation. Diverse centromere organization patterns and kinetochore structures have evolved in eukaryotes ranging from yeast to humans. In addition, centromere DNA and kinetochore position can vary even within individual cells. This flexibility manifests in several ways: centromere DNA sequences evolve rapidly, kinetochore positions shift in response to altered chromosome structure, and kinetochore complex numbers change in response to fluctuations in kinetochore protein levels. Despite their differences, all of these diverse structures promote efficient chromosome segregation. This robustness is inherent to chromosome segregation mechanisms and balances genome stability with adaptability. In this review, we explore the mechanisms and consequences of centromere and kinetochore flexibility as well as the benefits and limitations of different experimental model systems for studying them. PMID:22445183

  14. Measurement of the membrane dipole electric field in DMPC vesicles using vibrational shifts of p-cyanophenylalanine and molecular dynamics simulations.

    PubMed

    Shrestha, Rebika; Cardenas, Alfredo E; Elber, Ron; Webb, Lauren J

    2015-02-19

    The magnitude of the membrane dipole field was measured using vibrational Stark effect (VSE) shifts of nitrile oscillators placed on the unnatural amino acid p-cyanophenylalanine (p-CN-Phe) added to a peptide sequence at four unique positions. These peptides, which were based on a repeating alanine-leucine motif, intercalated into small unilamellar DMPC vesicles which formed an α-helix as confirmed by circular dichroic (CD) spectroscopy. Molecular dynamics simulations of the membrane-intercalated helix containing two of the nitrile probes, one near the headgroup region of the lipid (αLAX(25)) and one buried in the interior of the bilayer (αLAX(16)), were used to examine the structure of the nitrile with respect to the membrane normal, the assumed direction of the dipole field, by quantifying both a small tilt of the helix in the bilayer and conformational rotation of the p-CN-Phe side chain at steady state. Vibrational absorption energies of the nitrile oscillator at each position showed a systematic blue shift as the nitrile was stepped toward the membrane interior; for several different concentrations of peptide, the absorption energy of the nitrile located in the middle of the bilayer was ∼3 cm(-1) greater than that of the nitrile closest to the surface of the membrane. Taken together, the measured VSE shifts and nitrile orientations within the membrane resulted in an absolute magnitude of 8-11 MV/cm for the dipole field, at the high end of the range of possible values that have been accumulated from a variety of indirect measurements. Implications for this are discussed.

  15. Measurement of the Membrane Dipole Electric Field in DMPC Vesicles Using Vibrational Shifts of p-Cyanophenylalanine and Molecular Dynamics Simulations

    PubMed Central

    Shrestha, Rebika; Cardenas, Alfredo E.; Elber, Ron; Webb, Lauren J.

    2015-01-01

    The magnitude of the membrane dipole field was measured using vibrational Stark effect (VSE) shifts of nitrile oscillators placed on the unnatural amino acid p-cyanophenylalanine (p-CN-Phe) added to a peptide sequence at four unique positions. These peptides, which were based on a repeating alanine-leucine motif, intercalated into small unilamellar DMPC vesicles which formed an α-helix as confirmed by circular dichroic (CD) spectroscopy. Molecular dynamics simulations of the membrane-intercalated helix containing two of the nitrile probes, one near the head-group region of the lipid (αLAX(25)) and one buried in the interior of the bilayer (αLAX(16)), were used to examine the structure of the nitrile with respect to the membrane normal, the assumed direction the dipole field, by quantifying both a small tilt of the helix in the bilayer and conformational rotation of the p-CN-Phe side chain at steady-state. Vibrational absorption energies of the nitrile oscillator at each position showed a systematic blue shift as the nitrile was stepped towards the membrane interior; for several different concentrations of peptide, the absorption energy of the nitrile located in the middle of the bilayer was ~3 cm−1 greater than that of the nitrile closest to the surface of the membrane. Taken together, the measured VSE shifts and nitrile orientations within the membrane resulted in a value of 8 – 11 MV/cm for the dipole field, at the high end of the range of possible values that have been accumulated from a variety of indirect measurements. Implications for this are discussed. PMID:25602635

  16. Compression of computer generated phase-shifting hologram sequence using AVC and HEVC

    NASA Astrophysics Data System (ADS)

    Xing, Yafei; Pesquet-Popescu, Béatrice; Dufaux, Frederic

    2013-09-01

    With the capability of achieving twice the compression ratio of Advanced Video Coding (AVC) with similar reconstruction quality, High Efficiency Video Coding (HEVC) is expected to become the newleading technique of video coding. In order to reduce the storage and transmission burden of digital holograms, in this paper we propose to use HEVC for compressing the phase-shifting digital hologram sequences (PSDHS). By simulating phase-shifting digital holography (PSDH) interferometry, interference patterns between illuminated three dimensional( 3D) virtual objects and the stepwise phase changed reference wave are generated as digital holograms. The hologram sequences are obtained by the movement of the virtual objects and compressed by AVC and HEVC. The experimental results show that AVC and HEVC are efficient to compress PSDHS, with HEVC giving better performance. Good compression rate and reconstruction quality can be obtained with bitrate above 15000kbps.

  17. Technical Note: MR-visualization of interventional devices using transient field alterations and balanced steady-state free precession imaging.

    PubMed

    Eibofner, Frank; Martirosian, Petros; Würslin, Christian; Graf, Hansjörg; Syha, Roland; Clasen, Stephan

    2015-11-01

    In interventional magnetic resonance imaging, instruments can be equipped with conducting wires for visualization by current application. The potential of sequence triggered application of transient direct currents in balanced steady-state free precession (bSSFP) imaging is demonstrated. A conductor and a modified catheter were examined in water phantoms and in an ex vivo porcine liver. The current was switched by a trigger pulse in the bSSFP sequence in an interval between radiofrequency pulse and signal acquisition. Magnitude and phase images were recorded. Regions with transient field alterations were evaluated by a postprocessing algorithm. A phase mask was computed and overlaid with the magnitude image. Transient field alterations caused continuous phase shifts, which were separated by the postprocessing algorithm from phase jumps due to persistent field alterations. The overlaid images revealed the position of the conductor. The modified catheter generated visible phase offset in all orientations toward the static magnetic field and could be unambiguously localized in the ex vivo porcine liver. The application of a sequence triggered, direct current in combination with phase imaging allows conspicuous localization of interventional devices with a bSSFP sequence.

  18. Positive attitudinal shifts with the Physics by Inquiry curriculum across multiple implementations

    NASA Astrophysics Data System (ADS)

    Lindsey, Beth A.; Hsu, Leonardo; Sadaghiani, Homeyra; Taylor, Jack W.; Cummings, Karen

    2012-06-01

    Recent publications have documented positive attitudinal shifts on the Colorado Learning Attitudes about Science Survey (CLASS) among students enrolled in courses with an explicit epistemological focus. We now report positive attitudinal shifts in classes using the Physics by Inquiry (PbI) curriculum, which has only an implicit focus on student epistemologies and nature of science issues. These positive shifts have occurred in several different implementations of the curriculum, across multiple institutions and multiple semesters. In many classes, students experienced significant attitudinal shifts in the problem-solving categories of the CLASS, despite the conceptual focus of most PbI courses.

  19. Epigenetically-inherited centromere and neocentromere DNA replicates earliest in S-phase.

    PubMed

    Koren, Amnon; Tsai, Hung-Ji; Tirosh, Itay; Burrack, Laura S; Barkai, Naama; Berman, Judith

    2010-08-19

    Eukaryotic centromeres are maintained at specific chromosomal sites over many generations. In the budding yeast Saccharomyces cerevisiae, centromeres are genetic elements defined by a DNA sequence that is both necessary and sufficient for function; whereas, in most other eukaryotes, centromeres are maintained by poorly characterized epigenetic mechanisms in which DNA has a less definitive role. Here we use the pathogenic yeast Candida albicans as a model organism to study the DNA replication properties of centromeric DNA. By determining the genome-wide replication timing program of the C. albicans genome, we discovered that each centromere is associated with a replication origin that is the first to fire on its respective chromosome. Importantly, epigenetic formation of new ectopic centromeres (neocentromeres) was accompanied by shifts in replication timing, such that a neocentromere became the first to replicate and became associated with origin recognition complex (ORC) components. Furthermore, changing the level of the centromere-specific histone H3 isoform led to a concomitant change in levels of ORC association with centromere regions, further supporting the idea that centromere proteins determine origin activity. Finally, analysis of centromere-associated DNA revealed a replication-dependent sequence pattern characteristic of constitutively active replication origins. This strand-biased pattern is conserved, together with centromere position, among related strains and species, in a manner independent of primary DNA sequence. Thus, inheritance of centromere position is correlated with a constitutively active origin of replication that fires at a distinct early time. We suggest a model in which the distinct timing of DNA replication serves as an epigenetic mechanism for the inheritance of centromere position.

  20. Characterization of the rat RALDH1 promoter. A functional CCAAT and octamer motif are critical for basal promoter activity.

    PubMed

    Guimond, Julie; Devost, Dominic; Brodeur, Helene; Mader, Sylvie; Bhat, Pangala V

    2002-12-12

    Retinal dehydrogenase type 1 (RALDH1) catalyzes the oxidation of retinal to retinoic acid (RA), a metabolite of vitamin A important for embryogenesis and tissue differentiation. Rat RALDH1 is expressed to high levels in developing kidney, and in stomach, intestine epithelia. To understand the mechanisms of the transcriptional regulation of rat RALDH1, we cloned a 1360-base pair (bp) 5'-flanking region of RALDH1 gene. Using luciferase reporter constructs transfected into HEK 293 and LLCPK (kidney-derived) cells, basal promoter activity was associated with sequences between -80 and +43. In this minimal promoter region, TATA and CCAAT cis-acting elements as well as SP1, AP1 and octamer (Oct)-binding sites were present. The CCAAT box and Oct-binding site, located between positions -72 and -68 and -56 and -49, respectively, were shown by deletion analysis and site-directed mutation to be critical for promoter activity. Nuclear extracts from kidney cells contain proteins specifically binding the Oct and CCAAT sequences, resulting in the formation of six complexes, while different patterns of complexes were observed with non-kidney cell extracts. Gel shift assays using either single or double mutations of the Oct and CCAAT sequences as well as super shift assays demonstrated single and double occupancy of these two sites by Oct-1 and CBF-A. In addition, unidentified proteins also bound the Oct motif specifically in the absence of CBF-A binding. These results demonstrate specific involvement of Oct and CCAAT-binding proteins in the regulation of RALDH1 gene.

  1. Methods for magnetic resonance analysis using magic angle technique

    DOEpatents

    Hu, Jian Zhi [Richland, WA; Wind, Robert A [Kennewick, WA; Minard, Kevin R [Kennewick, WA; Majors, Paul D [Kennewick, WA

    2011-11-22

    Methods of performing a magnetic resonance analysis of a biological object are disclosed that include placing the object in a main magnetic field (that has a static field direction) and in a radio frequency field; rotating the object at a frequency of less than about 100 Hz around an axis positioned at an angle of about 54.degree.44' relative to the main magnetic static field direction; pulsing the radio frequency to provide a sequence that includes a phase-corrected magic angle turning pulse segment; and collecting data generated by the pulsed radio frequency. In particular embodiments the method includes pulsing the radio frequency to provide at least two of a spatially selective read pulse, a spatially selective phase pulse, and a spatially selective storage pulse. Further disclosed methods provide pulse sequences that provide extended imaging capabilities, such as chemical shift imaging or multiple-voxel data acquisition.

  2. Cognitive and motor shifting aptitude disorder in Parkinson's disease.

    PubMed Central

    Cools, A R; van den Bercken, J H; Horstink, M W; van Spaendonck, K P; Berger, H J

    1984-01-01

    Eighteen patients suffering from Parkinson's disease and nineteen control subjects, who were matched for age and intelligence, were compared in tests measuring "shifting aptitude" at cognitive and motor levels (word production, sorting blocks or animals, and finger pushing sequences). It was found that Parkinson patients produced fewer different names of animals and professions in one minute than control subjects, needed more trials for detecting a shift in a sorting criterion, and produced fewer finger responses in a change of pushing sequence than control subjects. These results are interpreted as reflecting a central programming deficit that manifests itself in verbal, figural and motor modalities, that is, a diminished "shifting aptitude" characteristic of patients with dysfunctioning basal ganglia. The results are discussed in relation to changes of behaviour organisations in animals with dysfunctioning basal ganglia. PMID:6736974

  3. Evolutionary Plasticity of AmrZ Regulation in Pseudomonas

    PubMed Central

    Dougherty, Kevin; Diaz, Beatriz; Murillo, Rachel

    2018-01-01

    ABSTRACT amrZ encodes a master regulator protein conserved across pseudomonads, which can be either a positive or negative regulator of swimming motility depending on the species examined. To better understand plasticity in the regulatory function of AmrZ, we characterized the mode of regulation for this protein for two different motility-related phenotypes in Pseudomonas stutzeri. As in Pseudomonas syringae, AmrZ functions as a positive regulator of swimming motility within P. stutzeri, which suggests that the functions of this protein with regard to swimming motility have switched at least twice across pseudomonads. Shifts in mode of regulation cannot be explained by changes in AmrZ sequence alone. We further show that AmrZ acts as a positive regulator of colony spreading within this strain and that this regulation is at least partially independent of swimming motility. Closer investigation of mechanistic shifts in dual-function regulators like AmrZ could provide unique insights into how transcriptional pathways are rewired between closely related species. IMPORTANCE Microbes often display finely tuned patterns of gene regulation across different environments, with major regulatory changes controlled by a small group of “master” regulators within each cell. AmrZ is a master regulator of gene expression across pseudomonads and can be either a positive or negative regulator for a variety of pathways depending on the strain and genomic context. Here, we demonstrate that the phenotypic outcomes of regulation of swimming motility by AmrZ have switched at least twice independently in pseudomonads, so that AmrZ promotes increased swimming motility in P. stutzeri and P. syringae but represses this phenotype in Pseudomonas fluorescens and Pseudomonas aeruginosa. Since examples of switches in regulatory mode are relatively rare, further investigation into the mechanisms underlying shifts in regulator function for AmrZ could provide unique insights into the evolution of bacterial regulatory proteins. PMID:29669886

  4. SU-D-207A-05: Investigating Sparse-Sampled MRI for Motion Management in Thoracic Radiotherapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sabouri, P; Sawant, A; Arai, T

    Purpose: Sparse sampling and reconstruction-based MRI techniques represent an attractive strategy to achieve sufficiently high image acquisition speed while maintaining image quality for the task of radiotherapy guidance. In this study, we examine rapid dynamic MRI using a sparse sampling sequence k-t BLAST in capturing motion-induced, cycle-to-cycle variations in tumor position. We investigate the utility of long-term MRI-based motion monitoring as a means of better characterizing respiration-induced tumor motion compared to a single-cycle 4DCT. Methods: An MRI-compatible, programmable, deformable lung motion phantom with eleven 1.5 ml water marker tubes was placed inside a 3.0 T whole-body MR scanner (Philips Ingenia).more » The phantom was programmed with 10 lung tumor motion traces previously recorded using the Synchrony system. 2D+t image sequences of a coronal slice were acquired using a balanced-SSFP sequence combined with k-t BLAST (accn=3, resolution=0.66×0.66×5 mm3; acquisition time = 110 ms/slice). kV fluoroscopic (ground truth) and 4DCT imaging was performed with the same phantom setup and motion trajectories. Marker positions in all three modalities were segmented and tracked using an opensource deformable image registration package, NiftyReg. Results: Marker trajectories obtained from rapid MRI exhibited <1 mm error compared to kv Fluoro trajectories in the presence of complex motion including baseline shifts and changes in respiratory amplitude, indicating the ability of MRI to monitor motion with adequate geometric fidelity for the purpose of radiotherapy guidance. In contrast, the trajectory derived from 4DCT exhibited significant errors up to 6 mm due to cycle-to-cycle variations and baseline shifts. Consequently, 4DCT was found to underestimate the range of marker motion by as much as 50%. Conclusion: Dynamic MRI is a promising tool for radiotherapy motion management as it permits for longterm, dose-free, soft-tissue-based monitoring of motion, yielding richer and more accurate information about tumor position and motion range compared to the current state-of-the-art, 4DCT. This work was partially supported through research funding from National Institutes of Health (R01CA169102).« less

  5. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  6. Age and the balance of emotions.

    PubMed

    Ross, Catherine E; Mirowsky, John

    2008-06-01

    With age, the quality of emotions may shift from negative in tone to positive, but also from active to passive. The shift from negative to positive is consistent with the age as maturity perspective. The shift from active to passive supports the age as decline perspective. If these generalities are correct, then they should apply to positive emotions as well as negative emotions. We should see a shift in positive emotions from active (excitement) to passive (serenity), as well as in the negative emotions (from the agitation of anxiety and anger to the lethargy of depression). In order to accurately portray the shifts in emotional tone, age may best be considered as simultaneously indicating maturity and decline. This paper examines results from the emotions module of the 1996 U.S. General Social Survey and finds support for the idea that age is associated with a shift from negative to positive and from active to passive emotions.

  7. Novel antigenic shift in HA sequences of H1N1 viruses detected by big data analysis.

    PubMed

    Zhang, Ruiying; Xu, Chongfeng; Duan, Ziyuan

    2017-07-01

    The influenza virus H1N1 has been prevalent all over the world for nearly a century. Many studies on its evolutionary history, substitution rate and antigenicity-associated sites have been done with small datasets. To have a complete view, we analysed 3171 full-length HA sequences from human H1N1 viruses sampled from 1918 to 2016, and discovered a new clade has formed with sequences isolated in Iran. Based on genetic distance calculations, we revealed an uneven evolutionary rate among sequences isolated in different years. We also found that the HA1 fragment of the new clade is like that of viruses that existed in the 1930s, while the HA2 fragment is closely associated with strains isolated after the 2009 pandemic. This new, "mixed" HA sequence indicates a cryptic antigenic shift event occurred, and it should draw more attention to the new clade identified from sequences from Iran. Copyright © 2017. Published by Elsevier B.V.

  8. The interplay of representations and patterns of classroom discourse in science teaching sequences

    NASA Astrophysics Data System (ADS)

    Tang, Kok-Sing

    2016-09-01

    The purpose of this study is to examines the relationship between the communicative approach of classroom talk and the modes of representations used by science teachers. Based on video data from two physics classrooms in Singapore, a recurring pattern in the relationship was observed as the teaching sequence of a lesson unfolded. It was found that as the mode of representation shifted from enactive (action based) to iconic (image based) to symbolic (language based), there was a concurrent and coordinated shift in the classroom communicative approach from interactive-dialogic to interactive-authoritative to non-interactive-authoritative. Specifically, the shift from enactive to iconic to symbolic representations occurred mainly within the interactive-dialogic approach while the shift towards the interactive-authoritative and non-interactive-authoritative approaches occurred when symbolic modes of representation were used. This concurrent and coordinated shift has implications on how we conceive the use of representations in conjunction with the co-occurring classroom discourse, both theoretically and pedagogically.

  9. Memory for sequences of events impaired in typical aging.

    PubMed

    Allen, Timothy A; Morris, Andrea M; Stark, Shauna M; Fortin, Norbert J; Stark, Craig E L

    2015-03-01

    Typical aging is associated with diminished episodic memory performance. To improve our understanding of the fundamental mechanisms underlying this age-related memory deficit, we previously developed an integrated, cross-species approach to link converging evidence from human and animal research. This novel approach focuses on the ability to remember sequences of events, an important feature of episodic memory. Unlike existing paradigms, this task is nonspatial, nonverbal, and can be used to isolate different cognitive processes that may be differentially affected in aging. Here, we used this task to make a comprehensive comparison of sequence memory performance between younger (18-22 yr) and older adults (62-86 yr). Specifically, participants viewed repeated sequences of six colored, fractal images and indicated whether each item was presented "in sequence" or "out of sequence." Several out of sequence probe trials were used to provide a detailed assessment of sequence memory, including: (i) repeating an item from earlier in the sequence ("Repeats"; e.g., AB A: DEF), (ii) skipping ahead in the sequence ("Skips"; e.g., AB D: DEF), and (iii) inserting an item from a different sequence into the same ordinal position ("Ordinal Transfers"; e.g., AB 3: DEF). We found that older adults performed as well as younger controls when tested on well-known and predictable sequences, but were severely impaired when tested using novel sequences. Importantly, overall sequence memory performance in older adults steadily declined with age, a decline not detected with other measures (RAVLT or BPS-O). We further characterized this deficit by showing that performance of older adults was severely impaired on specific probe trials that required detailed knowledge of the sequence (Skips and Ordinal Transfers), and was associated with a shift in their underlying mnemonic representation of the sequences. Collectively, these findings provide unambiguous evidence that the capacity to remember sequences of events is fundamentally affected by typical aging. © 2015 Allen et al.; Published by Cold Spring Harbor Laboratory Press.

  10. Putting Physics First: Three Case Studies of High School Science Department and Course Sequence Reorganization

    ERIC Educational Resources Information Center

    Larkin, Douglas B.

    2016-01-01

    This article examines the process of shifting to a "Physics First" sequence in science course offerings in three school districts in the United States. This curricular sequence reverses the more common U.S. high school sequence of biology/chemistry/physics, and has gained substantial support in the physics education community over the…

  11. Goos-Hänchen shifts of partially coherent light beams from a cavity with a four-level Raman gain medium

    NASA Astrophysics Data System (ADS)

    Ziauddin; Lee, Ray-Kuang; Qamar, Sajid

    2016-09-01

    We theoretically investigate spatial and angular Goos-Hänchen (GH) shifts (both negative and positive) in the reflected light for a partial coherent light incident on a cavity. A four-level Raman gain atomic medium is considered in a cavity. The effects of spatial coherence, beam width, and mode index of partial coherent light fields on spatial and angular GH shifts are studied. Our results reveal that a large magnitude of negative and positive GH shifts in the reflected light is achievable with the introduction of partial coherent light fields. Furthermore, the amplitude of spatial (negative and positive) GH shifts are sharply affected by the partial coherent light beam as compared to angular (negative and positive) GH shifts in the reflected light.

  12. Rubella virus genotypes in the People's Republic of China between 1979 and 2007: a shift in endemic viruses during the 2001 Rubella Epidemic.

    PubMed

    Zhu, Zhen; Abernathy, Emily; Cui, Aili; Zhang, Yan; Zhou, Shujie; Zhang, Zhenying; Wang, Changyin; Wang, Tongzhan; Ling, Hua; Zhao, Chunfang; Chen, Yingqiong; He, Jilan; Sun, Li; Chen, Xia; Tang, Jihai; Feng, Daxin; Wang, Yan; Ba, Zhuoma; Fan, Lixia; Chen, Haiyun; Pan, Zhengfan; Zhan, Jun; Chen, Hui; Zhou, Shunde; Zheng, Lei; Gao, Hui; Liang, Yong; Dai, Defang; Icenogle, Joseph; Xu, Wenbo

    2010-05-01

    The incidence of rubella cases in China from 1991 to 2007 was reviewed, and the nucleotide sequences from 123 rubella viruses collected during 1999 to 2007 and 4 viral sequences previously reported from 1979 to 1984 were phylogenetically analyzed. Rubella vaccination was not included in national immunization programs in China before 2007. Changes in endemic viruses were compared with incidences of rubella epidemics. The results showed that rubella epidemics occur approximately every 6 to 8 years (1993/1994, 2001, and 2007), and a shift of disease burden to susceptible young adults was observed. The Chinese rubella virus sequences were categorized into 5 of the 13 rubella virus genotypes, 1a, 1E, 1F, 2A, and 2B; cocirculations of these different genotypes were found in China. In Anhui province, a shift in the predominant genotype from 1F and 2B to 1E coincided with the 2001 rubella epidemic. This shift may have occurred throughout China during 2001 to 2007. This study investigated the genotype distribution of rubella viruses in China over a 28-year period to establish an important genetic baseline in China during its prevaccination era.

  13. Positive Attitudinal Shifts with the Physics by Inquiry Curriculum across Multiple Implementations

    ERIC Educational Resources Information Center

    Lindsey, Beth A.; Hsu, Leonardo; Sadaghiani, Homeyra; Taylor, Jack W.; Cummings, Karen

    2012-01-01

    Recent publications have documented positive attitudinal shifts on the Colorado Learning Attitudes about Science Survey (CLASS) among students enrolled in courses with an explicit epistemological focus. We now report positive attitudinal shifts in classes using the "Physics by Inquiry" ("PbI") curriculum, which has only an…

  14. Memory for sequences of events impaired in typical aging

    PubMed Central

    Allen, Timothy A.; Morris, Andrea M.; Stark, Shauna M.; Fortin, Norbert J.

    2015-01-01

    Typical aging is associated with diminished episodic memory performance. To improve our understanding of the fundamental mechanisms underlying this age-related memory deficit, we previously developed an integrated, cross-species approach to link converging evidence from human and animal research. This novel approach focuses on the ability to remember sequences of events, an important feature of episodic memory. Unlike existing paradigms, this task is nonspatial, nonverbal, and can be used to isolate different cognitive processes that may be differentially affected in aging. Here, we used this task to make a comprehensive comparison of sequence memory performance between younger (18–22 yr) and older adults (62–86 yr). Specifically, participants viewed repeated sequences of six colored, fractal images and indicated whether each item was presented “in sequence” or “out of sequence.” Several out of sequence probe trials were used to provide a detailed assessment of sequence memory, including: (i) repeating an item from earlier in the sequence (“Repeats”; e.g., ABADEF), (ii) skipping ahead in the sequence (“Skips”; e.g., ABDDEF), and (iii) inserting an item from a different sequence into the same ordinal position (“Ordinal Transfers”; e.g., AB3DEF). We found that older adults performed as well as younger controls when tested on well-known and predictable sequences, but were severely impaired when tested using novel sequences. Importantly, overall sequence memory performance in older adults steadily declined with age, a decline not detected with other measures (RAVLT or BPS-O). We further characterized this deficit by showing that performance of older adults was severely impaired on specific probe trials that required detailed knowledge of the sequence (Skips and Ordinal Transfers), and was associated with a shift in their underlying mnemonic representation of the sequences. Collectively, these findings provide unambiguous evidence that the capacity to remember sequences of events is fundamentally affected by typical aging. PMID:25691514

  15. Critical slowing down associated with regime shifts in the US housing market

    NASA Astrophysics Data System (ADS)

    Tan, James Peng Lung; Cheong, Siew Siew Ann

    2014-02-01

    Complex systems are described by a large number of variables with strong and nonlinear interactions. Such systems frequently undergo regime shifts. Combining insights from bifurcation theory in nonlinear dynamics and the theory of critical transitions in statistical physics, we know that critical slowing down and critical fluctuations occur close to such regime shifts. In this paper, we show how universal precursors expected from such critical transitions can be used to forecast regime shifts in the US housing market. In the housing permit, volume of homes sold and percentage of homes sold for gain data, we detected strong early warning signals associated with a sequence of coupled regime shifts, starting from a Subprime Mortgage Loans transition in 2003-2004 and ending with the Subprime Crisis in 2007-2008. Weaker signals of critical slowing down were also detected in the US housing market data during the 1997-1998 Asian Financial Crisis and the 2000-2001 Technology Bubble Crisis. Backed by various macroeconomic data, we propose a scenario whereby hot money flowing back into the US during the Asian Financial Crisis fueled the Technology Bubble. When the Technology Bubble collapsed in 2000-2001, the hot money then flowed into the US housing market, triggering the Subprime Mortgage Loans transition in 2003-2004 and an ensuing sequence of transitions. We showed how this sequence of couple transitions unfolded in space and in time over the whole of US.

  16. Effects of Gene Duplication, Positive Selection, and Shifts in Gene Expression on the Evolution of the Venom Gland Transcriptome in Widow Spiders

    PubMed Central

    Haney, Robert A.; Clarke, Thomas H.; Gadgil, Rujuta; Fitzpatrick, Ryan; Hayashi, Cheryl Y.; Ayoub, Nadia A.; Garb, Jessica E.

    2016-01-01

    Gene duplication and positive selection can be important determinants of the evolution of venom, a protein-rich secretion used in prey capture and defense. In a typical model of venom evolution, gene duplicates switch to venom gland expression and change function under the action of positive selection, which together with further duplication produces large gene families encoding diverse toxins. Although these processes have been demonstrated for individual toxin families, high-throughput multitissue sequencing of closely related venomous species can provide insights into evolutionary dynamics at the scale of the entire venom gland transcriptome. By assembling and analyzing multitissue transcriptomes from the Western black widow spider and two closely related species with distinct venom toxicity phenotypes, we do not find that gene duplication and duplicate retention is greater in gene families with venom gland biased expression in comparison with broadly expressed families. Positive selection has acted on some venom toxin families, but does not appear to be in excess for families with venom gland biased expression. Moreover, we find 309 distinct gene families that have single transcripts with venom gland biased expression, suggesting that the switching of genes to venom gland expression in numerous unrelated gene families has been a dominant mode of evolution. We also find ample variation in protein sequences of venom gland–specific transcripts, lineage-specific family sizes, and ortholog expression among species. This variation might contribute to the variable venom toxicity of these species. PMID:26733576

  17. Molecular mechanisms of ribosomal protein gene coregulation.

    PubMed

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. © 2015 Reja et al.; Published by Cold Spring Harbor Laboratory Press.

  18. Identification of squid species by melting temperature shifts on fluorescence melting curve analysis (FMCA) using single dual-labeled probe

    NASA Astrophysics Data System (ADS)

    Koh, Eunjung; Song, Ha Jeong; Kwon, Na Young; Kim, Gi Won; Lee, Kwang Ho; Jo, Soyeon; Park, Sujin; Park, Jihyun; Park, Eun Kyeong; Hwang, Seung Yong

    2017-06-01

    Real time PCR is a standard method for identification of species. One of limitations of the qPCR is that there would be false-positive result due to mismatched hybridization between target sequence and probe depending on the annealing temperature in the PCR condition. As an alternative, fluorescence melting curve analysis (FMCA) could be applied for species identification. FMCA is based on a dual-labeled probe. Even with subtle difference of target sequence, there are visible melting temperature (Tm) shift. One of FMCA applications is distinguishing organisms distributed and consumed globally as popular food ingredients. Their prices are set by species or country of origin. However, counterfeiting or distributing them without any verification procedure are becoming social problems and threatening food safety. Besides distinguishing them in naked eye is very difficult and almost impossible in any processed form. Therefore, it is necessary to identify species in molecular level. In this research three species of squids which have 1-2 base pair differences each are selected as samples since they have the same issue. We designed a probe which perfectly matches with one species and the others mismatches 2 and 1 base pair respectively and labeled with fluorophore and quencher. In an experiment with a single probe, we successfully distinguished them by Tm shift depending on the difference of base pair. By combining FMCA and qPCR chip, smaller-scale assay with higher sensitivity and resolution could be possible, andc furthermore, enabling results analysis with smart phone would realize point-of-care testing (POCT).

  19. Task 1.5 Genomic Shift and Drift Trends of Emerging Pathogens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Borucki, M

    2010-01-05

    The Lawrence Livermore National Laboratory (LLNL) Bioinformatics group has recently taken on a role in DTRA's Transformation Medical Technologies Initiative (TMTI). The high-level goal of TMTI is to accelerate the development of broad-spectrum countermeasures. To achieve those goals, TMTI has a near term need to conduct analyses of genomic shift and drift trends of emerging pathogens, with a focused eye on select agent pathogens, as well as antibiotic and virulence markers. Most emerging human pathogens are zoonotic viruses with a genome composed of RNA. The high mutation rate of the replication enzymes of RNA viruses contributes to sequence drift andmore » provides one mechanism for these viruses to adapt to diverse hosts (interspecies transmission events) and cause new human and zoonotic diseases. Additionally, new viral pathogens frequently emerge due to genetic shift (recombination and segment reassortment) which allows for dramatic genotypic and phenotypic changes to occur rapidly. Bacterial pathogens also evolve via genetic drift and shift, although sequence drift generally occurs at a much slower rate for bacteria as compared to RNA viruses. However, genetic shift such as lateral gene transfer and inter- and intragenomic recombination enables bacteria to rapidly acquire new mechanisms of survival and antibiotic resistance. New technologies such as rapid whole genome sequencing of bacterial genomes, ultra-deep sequencing of RNA virus populations, metagenomic studies of environments rich in antibiotic resistance genes, and the use of microarrays for the detection and characterization of emerging pathogens provide mechanisms to address the challenges posed by the rapid emergence of pathogens. Bioinformatic algorithms that enable efficient analysis of the massive amounts of data generated by these technologies as well computational modeling of protein structures and evolutionary processes need to be developed to allow the technology to fulfill its potential.« less

  20. Impact of Public Safety Policies on Human Immunodeficiency Virus Transmission Dynamics in Tijuana, Mexico.

    PubMed

    Mehta, Sanjay R; Chaillon, Antoine; Gaines, Tommi L; Gonzalez-Zuniga, Patricia E; Stockman, Jamila K; Almanza-Reyes, Horatio; Chavez, Jose Roman; Vera, Alicia; Wagner, Karla D; Patterson, Thomas L; Scott, Brianna; Smith, Davey M; Strathdee, Steffanie A

    2018-02-10

    North Tijuana, Mexico is home to many individuals at high risk for transmitting and acquiring human immunodeficiency virus (HIV). Recently, policy shifts by local government impacted how these individuals were handled by authorities. Here we examined how this affected regional HIV transmission dynamics. HIV pol sequences and associated demographic information were collected from 8 research studies enrolling persons in Tijuana and were used to infer viral transmission patterns. To evaluate the impact of recent policy changes on HIV transmission dynamics, qualitative interviews were performed on a subset of recently infected individuals. Between 2004 and 2016, 288 unique HIV pol sequences were obtained from individuals in Tijuana, including 46.4% from men who have sex with men, 42.1% from individuals reporting transactional sex, and 27.8% from persons who inject drugs (some individuals had >1 risk factor). Forty-two percent of sequences linked to at least 1 other sequence, forming 37 transmission clusters. Thirty-two individuals seroconverted during the observation period, including 8 between April and July 2016. Three of these individuals were putatively linked together. Qualitative interviews suggested changes in policing led individuals to shift locations of residence and injection drug use, leading to increased risk taking (eg, sharing needles). Near real-time molecular epidemiologic analyses identified a cluster of linked transmissions temporally associated with policy shifts. Interviews suggested these shifts may have led to increased risk taking among individuals at high risk for HIV acquisition. With all public policy shifts, downstream impacts need to be carefully considered, as even well-intentioned policies can have major public health consequences. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  1. A Selective-Echo Method for Chemical-Shift Imaging of Two-Component Systems

    NASA Astrophysics Data System (ADS)

    Gerald, Rex E., II; Krasavin, Anatoly O.; Botto, Robert E.

    A simple and effective method for selectively imaging either one of two chemical species in a two-component system is presented and demonstrated experimentally. The pulse sequence employed, selective- echo chemical- shift imaging (SECSI), is a hybrid (frequency-selective/ T1-contrast) technique that is executed in a short period of time, utilizes the full Boltzmann magnetization of each chemical species to form the corresponding image, and requires only hard pulses of quadrature phase. This approach provides a direct and unambiguous representation of the spatial distribution of the two chemical species. In addition, the performance characteristics and the advantages of the SECSI sequence are compared on a common basis to those of other pulse sequences.

  2. There is Diversity in Disorder-"In all Chaos there is a Cosmos, in all Disorder a Secret Order".

    PubMed

    Nielsen, Jakob T; Mulder, Frans A A

    2016-01-01

    The protein universe consists of a continuum of structures ranging from full order to complete disorder. As the structured part of the proteome has been intensively studied, stably folded proteins are increasingly well documented and understood. However, proteins that are fully, or in large part, disordered are much less well characterized. Here we collected NMR chemical shifts in a small database for 117 protein sequences that are known to contain disorder. We demonstrate that NMR chemical shift data can be brought to bear as an exquisite judge of protein disorder at the residue level, and help in validation. With the help of secondary chemical shift analysis we demonstrate that the proteins in the database span the full spectrum of disorder, but still, largely segregate into two classes; disordered with small segments of order scattered along the sequence, and structured with small segments of disorder inserted between the different structured regions. A detailed analysis reveals that the distribution of order/disorder along the sequence shows a complex and asymmetric distribution, that is highly protein-dependent. Access to ratified training data further suggests an avenue to improving prediction of disorder from sequence.

  3. A model-adaptivity method for the solution of Lennard-Jones based adhesive contact problems

    NASA Astrophysics Data System (ADS)

    Ben Dhia, Hachmi; Du, Shuimiao

    2018-05-01

    The surface micro-interaction model of Lennard-Jones (LJ) is used for adhesive contact problems (ACP). To address theoretical and numerical pitfalls of this model, a sequence of partitions of contact models is adaptively constructed to both extend and approximate the LJ model. It is formed by a combination of the LJ model with a sequence of shifted-Signorini (or, alternatively, -Linearized-LJ) models, indexed by a shift parameter field. For each model of this sequence, a weak formulation of the associated local ACP is developed. To track critical localized adhesive areas, a two-step strategy is developed: firstly, a macroscopic frictionless (as first approach) linear-elastic contact problem is solved once to detect contact separation zones. Secondly, at each shift-adaptive iteration, a micro-macro ACP is re-formulated and solved within the multiscale Arlequin framework, with significant reduction of computational costs. Comparison of our results with available analytical and numerical solutions shows the effectiveness of our global strategy.

  4. An analysis by metabolic labelling of the encephalomyocarditis virus ribosomal frameshifting efficiency and stimulators.

    PubMed

    Ling, Roger; Firth, Andrew E

    2017-08-01

    Programmed -1 ribosomal frameshifting is a mechanism of gene expression whereby specific signals within messenger RNAs direct a proportion of ribosomes to shift -1 nt and continue translating in the new reading frame. Such frameshifting normally depends on an RNA structure stimulator 3'-adjacent to a 'slippery' heptanucleotide shift site sequence. Recently we identified an unusual frameshifting mechanism in encephalomyocarditis virus, where the stimulator involves a trans-acting virus protein. Thus, in contrast to other examples of -1 frameshifting, the efficiency of frameshifting in encephalomyocarditis virus is best studied in the context of virus infection. Here we use metabolic labelling to analyse the frameshifting efficiency of wild-type and mutant viruses. Confirming previous results, frameshifting depends on a G_GUU_UUU shift site sequence and a 3'-adjacent stem-loop structure, but is not appreciably affected by the 'StopGo' sequence present ~30 nt upstream. At late timepoints, frameshifting was estimated to be 46-76 % efficient.

  5. Biosensors for DNA sequence detection

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  6. Positive selection of the peripheral B cell repertoire in gut-associated lymphoid tissues.

    PubMed

    Rhee, Ki-Jong; Jasper, Paul J; Sethupathi, Periannan; Shanmugam, Malathy; Lanning, Dennis; Knight, Katherine L

    2005-01-03

    Gut-associated lymphoid tissues (GALTs) interact with intestinal microflora to drive GALT development and diversify the primary antibody repertoire; however, the molecular mechanisms that link these events remain elusive. Alicia rabbits provide an excellent model to investigate the relationship between GALT, intestinal microflora, and modulation of the antibody repertoire. Most B cells in neonatal Alicia rabbits express V(H)n allotype immunoglobulin (Ig)M. Within weeks, the number of V(H)n B cells decreases, whereas V(H)a allotype B cells increase in number and become predominant. We hypothesized that the repertoire shift from V(H)n to V(H)a B cells results from interactions between GALT and intestinal microflora. To test this hypothesis, we surgically removed organized GALT from newborn Alicia pups and ligated the appendix to sequester it from intestinal microflora. Flow cytometry and nucleotide sequence analyses revealed that the V(H)n to V(H)a repertoire shift did not occur, demonstrating the requirement for interactions between GALT and intestinal microflora in the selective expansion of V(H)a B cells. By comparing amino acid sequences of V(H)n and V(H)a Ig, we identified a putative V(H) ligand binding site for a bacterial or endogenous B cell superantigen. We propose that interaction of such a superantigen with V(H)a B cells results in their selective expansion.

  7. Quantification of mRNA expression by competitive PCR using non-homologous competitors containing a shifted restriction site

    PubMed Central

    Watzinger, Franz; Hörth, Elfriede; Lion, Thomas

    2001-01-01

    Despite the recent introduction of real-time PCR methods, competitive PCR techniques continue to play an important role in nucleic acid quantification because of the significantly lower cost of equipment and consumables. Here we describe a shifted restriction-site competitive PCR (SRS-cPCR) assay based on a modified type of competitor. The competitor fragments are designed to contain a recognition site for a restriction endonuclease that is also present in the target sequence to be quantified, but in a different position. Upon completion of the PCR, the amplicons are digested in the same tube with a single restriction enzyme, without the need to purify PCR products. The generated competitor- and target-specific restriction fragments display different sizes, and can be readily separated by electrophoresis and quantified by image analysis. Suboptimal digestion affects competitor- and target-derived amplicons to the same extent, thus eliminating the problem of incorrect quantification as a result of incomplete digestion of PCR products. We have established optimized conditions for a panel of 20 common restriction endonucleases permitting efficient digestion in PCR buffer. It is possible, therefore, to find a suitable restriction site for competitive PCR in virtually any sequence of interest. The assay presented is inexpensive, widely applicable, and permits reliable and accurate quantification of nucleic acid targets. PMID:11376164

  8. The influence of the loop between residues 223-235 in beetle luciferase bioluminescence spectra: a solvent gate for the active site of pH-sensitive luciferases.

    PubMed

    Viviani, Vadim R; Silva Neto, Antonio J; Arnoldi, Frederico G C; Barbosa, João A R G; Ohmiya, Yoshihiro

    2008-01-01

    Beetle luciferases emit a wide range of bioluminescence colors, ranging from green to red. Firefly luciferases can shift the spectrum to red in response to pH and temperature changes, whereas click beetle and railroadworm luciferases do not. Despite many studies on firefly luciferases, the origin of pH-sensitivity is far from being understood. Through comparative site-directed mutagenesis and modeling studies, using the pH-sensitive luciferases (Macrolampis and Cratomorphus distinctus fireflies) and the pH-insensitive luciferases (Pyrearinus termitilluminans, Phrixotrix viviani and Phrixotrix hirtus) cloned by our group, here we show that substitutions dramatically affecting bioluminescence colors in both groups of luciferases are clustered in the loop between residues 223-235 (Photinus pyralis sequence). The substitutions at positions 227, 228 and 229 (P. pyralis sequence) cause dramatic redshift and temporal shift in both groups of luciferases, indicating their involvement in labile interactions. Modeling studies showed that the residues Y227 and N229 are buried in the protein core, fixing the loop to other structural elements participating at the bottom of the luciferin binding site. Changes in pH and temperature (in firefly luciferases), as well as point mutations in this loop, may disrupt the interactions of these structural elements exposing the active site and modulating bioluminescence colors.

  9. Effects of Site-Specific Guanine C8-Modifications on an Intramolecular DNA G-Quadruplex

    PubMed Central

    Lech, Christopher Jacques; Cheow Lim, Joefina Kim; Wen Lim, Jocelyn Mei; Amrane, Samir; Heddi, Brahim; Phan, Anh Tuân

    2011-01-01

    Understanding the fundamentals of G-quadruplex formation is important both for targeting G-quadruplexes formed by natural sequences and for engineering new G-quadruplexes with desired properties. Using a combination of experimental and computational techniques, we have investigated the effects of site-specific substitution of a guanine with C8-modified guanine derivatives, including 8-bromo-guanine, 8-O-methyl-guanine, 8-amino-guanine, and 8-oxo-guanine, within a well-defined (3 + 1) human telomeric G-quadruplex platform. The effects of substitutions on the stability of the G-quadruplex were found to depend on the type and position of the modification among different guanines in the structure. An interesting modification-dependent NMR chemical-shift effect was observed across basepairing within a guanine tetrad. This effect was reproduced by ab initio quantum mechanical computations, which showed that the observed variation in imino proton chemical shift is largely influenced by changes in hydrogen-bond geometry within the guanine tetrad. PMID:22004753

  10. Multi-proxy study of Ocean Anoxic Event 2 (Cenomanian-Turonian) yields new perspective on the drivers for Mesozoic anoxic events

    NASA Astrophysics Data System (ADS)

    Sageman, B. B.; Hurtgen, M.; Jacobson, A. D.; Selby, D. S.

    2015-12-01

    Mesozoic ocean anoxic events have long been a focus of intense study because they appear to reflect a large-scale oscillation of the marine redox state from oxic to anoxic, and at least locally sulfidic. The consensus view on the cause of these events has changed over the past 39 years, since they were first defined. A global net increase in primary production is now widely accepted as the key driver, and the evidence for a volcanic trigger of this process is strong. However, the exact pathway from volcanism to OAE is less certain. Some authors favor the direct role of a massive load of reduced compounds in LIP hydrothermal fluxes for consuming available marine oxygen. Others prefer the indirect pathway of oxygen consumption by enhanced organic matter flux, which requires a major increase in nutrient budgets. Metallic micronutrients in the hydrothermal fluxes have been hypothesized, as have increases in riverine phosphorus fluxes due to enhanced weathering that would result from volcanic CO2 driven warming. Our recent work on the OAE2 interval has led to some new ideas about these hypothesized drivers. In particular, refinement of the Late Cenomanian time scale, and comparison of the geochemical records of d13C, d34S, Osi, P phases, and d44Ca between selected sections in North America and Europe has suggested the following sequence of events: 1) Osi data indicate that the onset of a major volcanic event precedes the positive shift in C-isotopes by at least 40 to possibly 180 kyr; 2) a positive shift in d44Ca data interpreted to indicate ocean acidification is coincident with the volcanic event; 3) the positive shift in C-isotopes is interpreted to reflect the accumulated burial of marine organic matter sufficient to shift the C-reservoir to heavier values; thus, our data suggest that up to 180 kyr was required for the shift in nutrient supply, productivity increase, and organic matter burial. Two mechanisms that conceivably match the lagged character of the event are benthic phosphorus release due to increased microbial sulfate reduction and removal of the iron-oxyhydroxide trap for carbonate fluorapatite (Adams et al., 2010), and/or increased benthic phosphorus release due to acidification of carbonate surface sediments.

  11. A not-so-big crisis: re-reading Silurian conodont diversity in a sequence-stratigraphic framework

    NASA Astrophysics Data System (ADS)

    Jarochowska, Emilia; Munnecke, Axel

    2016-04-01

    Conodonts are extensively used in Ordovician through Triassic biostratigraphy and fossil-based geochemistry. However, their distribution in rock successions is commonly taken at face value, without taking into account their diverse and poorly understood ecology. Multielement taxonomy, ontogenetic and environmental variability, difficulties in extraction, and relative rarity all contribute to the general lack of quantitative studies on conodont stratigraphic distribution and temporal turnover. With respect to Silurian conodonts, the concept of recurrent conodont extinction events - the so called Ireviken, Mulde and Lau events - has become a standard in the stratigraphic literature. The concept has been proposed based on qualitative observations of local extirpations of open-marine pelagic or nekto-benthic taxa and temporary dominance of shallow-water species in the Silurian succession of the Swedish island of Gotland. These changes coincided with positive carbon isotope excursions, abrupt facies shifts, "blooms" of benthic fauna, and changes in reef communities, which have all been combined into a general view of Silurian bio-geochemical events. This view posits a deterministic, reproducible pattern in Silurian conodont diversity, attributed to recurrent ecological or geochemical conditions. The growing body of sequence-stratigraphic interpretations across these events in Gotland and other sections worldwide indicate that in all cases the Silurian "events" are associated with rapid global regressions. This suggests that faunal changes such as the dominance of shallow-water, low-diversity conodont fauna and the increase of benthic invertebrate diversity and abundance represent predictable consequences of the variation in the completeness of the rock record and preservation potential of different environments. Our studies in Poland and Ukraine indicate that the magnitude of change in the taxonomic composition of conodont assemblages across the middle Silurian global regression and the hypothesized Mulde Event is proportional to the associated facies shift. Quantitative data on facies distribution of individual conodont species combined with sequence stratigraphic architecture provides a testable model for the impact of sea-level changes on perceived conodont diversity in a section or basin. This approach highlights the need for quantitative data on conodont distribution in their environmental context, their integration into conodont-based stratigraphy and geochemistry, and for the regular use of Occam's razor to interpretations of paleobiodiversity.

  12. Dynamics and computation in functional shifts

    NASA Astrophysics Data System (ADS)

    Namikawa, Jun; Hashimoto, Takashi

    2004-07-01

    We introduce a new type of shift dynamics as an extended model of symbolic dynamics, and investigate the characteristics of shift spaces from the viewpoints of both dynamics and computation. This shift dynamics is called a functional shift, which is defined by a set of bi-infinite sequences of some functions on a set of symbols. To analyse the complexity of functional shifts, we measure them in terms of topological entropy, and locate their languages in the Chomsky hierarchy. Through this study, we argue that considering functional shifts from the viewpoints of both dynamics and computation gives us opposite results about the complexity of systems. We also describe a new class of shift spaces whose languages are not recursively enumerable.

  13. Food Safety in the Age of Next Generation Sequencing, Bioinformatics, and Open Data Access.

    PubMed

    Taboada, Eduardo N; Graham, Morag R; Carriço, João A; Van Domselaar, Gary

    2017-01-01

    Public health labs and food regulatory agencies globally are embracing whole genome sequencing (WGS) as a revolutionary new method that is positioned to replace numerous existing diagnostic and microbial typing technologies with a single new target: the microbial draft genome. The ability to cheaply generate large amounts of microbial genome sequence data, combined with emerging policies of food regulatory and public health institutions making their microbial sequences increasingly available and public, has served to open up the field to the general scientific community. This open data access policy shift has resulted in a proliferation of data being deposited into sequence repositories and of novel bioinformatics software designed to analyze these vast datasets. There also has been a more recent drive for improved data sharing to achieve more effective global surveillance, public health and food safety. Such developments have heightened the need for enhanced analytical systems in order to process and interpret this new type of data in a timely fashion. In this review we outline the emergence of genomics, bioinformatics and open data in the context of food safety. We also survey major efforts to translate genomics and bioinformatics technologies out of the research lab and into routine use in modern food safety labs. We conclude by discussing the challenges and opportunities that remain, including those expected to play a major role in the future of food safety science.

  14. Gene expression of galectin-9/ecalectin, a potent eosinophil chemoattractant, and/or the insertional isoform in human colorectal carcinoma cell lines and detection of frame-shift mutations for protein sequence truncations in the second functional lectin domain.

    PubMed

    Lahm, H; Hoeflich, A; Andre, S; Sordat, B; Kaltner, H; Wolf, E; Gabius, H J

    2000-09-01

    The family of Ca2+-independent galactoside-binding lectins with the beta-strand topology of the jelly-roll, referred to as galectins, is known to mediate and modulate a variety of cellular activities. Their functional versatility explains the current interest in monitoring their expression in cancer research, so far primarily focused on galectin-1 and -3. Tandem-repeat-type galectin-9 and its (most probably) allelic variant ecalectin, a potent eosinophil chemoattractant, are known to be human leukocyte products. We show by RT-PCR with primers specific for both that their mRNA is expressed in 17 of 21 human colorectal cancer lines. As also indicated by restriction analysis, in addition to the expected transcript of 571 bp an otherwise identical isoform coding for a 32-amino acid extension of the link peptide was detected. Positive cell lines differentially expressed either one (7 lines) or both transcripts (10 lines). Sequence analysis of RT-PCR products, performed in four cases, allowed to assign the standard transcript to ecalectin in the case of SW480 cells and detected two point mutations in the insert of the link peptide-coding sequence in WiDr and Colo205. Furthermore, this analysis identified the insertion of a single nucleotide into the coding sequence generating a frame-shift mutation, an event which has so far not been reported for any galectin. This alteration encountered in both transcripts of the WiDr line and the isoform transcript of Colo205 cells will most likely truncate the protein part within the second (C-terminal) carbohydrate recognition domain. Our results thus reveal the presence of mRNA for a galectin-9-isoform or a potent eosinophil chemoattractant (ecalectin) or a truncated version thereof with preserved N-terminal carbohydrate recognition domain in established human colon cancer cell lines.

  15. Optimization of sequence alignment for simple sequence repeat regions.

    PubMed

    Jighly, Abdulqader; Hamwieh, Aladdin; Ogbonnaya, Francis C

    2011-07-20

    Microsatellites, or simple sequence repeats (SSRs), are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs) mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs).SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type.When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic phylogenic relationship.

  16. Novel approach for identification of influenza virus host range and zoonotic transmissible sequences by determination of host-related associative positions in viral genome segments.

    PubMed

    Kargarfard, Fatemeh; Sami, Ashkan; Mohammadi-Dehcheshmeh, Manijeh; Ebrahimie, Esmaeil

    2016-11-16

    Recent (2013 and 2009) zoonotic transmission of avian or porcine influenza to humans highlights an increase in host range by evading species barriers. Gene reassortment or antigenic shift between viruses from two or more hosts can generate a new life-threatening virus when the new shuffled virus is no longer recognized by antibodies existing within human populations. There is no large scale study to help understand the underlying mechanisms of host transmission. Furthermore, there is no clear understanding of how different segments of the influenza genome contribute in the final determination of host range. To obtain insight into the rules underpinning host range determination, various supervised machine learning algorithms were employed to mine reassortment changes in different viral segments in a range of hosts. Our multi-host dataset contained whole segments of 674 influenza strains organized into three host categories: avian, human, and swine. Some of the sequences were assigned to multiple hosts. In point of fact, the datasets are a form of multi-labeled dataset and we utilized a multi-label learning method to identify discriminative sequence sites. Then algorithms such as CBA, Ripper, and decision tree were applied to extract informative and descriptive association rules for each viral protein segment. We found informative rules in all segments that are common within the same host class but varied between different hosts. For example, for infection of an avian host, HA14V and NS1230S were the most important discriminative and combinatorial positions. Host range identification is facilitated by high support combined rules in this study. Our major goal was to detect discriminative genomic positions that were able to identify multi host viruses, because such viruses are likely to cause pandemic or disastrous epidemics.

  17. A systematic approach to magnetic resonance imaging evaluation of epiphyseal lesions.

    PubMed

    Thawait, Shrey K; Thawait, Gaurav K; Frassica, Frank J; Andreisek, Gustav; Carrino, John A; Chhabra, Avneesh

    2013-04-01

    Magnetic Resonance Imaging (MRI) is the preferred modality of choice to image epiphyseal lesions. It provides excellent soft tissue resolution and extent of disease. A wide spectrum of tumor and tumor like lesions can involve the epiphysis. Early and accurate diagnosis as well as appropriate management of epiphyseal lesions is critical as these conditions may lead to disabling complications such as, limb length discrepancy, angular or joint surface deformities and secondary osteoarthritis. In this article, we discuss the role of conventional sequences, such as T1W, fluid sensitive T2W and intravenous (IV) Gadolinium enhanced sequences as well as the additional value of problem solving MRI sequences such as, chemical shift and diffusion weighted imaging. Based on the imaging findings on various MRI sequences and lesion characteristics, a systematic approach directed to the diagnoses of epiphyseal lesions is presented and discussed. MRI features of clinically and biopsy proven examples of the epiphyseal lesions, such as osteomyelitis, intra-osseous abscess, infiltrative malignancy, metastases, transient osteoporosis, subchondral insufficiency fracture, avascular necrosis, osteochondral fracture, osteochondritis dissecans, eosinophilic granuloma and geode are demonstrated. Using this systematic approach, the reader will be able to better characterize epiphyseal lesions with a potential to positively affect patient management. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. [The high content of palmitinic fatty acid in food as a major cause of increase of concentration of cholesterol and low density lipoproteins and atheromatous plaques of arteries' intima].

    PubMed

    Titov, V N

    2013-02-01

    The positioning of individual triglycerides of blood serum in palmitinic and oleic lipoproteins ofvery low density in the order ofincrease of the rate constant of their hydrolysis under action of post-heparin lipoprotein leads to the sequence as follows: palmitoil-palmitoil-palmitate-->palmitoil-palmitoil-oleate-->palmitoil-oleil-palmitat-->oleil-palmitoil-palmitate-->oleil-palmitate-palmitate-->oleil-oleil-palmitate-->oleil-oleil-oleate. The shift to the left and to the right is discerned with this spectrum of isoforms of triglycerides. The shift to the left into direction of palmitinicc triglycerides occurs in case of eating of animal food (i.e. beef andfoodstuf of fat saw milk) when the content of palmitinic saturated fatty acid supersedes 15% of fatty acids total and under the development of endogenic syndrome of insulin resistance. The content of low density lipoproteins cholesterol is high in blood The shift to the right with prevalence of oleinic triglycerides occurs in case of low content of beef and foodstuff of fat saw milk in food, fish eating, seafood and olive oil. The physiologic levels of carbohydrates in food and insulin function are present too. The shift to the right initiates the action of insulin, ometa-3 essential polyenic fatty acids, glytazones and fibrates. They increase the activity of delta9-stearil-KoA-desaturase-2 and the transformation of palmitine saturated fatty acid into mono unsaturated oleinic fatty acid. The shift to the left forms the palmitine alternative of metabolism of substrate to supply cells with energy. The shift to the right is a more effective oleinic alternative.

  19. Reducing the gradient artefact in simultaneous EEG-fMRI by adjusting the subject's axial position.

    PubMed

    Mullinger, Karen J; Yan, Winston X; Bowtell, Richard

    2011-02-01

    Large artefacts that compromise EEG data quality are generated when electroencephalography (EEG) and functional magnetic resonance imaging (fMRI) are carried out concurrently. The gradient artefact produced by the time-varying magnetic field gradients is the largest of these artefacts. Although average artefact correction (AAS) and related techniques can remove the majority of this artefact, the need to avoid amplifier saturation necessitates the use of a large dynamic range and strong low-pass filtering in EEG recording. Any intrinsic reduction in the gradient artefact amplitude would allow data with a higher bandwidth to be acquired without amplifier saturation, thus increasing the frequency range of neuronal activity that can be investigated using combined EEG-fMRI. Furthermore, gradient artefact correction methods assume a constant artefact morphology over time, so their performance is compromised by subject movement. Since the resulting, residual gradient artefacts can easily swamp signals from brain activity, any reduction in their amplitude would be highly advantageous for simultaneous EEG-fMRI studies. The aim of this work was to investigate whether adjustment of the subject's axial position in the MRI scanner can reduce the amplitude of the induced gradient artefact, before and after artefact correction using AAS. The variation in gradient artefact amplitude as a function of the subject's axial position was first investigated in six subjects by applying gradient pulses along the three Cartesian axes. The results of this study showed that a significant reduction in the gradient artefact magnitude can be achieved by shifting the subject axially by 4 cm towards the feet relative to the standard subject position (nasion at iso-centre). In a further study, the 4-cm shift was shown to produce a 40% reduction in the RMS amplitude (and a 31% reduction in the range) of the gradient artefact generated during the execution of a standard multi-slice, EPI sequence. By picking out signals occurring at harmonics of the slice acquisition frequency, it was also shown that the 4-cm shift led to a 36% reduction in the residual gradient artefact after AAS. Functional and anatomical MR data quality is not affected by the 4-cm shift, as the head remains in the homogeneous region of the static magnet field and gradients. Copyright © 2010 Elsevier Inc. All rights reserved.

  20. Evaluation of liver fat in the presence of iron with MRI using T2* correction: a clinical approach.

    PubMed

    Henninger, Benjamin; Benjamin, Henninger; Kremser, Christian; Christian, Kremser; Rauch, Stefan; Stefan, Rauch; Eder, Robert; Robert, Eder; Judmaier, Werner; Werner, Judmaier; Zoller, Heinz; Heinz, Zoller; Michaely, Henrik; Henrik, Michaely; Schocke, Michael; Michael, Schocke

    2013-06-01

    To assess magnetic resonance imaging (MRI) with conventional chemical shift-based sequences with and without T2* correction for the evaluation of steatosis hepatitis (SH) in the presence of iron. Thirty-one patients who underwent MRI and liver biopsy because of clinically suspected diffuse liver disease were retrospectively analysed. The signal intensity (SI) was calculated in co-localised regions of interest (ROIs) using conventional spoiled gradient-echo T1 FLASH in-phase and opposed-phase (IP/OP). T2* relaxation time was recorded in a fat-saturated multi-echo-gradient-echo sequence. The fat fraction (FF) was calculated with non-corrected and T2*-corrected SIs. Results were correlated with liver biopsy. There was significant difference (P < 0.001) between uncorrected and T2* corrected FF in patients with SH and concomitant hepatic iron overload (HIO). Using 5 % as a threshold resulted in eight false negative results with uncorrected FF whereas T2* corrected FF lead to true positive results in 5/8 patients. ROC analysis calculated three threshold values (8.97 %, 5.3 % and 3.92 %) for T2* corrected FF with accuracy 84 %, sensitivity 83-91 % and specificity 63-88 %. FF with T2* correction is accurate for the diagnosis of hepatic fat in the presence of HIO. Findings of our study suggest the use of IP/OP imaging in combination with T2* correction. • Magnetic resonance helps quantify both iron and fat content within the liver • T2* correction helps to predict the correct diagnosis of steatosis hepatitis • "Fat fraction" from T2*-corrected chemical shift-based sequences accurately quantifies hepatic fat • "Fat fraction" without T2* correction underestimates hepatic fat with iron overload.

  1. Crosslinking transcription factors to their recognition sequences with PtII complexes

    NASA Technical Reports Server (NTRS)

    Chu, B. C.; Orgel, L. E.

    1992-01-01

    We have prepared phosphorothioate-containing cyclic oligodeoxynucleotides that fold into 'dumbbells' containing CRE and TRE sequences, the binding sequences for the CREB and JUN proteins, respectively. Six phosphorothioate residues were introduced into each of the recognition sequences. K2PtCl4 crosslinks CRE to CREB and TRE to JUN. The extent of crosslinking is about eight times greater than that observed with standard oligodeoxynucleotides and amounts to 30-50% of the efficiency of non-covalent association as estimated by gel-shift assays. Crosslinking is reversed by incubation with NaCN. The crosslinking reaction is specific--a dumbbell oligonucleotide with six phosphorothioate groups introduced into the Sp1 recognition sequence could not be crosslinked efficiently to CREB or JUN proteins with K2PtCl4. The binding of TRE to CREB is not strong enough for effective detection by gel-shift assays, but the TRE-CREB complex is crosslinked efficiently by K2PtCl4 and can then readily be detected.

  2. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    PubMed

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  3. Formation and evolution of a drainage network during the Pleistocene through a process of homoclinal shifting initiated by headward erosion.

    NASA Astrophysics Data System (ADS)

    Castelltort, F. Xavier; Carles Balasch, J.; Cirés, Jordi; Colombo, Ferran

    2017-04-01

    A homoclinal shifting process in NE of the Ebro basin, NE Iberian Peninsula, reorganized an old flow network into a new one. This process was initiated by the reactivation of a major normal fault (Amer Fault). An anaclinal stream, flowing to the hanging wall block, incised in the fault-line scarp, accessing by headward erosion the less resistant Paleogene units. The result was the formation of a sequence of strike valleys. The first valleys are situated in a more elevated topographical position than the valleys formed later. The last and the most important valley is La Plana de Vic, which is being emptied by differential erosion in front of the resistant base layer. The study of the lateral migration of a drainage basin since its initial stages has allowed the recognition of the layout of a drainage network and its model of evolution. The new drainage network includes three different subsystems. The main subsystem consists of stream courses flowing along the strike valley. While the other two subsystems flow into the main or can flow directly to the basin sink. These are the anaclinal subsystem, which drains the scarp face of the asymmetric valley, and the cataclinal subsystem, which drains the cuesta. The process of homoclinal shifting makes the strike streams migrate laterally and dip in the less resistant unit. This migration implies the reorganization of the other two tributary subsystems. The sequence of reorganizations may be preserved on the resistant bedrock of the cuesta. This allows the reconstruction of the route of the headward erosion of the initial anaclinal stream course through remnants of ancient strike streams flowing into former basin sinks, and its cataclinal tributaries draining the cuesta. In the case study of La Plana de Vic the migration route of the basin sink can be reconstructed from its initial position, Early Pleistocene, until present day. Besides, reorganization of the cataclinal network can also be recognized. During the lateral migration three incisions were made in a large anticlinal structure in the north (Bellmunt Anticline) and one incision was made in a crystalline massif (Montseny) in the south. The last of the incisions into the Bellmunt Anticline captured by headward erosion an older drainage network with headwaters in the axial Pyrenees. The result of the homoclinal shifting process was the capture of older drainage basins and the formation of the current drainage basin of the river Ter.

  4. Improved diagonal queue medical image steganography using Chaos theory, LFSR, and Rabin cryptosystem.

    PubMed

    Jain, Mamta; Kumar, Anil; Choudhary, Rishabh Charan

    2017-06-01

    In this article, we have proposed an improved diagonal queue medical image steganography for patient secret medical data transmission using chaotic standard map, linear feedback shift register, and Rabin cryptosystem, for improvement of previous technique (Jain and Lenka in Springer Brain Inform 3:39-51, 2016). The proposed algorithm comprises four stages, generation of pseudo-random sequences (pseudo-random sequences are generated by linear feedback shift register and standard chaotic map), permutation and XORing using pseudo-random sequences, encryption using Rabin cryptosystem, and steganography using the improved diagonal queues. Security analysis has been carried out. Performance analysis is observed using MSE, PSNR, maximum embedding capacity, as well as by histogram analysis between various Brain disease stego and cover images.

  5. Rubella Virus Genotypes in the People's Republic of China between 1979 and 2007: a Shift in Endemic Viruses during the 2001 Rubella Epidemic▿ †

    PubMed Central

    Zhu, Zhen; Abernathy, Emily; Cui, Aili; Zhang, Yan; Zhou, Shujie; Zhang, Zhenying; Wang, Changyin; Wang, Tongzhan; Ling, Hua; Zhao, Chunfang; Chen, Yingqiong; He, Jilan; Sun, Li; Chen, Xia; Tang, Jihai; Feng, Daxin; Wang, Yan; Ba, Zhuoma; Fan, Lixia; Chen, Haiyun; Pan, Zhengfan; Zhan, Jun; Chen, Hui; Zhou, Shunde; Zheng, Lei; Gao, Hui; Liang, Yong; Dai, Defang; Icenogle, Joseph; Xu, Wenbo

    2010-01-01

    The incidence of rubella cases in China from 1991 to 2007 was reviewed, and the nucleotide sequences from 123 rubella viruses collected during 1999 to 2007 and 4 viral sequences previously reported from 1979 to 1984 were phylogenetically analyzed. Rubella vaccination was not included in national immunization programs in China before 2007. Changes in endemic viruses were compared with incidences of rubella epidemics. The results showed that rubella epidemics occur approximately every 6 to 8 years (1993/1994, 2001, and 2007), and a shift of disease burden to susceptible young adults was observed. The Chinese rubella virus sequences were categorized into 5 of the 13 rubella virus genotypes, 1a, 1E, 1F, 2A, and 2B; cocirculations of these different genotypes were found in China. In Anhui province, a shift in the predominant genotype from 1F and 2B to 1E coincided with the 2001 rubella epidemic. This shift may have occurred throughout China during 2001 to 2007. This study investigated the genotype distribution of rubella viruses in China over a 28-year period to establish an important genetic baseline in China during its prevaccination era. PMID:20351211

  6. The interplay between the kinetic nonlinear frequency shift and the flowing gradient in stimulated Brillouin scattering

    NASA Astrophysics Data System (ADS)

    Wang, Q.; Y Zheng, C.; Liu, Z. J.; Xiao, C. Z.; Feng, Q. S.; Zhang, H. C.; He, X. T.

    2018-02-01

    The effect of the kinetic nonlinear frequency shift (KNFS) on backward stimulated Brillouin scattering (SBS) in homogeneous plasmas and inhomogeneous flowing plasmas is investigated by three-wave coupled-mode equations. When the positive contribution to the KNFS from electrons as well as the negative contribution from ions is included, the net KNFS can become positive at a large electron-ion temperature ratio {{ZT}}e/{T}i. In homogeneous plasmas, KNFS can greatly reduce the SBS reflectivity at low or large {{ZT}}e/{T}i but has a weak effect on SBS at {{ZT}}e/{T}i where the positive frequency shifts from electrons almost cancels out the negative shifts from ions. In inhomogeneous plasmas, the net negative frequency shift can enhance the backward SBS reflectivity for the negative gradient of the plasma flowing, and can suppress the reflectivity for the positive case. On the contrary, the net positive frequency can suppress the reflectivity for the negative case of the flowing gradient and enhance the reflectivity for the positive case. This indicates that the SBS in inhomogeneous flowing plasmas can be controlled by changing the sign of the nonlinear frequency shift.

  7. Implementing a night-shift clinical nurse specialist.

    PubMed

    Becker, Dawn Marie

    2013-01-01

    Night-shift nurses receive fewer educational opportunities and less administrative support than do day-shift staff, tend to be newer, with less experience and fewer resources, and experience greater turnover rates, stress, and procedural errors. In an attempt to bridge the gap between day- and night-shift nursing, a night-shift clinical nurse specialist (CNS) position was created in a midsized, community teaching hospital. The goal was to provide an advanced practice presence to improve patient outcomes, communication, education, and cost-effectiveness. The night-shift CNS participated in nursing education and skill certifications, communicated new procedures and information, and created a communication committee specifically for night-shift nurses. Through regular rounding and on-call notification, the CNS was available to every area of the hospital for consultation and clinical assistance and assisted with rapid responses, codes, and traumas. Providing education during night shift reduced overtime costs and increased morale, positively affecting turnover rates. The night-shift CNS position has improved morale and equalized support for night-shift nurses. More research, most notably in specific night-shift metrics, is necessary, and with the implementation of the role in additional facilities, more can be understood about improving patient care and nursing staff satisfaction during night shift.

  8. The affective shift model of work engagement.

    PubMed

    Bledow, Ronald; Schmitt, Antje; Frese, Michael; Kühnel, Jana

    2011-11-01

    On the basis of self-regulation theories, the authors develop an affective shift model of work engagement according to which work engagement emerges from the dynamic interplay of positive and negative affect. The affective shift model posits that negative affect is positively related to work engagement if negative affect is followed by positive affect. The authors applied experience sampling methodology to test the model. Data on affective events, mood, and work engagement was collected twice a day over 9 working days among 55 software developers. In support of the affective shift model, negative mood and negative events experienced in the morning of a working day were positively related to work engagement in the afternoon if positive mood in the time interval between morning and afternoon was high. Individual differences in positive affectivity moderated within-person relationships. The authors discuss how work engagement can be fostered through affect regulation. (c) 2011 APA, all rights reserved.

  9. Transcriptional Activation Signals Found in the Epstein-Barr Virus (EBV) Latency C Promoter Are Conserved in the Latency C Promoter Sequences from Baboon and Rhesus Monkey EBV-Like Lymphocryptoviruses (Cercopithicine Herpesviruses 12 and 15)

    PubMed Central

    Fuentes-Pananá, Ezequiel M.; Swaminathan, Sankar; Ling, Paul D.

    1999-01-01

    The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (−1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates. PMID:9847397

  10. Transcriptional activation signals found in the Epstein-Barr virus (EBV) latency C promoter are conserved in the latency C promoter sequences from baboon and Rhesus monkey EBV-like lymphocryptoviruses (cercopithicine herpesviruses 12 and 15).

    PubMed

    Fuentes-Pananá, E M; Swaminathan, S; Ling, P D

    1999-01-01

    The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.

  11. Characterization of a Defined 2,3,5,6-Tetrachlorobiphenyl-ortho-Dechlorinating Microbial Community by Comparative Sequence Analysis of Genes Coding for 16S rRNA

    PubMed Central

    Pulliam Holoman, Tracey R.; Elberson, Margaret A.; Cutter, Leah A.; May, Harold D.; Sowers, Kevin R.

    1998-01-01

    Defined microbial communities were developed by combining selective enrichment with molecular monitoring of total community genes coding for 16S rRNAs (16S rDNAs) to identify potential polychlorinated biphenyl (PCB)-dechlorinating anaerobes that ortho dechlorinate 2,3,5,6-tetrachlorobiphenyl. In enrichment cultures that contained a defined estuarine medium, three fatty acids, and sterile sediment, a Clostridium sp. was predominant in the absence of added PCB, but undescribed species in the δ subgroup of the class Proteobacteria, the low-G+C gram-positive subgroup, the Thermotogales subgroup, and a single species with sequence similarity to the deeply branching species Dehalococcoides ethenogenes were more predominant during active dechlorination of the PCB. Species with high sequence similarities to Methanomicrobiales and Methanosarcinales archaeal subgroups were predominant in both dechlorinating and nondechlorinating enrichment cultures. Deletion of sediment from PCB-dechlorinating enrichment cultures reduced the rate of dechlorination and the diversity of the community. Substitution of sodium acetate for the mixture of three fatty acids increased the rate of dechlorination, further reduced the community diversity, and caused a shift in the predominant species that included restriction fragment length polymorphism patterns not previously detected. Although PCB-dechlorinating cultures were methanogenic, inhibition of methanogenesis and elimination of the archaeal community by addition of bromoethanesulfonic acid only slightly inhibited dechlorination, indicating that the archaea were not required for ortho dechlorination of the congener. Deletion of Clostridium spp. from the community profile by addition of vancomycin only slightly reduced dechlorination. However, addition of sodium molybdate, an inhibitor of sulfate reduction, inhibited dechlorination and deleted selected species from the community profiles of the class Bacteria. With the exception of one 16S rDNA sequence that had the highest sequence similarity to the obligate perchloroethylene-dechlorinating Dehalococcoides, the 16S rDNA sequences associated with PCB ortho dechlorination had high sequence similarities to the δ, low-G+C gram-positive, and Thermotogales subgroups, which all include sulfur-, sulfate-, and/or iron(III)-respiring bacterial species. PMID:9726883

  12. Two stage kickdown control system for a motor vehicle automatic transmission

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Higashi, H.; Waki, K.; Fukuiri, M.

    This patent describes a vehicle automatic transmission including a hydraulic torque converter and a transmission gear mechanism connected with the torque converter and having at least three gear stages of different gear ratios for forward drive. A principal feature of this system as described is a friction means for selecting one of the gear stages as well as a kickdown control means consisting of the first shift down circuit means for control of the friction means so that the transmission gear mechanism is shifted downward. A solenoid kick down means within the modality of the first shift down circuit andmore » a kick down switch means actuated by an engine control member when it is moved to a full power position provides control of the kick down solenoid and the effecting of a down shift. The shift down control means is composed of a second shift down circuit means for controlling the friction means so shift down occurs. The shift down solenoid contained in the second shift down circuit means in conjunction with a shift down switch actuated by engine control member movement to a position spaced a predetermined distance from the full power position control the shift down solenoid to effect a shift down. Thus this mechanism is actuated earlier than the kickdown switch means when the engine control member is moved toward the full power position. A time delay means from the time of actuation of the shift down switch means and controlling kickdown switch activation is also described.« less

  13. At the dawn of delegation? Experiences and attitudes of general practitioners in Germany - a questionnaire survey.

    PubMed

    Goetz, Katja; Kornitzky, Anna; Mahnkopf, Janis; Steinhäuser, Jost

    2017-12-19

    In the future, 'delegation' as task shifting from general practitioners (GPs) to non-physicians will be important in primary care. Therefore, the aim of this study was to evaluate the attitudes towards the concept of task shifting and to identify predictors of a positive attitude towards task shifting from the perspective of GPs. This cross-sectional questionnaire study analysed attitudes towards the concept of task shifting and delegated tasks from the perspective of GPs who were recruited in the German federal state of Schleswig-Holstein. Descriptive statistics and binary regression analyses were computed to identify potential predictors of a positive attitude towards task shifting. Out of 1538 questionnaires distributed, 577 GP questionnaires were returned (response rate: 37.5%). A total of 53.2% of the respondents were male, and 37.3% were female. A positive attitude regarding task shifting was shown by 49% of the participating GPs. The highest level of agreement (95.2%) was found for time savings with task shifting, and a lower agreement (39%) was found regarding the lack of clarity concerning the responsibilities and legal aspects with regards to task shifting. The most frequently delegated tasks were recording electrocardiograms and measuring blood glucose levels. A positive attitude towards task shifting was positively associated with higher job satisfaction and a need for qualified staff. Our sample of GPs for this study was very open-minded towards the concept of task shifting. Germany is just beginning this delegation, but the implementation of task shifting depends on different aspects, such as legal requirements, adequate payment and qualified staff. Finally, there is a need for continuing professional development in primary care teams, especially for non-clinical practice staff.

  14. Attention maintains mental extrapolation of target position: irrelevant distractors eliminate forward displacement after implied motion.

    PubMed

    Kerzel, Dirk

    2003-05-01

    Observers' judgments of the final position of a moving target are typically shifted in the direction of implied motion ("representational momentum"). The role of attention is unclear: visual attention may be necessary to maintain or halt target displacement. When attention was captured by irrelevant distractors presented during the retention interval, forward displacement after implied target motion disappeared, suggesting that attention may be necessary to maintain mental extrapolation of target motion. In a further corroborative experiment, the deployment of attention was measured after a sequence of implied motion, and faster responses were observed to stimuli appearing in the direction of motion. Thus, attention may guide the mental extrapolation of target motion. Additionally, eye movements were measured during stimulus presentation and retention interval. The results showed that forward displacement with implied motion does not depend on eye movements. Differences between implied and smooth motion are discussed with respect to recent neurophysiological findings.

  15. Spectral lines behavior of Be I and Na I isoelectronic sequence in Debye plasma environment

    NASA Astrophysics Data System (ADS)

    Chaudhuri, Rajat K.; Chattopadhyay, Sudip; Sinha Mahapatra, Uttam

    2012-08-01

    We report the plasma screening effect on the first ionization potential (IP) and [He]2s2(1S0)→[He]2s2p /2s3p allowed (P11) and inter-combination transitions (P31) in some selected Be-like ions. In addition, we investigate the spectral properties of [Ne]3s (2S1/2)→[Ne]np(2P1/2 and P23/2 for n = 3, 4) transitions in Ca X and Fe XVI ions (Na I isoelectronic sequence) and [He]3s(2S1/2)→[He]np(2P1/2 and P23/2 for n = 2, 3) transitions in Li, B II, and N IV (Li I isoelectronic sequence) under plasma environment. The state-of-the-art relativistic coupled cluster calculations using the Debye model of plasma for electron-nucleus interaction show that (a) the ionization potential decreases sharply with increasing plasma strength and (b) the gap between the [He]2s2(1S0)→[He]2s2p(1,3P1) energy levels increases with increasing plasma potential and nuclear charge. It is found that the [He]2s2 (1S0)→2s3p(1,3P1) transition energy decreases uniformly with increasing plasma potential and nuclear charge. In other words, the spectral lines associated with 2s-2p (i.e., Δn=0, where n corresponds to principle quantum number) transitions in Be I isoelectronic sequence exhibit a blue-shift (except for Be I, B II, and the lowest inter-combination line in C III, which exhibit a red-shift), whereas those associated with 2s-3p (i.e., Δn≠0) transitions are red-shifted. Similar trend is observed in Li I and Na I isoelectronic sequences, where spectral lines associated with Δn=0 (Δn≠0) are blue-shifted (red-shifted). The effect of Coulomb screening on the spectral lines of ions subjected to plasma is also addressed.

  16. Predicting ICU mortality: a comparison of stationary and nonstationary temporal models.

    PubMed Central

    Kayaalp, M.; Cooper, G. F.; Clermont, G.

    2000-01-01

    OBJECTIVE: This study evaluates the effectiveness of the stationarity assumption in predicting the mortality of intensive care unit (ICU) patients at the ICU discharge. DESIGN: This is a comparative study. A stationary temporal Bayesian network learned from data was compared to a set of (33) nonstationary temporal Bayesian networks learned from data. A process observed as a sequence of events is stationary if its stochastic properties stay the same when the sequence is shifted in a positive or negative direction by a constant time parameter. The temporal Bayesian networks forecast mortalities of patients, where each patient has one record per day. The predictive performance of the stationary model is compared with nonstationary models using the area under the receiver operating characteristics (ROC) curves. RESULTS: The stationary model usually performed best. However, one nonstationary model using large data sets performed significantly better than the stationary model. CONCLUSION: Results suggest that using a combination of stationary and nonstationary models may predict better than using either alone. PMID:11079917

  17. Toward University Modeling Instruction—Biology: Adapting Curricular Frameworks from Physics to Biology

    PubMed Central

    Manthey, Seth; Brewe, Eric

    2013-01-01

    University Modeling Instruction (UMI) is an approach to curriculum and pedagogy that focuses instruction on engaging students in building, validating, and deploying scientific models. Modeling Instruction has been successfully implemented in both high school and university physics courses. Studies within the physics education research (PER) community have identified UMI's positive impacts on learning gains, equity, attitudinal shifts, and self-efficacy. While the success of this pedagogical approach has been recognized within the physics community, the use of models and modeling practices is still being developed for biology. Drawing from the existing research on UMI in physics, we describe the theoretical foundations of UMI and how UMI can be adapted to include an emphasis on models and modeling for undergraduate introductory biology courses. In particular, we discuss our ongoing work to develop a framework for the first semester of a two-semester introductory biology course sequence by identifying the essential basic models for an introductory biology course sequence. PMID:23737628

  18. Toward university modeling instruction--biology: adapting curricular frameworks from physics to biology.

    PubMed

    Manthey, Seth; Brewe, Eric

    2013-06-01

    University Modeling Instruction (UMI) is an approach to curriculum and pedagogy that focuses instruction on engaging students in building, validating, and deploying scientific models. Modeling Instruction has been successfully implemented in both high school and university physics courses. Studies within the physics education research (PER) community have identified UMI's positive impacts on learning gains, equity, attitudinal shifts, and self-efficacy. While the success of this pedagogical approach has been recognized within the physics community, the use of models and modeling practices is still being developed for biology. Drawing from the existing research on UMI in physics, we describe the theoretical foundations of UMI and how UMI can be adapted to include an emphasis on models and modeling for undergraduate introductory biology courses. In particular, we discuss our ongoing work to develop a framework for the first semester of a two-semester introductory biology course sequence by identifying the essential basic models for an introductory biology course sequence.

  19. Postdoctoral Fellows | Center for Cancer Research

    Cancer.gov

    The Oncogenomics section of the Genetics Branch is a multidisciplinary and interdisciplinary translational research programmatic effort with the goal of utilizing genomics to develop novel immunotherapies for cancer. Our group is applying high throughput applied genomics methods including single cell RNAseq, single cell TCR sequencing, DNA sequencing, CRISPR/Cas9, bioinformatics combined with T cell based therapeutics to identify and develop novel immunotherapeutics for human cancer. We work with other investigators within the intramural program as well as industrial and pharmaceutical partners to rapidly translate our findings to the clinic. The program takes advantage of the uniqueness of the National Cancer Institute, (NCI), Center for Cancer Research (CCR) intramural program in that it spans high-risk basic discovery research in immunology, genomics and tumor biology, through preclinical translational research, to paradigm-shifting clinical trials. The position is available immediately. The appointment duration is up to 5 years. Stipends are commensurate with education and experience. Additional information can be found on Dr. Khan’s profile page: https://ccr.cancer.gov/Genetics-Branch/javed-khan

  20. Gene editing tools: state-of-the-art and the road ahead for the model and non-model fishes.

    PubMed

    Barman, Hirak Kumar; Rasal, Kiran Dashrath; Chakrapani, Vemulawada; Ninawe, A S; Vengayil, Doyil T; Asrafuzzaman, Syed; Sundaray, Jitendra K; Jayasankar, Pallipuram

    2017-10-01

    Advancements in the DNA sequencing technologies and computational biology have revolutionized genome/transcriptome sequencing of non-model fishes at an affordable cost. This has led to a paradigm shift with regard to our heightened understandings of structure-functional relationships of genes at a global level, from model animals/fishes to non-model large animals/fishes. Whole genome/transcriptome sequencing technologies were supplemented with the series of discoveries in gene editing tools, which are being used to modify genes at pre-determined positions using programmable nucleases to explore their respective in vivo functions. For a long time, targeted gene disruption experiments were mostly restricted to embryonic stem cells, advances in gene editing technologies such as zinc finger nuclease, transcriptional activator-like effector nucleases and CRISPR (clustered regulatory interspaced short palindromic repeats)/CRISPR-associated nucleases have facilitated targeted genetic modifications beyond stem cells to a wide range of somatic cell lines across species from laboratory animals to farmed animals/fishes. In this review, we discuss use of different gene editing tools and the strategic implications in fish species for basic and applied biology research.

  1. Effects of experimental leg length discrepancies on body posture and dental occlusion.

    PubMed

    Maeda, Nozomi; Sakaguchi, Kiwamu; Mehta, Noshir R; Abdallah, Emad F; Forgione, Albert G; Yokoyama, Atsuro

    2011-07-01

    The purpose of this study was to quantitatively evaluate the effects of experimental leg length discrepancies on body posture and dental occlusion. Thirty asymptomatic subjects (15 males and 15 females, ages 19-33, mean age 25.6 years) were included in this study and randomly assigned to one of two groups based on a table of random numbers. The only difference between group A and group B was the sequence of testing. Experimental leg length discrepancies were provided by using ten types of insoles with heights ranging from one to ten mm at one mm intervals, placed under both feet. The MatScan (Nitta Corp., Osaka, Japan) system was used to measure changes in body posture (center of foot pressure: COP) while subjects maintained the following three postural positions: 1. natural standing posture (control); 2. control with a heel lift under the right foot; or 3. control with a heel lift under the left foot. The T-Scan II system (Nitta Corp., Osaka, Japan) was used to analyze the results of changes in dental occlusion (center of occlusal force: COF) in the above-mentioned three postural positions. When subjects used a heel lift of six mm or more under the right foot, lateral weight distribution (LWD) shifted to the right side compared to the control (p<0.05). When a heel lift of four mm or more was used under the left foot, LWD shifted to the left side compared to the control (p<0.05). When subjects used a heel lift of eight mm or more under the right foot, occlusal force shifted to the right side compared to the control (p<0.05). When subjects used a heel lift of seven mm or more under the left foot, occlusal force shifted to the left side compared to the control (p<0.05). Based on these findings, it was concluded that leg length discrepancy affected body posture and dental occlusion.

  2. Sequences of talk about emotional concerns in follow-up consultations with adolescent childhood cancer survivors.

    PubMed

    Mellblom, A V; Korsvold, L; Ruud, E; Lie, H C; Loge, J H; Finset, A

    2016-01-01

    To explore practices regarding communication about emotional concerns in follow-up consultations with adolescent cancer survivors and pediatrician. Seven video-taped follow-up consultations with adolescent survivors which contained many examples of emotional cues and concern were analyzed according to principles of conversation analysis. During talk about emotional concerns, a task-focused asymmetric pattern of pediatrician questions and patient responses was most often upheld. In a number of cases a gradual build-up of emotional expression from a weak hint to a more explicit expression of emotional concern was observed, often facilitated by the pediatricians. Most often work-up was relatively brief, sometimes with a brief positive reappraisal, but more comprehensive elaboration was also seen. Topic shifts were often abrupt. Pediatricians and patients used some of the same conventions as in everyday conversation during emotional talk in medical encounters. We observed shifts between informal talk and a typical task-focused mode. Conscious attention to such shifts and to the sequential nature of emotional talk could be helpful for doctors in designing their responses to patients' emotional concerns. Our findings may contribute to insight in how clinicians respond to emotional concerns in follow-up consultations and have implications for communication skills training. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Order information in verbal working memory shifts the subjective midpoint in both the line bisection and the landmark tasks.

    PubMed

    Antoine, Sophie; Ranzini, Mariagrazia; Gebuis, Titia; van Dijck, Jean-Philippe; Gevers, Wim

    2017-10-01

    A largely substantiated view in the domain of working memory is that the maintenance of serial order is achieved by generating associations of each item with an independent representation of its position, so-called position markers. Recent studies reported that the ordinal position of an item in verbal working memory interacts with spatial processing. This suggests that position markers might be spatial in nature. However, these interactions were so far observed in tasks implying a clear binary categorization of space (i.e., with left and right responses or targets). Such binary categorizations leave room for alternative interpretations, such as congruency between non-spatial categorical codes for ordinal position (e.g., begin and end) and spatial categorical codes for response (e.g., left and right). Here we discard this interpretation by providing evidence that this interaction can also be observed in a task that draws upon a continuous processing of space, the line bisection task. Specifically, bisections are modulated by ordinal position in verbal working memory, with lines bisected more towards the right after retrieving items from the end compared to the beginning of the memorized sequence. This supports the idea that position markers are intrinsically spatial in nature.

  4. The OAE1a in Cuchía (Early Aptian, Spain): C and O geochemistry and global correlation

    NASA Astrophysics Data System (ADS)

    García-Mondéjar, Joaquín; Fernández-Mendiola, Pedro A.; Owen, Hugh G.

    2015-12-01

    C-isotopes, TOC and O geochemical data from the lower Aptian Cuchía section in the western Basque-Cantabrian basin (BCB) allow an accurate delimitation of the OAE1a-equivalent and its geochemical Menegattís segments, a detailed δ13Ccarb correlation with regional and interregional sections, and a high-resolution construction of TOC and bulk-rock δ18Ocarb curves and their interpretation. The δ13Ccarb values range from -2‰ and +4‰ (VPDB). They agree with previous data from the eastern BCB sections (Aralar) confirming the ammonite age of the OAE1a in the Basque-Cantabrian basin: Deshayesites forbesi, Deshayesites deshayesi, and Deshayesites deshayesi-Dufrenoyia furcata transition Zones. Interregional δ13Ccarb correlation with pelagic (Cismon, Italy, and Mid-Pacific Mountains, DSDP Site 463) and neritic (Roquefort-La Bédoule, France) core sections, reveals a common profile of a wide negative excursion characteristic of the OAE1a. It consists of a double trough separated by a flat relative maximum, with two negative spikes in the upper trough of neritic sections. TOC absolute values range from 0.12% to 1.37%. Segments of the TOC curve with persistent low values closely correspond with descending segments of the δ13Ccarb curve, and are attributed to lesser organic productivity in the BCB. Detailed bulk-rock δ18Ocarb data (-5.71‰ to -1.05 ‰ PDB) and variation curve show two main positive O-isotope shifts and three minor positive inflections, within a general negative trend characteristic of the OAE1a. The two major positive shifts correspond to both shallowing upwards sequences and the lowermost can be related to a eustatic sea level fall. Independent interregional correlation of the O-isotope shifts with C-isotopes supports their interpretation as punctuating colder events within a general warming trend.

  5. SNMR pulse sequence phase cycling

    DOEpatents

    Walsh, David O; Grunewald, Elliot D

    2013-11-12

    Technologies applicable to SNMR pulse sequence phase cycling are disclosed, including SNMR acquisition apparatus and methods, SNMR processing apparatus and methods, and combinations thereof. SNMR acquisition may include transmitting two or more SNMR pulse sequences and applying a phase shift to a pulse in at least one of the pulse sequences, according to any of a variety cycling techniques. SNMR processing may include combining SNMR from a plurality of pulse sequences comprising pulses of different phases, so that desired signals are preserved and indesired signals are canceled.

  6. Identification of Shifts and Trends in Hydrometric Data in Canada Based on Several Detection Tests

    NASA Astrophysics Data System (ADS)

    Lauzon, N.; Lence, B. J.

    2004-05-01

    This work proposes new detection tests based on the Kohonen neural network and on fuzzy c-means for the identification of shifts and trends in data sequences. Annual mean and maximum flow sequences are considered as application case, for they have often been considered for the study of shifts and trends in hydrologic data. In recent years, several studies for the identification of trends have been accomplished with North American hydrometric data, often making use of only one detection test. The assumption here is that one cannot rely on only one test, and consequently several are employed in this work. A total of eight tests are considered, four for shifts and four for trends. Four of these tests, two for shifts and two for trends, are conventional statistical tests that are regularly employed, while the other four are developed based on the Kohonen neural network and on fuzzy c-means. Data from a group of 40 hydrometric stations across Canada are assessed for the detection of shifts and trends in time periods of 30, 40 and 50 years. While the results obtained confirm the conclusions of previous studies performed on similar groups of data, they also indicate that each test may behave differently from one another. For example, one test may detect a trend in a given sequence while the other tests do not, or vice-versa. Thus, the strategy of using several tests ensures not only that they may confirm each others diagnostics but also may complement each other in the case of divergent diagnostics, with the possibility of improving the final conclusion on the detection of shifts and trends. Using artificial intelligence techniques for the construction of detection tests constitutes also a departure from the use of statistics, and a discussion in this work on complementary studies (i.e. detection on multivariate cases) highlights the possibility of enhanced performance by the artificial intelligence-based tests compared with conventional detection tests.

  7. SFESA: a web server for pairwise alignment refinement by secondary structure shifts.

    PubMed

    Tong, Jing; Pei, Jimin; Grishin, Nick V

    2015-09-03

    Protein sequence alignment is essential for a variety of tasks such as homology modeling and active site prediction. Alignment errors remain the main cause of low-quality structure models. A bioinformatics tool to refine alignments is needed to make protein alignments more accurate. We developed the SFESA web server to refine pairwise protein sequence alignments. Compared to the previous version of SFESA, which required a set of 3D coordinates for a protein, the new server will search a sequence database for the closest homolog with an available 3D structure to be used as a template. For each alignment block defined by secondary structure elements in the template, SFESA evaluates alignment variants generated by local shifts and selects the best-scoring alignment variant. A scoring function that combines the sequence score of profile-profile comparison and the structure score of template-derived contact energy is used for evaluation of alignments. PROMALS pairwise alignments refined by SFESA are more accurate than those produced by current advanced alignment methods such as HHpred and CNFpred. In addition, SFESA also improves alignments generated by other software. SFESA is a web-based tool for alignment refinement, designed for researchers to compute, refine, and evaluate pairwise alignments with a combined sequence and structure scoring of alignment blocks. To our knowledge, the SFESA web server is the only tool that refines alignments by evaluating local shifts of secondary structure elements. The SFESA web server is available at http://prodata.swmed.edu/sfesa.

  8. The role of belowground plant-microbe interactions in climate change induced range shifts

    NASA Astrophysics Data System (ADS)

    Ramirez, Kelly; Snoek, Basten; van der Putten, Wim

    2017-04-01

    With climate change, plants have been able to shift their ranges into novel environments were conditions have been made suitable due to warming temperature and changes in precipitation. Much belowground range expansion research has focused on either positive plant-soil interactions, such as AMF symbiosis, or on negative plant-soil interactions, such as pathogens. Less focus has been given to the core microbiome of plant hosts. Many unknowns remain in how the soil microbiome may contribute to plant adaptation to climate change, and how this may feedback to plant-soil interactions and ecosystem functions. Using high-throughput Illumina sequencing we assessed soil and root microbial communities under native and range expanding plant species spanning a north-south latitudinal transect in central Europe. As expected, the soil and root microbiomes are both strongly influenced by the plant species under which they grow. Specifically, about 10% of the microbiome could be related to the host plant species. Interestingly, we found that microbiomes associated with range shifting species are less variable than those associated with native species. Further, the enrichment of microbes in roots (from the soil) is stronger with range expanding species than with native plant species. Our research indicates that the soil and root microbiomes can provide insight into plant range shifts and may be important for plant establishment. Our results are also important at a continental and global level, as ecosystems and plant communities worldwide are effected by climate change induced range-expansions.

  9. Long frame sync words for binary PSK telemetry

    NASA Technical Reports Server (NTRS)

    Levitt, B. K.

    1975-01-01

    Correlation criteria have previously been established for identifying whether a given binary sequence would be a good frame sync word for phase-shift keyed telemetry. In the past, the search for a good K-bit sync word has involved the application of these criteria to the entire set of 2 exponent K binary K-tuples. It is shown that restricting this search to a much smaller subset consisting of K-bit prefixes of pseudonoise sequences results in sync words of comparable quality, with greatly reduced computer search times for larger values of K. As an example, this procedure is used to find good sync words of length 16-63; from a storage viewpoint, each of these sequences can be generated by a 5- or 6-bit linear feedback shift register.

  10. The bioinformatics of nucleotide sequence coding for proteins requiring metal coenzymes and proteins embedded with metals

    NASA Astrophysics Data System (ADS)

    Tremberger, G.; Dehipawala, Sunil; Cheung, E.; Holden, T.; Sullivan, R.; Nguyen, A.; Lieberman, D.; Cheung, T.

    2015-09-01

    All metallo-proteins need post-translation metal incorporation. In fact, the isotope ratio of Fe, Cu, and Zn in physiology and oncology have emerged as an important tool. The nickel containing F430 is the prosthetic group of the enzyme methyl coenzyme M reductase which catalyzes the release of methane in the final step of methano-genesis, a prime energy metabolism candidate for life exploration space mission in the solar system. The 3.5 Gyr early life sulfite reductase as a life switch energy metabolism had Fe-Mo clusters. The nitrogenase for nitrogen fixation 3 billion years ago had Mo. The early life arsenite oxidase needed for anoxygenic photosynthesis energy metabolism 2.8 billion years ago had Mo and Fe. The selection pressure in metal incorporation inside a protein would be quantifiable in terms of the related nucleotide sequence complexity with fractal dimension and entropy values. Simulation model showed that the studied metal-required energy metabolism sequences had at least ten times more selection pressure relatively in comparison to the horizontal transferred sequences in Mealybug, guided by the outcome histogram of the correlation R-sq values. The metal energy metabolism sequence group was compared to the circadian clock KaiC sequence group using magnesium atomic level bond shifting mechanism in the protein, and the simulation model would suggest a much higher selection pressure for the energy life switch sequence group. The possibility of using Kepler 444 as an example of ancient life in Galaxy with the associated exoplanets has been proposed and is further discussed in this report. Examples of arsenic metal bonding shift probed by Synchrotron-based X-ray spectroscopy data and Zn controlled FOXP2 regulated pathways in human and chimp brain studied tissue samples are studied in relationship to the sequence bioinformatics. The analysis results suggest that relatively large metal bonding shift amount is associated with low probability correlation R-sq outcome in the bioinformatics simulation.

  11. Body position-dependent shift in odor percept present only for perithreshold odors.

    PubMed

    Lundström, Johan N; Boyle, Julie A; Jones-Gotman, Marilyn

    2008-01-01

    We recently demonstrated that a supine position causes a decrease in olfactory sensitivity compared with an upright position. We pursued that initial finding in 3 separate experiments in which we explored the extent of, and mechanism underlying, this phenomenon. In Experiment 1, we replicated the decrease in olfactory sensitivity when in a supine compared with an upright position. In Experiment 2, we measured body position-dependent shifts in physiological variables and sniff measures while smelling suprathreshold odorants and performing a perithreshold odor intensity discrimination task. Olfactory performances were reduced while supine. However, no relationships between the shift in olfactory performances and either the physiological variables or sniff measures were found. In Experiment 3, we determined that there were no position-dependent shifts in ability to discriminate or identify suprathreshold odors or rate them for pleasantness, intensity, or familiarity. However, a drop in scores was observed, and performance was slowed, on a cognitive skill while supine. These results demonstrate a body position-dependent shift in olfactory sensitivity only for perithreshold odors that appears to be mediated by cognitive rather than physiological factors. Implications for olfactory imaging studies are discussed.

  12. Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

    PubMed

    Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

    2008-01-01

    Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

  13. Robustness of Fat Quantification using Chemical Shift Imaging

    PubMed Central

    Hansen, Katie H; Schroeder, Michael E; Hamilton, Gavin; Sirlin, Claude B; Bydder, Mark

    2011-01-01

    This purpose of this study was to investigate the effect of parameter changes that can potentially lead to unreliable measurements in fat quantification. Chemical shift imaging was performed using spoiled gradient echo sequences with systematic variations in the following: 2D/3D sequence, number of echoes, delta echo time, fractional echo factor, slice thickness, repetition time, flip angle, bandwidth, matrix size, flow compensation and field strength. Results indicated no significant (or significant but small) changes in fat fraction with parameter. The significant changes can be attributed to known effects of T1 bias and the two forms of noise bias. PMID:22055856

  14. The impact of shifting vantage perspective when recalling and imagining positive events.

    PubMed

    Vella, Nicholas C; Moulds, Michelle L

    2014-01-01

    The vantage perspective from which memories are recalled influences their emotional impact. To date, however, the impact of vantage perspective on the emotions elicited by positive memories and images of positive future events has been minimally explored. We experimentally manipulated the vantage perspective from which a sample of undergraduate students (n =80) recalled positive memories and imagined positive future events. Participants who naturally recalled their positive memories from a field perspective reported decreased vividness and positive affect (i.e., happiness, optimism, hopefulness) when they were instructed to shift to an observer perspective. The same pattern of emotionality ratings was observed when participants' vantage perspective of imagined future events was manipulated. In contrast, shifting participants from observer to field perspective recall of positive memories did not result in changes in ratings of memory-related emotion, although we found an unexpected trend towards reduced vividness. For positive future events, shifting from an observer to a field perspective resulted in decreased vividness but did not lead to any changes in positive emotion. Our findings confirm that vantage perspective plays a key role in determining the emotional impact of positive memories, and demonstrate that this relationship is also evident for images of future positive events.

  15. Shifts in Selective Pressures on Snake Phototransduction Genes Associated with Photoreceptor Transmutation and Dim-Light Ancestry.

    PubMed

    Schott, Ryan K; Van Nynatten, Alexander; Card, Daren C; Castoe, Todd A; S W Chang, Belinda

    2018-06-01

    The visual systems of snakes are heavily modified relative to other squamates, a condition often thought to reflect their fossorial origins. Further modifications are seen in caenophidian snakes, where evolutionary transitions between rod and cone photoreceptors, termed photoreceptor transmutations, have occurred in many lineages. Little previous work, however, has focused on the molecular evolutionary underpinnings of these morphological changes. To address this, we sequenced seven snake eye transcriptomes and utilized new whole-genome and targeted capture sequencing data. We used these data to analyze gene loss and shifts in selection pressures in phototransduction genes that may be associated with snake evolutionary origins and photoreceptor transmutation. We identified the surprising loss of rhodopsin kinase (GRK1), despite a low degree of gene loss overall and a lack of relaxed selection early during snake evolution. These results provide some of the first evolutionary genomic corroboration for a dim-light ancestor that lacks strong fossorial adaptations. Our results also indicate that snakes with photoreceptor transmutation experienced significantly different selection pressures from other reptiles. Significant positive selection was found primarily in cone-specific genes, but not rod-specific genes, contrary to our expectations. These results reveal potential molecular adaptations associated with photoreceptor transmutation and also highlight unappreciated functional differences between rod- and cone-specific phototransduction proteins. This intriguing example of snake visual system evolution illustrates how the underlying molecular components of a complex system can be reshaped in response to changing selection pressures.

  16. Measurement of 13C chemical shift tensor principal values with a magic-angle turning experiment.

    PubMed

    Hu, J Z; Orendt, A M; Alderman, D W; Pugmire, R J; Ye, C; Grant, D M

    1994-08-01

    The magic-angle turning (MAT) experiment introduced by Gan is developed into a powerful and routine method for measuring the principal values of 13C chemical shift tensors in powdered solids. A large-volume MAT probe with stable rotation frequencies down to 22 Hz is described. A triple-echo MAT pulse sequence is introduced to improve the quality of the two-dimensional baseplane. It is shown that measurements of the principal values of chemical shift tensors in complex compounds can be enhanced by using either short contact times or dipolar dephasing pulse sequences to isolate the powder patterns from protonated or non-protonated carbons, respectively. A model compound, 1,2,3-trimethoxybenzene, is used to demonstrate these techniques, and the 13C principal values in 2,3-dimethylnaphthalene and Pocahontas coal are reported as typical examples.

  17. New mutations of DAX-1 genes in two Japanese patients with X-linked congenital adrenal hypoplasia and hypogonadotropic hypogonadism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yanase, Toshihiko; Takayanagi, Ryoichi; Oba, Koichi

    Congenital adrenal hypoplasia, an X-linked disorder, is characterized by primary adrenal insufficiency and frequent association with hypogonadotropic hypogonadism. The X-chromosome gene DAX-1 has been most recently identified and shown to be responsible for this disorder. We analyzed the DAX-1 genes of two unrelated Japanese patients with congenital adrenal hypoplasia and hypogonadotropic hypogonadism by using PCR amplification of genomic DNA and its complete exonic sequencing. In a family containing several affected individuals, the proband male patient had a stop codon (TGA) in place of tryptophan (TGG) at amino acid position 171. As expected, his mother was a heterozygous carrier for themore » mutation, whereas his father and unaffected brother did not carry this mutation. In another male patient with noncontributory family history, sequencing revealed a 1-bp (T) deletion at amino acid position 280, leading to a frame shift and, subsequently a premature stop codon at amino acid position 371. The presence of this mutation in the patients` genome was further confirmed by digestion of genomic PCR product with MspI created by this mutation. Family studies using MspI digestion of genomic PCR products revealed that neither parent of this individual carried the mutation. These results clearly indicate that congenital adrenal hypoplasia and hypogonadotropic hypogonadism result from not only inherited but also de novo mutation in the DAX-1 gene. 31 refs., 4 figs., 2 tabs.« less

  18. Dynamic metabolic imaging of hyperpolarized [2-(13) C]pyruvate using spiral chemical shift imaging with alternating spectral band excitation.

    PubMed

    Josan, Sonal; Hurd, Ralph; Park, Jae Mo; Yen, Yi-Fen; Watkins, Ron; Pfefferbaum, Adolf; Spielman, Daniel; Mayer, Dirk

    2014-06-01

    In contrast to [1-(13) C]pyruvate, hyperpolarized [2-(13) C]pyruvate permits the ability to follow the (13) C label beyond flux through pyruvate dehydrogenase complex and investigate the incorporation of acetyl-coenzyme A into different metabolic pathways. However, chemical shift imaging (CSI) with [2-(13) C]pyruvate is challenging owing to the large spectral dispersion of the resonances, which also leads to severe chemical shift displacement artifacts for slice-selective acquisitions. This study introduces a sequence for three-dimensional CSI of [2-(13) C]pyruvate using spectrally selective excitation of limited frequency bands containing a subset of metabolites. Dynamic CSI data were acquired alternately from multiple frequency bands in phantoms for sequence testing and in vivo in rat heart. Phantom experiments verified the radiofrequency pulse design and demonstrated that the signal behavior of each group of resonances was unaffected by excitation of the other frequency bands. Dynamic three-dimensional (13) C CSI data demonstrated the sequence capability to image pyruvate, lactate, acetylcarnitine, glutamate, and acetoacetate, enabling the analysis of organ-specific spectra and metabolite time courses. The presented method allows CSI of widely separated resonances without chemical shift displacement artifact, acquiring multiple frequency bands alternately to obtain dynamic time-course information. This approach enables robust imaging of downstream metabolic products of acetyl-coenzyme A with hyperpolarized [2-(13) C]pyruvate. Copyright © 2013 Wiley Periodicals, Inc.

  19. 100,000-year-long terrestrial record of millennial-scale linkage between eastern North American mid-latitude paleovegetation shifts and Greenland ice-core oxygen isotope trends

    USGS Publications Warehouse

    Litwin, Ronald J.; Smoot, Joseph P.; Pavich, Milan J.; Markewich, Helaine Walsh; Brook, George; Durika, Nancy J.

    2013-01-01

    We document frequent, rapid, strong, millennial-scale paleovegetation shifts throughout the late Pleistocene, within a 100,000+ yr interval (~ 115–15 ka) of terrestrial sediments from the mid-Atlantic Region (MAR) of North America. High-resolution analyses of fossil pollen from one core locality revealed a continuously shifting sequence of thermally dependent forest assemblages, ranging between two endmembers: subtropical oak-tupelo-bald cypress-gum forest and high boreal spruce-pine forest. Sedimentary textural evidence indicates fluvial, paludal, and loess deposition, and paleosol formation, representing sequential freshwater to subaerial environments in which this record was deposited. Its total age"depth model, based on radiocarbon and optically stimulated luminescence ages, ranges from terrestrial oxygen isotope stages (OIS) 6 to 1. The particular core sub-interval presented here is correlative in trend and timing to that portion of the oxygen isotope sequence common among several Greenland ice cores: interstades GI2 to GI24 (≈ OIS2–5 d). This site thus provides the first evidence for an essentially complete series of "Dansgaard"Oeschger" climate events in the MAR. These data reveal that the ~ 100,000 yr preceding the Late Glacial and Holocene in the MAR of North America were characterized by frequently and dynamically changing climate states, and by vegetation shifts that closely tracked the Greenland paleoclimate sequence.

  20. Bit error rate tester using fast parallel generation of linear recurring sequences

    DOEpatents

    Pierson, Lyndon G.; Witzke, Edward L.; Maestas, Joseph H.

    2003-05-06

    A fast method for generating linear recurring sequences by parallel linear recurring sequence generators (LRSGs) with a feedback circuit optimized to balance minimum propagation delay against maximal sequence period. Parallel generation of linear recurring sequences requires decimating the sequence (creating small contiguous sections of the sequence in each LRSG). A companion matrix form is selected depending on whether the LFSR is right-shifting or left-shifting. The companion matrix is completed by selecting a primitive irreducible polynomial with 1's most closely grouped in a corner of the companion matrix. A decimation matrix is created by raising the companion matrix to the (n*k).sup.th power, where k is the number of parallel LRSGs and n is the number of bits to be generated at a time by each LRSG. Companion matrices with 1's closely grouped in a corner will yield sparse decimation matrices. A feedback circuit comprised of XOR logic gates implements the decimation matrix in hardware. Sparse decimation matrices can be implemented with minimum number of XOR gates, and therefore a minimum propagation delay through the feedback circuit. The LRSG of the invention is particularly well suited to use as a bit error rate tester on high speed communication lines because it permits the receiver to synchronize to the transmitted pattern within 2n bits.

  1. Bacteroides fragilis mobilizable transposon Tn5520 requires a 71 base pair origin of transfer sequence and a single mobilization protein for relaxosome formation during conjugation.

    PubMed

    Vedantam, Gayatri; Knopf, Sarah; Hecht, David W

    2006-01-01

    Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.

  2. Stabilized display of coronary x-ray image sequences

    NASA Astrophysics Data System (ADS)

    Close, Robert A.; Whiting, James S.; Da, Xiaolin; Eigler, Neal L.

    2004-05-01

    Display stabilization is a technique by which a feature of interest in a cine image sequence is tracked and then shifted to remain approximately stationary on the display device. Prior simulations indicate that display stabilization with high playback rates ( 30 f/s) can significantly improve detectability of low-contrast features in coronary angiograms. Display stabilization may also help to improve the accuracy of intra-coronary device placement. We validated our automated tracking algorithm by comparing the inter-frame difference (jitter) between manual and automated tracking of 150 coronary x-ray image sequences acquired on a digital cardiovascular X-ray imaging system with CsI/a-Si flat panel detector. We find that the median (50%) inter-frame jitter between manual and automatic tracking is 1.41 pixels or less, indicating a jump no further than an adjacent pixel. This small jitter implies that automated tracking and manual tracking should yield similar improvements in the performance of most visual tasks. We hypothesize that cardiologists would perceive a benefit in viewing the stabilized display as an addition to the standard playback of cine recordings. A benefit of display stabilization was identified in 87 of 101 sequences (86%). The most common tasks cited were evaluation of stenosis and determination of stent and balloon positions. We conclude that display stabilization offers perceptible improvements in the performance of visual tasks by cardiologists.

  3. Facies analysis and sequence stratigraphy of neoproterozoic Platform deposits in Adrar of Mauritania, Taoudeni basin, West Africa

    NASA Astrophysics Data System (ADS)

    Benan, C. A. A.; Deynoux, M.

    The Neoproterozoic and Palaeozoic Taoudeni basin forms the flat-lying and unmetamorphosed sedimentary cover of the West African Craton. In the western part of this basin, the Char Group and the lower part of the Atar Group make up a 400-m-thick Neoproterozoic siliciclastic succession which rests on the Palaeoproterozoic metamorphic and granitic basement. Five erosional bounding surfaces of regional extent have been identified in this succession. These surfaces separate five stratigraphic units with lithofacies associations ranging from fluvial to coastal and fluvial-, tide-, or wave-dominated shallow marine deposits. Owing to their regional extent and their position within the succession, the erosive bounding surfaces correspond to relative sea-level falls, and accordingly the five stratigraphic units they bound represent allocyclic transgressive-regressive depositional sequences (S1-S5). Changes in the nature of the deposits forming the transgressive-regressive cycles reflect landward or seaward shifts of the stacked sequences. These successive relative sea-level changes are related to the reactivation of basement faults and tilting during rifting of the Pan-Afro-Brasiliano supercontinent 1000 m.y. ago. The stromatolite bearing carbonate-shale sequences which form the rest of the Atar Group mark the onset of a quiet period of homogeneous subsidence contemporaneous with the Pan-African I oceanization 800-700 m.y. ago.

  4. Pepino mosaic virus genotype shift in North America and development of a loop-mediated isothermal amplification for rapid genotype identification

    PubMed Central

    2013-01-01

    Background Pepino mosaic, once an emerging disease a decade ago, has become endemic on greenhouse tomatoes worldwide in recent years. Three distinct genotypes of Pepino mosaic virus (PepMV), including EU, US1 and CH2 have been recognized. Our earlier study conducted in 2006–2007 demonstrated a predominant EU genotype in Canada and United States. The objective of the present study was to monitor the dynamic of PepMV genetic composition and its current status in North America. Results Through yearly monitoring efforts in 2009–2012, we detected a dramatic shift in the prevalent genotype of PepMV from the genotype EU to CH2 in North America since early 2010, with another shift from CH2 to US1 occurring in Mexico only two years later. Through genetic diversity analysis using the coat protein gene, such genotype shifting of PepMV in North America was linked to the positive identification of similar sequence variants in two different commercial tomato seed sources used for scion and rootstock, respectively. To allow for a quick identification, a reverse transcription loop-mediated isothermal amplification (RT-LAMP) system was developed and demonstrated to achieve a rapid identification for each of the three genotypes of PepMV, EU, US1 and CH2. Conclusion Through systemic yearly monitoring and genetic diversity analysis, we identified a linkage between the field epidemic isolates and those from commercial tomato seed lots as the likely sources of initial PepMV inoculum that resulted in genetic shifting as observed on greenhouse tomatoes in North America. Application of the genotype-specific RT-LAMP system would allow growers to efficiently determine the genetic diversity on their crops. PMID:23587202

  5. Formation of a parallel-stranded DNA homoduplex by d(GGA) repeat oligonucleotides.

    PubMed Central

    Suda, T; Mishima, Y; Asakura, H; Kominami, R

    1995-01-01

    The GGA9-H molecules consisting of a double helical stretch followed by a single-stranded 3'-terminal overhang of nine GGA sequence repeats exhibited a gel mobility-shifted band in a concentration-dependent manner, suggestive of the intermolecular complex formation. The position of the shifted band in a gel was almost identical to that of the Y-shaped dimer marker of the same molecular weight that had the two double-helices at one side. This suggests that GGA9-H dimerizes in a parallel orientation without the formation of four-stranded hairpin structure. Since the GGA9-H homoduplex was stably formed at pH 4, 7 and 9, the formation does not require protonation or deprotonation of the N1 position of adenines. Neither does it require the N7 group of guanines responsible for Hoogsteen base pairing from the methylation interference and modification studies. Modification of the N7 group of guanines with dimethyl sulfate (DMS) did not inhibit the association and also the N7 group in the homoduplex was not protected from DMS. On the other hand, the GAA9-H having the G to A base substitution did not show such an association with either GGA9-H or GAA9-H. These results suggest that the homoduplex formation may be due to G.G base pairing through non-Hoogsteen hydrogen bonds. Images PMID:7479009

  6. Effect of pulse sequence parameter selection on signal strength in positive-contrast MRI markers for MRI-based prostate postimplant assessment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lim, Tze Yee

    Purpose: For postimplant dosimetric assessment, computed tomography (CT) is commonly used to identify prostate brachytherapy seeds, at the expense of accurate anatomical contouring. Magnetic resonance imaging (MRI) is superior to CT for anatomical delineation, but identification of the negative-contrast seeds is challenging. Positive-contrast MRI markers were proposed to replace spacers to assist seed localization on MRI images. Visualization of these markers under varying scan parameters was investigated. Methods: To simulate a clinical scenario, a prostate phantom was implanted with 66 markers and 86 seeds, and imaged on a 3.0T MRI scanner using a 3D fast radiofrequency-spoiled gradient recalled echo acquisitionmore » with various combinations of scan parameters. Scan parameters, including flip angle, number of excitations, bandwidth, field-of-view, slice thickness, and encoding steps were systematically varied to study their effects on signal, noise, scan time, image resolution, and artifacts. Results: The effects of pulse sequence parameter selection on the marker signal strength and image noise were characterized. The authors also examined the tradeoff between signal-to-noise ratio, scan time, and image artifacts, such as the wraparound artifact, susceptibility artifact, chemical shift artifact, and partial volume averaging artifact. Given reasonable scan time and managable artifacts, the authors recommended scan parameter combinations that can provide robust visualization of the MRI markers. Conclusions: The recommended MRI pulse sequence protocol allows for consistent visualization of the markers to assist seed localization, potentially enabling MRI-only prostate postimplant dosimetry.« less

  7. High-performance magnetic field sensor based on superconducting quantum interference filters

    NASA Astrophysics Data System (ADS)

    Caputo, P.; Oppenländer, J.; Häussler, Ch.; Tomes, J.; Friesch, A.; Träuble, T.; Schopohl, N.

    2004-08-01

    We have developed an absolute magnetic field sensor using a superconducting quantum interference filter (SQIF) made of high-Tc grain-boundary Josephson junctions. The device shows the typical magnetic-field-dependent voltage response V(B ), which is a sharp deltalike dip in the vicinity of zero-magnetic field. When the SQIF is cooled with magnetic shield, and then the shield is removed, the presence of the ambient magnetic field induces a shift of the dip position from B0≈0 to a value B ≈B1, which is about the average value of the Earth's magnetic field, at our latitude. When the SQIF is cooled in the ambient field without shielding, the dip is first found at B ≈B1, and the further shielding of the SQIF results in a shift of the dip towards B0≈0. The low hysteresis observed in the sequence of experiments (less than 5% of B1) makes SQIFs suitable for high precision measurements of the absolute magnetic field. The experimental results are discussed in view of potential applications of high-Tc SQIFs in magnetometry.

  8. Carotid baroreflex response following 30 days exposure to simulated microgravity

    NASA Technical Reports Server (NTRS)

    Convertino, V. A.; Doerr, D. F.; Eckberg, D. L.; Fritsch, J. M.; Vernikos-Danellis, J.

    1989-01-01

    The mechanism of the carotid-baroreflex response to weightlessness was investigated in human subjects exposed to simulated microgravity (30 days of 6-day head-down bed rest followed by 5 days of recovery). Baroreceptor-cardiac reflex responses were elicited by a complex sequence of pressure changes delivered to a neck chamber device. The shape of the sigmoid baroreceptor-cardiac response curve was examined for alterations and the occurrence of resetting, as well as for a possible association of the impaired baroreflex function with hypotension during the postexposure orthostatic stress. It was found that the exposure to head-down bed rest caused a significant shift on the R-R interval axis, which paralleled reductions and elevations in baseline HR such that the baseline R-R (operational point) remained in the same position on the response curve. This shift in the location of the reflex relation indicates a significant resetting of the carotid baroreceptors, which may represent an appropriate adaptation which contributes to the maintenance of a constant resting arterial blood pressure before, during, and after bed rest, observed in these study.

  9. Methodology to reduce 6D patient positional shifts into a 3D linear shift and its verification in frameless stereotactic radiotherapy

    NASA Astrophysics Data System (ADS)

    Sarkar, Biplab; Ray, Jyotirmoy; Ganesh, Tharmarnadar; Manikandan, Arjunan; Munshi, Anusheel; Rathinamuthu, Sasikumar; Kaur, Harpreet; Anbazhagan, Satheeshkumar; Giri, Upendra K.; Roy, Soumya; Jassal, Kanan; Kalyan Mohanti, Bidhu

    2018-04-01

    The aim of this article is to derive and verify a mathematical formulation for the reduction of the six-dimensional (6D) positional inaccuracies of patients (lateral, longitudinal, vertical, pitch, roll and yaw) to three-dimensional (3D) linear shifts. The formulation was mathematically and experimentally tested and verified for 169 stereotactic radiotherapy patients. The mathematical verification involves the comparison of any (one) of the calculated rotational coordinates with the corresponding value from the 6D shifts obtained by cone beam computed tomography (CBCT). The experimental verification involves three sets of measurements using an ArcCHECK phantom, when (i) the phantom was not moved (neutral position: 0MES), (ii) the position of the phantom shifted by 6D shifts obtained from CBCT (6DMES) from neutral position and (iii) the phantom shifted from its neutral position by 3D shifts reduced from 6D shifts (3DMES). Dose volume histogram and statistical comparisons were made between ≤ft< TPSCAL{\\text -}0MES \\right> and ≤ft< 3DMES{\\text -6DMES} \\right> . The mathematical verification was performed by a comparison of the calculated and measured yaw (γ°) rotation values, which gave a straight line, Y  =  1X with a goodness of fit as R 2  =  0.9982. The verification, based on measurements, gave a planning target volume receiving 100% of the dose (V100%) as 99.1  ±  1.9%, 96.3  ±  1.8%, 74.3  ±  1.9% and 72.6  ±  2.8% for the calculated treatment planning system values TPSCAL, 0MES, 3DMES and 6DMES, respectively. The statistical significance (p-values: paired sample t-test) of V100% were found to be 0.03 for the paired sample ≤ft< 3DMES{\\text -6DMES} \\right> and 0.01 for ≤ft< 0MES{\\text -TPSCAL} \\right> . In this paper, a mathematical method to reduce 6D shifts to 3D shifts is presented. The mathematical method is verified by using well-matched values between the measured and calculated γ°. Measurements done on the ArcCHECK phantom also proved that the proposed methodology is correct. The post-correction of the table position condition introduces a minimal spatial dose delivery error in the frameless stereotactic system, using a 6D motion enabled robotic couch. This formulation enables the reduction of 6D positional inaccuracies to 3D linear shifts, and hence allows the treatment of patients with frameless stereotactic radiosurgery by using only a 3D linear motion enabled couch.

  10. Methodology to reduce 6D patient positional shifts into a 3D linear shift and its verification in frameless stereotactic radiotherapy.

    PubMed

    Sarkar, Biplab; Ray, Jyotirmoy; Ganesh, Tharmarnadar; Manikandan, Arjunan; Munshi, Anusheel; Rathinamuthu, Sasikumar; Kaur, Harpreet; Anbazhagan, Satheeshkumar; Giri, Upendra K; Roy, Soumya; Jassal, Kanan; Mohanti, Bidhu Kalyan

    2018-03-22

    The aim of this article is to derive and verify a mathematical formulation for the reduction of the six-dimensional (6D) positional inaccuracies of patients (lateral, longitudinal, vertical, pitch, roll and yaw) to three-dimensional (3D) linear shifts. The formulation was mathematically and experimentally tested and verified for 169 stereotactic radiotherapy patients. The mathematical verification involves the comparison of any (one) of the calculated rotational coordinates with the corresponding value from the 6D shifts obtained by cone beam computed tomography (CBCT). The experimental verification involves three sets of measurements using an ArcCHECK phantom, when (i) the phantom was not moved (neutral position: 0MES), (ii) the position of the phantom shifted by 6D shifts obtained from CBCT (6DMES) from neutral position and (iii) the phantom shifted from its neutral position by 3D shifts reduced from 6D shifts (3DMES). Dose volume histogram and statistical comparisons were made between [Formula: see text] and [Formula: see text]. The mathematical verification was performed by a comparison of the calculated and measured yaw (γ°) rotation values, which gave a straight line, Y  =  1X with a goodness of fit as R 2   =  0.9982. The verification, based on measurements, gave a planning target volume receiving 100% of the dose (V100%) as 99.1  ±  1.9%, 96.3  ±  1.8%, 74.3  ±  1.9% and 72.6  ±  2.8% for the calculated treatment planning system values TPSCAL, 0MES, 3DMES and 6DMES, respectively. The statistical significance (p-values: paired sample t-test) of V100% were found to be 0.03 for the paired sample [Formula: see text] and 0.01 for [Formula: see text]. In this paper, a mathematical method to reduce 6D shifts to 3D shifts is presented. The mathematical method is verified by using well-matched values between the measured and calculated γ°. Measurements done on the ArcCHECK phantom also proved that the proposed methodology is correct. The post-correction of the table position condition introduces a minimal spatial dose delivery error in the frameless stereotactic system, using a 6D motion enabled robotic couch. This formulation enables the reduction of 6D positional inaccuracies to 3D linear shifts, and hence allows the treatment of patients with frameless stereotactic radiosurgery by using only a 3D linear motion enabled couch.

  11. Handling the influence of chemical shift in amplitude-modulated heteronuclear dipolar recoupling solid-state NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Basse, Kristoffer; Shankar, Ravi; Bjerring, Morten

    We present a theoretical analysis of the influence of chemical shifts on amplitude-modulated heteronuclear dipolar recoupling experiments in solid-state NMR spectroscopy. The method is demonstrated using the Rotor Echo Short Pulse IRrAdiaTION mediated Cross-Polarization ({sup RESPIRATION}CP) experiment as an example. By going into the pulse sequence rf interaction frame and employing a quintuple-mode operator-based Floquet approach, we describe how chemical shift offset and anisotropic chemical shift affect the efficiency of heteronuclear polarization transfer. In this description, it becomes transparent that the main attribute leading to non-ideal performance is a fictitious field along the rf field axis, which is generated frommore » second-order cross terms arising mainly between chemical shift tensors and themselves. This insight is useful for the development of improved recoupling experiments. We discuss the validity of this approach and present quaternion calculations to determine the effective resonance conditions in a combined rf field and chemical shift offset interaction frame transformation. Based on this, we derive a broad-banded version of the {sup RESPIRATION}CP experiment. The new sequence is experimentally verified using SNNFGAILSS amyloid fibrils where simultaneous {sup 15}N → {sup 13}CO and {sup 15}N → {sup 13}C{sub α} coherence transfer is demonstrated on high-field NMR instrumentation, requiring great offset stability.« less

  12. Using the phase shift to asymptotically characterize the dipolar mixed modes in post-main-sequence stars

    NASA Astrophysics Data System (ADS)

    Jiang, C.; Christensen-Dalsgaard, J.; Cunha, M.

    2018-03-01

    Mixed modes have been extensively observed in post-main-sequence stars by the Kepler and CoRoT space missions. The mixture of the p and g modes can be measured by the dimensionless coefficient q, the so-called coupling strength factor. In this paper, we discuss the utility of the phase shifts θ from the eigenvalue condition for mixed modes as a tool to characterize dipolar mixed modes from the theoretical as well as the practical point of view. Unlike the coupling strength, whose variation in a given star is very small over the relevant frequency range, the phase shifts vary significantly for different modes. The analysis in terms of θ can also provide a better understanding of the pressure and gravity radial order for a given mixed mode. Observed frequencies of the Kepler red-giant star KIC 3744043 are used to test the method. The results are very promising.

  13. Frequency-Shift Detectors Bind Binaural as Well as Monaural Frequency Representations

    ERIC Educational Resources Information Center

    Carcagno, Samuele; Semal, Catherine; Demany, Laurent

    2011-01-01

    Previous psychophysical work provided evidence for the existence of automatic frequency-shift detectors (FSDs) that establish perceptual links between successive sounds. In this study, we investigated the characteristics of the FSDs with respect to the binaural system. Listeners were presented with sound sequences consisting of a chord of pure…

  14. Visuospatial bootstrapping: Binding useful visuospatial information during verbal working memory encoding does not require set-shifting executive resources.

    PubMed

    Calia, Clara; Darling, Stephen; Havelka, Jelena; Allen, Richard J

    2018-05-01

    Immediate serial recall of digits is better when the digits are shown by highlighting them in a familiar array, such as a phone keypad, compared with presenting them serially in a single location, a pattern referred to as "visuospatial bootstrapping." This pattern implies the establishment of temporary links between verbal and spatial working memory, alongside access to information in long-term memory. However, the role of working memory control processes like those implied by the "Central Executive" in bootstrapping has not been directly investigated. Here, we report a study addressing this issue, focusing on executive processes of attentional shifting. Tasks in which information has to be sequenced are thought to be heavily dependent on shifting. Memory for digits presented in keypads versus single locations was assessed under two secondary task load conditions, one with and one without a sequencing requirement, and hence differing in the degree to which they invoke shifting. Results provided clear evidence that multimodal binding (visuospatial bootstrapping) can operate independently of this form of executive control process.

  15. A spiral-based volumetric acquisition for MR temperature imaging.

    PubMed

    Fielden, Samuel W; Feng, Xue; Zhao, Li; Miller, G Wilson; Geeslin, Matthew; Dallapiazza, Robert F; Elias, W Jeffrey; Wintermark, Max; Butts Pauly, Kim; Meyer, Craig H

    2018-06-01

    To develop a rapid pulse sequence for volumetric MR thermometry. Simulations were carried out to assess temperature deviation, focal spot distortion/blurring, and focal spot shift across a range of readout durations and maximum temperatures for Cartesian, spiral-out, and retraced spiral-in/out (RIO) trajectories. The RIO trajectory was applied for stack-of-spirals 3D imaging on a real-time imaging platform and preliminary evaluation was carried out compared to a standard 2D sequence in vivo using a swine brain model, comparing maximum and mean temperatures measured between the two methods, as well as the temporal standard deviation measured by the two methods. In simulations, low-bandwidth Cartesian trajectories showed substantial shift of the focal spot, whereas both spiral trajectories showed no shift while maintaining focal spot geometry. In vivo, the 3D sequence achieved real-time 4D monitoring of thermometry, with an update time of 2.9-3.3 s. Spiral imaging, and RIO imaging in particular, is an effective way to speed up volumetric MR thermometry. Magn Reson Med 79:3122-3127, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  16. Soil suppressiveness to fusarium disease: shifts in root microbiome associated with reduction of pathogen root colonization.

    PubMed

    Klein, Eyal; Ofek, Maya; Katan, Jaacov; Minz, Dror; Gamliel, Abraham

    2013-01-01

    Soil suppressiveness to Fusarium disease was induced by incubating sandy soil with debris of wild rocket (WR; Diplotaxis tenuifolia) under field conditions. We studied microbial dynamics in the roots of cucumber seedlings following transplantation into WR-amended or nonamended soil, as influenced by inoculation with Fusarium oxysporum f. sp. radicis-cucumerinum. Disease symptoms initiated in nonamended soil 6 days after inoculation, compared with 14 days in WR-amended soil. Root infection by F. oxysporum f. sp. radicis-cucumerinum was quantified using real-time polymerase chain reaction (PCR). Target numbers were similar 3 days after inoculation for both WR-amended and nonamended soils, and were significantly lower (66%) 6 days after inoculation and transplanting into the suppressive (WR-amended) soil. This decrease in root colonization was correlated with a reduction in disease (60%) 21 days after inoculation and transplanting into the suppressive soil. Fungal community composition on cucumber roots was assessed using mass sequencing of fungal internal transcribed spacer gene fragments. Sequences related to F. oxysporum, Fusarium sp. 14005, Chaetomium sp. 15003, and an unclassified Ascomycota composed 96% of the total fungal sequences in all samples. The relative abundances of these major groups were highly affected by root inoculation with F. oxysporum f. sp. radicis-cucumerinum, with a 10-fold increase in F. oxysporum sequences, but were not affected by the WR amendment. Quantitative analysis and mass-sequencing methods indicated a qualitative shift in the root's bacterial community composition in suppressive soil, rather than a change in bacterial numbers. A sharp reduction in the size and root dominance of the Massilia population in suppressive soil was accompanied by a significant increase in the relative abundance of specific populations; namely, Rhizobium, Bacillus, Paenibacillus, and Streptomyces spp. Composition of the Streptomyces community shifted significantly, as determined by PCR denaturing gradient gel electrophoresis, resulting in an increase in the dominance of a specific population in suppressive soils after only 3 days. This shift was related mainly to the increase in Streptomyces humidus, a group previously described as antagonistic to phytopathogenic fungi. Thus, suitable soil amendment resulted in a shift in the root's bacterial communities, and infection by a virulent pathogen was contained by the root microbiome, leading to a reduced disease rate.

  17. Fiber supplementation influences phylogenetic structure and functional capacity of the human intestinal microbiome: follow-up of a randomized controlled trial.

    PubMed

    Holscher, Hannah D; Caporaso, J Gregory; Hooda, Seema; Brulc, Jennifer M; Fahey, George C; Swanson, Kelly S

    2015-01-01

    In our published randomized, double-blind, placebo-controlled, 3-period crossover trial, healthy adult men (n = 21) consumed bars containing no supplemental fiber (placebo; NFC), polydextrose (21 g/d), and soluble corn fiber (SCF; 21 g/d) for 21 d each. Fecal specimens were collected between days 16 and 21 for fermentative end-product analysis and 16S ribosomal RNA bacterial gene amplification for bacterial taxa identification. Fiber supplementation decreased fecal putrefaction compounds and shifted abundances of several bacterial taxa. The objective was to perform whole-genome shotgun 454 pyrosequencing on the same fecal specimens collected in that clinical trial to obtain comprehensive fecal bacterial genome sequencing coverage and explore the full range of bacterial genetic information in the fecal microbiome, thereby using a systematic approach to study the impact of dietary fiber supplementation on fecal metabolites, bacterial taxa, and bacterial metagenomes. Fecal samples were subjected to whole-genome shotgun 454 pyrosequencing to identify both fecal bacterial populations present and their functional genetic capacity. Whole-genome shotgun sequencing results revealed that fiber consumption shifted the Bacteroidetes:Firmicutes ratio, increasing the relative abundance of Bacteroidetes 12 ± 2% and 13 ± 2% with polydextrose and SCF, respectively, compared with NFC. Bivariate correlations showed a positive correlation between the Bacteroidetes:Firmicutes ratio and total dietary fiber intake but not body mass index. Principal coordinates analysis of Bray-Curtis distances indicated that bacterial gene composition was more similar in participants consuming fibers (polydextrose and SCF combined) in comparison with NFC. Shifts in bacterial gene abundances after polydextrose and SCF supplementation included genes associated with carbohydrate, amino acid, and lipid metabolism, as well as metabolism of cofactors and vitamins. This study conveys novel information about the impact of dietary fiber supplementation on the phylogenetic structure and functional capacity of the fecal microbiome of healthy adults. © 2015 American Society for Nutrition.

  18. Liver Ischemic Preconditioning (IPC) Improves Intestinal Microbiota Following Liver Transplantation in Rats through 16s rDNA-Based Analysis of Microbial Structure Shift

    PubMed Central

    Lu, Haifeng; Chen, Xinhua; Jiang, Jianwen; Liu, Hui; He, Yong; Ding, Songming; Hu, Zhenhua; Wang, Weilin; Zheng, Shusen

    2013-01-01

    Background Ischemia-reperfusion (I/R) injury is associated with intestinal microbial dysbiosis. The “gut-liver axis” closely links gut function and liver function in health and disease. Ischemic preconditioning (IPC) has been proven to reduce I/R injury in the surgery. This study aims to explore the effect of IPC on intestinal microbiota and to analyze characteristics of microbial structure shift following liver transplantation (LT). Methods The LT animal models of liver and gut IPC were established. Hepatic graft function was assessed by histology and serum ALT/AST. Intestinal barrier function was evaluated by mucosal ultrastructure, serum endotoxin, bacterial translocation, fecal sIgA content and serum TNF-α. Intestinal bacterial populations were determined by quantitative PCR. Microbial composition was characterized by DGGE and specific bacterial species were determined by sequence analysis. Principal Findings Liver IPC improved hepatic graft function expressed as ameliorated graft structure and reduced ALT/AST levels. After administration of liver IPC, intestinal mucosal ultrastructure improved, serum endotoxin and bacterial translocation mildly decreased, fecal sIgA content increased, and serum TNF-α decreased. Moreover, liver IPC promoted microbial restorations mainly through restoring Bifidobacterium spp., Clostridium clusters XI and Clostridium cluster XIVab on bacterial genus level. DGGE profiles indicated that liver IPC increased microbial diversity and species richness, and cluster analysis demonstrated that microbial structures were similar and clustered together between the NC group and Liver-IPC group. Furthermore, the phylogenetic tree of band sequences showed key bacteria corresponding to 10 key band classes of microbial structure shift induced by liver IPC, most of which were assigned to Bacteroidetes phylum. Conclusion Liver IPC cannot only improve hepatic graft function and intestinal barrier function, but also promote restorations of intestinal microbiota following LT, which may further benefit hepatic graft by positive feedback of the “gut-liver axis”. PMID:24098410

  19. Liver ischemic preconditioning (IPC) improves intestinal microbiota following liver transplantation in rats through 16s rDNA-based analysis of microbial structure shift.

    PubMed

    Ren, Zhigang; Cui, Guangying; Lu, Haifeng; Chen, Xinhua; Jiang, Jianwen; Liu, Hui; He, Yong; Ding, Songming; Hu, Zhenhua; Wang, Weilin; Zheng, Shusen

    2013-01-01

    Ischemia-reperfusion (I/R) injury is associated with intestinal microbial dysbiosis. The "gut-liver axis" closely links gut function and liver function in health and disease. Ischemic preconditioning (IPC) has been proven to reduce I/R injury in the surgery. This study aims to explore the effect of IPC on intestinal microbiota and to analyze characteristics of microbial structure shift following liver transplantation (LT). The LT animal models of liver and gut IPC were established. Hepatic graft function was assessed by histology and serum ALT/AST. Intestinal barrier function was evaluated by mucosal ultrastructure, serum endotoxin, bacterial translocation, fecal sIgA content and serum TNF-α. Intestinal bacterial populations were determined by quantitative PCR. Microbial composition was characterized by DGGE and specific bacterial species were determined by sequence analysis. Liver IPC improved hepatic graft function expressed as ameliorated graft structure and reduced ALT/AST levels. After administration of liver IPC, intestinal mucosal ultrastructure improved, serum endotoxin and bacterial translocation mildly decreased, fecal sIgA content increased, and serum TNF-α decreased. Moreover, liver IPC promoted microbial restorations mainly through restoring Bifidobacterium spp., Clostridium clusters XI and Clostridium cluster XIVab on bacterial genus level. DGGE profiles indicated that liver IPC increased microbial diversity and species richness, and cluster analysis demonstrated that microbial structures were similar and clustered together between the NC group and Liver-IPC group. Furthermore, the phylogenetic tree of band sequences showed key bacteria corresponding to 10 key band classes of microbial structure shift induced by liver IPC, most of which were assigned to Bacteroidetes phylum. Liver IPC cannot only improve hepatic graft function and intestinal barrier function, but also promote restorations of intestinal microbiota following LT, which may further benefit hepatic graft by positive feedback of the "gut-liver axis".

  20. Geometrical principles of homomeric β-barrels and β-helices: Application to modeling amyloid protofilaments.

    PubMed

    Hayward, Steven; Milner-White, E James

    2017-10-01

    Examples of homomeric β-helices and β-barrels have recently emerged. Here we generalize the theory for the shear number in β-barrels to encompass β-helices and homomeric structures. We introduce the concept of the "β-strip," the set of parallel or antiparallel neighboring strands, from which the whole helix can be generated giving it n-fold rotational symmetry. In this context, the shear number is interpreted as the sum around the helix of the fixed register shift between neighboring identical β-strips. Using this approach, we have derived relationships between helical width, pitch, angle between strand direction and helical axis, mass per length, register shift, and number of strands. The validity and unifying power of the method is demonstrated with known structures including α-hemolysin, T4 phage spike, cylindrin, and the HET-s(218-289) prion. From reported dimensions measured by X-ray fiber diffraction on amyloid fibrils, the relationships can be used to predict the register shift and the number of strands within amyloid protofilaments. This was used to construct models of transthyretin and Alzheimer β(40) amyloid protofilaments that comprise a single strip of in-register β-strands folded into a "β-strip helix." Results suggest both stabilization of an individual β-strip helix and growth by addition of further β-strip helices can involve the same pair of sequence segments associating with β-sheet hydrogen bonding at the same register shift. This process would be aided by a repeat sequence. Hence, understanding how the register shift (as the distance between repeat sequences) relates to helical dimensions will be useful for nanotube design. © 2017 Wiley Periodicals, Inc.

  1. Nonadiabatic conditional geometric phase shift with NMR.

    PubMed

    Xiang-Bin, W; Keiji, M

    2001-08-27

    A conditional geometric phase shift gate, which is fault tolerant to certain types of errors due to its geometric nature, was realized recently via nuclear magnetic resonance (NMR) under adiabatic conditions. However, in quantum computation, everything must be completed within the decoherence time. The adiabatic condition makes any fast conditional Berry phase (cyclic adiabatic geometric phase) shift gate impossible. Here we show that by using a newly designed sequence of simple operations with an additional vertical magnetic field, the conditional geometric phase shift gate can be run nonadiabatically. Therefore geometric quantum computation can be done at the same rate as usual quantum computation.

  2. Composite δ13C and petrographic 195-355 ka record from Frasassi cave (central Italy) stalagmites: investigating drivers of speleothem calcite carbon isotope signals.

    NASA Astrophysics Data System (ADS)

    Vanghi, V.; Borsato, A.; Frisia, S.; Drysdale, R.; Hellstrom, J. C.; Bajo, P.; Montanari, A.

    2016-12-01

    Carbon isotope ratio of speleothem calcite is known to be a proxy for climate-dependent soil CO2 production. One of the paradigms is that, ideally, C stable isotope incorporation occurred in equilibrium. Yet, the process of degassing in the cave commonly results in δ13C values more positive than theoretically expected for speleothems formed in temperate-humid settings. Fabrics then provide the benchmark to unravel local, regional and global significance of speleothem δ13C. The δ13C time-series from two precisely U-Th dated Frasassi stalagmites covering the interval from 195 ka to 355 ka (Marine Isotope Stages 7 - 10) were interpreted on the basis of the sequence of fabrics. Columnar fabrics indicated deposition under constant kinetic fractionation, whereby δ13C shifts through time reflected a combination of atmospheric CO2 concentration changes and soil efficiency variability, controlled by regional mean annual temperature. Given that the δ13C values are constantly more-positive-than-expected because of the effect of degassing, shifts to more positive δ13C values above a baseline of -7 permil during glacials are here interpreted as driven by low soil efficiency and higher contribution of atmospheric CO2 (Breecker et al. 2012, Borsato et al. 2015). The comparison of high resolution δ13C curves with atmospheric pCO2 and benthic δ18O records further suggests that hemispheric temperature changes driven by insolation modulated the δ13C shifts above or below the baseline. Thus, a -3‰ shift from glacial to interglacial at terminations IV and III is here ascribed to changes in atmospheric pCO2 (Schubert and Jahren 2012). More open fabrics mark warmer conditions and increased soil productivity and are associated with more negative δ13C. In conclusion, only by coupling petrography and geochemical properties the global and local drivers of δ13C anomalies in stalagmites from this deep cave could be distinguished. Borsato et al. (2015), Earth Surface Processes and Landforms 40 (9), 1158-1170. Breecker et al. (2012), Geochimica et Cosmochimica Acta 96 (1), 230-246. Schubert and Jahren (2012), Geochimica et Cosmochimica Acta 96, 29-43.

  3. Stimulus-Dependent Flexibility in Non-Human Auditory Pitch Processing

    ERIC Educational Resources Information Center

    Bregman, Micah R.; Patel, Aniruddh D.; Gentner, Timothy Q.

    2012-01-01

    Songbirds and humans share many parallels in vocal learning and auditory sequence processing. However, the two groups differ notably in their abilities to recognize acoustic sequences shifted in absolute pitch (pitch height). Whereas humans maintain accurate recognition of words or melodies over large pitch height changes, songbirds are…

  4. Coherent control of the Goos-Hänchen shift via Fano interference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Shaopeng; Yang, Wen-Xing, E-mail: wenxingyang@seu.edu.cn; Zhu, Zhonghu

    2016-04-14

    A scheme of enhanced Goos-Hänchen (GH) shifts in reflected and transmitted light beams is exploited in a cavity, where an asymmetric double AlGaAs/GaAs quantum well structure with resonant tunneling to a common continuum is employed as the intracavity medium. With the help of Fano-type interference induced by resonant tunneling, the generated GH shifts that contain a negative lateral shift in reflected light beam and a positive lateral shift in transmitted light beam are found to be significantly enhanced. More interestingly, these GH shifts in reflected and transmitted light beams are modulated by means of a control beam and external biasmore » voltage, in which maximum negative shift of 1.86 mm and positive shift of 0.37 mm are achievable.« less

  5. Experimental and Theoretical Studies on the Nazarov Cyclization/Wagner-Meerwein Rearrangement Sequence

    PubMed Central

    Lebœuf, David; Ciesielski, Jennifer

    2012-01-01

    Highly functionalized cyclopentenones can be generated stereospecifically by a chemoselective copper(II)-mediated Nazarov/Wagner-Meerwein rearrangement sequence of divinyl ketones. A detailed investigation of this sequence is described including a study of substrate scope and limitations. After the initial 4π electrocyclization, this reaction proceeds via two different sequential [1,2]-shifts, with selectivity that depends upon either migratory ability or the steric bulkiness of the substituents at C1 and C5. This methodology allows the creation of vicinal stereogenic centers, including adjacent quaternary centers. This sequence can also be achieved by using a catalytic amount of copper(II) in combination with NaBAr4f, a weak Lewis acid. During the study of the scope of the reaction, a partial or complete E / Z isomerization of the enone moiety was observed in some cases prior to the cyclization, which resulted in a mixture of diastereomeric products. Use of a Cu(II)-bisoxazoline complex prevented the isomerization, allowing high diastereoselectivity to be obtained in all substrate types. In addition, the reaction sequence was studied by DFT computations at the UB3LYP/6-31G(d,p) level, which are consistent with the proposed sequences observed, including E / Z isomerizations and chemoselective Wagner-Meerwein shifts. PMID:22471833

  6. Discrepancy and Disliking Do Not Induce Negative Opinion Shifts

    PubMed Central

    Flache, Andreas; Mäs, Michael

    2016-01-01

    Both classical social psychological theories and recent formal models of opinion differentiation and bi-polarization assign a prominent role to negative social influence. Negative influence is defined as shifts away from the opinion of others and hypothesized to be induced by discrepancy with or disliking of the source of influence. There is strong empirical support for the presence of positive social influence (a shift towards the opinion of others), but evidence that large opinion differences or disliking could trigger negative shifts is mixed. We examine positive and negative influence with controlled exposure to opinions of other individuals in one experiment and with opinion exchange in another study. Results confirm that similarities induce attraction, but results do not support that discrepancy or disliking entails negative influence. Instead, our findings suggest a robust positive linear relationship between opinion distance and opinion shifts. PMID:27333160

  7. Constant-time 2D and 3D through-bond correlation NMR spectroscopy of solids under 60 kHz MAS

    PubMed Central

    Zhang, Rongchun; Ramamoorthy, Ayyalusamy

    2016-01-01

    Establishing connectivity and proximity of nuclei is an important step in elucidating the structure and dynamics of molecules in solids using magic angle spinning (MAS) NMR spectroscopy. Although recent studies have successfully demonstrated the feasibility of proton-detected multidimensional solid-state NMR experiments under ultrafast-MAS frequencies and obtaining high-resolution spectral lines of protons, assignment of proton resonances is a major challenge. In this study, we first re-visit and demonstrate the feasibility of 2D constant-time uniform-sign cross-peak correlation (CTUC-COSY) NMR experiment on rigid solids under ultrafast-MAS conditions, where the sensitivity of the experiment is enhanced by the reduced spin-spin relaxation rate and the use of low radio-frequency power for heteronuclear decoupling during the evolution intervals of the pulse sequence. In addition, we experimentally demonstrate the performance of a proton-detected pulse sequence to obtain a 3D 1H/13C/1H chemical shift correlation spectrum by incorporating an additional cross-polarization period in the CTUC-COSY pulse sequence to enable proton chemical shift evolution and proton detection in the incrementable t1 and t3 periods, respectively. In addition to through-space and through-bond 13C/1H and 13C/13C chemical shift correlations, the 3D 1H/13C/1H experiment also provides a COSY-type 1H/1H chemical shift correlation spectrum, where only the chemical shifts of those protons, which are bonded to two neighboring carbons, are correlated. By extracting 2D F1/F3 slices (1H/1H chemical shift correlation spectrum) at different 13C chemical shift frequencies from the 3D 1H/13C/1H spectrum, resonances of proton atoms located close to a specific carbon atom can be identified. Overall, the through-bond and through-space homonuclear/heteronuclear proximities determined from the 3D 1H/13C/1H experiment would be useful to study the structure and dynamics of a variety of chemical and biological solids. PMID:26801026

  8. Frequency-shift detectors bind binaural as well as monaural frequency representations.

    PubMed

    Carcagno, Samuele; Semal, Catherine; Demany, Laurent

    2011-12-01

    Previous psychophysical work provided evidence for the existence of automatic frequency-shift detectors (FSDs) that establish perceptual links between successive sounds. In this study, we investigated the characteristics of the FSDs with respect to the binaural system. Listeners were presented with sound sequences consisting of a chord of pure tones followed by a single test tone. Two tasks were performed. In the "present/absent" task, the test tone was either identical to one of the chord components or positioned halfway in frequency between two components, and listeners had to discriminate between these two possibilities. In the "up/down" task, the test tone was slightly different in frequency from one of the chord components and listeners had to identify the direction (up or down) of the corresponding shift. When the test tone was a pure tone presented monaurally, either to the same ear as the chord or to the opposite ear, listeners performed the up/down task better than the present/absent task. This paradoxical advantage for directional frequency shifts, providing evidence for FSDs, persisted when the test tone was replaced by a dichotic stimulus consisting of noise but evoking a pitch sensation as a consequence of binaural processing. Performance in the up/down task was similar for the dichotic stimulus and for a monaural narrow-band noise matched in pitch salience to it. Our results indicate that the FSDs are insensitive to sound localization mechanisms and operate on central frequency representations, at or above the level of convergence of the monaural auditory pathways.

  9. Application of virtual phase-shifting speckle-interferometry for detection of polymorphism in the Chlamydia trachomatis omp1 gene

    NASA Astrophysics Data System (ADS)

    Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.

    2018-04-01

    Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.

  10. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  11. Genomics and integrated systems biology in Plasmodium falciparum: a path to malaria control and eradication.

    PubMed

    Le Roch, K G; Chung, D-W D; Ponts, N

    2012-01-01

    The first draft of the human malaria parasite's genome was released in 2002. Since then, the malaria scientific community has witnessed a steady embrace of new and powerful functional genomic studies. Over the years, these approaches have slowly revolutionized malaria research and enabled the comprehensive, unbiased investigation of various aspects of the parasite's biology. These genome-wide analyses delivered a refined annotation of the parasite's genome, delivered a better knowledge of its RNA, proteins and metabolite derivatives, and fostered the discovery of new vaccine and drug targets. Despite the positive impacts of these genomic studies, most research and investment still focus on protein targets, drugs and vaccine candidates that were known before the publication of the parasite genome sequence. However, recent access to next-generation sequencing technologies, along with an increased number of genome-wide applications, is expanding the impact of the parasite genome on biomedical research, contributing to a paradigm shift in research activities that may possibly lead to new optimized diagnosis and treatments. This review provides an update of Plasmodium falciparum genome sequences and an overview of the rapid development of genomics and system biology applications that have an immense potential of creating powerful tools for a successful malaria eradication campaign. © 2011 Blackwell Publishing Ltd.

  12. Interactions between the promoter and first intron are involved in transcriptional control of alpha 1(I) collagen gene expression.

    PubMed Central

    Bornstein, P; McKay, J; Liska, D J; Apone, S; Devarayalu, S

    1988-01-01

    The first intron of the human collagen alpha 1(I) gene contains several positively and negatively acting elements. We have studied the transcription of collagen-human growth hormone fusion genes, containing deletions and rearrangements of collagen intronic sequences, by transient transfection of chick tendon fibroblasts and NIH 3T3 cells. In chick tendon fibroblasts, but not in 3T3 cells, inversion of intronic sequences containing a previously studied 274-base-pair segment, A274, resulted in markedly reduced human growth hormone mRNA levels as determined by an RNase protection assay. This inhibitory effect was largely alleviated when deletions were introduced in the collagen promoter of plasmids containing negatively oriented intronic sequences. Evidence for interaction of the promoter with the intronic segment, A274, was obtained by gel mobility shift assays. We suggest that promoter-intron interactions, mediated by DNA-binding proteins, regulate collagen gene transcription. Inversion of intronic segments containing critical interactive elements might then lead to an altered geometry and reduced activity of a transcriptional complex in those cells with sufficiently high levels of appropriate transcription factors. We further suggest that the deleted promoter segment plays a key role in directing DNA interactions involved in transcriptional control. Images PMID:3211130

  13. Environmental distribution, abundance and activity of the Miscellaneous Crenarchaeotal Group

    NASA Astrophysics Data System (ADS)

    Lloyd, K. G.; Biddle, J.; Teske, A.

    2011-12-01

    Many marine sedimentary microbes have only been identified by 16S rRNA sequences. Consequently, little is known about the types of metabolism, activity levels, or relative abundance of these groups in marine sediments. We found that one of these uncultured groups, called the Miscellaneous Crenarchaeotal Group (MCG), dominated clone libraries made from reverse transcribed 16S rRNA, and 454 pyrosequenced 16S rRNA genes, in the White Oak River estuary. Primers suitable for quantitative PCR were developed for MCG and used to show that 16S rRNA DNA copy numbers from MCG account for nearly all the archaeal 16S rRNA genes present. RT-qPCR shows much less MCG rRNA than total archaeal rRNA, but comparisons of different primers for each group suggest bias in the RNA-based work relative to the DNA-based work. There is no evidence of a population shift with depth below the sulfate-methane transition zone, suggesting that the metabolism of MCG may not be tied to sulfur or methane cycles. We classified 2,771 new sequences within the SSU Silva 106 database that, along with the classified sequences in the Silva database was used to make an MCG database of 4,646 sequences that allowed us to increase the named subgroups of MCG from 7 to 19. Percent terrestrial sequences in each subgroup is positively correlated with percent of the marine sequences that are nearshore, suggesting that membership in the different subgroups is not random, but dictated by environmental selective pressures. Given their high phylogenetic diversity, ubiquitous distribution in anoxic environments, and high DNA copy number relative to total archaea, members of MCG are most likely anaerobic heterotrophs who are integral to the post-depositional marine carbon cycle.

  14. A G-to-A mutation in IVS-3 of the human gamma fibrinogen gene causing afibrinogenemia due to abnormal RNA splicing.

    PubMed

    Margaglione, M; Santacroce, R; Colaizzo, D; Seripa, D; Vecchione, G; Lupone, M R; De Lucia, D; Fortina, P; Grandone, E; Perricone, C; Di Minno, G

    2000-10-01

    Congenital afibrinogenemia is a rare autosomal recessive disorder characterized by a hemorrhagic diathesis of variable severity. Although more than 100 families with this disorder have been described, genetic defects have been characterized in few cases. An investigation of a young propositus, offspring of a consanguineous marriage, with undetectable levels of functional and quantitative fibrinogen, was conducted. Sequence analysis of the fibrinogen genes showed a homozygous G-to-A mutation at the fifth nucleotide (nt 2395) of the third intervening sequence (IVS) of the gamma-chain gene. Her first-degree relatives, who had approximately half the normal fibrinogen values and showed concordance between functional and immunologic levels, were heterozygtes. The G-to-A change predicts the disappearance of a donor splice site. After transfection with a construct, containing either the wild-type or the mutated sequence, cells with the mutant construct showed an aberrant messenger RNA (mRNA), consistent with skipping of exon 3, but not the expected mRNA. Sequencing of the abnormal mRNA showed the complete absence of exon 3. Skipping of exon 3 predicts the deletion of amino acid sequence from residue 16 to residue 75 and shifting of reading frame at amino acid 76 with a premature stop codon within exon 4 at position 77. Thus, the truncated gamma-chain gene product would not interact with other chains to form the mature fibrinogen molecule. The current findings show that mutations within highly conserved IVS regions of fibrinogen genes could affect the efficiency of normal splicing, giving rise to congenital afibrinogenemia.

  15. Inflammatory bowel diseases phenotype, C. difficile and NOD2 genotype are associated with shifts in human ileum associated microbial composition.

    PubMed

    Li, Ellen; Hamm, Christina M; Gulati, Ajay S; Sartor, R Balfour; Chen, Hongyan; Wu, Xiao; Zhang, Tianyi; Rohlf, F James; Zhu, Wei; Gu, Chi; Robertson, Charles E; Pace, Norman R; Boedeker, Edgar C; Harpaz, Noam; Yuan, Jeffrey; Weinstock, George M; Sodergren, Erica; Frank, Daniel N

    2012-01-01

    We tested the hypothesis that Crohn's disease (CD)-related genetic polymorphisms involved in host innate immunity are associated with shifts in human ileum-associated microbial composition in a cross-sectional analysis of human ileal samples. Sanger sequencing of the bacterial 16S ribosomal RNA (rRNA) gene and 454 sequencing of 16S rRNA gene hypervariable regions (V1-V3 and V3-V5), were conducted on macroscopically disease-unaffected ileal biopsies collected from 52 ileal CD, 58 ulcerative colitis and 60 control patients without inflammatory bowel diseases (IBD) undergoing initial surgical resection. These subjects also were genotyped for the three major NOD2 risk alleles (Leu1007fs, R708W, G908R) and the ATG16L1 risk allele (T300A). The samples were linked to clinical metadata, including body mass index, smoking status and Clostridia difficile infection. The sequences were classified into seven phyla/subphyla categories using the Naïve Bayesian Classifier of the Ribosome Database Project. Centered log ratio transformation of six predominant categories was included as the dependent variable in the permutation based MANCOVA for the overall composition with stepwise variable selection. Polymerase chain reaction (PCR) assays were conducted to measure the relative frequencies of the Clostridium coccoides - Eubacterium rectales group and the Faecalibacterium prausnitzii spp. Empiric logit transformations of the relative frequencies of these two microbial groups were included in permutation-based ANCOVA. Regardless of sequencing method, IBD phenotype, Clostridia difficile and NOD2 genotype were selected as associated (FDR ≤ 0.05) with shifts in overall microbial composition. IBD phenotype and NOD2 genotype were also selected as associated with shifts in the relative frequency of the C. coccoides--E. rectales group. IBD phenotype, smoking and IBD medications were selected as associated with shifts in the relative frequency of F. prausnitzii spp. These results indicate that the effects of genetic and environmental factors on IBD are mediated at least in part by the enteric microbiota.

  16. Inflammatory Bowel Diseases Phenotype, C. difficile and NOD2 Genotype Are Associated with Shifts in Human Ileum Associated Microbial Composition

    PubMed Central

    Li, Ellen; Hamm, Christina M.; Gulati, Ajay S.; Sartor, R. Balfour; Chen, Hongyan; Wu, Xiao; Zhang, Tianyi; Rohlf, F. James; Zhu, Wei; Gu, Chi; Robertson, Charles E.; Pace, Norman R.; Boedeker, Edgar C.; Harpaz, Noam; Yuan, Jeffrey; Weinstock, George M.; Sodergren, Erica; Frank, Daniel N.

    2012-01-01

    We tested the hypothesis that Crohn’s disease (CD)-related genetic polymorphisms involved in host innate immunity are associated with shifts in human ileum–associated microbial composition in a cross-sectional analysis of human ileal samples. Sanger sequencing of the bacterial 16S ribosomal RNA (rRNA) gene and 454 sequencing of 16S rRNA gene hypervariable regions (V1–V3 and V3–V5), were conducted on macroscopically disease-unaffected ileal biopsies collected from 52 ileal CD, 58 ulcerative colitis and 60 control patients without inflammatory bowel diseases (IBD) undergoing initial surgical resection. These subjects also were genotyped for the three major NOD2 risk alleles (Leu1007fs, R708W, G908R) and the ATG16L1 risk allele (T300A). The samples were linked to clinical metadata, including body mass index, smoking status and Clostridia difficile infection. The sequences were classified into seven phyla/subphyla categories using the Naïve Bayesian Classifier of the Ribosome Database Project. Centered log ratio transformation of six predominant categories was included as the dependent variable in the permutation based MANCOVA for the overall composition with stepwise variable selection. Polymerase chain reaction (PCR) assays were conducted to measure the relative frequencies of the Clostridium coccoides – Eubacterium rectales group and the Faecalibacterium prausnitzii spp. Empiric logit transformations of the relative frequencies of these two microbial groups were included in permutation-based ANCOVA. Regardless of sequencing method, IBD phenotype, Clostridia difficile and NOD2 genotype were selected as associated (FDR ≤0.05) with shifts in overall microbial composition. IBD phenotype and NOD2 genotype were also selected as associated with shifts in the relative frequency of the C. coccoides – E. rectales group. IBD phenotype, smoking and IBD medications were selected as associated with shifts in the relative frequency of F. prausnitzii spp. These results indicate that the effects of genetic and environmental factors on IBD are mediated at least in part by the enteric microbiota. PMID:22719818

  17. Use of pyrosequencing and denaturing gradient gel electrophoresis to examine the effects of probiotics and essential oil blends on digestive microflora in broilers under mixed Eimeria infection.

    PubMed

    Hume, Michael E; Barbosa, Nei A; Dowd, Scot E; Sakomura, Nilva K; Nalian, Armen G; Martynova-Van Kley, Alexandra; Oviedo-Rondón, Edgar O

    2011-11-01

    A protective digestive microflora helps prevent and reduce broiler infection and colonization by enteropathogens. In the current experiment, broilers fed diets supplemented with probiotics and essential oil (EO) blends were infected with a standard mixed Eimeria spp. to determine effects of performance enhancers on ileal and cecal microbial communities (MCs). Eight treatment groups included four controls (uninfected-unmedicated [UU], unmedicated-infected, the antibiotic BMD plus the ionophore Coban as positive control, and the ionophore as negative control), and four treatments (probiotics BC-30 and Calsporin; and EO, Crina Poultry Plus, and Crina PoultryAF). Day-old broilers were raised to 14 days in floor pens on used litter and then were moved to Petersime batteries and inoculated at 15 days with mixed Eimeria spp. Ileal and cecal samples were collected at 14 days and 7 days postinfection. Digesta DNA was subjected to pyrosequencing for sequencing of individual cecal bacteria and denaturing gradient gel electrophoresis (DGGE) for determination of changes in ileal and cecal MC according to percentage similarity coefficient (%SC). Pyrosequencing is very sensitive detecting shifts in individual bacterial sequences, whereas DGGE is able to detect gross shifts in entire MC. These combined techniques offer versatility toward identifying feed additive and mild Eimeria infection modulation of broiler MC. Pyrosequencing detected 147 bacterial species sequences. Additionally, pyrosequencing revealed the presence of relatively low levels of the potential human enteropathogens Campylobacter sp. and four Shigella spp. as well as the potential poultry pathogen Clostridiun perfringens. Pre- and postinfection changes in ileal (56%SC) and cecal (78.5%SC) DGGE profiles resulted from the coccidia infection and with increased broiler age. Probiotics and EO changed MC from those seen in UU ilea and ceca. Results potentially reflect the performance enhancement above expectations in comparison to broilers not given the probiotics or the specific EO blends as feed supplements.

  18. Microbiome dynamic modulation through functional diets based on pre- and probiotics (mannan-oligosaccharides and Saccharomyces cerevisiae) in juvenile rainbow trout (Oncorhynchus mykiss).

    PubMed

    Gonçalves, A T; Gallardo-Escárate, C

    2017-05-01

    This study used high-throughput sequencing to evaluate the intestinal microbiome dynamics in rainbow trout (Oncorhynchus mykiss) fed commercial diets supplemented with either pre- or probiotics (0·6% mannan-oligosaccharides and 0·5% Saccharomyces cerevisiae respectively) or the mixture of both. A total of 57 fish whole intestinal mucosa and contents bacterial communities were characterized by high-throughput sequencing and analysis of the V3-V4 region of the 16S rRNA gene, as well as the relationship between plasma biochemical health indicators and microbiome diversity. This was performed at 7, 14 and 30 days after start feeding functional diets, and microbiome diversity increased when fish fed functional diets after 7 days and it was positively correlated with plasma cholesterol levels. Dominant phyla were, in descending order, Proteobacteria, Firmicutes, Actinobacteria, Acidobacteria, Bacteroidetes and Fusobacteria. However, functional diets reduced the abundance of Gammaproteobacteria to favour abundances of organisms from Firmicutes and Fusobacteria, two phyla with members that confer beneficial effects. A dynamic shift of the microbiome composition was observed with changes after 7 days of feeding and the modulation by functional diets tend to cluster the corresponding groups apart from CTRL group. The core microbiome showed an overall stability with functional diets, except genus such as Escherichia-Shigella that suffered severe reductions on their abundances when feeding any of the functional diets. Functional diets based on pre- or probiotics dynamically modulate intestinal microbiota of juvenile trout engaging taxonomical abundance shifts that might impact fish physiological performance. This study shows for the first time the microbiome modulation dynamics by functional diets based on mannan-oligosaccharides and S. cerevisiae and their synergy using culture independent high-throughput sequencing technology, revealing the complexity behind the dietary modulation with functional feeds in aquatic organisms. © 2017 The Society for Applied Microbiology.

  19. Type I and II β-turns prediction using NMR chemical shifts.

    PubMed

    Wang, Ching-Cheng; Lai, Wen-Chung; Chuang, Woei-Jer

    2014-07-01

    A method for predicting type I and II β-turns using nuclear magnetic resonance (NMR) chemical shifts is proposed. Isolated β-turn chemical-shift data were collected from 1,798 protein chains. One-dimensional statistical analyses on chemical-shift data of three classes β-turn (type I, II, and VIII) showed different distributions at four positions, (i) to (i + 3). Considering the central two residues of type I β-turns, the mean values of Cο, Cα, H(N), and N(H) chemical shifts were generally (i + 1) > (i + 2). The mean values of Cβ and Hα chemical shifts were (i + 1) < (i + 2). The distributions of the central two residues in type II and VIII β-turns were also distinguishable by trends of chemical shift values. Two-dimensional cluster analyses on chemical-shift data show positional distributions more clearly. Based on these propensities of chemical shift classified as a function of position, rules were derived using scoring matrices for four consecutive residues to predict type I and II β-turns. The proposed method achieves an overall prediction accuracy of 83.2 and 84.2% with the Matthews correlation coefficient values of 0.317 and 0.632 for type I and II β-turns, indicating that its higher accuracy for type II turn prediction. The results show that it is feasible to use NMR chemical shifts to predict the β-turn types in proteins. The proposed method can be incorporated into other chemical-shift based protein secondary structure prediction methods.

  20. Vibration-Rotation Bands of HF and DF

    DTIC Science & Technology

    1977-09-23

    98 IZa. Comparison of Observed and Calculated Line Positions of HF, Av = I Sequence ........................... 99 f2b. Comparison of Observed and...Calculated Line Positions of HF, Av = 2 Sequence ........................... 102 12c. Comparison of Observed and Calculated Line Positions of HF, Av = 3...Sequence ........................... 107 i2d. Comparison of Observed and Calculated Line Positions ofHF, Av = 4 Sequence ........................... fi

  1. Mercury Trapped Ion Frequency Standard for Ultra-Stable Reference Applications

    NASA Technical Reports Server (NTRS)

    Larsen, Kameron (Inventor); Burt, Eric A. (Inventor); Tjoelker, Robert L. (Inventor); Hamell, Robert L. (Inventor); Tucker, Blake C. (Inventor)

    2017-01-01

    An atomic clock including an ion trap assembly, a C-field coil positioned for generating a first magnetic field in the interrogation region of the ion trap assembly, a compensation coil positioned for generating a second magnetic field in the interrogation region, wherein the combination of the first and second magnetic fields produces an ion number-dependent second order Zeeman shift (Zeeman shift) in the resonance frequency that is opposite in sign to an ion number-dependent second order Doppler shift (Doppler shift) in the resonance frequency, the C-field coil has a radius selected using data indicating how changes in the radius affect an ion-number-dependent shift in the resonance frequency, such that a difference in magnitude between the Doppler shift and the Zeeman shift is controlled or reduced, and the resonance frequency, including the adjustment by the Zeeman shift, is used to obtain the frequency standard.

  2. Holes influence the mutation spectrum of human mitochondrial DNA

    NASA Astrophysics Data System (ADS)

    Villagran, Martha; Miller, John

    Mutations drive evolution and disease, showing highly non-random patterns of variant frequency vs. nucleotide position. We use computational DNA hole spectroscopy [M.Y. Suarez-Villagran & J.H. Miller, Sci. Rep. 5, 13571 (2015)] to reveal sites of enhanced hole probability in selected regions of human mitochondrial DNA. A hole is a mobile site of positive charge created when an electron is removed, for example by radiation or contact with a mutagenic agent. The hole spectra are quantum mechanically computed using a two-stranded tight binding model of DNA. We observe significant correlation between spectra of hole probabilities and of genetic variation frequencies from the MITOMAP database. These results suggest that hole-enhanced mutation mechanisms exert a substantial, perhaps dominant, influence on mutation patterns in DNA. One example is where a trapped hole induces a hydrogen bond shift, known as tautomerization, which then triggers a base-pair mismatch during replication. Our results deepen overall understanding of sequence specific mutation rates, encompassing both hotspots and cold spots, which drive molecular evolution.

  3. Genetic diversity of porcine circovirus type 2 (PCV2) in Thailand during 2009-2015.

    PubMed

    Thangthamniyom, Nattarat; Sangthong, Pradit; Poolperm, Pariwat; Thanantong, Narut; Boonsoongnern, Alongkot; Hansoongnern, Payuda; Semkum, Ploypailin; Petcharat, Nantawan; Lekcharoensuk, Porntippa

    2017-09-01

    Porcine circovirus type 2 (PCV2), the essential cause of porcine circovirus associated disease (PCVAD), has evolved rapidly and it has been reported worldwide. However, genetic information of PCV2 in Thailand has not been available since 2011. Herein, we studied occurrence and genetic diversity of PCV2 in Thailand and their relationships to the global PCV2 based on ORF2 sequences. The results showed that 306 samples (44.09%) from 56 farms (80%) were PCV2 positive by PCR. Phylogenetic trees constructed by both neighbor-joining and Bayesian Inference yielded similar topology of the ORF2 sequences. Thai PCV2 comprise four clusters: PCV2a (5.5%), PCV2b (29.41%), intermediate clade 1 (IM1) PCV2b (11.03%) and PCV2d (54.41%). Genetic shift of PCV2 in Thailand has occurred similarly to the global situation. The shift from PCV2b to PCV2d was clearly observed during 2013-2014. The viruses with genetically similar to the first reported PCV2 in 2004 have still circulated in Thailand. The first Thai PCV2b and PCV2d were closely related to the neighboring countries. The haplotype network analysis revealed the relationship of PCV2 in Thailand and other countries. These results indicate that genetic diversity of PCV2 in Thailand is caused by genetic drift of the local strains and intermittent introduction of new strains or genotypes from other countries. Genetic evolution of PCV2 in Thailand is similar to that occurs globally. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. 29 CFR 1918.24 - Fixed and portable ladders.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., and be positively secured or held against shifting or slipping. When conditions are such that a... strength shall be furnished and positively secured or held against shifting or slipping while in use. Steps... securely positioned on a level and firm base. (2) Ladders shall be fitted with slip-resistant bases and/or...

  5. 29 CFR 1918.24 - Fixed and portable ladders.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ..., and be positively secured or held against shifting or slipping. When conditions are such that a... strength shall be furnished and positively secured or held against shifting or slipping while in use. Steps... securely positioned on a level and firm base. (2) Ladders shall be fitted with slip-resistant bases and/or...

  6. 29 CFR 1918.24 - Fixed and portable ladders.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., and be positively secured or held against shifting or slipping. When conditions are such that a... strength shall be furnished and positively secured or held against shifting or slipping while in use. Steps... securely positioned on a level and firm base. (2) Ladders shall be fitted with slip-resistant bases and/or...

  7. 29 CFR 1918.24 - Fixed and portable ladders.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ..., and be positively secured or held against shifting or slipping. When conditions are such that a... strength shall be furnished and positively secured or held against shifting or slipping while in use. Steps... securely positioned on a level and firm base. (2) Ladders shall be fitted with slip-resistant bases and/or...

  8. 29 CFR 1918.24 - Fixed and portable ladders.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ..., and be positively secured or held against shifting or slipping. When conditions are such that a... strength shall be furnished and positively secured or held against shifting or slipping while in use. Steps... securely positioned on a level and firm base. (2) Ladders shall be fitted with slip-resistant bases and/or...

  9. Chaos and unpredictability in evolution of cooperation in continuous time

    NASA Astrophysics Data System (ADS)

    You, Taekho; Kwon, Minji; Jo, Hang-Hyun; Jung, Woo-Sung; Baek, Seung Ki

    2017-12-01

    Cooperators benefit others with paying costs. Evolution of cooperation crucially depends on the cost-benefit ratio of cooperation, denoted as c . In this work, we investigate the infinitely repeated prisoner's dilemma for various values of c with four of the representative memory-one strategies, i.e., unconditional cooperation, unconditional defection, tit-for-tat, and win-stay-lose-shift. We consider replicator dynamics which deterministically describes how the fraction of each strategy evolves over time in an infinite-sized well-mixed population in the presence of implementation error and mutation among the four strategies. Our finding is that this three-dimensional continuous-time dynamics exhibits chaos through a bifurcation sequence similar to that of a logistic map as c varies. If mutation occurs with rate μ ≪1 , the position of the bifurcation sequence on the c axis is numerically found to scale as μ0.1, and such sensitivity to μ suggests that mutation may have nonperturbative effects on evolutionary paths. It demonstrates how the microscopic randomness of the mutation process can be amplified to macroscopic unpredictability by evolutionary dynamics.

  10. The molecular genetic makeup of acute lymphoblastic leukemia | Office of Cancer Genomics

    Cancer.gov

    Abstract: Genomic profiling has transformed our understanding of the genetic basis of acute lymphoblastic leukemia (ALL). Recent years have seen a shift from microarray analysis and candidate gene sequencing to next-generation sequencing. Together, these approaches have shown that many ALL subtypes are characterized by constellations of structural rearrangements, submicroscopic DNA copy number alterations, and sequence mutations, several of which have clear implications for risk stratification and targeted therapeutic intervention.

  11. Spatial variations of bacterial community and its relationship with water chemistry in Sanya Bay, South China Sea as determined by DGGE fingerprinting and multivariate analysis.

    PubMed

    Ling, Juan; Zhang, Yan-Ying; Dong, Jun-De; Wang, You-Shao; Feng, Jing-Bing; Zhou, Wei-Hua

    2015-10-01

    Bacteria play important roles in the structure and function of marine food webs by utilizing nutrients and degrading the pollutants, and their distribution are determined by surrounding water chemistry to a certain extent. It is vital to investigate the bacterial community's structure and identifying the significant factors by controlling the bacterial distribution in the paper. Flow cytometry showed that the total bacterial abundance ranged from 5.27 × 10(5) to 3.77 × 10(6) cells/mL. Molecular fingerprinting technique, denaturing gradient gel electrophoresis (DGGE) followed by DNA sequencing has been employed to investigate the bacterial community composition. The results were then interpreted through multivariate statistical analysis and tended to explain its relationship to the environmental factors. A total of 270 bands at 83 different positions were detected in DGGE profiles and 29 distinct DGGE bands were sequenced. The predominant bacteria were related to Phyla Protebacteria species (31 %, nine sequences), Cyanobacteria (37.9 %, eleven sequences) and Actinobacteria (17.2 %, five sequences). Other phylogenetic groups identified including Firmicutes (6.9 %, two sequences), Bacteroidetes (3.5 %, one sequences) and Verrucomicrobia (3.5 %, one sequences). Conical correspondence analysis was used to elucidate the relationships between the bacterial community compositions and environmental factors. The results showed that the spatial variations in the bacterial community composition was significantly related to phosphate (P = 0.002, P < 0.01), dissolved organic carbon (P = 0.004, P < 0.01), chemical oxygen demand (P = 0.010, P < 0.05) and nitrite (P = 0.016, P < 0.05). This study revealed the spatial variations of bacterial community and significant environmental factors driving the bacterial composition shift. These results may be valuable for further investigation on the functional microbial structure and expression quantitatively under the polluted environments in the world.

  12. Intrafractional Baseline Shift or Drift of Lung Tumor Motion During Gated Radiation Therapy With a Real-Time Tumor-Tracking System.

    PubMed

    Takao, Seishin; Miyamoto, Naoki; Matsuura, Taeko; Onimaru, Rikiya; Katoh, Norio; Inoue, Tetsuya; Sutherland, Kenneth Lee; Suzuki, Ryusuke; Shirato, Hiroki; Shimizu, Shinichi

    2016-01-01

    To investigate the frequency and amplitude of baseline shift or drift (shift/drift) of lung tumors in stereotactic body radiation therapy (SBRT), using a real-time tumor-tracking radiation therapy (RTRT) system. Sixty-eight patients with peripheral lung tumors were treated with SBRT using the RTRT system. One of the fiducial markers implanted near the tumor was used for the real-time monitoring of the intrafractional tumor motion every 0.033 seconds by the RTRT system. When baseline shift/drift is determined by the system, the position of the treatment couch is adjusted to compensate for the shift/drift. Therefore, the changes in the couch position correspond to the baseline shift/drift in the tumor motion. The frequency and amount of adjustment to the couch positions in the left-right (LR), cranio-caudal (CC), and antero-posterior (AP) directions have been analyzed for 335 fractions administered to 68 patients. The average change in position of the treatment couch during the treatment time was 0.45 ± 2.23 mm (mean ± standard deviation), -1.65 ± 5.95 mm, and 1.50 ± 2.54 mm in the LR, CC, and AP directions, respectively. Overall the baseline shift/drift occurs toward the cranial and posterior directions. The incidence of baseline shift/drift exceeding 3 mm was 6.0%, 15.5%, 14.0%, and 42.1% for the LR, CC, AP, and for the square-root of sum of 3 directions, respectively, within 10 minutes of the start of treatment, and 23.0%, 37.6%, 32.5%, and 71.6% within 30 minutes. Real-time monitoring and frequent adjustments of the couch position and/or adding appropriate margins are suggested to be essential to compensate for possible underdosages due to baseline shift/drift in SBRT for lung cancers. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Measurements of relative chemical shift tensor orientations in solid-state NMR: new slow magic angle spinning dipolar recoupling experiments.

    PubMed

    Jurd, Andrew P S; Titman, Jeremy J

    2009-08-28

    Solid-state NMR experiments can be used to determine conformational parameters, such as interatomic distances and torsion angles. The latter can be obtained from measurements of the relative orientation of two chemical shift tensors, if the orientation of these with respect to the surrounding bonds is known. In this paper, a new rotor-synchronized magic angle spinning (MAS) dipolar correlation experiment is described which can be used in this way. Because the experiment requires slow MAS rates, a novel recoupling sequence, designed using symmetry principles, is incorporated into the mixing period. This recoupling sequence is based in turn on a new composite cyclic pulse referred to as COAST (for combined offset and anisotropy stabilization). The new COAST-C7(2)(1) sequence is shown to give good theoretical and experimental recoupling efficiency, even when the CSA far exceeds the MAS rate. In this regime, previous recoupling sequences, such as POST-C7(2)(1), exhibit poor recoupling performance. The effectiveness of the new method has been explored by a study of the dipeptide L-phenylalanyl-L-phenylalanine.

  14. The role of pH in determining the species composition of the human colonic microbiota.

    PubMed

    Duncan, Sylvia H; Louis, Petra; Thomson, John M; Flint, Harry J

    2009-08-01

    The pH of the colonic lumen varies with anatomical site and microbial fermentation of dietary residue. We have investigated the impact of mildly acidic pH, which occurs in the proximal colon, on the growth of different species of human colonic bacteria in pure culture and in the complete microbial community. Growth was determined for 33 representative human colonic bacteria at three initial pH values (approximately 5.5, 6.2 and 6.7) in anaerobic YCFA medium, which includes a mixture of short-chain fatty acids (SCFA) with 0.2% glucose as energy source. Representatives of all eight Bacteroides species tested grew poorly at pH 5.5, as did Escherichia coli, whereas 19 of the 23 gram-positive anaerobes tested gave growth rates at pH 5.5 that were at least 50% of those at pH 6.7. Growth inhibition of B. thetaiotaomicron at pH 5.5 was increased by the presence of the SCFA mix (33 mM acetate, 9 mM propionate and 1 mM each of iso-valerate, valerate and iso-butyrate). Analysis of amplified 16S rRNA sequences demonstrated a major pH-driven shift within a human faecal bacterial community in a continuous flow fermentor. Bacteroides spp. accounted for 27% of 16S rRNA sequences detected at pH 5.5, but 86% of sequences at pH 6.7. Conversely, butyrate-producing gram-positive bacteria related to Eubacterium rectale represented 50% of all 16S rRNA sequences at pH 5.5, but were not detected at pH 6.7. Inhibition of the growth of a major group of gram-negative bacteria at mildly acidic pH apparently creates niches that can be exploited by more low pH-tolerant microorganisms.

  15. Anomalous positive flatband voltage shifts in metal gate stacks containing rare-earth oxide capping layers

    NASA Astrophysics Data System (ADS)

    Caraveo-Frescas, J. A.; Hedhili, M. N.; Wang, H.; Schwingenschlögl, U.; Alshareef, H. N.

    2012-03-01

    It is shown that the well-known negative flatband voltage (VFB) shift, induced by rare-earth oxide capping in metal gate stacks, can be completely reversed in the absence of the silicon overlayer. Using TaN metal gates and Gd2O3-doped dielectric, we measure a ˜350 mV negative shift with the Si overlayer present and a ˜110 mV positive shift with the Si overlayer removed. This effect is correlated to a positive change in the average electrostatic potential at the TaN/dielectric interface which originates from an interfacial dipole. The dipole is created by the replacement of interfacial oxygen atoms in the HfO2 lattice with nitrogen atoms from TaN.

  16. Charge injection from gate electrode by simultaneous stress of optical and electrical biases in HfInZnO amorphous oxide thin film transistor

    NASA Astrophysics Data System (ADS)

    Kwon, Dae Woong; Kim, Jang Hyun; Chang, Ji Soo; Kim, Sang Wan; Sun, Min-Chul; Kim, Garam; Kim, Hyun Woo; Park, Jae Chul; Song, Ihun; Kim, Chang Jung; Jung, U. In; Park, Byung-Gook

    2010-11-01

    A comprehensive study is done regarding stabilities under simultaneous stress of light and dc-bias in amorphous hafnium-indium-zinc-oxide thin film transistors. The positive threshold voltage (Vth) shift is observed after negative gate bias and light stress, and it is completely different from widely accepted phenomenon which explains that negative-bias stress results in Vth shift in the left direction by bias-induced hole-trapping. Gate current measurement is performed to explain the unusual positive Vth shift under simultaneous application of light and negative gate bias. As a result, it is clearly found that the positive Vth shift is derived from electron injection from gate electrode to gate insulator.

  17. Depositional sequence stratigraphy and architecture of the cretaceous ferron sandstone: Implications for coal and coalbed methane resources - A field excursion

    USGS Publications Warehouse

    Garrison, J.R.; Van Den, Bergh; Barker, C.E.; Tabet, D.E.

    1997-01-01

    This Field Excursion will visit outcrops of the fluvial-deltaic Upper Cretaceous (Turonian) Ferron Sandstone Member of the Mancos Shale, known as the Last Chance delta or Upper Ferron Sandstone. This field guide and the field stops will outline the architecture and depositional sequence stratigraphy of the Upper Ferron Sandstone clastic wedge and explore the stratigraphic positions and compositions of major coal zones. The implications of the architecture and stratigraphy of the Ferron fluvial-deltaic complex for coal and coalbed methane resources will be discussed. Early works suggested that the southwesterly derived deltaic deposits of the the upper Ferron Sandstone clastic wedge were a Type-2 third-order depositional sequence, informally called the Ferron Sequence. These works suggested that the Ferron Sequence is separated by a type-2 sequence boundary from the underlying 3rd-order Hyatti Sequence, which has its sediment source from the northwest. Within the 3rd-order depositional sequence, the deltaic events of the Ferron clastic wedge, recognized as parasequence sets, appear to be stacked into progradational, aggradational, and retrogradational patterns reflecting a generally decreasing sediment supply during an overall slow sea-level rise. The architecture of both near-marine facies and non-marine fluvial facies exhibit well defined trends in response to this decrease in available sediment. Recent studies have concluded that, unless coincident with a depositional sequence boundary, regionally extensive coal zones occur at the tops of the parasequence sets within the Ferron clastic wedge. These coal zones consist of coal seams and their laterally equivalent fissile carbonaceous shales, mudstones, and siltstones, paleosols, and flood plain mudstones. Although the compositions of coal zones vary along depositional dip, the presence of these laterally extensive stratigraphic horizons, above parasequence sets, provides a means of correlating and defining the tops of depositional parasequence sets in both near-marine and non-marine parts of fluvial-deltaic depositional sequences. Ongoing field studies, based on this concept of coal zone stratigraphy, and detailed stratigraphic mapping, have documented the existence of at least 12 parasequence sets within the Last Chance delta clastic wedge. These parasequence sets appear to form four high frequency, 4th-order depositional sequences. The dramatic erosional unconformities, associated with these 4th-order sequence boundaries, indicate that there was up to 20-30 m of erosion, signifying locally substantial base-level drops. These base-level drops were accompanied by a basin ward shift in paleo-shorelines by as much as 5-7 km. These 4th-order Upper Ferron Sequences are superimposed on the 3rd-order sea-level rise event and the 3rd-order, sediment supply/accommodation space driven, stratigraphie architecture of the Upper Ferron Sandstone. The fluvial deltaic architecture shows little response to these 4th-order sea-level events. Coal zones generally thicken landward relative to the mean position of the landward pinch-out of the underlying parasequence set, but after some distance landward, they decrease in thickness. Coal zones also generally thin seaward relative to the mean position of the landward pinch-out of the underlying parasequence set. The coal is thickest in the region between this landward pinch-out and the position of maximum zone thickness. Data indicate that the proportion of coal in the coal zone decreases progressively landward from the landward pinch-out. The effects of differential compaction and differences in original pre-peat swamp topography have the effect of adding perturbations to the general trends. These coal zone systematics have major impact on approaches to exploration and production, and the resource accessment of both coal and coalbed methane.

  18. Early dynamics of the semantic priming shift

    PubMed Central

    Lavigne, Frédéric; Chanquoy, Lucile; Dumercy, Laurent; Vitu, Françoise

    2013-01-01

    Semantic processing of sequences of words requires the cognitive system to keep several word meanings simultaneously activated in working memory with limited capacity. The real- time updating of the sequence of word meanings relies on dynamic changes in the associates to the words that are activated. Protocols involving two sequential primes report a semantic priming shift from larger priming of associates to the first prime to larger priming of associates to the second prime, in a range of long SOAs (stimulus-onset asynchronies) between the second prime and the target. However, the possibility for an early semantic priming shift is still to be tested, and its dynamics as a function of association strength remain unknown. Three multiple priming experiments are proposed that cross-manipulate association strength between each of two successive primes and a target, for different values of short SOAs and prime durations. Results show an early priming shift ranging from priming of associates to the first prime only to priming of strong associates to the first prime and all of the associates to the second prime. We investigated the neural basis of the early priming shift by using a network model of spike frequency adaptive cortical neurons (e.g., Deco & Rolls, 2005), able to code different association strengths between the primes and the target. The cortical network model provides a description of the early dynamics of the priming shift in terms of pro-active and retro-active interferences within populations of excitatory neurons regulated by fast and unselective inhibitory feedback. PMID:23717346

  19. Cross-fostering immediately after birth induces a permanent microbiota shift that is shaped by the nursing mother.

    PubMed

    Daft, Joseph G; Ptacek, Travis; Kumar, Ranjit; Morrow, Casey; Lorenz, Robin G

    2015-01-01

    Current research has led to the appreciation that there are differences in the commensal microbiota between healthy individuals and individuals that are predisposed to disease. Treatments to reverse disease pathogenesis through the manipulation of the gastrointestinal (GI) microbiota are now being explored. Normalizing microbiota between different strains of mice in the same study is also needed to better understand disease pathogenesis. Current approaches require repeated delivery of bacteria and large numbers of animals and vary in treatment start time. A method is needed that can shift the microbiota of predisposed individuals to a healthy microbiota at an early age and sustain this shift through the lifetime of the individual. We tested cross-fostering of pups within 48 h of birth as a means to permanently shift the microbiota from birth. Taxonomical analysis revealed that the nursing mother was the critical factor in determining bacterial colonization, instead of the birth mother. Data was evaluated using bacterial 16S rDNA sequences from fecal pellets and sequencing was performed on an Illumina Miseq using a 251 bp paired-end library. The results show that cross-fostering is an effective means to induce an early and maintained shift in the commensal microbiota. This will allow for the evaluation of a prolonged microbial shift and its effects on disease pathogenesis. Cross-fostering will also eliminate variation within control models by normalizing the commensal microbiota between different strains of mice.

  20. Extended Closed-form Expressions for the Robust Symmetrical Number System Dynamic Range and an Efficient Algorithm for its Computation

    DTIC Science & Technology

    2014-01-01

    and distance between all of the vector ambiguity pairs for the combined N−sequences. To simplify our derivation, we define the center of ambiguity (COA...modulo N . The resulting structure of the N sequences ensures that two successive RSNS vectors (paired terms from all N sequences) when considered...represented by a vector , Xh = [x1,h, x2,h, . . . , xN,h] T , of N paired integers from each se- quence at h. For example, a left-shifted, three-sequence

  1. bHLH106 Integrates Functions of Multiple Genes through Their G-Box to Confer Salt Tolerance on Arabidopsis.

    PubMed

    Ahmad, Aftab; Niwa, Yasuo; Goto, Shingo; Ogawa, Takeshi; Shimizu, Masanori; Suzuki, Akane; Kobayashi, Kyoko; Kobayashi, Hirokazu

    2015-01-01

    An activation-tagging methodology was applied to dedifferentiated calli of Arabidopsis to identify new genes involved in salt tolerance. This identified salt tolerant callus 8 (stc8) as a gene encoding the basic helix-loop-helix transcription factor bHLH106. bHLH106-knockout (KO) lines were more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. Back-transformation of the KO line rescued its phenotype, and over-expression (OX) of bHLH106 in differentiated plants exhibited tolerance to NaCl. Green fluorescent protein (GFP) fused with bHLH106 revealed that it was localized to the nucleus. Prepared bHLH106 protein was subjected to electrophoresis mobility shift assays against E-box sequences (5'-CANNTG-3'). The G-box sequence 5'-CACGTG-3' had the strongest interaction with bHLH106. bHLH106-OX lines were transcriptomically analyzed, and resultant up- and down-regulated genes selected on the criterion of presence of a G-box sequence. There were 198 genes positively regulated by bHLH106 and 36 genes negatively regulated; these genes possessed one or more G-box sequences in their promoter regions. Many of these genes are known to be involved in abiotic stress response. It is concluded that bHLH106 locates at a branching point in the abiotic stress response network by interacting directly to the G-box in genes conferring salt tolerance on plants.

  2. Association between rotating night shift work and metabolic syndrome in Korean workers: differences between 8-hour and 12-hour rotating shift work.

    PubMed

    Oh, Jae-Il; Yim, Hyeon Woo

    2018-02-07

    This study aimed to analyze the association between the shift work schedule and metabolic syndrome (MetS). This is a retrospective longitudinal study based on the 2015 health checkup data of 2,090 workers evaluated for MetS in 2010 at a general hospital in Korea. The participants were divided according to their shift work schedule into daytime, three-shift (8-h rotation), and two-shift (12-h rotation) workers. The index that indicates the association between the shift work schedule and MetS is the odds ratio (OR) calculated using multivariate logistic regression. The analysis for the entire group of workers indicated that there was positive association between two-shift rotation and MetS (OR=1.58, 95% confidence interval [CI]: 1.09, 2.29). In the analysis of rotating night-shift workers, the years of rotating night shifts, frequency of night-shift work, and sleep disturbance were added to the confounding variables, and two-shift work remained positively associated with MetS (OR=1.72, 95% CI: 1.10, 2.70). The risk of MetS differs based on the shift work schedules they engage in. Hence, structural changes to the shift work schedules are required to prevent MetS in night-shift workers.

  3. Association between rotating night shift work and metabolic syndrome in Korean workers: differences between 8-hour and 12-hour rotating shift work

    PubMed Central

    OH, Jae-Il; YIM, Hyeon Woo

    2017-01-01

    This study aimed to analyze the association between the shift work schedule and metabolic syndrome (MetS). This is a retrospective longitudinal study based on the 2015 health checkup data of 2,090 workers evaluated for MetS in 2010 at a general hospital in Korea. The participants were divided according to their shift work schedule into daytime, three-shift (8-h rotation), and two-shift (12-h rotation) workers. The index that indicates the association between the shift work schedule and MetS is the odds ratio (OR) calculated using multivariate logistic regression. The analysis for the entire group of workers indicated that there was positive association between two-shift rotation and MetS (OR=1.58, 95% confidence interval [CI]: 1.09, 2.29). In the analysis of rotating night-shift workers, the years of rotating night shifts, frequency of night-shift work, and sleep disturbance were added to the confounding variables, and two-shift work remained positively associated with MetS (OR=1.72, 95% CI: 1.10, 2.70). The risk of MetS differs based on the shift work schedules they engage in. Hence, structural changes to the shift work schedules are required to prevent MetS in night-shift workers. PMID:29046489

  4. The Rise and Fall of an Evolutionary Innovation: Contrasting Strategies of Venom Evolution in Ancient and Young Animals

    PubMed Central

    Sunagar, Kartik; Moran, Yehu

    2015-01-01

    Animal venoms are theorized to evolve under the significant influence of positive Darwinian selection in a chemical arms race scenario, where the evolution of venom resistance in prey and the invention of potent venom in the secreting animal exert reciprocal selection pressures. Venom research to date has mainly focused on evolutionarily younger lineages, such as snakes and cone snails, while mostly neglecting ancient clades (e.g., cnidarians, coleoids, spiders and centipedes). By examining genome, venom-gland transcriptome and sequences from the public repositories, we report the molecular evolutionary regimes of several centipede and spider toxin families, which surprisingly accumulated low-levels of sequence variations, despite their long evolutionary histories. Molecular evolutionary assessment of over 3500 nucleotide sequences from 85 toxin families spanning the breadth of the animal kingdom has unraveled a contrasting evolutionary strategy employed by ancient and evolutionarily young clades. We show that the venoms of ancient lineages remarkably evolve under the heavy constraints of negative selection, while toxin families in lineages that originated relatively recently rapidly diversify under the influence of positive selection. We propose that animal venoms mostly employ a ‘two-speed’ mode of evolution, where the major influence of diversifying selection accompanies the earlier stages of ecological specialization (e.g., diet and range expansion) in the evolutionary history of the species–the period of expansion, resulting in the rapid diversification of the venom arsenal, followed by longer periods of purifying selection that preserve the potent toxin pharmacopeia–the period of purification and fixation. However, species in the period of purification may re-enter the period of expansion upon experiencing a major shift in ecology or environment. Thus, we highlight for the first time the significant roles of purifying and episodic selections in shaping animal venoms. PMID:26492532

  5. Alleviating artifacts in 1H MRI thermometry by single scan spatiotemporal encoding.

    PubMed

    Schmidt, Rita; Frydman, Lucio

    2013-10-01

    Recent years have seen an increased interest in combining MRI thermometry with devices capable of destroying malignancies by heat ablation. Expected from the MR protocols are accurate and fast thermal characterizations, providing real time feedback on restricted tissue volumes and/or rapidly moving organs like liver. This article explores the potential advantages of relying on spatiotemporally encoded (SPEN) sequences for retrieving real-time thermometric images based on the water's proton resonance frequency (PRF) shifts. Hybrid spatiotemporal/k-space encoding single-scan MRI experiments were implemented on animal and human scanners, and their abilities to deliver single- and multi-slice real-time thermometric measurements based on PRF-derived phase maps in phantoms and in vivo, were compared against echo planar imaging (EPI) and gradient-echo counterparts. Under comparable acquisition conditions, SPEN exhibited advantages vis-à-vis EPI in terms of dealing with inhomogeneous magnetic field distortions, with shifts arising due to changes in the central frequency offsets, with PRF distributions, and for zooming into restricted fields-of-view without special pulse sequence provisions. This work confirms the ability of SPEN sequences, particularly when implemented under fully-refocused conditions, to exploit their built-in robustness to shift- and field-derived inhomogeneities for monitoring thermal changes in real-time under in vitro and in vivo conditions.

  6. Characterization of microbial compositions in a thermophilic chemostat of mixed culture fermentation.

    PubMed

    Zhang, Fang; Yang, Jing-Hua; Dai, Kun; Chen, Yun; Li, Qiu-Rong; Gao, Fa-Ming; Zeng, Raymond J

    2016-02-01

    The microbial community compositions of a chemostat enriched in a thermophilic (55 °C) mixed culture fermentation (MCF) for hydrogen production under different operational conditions were revealed in this work by integrating denaturing gradient gel electrophoresis (DGGE), Illumina Miseq high-throughput sequencing, and 16S rRNA clone library sequencing. The results showed that the community structure of the enriched cultures was relatively simple. Clones close to the genera of Thermoanaerobacter and/or Bacillus mainly dominated the bacteria. And homoacetogens and archaea were washed out and not detected even by Illumina Miseq high-throughput sequencing which supported the benefit for hydrogen production. On the other hand, the results revealed that the metabolic shift was clearly associated with the change of dominated bacterial groups. The effects of hydrogen partial pressure (PH2) and pH from 4.0 to 5.5 on the microbial compositions were not notable and Thermoanaerobacter was dominant, thus, the metabolites were also not changed. While Bacillus, Thermoanaerobacter and Propionispora hippei dominated the bacteria communities at neutral pH, or Bacillus and Thermoanaerobacter dominated at high influent glucose concentrations, consequently the main metabolites shifted to acetate, ethanol, propionate, or lactate. Thereby, the effect of microbial composition on the metabolite distribution and shift shall be considered when modeling thermophilic MCF in the future.

  7. The relationship between executive function and fine motor control in young and older adults.

    PubMed

    Corti, Emily J; Johnson, Andrew R; Riddle, Hayley; Gasson, Natalie; Kane, Robert; Loftus, Andrea M

    2017-01-01

    The present study examined the relationship between executive function (EF) and fine motor control in young and older healthy adults. Participants completed 3 measures of executive function; a spatial working memory (SWM) task, the Stockings of Cambridge task (planning), and the Intra-Dimensional Extra-Dimensional Set-Shift task (set-shifting). Fine motor control was assessed using 3 subtests of the Purdue Pegboard (unimanual, bimanual, sequencing). For the younger adults, there were no significant correlations between measures of EF and fine motor control. For the older adults, all EFs significantly correlated with all measures of fine motor control. Three separate regressions examined whether planning, SWM and set-shifting independently predicted unimanual, bimanual, and sequencing scores for the older adults. Planning was the primary predictor of performance on all three Purdue subtests. A multiple-groups mediation model examined whether planning predicted fine motor control scores independent of participants' age, suggesting that preservation of planning ability may support fine motor control in older adults. Planning remained a significant predictor of unimanual performance in the older age group, but not bimanual or sequencing performance. The findings are discussed in terms of compensation theory, whereby planning is a key compensatory resource for fine motor control in older adults. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Accounting for phase drifts in SSVEP-based BCIs by means of biphasic stimulation.

    PubMed

    Wu, Hung-Yi; Lee, Po-Lei; Chang, Hsiang-Chih; Hsieh, Jen-Chuen

    2011-05-01

    This study proposes a novel biphasic stimulation technique to solve the issue of phase drifts in steady-state visual evoked potential (SSVEPs) in phase-tagged systems. Phase calibration was embedded in stimulus sequences using a biphasic flicker, which is driven by a sequence with alternating reference and phase-shift states. Nine subjects were recruited to participate in off-line and online tests. Signals were bandpass filtered and segmented by trigger signals into reference and phase-shift epochs. Frequency components of SSVEP in the reference and phase-shift epochs were extracted using the Fourier method with a 50% overlapped sliding window. The real and imaginary parts of the SSVEP frequency components were organized into complex vectors in each epoch. Hotelling's t-square test was used to determine the significances of nonzero mean vectors. The rejection of noisy data segments and the validation of gaze detections were made based on p values. The phase difference between the valid mean vectors of reference and phase-shift epochs was used to identify user's gazed targets in this system. Data showed an average information transfer rate of 44.55 and 38.21 bits/min in off-line and online tests, respectively. © 2011 IEEE

  9. Comparison of qualitative and quantitative evaluation of diffusion-weighted MRI and chemical-shift imaging in the differentiation of benign and malignant vertebral body fractures.

    PubMed

    Geith, Tobias; Schmidt, Gerwin; Biffar, Andreas; Dietrich, Olaf; Dürr, Hans Roland; Reiser, Maximilian; Baur-Melnyk, Andrea

    2012-11-01

    The objective of our study was to compare the diagnostic value of qualitative diffusion-weighted imaging (DWI), quantitative DWI, and chemical-shift imaging in a single prospective cohort of patients with acute osteoporotic and malignant vertebral fractures. The study group was composed of patients with 26 osteoporotic vertebral fractures (18 women, eight men; mean age, 69 years; age range, 31 years 6 months to 86 years 2 months) and 20 malignant vertebral fractures (nine women, 11 men; mean age, 63.4 years; age range, 24 years 8 months to 86 years 4 months). T1-weighted, STIR, and T2-weighted sequences were acquired at 1.5 T. A DW reverse fast imaging with steady-state free precession (PSIF) sequence at different delta values was evaluated qualitatively. A DW echo-planar imaging (EPI) sequence and a DW single-shot turbo spin-echo (TSE) sequence at different b values were evaluated qualitatively and quantitatively using the apparent diffusion coefficient. Opposed-phase sequences were used to assess signal intensity qualitatively. The signal loss between in- and opposed-phase images was determined quantitatively. Two-tailed Fisher exact test, Mann-Whitney test, and receiver operating characteristic analysis were performed. Sensitivities, specificities, and accuracies were determined. Qualitative DW-PSIF imaging (delta = 3 ms) showed the best performance for distinguishing between benign and malignant fractures (sensitivity, 100%; specificity, 88.5%; accuracy, 93.5%). Qualitative DW-EPI (b = 50 s/mm(2) [p = 1.00]; b = 250 s/mm(2) [p = 0.50]) and DW single-shot TSE imaging (b = 100 s/mm(2) [p = 1.00]; b = 250 s/mm(2) [p = 0.18]; b = 400 s/mm(2) [p = 0.18]; b = 600 s/mm(2) [p = 0.39]) did not indicate significant differences between benign and malignant fractures. DW-EPI using a b value of 500 s/mm(2) (p = 0.01) indicated significant differences between benign and malignant vertebral fractures. Quantitative DW-EPI (p = 0.09) and qualitative opposed-phase imaging (p = 0.06) did not exhibit significant differences, quantitative DW single-shot TSE imaging (p = 0.002) and quantitative chemical-shift imaging (p = 0.01) showed significant differences between benign and malignant fractures. The DW-PSIF sequence (delta = 3 ms) had the highest accuracy in differentiating benign from malignant vertebral fractures. Quantitative chemical-shift imaging and quantitative DW single-shot TSE imaging had a lower accuracy than DW-PSIF imaging because of a large overlap. Qualitative assessment of opposed-phase, DW-EPI, and DW single-shot TSE sequences and quantitative assessment of the DW-EPI sequence were not suitable for distinguishing between benign and malignant vertebral fractures.

  10. 29 CFR 825.216 - Limitations on an employee's right to reinstatement.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... slated for lay-off when the employee's original position is not would not meet the requirements of an equivalent position. (2) If a shift has been eliminated, or overtime has been decreased, an employee would..., if a position on, for example, a night shift has been filled by another employee, the employee is...

  11. Lost in Time and Space: States of High Arousal Disrupt Implicit Acquisition of Spatial and Sequential Context Information

    PubMed Central

    Maran, Thomas; Sachse, Pierre; Martini, Markus; Weber, Barbara; Pinggera, Jakob; Zuggal, Stefan; Furtner, Marco

    2017-01-01

    Biased cognition during high arousal states is a relevant phenomenon in a variety of topics: from the development of post-traumatic stress disorders or stress-triggered addictive behaviors to forensic considerations regarding crimes of passion. Recent evidence indicates that arousal modulates the engagement of a hippocampus-based “cognitive” system in favor of a striatum-based “habit” system in learning and memory, promoting a switch from flexible, contextualized to more rigid, reflexive responses. Existing findings appear inconsistent, therefore it is unclear whether and which type of context processing is disrupted by enhanced arousal. In this behavioral study, we investigated such arousal-triggered cognitive-state shifts in human subjects. We validated an arousal induction procedure (three experimental conditions: violent scene, erotic scene, neutral control scene) using pupillometry (Preliminary Experiment, n = 13) and randomly administered this method to healthy young adults to examine whether high arousal states affect performance in two core domains of contextual processing, the acquisition of spatial (spatial discrimination paradigm; Experiment 1, n = 66) and sequence information (learned irrelevance paradigm; Experiment 2, n = 84). In both paradigms, spatial location and sequences were encoded incidentally and both displacements when retrieving spatial position as well as the predictability of the target by a cue in sequence learning changed stepwise. Results showed that both implicit spatial and sequence learning were disrupted during high arousal states, regardless of valence. Compared to the control group, participants in the arousal conditions showed impaired discrimination of spatial positions and abolished learning of associative sequences. Furthermore, Bayesian analyses revealed evidence against the null models. In line with recent models of stress effects on cognition, both experiments provide evidence for decreased engagement of flexible, cognitive systems supporting encoding of context information in active cognition during acute arousal, promoting reduced sensitivity for contextual details. We argue that arousal fosters cognitive adaptation towards less demanding, more present-oriented information processing, which prioritizes a current behavioral response set at the cost of contextual cues. This transient state of behavioral perseverance might reduce reliance on context information in unpredictable environments and thus represent an adaptive response in certain situations. PMID:29170634

  12. A study examining the impact of 12-hour shifts on critical care staff.

    PubMed

    Richardson, Annette; Turnock, Christopher; Harris, Liz; Finley, Alison; Carson, Sarah

    2007-11-01

    Twelve-hour shifts contribute to flexible patterns of work, but the effects on delivery of direct care and staff fatigue are important topics for deeper examination. To examine the impact and implications of 12-hour shifts on critical care staff. A staged dual approach using two focus groups (n = 16) and questionnaires (n = 147) with critical care staff from three critical care units. Positive effects were found with planning and prioritizing care, improved relationships with patients/relatives, good-quality time off work and ease of travelling to work. Less favourable effects were with caring for patients in isolation cubicles and the impact on staff motivation and tiredness. Acceptable patterns of work were suggested for 'numbers of consecutive shifts' and 'rest periods between shifts'. Most participants believed 12-hour shifts should continue. The challenge is to ensure existing systems and practices develop to improve on the less positive effects of working 12-hour shifts. This study provides nurse managers with important and relevant staff views on the impact of working 12-hour shifts. In particular to those working within a critical care environment and suggests the challenge is to ensure existing systems and practices develop to improve on the less encouraging effects of working 12-hour shifts. It adds an understanding of the senior nurse's view on the positive and negative effects of managing and organizing staff off duty to safely run a department with 12-hour shifts.

  13. Optimal Shift Duration and Sequence: Recommended Approach for Short-Term Emergency Response Activations for Public Health and Emergency Management

    PubMed Central

    Burgess, Paula A.

    2007-01-01

    Since September 11, 2001, and the consequent restructuring of the US preparedness and response activities, public health workers are increasingly called on to activate a temporary round-the-clock staffing schedule. These workers may have to make key decisions that could significantly impact the health and safety of the public. The unique physiological demands of rotational shift work and night shift work have the potential to negatively impact decisionmaking ability. A responsible, evidence-based approach to scheduling applies the principles of circadian physiology, as well as unique individual physiologies and preferences. Optimal scheduling would use a clockwise (morning-afternoon-night) rotational schedule: limiting night shifts to blocks of 3, limiting shift duration to 8 hours, and allowing 3 days of recuperation after night shifts. PMID:17413074

  14. A m-ary linear feedback shift register with binary logic

    NASA Technical Reports Server (NTRS)

    Perlman, M. (Inventor)

    1973-01-01

    A family of m-ary linear feedback shift registers with binary logic is disclosed. Each m-ary linear feedback shift register with binary logic generates a binary representation of a nonbinary recurring sequence, producible with a m-ary linear feedback shift register without binary logic in which m is greater than 2. The state table of a m-ary linear feedback shift register without binary logic, utilizing sum modulo m feedback, is first tubulated for a given initial state. The entries in the state table are coded in binary and the binary entries are used to set the initial states of the stages of a plurality of binary shift registers. A single feedback logic unit is employed which provides a separate feedback binary digit to each binary register as a function of the states of corresponding stages of the binary registers.

  15. A relative shift in cloacal location repositions external genitalia in amniote evolution.

    PubMed

    Tschopp, Patrick; Sherratt, Emma; Sanger, Thomas J; Groner, Anna C; Aspiras, Ariel C; Hu, Jimmy K; Pourquié, Olivier; Gros, Jérôme; Tabin, Clifford J

    2014-12-18

    The move of vertebrates to a terrestrial lifestyle required major adaptations in their locomotory apparatus and reproductive organs. While the fin-to-limb transition has received considerable attention, little is known about the developmental and evolutionary origins of external genitalia. Similarities in gene expression have been interpreted as a potential evolutionary link between the limb and genitals; however, no underlying developmental mechanism has been identified. We re-examined this question using micro-computed tomography, lineage tracing in three amniote clades, and RNA-sequencing-based transcriptional profiling. Here we show that the developmental origin of external genitalia has shifted through evolution, and in some taxa limbs and genitals share a common primordium. In squamates, the genitalia develop directly from the budding hindlimbs, or the remnants thereof, whereas in mice the genital tubercle originates from the ventral and tail bud mesenchyme. The recruitment of different cell populations for genital outgrowth follows a change in the relative position of the cloaca, the genitalia organizing centre. Ectopic grafting of the cloaca demonstrates the conserved ability of different mesenchymal cells to respond to these genitalia-inducing signals. Our results support a limb-like developmental origin of external genitalia as the ancestral condition. Moreover, they suggest that a change in the relative position of the cloacal signalling centre during evolution has led to an altered developmental route for external genitalia in mammals, while preserving parts of the ancestral limb molecular circuitry owing to a common evolutionary origin.

  16. Measurement of body joint angles for physical therapy based on mean shift tracking using two low cost Kinect images.

    PubMed

    Chen, Y C; Lee, H J; Lin, K H

    2015-08-01

    Range of motion (ROM) is commonly used to assess a patient's joint function in physical therapy. Because motion capture systems are generally very expensive, physical therapists mostly use simple rulers to measure patients' joint angles in clinical diagnosis, which will suffer from low accuracy, low reliability, and subjective. In this study we used color and depth image feature from two sets of low-cost Microsoft Kinect to reconstruct 3D joint positions, and then calculate moveable joint angles to assess the ROM. A Gaussian background model is first used to segment the human body from the depth images. The 3D coordinates of the joints are reconstructed from both color and depth images. To track the location of joints throughout the sequence more precisely, we adopt the mean shift algorithm to find out the center of voxels upon the joints. The two sets of Kinect are placed three meters away from each other and facing to the subject. The joint moveable angles and the motion data are calculated from the position of joints frame by frame. To verify the results of our system, we take the results from a motion capture system called VICON as golden standard. Our 150 test results showed that the deviation of joint moveable angles between those obtained by VICON and our system is about 4 to 8 degree in six different upper limb exercises, which are acceptable in clinical environment.

  17. Controlling and fine tuning the physical properties of two identical metal coordination sites in de novo designed three stranded coiled coil peptides.

    PubMed

    Iranzo, Olga; Chakraborty, Saumen; Hemmingsen, Lars; Pecoraro, Vincent L

    2011-01-19

    Herein we report how de novo designed peptides can be used to investigate whether the position of a metal site along a linear sequence that folds into a three-stranded α-helical coiled coil defines the physical properties of Cd(II) ions in either CdS(3) or CdS(3)O (O-being an exogenous water molecule) coordination environments. Peptides are presented that bind Cd(II) into two identical coordination sites that are located at different topological positions at the interior of these constructs. The peptide GRANDL16PenL19IL23PenL26I binds two Cd(II) as trigonal planar 3-coordinate CdS(3) structures whereas GRANDL12AL16CL26AL30C sequesters two Cd(II) as pseudotetrahedral 4-coordinate CdS(3)O structures. We demonstrate how for the first peptide, having a more rigid structure, the location of the identical binding sites along the linear sequence does not affect the physical properties of the two bound Cd(II). However, the sites are not completely independent as Cd(II) bound to one of the sites ((113)Cd NMR chemical shift of 681 ppm) is perturbed by the metalation state (apo or [Cd(pep)(Hpep)(2)](+) or [Cd(pep)(3)](-)) of the second center ((113)Cd NMR chemical shift of 686 ppm). GRANDL12AL16CL26AL30C shows a completely different behavior. The physical properties of the two bound Cd(II) ions indeed depend on the position of the metal center, having pK(a2) values for the equilibrium [Cd(pep)(Hpep)(2)](+) → [Cd(pep)(3)](-) + 2H(+) (corresponding to deprotonation and coordination of cysteine thiols) that range from 9.9 to 13.9. In addition, the L26AL30C site shows dynamic behavior, which is not observed for the L12AL16C site. These results indicate that for these systems one cannot simply assign a "4-coordinate structure" and assume certain physical properties for that site since important factors such as packing of the adjacent Leu, size of the intended cavity (endo vs exo) and location of the metal site play crucial roles in determining the final properties of the bound Cd(II).

  18. Characterization of CYCLOIDEA-like genes in Proteaceae, a basal eudicot family with multiple shifts in floral symmetry

    PubMed Central

    Citerne, Hélène L.; Reyes, Elisabeth; Le Guilloux, Martine; Delannoy, Etienne; Simonnet, Franck; Sauquet, Hervé; Weston, Peter H.; Nadot, Sophie; Damerval, Catherine

    2017-01-01

    Background and Aims The basal eudicot family Proteaceae (approx. 1700 species) shows considerable variation in floral symmetry but has received little attention in studies of evolutionary development at the genetic level. A framework for understanding the shifts in floral symmetry in Proteaceae is provided by reconstructing ancestral states on an upated phylogeny of the family, and homologues of CYCLOIDEA (CYC), a key gene for the control of floral symmetry in both monocots and eudicots, are characterized. Methods Perianth symmetry transitions were reconstructed on a new species-level tree using parsimony and maximum likelihood. CYC-like genes in 35 species (31 genera) of Proteaceae were sequenced and their phylogeny was reconstructed. Shifts in selection pressure following gene duplication were investigated using nested branch-site models of sequence evolution. Expression patterns of CYC homologues were characterized in three species of Grevillea with different types of floral symmetry. Key Results Zygomorphy has evolved 10–18 times independently in Proteaceae from actinomorphic ancestors, with at least four reversals to actinomorphy. A single duplication of CYC-like genes occurred prior to the diversification of Proteaceae, with putative loss or divergence of the ProtCYC1 paralogue in more than half of the species sampled. No shifts in selection pressure were detected in the branches subtending the two ProtCYC paralogues. However, the amino acid sequence preceding the TCP domain is strongly divergent in Grevillea ProtCYC1 compared with other species. ProtCYC genes were expressed in developing flowers of both actinomorphic and zygomorphic Grevillea species, with late asymmetric expression in the perianth of the latter. Conclusion Proteaceae is a remarkable family in terms of the number of transitions in floral symmetry. Furthermore, although CYC-like genes in Grevillea have unusual sequence characteristics, they display patterns of expression that make them good candidates for playing a role in the establishment of floral symmetry. PMID:28025288

  19. Gut microbiomes of wild great apes fluctuate seasonally in response to diet.

    PubMed

    Hicks, Allison L; Lee, Kerry Jo; Couto-Rodriguez, Mara; Patel, Juber; Sinha, Rohini; Guo, Cheng; Olson, Sarah H; Seimon, Anton; Seimon, Tracie A; Ondzie, Alain U; Karesh, William B; Reed, Patricia; Cameron, Kenneth N; Lipkin, W Ian; Williams, Brent L

    2018-05-03

    The microbiome is essential for extraction of energy and nutrition from plant-based diets and may have facilitated primate adaptation to new dietary niches in response to rapid environmental shifts. Here we use 16S rRNA sequencing to characterize the microbiota of wild western lowland gorillas and sympatric central chimpanzees and demonstrate compositional divergence between the microbiotas of gorillas, chimpanzees, Old World monkeys, and modern humans. We show that gorilla and chimpanzee microbiomes fluctuate with seasonal rainfall patterns and frugivory. Metagenomic sequencing of gorilla microbiomes demonstrates distinctions in functional metabolic pathways, archaea, and dietary plants among enterotypes, suggesting that dietary seasonality dictates shifts in the microbiome and its capacity for microbial plant fiber digestion versus growth on mucus glycans. These data indicate that great ape microbiomes are malleable in response to dietary shifts, suggesting a role for microbiome plasticity in driving dietary flexibility, which may provide fundamental insights into the mechanisms by which diet has driven the evolution of human gut microbiomes.

  20. Ontogenetic shifts of heart position in snakes.

    PubMed

    Lillywhite, Harvey B; Lillywhite, Steven M

    2017-08-01

    Heart position relative to total body length (TL) varies among snakes, with anterior hearts in arboreal species and more centrally located hearts in aquatic or ground-dwelling species. Anterior hearts decrease the cardiac work associated with cranial blood flow and minimize drops in cranial pressure and flow during head-up climbing. Here, we investigate whether heart position shifts intraspecifically during ontogenetic increases in TL. Insular Florida cottonmouth snakes, Agkistrodon conanti, are entirely ground-dwelling and have a mean heart position that is 33.32% TL from the head. In contrast, arboreal rat snakes, Pantherophis obsoleta, of similar lengths have a mean heart position that is 17.35% TL from the head. In both species, relative heart position shifts craniad during ontogeny, with negative slopes = -.035 and -.021% TL/cm TL in Agkistrodon and Pantherophis, respectively. Using a large morphometric data set available for Agkistrodon (N = 192 individuals, 23-140 cm TL), we demonstrate there is an anterior ontogenetic shift of the heart position within the trunk (= 4.56% trunk length from base of head to cloacal vent), independent of head and tail allometry which are both negative. However, in longer snakes > 100 cm, the heart position reverses and shifts caudally in longer Agkistrodon but continues toward the head in longer individuals of Pantherophis. Examination of data sets for two independent lineages of fully marine snakes (Acrochordus granulatus and Hydrophis platurus), which do not naturally experience postural gravity stress, demonstrate both ontogenetic patterns for heart position that are seen in the terrestrial snakes. The anterior migration of the heart is greater in the terrestrial species, even if TL is standardized to that of the longer P. obsoleta, and compensates for about 5 mmHg gravitational pressure head if they are fully upright. © 2017 Wiley Periodicals, Inc.

  1. Self-definition, defensive processing, and influence: the normative impact of majority and minority groups.

    PubMed

    Wood, W; Pool, G J; Leck, K; Purvis, D

    1996-12-01

    Past research has found that recipients agree with majority group positions and resist minority group positions on direct measures of influence. The authors suggest that these attitude shifts reflect normative pressures to align with valued majorities and to differentiate from derogated minorities. In support of this idea, participants who considered a majority group relevant to their own self-definitions (but not those who judged it irrelevant), on learning that the group held a counterattitudinal position, shifted their attitudes to agree with the source. In a second study, recipients who judged a minority group (negatively) self-relevant, on learning that the group held a similar attitude to their own, shifted their attitudes to diverge from the source. These shifts in attitudes were based on participants' interpretations of the attitude issues.

  2. Quantum memory receiver for superadditive communication using binary coherent states

    NASA Astrophysics Data System (ADS)

    Klimek, Aleksandra; Jachura, Michał; Wasilewski, Wojciech; Banaszek, Konrad

    2016-11-01

    We propose a simple architecture based on multimode quantum memories for collective readout of classical information keyed using a pair coherent states, exemplified by the well-known binary phase shift keying format. Such a configuration enables demonstration of the superadditivity effect in classical communication over quantum channels, where the transmission rate becomes enhanced through joint detection applied to multiple channel uses. The proposed scheme relies on the recently introduced idea to prepare Hadamard sequences of input symbols that are mapped by a linear optical transformation onto the pulse position modulation format [Guha, S. Phys. Rev. Lett. 2011, 106, 240502]. We analyze two versions of readout based on direct detection and an optional Dolinar receiver which implements the minimum-error measurement for individual detection of a binary coherent state alphabet.

  3. Quantum memory receiver for superadditive communication using binary coherent states.

    PubMed

    Klimek, Aleksandra; Jachura, Michał; Wasilewski, Wojciech; Banaszek, Konrad

    2016-11-12

    We propose a simple architecture based on multimode quantum memories for collective readout of classical information keyed using a pair coherent states, exemplified by the well-known binary phase shift keying format. Such a configuration enables demonstration of the superadditivity effect in classical communication over quantum channels, where the transmission rate becomes enhanced through joint detection applied to multiple channel uses. The proposed scheme relies on the recently introduced idea to prepare Hadamard sequences of input symbols that are mapped by a linear optical transformation onto the pulse position modulation format [Guha, S. Phys. Rev. Lett. 2011 , 106 , 240502]. We analyze two versions of readout based on direct detection and an optional Dolinar receiver which implements the minimum-error measurement for individual detection of a binary coherent state alphabet.

  4. The Time-Dependent Wavelet Spectrum of HH 1 and 2

    NASA Astrophysics Data System (ADS)

    Raga, A. C.; Reipurth, B.; Esquivel, A.; González-Gómez, D.; Riera, A.

    2018-04-01

    We have calculated the wavelet spectra of four epochs (spanning ≍20 yr) of Hα and [S II] HST images of HH 1 and 2. From these spectra we calculated the distribution functions of the (angular) radii of the emission structures. We found that the size distributions have maxima (corresponding to the characteristic sizes of the observed structures) with radii that are logarithmically spaced with factors of ≍2→3 between the successive peaks. The positions of these peaks generally showed small shifts towards larger sizes as a function of time. This result indicates that the structures of HH 1 and 2 have a general expansion (seen at all scales), and/or are the result of a sequence of merging events resulting in the formation of knots with larger characteristic sizes.

  5. The Development of Mental Models for Auditory Events: Relational Complexity and Discrimination of Pitch and Duration

    ERIC Educational Resources Information Center

    Stevens, Catherine; Gallagher, Melinda

    2004-01-01

    This experiment investigated relational complexity and relational shift in judgments of auditory patterns. Pitch and duration values were used to construct two-note perceptually similar sequences (unary relations) and four-note relationally similar sequences (binary relations). It was hypothesized that 5-, 8- and 11-year-old children would perform…

  6. [Influence of "prehistory" of sequential movements of the right and the left hand on reproduction: coding of positions, movements and sequence structure].

    PubMed

    Bobrova, E V; Liakhovetskiĭ, V A; Borshchevskaia, E R

    2011-01-01

    The dependence of errors during reproduction of a sequence of hand movements without visual feedback on the previous right- and left-hand performance ("prehistory") and on positions in space of sequence elements (random or ordered by the explicit rule) was analyzed. It was shown that the preceding information about the ordered positions of the sequence elements was used during right-hand movements, whereas left-hand movements were performed with involvement of the information about the random sequence. The data testify to a central mechanism of the analysis of spatial structure of sequence elements. This mechanism activates movement coding specific for the left hemisphere (vector coding) in case of an ordered sequence structure and positional coding specific for the right hemisphere in case of a random sequence structure.

  7. Comparative visual ecology of cephalopods from different habitats.

    PubMed

    Chung, Wen-Sung; Marshall, N Justin

    2016-09-14

    Previous investigations of vision and visual pigment evolution in aquatic predators have focused on fish and crustaceans, generally ignoring the cephalopods. Since the first cephalopod opsin was sequenced in late 1980s, we now have data on over 50 cephalopod opsins, prompting this functional and phylogenetic examination. Much of this data does not specifically examine the visual pigment spectral absorbance position (λmax) relative to environment or lifestyle, and cephalopod opsin functional adaptation and visual ecology remain largely unknown. Here we introduce a new protocol for photoreceptor microspectrophotometry (MSP) that overcomes the difficulty of bleaching the bistable visual pigment and that reveals eight coastal coleoid cephalopods to be monochromatic with λmax varying from 484 to 505 nm. A combination of current MSP results, the λmax values previously characterized using cephalopod retinal extracts (467-500 nm) and the corresponding opsin phylogenetic tree were used for systematic comparisons with an end goal of examining the adaptations of coleoid visual pigments to different light environments. Spectral tuning shifts are described in response to different modes of life and light conditions. A new spectral tuning model suggests that nine amino acid substitution sites may determine the direction and the magnitude of spectral shifts. © 2016 The Authors.

  8. Characterization of Ribosomal Frameshifting in Theiler's Murine Encephalomyelitis Virus.

    PubMed

    Finch, Leanne K; Ling, Roger; Napthine, Sawsan; Olspert, Allan; Michiels, Thomas; Lardinois, Cécile; Bell, Susanne; Loughran, Gary; Brierley, Ian; Firth, Andew E

    2015-08-01

    Theiler's murine encephalomyelitis virus (TMEV) is a member of the genus Cardiovirus in the Picornaviridae, a family of positive-sense single-stranded RNA viruses. Previously, we demonstrated that in the related cardiovirus, Encephalomyocarditis virus, a programmed-1 ribosomal frameshift (1 PRF) occurs at a conserved G_GUU_UUU sequence within the 2B-encoding region of the polyprotein open reading frame (ORF). Here we show that-1 PRF occurs at a similar site during translation of the TMEV genome. In addition, we demonstrate that a predicted 3= RNA stem-loop structure at a noncanonical spacing downstream of the shift site is required for efficient frameshifting in TMEV and that frameshifting also requires virus infection. Mutating the G_GUU_UUU shift site to inhibit frameshifting results in an attenuated virus with reduced growth kinetics and a small-plaque phenotype. Frameshifting in the virus context was found to be extremely efficient at 74 to 82%, which, to our knowledge, is the highest frameshifting efficiency recorded to date for any virus. We propose that highly efficient-1 PRF in TMEV provides a mechanism to escape the confines of equimolar expression normally inherent in the single-polyprotein expression strategy of picornaviruses.

  9. Base-Displaced Intercalated Conformation of the 2-Amino-3-methylimidazo[4,5-f]quinoline N2-dG DNA Adduct Positioned at the Nonreiterated G1 in the NarI Restriction Site

    PubMed Central

    2016-01-01

    The conformation of an N2-dG adduct arising from the heterocyclic amine 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), a potent food mutagen, was determined in 5′-d(C1T2C3X4G5C6G7C8C9A10T11C12)-3′:5′-d(G13A14T15G16G17C18G19C20C21G22A23G24)-3′; X = N2-dG-IQ, in which the modified nucleotide X4 corresponds to G1 in the 5′-d(G1G2CG3CC)-3′ NarI restriction endonuclease site. Circular dichroism (CD) revealed blue shifts relative to the unmodified duplex, consistent with adduct-induced twisting, and a hypochromic effect for the IQ absorbance in the near UV region. NMR revealed that the N2-dG-IQ adduct adopted a base-displaced intercalated conformation in which the modified guanine remained in the anti conformation about the glycosidic bond, the IQ moiety intercalated into the duplex, and the complementary base C21 was displaced into the major groove. The processing of the N2-dG-IQ lesion by hpol η is sequence-dependent; when placed at the reiterated G3 position, but not at the G1 position, this lesion exhibits a propensity for frameshift replication [Choi, J. Y., et al. (2006) J. Biol. Chem., 281, 25297–25306]. The structure of the N2-dG-IQ adduct at the nonreiterated G1 position was compared to that of the same adduct placed at the G3 position [Stavros, K. M., et al. (2014) Nucleic Acids Res., 42, 3450–3463]. CD indicted minimal spectral differences between the G1 vs G3N2-dG-IQ adducts. NMR indicated that the N2-dG-IQ adduct exhibited similar base-displaced intercalated conformations at both the G1 and G3 positions. This result differed as compared to the corresponding C8-dG-IQ adducts placed at the same positions. The C8-dG-IQ adduct adopted a minor groove conformation when placed at position G1 but a base-displaced intercalated conformation when placed at position G3 in the NarI sequence. The present studies suggest that differences in lesion bypass by hpol η may be mediated by differences in the 3′-flanking sequences, perhaps modulating the ability to accommodate transient strand slippage intermediates. PMID:26083477

  10. Event sequence detector

    NASA Technical Reports Server (NTRS)

    Hanna, M. F. (Inventor)

    1973-01-01

    An event sequence detector is described with input units, each associated with a row of bistable elements arranged in an array of rows and columns. The detector also includes a shift register which is responsive to clock pulses from any of the units to sequentially provide signals on its output lines each of which is connected to the bistable elements in a corresponding column. When the event-indicating signal is received by an input unit it provides a clock pulse to the shift register to provide the signal on one of its output lines. The input unit also enables all its bistable elements so that the particular element in the column supplied with the signal from the register is driven to an event-indicating state.

  11. Fossil mice and rats show isotopic evidence of niche partitioning and change in dental ecomorphology related to dietary shift in Late Miocene of Pakistan.

    PubMed

    Kimura, Yuri; Jacobs, Louis L; Cerling, Thure E; Uno, Kevin T; Ferguson, Kurt M; Flynn, Lawrence J; Patnaik, Rajeev

    2013-01-01

    Stable carbon isotope analysis in tooth enamel is a well-established approach to infer C3 and C4 dietary composition in fossil mammals. The bulk of past work has been conducted on large herbivorous mammals. One important finding is that their dietary habits of fossil large mammals track the late Miocene ecological shift from C3 forest and woodland to C4 savannah. However, few studies on carbon isotopes of fossil small mammals exist due to limitations imposed by the size of rodent teeth, and the isotopic ecological and dietary behaviors of small mammals to climate change remain unknown. Here we evaluate the impact of ecological change on small mammals by fine-scale comparisons of carbon isotope ratios (δ(13)C) with dental morphology of murine rodents, spanning 13.8 to ∼2.0 Ma, across the C3 to C4 vegetation shift in the Miocene Siwalik sequence of Pakistan. We applied in-situ laser ablation GC-IRMS to lower first molars and measured two grazing indices on upper first molars. Murine rodents yield a distinct, but related, record of past ecological conditions from large herbivorous mammals, reflecting available foods in their much smaller home ranges. In general, larger murine species show more positive δ(13)C values and have higher grazing indices than smaller species inhabiting the same area at any given age. Two clades of murine rodents experienced different rates of morphological change. In the faster-evolving clade, the timing and trend of morphological innovations are closely tied to consumption of C4 diet during the vegetation shift. This study provides quantitative evidence of linkages among diet, niche partitioning, and dental morphology at a more detailed level than previously possible.

  12. Fossil Mice and Rats Show Isotopic Evidence of Niche Partitioning and Change in Dental Ecomorphology Related to Dietary Shift in Late Miocene of Pakistan

    PubMed Central

    Kimura, Yuri; Jacobs, Louis L.; Cerling, Thure E.; Uno, Kevin T.; Ferguson, Kurt M.; Flynn, Lawrence J.; Patnaik, Rajeev

    2013-01-01

    Stable carbon isotope analysis in tooth enamel is a well-established approach to infer C3 and C4 dietary composition in fossil mammals. The bulk of past work has been conducted on large herbivorous mammals. One important finding is that their dietary habits of fossil large mammals track the late Miocene ecological shift from C3 forest and woodland to C4 savannah. However, few studies on carbon isotopes of fossil small mammals exist due to limitations imposed by the size of rodent teeth, and the isotopic ecological and dietary behaviors of small mammals to climate change remain unknown. Here we evaluate the impact of ecological change on small mammals by fine-scale comparisons of carbon isotope ratios (δ13C) with dental morphology of murine rodents, spanning 13.8 to ∼2.0 Ma, across the C3 to C4 vegetation shift in the Miocene Siwalik sequence of Pakistan. We applied in-situ laser ablation GC-IRMS to lower first molars and measured two grazing indices on upper first molars. Murine rodents yield a distinct, but related, record of past ecological conditions from large herbivorous mammals, reflecting available foods in their much smaller home ranges. In general, larger murine species show more positive δ13C values and have higher grazing indices than smaller species inhabiting the same area at any given age. Two clades of murine rodents experienced different rates of morphological change. In the faster-evolving clade, the timing and trend of morphological innovations are closely tied to consumption of C4 diet during the vegetation shift. This study provides quantitative evidence of linkages among diet, niche partitioning, and dental morphology at a more detailed level than previously possible. PMID:23936324

  13. Tonic ubiquitylation controls T-cell receptor:CD3 complex expression during T-cell development.

    PubMed

    Wang, Haopeng; Holst, Jeff; Woo, Seng-Ryong; Guy, Cliff; Bettini, Matt; Wang, Yao; Shafer, Aaron; Naramura, Mayumi; Mingueneau, Michaël; Dragone, Leonard L; Hayes, Sandra M; Malissen, Bernard; Band, Hamid; Vignali, Dario A A

    2010-04-07

    Expression of the T-cell receptor (TCR):CD3 complex is tightly regulated during T-cell development. The mechanism and physiological role of this regulation are unclear. Here, we show that the TCR:CD3 complex is constitutively ubiquitylated in immature double positive (DP) thymocytes, but not mature single positive (SP) thymocytes or splenic T cells. This steady state, tonic CD3 monoubiquitylation is mediated by the CD3varepsilon proline-rich sequence, Lck, c-Cbl, and SLAP, which collectively trigger the dynamin-dependent downmodulation, lysosomal sequestration and degradation of surface TCR:CD3 complexes. Blocking this tonic ubiquitylation by mutating all the lysines in the CD3 cytoplasmic tails significantly upregulates TCR levels on DP thymocytes. Mimicking monoubiquitylation by expression of a CD3zeta-monoubiquitin (monoUb) fusion molecule significantly reduces TCR levels on immature thymocytes. Moreover, modulating CD3 ubiquitylation alters immunological synapse (IS) formation and Erk phosphorylation, thereby shifting the signalling threshold for positive and negative selection, and regulatory T-cell development. Thus, tonic TCR:CD3 ubiquitylation results in precise regulation of TCR expression on immature T cells, which is required to maintain the fidelity of T-cell development.

  14. Tonic ubiquitylation controls T-cell receptor:CD3 complex expression during T-cell development

    PubMed Central

    Wang, Haopeng; Holst, Jeff; Woo, Seng-Ryong; Guy, Cliff; Bettini, Matt; Wang, Yao; Shafer, Aaron; Naramura, Mayumi; Mingueneau, Michaël; Dragone, Leonard L; Hayes, Sandra M; Malissen, Bernard; Band, Hamid; Vignali, Dario A A

    2010-01-01

    Expression of the T-cell receptor (TCR):CD3 complex is tightly regulated during T-cell development. The mechanism and physiological role of this regulation are unclear. Here, we show that the TCR:CD3 complex is constitutively ubiquitylated in immature double positive (DP) thymocytes, but not mature single positive (SP) thymocytes or splenic T cells. This steady state, tonic CD3 monoubiquitylation is mediated by the CD3ɛ proline-rich sequence, Lck, c-Cbl, and SLAP, which collectively trigger the dynamin-dependent downmodulation, lysosomal sequestration and degradation of surface TCR:CD3 complexes. Blocking this tonic ubiquitylation by mutating all the lysines in the CD3 cytoplasmic tails significantly upregulates TCR levels on DP thymocytes. Mimicking monoubiquitylation by expression of a CD3ζ-monoubiquitin (monoUb) fusion molecule significantly reduces TCR levels on immature thymocytes. Moreover, modulating CD3 ubiquitylation alters immunological synapse (IS) formation and Erk phosphorylation, thereby shifting the signalling threshold for positive and negative selection, and regulatory T-cell development. Thus, tonic TCR:CD3 ubiquitylation results in precise regulation of TCR expression on immature T cells, which is required to maintain the fidelity of T-cell development. PMID:20150895

  15. Evidence of positive selection associated with placental loss in tiger sharks.

    PubMed

    Swift, Dominic G; Dunning, Luke T; Igea, Javier; Brooks, Edward J; Jones, Catherine S; Noble, Leslie R; Ciezarek, Adam; Humble, Emily; Savolainen, Vincent

    2016-06-14

    All vertebrates initially feed their offspring using yolk reserves. In some live-bearing species these yolk reserves may be supplemented with extra nutrition via a placenta. Sharks belonging to the Carcharhinidae family are all live-bearing, and with the exception of the tiger shark (Galeocerdo cuvier), develop placental connections after exhausting yolk reserves. Phylogenetic relationships suggest the lack of placenta in tiger sharks is due to secondary loss. This represents a dramatic shift in reproductive strategy, and is likely to have left a molecular footprint of positive selection within the genome. We sequenced the transcriptome of the tiger shark and eight other live-bearing shark species. From this data we constructed a time-calibrated phylogenetic tree estimating the tiger shark lineage diverged from the placental carcharhinids approximately 94 million years ago. Along the tiger shark lineage, we identified five genes exhibiting a signature of positive selection. Four of these genes have functions likely associated with brain development (YWHAE and ARL6IP5) and sexual reproduction (VAMP4 and TCTEX1D2). Our results indicate the loss of placenta in tiger sharks may be associated with subsequent adaptive changes in brain development and sperm production.

  16. Investigation of proposed process sequence for the array automated assembly task, phases 1 and 2

    NASA Technical Reports Server (NTRS)

    Mardesich, N.; Garcia, A.; Eskenas, K.

    1980-01-01

    Progress was made on the process sequence for module fabrication. A shift from bonding with a conformal coating to laminating with ethylene vinyl acetate and a glass superstrate is recommended for further module fabrication. The processes that were retained for the selected process sequence, spin-on diffusion, print and fire aluminum p+ back, clean, print and fire silver front contact and apply tin pad to aluminum back, were evaluated for their cost contribution.

  17. Constant-time 2D and 3D through-bond correlation NMR spectroscopy of solids under 60 kHz MAS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Rongchun; Ramamoorthy, Ayyalusamy, E-mail: ramamoor@umich.edu

    2016-01-21

    Establishing connectivity and proximity of nuclei is an important step in elucidating the structure and dynamics of molecules in solids using magic angle spinning (MAS) NMR spectroscopy. Although recent studies have successfully demonstrated the feasibility of proton-detected multidimensional solid-state NMR experiments under ultrafast-MAS frequencies and obtaining high-resolution spectral lines of protons, assignment of proton resonances is a major challenge. In this study, we first re-visit and demonstrate the feasibility of 2D constant-time uniform-sign cross-peak correlation (CTUC-COSY) NMR experiment on rigid solids under ultrafast-MAS conditions, where the sensitivity of the experiment is enhanced by the reduced spin-spin relaxation rate and themore » use of low radio-frequency power for heteronuclear decoupling during the evolution intervals of the pulse sequence. In addition, we experimentally demonstrate the performance of a proton-detected pulse sequence to obtain a 3D {sup 1}H/{sup 13}C/{sup 1}H chemical shift correlation spectrum by incorporating an additional cross-polarization period in the CTUC-COSY pulse sequence to enable proton chemical shift evolution and proton detection in the incrementable t{sub 1} and t{sub 3} periods, respectively. In addition to through-space and through-bond {sup 13}C/{sup 1}H and {sup 13}C/{sup 13}C chemical shift correlations, the 3D {sup 1}H/{sup 13}C/{sup 1}H experiment also provides a COSY-type {sup 1}H/{sup 1}H chemical shift correlation spectrum, where only the chemical shifts of those protons, which are bonded to two neighboring carbons, are correlated. By extracting 2D F1/F3 slices ({sup 1}H/{sup 1}H chemical shift correlation spectrum) at different {sup 13}C chemical shift frequencies from the 3D {sup 1}H/{sup 13}C/{sup 1}H spectrum, resonances of proton atoms located close to a specific carbon atom can be identified. Overall, the through-bond and through-space homonuclear/heteronuclear proximities determined from the 3D {sup 1}H/{sup 13}C/{sup 1}H experiment would be useful to study the structure and dynamics of a variety of chemical and biological solids.« less

  18. Information Entropy of Influenza A Segment 7

    NASA Astrophysics Data System (ADS)

    Thompson, William A.; Fan, Shaohua; Weltman, Joel K.

    2008-12-01

    Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.

  19. A POSITIONAL DATA SYSTEM

    DOEpatents

    Forster, G.A.

    1963-09-24

    between master and slave synchros is described. A threephase a-c power source is connected to the stators of the synchros and an error detector is connected to the rotors of the synchros to measure the phasor difference therebetween. A phase shift network shifts the phase of one of the rotors 90 degrees and a demodulator responsive thereto causes the phasor difference signal of the rotors to shift phase 180 degrees whenever the 90 degree phase shifted signal goes negative. The phase shifted difference signal has a waveform which, with the addition of small values of resistance and capacitance, gives a substantially pure d-c output whose amplitude and polarity is proportional to the magnitude and direction of the difference in the angular positions of the synchro's rotors. (AEC)

  20. The complete mitochondrial genome of the tapeworm Cladotaenia vulturi (Cestoda: Paruterinidae): gene arrangement and phylogenetic relationships with other cestodes.

    PubMed

    Guo, Aijiang

    2016-08-31

    Tapeworms Cladotaenia spp. are among the most important wildlife pathogens in birds of prey. The genus Cladotaenia is placed in the family Paruterinidae based on morphological characteristics and hosts. However, limited molecular information is available for studying the phylogenetic position of this genus in relation to other cestodes. In this study, the complete mitochondrial (mt) genome of Cladotaenia vulturi was amplified using "Long-PCR" and then sequenced by primer walking. Sequence annotation and gene identification were performed by comparison with published flatworm mt genomes. The phylogenetic relationships of C. vulturi with other cestode species were established using the concatenated amino acid sequences of 12 protein-coding genes with Bayesian Inference and Maximum Likelihood methods. The complete mitochondrial genome of the Cladotaenia vulturi is 13,411 kb in size and contains 36 genes. The gene arrangement of C. vulturi is identical to those in Anoplocephala spp. (Anoplocephalidae), Hymenolepis spp. (Hymenolepididae) and Dipylidium caninum (Dipylidiidae), but different from that in taeniids owing to the order shift between the tRNA (L1) and tRNA (S2) genes. Phylogenetic analyses based on the amino acid sequences of the concatenated 12 protein-coding genes showed that the species in the Taeniidae form a group and C. vulturi is a sister taxon to the species of the family Taeniidae. To our knowledge, the present study provides the first molecular data to support the early proposal from morphological evidence that the Taeniidae is a sister group to the family Paruterinidae. This novel mt genome sequence will be useful for further investigations into the population genetics, phylogenetics and systematics of the family Paruterinidae and inferring phylogenetic relationships among several lineages within the order Cyclophyllidea.

  1. The evolutionary implications of knox-I gene duplications in conifers: correlated evidence from phylogeny, gene mapping, and analysis of functional divergence.

    PubMed

    Guillet-Claude, Carine; Isabel, Nathalie; Pelgas, Betty; Bousquet, Jean

    2004-12-01

    Class I knox genes code for transcription factors that play an essential role in plant growth and development as central regulators of meristem cell identity. Based on the analysis of new cDNA sequences from various tissues and genomic DNA sequences, we identified a highly diversified group of class I knox genes in conifers. Phylogenetic analyses of complete amino acid sequences from various seed plants indicated that all conifer sequences formed a monophyletic group. Within conifers, four subgroups here named genes KN1 to KN4 were well delineated, each regrouping pine and spruce sequences. KN4 was sister group to KN3, which was sister group to KN1 and KN2. Genetic mapping on the genomes of two divergent Picea species indicated that KN1 and KN2 are located close to each other on the same linkage group, whereas KN3 and KN4 mapped on different linkage groups, correlating the more ancient divergence of these two genes. The proportion of synonymous and nonsynonymous substitutions suggested intense purifying selection for the four genes. However, rates of substitution per year indicated an evolution in two steps: faster rates were noted after gene duplications, followed subsequently by lower rates. Positive directional selection was detected for most of the internal branches harboring an accelerated rate of evolution. In addition, many sites with highly significant amino acid rate shift were identified between these branches. However, the tightly linked KN1 and KN2 did not diverge as much from each other. The implications of the correlation between phylogenetic, structural, and functional information are discussed in relation to the diversification of the knox-I gene family in conifers.

  2. Molecular Inferences Suggest Multiple Host Shifts of Rabies Viruses from Bats to Mesocarnivores in Arizona during 2001–2009

    PubMed Central

    Kuzmin, Ivan V.; Shi, Mang; Orciari, Lillian A.; Yager, Pamela A.; Velasco-Villa, Andres; Kuzmina, Natalia A.; Streicker, Daniel G.; Bergman, David L.; Rupprecht, Charles E.

    2012-01-01

    In nature, rabies virus (RABV; genus Lyssavirus, family Rhabdoviridae) represents an assemblage of phylogenetic lineages, associated with specific mammalian host species. Although it is generally accepted that RABV evolved originally in bats and further shifted to carnivores, mechanisms of such host shifts are poorly understood, and examples are rarely present in surveillance data. Outbreaks in carnivores caused by a RABV variant, associated with big brown bats, occurred repeatedly during 2001–2009 in the Flagstaff area of Arizona. After each outbreak, extensive control campaigns were undertaken, with no reports of further rabies cases in carnivores for the next several years. However, questions remained whether all outbreaks were caused by a single introduction and further perpetuation of bat RABV in carnivore populations, or each outbreak was caused by an independent introduction of a bat virus. Another question of concern was related to adaptive changes in the RABV genome associated with host shifts. To address these questions, we sequenced and analyzed 66 complete and 20 nearly complete RABV genomes, including those from the Flagstaff area and other similar outbreaks in carnivores, caused by bat RABVs, and representatives of the major RABV lineages circulating in North America and worldwide. Phylogenetic analysis demonstrated that each Flagstaff outbreak was caused by an independent introduction of bat RABV into populations of carnivores. Positive selection analysis confirmed the absence of post-shift changes in RABV genes. In contrast, convergent evolution analysis demonstrated several amino acids in the N, P, G and L proteins, which might be significant for pre-adaptation of bat viruses to cause effective infection in carnivores. The substitution S/T242 in the viral glycoprotein is of particular merit, as a similar substitution was suggested for pathogenicity of Nishigahara RABV strain. Roles of the amino acid changes, detected in our study, require additional investigations, using reverse genetics and other approaches. PMID:22737076

  3. Gaze-based rehearsal in children under 7: a developmental investigation of eye movements during a serial spatial memory task.

    PubMed

    Morey, Candice C; Mareva, Silvana; Lelonkiewicz, Jaroslaw R; Chevalier, Nicolas

    2018-05-01

    The emergence of strategic verbal rehearsal at around 7 years of age is widely considered a major milestone in descriptions of the development of short-term memory across childhood. Likewise, rehearsal is believed by many to be a crucial factor in explaining why memory improves with age. This apparent qualitative shift in mnemonic processes has also been characterized as a shift from passive visual to more active verbal mnemonic strategy use, but no investigation of the development of overt spatial rehearsal has informed this explanation. We measured serial spatial order reconstruction in adults and groups of children 5-7 years old and 8-11 years old, while recording their eye movements. Children, particularly the youngest children, overtly fixated late-list spatial positions longer than adults, suggesting that younger children are less likely to engage in covert rehearsal during stimulus presentation than older children and adults. However, during retention the youngest children overtly fixated more of the to-be-remembered sequences than any other group, which is inconsistent with the idea that children do nothing to try to remember. Altogether, these data are inconsistent with the notion that children under 7 do not engage in any attempts to remember. They are most consistent with proposals that children's style of remembering shifts around age 7 from reactive cue-driven methods to proactive, covert methods, which may include cumulative rehearsal. © 2017 John Wiley & Sons Ltd.

  4. Shifts in microbial community composition following surface application of dredged river sediments.

    PubMed

    Baniulyte, Dovile; Favila, Emmanuel; Kelly, John J

    2009-01-01

    Sediment input to the Illinois River has drastically decreased river depth and reduced habitats for aquatic organisms. Dredging is being used to remove sediment from the Illinois River, and the dredged sediment is being applied to the surface of a brownfield site in Chicago with the goal of revegetating the site. In order to determine the effects of this drastic habitat change on sediment microbial communities, we examined sediment physical, chemical, and microbial characteristics at the time of sediment application to the soil surface as well as 1 and 2 years after application. Microbial community biomass was determined by measurement of lipid phosphate. Microbial community composition was assessed using phospholipid fatty acid (PLFA) analysis, terminal restriction fragment length polymorphism (T-RFLP) analysis of 16S rRNA genes, and clone library sequencing of 16S rRNA genes. Results indicated that the moisture content, organic carbon, and total nitrogen content of the sediment all decreased over time. Total microbial biomass did not change over the course of the study, but there were significant changes in the composition of the microbial communities. PLFA analysis revealed relative increases in fungi, actinomycetes, and Gram positive bacteria. T-RFLP analysis indicated a significant shift in bacterial community composition within 1 year of application, and clone library analysis revealed relative increases in Proteobacteria, Gemmatimonadetes, and Bacteriodetes and relative decreases in Acidobacteria, Spirochaetes, and Planctomycetes. These results provide insight into microbial community shifts following land application of dredged sediment.

  5. The crystal structure of the Sox4 HMG domain-DNA complex suggests a mechanism for positional interdependence in DNA recognition.

    PubMed

    Jauch, Ralf; Ng, Calista K L; Narasimhan, Kamesh; Kolatkar, Prasanna R

    2012-04-01

    It has recently been proposed that the sequence preferences of DNA-binding TFs (transcription factors) can be well described by models that include the positional interdependence of the nucleotides of the target sites. Such binding models allow for multiple motifs to be invoked, such as principal and secondary motifs differing at two or more nucleotide positions. However, the structural mechanisms underlying the accommodation of such variant motifs by TFs remain elusive. In the present study we examine the crystal structure of the HMG (high-mobility group) domain of Sox4 [Sry (sex-determining region on the Y chromosome)-related HMG box 4] bound to DNA. By comparing this structure with previously solved structures of Sox17 and Sox2, we observed subtle conformational differences at the DNA-binding interface. Furthermore, using quantitative electrophoretic mobility-shift assays we validated the positional interdependence of two nucleotides and the presence of a secondary Sox motif in the affinity landscape of Sox4. These results suggest that a concerted rearrangement of two interface amino acids enables Sox4 to accommodate primary and secondary motifs. The structural adaptations lead to altered dinucleotide preferences that mutually reinforce each other. These analyses underline the complexity of the DNA recognition by TFs and provide an experimental validation for the conceptual framework of positional interdependence and secondary binding motifs.

  6. Reproducibility of Centric Relation Techniques by means of Condyle Position Analysis

    PubMed Central

    Galeković, Nikolina Holen; Fugošić, Vesna; Braut, Vedrana

    2017-01-01

    Purpose The aim of this study was to determine the reproducibility of clinical centric relation (CR) registration techniques (bimanual manipulation, chin point guidance and Roth's method) by means of condyle position analysis. Material and methods Thirty two fully dentate asymptomatic subjects (16 female and 16 male) with normal occlusal relations (Angle class I) participated in the study (mean age, 22.6 ± 4.7 years). The mandibular position indicator (MPI) was used to analyze the three-dimensional (anteroposterior (ΔX), superoinferior (ΔZ), mediolateral (ΔY)) condylar shift generated by the difference between the centric relation position (CR) and the maximal intercuspation position (MI) observed in dental arches. Results The mean value and standard deviation of three-dimensional condylar shift of the tested clinical CR techniques was 0.19 ± 0.34 mm. Significant differences within the tested clinical CR registration techniques were found for anteroposterior condylar shift on the right side posterior (Δ Xrp; P ≤ 0.012); and superoinferior condylar shift on the left side inferior (Δ Zli; P ≤ 0.011), whereas between the tested CR registration techniques were found for anteroposterior shift on the right side posterior (ΔXrp, P ≤ 0.037) and superoinferior shift on the right side inferior (ΔZri, P ≤ 0.004), on the left side inferior (ΔZli, P ≤ 0.005) and on the left side superior (ΔZls, P ≤ 0.007). Conclusion Bimanual manipulation, chin point guidance and Roth's method are clinical CR registration techniques of equal accuracy and reproducibility in asymptomatic subjects with normal occlusal relationship. PMID:28740266

  7. Reproducibility of Centric Relation Techniques by means of Condyle Position Analysis.

    PubMed

    Galeković, Nikolina Holen; Fugošić, Vesna; Braut, Vedrana; Ćelić, Robert

    2017-03-01

    The aim of this study was to determine the reproducibility of clinical centric relation (CR) registration techniques (bimanual manipulation, chin point guidance and Roth's method) by means of condyle position analysis. Thirty two fully dentate asymptomatic subjects (16 female and 16 male) with normal occlusal relations (Angle class I) participated in the study (mean age, 22.6 ± 4.7 years). The mandibular position indicator (MPI) was used to analyze the three-dimensional (anteroposterior (ΔX), superoinferior (ΔZ), mediolateral (ΔY)) condylar shift generated by the difference between the centric relation position (CR) and the maximal intercuspation position (MI) observed in dental arches. The mean value and standard deviation of three-dimensional condylar shift of the tested clinical CR techniques was 0.19 ± 0.34 mm. Significant differences within the tested clinical CR registration techniques were found for anteroposterior condylar shift on the right side posterior (Δ Xrp; P ≤ 0.012); and superoinferior condylar shift on the left side inferior (Δ Zli; P ≤ 0.011), whereas between the tested CR registration techniques were found for anteroposterior shift on the right side posterior (ΔXrp, P ≤ 0.037) and superoinferior shift on the right side inferior (ΔZri, P ≤ 0.004), on the left side inferior (ΔZli, P ≤ 0.005) and on the left side superior (ΔZls, P ≤ 0.007). Bimanual manipulation, chin point guidance and Roth's method are clinical CR registration techniques of equal accuracy and reproducibility in asymptomatic subjects with normal occlusal relationship.

  8. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  9. Sequence-Based Identification of Aspergillus, Fusarium, and Mucorales in the Clinical Laboratory: Where Are We and Where Should We Go From Here?

    USDA-ARS?s Scientific Manuscript database

    Accurate identification of fungal species helps establish or exclude a fungal cause of disease. In the past, clinical microbiology labs were restricted to a limited array of phenotypic criteria for categorizing isolates to the species level. This scenario is shifting in favour of DNA sequence-base...

  10. Does a Sensory Processing Deficit Explain Counting Accuracy on Rapid Visual Sequencing Tasks in Adults with and without Dyslexia?

    ERIC Educational Resources Information Center

    Conlon, Elizabeth G.; Wright, Craig M.; Norris, Karla; Chekaluk, Eugene

    2011-01-01

    The experiments conducted aimed to investigate whether reduced accuracy when counting stimuli presented in rapid temporal sequence in adults with dyslexia could be explained by a sensory processing deficit, a general slowing in processing speed or difficulties shifting attention between stimuli. To achieve these aims, the influence of the…

  11. Accounting for rate-dependent category boundary shifts in speech perception.

    PubMed

    Bosker, Hans Rutger

    2017-01-01

    The perception of temporal contrasts in speech is known to be influenced by the speech rate in the surrounding context. This rate-dependent perception is suggested to involve general auditory processes because it is also elicited by nonspeech contexts, such as pure tone sequences. Two general auditory mechanisms have been proposed to underlie rate-dependent perception: durational contrast and neural entrainment. This study compares the predictions of these two accounts of rate-dependent speech perception by means of four experiments, in which participants heard tone sequences followed by Dutch target words ambiguous between /ɑs/ "ash" and /a:s/ "bait". Tone sequences varied in the duration of tones (short vs. long) and in the presentation rate of the tones (fast vs. slow). Results show that the duration of preceding tones did not influence target perception in any of the experiments, thus challenging durational contrast as explanatory mechanism behind rate-dependent perception. Instead, the presentation rate consistently elicited a category boundary shift, with faster presentation rates inducing more /a:s/ responses, but only if the tone sequence was isochronous. Therefore, this study proposes an alternative, neurobiologically plausible account of rate-dependent perception involving neural entrainment of endogenous oscillations to the rate of a rhythmic stimulus.

  12. Modulating Uranium Binding Affinity in Engineered Calmodulin EF-Hand Peptides: Effect of Phosphorylation

    PubMed Central

    Pardoux, Romain; Sauge-Merle, Sandrine; Lemaire, David; Delangle, Pascale; Guilloreau, Luc; Adriano, Jean-Marc; Berthomieu, Catherine

    2012-01-01

    To improve our understanding of uranium toxicity, the determinants of uranyl affinity in proteins must be better characterized. In this work, we analyzed the contribution of a phosphoryl group on uranium binding affinity in a protein binding site, using the site 1 EF-hand motif of calmodulin. The recombinant domain 1 of calmodulin from A. thaliana was engineered to impair metal binding at site 2 and was used as a structured template. Threonine at position 9 of the loop was phosphorylated in vitro, using the recombinant catalytic subunit of protein kinase CK2. Hence, the T9TKE12 sequence was substituted by the CK2 recognition sequence TAAE. A tyrosine was introduced at position 7, so that uranyl and calcium binding affinities could be determined by following tyrosine fluorescence. Phosphorylation was characterized by ESI-MS spectrometry, and the phosphorylated peptide was purified to homogeneity using ion-exchange chromatography. The binding constants for uranyl were determined by competition experiments with iminodiacetate. At pH 6, phosphorylation increased the affinity for uranyl by a factor of ∼5, from Kd = 25±6 nM to Kd = 5±1 nM. The phosphorylated peptide exhibited a much larger affinity at pH 7, with a dissociation constant in the subnanomolar range (Kd = 0.25±0.06 nM). FTIR analyses showed that the phosphothreonine side chain is partly protonated at pH 6, while it is fully deprotonated at pH 7. Moreover, formation of the uranyl-peptide complex at pH 7 resulted in significant frequency shifts of the νas(P-O) and νs(P-O) IR modes of phosphothreonine, supporting its direct interaction with uranyl. Accordingly, a bathochromic shift in νas(UO2)2+ vibration (from 923 cm−1 to 908 cm−1) was observed upon uranyl coordination to the phosphorylated peptide. Together, our data demonstrate that the phosphoryl group plays a determining role in uranyl binding affinity to proteins at physiological pH. PMID:22870263

  13. Structure of the red fluorescent protein from a lancelet (Branchiostoma lanceolatum): a novel GYG chromophore covalently bound to a nearby tyrosine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pletnev, Vladimir Z., E-mail: vzpletnev@gmail.com; Pletneva, Nadya V.; Lukyanov, Konstantin A.

    The crystal structure of the novel red emitting fluorescent protein from lancelet Branchiostoma lanceolatum (Chordata) revealed an unusual five residues cyclic unit comprising Gly58-Tyr59-Gly60 chromophore, the following Phe61 and Tyr62 covalently bound to chromophore Tyr59. A key property of proteins of the green fluorescent protein (GFP) family is their ability to form a chromophore group by post-translational modifications of internal amino acids, e.g. Ser65-Tyr66-Gly67 in GFP from the jellyfish Aequorea victoria (Cnidaria). Numerous structural studies have demonstrated that the green GFP-like chromophore represents the ‘core’ structure, which can be extended in red-shifted proteins owing to modifications of the protein backbonemore » at the first chromophore-forming position. Here, the three-dimensional structures of green laGFP (λ{sub ex}/λ{sub em} = 502/511 nm) and red laRFP (λ{sub ex}/λ{sub em} ≃ 521/592 nm), which are fluorescent proteins (FPs) from the lancelet Branchiostoma lanceolatum (Chordata), were determined together with the structure of a red variant laRFP-ΔS83 (deletion of Ser83) with improved folding. Lancelet FPs are evolutionarily distant and share only ∼20% sequence identity with cnidarian FPs, which have been extensively characterized and widely used as genetically encoded probes. The structure of red-emitting laRFP revealed three exceptional features that have not been observed in wild-type fluorescent proteins from Cnidaria reported to date: (i) an unusual chromophore-forming sequence Gly58-Tyr59-Gly60, (ii) the presence of Gln211 at the position of the conserved catalytic Glu (Glu222 in Aequorea GFP), which proved to be crucial for chromophore formation, and (iii) the absence of modifications typical of known red chromophores and the presence of an extremely unusual covalent bond between the Tyr59 C{sup β} atom and the hydroxyl of the proximal Tyr62. The impact of this covalent bond on the red emission and the large Stokes shift (∼70 nm) of laRFP was verified by extensive structure-based site-directed mutagenesis.« less

  14. Region-based multifocus image fusion for the precise acquisition of Pap smear images.

    PubMed

    Tello-Mijares, Santiago; Bescós, Jesús

    2018-05-01

    A multifocus image fusion method to obtain a single focused image from a sequence of microscopic high-magnification Papanicolau source (Pap smear) images is presented. These images, captured each in a different position of the microscope lens, frequently show partially focused cells or parts of cells, which makes them unpractical for the direct application of image analysis techniques. The proposed method obtains a focused image with a high preservation of original pixels information while achieving a negligible visibility of the fusion artifacts. The method starts by identifying the best-focused image of the sequence; then, it performs a mean-shift segmentation over this image; the focus level of the segmented regions is evaluated in all the images of the sequence, and best-focused regions are merged in a single combined image; finally, this image is processed with an adaptive artifact removal process. The combination of a region-oriented approach, instead of block-based approaches, and a minimum modification of the value of focused pixels in the original images achieve a highly contrasted image with no visible artifacts, which makes this method especially convenient for the medical imaging domain. The proposed method is compared with several state-of-the-art alternatives over a representative dataset. The experimental results show that our proposal obtains the best and more stable quality indicators. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).

  15. Folding and conformational consequences of glycine to alanine replacements at different positions in a collagen model peptide.

    PubMed

    Bhate, Manjiri; Wang, Xin; Baum, Jean; Brodsky, Barbara

    2002-05-21

    The collagen model peptide T1-892 includes a C-terminal nucleation domain, (Gly-Pro-Hyp)(4), and an N-terminal (Gly-X-Y)(6) sequence taken from type I collagen. In osteogenesis imperfecta (OI) and other collagen diseases, single base mutations often convert one Gly to a larger residue, and T1-892 homologues modeling such mutations were synthesized with Gly to Ala substitutions in either the (Gly-Pro-Hyp)(4) domain, Gly25Ala, or the (Gly-X-Y)(6) domain, Gly10Ala. CD and NMR studies show the Gly10Ala peptide forms a normal triple-helix at the C-terminal end and propagates from the C- to the N-terminus until the Gly --> Ala substitution is encountered. At this point, triple-helix folding is terminated and cannot be reinitiated, leaving a nonhelical N-terminus. A decreased thermal stability is observed as a result of the shorter length of the triple-helix. In contrast, introduction of the Gly to Ala replacement at position 25, in the nucleation domain, shifts the monomer/trimer equilibrium toward the monomer form. The increased monomer and lower trimer populations are reflected in the dramatic decrease in triple-helix content and stability. Unlike the Ala replacement at position 10, the Ala substitution in the (Gly-Pro-Hyp)(4) region can still be incorporated into a triple-helix, but at a greatly decreased rate of folding, since the original efficient nucleation site is no longer operative. The specific consequences of Gly to Ala replacements in two distinctive sequences in this triple-helical peptide may help clarify the variability in OI clinical severity resulting from mutations at different sites along type I collagen chains.

  16. Long sequence correlation coprocessor

    NASA Astrophysics Data System (ADS)

    Gage, Douglas W.

    1994-09-01

    A long sequence correlation coprocessor (LSCC) accelerates the bitwise correlation of arbitrarily long digital sequences by calculating in parallel the correlation score for 16, for example, adjacent bit alignments between two binary sequences. The LSCC integrated circuit is incorporated into a computer system with memory storage buffers and a separate general purpose computer processor which serves as its controller. Each of the LSCC's set of sequential counters simultaneously tallies a separate correlation coefficient. During each LSCC clock cycle, computer enable logic associated with each counter compares one bit of a first sequence with one bit of a second sequence to increment the counter if the bits are the same. A shift register assures that the same bit of the first sequence is simultaneously compared to different bits of the second sequence to simultaneously calculate the correlation coefficient by the different counters to represent different alignments of the two sequences.

  17. An NMR-Based Structural Rationale for Contrasting Stoichiometry and Ligand Binding Site(s) in Fatty Acid-binding Proteins†

    PubMed Central

    He, Yan; Estephan, Rima; Yang, Xiaomin; Vela, Adriana; Wang, Hsin; Bernard, Cédric; Stark, Ruth E.

    2011-01-01

    Liver fatty acid-binding protein (LFABP) is a 14-kDa cytosolic polypeptide, differing from other family members in number of ligand binding sites, diversity of bound ligands, and transfer of fatty acid(s) to membranes primarily via aqueous diffusion rather than direct collisional interactions. Distinct two-dimensional 1H-15N NMR signals indicative of slowly exchanging LFABP assemblies formed during stepwise ligand titration were exploited, without solving the protein-ligand complex structures, to yield the stoichiometries for the bound ligands, their locations within the protein binding cavity, the sequence of ligand occupation, and the corresponding protein structural accommodations. Chemical shifts were monitored for wild-type LFABP and a R122L/S124A mutant in which electrostatic interactions viewed as essential to fatty acid binding were removed. For wild-type LFABP the results compared favorably with previous tertiary structures of oleate-bound wild-type LFABP in crystals and in solution: there are two oleates, one U-shaped ligand that positions the long hydrophobic chain deep within the cavity and another extended structure with the hydrophobic chain facing the cavity and the carboxylate group lying close to the protein surface. The NMR titration validated a prior hypothesis that the first oleate to enter the cavity occupies the internal protein site. In contrast, 1H/15N chemical shift changes supported only one liganded oleate for R122L/S124A LFABP, at an intermediate location within the protein cavity. A rationale based on protein sequence and electrostatics was developed to explain the stoichiometry and binding site trends for LFABPs and to put these findings into context within the larger protein family. PMID:21226535

  18. Investigation of mixed ionospheric and fround scatter using high spectral content pulse sequences for SuperDARN radars

    NASA Astrophysics Data System (ADS)

    Spaleta, J.; Bristow, W. A.

    2013-12-01

    SuperDARN radars estimate plasma drift velocities from the Doppler shift observed on signals scattered from field-aligned density irregularities. These field-aligned density irregularities are embedded in the ionospheric plasma, and move at the same velocity as background plasma. As a result, the electromagnetic signals scattered from these irregularities are Doppler shifted. The SuperDARN radars routinely observe ionospheric scatter Doppler velocities ranging from zero to thousands of meters per second. The radars determine the Doppler shift of the ionospheric scatter by linear fitting the phase of an auto correlation function derived from the radar pulse sequence. The phase fitting technique employed assumes a single dominant velocity is present in the signal. In addition, the SuperDARN radars can also observe signals scattered from the ground. Once refracted by the ionospheric plasma and bent earthward, the radar pulses eventually reach the ground where they scatter, sending signal back to the radar. This ground-scatter signal is characterized as having a low Doppler shift and low spectral width. The SuperDARN radars are able to use these signal characteristics to discriminate the ground scatter signal from the ionospheric scatter, when regions of ground scatter are isolated from ionospheric scatter returns. The phase fitting assumption of a single dominate target can easily be violated at ranges where ground and ionospheric scatter mix together. Due to the wide elevation angle extent of the SuperDARN radar design, ground and ionospheric scatter from different propagation paths can mix together in the return signal. When this happens, the fitting algorithm attempts to fit to the dominant signal, and if ground scatter dominates, information about the ionospheric scatter at that range can be unresolved. One way to address the mix scatter situation is to use a high spectral content pulse sequence together with a spectral estimation technique. The high spectral content pulse sequence consists of twice as many pulses and five times as many distinct lags over which to calculate the auto correlation function. This additional spectral information makes it possible to use spectral estimator techniques, that are robust against aperiodic time series data, to calculate the existence of multiple scatter modes in the signal. A comparison of the operation of the traditional SuperDARN pulse sequence and high spectral content pulse sequence will be presented for both synthetic examples and real SuperDARN radar mixed scatter situation.

  19. Unexpected series of regular frequency spacing of δ Scuti stars in the non-asymptotic regime - I. The methodology

    DOE PAGES

    Paparo, M.; Benko, J. M.; Hareter, M.; ...

    2016-05-11

    In this study, a sequence search method was developed to search the regular frequency spacing in δ Scuti stars through visual inspection and an algorithmic search. We searched for sequences of quasi-equally spaced frequencies, containing at least four members per sequence, in 90 δ Scuti stars observed by CoRoT. We found an unexpectedly large number of independent series of regular frequency spacing in 77 δ Scuti stars (from one to eight sequences) in the non-asymptotic regime. We introduce the sequence search method presenting the sequences and echelle diagram of CoRoT 102675756 and the structure of the algorithmic search. Four sequencesmore » (echelle ridges) were found in the 5–21 d –1 region where the pairs of the sequences are shifted (between 0.5 and 0.59 d –1) by twice the value of the estimated rotational splitting frequency (0.269 d –1). The general conclusions for the whole sample are also presented in this paper. The statistics of the spacings derived by the sequence search method, by FT (Fourier transform of the frequencies), and the statistics of the shifts are also compared. In many stars more than one almost equally valid spacing appeared. The model frequencies of FG Vir and their rotationally split components were used to formulate the possible explanation that one spacing is the large separation while the other is the sum of the large separation and the rotational frequency. In CoRoT 102675756, the two spacings (2.249 and 1.977 d –1) are in better agreement with the sum of a possible 1.710 d –1 large separation and two or one times, respectively, the value of the rotational frequency.« less

  20. Unexpected series of regular frequency spacing of δ Scuti stars in the non-asymptotic regime - I. The methodology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paparo, M.; Benko, J. M.; Hareter, M.

    In this study, a sequence search method was developed to search the regular frequency spacing in δ Scuti stars through visual inspection and an algorithmic search. We searched for sequences of quasi-equally spaced frequencies, containing at least four members per sequence, in 90 δ Scuti stars observed by CoRoT. We found an unexpectedly large number of independent series of regular frequency spacing in 77 δ Scuti stars (from one to eight sequences) in the non-asymptotic regime. We introduce the sequence search method presenting the sequences and echelle diagram of CoRoT 102675756 and the structure of the algorithmic search. Four sequencesmore » (echelle ridges) were found in the 5–21 d –1 region where the pairs of the sequences are shifted (between 0.5 and 0.59 d –1) by twice the value of the estimated rotational splitting frequency (0.269 d –1). The general conclusions for the whole sample are also presented in this paper. The statistics of the spacings derived by the sequence search method, by FT (Fourier transform of the frequencies), and the statistics of the shifts are also compared. In many stars more than one almost equally valid spacing appeared. The model frequencies of FG Vir and their rotationally split components were used to formulate the possible explanation that one spacing is the large separation while the other is the sum of the large separation and the rotational frequency. In CoRoT 102675756, the two spacings (2.249 and 1.977 d –1) are in better agreement with the sum of a possible 1.710 d –1 large separation and two or one times, respectively, the value of the rotational frequency.« less

  1. Complete (1)H resonance assignment of beta-maltose from (1)H-(1)H DQ-SQ CRAMPS and (1)H (DQ-DUMBO)-(13)C SQ refocused INEPT 2D solid-state NMR spectra and first principles GIPAW calculations.

    PubMed

    Webber, Amy L; Elena, Bénédicte; Griffin, John M; Yates, Jonathan R; Pham, Tran N; Mauri, Francesco; Pickard, Chris J; Gil, Ana M; Stein, Robin; Lesage, Anne; Emsley, Lyndon; Brown, Steven P

    2010-07-14

    A disaccharide is a challenging case for high-resolution (1)H solid-state NMR because of the 24 distinct protons (14 aliphatic and 10 OH) having (1)H chemical shifts that all fall within a narrow range of approximately 3 to 7 ppm. High-resolution (1)H (500 MHz) double-quantum (DQ) combined rotation and multiple pulse sequence (CRAMPS) solid-state NMR spectra of beta-maltose monohydrate are presented. (1)H-(1)H DQ-SQ CRAMPS spectra are presented together with (1)H (DQ)-(13)C correlation spectra obtained with a new pulse sequence that correlates a high-resolution (1)H DQ dimension with a (13)C single quantum (SQ) dimension using the refocused INEPT pulse-sequence element to transfer magnetization via one-bond (13)C-(1)H J couplings. Compared to the observation of only a single broad peak in a (1)H DQ spectrum recorded at 30 kHz magic-angle spinning (MAS), the use of DUMBO (1)H homonuclear decoupling in the (1)H DQ CRAMPS experiment allows the resolution of distinct DQ correlation peaks which, in combination with first-principles chemical shift calculations based on the GIPAW (Gauge Including Projector Augmented Waves) plane-wave pseudopotential approach, enables the assignment of the (1)H resonances to the 24 distinct protons. We believe this to be the first experimental solid-state NMR determination of the hydroxyl OH (1)H chemical shifts for a simple sugar. Variable-temperature (1)H-(1)H DQ CRAMPS spectra reveal small increases in the (1)H chemical shifts of the OH resonances upon decreasing the temperature from 348 K to 248 K.

  2. Search and Discovery Strategies for Biotechnology: the Paradigm Shift

    PubMed Central

    Bull, Alan T.; Ward, Alan C.; Goodfellow, Michael

    2000-01-01

    Profound changes are occurring in the strategies that biotechnology-based industries are deploying in the search for exploitable biology and to discover new products and develop new or improved processes. The advances that have been made in the past decade in areas such as combinatorial chemistry, combinatorial biosynthesis, metabolic pathway engineering, gene shuffling, and directed evolution of proteins have caused some companies to consider withdrawing from natural product screening. In this review we examine the paradigm shift from traditional biology to bioinformatics that is revolutionizing exploitable biology. We conclude that the reinvigorated means of detecting novel organisms, novel chemical structures, and novel biocatalytic activities will ensure that natural products will continue to be a primary resource for biotechnology. The paradigm shift has been driven by a convergence of complementary technologies, exemplified by DNA sequencing and amplification, genome sequencing and annotation, proteome analysis, and phenotypic inventorying, resulting in the establishment of huge databases that can be mined in order to generate useful knowledge such as the identity and characterization of organisms and the identity of biotechnology targets. Concurrently there have been major advances in understanding the extent of microbial diversity, how uncultured organisms might be grown, and how expression of the metabolic potential of microorganisms can be maximized. The integration of information from complementary databases presents a significant challenge. Such integration should facilitate answers to complex questions involving sequence, biochemical, physiological, taxonomic, and ecological information of the sort posed in exploitable biology. The paradigm shift which we discuss is not absolute in the sense that it will replace established microbiology; rather, it reinforces our view that innovative microbiology is essential for releasing the potential of microbial diversity for biotechnology penetration throughout industry. Various of these issues are considered with reference to deep-sea microbiology and biotechnology. PMID:10974127

  3. Molecular implementation of molecular shift register memories

    NASA Technical Reports Server (NTRS)

    Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

    1991-01-01

    An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

  4. Modulation of cyclobutane thymine photodimer formation in T11-tracts in rotationally phased nucleosome core particles and DNA minicircles.

    PubMed

    Wang, Kesai; Taylor, John-Stephen A

    2017-07-07

    Cyclobutane pyrimidine dimers (CPDs) are DNA photoproducts linked to skin cancer, whose mutagenicity depends in part on their frequency of formation and deamination. Nucleosomes modulate CPD formation, favoring outside facing sites and disfavoring inward facing sites. A similar pattern of CPD formation in protein-free DNA loops suggests that DNA bending causes the modulation in nucleosomes. To systematically study the cause and effect of nucleosome structure on CPD formation and deamination, we have developed a circular permutation synthesis strategy for positioning a target sequence at different superhelix locations (SHLs) across a nucleosome in which the DNA has been rotationally phased with respect to the histone octamer by TG motifs. We have used this system to show that the nucleosome dramatically modulates CPD formation in a T11-tract that covers one full turn of the nucleosome helix at seven different SHLs, and that the position of maximum CPD formation at all locations is shifted to the 5΄-side of that found in mixed-sequence nucleosomes. We also show that an 80-mer minicircle DNA using the same TG-motifs faithfully reproduces the CPD pattern in the nucleosome, indicating that it is a good model for protein-free rotationally phased bent DNA of the same curvature as in a nucleosome, and that bending is modulating CPD formation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Characterization of the complete mitochondrial genome of the cloacal tapeworm Cloacotaenia megalops (Cestoda: Hymenolepididae).

    PubMed

    Guo, Aijiang

    2016-09-05

    The cloacal tapeworm Cloacotaenia megalops (Hymenolepididae) is one of the most common cestode parasites of domestic and wild ducks worldwide. However, limited information is available regarding its epidemiology, biology, genetics and systematics. This study provides characterisation of the complete mitochondrial (mt) genome of C. megalops. The complete mt genome of C. megalops was obtained by long PCR, sequenced and annotated. The length of the entire mt genome of C. megalops is 13,887 bp; it contains 12 protein-coding, 2 ribosomal RNA and 22 transfer RNA genes, but lacks an atp8 gene. The mt gene arrangement of C. megalops is identical to that observed in Anoplocephala magna and A. perfoliata (Anoplocephalidae), Dipylidium caninum (Dipylidiidae) and Hymenolepis diminuta (Hymenolepididae), but differs from that reported in taeniids owing to the position shift between the tRNA (L1) and tRNA (S2) genes. The phylogenetic position of C. megalops was inferred using Maximum likelihood and Bayesian inference methods based on the concatenated amino acid data for 12 protein-coding genes. Phylogenetic trees showed that C. megalops is sister to Anoplocephala spp. (Anoplocephalidae) + Pseudanoplocephala crawfordi + Hymenolepis spp. (Hymenolepididae) indicating that the family Hymenolepididae is paraphyletic. The complete mt genome of C. megalops is sequenced. Phylogenetic analyses provided an insight into the phylogenetic relationships among the families Anoplocephalidae, Hymenolepididae, Dipylidiidae and Taeniidae. This novel genomic information also provides the opportunity to develop useful genetic markers for studying the molecular epidemiology, biology, genetics and systematics of C. megalops.

  6. Extending positive CLASS results across multiple instructors and multiple classes of Modeling Instruction

    NASA Astrophysics Data System (ADS)

    Brewe, Eric; Traxler, Adrienne; de la Garza, Jorge; Kramer, Laird H.

    2013-12-01

    We report on a multiyear study of student attitudes measured with the Colorado Learning Attitudes about Science Survey in calculus-based introductory physics taught with the Modeling Instruction curriculum. We find that five of six instructors and eight of nine sections using Modeling Instruction showed significantly improved attitudes from pre- to postcourse. Cohen’s d effect sizes range from 0.08 to 0.95 for individual instructors. The average effect was d=0.45, with a 95% confidence interval of (0.26-0.64). These results build on previously published results showing positive shifts in attitudes from Modeling Instruction classes. We interpret these data in light of other published positive attitudinal shifts and explore mechanistic explanations for similarities and differences with other published positive shifts.

  7. SU-F-J-125: Effects of Couch Position Variability On Dosimetric Accuracy with An MRI-Guided Co-60 Radiation Therapy Machine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chow, P; Thomas, D; Agazaryan, N

    2016-06-15

    Purpose: Magnetic resonance imaging (MRI) guidance in radiation therapy brings real-time imaging and adaptive planning into the treatment vault where it can account for interfraction and intrafraction movement of soft tissue. The only commercially-available MRI-guided radiation therapy device is a three-head 60Co and MRI system with an integrated treatment planning system (TPS). An up to 20% attenuation of the beam by the couch is well modeled in the TPS. However, variations in the patient’s day-to-day position introduce discrepancies in the actual couch position relative its location as modeled in the treatment plan. For this reason, our institution avoids plans withmore » beams that pass through or near the couch edges. This study looks at plans without restriction on beam angles and investigates the effects of couch shift by simulating shifts of the couch relative to the patient, in order to determine whether couch edge avoidance restrictions can be lifted. Methods: A total of 27 plans from 23 patients were investigated. Couch shifts of 1 and 2 cm were introduced in combinations of lateral and vertical direction to simulate variations in patient positioning on the couch giving 16 shifted plans per reference plan. The shift values of 1 and 2 cm were based on shifts recorded in 320 treatment fractions. Results: Measured couch attenuation versus TPS modeled agreed within 2.1%. Planning Target Volume (PTV) D95 changed less than 1% for 1 and 2 cm couch shifts in only the x-direction and less than 3% for all directions. Conclusion: The dosimetry of all plans with shifts up to ±2 cm was within reasonable clinical tolerances. Robustness of a plan to couch shifts can be tested in the TPS. Inclusion of beams traversing the couch edges should be considered if an improvement in plan quality or delivery time can be achieved.« less

  8. A combined mechanistic and computational study of the gold(I)-catalyzed formation of substituted indenes.

    PubMed

    Nun, Pierrick; Gaillard, Sylvain; Poater, Albert; Cavallo, Luigi; Nolan, Steven P

    2011-01-07

    Substituted indenes can be prepared after a sequence [1,3] O-acyl shift-hydroarylation-[1,3] O-acyl shift. Each step is catalyzed by a cationic NHC-Gold(I) species generated in situ after reaction between [(IPr)AuOH] and HBF(4)·OEt(2). This interesting silver-free way is fully supported by a computational study justifying the formation of each intermediate.

  9. Climate change and land use drivers of fecal bacteria in tropical Hawaiian rivers

    Treesearch

    Ayron M. Strauch; Richard A. Mackenzie; Gregory L. Bruland; Ralph Tingley; Christian P. Giardina

    2014-01-01

    Potential shifts in rainfall driven by climate change are anticipated to affect watershed processes (e.g., soil moisture, runoff, stream flow), yet few model systems exist in the tropics to test hypotheses about how these processes may respond to these shifts. We used a sequence of nine watersheds on Hawaii Island spanning 3000 mm (7500–4500 mm) of mean annual rainfall...

  10. Characterization of the juvenile green turtle (Chelonia mydas) microbiome throughout an ontogenetic shift from pelagic to neritic habitats

    USGS Publications Warehouse

    Price, James T.; Paladino, Frank V.; Lamont, Margaret M.; Witherington, Blair E.; Bates, Scott T.; Soule, Tanya

    2017-01-01

    The gut microbiome of herbivorous animals consists of organisms that efficiently digest the structural carbohydrates of ingested plant material. Green turtles (Chelonia mydas) provide an interesting model of change in these microbial communities because they undergo a pronounced shift from a surface-pelagic distribution and omnivorous diet to a neritic distribution and herbivorous diet. As an alternative to direct sampling of the gut, we investigated the cloacal microbiomes of juvenile green turtles before and after recruitment to neritic waters to observe any changes in their microbial community structure. Cloacal swabs were taken from individual turtles for analysis of the 16S rRNA gene sequences using Illumina sequencing. One fecal sample was also obtained, allowing for a preliminary comparison with the bacterial community of the cloaca. We found significant variation in the juvenile green turtle bacterial communities between pelagic and neritic habitats, suggesting that environmental and dietary factors support different bacterial communities in green turtles from these habitats. This is the first study to characterize the cloacal microbiome of green turtles in the context of their ontogenetic shifts, which could provide valuable insight into the origins of their gut bacteria and how the microbial community supports their shift to herbivory.

  11. Accurate evaluation of fast threshold voltage shift for SiC MOS devices under various gate bias stress conditions

    NASA Astrophysics Data System (ADS)

    Sometani, Mitsuru; Okamoto, Mitsuo; Hatakeyama, Tetsuo; Iwahashi, Yohei; Hayashi, Mariko; Okamoto, Dai; Yano, Hiroshi; Harada, Shinsuke; Yonezawa, Yoshiyuki; Okumura, Hajime

    2018-04-01

    We investigated methods of measuring the threshold voltage (V th) shift of 4H-silicon carbide (SiC) metal–oxide–semiconductor field-effect transistors (MOSFETs) under positive DC, negative DC, and AC gate bias stresses. A fast measurement method for V th shift under both positive and negative DC stresses revealed the existence of an extremely large V th shift in the short-stress-time region. We then examined the effect of fast V th shifts on drain current (I d) changes within a pulse under AC operation. The fast V th shifts were suppressed by nitridation. However, the I d change within one pulse occurred even in commercially available SiC MOSFETs. The correlation between I d changes within one pulse and V th shifts measured by a conventional method is weak. Thus, a fast and in situ measurement method is indispensable for the accurate evaluation of I d changes under AC operation.

  12. Shift work at a modern offshore drilling rig.

    PubMed

    Rodrigues, V F; Fischer, F M; Brito, M J

    2001-12-01

    The oil and gas exploration and production offshore units are classified as hazardous installations. Work in these facilities is complex, confined and associated with a wide range of risks. The continuous operation is secured by various shift work patterns. The objective of this study was to evaluate how offshore drilling workers perceived shift work at high seas and its impacts on their life and working conditions. The main features of the studied offshore shift work schedules are: long time on board (14 to 28 days), extended shifts (12 hours or more per day), slow rotation (7 to 14 days in the same shift), long sequence of days on the night shift (7 to 14 days in a row) and the extra-long extended journey (18 hours) on shift change and landing days. Interviews revealed a wide range of stressors caused by the offshore shift work, as well as difficulties to conciliate work with family life. It was observed that changes of the family model, leading to role conflicts and social isolation, work in a hazardous environment, perceiving poor sleep when working at night shifts and the imbalance between the expected and actual rewards are the major stressors for the offshore drilling workers.

  13. Eyewitness identification in simultaneous and sequential lineups: an investigation of position effects using receiver operating characteristics.

    PubMed

    Meisters, Julia; Diedenhofen, Birk; Musch, Jochen

    2018-04-20

    For decades, sequential lineups have been considered superior to simultaneous lineups in the context of eyewitness identification. However, most of the research leading to this conclusion was based on the analysis of diagnosticity ratios that do not control for the respondent's response criterion. Recent research based on the analysis of ROC curves has found either equal discriminability for sequential and simultaneous lineups, or higher discriminability for simultaneous lineups. Some evidence for potential position effects and for criterion shifts in sequential lineups has also been reported. Using ROC curve analysis, we investigated the effects of the suspect's position on discriminability and response criteria in both simultaneous and sequential lineups. We found that sequential lineups suffered from an unwanted position effect. Respondents employed a strict criterion for the earliest lineup positions, and shifted to a more liberal criterion for later positions. No position effects and no criterion shifts were observed in simultaneous lineups. This result suggests that sequential lineups are not superior to simultaneous lineups, and may give rise to unwanted position effects that have to be considered when conducting police lineups.

  14. Relational interaction in occupational therapy: Conversation analysis of positive feedback.

    PubMed

    Weiste, Elina

    2018-01-01

    The therapeutic relationship is an important factor for good therapy outcomes. The primary mediator of a beneficial therapy relationship is clinician-client interaction. However, few studies identify the observable interactional attributes of good quality relational interactions, e.g. offering the client positive feedback. The present paper aims to expand current understanding of relational interaction by analyzing the real-time interactional practices therapists use for offering positive feedback, an important value in occupational therapy. The analysis is based on the conversation analysis of 15 video-recorded occupational therapy encounters in psychiatric outpatient clinics. Two types of positive feedback were identified. In aligning feedback, therapists encouraged and complimented clients' positive perspectives on their own achievements in adopting certain behaviour, encouraging and supporting their progress. In redirecting feedback, therapists shifted the perspective from clients' negative experiences to their positive experiences. This shift was interactionally successful if they laid the foundation for the shift in perspective and attuned their expressions to the clients' emotional states. Occupational therapists routinely provide their clients with positive feedback. Awareness of the interactional attributes related to positive feedback is critically important for successful relational interaction.

  15. Adaptive multiphoton endomicroscopy through a dynamically deformed multicore optical fiber using proximal detection.

    PubMed

    Warren, Sean C; Kim, Youngchan; Stone, James M; Mitchell, Claire; Knight, Jonathan C; Neil, Mark A A; Paterson, Carl; French, Paul M W; Dunsby, Chris

    2016-09-19

    This paper demonstrates multiphoton excited fluorescence imaging through a polarisation maintaining multicore fiber (PM-MCF) while the fiber is dynamically deformed using all-proximal detection. Single-shot proximal measurement of the relative optical path lengths of all the cores of the PM-MCF in double pass is achieved using a Mach-Zehnder interferometer read out by a scientific CMOS camera operating at 416 Hz. A non-linear least squares fitting procedure is then employed to determine the deformation-induced lateral shift of the excitation spot at the distal tip of the PM-MCF. An experimental validation of this approach is presented that compares the proximally measured deformation-induced lateral shift in focal spot position to an independent distally measured ground truth. The proximal measurement of deformation-induced shift in focal spot position is applied to correct for deformation-induced shifts in focal spot position during raster-scanning multiphoton excited fluorescence imaging.

  16. Myosin phosphatase Fine-tunes Zebrafish Motoneuron Position during Axonogenesis

    PubMed Central

    Granato, Michael

    2016-01-01

    During embryogenesis the spinal cord shifts position along the anterior-posterior axis relative to adjacent tissues. How motor neurons whose cell bodies are located in the spinal cord while their axons reside in adjacent tissues compensate for such tissue shift is not well understood. Using live cell imaging in zebrafish, we show that as motor axons exit from the spinal cord and extend through extracellular matrix produced by adjacent notochord cells, these cells shift several cell diameters caudally. Despite this pronounced shift, individual motoneuron cell bodies stay aligned with their extending axons. We find that this alignment requires myosin phosphatase activity within motoneurons, and that mutations in the myosin phosphatase subunit mypt1 increase myosin phosphorylation causing a displacement between motoneuron cell bodies and their axons. Thus, we demonstrate that spinal motoneurons fine-tune their position during axonogenesis and we identify the myosin II regulatory network as a key regulator. PMID:27855159

  17. Visual attention shifting in autism spectrum disorders.

    PubMed

    Richard, Annette E; Lajiness-O'Neill, Renee

    2015-01-01

    Abnormal visual attention has been frequently observed in autism spectrum disorders (ASD). Abnormal shifting of visual attention is related to abnormal development of social cognition and has been identified as a key neuropsychological finding in ASD. Better characterizing attention shifting in ASD and its relationship with social functioning may help to identify new targets for intervention and improving social communication in these disorders. Thus, the current study investigated deficits in attention shifting in ASD as well as relationships between attention shifting and social communication in ASD and neurotypicals (NT). To investigate deficits in visual attention shifting in ASD, 20 ASD and 20 age- and gender-matched NT completed visual search (VS) and Navon tasks with attention-shifting demands as well as a set-shifting task. VS was a feature search task with targets defined in one of two dimensions; Navon required identification of a target letter presented at the global or local level. Psychomotor and processing speed were entered as covariates. Relationships between visual attention shifting, set shifting, and social functioning were also examined. ASD and NT showed comparable costs of shifting attention. However, psychomotor and processing speed were slower in ASD than in NT, and psychomotor and processing speed were positively correlated with attention-shifting costs on Navon and VS, respectively, for both groups. Attention shifting on VS and Navon were correlated among NT, while attention shifting on Navon was correlated with set shifting among ASD. Attention-shifting costs on Navon were positively correlated with restricted and repetitive behaviors among ASD. Relationships between attention shifting and psychomotor and processing speed, as well as relationships between measures of different aspects of visual attention shifting, suggest inefficient top-down influences over preattentive visual processing in ASD. Inefficient attention shifting may be related to restricted and repetitive behaviors in these disorders.

  18. Earth field NMR with chemical shift spectral resolution: theory and proof of concept.

    PubMed

    Katz, Itai; Shtirberg, Lazar; Shakour, Gubrail; Blank, Aharon

    2012-06-01

    A new method for obtaining an NMR signal in the Earth's magnetic field (EF) is presented. The method makes use of a simple pulse sequence with only DC fields which is much less demanding than previous approaches in terms of the pulses' rise and fall times. Furthermore, it offers the possibility of obtaining NMR data with enough spectral resolution to allow retrieving high resolution molecular chemical shift (CS) information - a capability that was not considered possible in EF NMR until now. Details of the pulse sequence, the experimental system, and our specially tailored EF NMR probe are provided. The experimental results demonstrate the capability to differentiate between three types of samples made of common fluorine compounds, based on their CS data. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Comparison of eight and 12 hour shifts: impacts on health, wellbeing, and alertness during the shift.

    PubMed

    Tucker, P; Barton, J; Folkard, S

    1996-11-01

    The generally agreed view is that there is no ideal shift system, and that most systems will have both advantages and disadvantages. As such, attention has been placed on trying to identify good and bad features of shift systems, with a view to minimising the possible ill health as a consequence of shiftwork. The present study focuses on the duration of the shift and looks at the implications for individual health, wellbeing, and alertness during the shift of extending the shift from the traditional eight hours to 12. Two groups of chemical workers, one working 12 hour shifts and the other working eight hour shifts, took part. All completed a modified version of the standard shiftwork index (SSI), a set of self reported questionnaires related to health and wellbeing. The two groups did not differ on most outcome measures, although the differences that did exist suggested advantages for the 12 hour shift workers over the eight hour shift workers; with the notable exception of rated alertness at certain times of day. The results are explained in terms of the design of the 12 hour shift system and the specific sequencing of shifts that seem to minimise the potential for the build up of fatigue. Although the current data moderately favour 12 hour shifts, a cautionary note is sounded with regard to the implications of the alertness ratings for performance and safety.

  20. Problem of intraoperative anatomical shift in image-guided surgery

    NASA Astrophysics Data System (ADS)

    Nauta, Haring J.; Bonnen, J. G.

    1998-06-01

    Experience with image guided, frameless stereotactic neurosurgery shows that intraoperative brain position shifts can be large enough to be problematic, and can occur in different directions at different directions at different stages of an operation. An understanding of the behavior of shifts will allow the surgeon to make the most appropriate use of the image guidance by first minimizing the shift itself, and then anticipating and compensating for any influence the remaining shift will have on the accuracy of the guidance. Three types of shift are described. Type I shift is a local outward bulging that occurs after the skull and dura are opened but before a mass lesion is resected. Type II shift is a local collapse of the brain tissue into the space previously occupied by the tumor. Type III shift is related to loss of cerebrospinal fluid or brain dehydration and is a generalized, more symmetric loss of brain volume. Strategies to minimize these types of shift include appropriate use of medical measures to reduce brain swelling early in the procedure without producing so much brain dehydration that Type II shift is accentuated later in the procedure. Other strategies include mechanical stabilization of brain position with retractors. Anticipating shift, the neurosurgeon should use the guidance as far as possible to map key boundaries early in the procedure before shift becomes more pronounced. Ultimately, however, the correction for the problem of intraoperative brain shift will require the ability to update the imaging data during the surgery.

  1. Static roll-tilt over 5 minutes locally distorts the internal estimate of direction of gravity.

    PubMed

    Tarnutzer, A A; Bockisch, C J; Straumann, D; Marti, S; Bertolini, G

    2014-12-01

    The subjective visual vertical (SVV) indicates perceived direction of gravity. Even in healthy human subjects, roll angle-dependent misestimations, roll overcompensation (A-effect, head-roll > 60° and <135°) and undercompensation (E-effect, head-roll < 60°), occur. Previously, we demonstrated that, after prolonged roll-tilt, SVV estimates when upright are biased toward the preceding roll position, which indicates that perceived vertical (PV) is shifted by the prior tilt (Tarnutzer AA, Bertolini G, Bockisch CJ, Straumann D, Marti S. PLoS One 8: e78079, 2013). Hypothetically, PV in any roll position could be biased toward the previous roll position. We asked whether such a "global" bias occurs or whether the bias is "local". The SVV of healthy human subjects (N = 9) was measured in nine roll positions (-120° to +120°, steps = 30°) after 5 min of roll-tilt in one of two adaptation positions (±90°) and compared with control trials without adaptation. After adapting, adjustments were shifted significantly (P < 0.05) toward the previous adaptation position for nearby roll-tilted positions (±30°, ±60°) and upright only. We computationally simulated errors based on the sum of a monotonically increasing function (producing roll undercompensation) and a mixture of Gaussian functions (representing roll overcompensation centered around PV). In combination, the pattern of A- and E-effects could be generated. By shifting the function representing local overcompensation toward the adaptation position, the experimental postadaptation data could be fitted successfully. We conclude that prolonged roll-tilt locally distorts PV rather than globally shifting it. Short-term adaptation of roll overcompensation may explain these shifts and could reflect the brain's strategy to optimize SVV estimates around recent roll positions. Thus postural stability can be improved by visually-mediated compensatory responses at any sustained body-roll orientation. Copyright © 2014 the American Physiological Society.

  2. Did a brief nap break have positive benefits on information processing among nurses working on the first 8-h night shift?

    PubMed

    Chang, Yu-San; Wu, Yu-Hsuan; Lu, Mei Rou; Hsu, Chung-Yao; Liu, Ching-Kuan; Hsu, Chin

    2015-05-01

    Shift workers frequently experience acute sleep deprivation on first night shift. This study compared the efficacy of 30-min nap (between 2 and 3 a.m.) on the visual attention ability of the nurses working at first 8-h night shift at the time of maximum fatigue (between 3 and 4 a.m.). In addition, we measured cognitive function (between 9 and 10 a.m.) in nurses working on daytime shift, which we defined as baseline wakefulness. The results showed that working on the night shift groups was associated with sleep loss, leading to a decrease in visual attention performance compared to the daytime shift group. There was no statistically significant difference in the visual attention performance between those taking and not taking a nap during the night shift, however the effect size was medium in the information process. It was still needed increase sample size to draw the conclusion regarding a 30-min nap break have positive benefits on perceptual speed during the first night shift. Copyright © 2014 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  3. Stacking sequence determines Raman intensities of observed interlayer shear modes in 2D layered materials – A general bond polarizability model

    PubMed Central

    Luo, Xin; Lu, Xin; Cong, Chunxiao; Yu, Ting; Xiong, Qihua; Ying Quek, Su

    2015-01-01

    2D layered materials have recently attracted tremendous interest due to their fascinating properties and potential applications. The interlayer interactions are much weaker than the intralayer bonds, allowing the as-synthesized materials to exhibit different stacking sequences, leading to different physical properties. Here, we show that regardless of the space group of the 2D materials, the Raman frequencies of the interlayer shear modes observed under the typical configuration blue shift for AB stacked materials, and red shift for ABC stacked materials, as the number of layers increases. Our predictions are made using an intuitive bond polarizability model which shows that stacking sequence plays a key role in determining which interlayer shear modes lead to the largest change in polarizability (Raman intensity); the modes with the largest Raman intensity determining the frequency trends. We present direct evidence for these conclusions by studying the Raman modes in few layer graphene, MoS2, MoSe2, WSe2 and Bi2Se3, using both first principles calculations and Raman spectroscopy. This study sheds light on the influence of stacking sequence on the Raman intensities of intrinsic interlayer modes in 2D layered materials in general, and leads to a practical way of identifying the stacking sequence in these materials. PMID:26469313

  4. Stacking sequence determines Raman intensities of observed interlayer shear modes in 2D layered materials--A general bond polarizability model.

    PubMed

    Luo, Xin; Lu, Xin; Cong, Chunxiao; Yu, Ting; Xiong, Qihua; Quek, Su Ying

    2015-10-15

    2D layered materials have recently attracted tremendous interest due to their fascinating properties and potential applications. The interlayer interactions are much weaker than the intralayer bonds, allowing the as-synthesized materials to exhibit different stacking sequences, leading to different physical properties. Here, we show that regardless of the space group of the 2D materials, the Raman frequencies of the interlayer shear modes observed under the typical z(xx)z configuration blue shift for AB stacked materials, and red shift for ABC stacked materials, as the number of layers increases. Our predictions are made using an intuitive bond polarizability model which shows that stacking sequence plays a key role in determining which interlayer shear modes lead to the largest change in polarizability (Raman intensity); the modes with the largest Raman intensity determining the frequency trends. We present direct evidence for these conclusions by studying the Raman modes in few layer graphene, MoS2, MoSe2, WSe2 and Bi2Se3, using both first principles calculations and Raman spectroscopy. This study sheds light on the influence of stacking sequence on the Raman intensities of intrinsic interlayer modes in 2D layered materials in general, and leads to a practical way of identifying the stacking sequence in these materials.

  5. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    PubMed Central

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  6. Investigation of an anomalous hump phenomenon in via-type amorphous In-Ga-Zn-O thin-film transistors under positive bias temperature stress

    NASA Astrophysics Data System (ADS)

    Yang, Jianwen; Liao, Po-Yung; Chang, Ting-Chang; Chen, Bo-Wei; Huang, Hui-Chun; Su, Wan-Ching; Chiang, Hsiao-Cheng; Zhang, Qun

    2017-04-01

    Amorphous InGaZnO thin film transistors (a-IGZO TFTs) with an etching-stop layer (ESL) exhibit an anomalous negative shift of threshold voltage (Vth) under positive bias temperature stress. TFTs with wider and shorter channels show a clear hump phenomenon, resulting from the existence of both main channels and parasitic channels. The electrons trapped in the gate insulator are responsible for the positive shift in the main channel characteristics. The electrons trapped near the IGZO edges and the holes injected into the ESL layer above InGaZnO (IGZO) jointly determine the shift of the parasitic TFT performance.

  7. WebLogo: A Sequence Logo Generator

    PubMed Central

    Crooks, Gavin E.; Hon, Gary; Chandonia, John-Marc; Brenner, Steven E.

    2004-01-01

    WebLogo generates sequence logos, graphical representations of the patterns within a multiple sequence alignment. Sequence logos provide a richer and more precise description of sequence similarity than consensus sequences and can rapidly reveal significant features of the alignment otherwise difficult to perceive. Each logo consists of stacks of letters, one stack for each position in the sequence. The overall height of each stack indicates the sequence conservation at that position (measured in bits), whereas the height of symbols within the stack reflects the relative frequency of the corresponding amino or nucleic acid at that position. WebLogo has been enhanced recently with additional features and options, to provide a convenient and highly configurable sequence logo generator. A command line interface and the complete, open WebLogo source code are available for local installation and customization. PMID:15173120

  8. Way out of Africa: Early Pleistocene paleoenvironments inhabited by Homo erectus in Sangiran, Java.

    PubMed

    Bettis, E Arthur; Milius, Adrianne K; Carpenter, Scott J; Larick, Roy; Zaim, Yahdi; Rizal, Yan; Ciochon, Russell L; Tassier-Surine, Stephanie A; Murray, Daniel; Suminto; Bronto, Sutinko

    2009-01-01

    A sequence of paleosols in the Solo Basin, Central Java, Indonesia, documents the local and regional environments present when Homo erectus spread through Southeast Asia during the early Pleistocene. The earliest human immigrants encountered a low-relief lake-margin landscape dominated by moist grasslands with open woodlands in the driest landscape positions. By 1.5 Ma, large streams filled the lake and the landscape became more riverine in nature, with riparian forests, savanna, and open woodland. Paleosol morphology and carbon isotope values of soil organic matter and pedogenic carbonates indicate a long-term shift toward regional drying or increased duration of the annual dry season through the early Pleistocene. This suggests that an annual dry season associated with monsoon conditions was an important aspect of the paleoclimate in which early humans spread from Africa to Southeast Asia.

  9. The role of temporal context in norm-based encoding of faces.

    PubMed

    Van Rensbergen, Bram; Op de Beeck, Hans P

    2014-02-01

    Research shows that the human brain encodes faces in terms of how they relate to a prototypical face, a phenomenon referred to as norm-based encoding. The goal of this study was to examine the effect of short-term exposure on the development of the norm, independently of global, long-term exposure. We achieved this by varying the sequence of presentation of the stimuli while keeping global exposure constant. We found that a systematic manipulation of the average face in a set of 10 preceding trials can shift this norm toward that average. However, there was no effect of order or recency among these trials; thus, there was no evidence that the last faces mattered more than the first. This suggests that the position of the face norm is modified by information that is integrated across multiple recent faces.

  10. Performance Evaluation of High Speed Multicarrier System for Optical Wireless Communication

    NASA Astrophysics Data System (ADS)

    Mathur, Harshita; Deepa, T.; Bartalwar, Sophiya

    2018-04-01

    Optical wireless communication (OWC) in the infrared and visible range is quite impressive solution, especially where radio communication face challenges. Visible light communication (VLC) uses visible light over a range of 400 and 800 THz and is a subdivision of OWC technologies. With an increasing demand for use of wireless communications, wireless access via Wi-Fi is facing many challenges especially in terms of capacity, availability, security and efficiency. VLC uses intensity modulation and direct detection (IM/DD) techniques and hence they require the signals to certainly be real valued positive sequences. These constraints pose limitation on digital modulation techniques. These limitations result in spectrum-efficiency or power-efficiency losses. In this paper, we investigate an amplitude shift keying (ASK) based orthogonal frequency division multiplexing (OFDM) signal transmission scheme using LabVIEW for VLC technology.

  11. Absorption spectrum of a two-level system subjected to a periodic pulse sequence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fotso, H. F.; Dobrovitski, V. V.

    We investigate how the quantum control of a two-level system (TLS) coupled to photons can modify and tune the TLS’s photon absorption spectrum. Tuning and controlling the emission and the absorption is of much interest e.g. for the development of efficient interfaces between stationary and flying qubits in modern architectures for quantum computation and quantum communication. We consider the periodic pulse control, where the TLS is subjected to a periodic sequence of the near-resonant Rabi driving pulses, each pulse implementing a 180° rotation. For small inter-pulse delays, the absorption spectrum features a pronounced peak of stimulated emission at the pulsemore » frequency, as well as equidistant satellite peaks with smaller spectral weights. As long as the detuning between the carrier frequency of the driving and the TLS transition frequency remains moderate, this spectral shape shows little change. Therefore, the quantum control allows shifting the absorption peak to a desired position, and locks the absorption peak to the carrier frequency of the driving pulses. Detailed description of the spectrum, and its evolution as a function time, the inter-pulse spacing and the detuning, is presented.« less

  12. Absorption spectrum of a two-level system subjected to a periodic pulse sequence

    DOE PAGES

    Fotso, H. F.; Dobrovitski, V. V.

    2017-06-01

    We investigate how the quantum control of a two-level system (TLS) coupled to photons can modify and tune the TLS’s photon absorption spectrum. Tuning and controlling the emission and the absorption is of much interest e.g. for the development of efficient interfaces between stationary and flying qubits in modern architectures for quantum computation and quantum communication. We consider the periodic pulse control, where the TLS is subjected to a periodic sequence of the near-resonant Rabi driving pulses, each pulse implementing a 180° rotation. For small inter-pulse delays, the absorption spectrum features a pronounced peak of stimulated emission at the pulsemore » frequency, as well as equidistant satellite peaks with smaller spectral weights. As long as the detuning between the carrier frequency of the driving and the TLS transition frequency remains moderate, this spectral shape shows little change. Therefore, the quantum control allows shifting the absorption peak to a desired position, and locks the absorption peak to the carrier frequency of the driving pulses. Detailed description of the spectrum, and its evolution as a function time, the inter-pulse spacing and the detuning, is presented.« less

  13. BiQ Analyzer HT: locus-specific analysis of DNA methylation by high-throughput bisulfite sequencing

    PubMed Central

    Lutsik, Pavlo; Feuerbach, Lars; Arand, Julia; Lengauer, Thomas; Walter, Jörn; Bock, Christoph

    2011-01-01

    Bisulfite sequencing is a widely used method for measuring DNA methylation in eukaryotic genomes. The assay provides single-base pair resolution and, given sufficient sequencing depth, its quantitative accuracy is excellent. High-throughput sequencing of bisulfite-converted DNA can be applied either genome wide or targeted to a defined set of genomic loci (e.g. using locus-specific PCR primers or DNA capture probes). Here, we describe BiQ Analyzer HT (http://biq-analyzer-ht.bioinf.mpi-inf.mpg.de/), a user-friendly software tool that supports locus-specific analysis and visualization of high-throughput bisulfite sequencing data. The software facilitates the shift from time-consuming clonal bisulfite sequencing to the more quantitative and cost-efficient use of high-throughput sequencing for studying locus-specific DNA methylation patterns. In addition, it is useful for locus-specific visualization of genome-wide bisulfite sequencing data. PMID:21565797

  14. Sedimentological indicators of paleoenvironments and siliciclastic stratigraphic sequences in some Miocene deposits of the Calvert Cliffs, southern Maryland

    USGS Publications Warehouse

    Shideler, G.L.

    1994-01-01

    Middle Miocene siliciclastic deposits comprising the Calvert Cliffs section at the Baltimore Gas and Electric Company's (BG&E) nuclear power plant site in southern Maryland were analyzed in terms of lithostratigraphy, sedimentary structures, and granulometric parameters, to interprete paleo-environments within a sequence-stratigraphic framework. In terms of sequence-stratigraphic models, the BG&E section can be interpreted as consisting of two genetic stratigraphic sequences (Galloway model), namely, a shelf sequence and an overlying deltaic sequence. Using the Exxon model, the section consists of two third-order (1-5 m.y. duration) depositional sequences. The stratigraphic sequences of the BG&E section reflect both relatively short-term eustatic transgressive events, as well as a long-term regressive trend with associated local deltation and coastal progradation. The regression probably signified a regional basinward shift of depocenters within the Salisbury embayment during Miocene time. -from Author

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xing, Y; Macq, B; Bondar, L

    Purpose: To quantify the accuracy in predicting the Bragg peak position using simulated in-room measurements of prompt gamma (PG) emissions for realistic treatment error scenarios that combine several sources of errors. Methods: Prompt gamma measurements by a knife-edge slit camera were simulated using an experimentally validated analytical simulation tool. Simulations were performed, for 143 treatment error scenarios, on an anthropomorphic phantom and a pencil beam scanning plan for nasal cavity. Three types of errors were considered: translation along each axis, rotation around each axis, and CT-calibration errors with magnitude ranging respectively, between −3 and 3 mm, −5 and 5 degrees,more » and between −5 and +5%. We investigated the correlation between the Bragg peak (BP) shift and the horizontal shift of PG profiles. The shifts were calculated between the planned (reference) position and the position by the error scenario. The prediction error for one spot was calculated as the absolute difference between the PG profile shift and the BP shift. Results: The PG shift was significantly and strongly correlated with the BP shift for 92% of the cases (p<0.0001, Pearson correlation coefficient R>0.8). Moderate but significant correlations were obtained for all cases that considered only CT-calibration errors and for 1 case that combined translation and CT-errors (p<0.0001, R ranged between 0.61 and 0.8). The average prediction errors for the simulated scenarios ranged between 0.08±0.07 and 1.67±1.3 mm (grand mean 0.66±0.76 mm). The prediction error was moderately correlated with the value of the BP shift (p=0, R=0.64). For the simulated scenarios the average BP shift ranged between −8±6.5 mm and 3±1.1 mm. Scenarios that considered combinations of the largest treatment errors were associated with large BP shifts. Conclusion: Simulations of in-room measurements demonstrate that prompt gamma profiles provide reliable estimation of the Bragg peak position for complex error scenarios. Yafei Xing and Luiza Bondar are funded by BEWARE grants from the Walloon Region. The work presents simulations results for a prompt gamma camera prototype developed by IBA.« less

  16. Experimental Climate Change Modifies Degradative Succession in Boreal Peatland Fungal Communities.

    PubMed

    Asemaninejad, Asma; Thorn, R Greg; Lindo, Zoë

    2017-04-01

    Peatlands play an important role in global climate change through sequestration of atmospheric CO 2 . Climate-driven changes in the structure of fungal communities in boreal peatlands that favor saprotrophic fungi can substantially impact carbon dynamics and nutrient cycling in these crucial ecosystems. In a mesocosm study using a full factorial design, 100 intact peat monoliths, complete with living Sphagnum and above-ground vascular vegetation, were subjected to three climate change variables (increased temperature, reduced water table, and elevated CO 2 concentrations). Peat litterbags were placed in mesocosms, and fungal communities in litterbags were monitored over 12 months to assess the impacts of climate change variables on peat-inhabiting fungi. Changes in fungal richness, diversity, and community composition were assessed using Illumina MiSeq sequencing of ribosomal DNA (rDNA). While general fungal richness reduced under warming conditions, Ascomycota exhibited higher diversity under increased temperature treatments over the course of the experiment. Both increased temperature and lowered water table position drove shifts in fungal community composition with a strong positive effect on endophytic and mycorrhizal fungi (including one operational taxonomic unit (OTU) tentatively identified as Barrenia panicia) and different groups of saprotrophs identified as Mortierella, Galerina, and Mycena. These shifts were observed during a predicted degradative succession in the decomposer community as different carbon substrates became available. Since fungi play a central role in peatland communities, increased abundances of saprotrophic fungi under warming conditions, at the expense of reduced fungal richness overall, may increase decomposition rates under future climate scenarios and could potentially aggravate the impacts of climate change.

  17. The adaptation of limb kinematics to increasing walking speeds in freely moving mice 129/Sv and C57BL/6.

    PubMed

    Serradj, Nadjet; Jamon, Marc

    2009-07-19

    The kinematics of locomotion was analyzed in two strains of great importance for the creation of mutated mice (C56BL/6 and 129/Sv). Different behavioral situations were used to trigger sequences of movement covering the whole range of velocities in the mice, and the variations of kinematic parameters were analyzed in relation with velocity. Both stride frequency and stride length contributed to the moving speed, but stride frequency was found to be the main contributor to the speed increase. A trot-gallop transition was detected at speed about 70 cm/s, in relation with a sharp shift in limb coordination. The results of this study were consistent with pieces of information previously published concerning the gait analyses of other strains, and provided an integrative view of the basic motor pattern of mice. On the other hand some qualitative differences were found in the movement characteristics of the two strains. The stride frequency showed a higher contribution to speed in 129/Sv than in C57BL/6. In addition, 129/Sv showed a phase shift in the forelimb and hindlimb, and a different position of the foot during the stance time that revealed a different gait and body position during walking. Overall, 129/Sv moved at a slower speed than C57BL/6 in any behavioral situation. This difference was related to a basal lower level of motor activity. The possibility that an alteration in the dopamine circuit was responsible for the different movement pattern in 129/Sv is discussed.

  18. RNA editing makes mistakes in plant mitochondria: editing loses sense in transcripts of a rps19 pseudogene and in creating stop codons in coxI and rps3 mRNAs of Oenothera.

    PubMed Central

    Schuster, W; Brennicke, A

    1991-01-01

    An intact gene for the ribosomal protein S19 (rps19) is absent from Oenothera mitochondria. The conserved rps19 reading frame found in the mitochondrial genome is interrupted by a termination codon. This rps19 pseudogene is cotranscribed with the downstream rps3 gene and is edited on both sides of the translational stop. Editing, however, changes the amino acid sequence at positions that were well conserved before editing. Other strange editings create translational stops in open reading frames coding for functional proteins. In coxI and rps3 mRNAs CGA codons are edited to UGA stop codons only five and three codons, respectively, downstream to the initiation codon. These aberrant editings in essential open reading frames and in the rps19 pseudogene appear to have been shifted to these positions from other editing sites. These observations suggest a requirement for a continuous evolutionary constraint on the editing specificities in plant mitochondria. Images PMID:1762921

  19. Biofilm bacterial communities in urban drinking water distribution systems transporting waters with different purification strategies.

    PubMed

    Wu, Huiting; Zhang, Jingxu; Mi, Zilong; Xie, Shuguang; Chen, Chao; Zhang, Xiaojian

    2015-02-01

    Biofilm formation in drinking water distribution systems (DWDS) has many adverse consequences. Knowledge of microbial community structure of DWDS biofilm can aid in the design of an effective control strategy. However, biofilm bacterial community in real DWDS and the impact of drinking water purification strategy remain unclear. The present study investigated the composition and diversity of biofilm bacterial community in real DWDSs transporting waters with different purification strategies (conventional treatment and integrated treatment). High-throughput Illumina MiSeq sequencing analysis illustrated a large shift in the diversity and structure of biofilm bacterial community in real DWDS. Proteobacteria, Firmicutes, Bacteroidetes, Actinobacteria, Nitrospirae, and Cyanobacteria were the major components of biofilm bacterial community. Proteobacteria (mainly Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria) predominated in each DWDS biofilm, but the compositions of the dominant proteobacterial classes and genera and their proportions varied among biofilm samples. Drinking water purification strategy could shape DWDS biofilm bacterial community. Moreover, Pearson's correlation analysis indicated that Actinobacteria was positively correlated with the levels of total alkalinity and dissolved organic carbon in tap water, while Firmicutes had a significant positive correlation with nitrite nitrogen.

  20. The function of the Mediator complex in plant immunity.

    PubMed

    An, Chuanfu; Mou, Zhonglin

    2013-03-01

    Upon pathogen infection, plants undergo dramatic transcriptome reprogramming to shift from normal growth and development to immune response. During this rapid process, the multiprotein Mediator complex has been recognized as an important player to fine-tune gene-specific and pathway-specific transcriptional reprogramming by acting as an adaptor/coregulator between sequence-specific transcription factor and RNA polymerase II (RNAPII). Here, we review current understanding of the role of five functionally characterized Mediator subunits (MED8, MED15, MED16, MED21 and MED25) in plant immunity. All these Mediator subunits positively regulate resistance against leaf-infecting biotrophic bacteria or necrotrophic fungi. While MED21 appears to regulate defense against fungal pathogens via relaying signals from upstream regulators and chromatin modification to RNAPII, the other four Mediator subunits locate at different positions of the defense network to convey phytohormone signal(s). Fully understanding the role of Mediator in plant immunity needs to characterize more Mediator subunits in both Arabidopsis and other plant species. Identification of interacting proteins of Mediator subunits will further help to reveal their specific regulatory mechanisms in plant immunity.

  1. [Learning and Repetive Reproduction of Memorized Sequences by the Right and the Left Hand].

    PubMed

    Bobrova, E V; Lyakhovetskii, V A; Bogacheva, I N

    2015-01-01

    An important stage of learning a new skill is repetitive reproduction of one and the same sequence of movements, which plays a significant role in forming of the movement stereotypes. Two groups of right-handers repeatedly memorized (6-10 repetitions) the sequences of their hand transitions by experimenter in 6 positions, firstly by the right hand (RH), and then--by the left hand (LH) or vice versa. Random sequences previously unknown to the volunteers were reproduced in the 11 series. Modified sequences were tested in the 2nd and 3rd series, where the same elements' positions were presented in different order. The processes of repetitive sequence reproduction were similar for RH and LH. However, the learning of the modified sequences differed: Information about elements' position disregarding the reproduction order was used only when LH initiated task performing. This information was not used when LH followed RH and when RH performed the task. Consequently, the type of information coding activated by LH helped learn the positions of sequence elements, while the type of information coding activated by RH prevented learning. It is supposedly connected with the predominant role of right hemisphere in the processes of positional coding and motor learning.

  2. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    PubMed

    Seo, Heewon; Park, Yoomi; Min, Byung Joo; Seo, Myung Eui; Kim, Ju Han

    2017-01-01

    The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7%) of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit) exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  3. Crystal structure analysis of C-phycoerythrin from marine cyanobacterium Phormidium sp. A09DM.

    PubMed

    Kumar, Vinay; Sonani, Ravi R; Sharma, Mahima; Gupta, Gagan D; Madamwar, Datta

    2016-07-01

    The role of unique sequence features of C-phycoerythrin, isolated from Phormidium sp. A09DM, has been investigated by crystallographic studies. Two conserved indels (i.e. inserts or deletions) are found in the β-subunit of Phormidium phycoerythrin that are distinctive characteristics of large number of cyanobacterial sequences. The identified signatures are a two-residue deletion from position 21 and a nine-residue insertion at position 146. Crystals of Phormidium phycoerythrin were obtained at pH values of 5 and 8.5, and structures have been resolved to high precision at 1.95 and 2.1 Å resolution, respectively. In both the structures, heterodimers of α- and β- subunits assemble as hexamers. The 7-residue insertion at position 146 significantly reduces solvent exposure of π-conjugated A-C rings of a phycoerythrobilin (PEB) chromophore, and can influence energy absorption and energy transfer characteristics. The structural analyses (with 12-fold redundancy) suggest that protein micro-environment alone dictates the conformation of bound chromophores. The low- and high-energy absorbing chromophores are identified based on A-B ring coplanarity. The spatial distribution of these is found to be similar to that observed in R-phycoerythrin, suggesting the direction of energy transfer from outer-surface of hexamer to inner-hollow cavity in the Phormidium protein. The crystal structures also reveal that a commonly observed Hydrogen-bonding network in phycobiliproteins, involving chromophore bound to α-subunit and amino acid at position 73 of β-subunit, may not be essential for structural and functional integrity of C-phycoerythrin orthologs. In solution, the protein displays slight red shift and decrease in fluorescence emission at acidic pH. The mechanism for which may be static and correlates with the proximity of +ve electric field of Arg148 to the C-ring of a PEB chromophore.

  4. A physiological frequency-position map of the chinchilla cochlea.

    PubMed

    Müller, Marcus; Hoidis, Silvi; Smolders, Jean W T

    2010-09-01

    Accumulating evidence indicates that mammalian cochlear frequency-position maps (location of maximum vibration of the basilar membrane as a function of frequency) depend on the physiological condition of the inner ear. Cochlear damage desensitizes the ear, after the damage the original location of maximum vibration is tuned to a lower sound frequency. This suggests that frequency-position maps, derived from such desensitized ears, are shifted to lower frequencies, corresponding to a shift of the basilar membrane vibration pattern towards the base for a given stimulus frequency. To test this hypothesis, we re-mapped the cochlear frequency-position map in the chinchilla. We collected frequency-position data from chinchillas in normal physiological condition ("physiological map") and compared these to data previously established from sound overexposed ears ("anatomical map"). The characteristic frequency (CF) of neurons in the cochlear nucleus was determined. Horse-radish peroxidase (HRP) or biocytin (BCT) were injected iontophoretically to trace auditory nerve fibers towards their innervation site in the organ of Corti. The relationship between distance from the base (d, percent) and frequency (f, kHz) was described best by a simple exponential function: d = 61.2 - 42.2 x log(f). The slope of the function was 2.55 mm/octave. Compared to the "anatomical map", the "physiological map" was shifted by about 0.3 octaves to higher frequencies corresponding to a shift of the basilar membrane vibration pattern of 0.8 mm towards the apex for a given stimulus frequency. Our findings affirm that frequency-position maps in the mammalian cochlea depend on the condition of the inner ear. Damage-induced desensitization in mammalian inner ears results in similar shifts of CF (about 0.5 octaves) but different shifts of the maximum of the vibration pattern towards the base at given frequencies, dependent on the mapping constant of the species, longer basilar membranes showing a larger basal shift. Furthermore, the results substantiate the notion that "crowding" at lower frequencies appears to be a specialization rather than a general feature. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  5. When seconds count: A study of communication variables in the opening segment of emergency calls.

    PubMed

    Penn, Claire; Koole, Tom; Nattrass, Rhona

    2017-09-01

    The opening sequence of an emergency call influences the efficiency of the ambulance dispatch time. The greeting sequences in 105 calls to a South African emergency service were analysed. Initial results suggested the advantage of a specific two-part opening sequence. An on-site experiment aimed at improving call efficiency was conducted during one shift (1100 calls). Results indicated reduced conversational repairs and a significant reduction of 4 seconds in mean call length. Implications for systems and training are derived.

  6. The detection error of thermal test low-frequency cable based on M sequence correlation algorithm

    NASA Astrophysics Data System (ADS)

    Wu, Dongliang; Ge, Zheyang; Tong, Xin; Du, Chunlin

    2018-04-01

    The problem of low accuracy and low efficiency of off-line detecting on thermal test low-frequency cable faults could be solved by designing a cable fault detection system, based on FPGA export M sequence code(Linear feedback shift register sequence) as pulse signal source. The design principle of SSTDR (Spread spectrum time-domain reflectometry) reflection method and hardware on-line monitoring setup figure is discussed in this paper. Testing data show that, this detection error increases with fault location of thermal test low-frequency cable.

  7. [Prospects for applications in human health of nanopore-based sequencing].

    PubMed

    Audebert, Christophe; Hot, David; Caboche, Ségolène

    2018-04-01

    High throughput sequencing has opened up new clinical opportunities moving towards a medicine of precision. Oncology, infectious diseases or human genomics, many applications have been developed in recent years. The introduction of a third generation of nanopore-based sequencing technology, addressing some of the weaknesses of the previous generation, heralds a new revolution. Portability, real time, long reads and marginal investment costs, these promising new technologies point to a new shift of paradigm. What are the perspectives opened up by nanopores for clinical applications? © 2018 médecine/sciences – Inserm.

  8. Real time, TV-based, point-image quantizer and sorter

    DOEpatents

    Case, Arthur L.; Davidson, Jackson B.

    1976-01-01

    A device is provided for improving the vertical resolution in a television-based, two-dimensional readout for radiation detection systems such as are used to determine the location of light or nuclear radiation impinging a target area viewed by a television camera, where it is desired to store the data indicative of the centroid location of such images. In the example embodiment, impinging nuclear radiation detected in the form of a scintillation occurring in a crystal is stored as a charge image on a television camera tube target. The target is scanned in a raster and the image position is stored according to a corresponding vertical scan number and horizontal position number along the scan. To determine the centroid location of an image that may overlap a number of horizontal scan lines along the vertical axis of the raster, digital logic circuits are provided with at least four series-connected shift registers, each having 512 bit positions according to a selected 512 horizontal increment of resolutions along a scan line. The registers are shifted by clock pulses at a rate of 512 pulses per scan line. When an image or portion thereof is detected along a scan, its horizontal center location is determined and the present front bit is set in the first shift register and shifted through the registers one at a time for each horizontal scan. Each register is compared bit-by-bit with the preceding register to detect coincident set bit positions until the last scan line detecting a portion of the image is determined. Depending on the number of shift registers through which the first detection of the image is shifted, circuitry is provided to store the vertical center position of the event according to the number of shift registers through which the first detection of the event is shifted. Interpolation circuitry is provided to determine if the event centroid is between adjacent scan lines and stored in a vertical address accordingly. The horizontal location of the event is stored in a separate address memory.

  9. Resurgence of Integrated Behavioral Units

    PubMed Central

    Bachá-Méndez, Gustavo; Reid, Alliston K; Mendoza-Soylovna, Adela

    2007-01-01

    Two experiments with rats examined the dynamics of well-learned response sequences when reinforcement contingencies were changed. Both experiments contained four phases, each of which reinforced a 2-response sequence of lever presses until responding was stable. The contingencies then were shifted to a new reinforced sequence until responding was again stable. Extinction-induced resurgence of previously reinforced, and then extinguished, heterogeneous response sequences was observed in all subjects in both experiments. These sequences were demonstrated to be integrated behavioral units, controlled by processes acting at the level of the entire sequence. Response-level processes were also simultaneously operative. Errors in sequence production were strongly influenced by the terminal, not the initial, response in the currently reinforced sequence, but not by the previously reinforced sequence. These studies demonstrate that sequence-level and response-level processes can operate simultaneously in integrated behavioral units. Resurgence and the development of integrated behavioral units may be dissociated; thus the observation of one does not necessarily imply the other. PMID:17345948

  10. Effect of top gate potential on bias-stress for dual gate amorphous indium-gallium-zinc-oxide thin film transistor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chun, Minkyu; Um, Jae Gwang; Park, Min Sang

    We report the abnormal behavior of the threshold voltage (V{sub TH}) shift under positive bias Temperature stress (PBTS) and negative bias temperature stress (NBTS) at top/bottom gate in dual gate amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors (TFTs). It is found that the PBTS at top gate shows negative transfer shift and NBTS shows positive transfer shift for both top and bottom gate sweep. The shift of bottom/top gate sweep is dominated by top gate bias (V{sub TG}), while bottom gate bias (V{sub BG}) is less effect than V{sub TG}. The X-ray photoelectron spectroscopy (XPS) depth profile provides the evidence of Inmore » metal diffusion to the top SiO{sub 2}/a-IGZO and also the existence of large amount of In{sup +} under positive top gate bias around top interfaces, thus negative transfer shift is observed. On the other hand, the formation of OH{sup −} at top interfaces under the stress of negative top gate bias shows negative transfer shift. The domination of V{sub TG} both on bottom/top gate sweep after PBTS/NBTS is obviously occurred due to thin active layer.« less

  11. Effect of lower-body positive pressure on postural fluid shifts in men

    NASA Technical Reports Server (NTRS)

    Hinghofer-Szalkay, H.; Kravik, S. E.; Greenleaf, J. E.

    1988-01-01

    The effect of the lower-body positive pressure (LBPP) on the orthostatic fluid and protein shifts were investigated in five men during combined tilt-table/antigravity suit inflation and deflation experiments. Changes in the mass densities of venous blood and plasma were measured and the values were used to calculate the densities of erythrocytes, whole-body blood, and shifted fluid. It was found that the application of 60 mm Hg LBPP during 60-deg head-up tilt prevented about half of the postural hemoconcentration occurring during passive head-up tilt.

  12. Impulsive EUV bursts observed in C IV with OSO-8. [UV solar spectra

    NASA Technical Reports Server (NTRS)

    Athay, R. G.; White, O. R.; Lites, B. W.; Bruner, E. C., Jr.

    1980-01-01

    Time sequences of profiles of the 1548 A line of C IV containing 51 EUV bursts observed in or near active regions are analyzed to determine the brightness, Doppler shift and line broadening characteristics of the bursts. The bursts have mean lifetimes of approximately 150 s, and mean increases in brightness at burst maximum of four-fold as observed with a field of view of 2 x 20 arc sec. Mean burst diameters are estimated to be 3 arc sec, or smaller. All but three of the bursts show Doppler shifts with velocities sometimes exceeding 75 km/s; 31 are dominated by red shifts and 17 are dominated by blue shifts. Approximately half of the latter group have red-shifted precursors. The bursts are interpreted as prominence material, such as surges and coronal rain, moving through the field of view of the spectrometer.

  13. Relationship between shift work and the onset of rheumatoid arthritis

    PubMed Central

    Hedström, Anna Karin; Åkerstedt, Torbjörn; Klareskog, Lars; Alfredsson, Lars

    2017-01-01

    Background Environmental factors play a prominent role in rheumatoid arthritis (RA) aetiology. Shift work has previously been associated with increased RA risk in females. The aim of this study was to investigate the potential association, including a dose–response association, between permanent night shift work, rotating shift work and day-oriented shift work and risk of developing anticitrullinated peptide antibodies (ACPA)-positive and ACPA-negative RA. Methods The present report is based on a population-based, case–control study with incident cases of RA (1951 cases and 2225 controls matched by age, gender and residential area). Using logistic regression, occurrence of RA among subjects who have been exposed to different kinds of shift work was compared with that among those who have never been exposed by calculating the OR with a 95% CI. Results Rotating shift work and day-oriented shift work increased the risk of developing ACPA-positive RA (OR 1.3, 95% CI 1.0 to 1.7 and OR 1.3, 95% CI 1.0 to 1.6), but not ACPA-negative RA. Permanent night shift work appeared to be a protective factor both against ACPA-positive RA (OR 0.7, 95% CI 0.6 to 0.9) and ACPA-negative RA (OR 0.8, 95% CI 0.6 to 1.0). For both subsets of RA, significant trends showed a lower risk of developing RA with increasing duration of permanent night shift work (p value for trend 0.002 vs 0.04). Conclusions Sleep restriction as a consequence of shift work is associated with several biological effects among which changes in melatonin production may be involved. The present epidemiological findings of a complex relationship between sleep patterns and different forms of RA may be of importance for increasing the understanding of the pathophysiology of RA. PMID:29225920

  14. Technical Note: Dosimetric effects of couch position variability on treatment plan quality with an MRI-guided Co-60 radiation therapy machine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chow, Phillip E., E-mail: pechow@mednet.ucla.edu

    2016-08-15

    Purpose: Magnetic resonance imaging (MRI) guidance in radiation therapy brings real-time imaging and adaptive planning into the treatment vault where it can account for interfraction and intrafraction movement of soft tissue. The only commercially available MRI-guided radiation therapy device is a three-head {sup 60}Co and MRI system with an integrated treatment planning system (TPS). Couch attenuation of the beam of up to 20% is well modeled in the TPS. Variations in the patient’s day-to-day position introduce discrepancies in the actual couch attenuation as modeled in the treatment plan. For this reason, the authors’ institution avoids plans with beams that passmore » through or near the couch edges. This study investigates the effects of differential beam attenuation by the couch due to couch shifts in order to determine whether couch edge avoidance restrictions can be lifted. Couch shifts were simulated using a Monte Carlo treatment planning system and ion chamber measurements performed for validation. Methods: A total of 27 plans from 23 patients were investigated. Couch shifts of 1 and 2 cm were introduced in combinations of lateral and vertical directions to simulate patient position variations giving 16 shifted plans per reference plan. The 1 and 2 cm shifts were based on shifts recorded in 320 treatment fractions. Results: Following TG176 recommendations for measurement methods, couch attenuation measurements agreed with TPS modeled attenuation to within 2.1%. Planning target volume D95 changed less than 1% for 1 and 2 cm couch shifts in only the x-direction and less than 3% for all directions. Conclusions: Dosimetry of all plans tested was robust to couch shifts up to ±2 cm. In general, couch shifts resulted in clinically insignificant dosimetric deviations. It is conceivable that in certain cases with large systematic couch shifts and plans that are particularly sensitive to shifts, dosimetric changes might rise to a clinically significant level.« less

  15. Do mood and the receipt of work-based support influence nurse perceived quality of care delivery? A behavioural diary study.

    PubMed

    Jones, Martyn C; Johnston, Derek

    2013-03-01

    To examine the effect of nurse mood in the worst event of shift (negative affect, positive affect), receipt of work-based support from managers and colleagues, colleague and patient involvement on perceived quality of care delivery. While the effect of the work environment on nurse mood is well documented, little is known about the effects of the worst event of shift on the quality of care delivered by nurses. This behavioural diary study employed a within-subject and between-subject designs incorporating both cross-sectional and longitudinal elements. One hundred and seventy-one nurses in four large district general hospitals in England completed end-of-shift computerised behavioural diaries over three shifts to explore the effects of the worst clinical incident of shift. Diaries measured negative affect, positive affect, colleague involvement, receipt of work-based support and perceived quality of care delivery. Analysis used multilevel modelling (MLWIN 2.19; Centre for Multi-level Modelling, University of Bristol, Bristol, UK). High levels of negative affect and low levels of positive affect reported in the worst clinical incident of shift were associated with reduced perceived quality of care delivery. Receipt of managerial support and its interaction with negative affect had no relationship with perceived quality of care delivery. Perceived quality of care delivery deteriorated the most when the nurse reported a combination of high negative affect and no receipt of colleague support in the worst clinical incident of shift. Perceived quality of care delivery was also particularly influenced when the nurse reported low positive affect and colleague actions contributed to the problem. Receipt of colleague support is particularly salient in protecting perceived quality of care delivery, especially if the nurse also reports high levels of negative affect in the worst event of shift. The effect of work-based support on care delivery is complex and requires further investigation. © 2012 Blackwell Publishing Ltd.

  16. Inferring Short-Range Linkage Information from Sequencing Chromatograms

    PubMed Central

    Beggel, Bastian; Neumann-Fraune, Maria; Kaiser, Rolf; Verheyen, Jens; Lengauer, Thomas

    2013-01-01

    Direct Sanger sequencing of viral genome populations yields multiple ambiguous sequence positions. It is not straightforward to derive linkage information from sequencing chromatograms, which in turn hampers the correct interpretation of the sequence data. We present a method for determining the variants existing in a viral quasispecies in the case of two nearby ambiguous sequence positions by exploiting the effect of sequence context-dependent incorporation of dideoxynucleotides. The computational model was trained on data from sequencing chromatograms of clonal variants and was evaluated on two test sets of in vitro mixtures. The approach achieved high accuracies in identifying the mixture components of 97.4% on a test set in which the positions to be analyzed are only one base apart from each other, and of 84.5% on a test set in which the ambiguous positions are separated by three bases. In silico experiments suggest two major limitations of our approach in terms of accuracy. First, due to a basic limitation of Sanger sequencing, it is not possible to reliably detect minor variants with a relative frequency of no more than 10%. Second, the model cannot distinguish between mixtures of two or four clonal variants, if one of two sets of linear constraints is fulfilled. Furthermore, the approach requires repetitive sequencing of all variants that might be present in the mixture to be analyzed. Nevertheless, the effectiveness of our method on the two in vitro test sets shows that short-range linkage information of two ambiguous sequence positions can be inferred from Sanger sequencing chromatograms without any further assumptions on the mixture composition. Additionally, our model provides new insights into the established and widely used Sanger sequencing technology. The source code of our method is made available at http://bioinf.mpi-inf.mpg.de/publications/beggel/linkageinformation.zip. PMID:24376502

  17. WebLogo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Crooks, Gavin E.

    WebLogo is a web based application designed to make the generation of sequence logos as easy and painless as possible. Sequesnce logos are a graphical representation of an amino acid or nucleic acid multiple sequence alignment developed by Tom Schneider and Mike Stephens. Each logo consists of stacks of symbols, one stack for each position in the sequence. The overall height of the stack indicates the sequence conservation at that position, while the height of symbols within the stack indicates the relative frequency of each amino or nucleic acid at that position. In general, a sequence logo provides a richermore » and more precise description of, for example, a binding site, than would a consensus sequence.« less

  18. UNEXPECTED SERIES OF REGULAR FREQUENCY SPACING OF δ SCUTI STARS IN THE NON-ASYMPTOTIC REGIME. I. THE METHODOLOGY

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paparó, M.; Benkő, J. M.; Hareter, M.

    A sequence search method was developed to search the regular frequency spacing in δ Scuti stars through visual inspection and an algorithmic search. We searched for sequences of quasi-equally spaced frequencies, containing at least four members per sequence, in 90 δ Scuti stars observed by CoRoT . We found an unexpectedly large number of independent series of regular frequency spacing in 77 δ Scuti stars (from one to eight sequences) in the non-asymptotic regime. We introduce the sequence search method presenting the sequences and echelle diagram of CoRoT 102675756 and the structure of the algorithmic search. Four sequences (echelle ridges)more » were found in the 5–21 d{sup −1} region where the pairs of the sequences are shifted (between 0.5 and 0.59 d{sup −1}) by twice the value of the estimated rotational splitting frequency (0.269 d{sup −1}). The general conclusions for the whole sample are also presented in this paper. The statistics of the spacings derived by the sequence search method, by FT (Fourier transform of the frequencies), and the statistics of the shifts are also compared. In many stars more than one almost equally valid spacing appeared. The model frequencies of FG Vir and their rotationally split components were used to formulate the possible explanation that one spacing is the large separation while the other is the sum of the large separation and the rotational frequency. In CoRoT 102675756, the two spacings (2.249 and 1.977 d{sup −1}) are in better agreement with the sum of a possible 1.710 d{sup −1} large separation and two or one times, respectively, the value of the rotational frequency.« less

  19. Missed detection of significant positive and negative shifts in gentamicin assay: implications for routine laboratory quality practices.

    PubMed

    Koerbin, Gus; Liu, Jiakai; Eigenstetter, Alex; Tan, Chin Hon; Badrick, Tony; Loh, Tze Ping

    2018-02-15

    A product recall was issued for the Roche/Hitachi Cobas Gentamicin II assays on 25 th May 2016 in Australia, after a 15 - 20% positive analytical shift was discovered. Laboratories were advised to employ the Thermo Fisher Gentamicin assay as an alternative. Following the reintroduction of the revised assay on 12 th September 2016, a second reagent recall was made on 20 th March 2017 after the discovery of a 20% negative analytical shift due to erroneous instrument adjustment factor. The practices of an index laboratory were examined to determine how the analytical shifts evaded detection by routine internal quality control (IQC) and external quality assurance (EQA) systems. The ability of the patient result-based approaches, including moving average (MovAvg) and moving sum of outliers (MovSO) approaches in detecting these shifts were examined. Internal quality control data of the index laboratory were acceptable prior to the product recall. The practice of adjusting IQC target following a change in assay method resulted in the missed negative shift when the revised Roche assay was reintroduced. While the EQA data of the Roche subgroup showed clear negative bias relative to other laboratory methods, the results were considered as possible 'matrix effect'. The MovAvg method detected the positive shift before the product recall. The MovSO did not detect the negative shift in the index laboratory but did so in another laboratory 5 days before the second product recall. There are gaps in current laboratory quality practices that leave room for analytical errors to evade detection.

  20. G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Willing, M.; Deschenes, S.

    We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exonmore » 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.« less

  1. Adaptive Digital Signature Design and Short-Data-Record Adaptive Filtering

    DTIC Science & Technology

    2008-04-01

    rate BPSK binary phase shift keying CA − CFAR cell averaging− constant false alarm rate CDMA code − division multiple − access CFAR constant false...Cotae, “Spreading sequence design for multiple cell synchronous DS-CDMA systems under total weighted squared correlation criterion,” EURASIP Journal...415-428, Mar. 2002. [6] P. Cotae, “Spreading sequence design for multiple cell synchronous DS-CDMA systems under total weighted squared correlation

  2. Spread-Spectrum Communications.

    DTIC Science & Technology

    1984-08-07

    Articles M. B. Parsley and H. F. A. Roefs, "Numerical evaluation of correlation parameters for optimal phases of binary shift-register sequences," IEEE...Transactions on Communications, Vol. COM-27, pp. 1597-1604, October 1979. D. V. Sarwate and M. B. Parsley , "Crcuecorrehation proets Of psuoadmand related...Signal Processing, Vol. 128, pp. 104-109, April 1981. * M. B. Parsley , D. V. Sarwate, and W. E. Stark, ’Error probability for direct-sequence spread

  3. Drugs and People: Repertory Grid Structure and the Construal of Two Different Kinds of Target.

    ERIC Educational Resources Information Center

    Leenaars, Antoon A.

    1981-01-01

    Investigated comparisons of perceptions of drugs with perceptions of people, using the repertory grid technique. A significant result was finding a shift from seeing people as less positive and drugs as more positive when subjects shifted from a normal state of consciousness to a simulated altered state of consciousness. (Author)

  4. Right Hand Presence Modulates Shifts of Exogenous Visuospatial Attention in Near Perihand Space

    ERIC Educational Resources Information Center

    Lloyd, Donna M.; Azanon, Elena; Poliakoff, Ellen

    2010-01-01

    To investigate attentional shifting in perihand space, we measured performance on a covert visual orienting task under different hand positions. Participants discriminated visual shapes presented on a screen and responded using footpedals placed under their right foot. With the right hand positioned by the right side of the screen, mean cueing…

  5. The Development of a National Agenda for College Faculty: "McDonaldizing" Higher Education.

    ERIC Educational Resources Information Center

    Anderson, Lara A.; Miller, Michael

    By analyzing contemporary literature, this paper posits a federal role in what is seen as a trend toward "normalizing" college faculty positions and shifting control away from state and local jurisdictions. Three factors are seen as contributing to this shift. The first is the government's role in funding the hard sciences which has, in…

  6. Comparative study of fat-suppression techniques for hip arthroplasty MR imaging.

    PubMed

    Molière, Sébastien; Dillenseger, Jean-Philippe; Ehlinger, Matthieu; Kremer, Stéphane; Bierry, Guillaume

    2017-09-01

    The goal of this study was to evaluate different fat-suppressed fluid-sensitive sequences in association with different metal artifacts reduction techniques (MARS) to determine which combination allows better fat suppression around metallic hip implants. An experimental study using an MRI fat-water phantom quantitatively evaluated contrast shift induced by metallic hip implant for different fat-suppression techniques and MARS. Then a clinical study with patients addressed to MRI unit for painful hip prosthesis compared these techniques in terms of fat suppression quality and diagnosis confidence. Among sequences without MARS, both T2 Dixon and short tau inversion recuperation (STIR) had significantly lower contrast shift (p < 0.05), Dixon offering the best fat suppression. Adding MARS (view-angle tilting or slice-encoding for metal artifact correction (SEMAC)) to STIR gave better results than Dixon alone, and also better than SPAIR and fat saturation with MARS (p < 0.05). There were no statistically significant differences between STIR with view-angle tilting and STIR with SEMAC in terms of fat suppression quality. STIR sequence is the preferred fluid-sensitive MR sequence in patients with metal implant. In combination with MARS (view-angle tilting or SEMAC), STIR appears to be the best option for high-quality fat suppression.

  7. Understanding the fate of the oxyallyl cation following Nazarov electrocyclization: sequential Wagner-Meerwein migrations and the synthesis of spirocyclic cyclopentenones

    PubMed Central

    Huang, Jie; Lebœuf, David; Frontier, Alison J.

    2011-01-01

    A general reaction sequence is described that involves Nazarov cyclization followed by two sequential Wagner Meerwein migrations, to afford spirocyclic compounds from divinyl ketones in the presence of one equivalent of copper(II) complexes. A detailed investigation of this sequence is described including a study of substrate scope and limitations. It was found that after 4π electrocyclization, two different pathways are available to the oxyallyl cation intermediate: elimination of a proton can give the usual Nazarov cycloadduct, or ring contraction can give an alternative tertiary carbocation. After ring contraction, either [1,2]-hydride or carbon migration can occur, depending upon the substitution pattern of the substrate, to furnish spirocyclic products. The rearrangement pathway is favored over the elimination pathway when catalyst loading was high and the copper(II) counterion is noncoordinating. Several ligands were found to be effective for the reaction. Thus, the reaction sequence can be controlled by judicious choice of reaction conditions to allow selective generation of richly functionalized spirocycles. The three steps of the sequence are stereospecific: electrocyclization followed by two [1,2]-suprafacial Wagner-Meerwein shifts: the ring contraction and then an hydride, alkenyl or aryl shift. The method allows stereospecific installation of adjacent stereocenters or adjacent quaternary centers arrayed around a cyclopentenone ring. PMID:21466152

  8. Microbial profiling of dental plaque from mechanically ventilated patients.

    PubMed

    Sands, Kirsty M; Twigg, Joshua A; Lewis, Michael A O; Wise, Matt P; Marchesi, Julian R; Smith, Ann; Wilson, Melanie J; Williams, David W

    2016-02-01

    Micro-organisms isolated from the oral cavity may translocate to the lower airways during mechanical ventilation (MV) leading to ventilator-associated pneumonia (VAP). Changes within the dental plaque microbiome during MV have been documented previously, primarily using culture-based techniques. The aim of this study was to use community profiling by high throughput sequencing to comprehensively analyse suggested microbial changes within dental plaque during MV. Bacterial 16S rDNA gene sequences were obtained from 38 samples of dental plaque sampled from 13 mechanically ventilated patients and sequenced using the Illumina platform. Sequences were processed using Mothur, applying a 97% gene similarity cut-off for bacterial species level identifications. A significant 'microbial shift' occurred in the microbial community of dental plaque during MV for nine out of 13 patients. Following extubation, or removal of the endotracheal tube that facilitates ventilation, sampling revealed a decrease in the relative abundance of potential respiratory pathogens and a compositional change towards a more predominantly (in terms of abundance) oral microbiota including Prevotella spp., and streptococci. The results highlight the need to better understand microbial shifts in the oral microbiome in the development of strategies to reduce VAP, and may have implications for the development of other forms of pneumonia such as community-acquired infection.

  9. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    PubMed Central

    Yang, Seung Hak; Lim, Joung Soo; Khan, Modabber Ahmed; Kim, Bong Soo; Choi, Dong Yoon; Lee, Eun Young; Ahn, Hee Kwon

    2015-01-01

    The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site. PMID:26500442

  10. Does clinical incident seriousness and receipt of work-based support influence mood experienced by nurses at work? A behavioural diary study.

    PubMed

    Jones, Martyn C; Johnston, Derek W

    2012-08-01

    While the relationship between general perceptions of the work environment and negative mood is well detailed, little is known about the effect of specific clinical incident characteristics on the mood experienced at work by nurses. This study examines the effect of incident seriousness and receipt of work-based support in the worst event of a shift from managers and colleagues on the Negative and Positive Affect experienced by nurses at work. We approached the total cohort of medical and surgical nurses in 4 large district general hospitals in England, 17% volunteered. Some 171 nurses filled end of shift and standard entry (every 90 min) computerised behavioural diaries over three consecutive shifts. The diaries measured Incident Seriousness, Receipt of Managerial and Co-worker Support, Negative Affect and Positive Affect. Results were analysed using multilevel modelling (MLwiN 2.19). Following the worst clinical incident of a shift, nurses reported higher Negative Affect (β=1.28, [95%CI: 0.12, 2.45], z=2.17, p<.05) and lower Positive Affect (β=-2.39, [95%CI: -3.96, -0.82], z=2.99, p<.005) which persisted for the remainder of the shift. Most critically, Negative Affect was more elevated after serious incidents (β=0.07, [95%CI: 0.04, 0.10], z=3.5, p<.005). Nurses who reported Receipt of Managerial Support following an incident reported significantly lower levels of Positive Affect compared to those reporting no such contact (β=-5.30, [95%CI: -9.51, -1.09], z=2.47, p<.05). The interaction between Incident and the Receipt of Work-Based Support on NA was not significant (β=2.34 [95%CI: -0.82, 3.95], z=1.45, p>.05). Receipt of Colleague Support had no relationship with Negative Affect or Positive Affect. Free text reports mainly revealed the negative impact of managerial support, although there were instances of contact with managers which were sought following exposure to difficult clinical situations. Serious clinical incidents have enduring effects on Negative Affect and Positive Affect for the remainder of the shift. Nurse Positive Affect was significantly worse following the worst clinical incident of shift when managerial support was received. Further research is required to determine the positive and negative effects of managerial support on the mood experienced by nurses at work. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Distribution of mean Doppler shift, spectral width, and skewness of coherent 50-MHz auroral radar backscatter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watermann, J.; McNamara, A.G.; Sofko, G.J.

    Some 7,700 radio aurora spectra obtained from a six link 50-MHz CW radar network set up on the Canadian prairies were analyzed with respect to the distributions of mean Doppler shift, spectral width and skewness. A comparison with recently published SABRE results obtained at 153 MHz shows substantial differences in the distributions which are probably due to different experimental and geophysical conditions. The spectra are mostly broad with mean Doppler shifts close to zero (type II spectra). The typical groupings of type I and type III spectra are clearly identified. All types appear to be in general much more symmetricmore » than those recorded with SABRE, and the skewness is only weakly dependent on the sign of the mean Doppler shift. Its distribution peaks near zero and shows a weak positive correlation with the type II Doppler shifts while the mostly positive type I Doppler shifts are slightly negatively correlated with the skewness.« less

  12. The characterization of GH shifts of surface plasmon resonance in a waveguide using the FDTD method.

    PubMed

    Oh, Geum-Yoon; Kim, Doo Gun; Choi, Young-Wan

    2009-11-09

    We have explicated the Goos-Hänchen (GH) shift in a mum-order Kretchmann-Raether configuration embedded in an optical waveguide structure by using the finite-difference time-domain method. For optical waveguide-type surface plasmon resonance (SPR) devices, the precise derivation of the GH shift has become critical. Artmann's equation, which is accurate enough for bulk optics, is difficult to apply to waveguide-type SPR devices. This is because Artmann's equation, based on the differentiation of the phase shift, is inaccurate at the critical and resonance angles where drastic phase changes occur. In this study, we accurately identified both the positive and the negative GH shifts around the incidence angle of resonance. In a waveguide-type Kretchmann-Raether configuration with an Au thin film of 50 nm, positive and negative lateral shifts of -0.75 and + 1.0 microm are obtained on the SPR with the incident angles of 44.4 degrees and 47.5 degrees, respectively, at a wavelength of 632.8 nm.

  13. Quantifying the performance of in vivo portal dosimetry in detecting four types of treatment parameter variations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bojechko, C.; Ford, E. C., E-mail: eford@uw.edu

    Purpose: To quantify the ability of electronic portal imaging device (EPID) dosimetry used during treatment (in vivo) in detecting variations that can occur in the course of patient treatment. Methods: Images of transmitted radiation from in vivo EPID measurements were converted to a 2D planar dose at isocenter and compared to the treatment planning dose using a prototype software system. Using the treatment planning system (TPS), four different types of variability were modeled: overall dose scaling, shifting the positions of the multileaf collimator (MLC) leaves, shifting of the patient position, and changes in the patient body contour. The gamma passmore » rate was calculated for the modified and unmodified plans and used to construct a receiver operator characteristic (ROC) curve to assess the detectability of the different parameter variations. The detectability is given by the area under the ROC curve (AUC). The TPS was also used to calculate the impact of the variations on the target dose–volume histogram. Results: Nine intensity modulation radiation therapy plans were measured for four different anatomical sites consisting of 70 separate fields. Results show that in vivo EPID dosimetry was most sensitive to variations in the machine output, AUC = 0.70 − 0.94, changes in patient body habitus, AUC = 0.67 − 0.88, and systematic shifts in the MLC bank positions, AUC = 0.59 − 0.82. These deviations are expected to have a relatively small clinical impact [planning target volume (PTV) D{sub 99} change <7%]. Larger variations have even higher detectability. Displacements in the patient’s position and random variations in MLC leaf positions were not readily detectable, AUC < 0.64. The D{sub 99} of the PTV changed by up to 57% for the patient position shifts considered here. Conclusions: In vivo EPID dosimetry is able to detect relatively small variations in overall dose, systematic shifts of the MLC’s, and changes in the patient habitus. Shifts in the patient’s position which can introduce large changes in the target dose coverage were not readily detected.« less

  14. Accuracy of maxillary positioning after standard and inverted orthognathic sequencing.

    PubMed

    Ritto, Fabio G; Ritto, Thiago G; Ribeiro, Danilo Passeado; Medeiros, Paulo José; de Moraes, Márcio

    2014-05-01

    This study aimed to compare the accuracy of maxillary positioning after bimaxillary orthognathic surgery, using 2 sequences. A total of 80 cephalograms (40 preoperative and 40 postoperative) from 40 patients were analyzed. Group 1 included radiographs of patients submitted to conventional sequence, whereas group 2 patients were submitted to inverted sequence. The final position of the maxillary central incisor was obtained after vertical and horizontal measurements of the tracings, and it was compared with what had been planned. The null hypothesis, which stated that there would be no difference between the groups, was tested. After applying the Welch t test for comparison of mean differences between maxillary desired and achieved position, considering a statistical significance of 5% and a 2-tailed test, the null hypothesis was not rejected (P > .05). Thus, there was no difference in the accuracy of maxillary positioning between groups. Conventional and inverted sequencing proved to be reliable in positioning the maxilla after LeFort I osteotomy in bimaxillary orthognathic surgeries. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. DETERMINATION OF CENTRAL ENGINE POSITION AND ACCRETION DISK STRUCTURE IN NGC 4261 BY CORE SHIFT MEASUREMENTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haga, Takafumi; Doi, Akihiro; Murata, Yasuhiro

    2015-07-01

    We report multifrequency phase-referenced observations of the nearby radio galaxy NGC 4261, which has prominent two-sided jets, using the Very Long Baseline Array at 1.4–43 GHz. We measured radio core positions showing observing frequency dependences (known as “core shift”) in both approaching jets and counterjets. The limit of the core position as the frequency approaches infinity, which suggests a jet base, is separated by 82 ± 16 μas upstream in projection, corresponding to (310 ± 60)R{sub s} (R{sub s}: Schwarzschild radius) as a deprojected distance, from the 43 GHz core in the approaching jet. In addition, the innermost component atmore » the counterjet side appeared to approach the same position at infinity of the frequency, indicating that cores on both sides are approaching the same position, suggesting a spatial coincidence with the central engine. Applying a phase-referencing technique, we also obtained spectral index maps, which indicate that emission from the counterjet is affected by free–free absorption (FFA). The result of the core shift profile on the counterjet also requires FFA because the core positions at 5–15 GHz cannot be explained by a simple core shift model based on synchrotron self-absorption (SSA). Our result is apparently consistent with the SSA core shift with an additional disk-like absorber over the counterjet side. Core shift and opacity profiles at the counterjet side suggest a two-component accretion: a radiatively inefficient accretion flow at the inner region and a truncated thin disk in the outer region. We proposed a possible solution about density and temperature profiles in the outer disk on the basis of the radio observation.« less

  16. Expanded turn conformations: characterization and sequence-structure correspondence in alpha-turns with implications in helix folding.

    PubMed

    Dasgupta, Bhaskar; Pal, Lipika; Basu, Gautam; Chakrabarti, Pinak

    2004-05-01

    Like the beta-turns, which are characterized by a limiting distance between residues two positions apart (i, i+3), a distance criterion (involving residues at positions i and i+4) is used here to identify alpha-turns from a database of known protein structures. At least 15 classes of alpha-turns have been enumerated based on the location in the phi,psi space of the three central residues (i+1 to i+3)-one of the major being the class AAA, where the residues occupy the conventional helical backbone torsion angles. However, moving towards the C-terminal end of the turn, there is a shift in the phi,psi angles towards more negative phi, such that the electrostatic repulsion between two consecutive carbonyl oxygen atoms is reduced. Except for the last position (i+4), there is not much similarity in residue composition at different positions of hydrogen and non-hydrogen bonded AAA turns. The presence or absence of Pro at i+1 position of alpha- and beta-turns has a bearing on whether the turn is hydrogen-bonded or without a hydrogen bond. In the tertiary structure, alpha-turns are more likely to be found in beta-hairpin loops. The residue composition at the beginning of the hydrogen bonded AAA alpha-turn has similarity with type I beta-turn and N-terminal positions of helices, but the last position matches with the C-terminal capping position of helices, suggesting that the existence of a "helix cap signal" at i+4 position prevents alpha-turns from growing into helices. Our results also provide new insights into alpha-helix nucleation and folding. Copyright 2004 Wiley-Liss, Inc.

  17. Solvent-dependent reactions for the synthesis of β-keto-benzo-δ-sultone scaffolds via DBU-catalyzed O-sulfonylation/intramolecular Baylis-Hillman/1,3-H shift or dehydration tandem sequences.

    PubMed

    Ghandi, Mehdi; Bozcheloei, Abolfazl Hasani; Nazari, Seyed Hadi; Sadeghzadeh, Masoud

    2011-12-16

    We have developed a solvent-dependent method for the synthesis of novel benzo-δ-sultone scaffolds. A variety of benzylbenzo[e][1,2]oxathiin-4(3H)-one-2,2-dioxides were obtained in high yields in DMF using a one-pot, DBU-catalyzed condensation of 2-hydroxybenzaldehydes with a number of (E)-2-phenylethenesulfonyl chlorides. On the other hand, the initially prepared 2-formylphenyl-(E)-2-phenylethenesulfonate derivatives underwent DBU-catalyzed reactions to a series of 3-[methoxy(phenyl)methyl]benzo[e][1,2]oxathiine-2,2-dioxides in moderate to good yields in MeOH. These reactions presumably proceed via DBU-catalyzed O-sulfonylation/intramolecular Baylis-Hillman/1,3-H shift or dehydration tandem sequences, respectively.

  18. Regime Shift and Microbial Dynamics in a Sequencing Batch Reactor for Nitrification and Anammox Treatment of Urine ▿†

    PubMed Central

    Bürgmann, Helmut; Jenni, Sarina; Vazquez, Francisco; Udert, Kai M.

    2011-01-01

    The microbial population and physicochemical process parameters of a sequencing batch reactor for nitrogen removal from urine were monitored over a 1.5-year period. Microbial community fingerprinting (automated ribosomal intergenic spacer analysis), 16S rRNA gene sequencing, and quantitative PCR on nitrogen cycle functional groups were used to characterize the microbial population. The reactor combined nitrification (ammonium oxidation)/anammox with organoheterotrophic denitrification. The nitrogen elimination rate initially increased by 400%, followed by an extended period of performance degradation. This phase was characterized by accumulation of nitrite and nitrous oxide, reduced anammox activity, and a different but stable microbial community. Outwashing of anammox bacteria or their inhibition by oxygen or nitrite was insufficient to explain reactor behavior. Multiple lines of evidence, e.g., regime-shift analysis of chemical and physical parameters and cluster and ordination analysis of the microbial community, indicated that the system had experienced a rapid transition to a new stable state that led to the observed inferior process rates. The events in the reactor can thus be interpreted to be an ecological regime shift. Constrained ordination indicated that the pH set point controlling cycle duration, temperature, airflow rate, and the release of nitric and nitrous oxides controlled the primarily heterotrophic microbial community. We show that by combining chemical and physical measurements, microbial community analysis and ecological theory allowed extraction of useful information about the causes and dynamics of the observed process instability. PMID:21724875

  19. ACM-based automatic liver segmentation from 3-D CT images by combining multiple atlases and improved mean-shift techniques.

    PubMed

    Ji, Hongwei; He, Jiangping; Yang, Xin; Deklerck, Rudi; Cornelis, Jan

    2013-05-01

    In this paper, we present an autocontext model(ACM)-based automatic liver segmentation algorithm, which combines ACM, multiatlases, and mean-shift techniques to segment liver from 3-D CT images. Our algorithm is a learning-based method and can be divided into two stages. At the first stage, i.e., the training stage, ACM is performed to learn a sequence of classifiers in each atlas space (based on each atlas and other aligned atlases). With the use of multiple atlases, multiple sequences of ACM-based classifiers are obtained. At the second stage, i.e., the segmentation stage, the test image will be segmented in each atlas space by applying each sequence of ACM-based classifiers. The final segmentation result will be obtained by fusing segmentation results from all atlas spaces via a multiclassifier fusion technique. Specially, in order to speed up segmentation, given a test image, we first use an improved mean-shift algorithm to perform over-segmentation and then implement the region-based image labeling instead of the original inefficient pixel-based image labeling. The proposed method is evaluated on the datasets of MICCAI 2007 liver segmentation challenge. The experimental results show that the average volume overlap error and the average surface distance achieved by our method are 8.3% and 1.5 m, respectively, which are comparable to the results reported in the existing state-of-the-art work on liver segmentation.

  20. Associations between number of consecutive night shifts and impairment of neurobehavioral performance during a subsequent simulated night shift.

    PubMed

    Magee, Michelle; Sletten, Tracey L; Ferguson, Sally A; Grunstein, Ronald R; Anderson, Clare; Kennaway, David J; Lockley, Steven W; Rajaratnam, Shantha Mw

    2016-05-01

    This study aimed to investigate sleep and circadian phase in the relationships between neurobehavioral performance and the number of consecutive shifts worked. Thirty-four shift workers [20 men, mean age 31.8 (SD 10.9) years] worked 2-7 consecutive night shifts immediately prior to a laboratory-based, simulated night shift. For 7 days prior, participants worked their usual shift sequence, and sleep was assessed with logs and actigraphy. Participants completed a 10-minute auditory psychomotor vigilance task (PVT) at the start (~21:00 hours) and end (~07:00 hours) of the simulated night shift. Mean reaction times (RT), number of lapses and RT distribution was compared between those who worked 2-3 consecutive night shifts versus those who worked 4-7 shifts. Following 4-7 shifts, night shift workers had significantly longer mean RT at the start and end of shift, compared to those who worked 2-3 shifts. The slowest and fastest 10% RT were significantly slower at the start, but not end, of shift among participants who worked 4-7 nights. Those working 4-7 nights also demonstrated a broader RT distribution at the start and end of shift and had significantly slower RT based on cumulative distribution analysis (5 (th), 25 (th), 50 (th), 75 (th)percentiles at the start of shift; 75th percentile at the end of shift). No group differences in sleep parameters were found for 7 days and 24 hours prior to the simulated night shift. A greater number of consecutive night shifts has a negative impact on neurobehavioral performance, likely due to cognitive slowing.

  1. Counting Patterns in Degenerated Sequences

    NASA Astrophysics Data System (ADS)

    Nuel, Grégory

    Biological sequences like DNA or proteins, are always obtained through a sequencing process which might produce some uncertainty. As a result, such sequences are usually written in a degenerated alphabet where some symbols may correspond to several possible letters (ex: IUPAC DNA alphabet). When counting patterns in such degenerated sequences, the question that naturally arises is: how to deal with degenerated positions ? Since most (usually 99%) of the positions are not degenerated, it is considered harmless to discard the degenerated positions in order to get an observation, but the exact consequences of such a practice are unclear. In this paper, we introduce a rigorous method to take into account the uncertainty of sequencing for biological sequences (DNA, Proteins). We first introduce a Forward-Backward approach to compute the marginal distribution of the constrained sequence and use it both to perform a Expectation-Maximization estimation of parameters, as well as deriving a heterogeneous Markov distribution for the constrained sequence. This distribution is hence used along with known DFA-based pattern approaches to obtain the exact distribution of the pattern count under the constraints. As an illustration, we consider a EST dataset from the EMBL database. Despite the fact that only 1% of the positions in this dataset are degenerated, we show that not taking into account these positions might lead to erroneous observations, further proving the interest of our approach.

  2. Direct measurement of the Goos-Hänchen shift using a scanning quadrant detector and a polarization maintaining fiber.

    PubMed

    Yallapragada, Venkata Jayasurya; Mulay, Gajendra L; Rao, Ch N; Ravishankar, Ajith P; Achanta, Venu Gopal

    2016-10-01

    High precision measurements of optical beam shifts are important in various fields including sensing, atomic force microscopy, and measuring beam shifts at interfaces. Sub-micron shifts are generally measured by indirect techniques such as weak measurements. We demonstrate a straightforward and robust measurement scheme for the shift, based on a scanning quadrant photodiode (QPD) that is biased using a low noise electronic circuit. The shift is measured with respect to a reference beam that is co-propagating with the signal beam. Thus, the shift of the signal beam is readout directly as the difference between the x-intercepts of the QPD scan plot of the signal and reference beams versus the position of the detector. To measure the beam shift, we use polarization multiplexing scheme where the p-polarized signal and s-polarized reference beams are modulated at two different frequencies and co-launched into a polarization-maintaining fiber. Both the signal and reference beam positions are readout by two lock-in amplifiers simultaneously. In order to demonstrate the utility of this method, we perform a direct measurement of Goos-Hänchen shift of a beam that is reflected from a plane gold surface. Accuracy of 150 nm is achieved using this technique.

  3. Direct measurement of the Goos-Hänchen shift using a scanning quadrant detector and a polarization maintaining fiber

    NASA Astrophysics Data System (ADS)

    Yallapragada, Venkata Jayasurya; Mulay, Gajendra L.; Rao, Ch. N.; Ravishankar, Ajith P.; Achanta, Venu Gopal

    2016-10-01

    High precision measurements of optical beam shifts are important in various fields including sensing, atomic force microscopy, and measuring beam shifts at interfaces. Sub-micron shifts are generally measured by indirect techniques such as weak measurements. We demonstrate a straightforward and robust measurement scheme for the shift, based on a scanning quadrant photodiode (QPD) that is biased using a low noise electronic circuit. The shift is measured with respect to a reference beam that is co-propagating with the signal beam. Thus, the shift of the signal beam is readout directly as the difference between the x-intercepts of the QPD scan plot of the signal and reference beams versus the position of the detector. To measure the beam shift, we use polarization multiplexing scheme where the p-polarized signal and s-polarized reference beams are modulated at two different frequencies and co-launched into a polarization-maintaining fiber. Both the signal and reference beam positions are readout by two lock-in amplifiers simultaneously. In order to demonstrate the utility of this method, we perform a direct measurement of Goos-Hänchen shift of a beam that is reflected from a plane gold surface. Accuracy of 150 nm is achieved using this technique.

  4. Canceling the Gravity Gradient Phase Shift in Atom Interferometry.

    PubMed

    D'Amico, G; Rosi, G; Zhan, S; Cacciapuoti, L; Fattori, M; Tino, G M

    2017-12-22

    Gravity gradients represent a major obstacle in high-precision measurements by atom interferometry. Controlling their effects to the required stability and accuracy imposes very stringent requirements on the relative positioning of freely falling atomic clouds, as in the case of precise tests of Einstein's equivalence principle. We demonstrate a new method to exactly compensate the effects introduced by gravity gradients in a Raman-pulse atom interferometer. By shifting the frequency of the Raman lasers during the central π pulse, it is possible to cancel the initial position- and velocity-dependent phase shift produced by gravity gradients. We apply this technique to simultaneous interferometers positioned along the vertical direction and demonstrate a new method for measuring local gravity gradients that does not require precise knowledge of the relative position between the atomic clouds. Based on this method, we also propose an improved scheme to determine the Newtonian gravitational constant G towards the 10 ppm relative uncertainty.

  5. Canceling the Gravity Gradient Phase Shift in Atom Interferometry

    NASA Astrophysics Data System (ADS)

    D'Amico, G.; Rosi, G.; Zhan, S.; Cacciapuoti, L.; Fattori, M.; Tino, G. M.

    2017-12-01

    Gravity gradients represent a major obstacle in high-precision measurements by atom interferometry. Controlling their effects to the required stability and accuracy imposes very stringent requirements on the relative positioning of freely falling atomic clouds, as in the case of precise tests of Einstein's equivalence principle. We demonstrate a new method to exactly compensate the effects introduced by gravity gradients in a Raman-pulse atom interferometer. By shifting the frequency of the Raman lasers during the central π pulse, it is possible to cancel the initial position- and velocity-dependent phase shift produced by gravity gradients. We apply this technique to simultaneous interferometers positioned along the vertical direction and demonstrate a new method for measuring local gravity gradients that does not require precise knowledge of the relative position between the atomic clouds. Based on this method, we also propose an improved scheme to determine the Newtonian gravitational constant G towards the 10 ppm relative uncertainty.

  6. Poster - Thur Eve - 26: Interfraction reproducibility of heart position during breast irradiation using Active Breathing Control.

    PubMed

    Comsa, D; Zhang, B; Mosely, D; Yeung, I

    2012-07-01

    The moderate deep-inspiration breath hold (mDIBH) technique using the Active Breathing Coordinator (ABC) from Elekta is used in our clinic to lower the heart dose during left breast irradiations. The purpose of this work was to investigate the interfraction reproducibility of the heart to chest distance during these treatments and to evaluate the dosimetric effect of any changes in the heart position. Daily CBCT images were available for 5 patients who had been treated with ABC tangents and a cavity boost. On these images, one-dimensional measurements of the distance between the heart and the chest wall were taken at two anatomical locations corresponding roughly with the location where the radiation field most likely intercepts the heart. The average change in this distance was interpreted as a shift of the heart position. To assess the effect of this shift on the delivered heart dose, the heart contours in the clinical plans of the corresponding patients were shifted towards the treatment field using standard Pinnacle tools. Although the ABC device allows good reproducibility of the volume of air held, this does not warrant reproducibility of heart position for all patients during treatment. The largest average heart shift extracted from CBCT images in this study was 6.2mm. The heart dose reconstructed using this shift for the corresponding patient also showed the largest effect. However, even in the presence of a systematic heart shift of this magnitude, the ABC plan still showed superior heart dose reduction compared to the free-breathing plan. © 2012 American Association of Physicists in Medicine.

  7. Audiovisual temporal recalibration: space-based versus context-based.

    PubMed

    Yuan, Xiangyong; Li, Baolin; Bi, Cuihua; Yin, Huazhan; Huang, Xiting

    2012-01-01

    Recalibration of perceived simultaneity has been widely accepted to minimise delay between multisensory signals owing to different physical and neural conduct times. With concurrent exposure, temporal recalibration is either contextually or spatially based. Context-based recalibration was recently described in detail, but evidence for space-based recalibration is scarce. In addition, the competition between these two reference frames is unclear. Here, we examined participants who watched two distinct blob-and-tone couples that laterally alternated with one asynchronous and the other synchronous and then judged their perceived simultaneity and sequence when they swapped positions and varied in timing. For low-level stimuli with abundant auditory location cues space-based aftereffects were significantly more apparent (8.3%) than context-based aftereffects (4.2%), but without such auditory cues space-based aftereffects were less apparent (4.4%) and were numerically smaller than context-based aftereffects (6.0%). These results suggested that stimulus level and auditory location cues were both determinants of the recalibration frame. Through such joint judgments and the simple reaction time task, our results further revealed that criteria from perceived simultaneity to successiveness profoundly shifted without accompanying perceptual latency changes across adaptations, hence implying that criteria shifts, rather than perceptual latency changes, accounted for space-based and context-based temporal recalibration.

  8. L alpha, L beta /of H I/, K and H /of MG II/, K and H /of CA II/ observations in a quiescent prominence with the OSO-8 LPSP instrument

    NASA Astrophysics Data System (ADS)

    Vial, J. C.; Martres, M. J.; Salm-Platzer, J.

    1981-04-01

    A sequence of images taken at different positions in the resonance lines of Ca II, Mg II, and H I was obtained over a quiescent prominence with the LPSP instrument on OSO-8. Ca II K (and H) profiles are reconstructed at different locations in the prominence with a (10 × 5) arc sec2 resolution. Significant variations of FWHM and line shifts are found: FWHM range from 0.14 Å to 0.5 Å; blue shifts reach about 14 km s-1. The ratio of K to H absolute intensities shows a large spread around the average value of 1.2. The same ratio for the Mg II lines in the whole prominence is higher (1.7), a fact already noticed at the edge of an active prominence (Vial et al., 1979). The ionization degree, as measured by the Lα/Ca K ratio, shows noticeable variations within the prominence. The La intensity is about 0.3 times the intensity measured in the quiet Sun, and the Lα/Lβ ratio is less than one half the disk value. These results indicate important variations of the thermal conditions inside the prominence.

  9. The influence of context boundaries on memory for the sequential order of events.

    PubMed

    DuBrow, Sarah; Davachi, Lila

    2013-11-01

    Episodic memory allows people to reexperience the past by recovering the sequences of events that characterize those prior experiences. Although experience is continuous, people are able to selectively retrieve and reexperience more discrete episodes from their past, raising the possibility that some elements become tightly related to each other in memory, whereas others do not. The current series of experiments was designed to ask how shifts in context during an experience influence how people remember the past. Specifically, we asked how context shifts influence the ability to remember the relative order of past events, a hallmark of episodic memory. We found that memory for the order of events was enhanced within, rather than across, context shifts, or boundaries (Experiment 1). Next, we showed that this relative enhancement in order memory was eliminated when across-item associative processing was disrupted (Experiment 2), suggesting that context shifts have a selective effect on sequential binding. Finally, we provide evidence that the act of making order memory judgments involves the reactivation of representations that bridged the tested items (Experiment 3). Together, these data suggest that boundaries may serve to parse continuous experience into sequences of contextually related events and that this organization facilitates remembering the temporal order of events that share the same context. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  10. Intrafractional Baseline Shift or Drift of Lung Tumor Motion During Gated Radiation Therapy With a Real-Time Tumor-Tracking System

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takao, Seishin; Miyamoto, Naoki; Matsuura, Taeko

    2016-01-01

    Purpose: To investigate the frequency and amplitude of baseline shift or drift (shift/drift) of lung tumors in stereotactic body radiation therapy (SBRT), using a real-time tumor-tracking radiation therapy (RTRT) system. Methods and Materials: Sixty-eight patients with peripheral lung tumors were treated with SBRT using the RTRT system. One of the fiducial markers implanted near the tumor was used for the real-time monitoring of the intrafractional tumor motion every 0.033 seconds by the RTRT system. When baseline shift/drift is determined by the system, the position of the treatment couch is adjusted to compensate for the shift/drift. Therefore, the changes in the couch positionmore » correspond to the baseline shift/drift in the tumor motion. The frequency and amount of adjustment to the couch positions in the left-right (LR), cranio-caudal (CC), and antero-posterior (AP) directions have been analyzed for 335 fractions administered to 68 patients. Results: The average change in position of the treatment couch during the treatment time was 0.45 ± 2.23 mm (mean ± standard deviation), −1.65 ± 5.95 mm, and 1.50 ± 2.54 mm in the LR, CC, and AP directions, respectively. Overall the baseline shift/drift occurs toward the cranial and posterior directions. The incidence of baseline shift/drift exceeding 3 mm was 6.0%, 15.5%, 14.0%, and 42.1% for the LR, CC, AP, and for the square-root of sum of 3 directions, respectively, within 10 minutes of the start of treatment, and 23.0%, 37.6%, 32.5%, and 71.6% within 30 minutes. Conclusions: Real-time monitoring and frequent adjustments of the couch position and/or adding appropriate margins are suggested to be essential to compensate for possible underdosages due to baseline shift/drift in SBRT for lung cancers.« less

  11. Discovery of T Cell Receptor β Motifs Specific to HLA-B27-Positive Ankylosing Spondylitis by Deep Repertoire Sequence Analysis.

    PubMed

    Faham, Malek; Carlton, Victoria; Moorhead, Martin; Zheng, Jianbiao; Klinger, Mark; Pepin, Francois; Asbury, Thomas; Vignali, Marissa; Emerson, Ryan O; Robins, Harlan S; Ireland, James; Baechler-Gillespie, Emily; Inman, Robert D

    2017-04-01

    Ankylosing spondylitis (AS), a chronic inflammatory disorder, has a notable association with HLA-B27. One hypothesis suggests that a common antigen that binds to HLA-B27 is important for AS disease pathogenesis. This study was undertaken to determine sequences and motifs that are shared among HLA-B27-positive AS patients, using T cell repertoire next-generation sequencing. To identify motifs enriched among B27-positive AS patients, we performed T cell receptor β (TCRβ) repertoire sequencing on samples from 191 B27-positive AS patients, 43 B27-negative AS patients, and 227 controls, and we obtained >77 million TCRβ clonotype sequences. First, we assessed whether any of 50 previously published sequences were enriched in B27-positive AS patients. We then used training and test cohorts to identify discovered motifs that were enriched in B27-positive AS patients versus controls. Six previously published and 11 discovered motifs were enriched in the B27-positive AS samples as compared to controls. After combining motifs related by sequence, we identified a total of 15 independent motifs. Both the full set of 15 motifs and a set of 6 published motifs were enriched in the B27-positive AS patients as compared to B27-positive healthy individuals (P = 0.049 and P = 0.001, respectively). Using an independent cohort, we validated that at least some of these motifs were associated with AS, and not simply with B27-positive status. We identified TCRβ motifs that are enriched in B27-positive AS patients as compared to B27-positive healthy controls. This suggests that a common antigen, presented by HLA-B27 and detected by CD8+ T cells, may be associated with AS disease pathogenesis. © 2016, American College of Rheumatology.

  12. Contributory role of the tongue and mandible in modulating the in-mouth air cavity at rest.

    PubMed

    Bourdiol, Pierre; Mishellany-Dutour, Anne; Peyron, Marie-Agnes; Woda, Alain

    2013-12-01

    The tongue-to-palate distance influences the volume of the in-mouth air cavity (IMAC), thus conditioning the entry of aromatic compounds to the olfactory mucosa site. This study was set out to record the IMAC volume by measuring tongue-to-palate distance at rest. Twelve young adults in good general health were tested--lips contacting, with at-rest posture of the tongue and jaw during a silent reading task. Observations in this study were limited to pre- and post-swallowing sequences. The tongue-to-palate distance was measured using three electromagnetic sensors placed on the tongue upper surface. IMAC volume was evaluated from a geometrical model, taking into account the tongue-to-palate distance, the IMAC transversal distance measured from dental casts and historic data giving the anterior-posterior distance of the oral cavity. (1) In the at-rest posture, the tongue-to-palate distance was significantly greater at the posterior sensor level. (2) A vertical shift in tongue posture at rest frequently appeared following deglutition. The upward shifts were of larger amplitude and more frequent than the downward shifts. (3) Evaluation of the IMAC volume gave an approximate value of 12 ml at rest. (4) The chin sensor at rest was 2.8 ± 0.8 mm below its position when in occlusion. The tongue and mandible contribute to shaping the IMAC volume. These and other results suggest that deglutition changes tongue-to-palate distance and influences aroma release during mastication/deglutition acts through modulation of the IMAC volume.

  13. Bulk and Rhizosphere Soil Bacterial Communities Studied by Denaturing Gradient Gel Electrophoresis: Plant-Dependent Enrichment and Seasonal Shifts Revealed

    PubMed Central

    Smalla, K.; Wieland, G.; Buchner, A.; Zock, A.; Parzy, J.; Kaiser, S.; Roskot, N.; Heuer, H.; Berg, G.

    2001-01-01

    The bacterial rhizosphere communities of three host plants of the pathogenic fungus Verticillium dahliae, field-grown strawberry (Fragaria ananassa Duch.), oilseed rape (Brassica napus L.), and potato (Solanum tuberosum L.), were analyzed. We aimed to determine the degree to which the rhizosphere effect is plant dependent and whether this effect would be increased by growing the same crops in two consecutive years. Rhizosphere or soil samples were taken five times over the vegetation periods. To allow a cultivation-independent analysis, total community DNA was extracted from the microbial pellet recovered from root or soil samples. 16S rDNA fragments amplified by PCR from soil or rhizosphere bacterium DNA were analyzed by denaturing gradient gel electrophoresis (DGGE). The DGGE fingerprints showed plant-dependent shifts in the relative abundance of bacterial populations in the rhizosphere which became more pronounced in the second year. DGGE patterns of oilseed rape and potato rhizosphere communities were more similar to each other than to the strawberry patterns. In both years seasonal shifts in the abundance and composition of the bacterial rhizosphere populations were observed. Independent of the plant species, the patterns of the first sampling times for both years were characterized by the absence of some of the bands which became dominant at the following sampling times. Bacillus megaterium and Arthrobacter sp. were found as predominant populations in bulk soils. Sequencing of dominant bands excised from the rhizosphere patterns revealed that 6 out of 10 bands resembled gram-positive bacteria. Nocardia populations were identified as strawberry-specific bands. PMID:11571180

  14. Rotating shift work associated with obesity in men from northeastern Ontario

    PubMed Central

    Anne, Grundy; Michelle, Cotterchio; Victoria A., Kirsh; Victoria, Nadalin; Nancy, Lightfoot; Loretta, Ryan; Nancy, Kreiger

    2017-01-01

    Abstract Introduction: While some studies have suggested associations between shift work and obesity, few have been population-based or considered multiple shift schedules. Since obesity is linked with several chronic health conditions, understanding which types of shift work influence obesity is important and additional work with more detailed exposure assessment of shift work is warranted. Methods: Using multivariate polytomous logistic regression, we investigated the associations between shift work (evening/night, rotating and other shift schedules) and overweight and obesity as measured by body mass index cross-sectionally among 1561 men. These men had previously participated as population controls in a prostate cancer case-control study conducted in northeastern Ontario from 1995 to 1999. We obtained information on work history (including shift work), height and weight from the existing self-reported questionnaire data. Results: We observed an association for ever (vs. never) having been employed in rotating shift work for both the overweight (OR [odds ratio] = 1.34; 95% CI [confidence interval]: 1.05–1.73) and obese (OR = 1.57; 95% CI: 1.12–2.21) groups. We also observed nonsignificant associations for ever (vs. never) having been employed in permanent evening/night shifts. In addition, we found a significant trend of increased risk for both overweight and obesity with increasing duration of rotating shift work. Conclusion: Both the positive association between rotating shift work and obesity and the suggested positive association for permanent evening/night shift work in this study are consistent with previous findings. Future population-based research that is able to build on our results while examining additional shift work characteristics will further clarify whether some shift patterns have a greater impact on obesity than others. PMID:28800293

  15. Rotating shift work associated with obesity in men from northeastern Ontario.

    PubMed

    Grundy, Anne; Cotterchio, Michelle; Kirsh, Victoria A; Nadalin, Victoria; Lightfoot, Nancy; Kreiger, Nancy

    2017-08-01

    While some studies have suggested associations between shift work and obesity, few have been population-based or considered multiple shift schedules. Since obesity is linked with several chronic health conditions, understanding which types of shift work influence obesity is important and additional work with more detailed exposure assessment of shift work is warranted. Using multivariate polytomous logistic regression, we investigated the associations between shift work (evening/night, rotating and other shift schedules) and overweight and obesity as measured by body mass index cross-sectionally among 1561 men. These men had previously participated as population controls in a prostate cancer case-control study conducted in northeastern Ontario from 1995 to 1999. We obtained information on work history (including shift work), height and weight from the existing self-reported questionnaire data. We observed an association for ever (vs. never) having been employed in rotating shift work for both the overweight (OR [odds ratio] = 1.34; 95% CI [confidence interval]: 1.05-1.73) and obese (OR = 1.57; 95% CI: 1.12-2.21) groups. We also observed nonsignificant associations for ever (vs. never) having been employed in permanent evening/night shifts. In addition, we found a significant trend of increased risk for both overweight and obesity with increasing duration of rotating shift work. Both the positive association between rotating shift work and obesity and the suggested positive association for permanent evening/night shift work in this study are consistent with previous findings. Future population-based research that is able to build on our results while examining additional shift work characteristics will further clarify whether some shift patterns have a greater impact on obesity than others.

  16. A canonical correlation analysis based EMG classification algorithm for eliminating electrode shift effect.

    PubMed

    Zhe Fan; Zhong Wang; Guanglin Li; Ruomei Wang

    2016-08-01

    Motion classification system based on surface Electromyography (sEMG) pattern recognition has achieved good results in experimental condition. But it is still a challenge for clinical implement and practical application. Many factors contribute to the difficulty of clinical use of the EMG based dexterous control. The most obvious and important is the noise in the EMG signal caused by electrode shift, muscle fatigue, motion artifact, inherent instability of signal and biological signals such as Electrocardiogram. In this paper, a novel method based on Canonical Correlation Analysis (CCA) was developed to eliminate the reduction of classification accuracy caused by electrode shift. The average classification accuracy of our method were above 95% for the healthy subjects. In the process, we validated the influence of electrode shift on motion classification accuracy and discovered the strong correlation with correlation coefficient of >0.9 between shift position data and normal position data.

  17. A novel phase retrieval method from three-wavelength in-line phase-shifting interferograms based on positive negative 2π phase shifts

    NASA Astrophysics Data System (ADS)

    Xu, Xiaoqing; Wang, Yawei; Ji, Ying; Xu, Yuanyuan; Xie, Ming

    2018-01-01

    A new method to extract quantitative phases for each wavelength from three-wavelength in-line phase-shifting interferograms is proposed. Firstly, seven interferograms with positive negative 2π phase shifts are sequentially captured by using the phase-shifting technique. Secondly, six dc-term suppressed intensities can be achieved by the use of the algebraic algorithm. Finally, the wrapped phases at the three wavelengths can be acquired simultaneously from these six interferograms add-subtracting by employing the trigonometric function method. The surface morphology with increased ambiguity-free range at synthetic beat wavelength can be obtained, while maintaining the low noise precision of the single wavelength measurement, by combining this method with three-wavelength phase unwrapping method. We illustrate the principle of this algorithm, and the simulated experiments of the spherical cap and the HeLa cell are conducted to prove our proposed method, respectively.

  18. Physics behind the mechanical nucleosome positioning code

    NASA Astrophysics Data System (ADS)

    Zuiddam, Martijn; Everaers, Ralf; Schiessel, Helmut

    2017-11-01

    The positions along DNA molecules of nucleosomes, the most abundant DNA-protein complexes in cells, are influenced by the sequence-dependent DNA mechanics and geometry. This leads to the "nucleosome positioning code", a preference of nucleosomes for certain sequence motives. Here we introduce a simplified model of the nucleosome where a coarse-grained DNA molecule is frozen into an idealized superhelical shape. We calculate the exact sequence preferences of our nucleosome model and find it to reproduce qualitatively all the main features known to influence nucleosome positions. Moreover, using well-controlled approximations to this model allows us to come to a detailed understanding of the physics behind the sequence preferences of nucleosomes.

  19. An intuitive graphical webserver for multiple-choice protein sequence search.

    PubMed

    Banky, Daniel; Szalkai, Balazs; Grolmusz, Vince

    2014-04-10

    Every day tens of thousands of sequence searches and sequence alignment queries are submitted to webservers. The capitalized word "BLAST" becomes a verb, describing the act of performing sequence search and alignment. However, if one needs to search for sequences that contain, for example, two hydrophobic and three polar residues at five given positions, the query formation on the most frequently used webservers will be difficult. Some servers support the formation of queries with regular expressions, but most of the users are unfamiliar with their syntax. Here we present an intuitive, easily applicable webserver, the Protein Sequence Analysis server, that allows the formation of multiple choice queries by simply drawing the residues to their positions; if more than one residue are drawn to the same position, then they will be nicely stacked on the user interface, indicating the multiple choice at the given position. This computer-game-like interface is natural and intuitive, and the coloring of the residues makes possible to form queries requiring not just certain amino acids in the given positions, but also small nonpolar, negatively charged, hydrophobic, positively charged, or polar ones. The webserver is available at http://psa.pitgroup.org. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Discovering frequently recurring movement sequences in team-sport athlete spatiotemporal data.

    PubMed

    Sweeting, Alice J; Aughey, Robert J; Cormack, Stuart J; Morgan, Stuart

    2017-12-01

    Athlete external load is typically analysed from predetermined movement thresholds. The combination of movement sequences and differences in these movements between playing positions is also currently unknown. This study developed a method to discover the frequently recurring movement sequences across playing position during matches. The external load of 12 international female netball athletes was collected by a local positioning system during four national-level matches. Velocity, acceleration and angular velocity were calculated from positional (X, Y) data, clustered via one-dimensional k-means and assigned a unique alphabetic label. Combinations of velocity, acceleration and angular velocity movement were compared using the Levenshtein distance and similarities computed by the longest common substring problem. The contribution of each movement sequence, according to playing position and relative to the wider data set, was then calculated via the Minkowski distance. A total of 10 frequently recurring combinations of movement were discovered, regardless of playing position. Only the wing attack, goal attack and goal defence playing positions are closely related. We developed a technique to discover the movement sequences, according to playing position, performed by elite netballers. This methodology can be extended to discover the frequently recurring movements within other team sports and across levels of competition.

  1. Positive focal shift of gallium nitride high contrast grating focusing reflectors

    NASA Astrophysics Data System (ADS)

    He, Shumin; Wang, Zhenhai; Liu, Qifa

    2016-09-01

    We design a type of metasurfaces capable of serving as a visible-light focusing reflector based on gallium nitride (GaN) high contrast gratings (HCGs). The wavefront of the reflected light is precisely manipulated by spatial variation of the grating periods along the subwavelength ridge array to achieve light focusing. Different from conventional negative focal shift effect, a positive focal shift is observed in such focusing reflectors. Detailed investigations of the influence of device size on the focusing performance, especially the focal length, are preformed via a finite element method . The results show that all performance parameters are greatly affected by the reflector size. A more concentrated focal point, or a better focusing capability, can be achieved by larger size. With increasing reflector size, the achieved focal length decreases and gradually approaches to the design, thus the corresponding positive focal shift decreases. Our results are helpful for understanding the visible-light control of the planar HCG-based focusing reflectors.

  2. Asymmetric binding of histone H1 stabilizes MMTV nucleosomes and the interaction of progesterone receptor with the exposed HRE.

    PubMed

    Vicent, Guillermo P; Meliá, María J; Beato, Miguel

    2002-11-29

    Packaging of mouse mammary tumor virus (MMTV) promoter sequences in nucleosomes modulates access of DNA binding proteins and influences the interaction among DNA bound transcription factors. Here we analyze the binding of histone H1 to MMTV mononucleosomes assembled with recombinant histones and study its influence on nucleosome structure and stability as well as on progesterone receptor (PR) binding to the hormone responsive elements (HREs). The MMTV nucleosomes can be separated into three main populations, two of which exhibited precise translational positioning. Histone H1 bound preferentially to the 5' distal nucleosomal DNA protecting additional 27-28 nt from digestion by micrococcal nuclease. Binding of histone H1 was unaffected by prior crosslinking of protein and DNA in nucleosomes with formaldehyde. Neither the translational nor the rotational nucleosome positioning was altered by histone H1 binding, but the nucleosomes were stabilized as judged by the kinetics of nuclease cleavage. Unexpectedly, binding of recombinant PR to the exposed distal HRE-I in nucleosomes was enhanced in the presence of histone H1, as demonstrated by band shift and footprinting experiments. This enhanced PR affinity may contribute to the reported positive effect of histone H1 on the hormonal activation of MMTV reporter genes.

  3. The impact of alcohol-related presentations on a New Zealand hospital emergency department.

    PubMed

    Stewart, Rebecca; Das, Manidipa; Ardagh, Michael; Deely, Joanne M; Dodd, Stuart; Bartholomew, Nadia; Pearson, Scott; Spearing, Ruth; Williams, Tracey; Than, Martin

    2014-08-29

    To determine the impact of alcohol-related presentations on the Christchurch Hospital Emergency Department (ED). Over 42 8-hour shifts (2 weeks) between 15 November 2013 and 9 December 2013, patients attending the ED with recent alcohol consumption were classified as screen-positive (consumed alcohol in the 4 hours prior to presentation) or not. A subset of screen-positive patients was classified as impact-positive (alcohol consumption clearly contributed to the reason for presenting). Data were analysed in relation to days/shifts for gender, age, disruptive behaviour, medical reasons for presenting, and completeness of ED records. Of the 3619 patients screened in the study, 268 (7.4%) and 182 (5%) were screen-positive and impact-positive, respectively. Most patients attended the ED on the weekends (58%: 105/182), particularly on Saturday night (31%; 56/182). More males (118) than females (64) were impact-positive. Of the impact-positive males, most were 16-25 years old (37%; 44/118) or 41-61 years old (32%; 38/118), attended the ED on weekend night shifts (24%; 28/118), and sought treatment for non- interpersonal trauma (38%; 45/118) or interpersonal trauma due to violence (17%; 20/118). Of the female impact-positive patients, most were 16-25 years old (41%; 26/64) or 41-60 years old (33%; 21/64), and presented for deliberate self-harm (36%; 23/64) or non-interpersonal trauma (27%; 17/64). Of the 182 impact-positive patients, 86% (156) were recorded in the ED computer system. Alcohol-related presentations had a significant impact on the ED, particularly on weekends. Teenagers, young adults and middle-aged adults contributed to the alcohol-related patient impact on weekends. Male patients were a significant burden on Saturday evening and night shifts.

  4. miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

    PubMed Central

    Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

    2015-01-01

    RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

  5. Investigation of FANCA gene in Fanconi anaemia patients in Iran

    PubMed Central

    Saffar Moghadam, Ali Akbar; Mahjoubi, Frouzandeh; Reisi, Nahid; Vosough, Parvaneh

    2016-01-01

    Background & objectives: Fanconi anaemia (FA) is a syndrome with a predisposition to bone marrow failure, congenital anomalies and malignancies. It is characterized by cellular hypersensitivity to cross-linking agents such as mitomycin C (MMC). In the present study, a new approach was selected to investigate FANCA (Fanconi anaemia complementation group A) gene in patients clinically diagnosed with cellular hypersensitivity to DNA cross-linking agent MMC. Methods: Chromosomal breakage analysis was performed to prove the diagnosis of Fanconi anaemia in 318 families. Of these, 70 families had a positive result. Forty families agreed to molecular genetic testing. In total, there were 27 patients with unknown complementary types. Genomic DNA was extracted and total RNA was isolated from fresh whole blood of the patients. The first-strand cDNA was synthesized and the cDNA of each patient was then tested with 21 pairs of overlapping primers. High resolution melting curve analysis was used to screen FANCA, and LinReg software version 1.7 was utilized for analysis of expression. Results: In total, six sequence alterations were identified, which included two stop codons, two frames-shift mutations, one large deletion and one amino acid exchange. FANCA expression was downregulated in patients who had sequence alterations. Interpretation & conclusions: The results of the present study show that high resolution melting (HRM) curve analysis may be useful in the detection of sequence alteration. It is simpler and more costeffective than the multiplex ligation-dependent probe amplification (MLPA) procedure. PMID:27121516

  6. Investigation of FANCA gene in Fanconi anaemia patients in Iran.

    PubMed

    Moghadam, Ali Akbar Saffar; Mahjoubi, Frouzandeh; Reisi, Nahid; Vosough, Parvaneh

    2016-02-01

    Fanconi anaemia (FA) is a syndrome with a predisposition to bone marrow failure, congenital anomalies and malignancies. It is characterized by cellular hypersensitivity to cross-linking agents such as mitomycin C (MMC). In the present study, a new approach was selected to investigate FANCA (Fanconi anaemia complementation group A) gene in patients clinically diagnosed with cellular hypersensitivity to DNA cross-linking agent MMC. Chromosomal breakage analysis was performed to prove the diagnosis of Fanconi anaemia in 318 families. Of these, 70 families had a positive result. Forty families agreed to molecular genetic testing. In total, there were 27 patients with unknown complementary types. Genomic DNA was extracted and total RNA was isolated from fresh whole blood of the patients. The first-strand cDNA was synthesized and the cDNA of each patient was then tested with 21 pairs of overlapping primers. High resolution melting curve analysis was used to screen FANCA, and LinReg software version 1.7 was utilized for analysis of expression. In total, six sequence alterations were identified, which included two stop codons, two frames-shift mutations, one large deletion and one amino acid exchange. FANCA expression was downregulated in patients who had sequence alterations. The results of the present study show that high resolution melting (HRM) curve analysis may be useful in the detection of sequence alteration. It is simpler and more cost-effective than the multiplex ligation-dependent probe amplification (MLPA) procedure.

  7. Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene.

    PubMed

    Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

    2014-01-01

    Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband's leukocytes. DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5' splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia.

  8. Seven New Complete Plastome Sequences Reveal Rampant Independent Loss of the ndh Gene Family across Orchids and Associated Instability of the Inverted Repeat/Small Single-Copy Region Boundaries.

    PubMed

    Kim, Hyoung Tae; Kim, Jung Sung; Moore, Michael J; Neubig, Kurt M; Williams, Norris H; Whitten, W Mark; Kim, Joo-Hwan

    2015-01-01

    Earlier research has revealed that the ndh loci have been pseudogenized, truncated, or deleted from most orchid plastomes sequenced to date, including in all available plastomes of the two most species-rich subfamilies, Orchidoideae and Epidendroideae. This study sought to resolve deeper-level phylogenetic relationships among major orchid groups and to refine the history of gene loss in the ndh loci across orchids. The complete plastomes of seven orchids, Oncidium sphacelatum (Epidendroideae), Masdevallia coccinea (Epidendroideae), Sobralia callosa (Epidendroideae), Sobralia aff. bouchei (Epidendroideae), Elleanthus sodiroi (Epidendroideae), Paphiopedilum armeniacum (Cypripedioideae), and Phragmipedium longifolium (Cypripedioideae) were sequenced and analyzed in conjunction with all other available orchid and monocot plastomes. Most ndh loci were found to be pseudogenized or lost in Oncidium, Paphiopedilum and Phragmipedium, but surprisingly, all ndh loci were found to retain full, intact reading frames in Sobralia, Elleanthus and Masdevallia. Character mapping suggests that the ndh genes were present in the common ancestor of orchids but have experienced independent, significant losses at least eight times across four subfamilies. In addition, ndhF gene loss was correlated with shifts in the position of the junction of the inverted repeat (IR) and small single-copy (SSC) regions. The Orchidaceae have unprecedented levels of homoplasy in ndh gene presence/absence, which may be correlated in part with the unusual life history of orchids. These results also suggest that ndhF plays a role in IR/SSC junction stability.

  9. Motor vehicle seat belt restraint system analysis during rollover.

    PubMed

    Meyer, Steven E; Hock, Davis; Forrest, Stephen; Herbst, Brian; Sances, Anthony; Kumaresan, Srirangam

    2003-01-01

    The multi-planar and multiple impact long duration accident sequence of a real world rollover results in multidirectional vehicle acceleration pulses and multiplanar occupant motions not typically seen in a planar crash sequence. Various researchers have documented that, while contemporary production emergency locking seatbelt retractors (ELRs) have been found to be extremely effective in the planar crashes in which they are extensively evaluated, when subjected to multi-planar acceleration environments their response may be different than expected. Specifically, accelerations in the vertical plane have been shown to substantially affect the timeliness of the retractors inertial sensor moving out of its neutral position and locking the seat belt. An analysis of the vehicle occupant motions relative to the acceleration pulses sensed at the retractor location indicates a time phase shift that, under certain circumstances, can result in unexpected seat belt spool out and occupant excursions in these multi-planar, multiple impact crash sequences. This paper will review the various previous studies focusing on the retractors response to these multidirectional, including vertical, acceleration environments and review statistical studies based upon U.S. government collected data indicating a significant difference in belt usage rates in rollover accidents as compared to all other planar accident modes. A significant number of real world accident case studies will be reviewed wherein the performance of ELR equipped seatbelt systems spooled out. Finally, the typical occupant injury and the associated mechanism due to belt spool out in real world accidents will be delineated.

  10. Plastid Phylogenomics Resolve Deep Relationships among Eupolypod II Ferns with Rapid Radiation and Rate Heterogeneity

    PubMed Central

    Wei, Ran; Yan, Yue-Hong; Harris, AJ; Kang, Jong-Soo; Shen, Hui; Zhang, Xian-Chun

    2017-01-01

    Abstract The eupolypods II ferns represent a classic case of evolutionary radiation and, simultaneously, exhibit high substitution rate heterogeneity. These factors have been proposed to contribute to the contentious resolutions among clades within this fern group in multilocus phylogenetic studies. We investigated the deep phylogenetic relationships of eupolypod II ferns by sampling all major families and using 40 plastid genomes, or plastomes, of which 33 were newly sequenced with next-generation sequencing technology. We performed model-based analyses to evaluate the diversity of molecular evolutionary rates for these ferns. Our plastome data, with more than 26,000 informative characters, yielded good resolution for deep relationships within eupolypods II and unambiguously clarified the position of Rhachidosoraceae and the monophyly of Athyriaceae. Results of rate heterogeneity analysis revealed approximately 33 significant rate shifts in eupolypod II ferns, with the most heterogeneous rates (both accelerations and decelerations) occurring in two phylogenetically difficult lineages, that is, the Rhachidosoraceae–Aspleniaceae and Athyriaceae clades. These observations support the hypothesis that rate heterogeneity has previously constrained the deep phylogenetic resolution in eupolypods II. According to the plastome data, we propose that 14 chloroplast markers are particularly phylogenetically informative for eupolypods II both at the familial and generic levels. Our study demonstrates the power of a character-rich plastome data set and high-throughput sequencing for resolving the recalcitrant lineages, which have undergone rapid evolutionary radiation and dramatic changes in substitution rates. PMID:28854625

  11. Complex Transcriptional Control of the Antibiotic Regulator afsS in Streptomyces: PhoP and AfsR Are Overlapping, Competitive Activators▿

    PubMed Central

    Santos-Beneit, Fernando; Rodríguez-García, Antonio; Martín, Juan F.

    2011-01-01

    The afsS gene of several Streptomyces species encodes a small sigma factor-like protein that acts as an activator of several pathway-specific regulatory genes (e.g., actII-ORF4 and redD in Streptomyces coelicolor). The two pleiotropic regulators AfsR and PhoP bind to overlapping sequences in the −35 region of the afsS promoter and control its expression. Using mutated afsS promoters containing specific point mutations in the AfsR and PhoP binding sequences, we proved that the overlapping recognition sequences for AfsR and PhoP are displaced by 1 nucleotide. Different nucleotide positions are important for binding of AfsR or PhoP, as shown by electrophoretic mobility shift assays and by reporter studies using the luxAB gene coupled to the different promoters. Mutant promoter M5 (with a nucleotide change at position 5 of the consensus box) binds AfsR but not PhoP with high affinity (named “superAfsR”). Expression of the afsS gene from this promoter led to overproduction of actinorhodin. Mutant promoter M16 binds PhoP with extremely high affinity (“superPhoP”). Studies with ΔafsR and ΔphoP mutants (lacking AfsR and PhoP, respectively) showed that both global regulators are competitive transcriptional activators of afsS. AfsR has greater influence on expression of afsS than PhoP, as shown by reverse transcriptase PCR (RT-PCR) and promoter reporter (luciferase) studies. These two high-level regulators appear to integrate different nutritional signals (particularly phosphate limitation sensed by PhoR), S-adenosylmethionine, and other still unknown environmental signals (leading to AfsR phosphorylation) for the AfsS-mediated control of biosynthesis of secondary metabolites. PMID:21378195

  12. Molecular characterization of hepatitis A virus strains in a tertiary care health set up in north western India.

    PubMed

    Singh, Mini Pritam; Majumdar, Manasi; Thapa, Babu Ram; Gupta, Puneet Kumar; Khurana, Jasmine; Budhathoki, Bimal; Ratho, Radha Kanta

    2015-02-01

    Hepatitis A virus usually causes acute viral hepatitis (AVH) in the paediatric age group with a recent shift in age distribution and disease manifestations like acute liver failure (ALF). This has been attributed to mutations in 5'non-translated region (5'NTR) which affects the viral multiplication. The present study was aimed to carry out the molecular detection and phylogenetic analysis of hepatitis A virus strains circulating in north western India. Serum samples from in patients and those attending out patient department of Pediatric Gastroenterology in a tertiary care hospital in north India during 2007-2011 with clinically suspected AVH were tested for anti-hepatitis A virus (HAV) IgM antibodies. Acute phase serum samples were subjected to nested PCR targeting the 5'NTR region followed by sequencing of the representative strains. A total of 1334 samples were tested, 290 (21.7%) were positive for anti-HAV IgM antibody. Of these, 78 serum samples (< 7 days old) were subjected to PCR and 47.4% (37/78) samples showed the presence of HAV RNA. Children < 15 yr of age accounted for majority (94%) of cases with highest seropositivity during rainy season. Sequencing of 15 representative strains was carried out and the circulating genotype was found to be III A. The nucleotide sequences showed high homology among the strains with a variation ranging from 0.1-1 per cent over the years. An important substitution of G to A at 324 position was shown by both AVH and ALF strains. The cumulative substitution in AVH strains Vs ALF strains as compared to GBM, Indian and prototype strain in the 200-500 region of 5' NTR was comparable. Our results showed hepatitis A still a disease of children with III A as a circulating genotype in this region. The mutations at 5'NTR region warrant further analysis as these affect the structure of internal ribosomal entry site which is important for viral replication.

  13. Evidence for positive, but not negative, behavioral contrast with wheel-running reinforcement on multiple variable-ratio schedules.

    PubMed

    Belke, Terry W; Pierce, W David

    2016-12-01

    Rats responded on a multiple variable-ratio (VR) 10 VR 10 schedule of reinforcement in which lever pressing was reinforced by the opportunity to run in a wheel for 30s in both the changed (manipulated) and unchanged components. To generate positive contrast, the schedule of reinforcement in the changed component was shifted to extinction; to generate negative contrast, the schedule was shifted to VR 3. With the shift to extinction in the changed component, wheel-running and local lever-pressing rates increased in the unchanged component, a result supporting positive contrast; however, the shift to a VR 3 schedule in the changed component showed no evidence of negative contrast in the unaltered setting, only wheel running decreased in the unchanged component. Changes in wheel-running rates across components were consistent in showing a compensation effect, depending on whether the schedule manipulation increased or decreased opportunities for wheel running in the changed component. These findings are the first to demonstrate positive behavioral contrast on a multiple schedule with wheel running as reinforcement in both components. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Emerging pathogens in the fish farming industry and sequencing-based pathogen discovery.

    PubMed

    Tengs, Torstein; Rimstad, Espen

    2017-10-01

    The use of large scale DNA/RNA sequencing has become an integral part of biomedical research. Reduced sequencing costs and the availability of efficient computational resources has led to a revolution in how problems concerning genomics and transcriptomics are addressed. Sequencing-based pathogen discovery represents one example of how genetic data can now be used in ways that were previously considered infeasible. Emerging pathogens affect both human and animal health due to a multitude of factors, including globalization, a shifting environment and an increasing human population. Fish farming represents a relevant, interesting and challenging system to study emerging pathogens. This review summarizes recent progress in pathogen discovery using sequence data, with particular emphasis on viruses in Atlantic salmon (Salmo salar). Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Dispersion of the HIV-1 Epidemic in Men Who Have Sex with Men in the Netherlands: A Combined Mathematical Model and Phylogenetic Analysis.

    PubMed

    Bezemer, Daniela; Cori, Anne; Ratmann, Oliver; van Sighem, Ard; Hermanides, Hillegonda S; Dutilh, Bas E; Gras, Luuk; Rodrigues Faria, Nuno; van den Hengel, Rob; Duits, Ashley J; Reiss, Peter; de Wolf, Frank; Fraser, Christophe

    2015-11-01

    The HIV-1 subtype B epidemic amongst men who have sex with men (MSM) is resurgent in many countries despite the widespread use of effective combination antiretroviral therapy (cART). In this combined mathematical and phylogenetic study of observational data, we aimed to find out the extent to which the resurgent epidemic is the result of newly introduced strains or of growth of already circulating strains. As of November 2011, the ATHENA observational HIV cohort of all patients in care in the Netherlands since 1996 included HIV-1 subtype B polymerase sequences from 5,852 patients. Patients who were diagnosed between 1981 and 1995 were included in the cohort if they were still alive in 1996. The ten most similar sequences to each ATHENA sequence were selected from the Los Alamos HIV Sequence Database, and a phylogenetic tree was created of a total of 8,320 sequences. Large transmission clusters that included ≥10 ATHENA sequences were selected, with a local support value ≥ 0.9 and median pairwise patristic distance below the fifth percentile of distances in the whole tree. Time-varying reproduction numbers of the large MSM-majority clusters were estimated through mathematical modeling. We identified 106 large transmission clusters, including 3,061 (52%) ATHENA and 652 Los Alamos sequences. Half of the HIV sequences from MSM registered in the cohort in the Netherlands (2,128 of 4,288) were included in 91 large MSM-majority clusters. Strikingly, at least 54 (59%) of these 91 MSM-majority clusters were already circulating before 1996, when cART was introduced, and have persisted to the present. Overall, 1,226 (35%) of the 3,460 diagnoses among MSM since 1996 were found in these 54 long-standing clusters. The reproduction numbers of all large MSM-majority clusters were around the epidemic threshold value of one over the whole study period. A tendency towards higher numbers was visible in recent years, especially in the more recently introduced clusters. The mean age of MSM at diagnosis increased by 0.45 years/year within clusters, but new clusters appeared with lower mean age. Major strengths of this study are the high proportion of HIV-positive MSM with a sequence in this study and the combined application of phylogenetic and modeling approaches. Main limitations are the assumption that the sampled population is representative of the overall HIV-positive population and the assumption that the diagnosis interval distribution is similar between clusters. The resurgent HIV epidemic amongst MSM in the Netherlands is driven by several large, persistent, self-sustaining, and, in many cases, growing sub-epidemics shifting towards new generations of MSM. Many of the sub-epidemics have been present since the early epidemic, to which new sub-epidemics are being added.

  16. Enrichment of beneficial bacteria in the skin microbiota of bats persisting with white-nose syndrome.

    PubMed

    Lemieux-Labonté, Virginie; Simard, Anouk; Willis, Craig K R; Lapointe, François-Joseph

    2017-09-05

    Infectious diseases of wildlife are increasing worldwide with implications for conservation and human public health. The microbiota (i.e. microbial community living on or in a host) could influence wildlife disease resistance or tolerance. White-nose syndrome (WNS), caused by the fungus Pseudogymnoascus destructans (Pd), has killed millions of hibernating North American bats since 2007. We characterized the skin microbiota of naïve, pre-WNS little brown bats (Myotis lucifugus) from three WNS-negative hibernation sites and persisting, previously exposed bats from three WNS-positive sites to test the hypothesis that the skin microbiota of bats shifts following WNS invasion. Using high-throughput 16S rRNA gene sequencing on 66 bats and 11 environmental samples, we found that hibernation site strongly influenced the composition and diversity of the skin microbiota. Bats from WNS-positive and WNS-negative sites differed in alpha and beta diversity, as well as in microbiota composition. Alpha diversity was reduced in persisting, WNS-positive bats, and the microbiota profile was enriched with particular taxa such Janthinobacterium, Micrococcaceae, Pseudomonas, Ralstonia, and Rhodococcus. Some of these taxa are recognized for their antifungal activity, and specific strains of Rhodococcus and Pseudomonas are known to inhibit Pd growth. Composition of the microbial community in the hibernaculum environment and the community on bat skin was superficially similar but differed in relative abundance of some bacterial taxa. Our results are consistent with the hypothesis that Pd invasion leads to a shift in the skin microbiota of surviving bats and suggest the possibility that the microbiota plays a protective role for bats facing WNS. The detection of what appears to be enrichment of beneficial bacteria in the skin microbiota of persisting bats is a promising discovery for species re-establishment. Our findings highlight not only the potential value of management actions that might encourage transmission, growth, and establishment of beneficial bacteria on bats, and within hibernacula, but also the potential risks of such management actions.

  17. Alteration of Microbial Communities Colonizing Leaf Litter in a Temperate Woodland Stream by Growth of Trees under Conditions of Elevated Atmospheric CO2 ▿

    PubMed Central

    Kelly, John J.; Bansal, Amit; Winkelman, Jonathan; Janus, Lori R.; Hell, Shannon; Wencel, Marie; Belt, Patricia; Kuehn, Kevin A.; Rier, Steven T.; Tuchman, Nancy C.

    2010-01-01

    Elevated atmospheric CO2 can cause increased carbon fixation and altered foliar chemical composition in a variety of plants, which has the potential to impact forested headwater streams because they are detritus-based ecosystems that rely on leaf litter as their primary source of organic carbon. Fungi and bacteria play key roles in the entry of terrestrial carbon into aquatic food webs, as they decompose leaf litter and serve as a source of nutrition for invertebrate consumers. This study tested the hypothesis that changes in leaf chemistry caused by elevated atmospheric CO2 would result in changes in the size and composition of microbial communities colonizing leaves in a woodland stream. Three tree species, Populus tremuloides, Salix alba, and Acer saccharum, were grown under ambient (360 ppm) or elevated (720 ppm) CO2, and their leaves were incubated in a woodland stream. Elevated-CO2 treatment resulted in significant increases in the phenolic and tannin contents and C/N ratios of leaves. Microbial effects, which occurred only for P. tremuloides leaves, included decreased fungal biomass and decreased bacterial counts. Analysis of fungal and bacterial communities on P. tremuloides leaves via terminal restriction fragment length polymorphism (T-RFLP) and clone library sequencing revealed that fungal community composition was mostly unchanged by the elevated-CO2 treatment, whereas bacterial communities showed a significant shift in composition and a significant increase in diversity. Specific changes in bacterial communities included increased numbers of alphaproteobacterial and cytophaga-flavobacter-bacteroides (CFB) group sequences and decreased numbers of betaproteobacterial and firmicutes sequences, as well as a pronounced decrease in overall Gram-positive bacterial sequences. PMID:20543045

  18. Alteration of microbial communities colonizing leaf litter in a temperate woodland stream by growth of trees under conditions of elevated atmospheric CO2.

    PubMed

    Kelly, John J; Bansal, Amit; Winkelman, Jonathan; Janus, Lori R; Hell, Shannon; Wencel, Marie; Belt, Patricia; Kuehn, Kevin A; Rier, Steven T; Tuchman, Nancy C

    2010-08-01

    Elevated atmospheric CO(2) can cause increased carbon fixation and altered foliar chemical composition in a variety of plants, which has the potential to impact forested headwater streams because they are detritus-based ecosystems that rely on leaf litter as their primary source of organic carbon. Fungi and bacteria play key roles in the entry of terrestrial carbon into aquatic food webs, as they decompose leaf litter and serve as a source of nutrition for invertebrate consumers. This study tested the hypothesis that changes in leaf chemistry caused by elevated atmospheric CO(2) would result in changes in the size and composition of microbial communities colonizing leaves in a woodland stream. Three tree species, Populus tremuloides, Salix alba, and Acer saccharum, were grown under ambient (360 ppm) or elevated (720 ppm) CO(2), and their leaves were incubated in a woodland stream. Elevated-CO(2) treatment resulted in significant increases in the phenolic and tannin contents and C/N ratios of leaves. Microbial effects, which occurred only for P. tremuloides leaves, included decreased fungal biomass and decreased bacterial counts. Analysis of fungal and bacterial communities on P. tremuloides leaves via terminal restriction fragment length polymorphism (T-RFLP) and clone library sequencing revealed that fungal community composition was mostly unchanged by the elevated-CO(2) treatment, whereas bacterial communities showed a significant shift in composition and a significant increase in diversity. Specific changes in bacterial communities included increased numbers of alphaproteobacterial and cytophaga-flavobacter-bacteroides (CFB) group sequences and decreased numbers of betaproteobacterial and firmicutes sequences, as well as a pronounced decrease in overall gram-positive bacterial sequences.

  19. The Sudden Dominance of bla CTX–M Harbouring Plasmids in Shigella spp. Circulating in Southern Vietnam

    PubMed Central

    Nhu, Nguyen Thi Khanh; Vinh, Ha; Nga, Tran Vu Thieu; Stabler, Richard; Duy, Pham Thanh; Thi Minh Vien, Le; van Doorn, H. Rogier; Cerdeño-Tárraga, Ana; Thomson, Nicholas; Campbell, James; Van Minh Hoang, Nguyen; Thi Thu Nga, Tran; Minh, Pham Van; Thuy, Cao Thu; Wren, Brendan; Farrar, Jeremy; Baker, Stephen

    2010-01-01

    Background Plasmid mediated antimicrobial resistance in the Enterobacteriaceae is a global problem. The rise of CTX-M class extended spectrum beta lactamases (ESBLs) has been well documented in industrialized countries. Vietnam is representative of a typical transitional middle income country where the spectrum of infectious diseases combined with the spread of drug resistance is shifting and bringing new healthcare challenges. Methodology We collected hospital admission data from the pediatric population attending the hospital for tropical diseases in Ho Chi Minh City with Shigella infections. Organisms were cultured from all enrolled patients and subjected to antimicrobial susceptibility testing. Those that were ESBL positive were subjected to further investigation. These investigations included PCR amplification for common ESBL genes, plasmid investigation, conjugation, microarray hybridization and DNA sequencing of a bla CTX–M encoding plasmid. Principal Findings We show that two different bla CTX-M genes are circulating in this bacterial population in this location. Sequence of one of the ESBL plasmids shows that rather than the gene being integrated into a preexisting MDR plasmid, the bla CTX-M gene is located on relatively simple conjugative plasmid. The sequenced plasmid (pEG356) carried the bla CTX-M-24 gene on an ISEcp1 element and demonstrated considerable sequence homology with other IncFI plasmids. Significance The rapid dissemination, spread of antimicrobial resistance and changing population of Shigella spp. concurrent with economic growth are pertinent to many other countries undergoing similar development. Third generation cephalosporins are commonly used empiric antibiotics in Ho Chi Minh City. We recommend that these agents should not be considered for therapy of dysentery in this setting. PMID:20544028

  20. An Activation-Based Model of Routine Sequence Errors

    DTIC Science & Technology

    2015-04-01

    part of the ACT-R frame- work (e.g., Anderson, 1983), we adopt a newer, richer no- tion of priming as part of our approach ( Harrison & Trafton, 2010...2014). Other models of routine sequence errors, such as the in- teractive activation network ( IAN ) model (Cooper & Shal- lice, 2006) and the simple...error patterns that results from an interface layout shift. The ideas behind our expanded priming approach, however, could apply to IAN , which uses

  1. Single nucleotide polymorphisms of Helicobacter pylori dupA that lead to premature stop codons.

    PubMed

    Moura, Sílvia B; Costa, Rafaella F A; Anacleto, Charles; Rocha, Gifone A; Rocha, Andreia M C; Queiroz, Dulciene M M

    2012-06-01

     The detection of the putative disease-specific Helicobacter pylori marker duodenal ulcer promoting gene A (dupA) is currently based on PCR detection of jhp0917 and jhp0918 that form the gene. However, mutations that lead to premature stop codons that split off the dupA leading to truncated products cannot be evaluated by PCR. We directly sequence the complete dupA of 75 dupA-positive strains of H. pylori isolated from patients with gastritis (n = 26), duodenal ulcer (n = 29), and gastric carcinoma (n = 20), to search for frame-shifting mutations that lead to stop codon. Thirty-four strains had single nucleotide mutations in dupA that lead to premature stop codon creating smaller products than the predicted 1839 bp product and, for this reason, were considered as dupA-negative. Intact dupA was more frequently observed in strains isolated from duodenal ulcer patients (65.5%) than in patients with gastritis only (46.2%) or with gastric carcinoma (50%). In logistic analysis, the presence of the intact dupA independently associated with duodenal ulcer (OR = 5.06; 95% CI = 1.22-20.96, p = .02).  We propose the primer walking methodology as a simple technique to sequence the gene. When we considered as dupA-positive only those strains that carry dupA gene without premature stop codons, the gene was associated with duodenal ulcer and, therefore, can be used as a marker for this disease in our population. © 2012 Blackwell Publishing Ltd.

  2. Detecting Fermi-level shifts by Auger electron spectroscopy in Si and GaAs

    NASA Astrophysics Data System (ADS)

    Debehets, J.; Homm, P.; Menghini, M.; Chambers, S. A.; Marchiori, C.; Heyns, M.; Locquet, J. P.; Seo, J. W.

    2018-05-01

    In this paper, changes in surface Fermi-level of Si and GaAs, caused by doping and cleaning, are investigated by Auger electron spectroscopy. Based on the Auger voltage contrast, we compared the Auger transition peak energy but with higher accuracy by using a more accurate analyzer and an improved peak position determination method. For silicon, a peak shift as large as 0.46 eV was detected when comparing a cleaned p-type and n-type wafer, which corresponds rather well with the theoretical difference in Fermi-levels. If no cleaning was applied, the peak position did not differ significantly for both wafer types, indicating Fermi-level pinning in the band gap. For GaAs, peak shifts were detected after cleaning with HF and (NH4)2S-solutions in an inert atmosphere (N2-gas). Although the (NH4)2S-cleaning in N2 is very efficient in removing the oxygen from the surface, the observed Ga- and As-peak shifts are smaller than those obtained after the HF-cleaning. It is shown that the magnitude of the shift is related to the surface composition. After Si-deposition on the (NH4)2S-cleaned surface, the Fermi-level shifts back to a similar position as observed for an as-received wafer, indicating that this combination is not successful in unpinning the Fermi-level of GaAs.

  3. Three dimensional imaging detector employing wavelength-shifting optical fibers

    DOEpatents

    Worstell, William A.

    1997-01-01

    A novel detector element structure and method for its use is provided. In a preferred embodiment, one or more inorganic scintillating crystals are coupled through wavelength shifting optical fibers (WLSFs) to position sensitive photomultipliers (PS-PMTs). The superior detector configuration in accordance with this invention is designed for an array of applications in high spatial resolution gamma ray sensing with particular application to SPECT, PET and PVI imaging systems. The design provides better position resolution than prior art devices at a lower total cost. By employing wavelength shifting fibers (WLSFs), the sensor configuration of this invention can operate with a significant reduction in the number of photomultipliers and electronics channels, while potentially improving the resolution of the system by allowing three dimensional reconstruction of energy deposition positions.

  4. Three dimensional imaging detector employing wavelength-shifting optical fibers

    DOEpatents

    Worstell, W.A.

    1997-02-04

    A novel detector element structure and method for its use is provided. In a preferred embodiment, one or more inorganic scintillating crystals are coupled through wavelength shifting optical fibers (WLSFs) to position sensitive photomultipliers (PS-PMTs). The superior detector configuration in accordance with this invention is designed for an array of applications in high spatial resolution gamma ray sensing with particular application to SPECT, PET and PVI imaging systems. The design provides better position resolution than prior art devices at a lower total cost. By employing wavelength shifting fibers (WLSFs), the sensor configuration of this invention can operate with a significant reduction in the number of photomultipliers and electronics channels, while potentially improving the resolution of the system by allowing three dimensional reconstruction of energy deposition positions. 11 figs.

  5. Prokaryote community dynamics in anaerobic co-digestion of swine manure, rice straw and industrial clay residuals.

    PubMed

    Jiménez, Janet; Theuerl, Susanne; Bergmann, Ingo; Klocke, Michael; Guerra, Gilda; Romero-Romero, Osvaldo

    The aim of this study was to analyze the effect of the addition of rice straw and clay residuals on the prokaryote methane-producing community structure in a semi-continuously stirred tank reactor fed with swine manure. Molecular techniques, including terminal restriction fragment length polymorphism and a comparative nucleotide sequence analyses of the prokaryotic 16S rRNA genes, were performed. The results showed a positive effect of clay addition on methane yield during the co-digestion of swine manure and rice straw. At the digestion of swine manure, the bacterial phylum Firmicutes and the archaeal family Methanosarcinaceae, particularly Methanosarcina species, were predominant. During the co-digestion of swine manure and rice straw the microbial community changed, and with the addition of clay residual, the phylum Bacteroidetes predominated. The new nutritional conditions resulted in a shift in the archaeal family Methanosarcinaceae community as acetoclastic Methanosaeta species became dominant.

  6. Adaptation to stimulus statistics in the perception and neural representation of auditory space.

    PubMed

    Dahmen, Johannes C; Keating, Peter; Nodal, Fernando R; Schulz, Andreas L; King, Andrew J

    2010-06-24

    Sensory systems are known to adapt their coding strategies to the statistics of their environment, but little is still known about the perceptual implications of such adjustments. We investigated how auditory spatial processing adapts to stimulus statistics by presenting human listeners and anesthetized ferrets with noise sequences in which interaural level differences (ILD) rapidly fluctuated according to a Gaussian distribution. The mean of the distribution biased the perceived laterality of a subsequent stimulus, whereas the distribution's variance changed the listeners' spatial sensitivity. The responses of neurons in the inferior colliculus changed in line with these perceptual phenomena. Their ILD preference adjusted to match the stimulus distribution mean, resulting in large shifts in rate-ILD functions, while their gain adapted to the stimulus variance, producing pronounced changes in neural sensitivity. Our findings suggest that processing of auditory space is geared toward emphasizing relative spatial differences rather than the accurate representation of absolute position.

  7. A sequence of physical processes quantified in LAOS by continuous local measures

    NASA Astrophysics Data System (ADS)

    Lee, Ching-Wei; Rogers, Simon A.

    2017-11-01

    The response to large amplitude oscillatory shear of a soft colloidal glass formed by a suspension of multiarm star polymers is investigated by means of well-defined continuous local measures. The local measures provide information regarding the transient elastic and viscous response of the material, as well as elastic extension via a shifting equilibrium position. It is shown that even when the amplitude of the strain is very large, cages reform and break twice per period and exhibit maximum elasticity around the point of zero stress. It is also shown that around the point of zero stress, the cages are extended by a nearly constant amount of approximately 5% at 1 rad/s and 7% at 10 rad/s, even when the total strain is as large as 420%. The results of this study provide a blueprint for a generic approach to elucidating the complex dynamics exhibited by soft materials under flow.

  8. Changes in Abundance of Oral Microbiota Associated with Oral Cancer

    PubMed Central

    Schmidt, Brian L.; Kuczynski, Justin; Bhattacharya, Aditi; Huey, Bing; Corby, Patricia M.; Queiroz, Erica L. S.; Nightingale, Kira; Kerr, A. Ross; DeLacure, Mark D.; Veeramachaneni, Ratna; Olshen, Adam B.; Albertson, Donna G.

    2014-01-01

    Individual bacteria and shifts in the composition of the microbiome have been associated with human diseases including cancer. To investigate changes in the microbiome associated with oral cancers, we profiled cancers and anatomically matched contralateral normal tissue from the same patient by sequencing 16S rDNA hypervariable region amplicons. In cancer samples from both a discovery and a subsequent confirmation cohort, abundance of Firmicutes (especially Streptococcus) and Actinobacteria (especially Rothia) was significantly decreased relative to contralateral normal samples from the same patient. Significant decreases in abundance of these phyla were observed for pre-cancers, but not when comparing samples from contralateral sites (tongue and floor of mouth) from healthy individuals. Weighted UniFrac principal coordinates analysis based on 12 taxa separated most cancers from other samples with greatest separation of node positive cases. These studies begin to develop a framework for exploiting the oral microbiome for monitoring oral cancer development, progression and recurrence. PMID:24887397

  9. Regulation of hepatitis B virus ENI enhancer activity by hepatocyte-enriched transcription factor HNF3.

    PubMed

    Chen, M; Hieng, S; Qian, X; Costa, R; Ou, J H

    1994-11-15

    Hepatitis B virus (HBV) ENI enhancer can activate the expression of HBV and non-HBV genes in a liver-specific manner. By performing the electrophoretic mobility-shift assays, we demonstrated that the three related, liver-enriched, transcription factors, HNF3 alpha, HNF3 beta, and HNF3 gamma could all bind to the 2c site of HBV ENI enhancer. Mutations introduced in the 2c site to abolish the binding by HNF3 reduced the enhancer activity approximately 15-fold. Moreover, expression of HNF3 antisense sequences to suppress the expression of HNF3 in Huh-7 hepatoma cells led to reduction of the ENI enhancer activity. These results indicate that HNF3 positively regulates the ENI enhancer activity and this regulation is most likely mediated through the 2c site. The requirement of HNF3 for the ENI enhancer activity could explain the liver specificity of this enhancer element.

  10. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  11. Single-Molecule Electrical Random Resequencing of DNA and RNA

    NASA Astrophysics Data System (ADS)

    Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji

    2012-07-01

    Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.

  12. The experience of being a shift-leader in a hospital ward.

    PubMed

    Goldblatt, Hadass; Granot, Michal; Admi, Hanna; Drach-Zahavy, Anat

    2008-07-01

    This paper is a report of a study to explore the experience of being a shift-leader, and how these nurses view the management of their shift. Professional demands on skilled and capable shift-leaders, who competently handle multi-disciplinary staff and patients, as well as operations and information, call for the development of efficient nursing leadership roles. Nevertheless, knowledge of shift-leaders' perspectives concerning their task management and leadership styles is relatively limited. Twenty-eight Registered Nurses working in an Israeli medical centre participated in this qualitative study. Data were gathered through in-depth interviews conducted in two phases between February and October 2005: three focus group interviews (phase 1) followed by seven individual interviews (phase 2). Content analysis revealed two major themes which constitute the essence of being a shift-leader: (1) a burden of responsibility, where the shift-leader moves between positions of maximum control and delegating some responsibility to other nurses; (2) the role's temporal dimension, expressed as a strong desire to reach the end of the shift safely, and taking managerial perspectives beyond the boundaries of the specific shift. The core of the shift-leader's position is an immense sense of responsibility. However, this managerial role is transient and therefore lacks an established authority. A two-dimensional taxonomy of these themes reveals four types of potential and actual coping among shift-leaders, indicating the need to train them in leadership skills and systemic thinking. Interventions to limit the potential stress hazards should be focused simultaneously on shift-leaders themselves and on job restructuring.

  13. Global molecular genetic analysis of porcine circovirus type 2 (PCV2) sequences confirms the presence of four main PCV2 genotypes and reveals a rapid increase of PCV2d.

    PubMed

    Xiao, Chao-Ting; Halbur, Patrick G; Opriessnig, Tanja

    2015-07-01

    The oldest porcine circovirus type 2 (PCV2) sequence dates back to 1962 and is among several hundreds of publicly available PCV2 sequences. Despite this resource, few studies have investigated the global genetic diversity of PCV2. To evaluate the phylogenetic relationship of PCV2 strains, 1680 PCV2 open reading frame 2 (ORF2) sequences were compared and analysed by methods of neighbour-joining, maximum-likelihood, Bayesian inference and network analysis. Four distinct clades were consistently identified and included PCV2a, PCV2b, PCV2c and PCV2d; the p-distance between PCV2d and PCV2b was 0.055±0.008, larger than the PCV2 genotype-definition cut-off of 0.035, supporting PCV2d as an independent genotype. Among the 1680 sequences, 278-285 (16.5-17 %) were classified as PCV2a, 1007-1058 (59.9-63 %) as PCV2b, three (0.2 %) as PCV2c and 322-323 (19.2 %) as PCV2d, with the remaining 12-78 sequences (0.7-4.6 %) classified as intermediate clades or strains by the various methods. Classification of strains to genotypes differed based on the number of sequences used for the analysis, indicating that sample size is important when determining classification and assessing PCV2 trends and shifts. PCV2d was initially identified in 1999 in samples collected in Switzerland, now appears to be widespread in China and has been present in North America since 2012. During 2012-2013, 37 % of all investigated PCV2 sequences from US pigs were classified as PCV2d and overall data analysis suggests an ongoing genotype shift from PCV2b towards PCV2d. The present analyses indicate that PCV2d emerged approximately 20 years ago.

  14. Unexpected series of regular frequency spacing of δ Scuti stars in the non-asymptotic regime. II. Sample-Echelle diagrams and rotation

    DOE PAGES

    Paparo, M.; Benko, J. M.; Hareter, M.; ...

    2016-06-17

    A sequence search method was developed for searching for regular frequency spacing in δ Scuti stars by visual inspection (VI) and algorithmic search. The sample contains 90 δ Scuti stars observed by CoRoT. An example is given to represent the VI. The algorithm (SSA) is described in detail. The data treatment of the CoRoT light curves, the criteria for frequency filtering, and the spacings derived by two methods (i.e., three approaches: VI, SSA, and FT) are given for each target. Echelle diagrams are presented for 77 targets for which at least one sequence of regular spacing was identified. Comparing the spacing and the shifts between pairs of echelle ridges revealed that at least one pair of echelle ridges is shifted to midway between the spacing for 22 stars. The estimated rotational frequencies compared to the shifts revealed rotationally split doublets, triplets, and multiplets not only for single frequencies, but for the complete echelle ridges in 31 δ Scuti stars. Furthermore, using several possible assumptions for the origin of the spacings, we derived the large separation (more » $${\\rm{\\Delta }}\

  15. Unexpected series of regular frequency spacing of δ Scuti stars in the non-asymptotic regime. II. Sample-Echelle diagrams and rotation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paparo, M.; Benko, J. M.; Hareter, M.

    A sequence search method was developed for searching for regular frequency spacing in δ Scuti stars by visual inspection (VI) and algorithmic search. The sample contains 90 δ Scuti stars observed by CoRoT. An example is given to represent the VI. The algorithm (SSA) is described in detail. The data treatment of the CoRoT light curves, the criteria for frequency filtering, and the spacings derived by two methods (i.e., three approaches: VI, SSA, and FT) are given for each target. Echelle diagrams are presented for 77 targets for which at least one sequence of regular spacing was identified. Comparing the spacing and the shifts between pairs of echelle ridges revealed that at least one pair of echelle ridges is shifted to midway between the spacing for 22 stars. The estimated rotational frequencies compared to the shifts revealed rotationally split doublets, triplets, and multiplets not only for single frequencies, but for the complete echelle ridges in 31 δ Scuti stars. Furthermore, using several possible assumptions for the origin of the spacings, we derived the large separation (more » $${\\rm{\\Delta }}\

  16. Progress in Spin Dynamics Solid-State Nuclear Magnetic Resonance with the Application of Floquet-Magnus Expansion to Chemical Shift Anisotropy

    PubMed Central

    Mananga, Eugene Stephane

    2013-01-01

    The purpose of this article is to present an historical overview of theoretical approaches used for describing spin dynamics under static or rotating experiments in solid state nuclear magnetic resonance. The article gives a brief historical overview for major theories in nuclear magnetic resonance and the promising theories. We present the first application of Floquet-Magnus expansion to chemical shift anisotropy when irradiated by BABA pulse sequence. PMID:23711337

  17. Comprehensive time average digital holographic vibrometry

    NASA Astrophysics Data System (ADS)

    Psota, Pavel; Lédl, Vít; Doleček, Roman; Mokrý, Pavel; Vojtíšek, Petr; Václavík, Jan

    2016-12-01

    This paper presents a method that simultaneously deals with drawbacks of time-average digital holography: limited measurement range, limited spatial resolution, and quantitative analysis of the measured Bessel fringe patterns. When the frequency of the reference wave is shifted by an integer multiple of frequency at which the object oscillates, the measurement range of the method can be shifted either to smaller or to larger vibration amplitudes. In addition, phase modulation of the reference wave is used to obtain a sequence of phase-modulated fringe patterns. Such fringe patterns can be combined by means of phase-shifting algorithms, and amplitudes of vibrations can be straightforwardly computed. This approach independently calculates the amplitude values in every single pixel. The frequency shift and phase modulation are realized by proper control of Bragg cells and therefore no additional hardware is required.

  18. Importance of tibial slope for stability of the posterior cruciate ligament deficient knee.

    PubMed

    Giffin, J Robert; Stabile, Kathryne J; Zantop, Thore; Vogrin, Tracy M; Woo, Savio L-Y; Harner, Christopher D

    2007-09-01

    Previous studies have shown that increasing tibial slope can shift the resting position of the tibia anteriorly. As a result, sagittal osteotomies that alter slope have recently been proposed for treatment of posterior cruciate ligament (PCL) injuries. Increasing tibial slope with an osteotomy shifts the resting position anteriorly in a PCL-deficient knee, thereby partially reducing the posterior tibial "sag" associated with PCL injury. This shift in resting position from the increased slope causes a decrease in posterior tibial translation compared with the PCL-deficient knee in response to posterior tibial and axial compressive loads. Controlled laboratory study. Three knee conditions were tested with a robotic universal force-moment sensor testing system: intact, PCL-deficient, and PCL-deficient with increased tibial slope. Tibial slope was increased via a 5-mm anterior opening wedge osteotomy. Three external loading conditions were applied to each knee condition at 0 degrees, 30 degrees, 60 degrees, 90 degrees, and 120 degrees of knee flexion: (1) 134-N anterior-posterior (A-P) tibial load, (2) 200-N axial compressive load, and (3) combined 134-N A-P and 200-N axial loads. For each loading condition, kinematics of the intact knee were recorded for the remaining 5 degrees of freedom (ie, A-P, medial-lateral, and proximal-distal translations, internal-external and varus-valgus rotations). Posterior cruciate ligament deficiency resulted in a posterior shift of the tibial resting position to 8.4 +/- 2.6 mm at 90 degrees compared with the intact knee. After osteotomy, tibial slope increased from 9.2 degrees +/- 1.0 degrees in the intact knee to 13.8 degrees +/- 0.9 degrees. This increase in slope reduced the posterior sag of the PCL-deficient knee, shifting the resting position anteriorly to 4.0 +/- 2.0 mm at 90 degrees. Under a 200-N axial compressive load with the osteotomy, an additional increase in anterior tibial translation to 2.7 +/- 1.7 mm at 30 degrees was observed. Under a 134-N A-P load, the osteotomy did not significantly affect total A-P translation when compared with the PCL-deficient knee. However, because of the anterior shift in resting position, there was a relative decrease in posterior tibial translation and increase in anterior tibial translation. Increasing tibial slope in a PCL-deficient knee reduces tibial sag by shifting the resting position of the tibia anteriorly. This sag is even further reduced when the knee is subjected to axial compressive loads. These data suggest that increasing tibial slope may be beneficial for patients with PCL-deficient knees.

  19. Thermodynamics of strain-induced crystallization of random copolymers.

    PubMed

    Nie, Yijing; Gao, Huanhuan; Wu, Yixian; Hu, Wenbing

    2014-01-14

    Industrial semi-crystalline polymers contain various kinds of sequence defects, which behave like non-crystallizable comonomer units on random copolymers. We performed dynamic Monte Carlo simulations of strain-induced crystallization of random copolymers with various contents of comonomers at high temperatures. We observed that the onset strains of crystallization shift up with the increase of comonomer contents and temperatures. The behaviors can be predicted well by a combination of Flory's theories on the melting-point shifting-down of random copolymers and on the melting-point shifting-up of strain-induced crystallization. Our thermodynamic results are fundamentally important for us to understand the rubber strain-hardening, the plastic molding, the film stretching as well as the fiber spinning.

  20. Sleep loss and circadian disruption in shift work: health burden and management.

    PubMed

    Rajaratnam, Shantha M W; Howard, Mark E; Grunstein, Ronald R

    2013-10-21

    About 1.5 million Australians are shift workers. Shift work is associated with adverse health, safety and performance outcomes. Circadian rhythm misalignment, inadequate and poor-quality sleep, and sleep disorders such as sleep apnoea, insomnia and shift work disorder (excessive sleepiness and/or insomnia temporally associated with the work schedule) contribute to these associations. Falling asleep at work at least once a week occurs in 32%-36% of shift workers. Risk of occupational accidents is at least 60% higher for non-day shift workers. Shift workers also have higher rates of cardiometabolic diseases and mood disturbances. Road and workplace accidents related to excessive sleepiness, to which shift work is a significant contributor, are estimated to cost $71-$93 billion per annum in the United States. There is growing evidence that understanding the interindividual variability in sleep-wake responses to shift work will help detect and manage workers vulnerable to the health consequences of shift work. A range of approaches can be used to enhance alertness in shift workers, including screening and treating sleep disorders, melatonin treatment to promote sleep during the daytime, and avoidance of inappropriate use of sedatives and wakefulness-promoters such as modafinil and caffeine. Short naps, which minimise sleep inertia, are generally effective. Shifting the circadian pacemaker with appropriately timed melatonin and/or bright light may be used to facilitate adjustment to a shift work schedule in some situations, such as a long sequence of night work. It is important to manage the health risk of shift workers by minimising vascular risk factors through dietary and other lifestyle approaches.

  1. Using variable rate models to identify genes under selection in sequence pairs: their validity and limitations for EST sequences.

    PubMed

    Church, Sheri A; Livingstone, Kevin; Lai, Zhao; Kozik, Alexander; Knapp, Steven J; Michelmore, Richard W; Rieseberg, Loren H

    2007-02-01

    Using likelihood-based variable selection models, we determined if positive selection was acting on 523 EST sequence pairs from two lineages of sunflower and lettuce. Variable rate models are generally not used for comparisons of sequence pairs due to the limited information and the inaccuracy of estimates of specific substitution rates. However, previous studies have shown that the likelihood ratio test (LRT) is reliable for detecting positive selection, even with low numbers of sequences. These analyses identified 56 genes that show a signature of selection, of which 75% were not identified by simpler models that average selection across codons. Subsequent mapping studies in sunflower show four of five of the positively selected genes identified by these methods mapped to domestication QTLs. We discuss the validity and limitations of using variable rate models for comparisons of sequence pairs, as well as the limitations of using ESTs for identification of positively selected genes.

  2. Mandibular kinematic changes after unilateral cross-bite with lateral shift correction.

    PubMed

    Venancio, F; Alarcon, J A; Lenguas, L; Kassem, M; Martin, C

    2014-10-01

    The aim of this randomised prospective study was to evaluate the effects of slow maxillary expansion with expansion plates and Hyrax expanders on the kinematics of the mandible after cross-bite correction. Thirty children (15 boys and 15 girls), aged 7·1-11·8, with unilateral cross-bite and functional shift were divided into two groups: expansion plate (n = 15) and Hyrax expander (n = 15). Thirty children with normal occlusion (14 boys and 16 girls, aged 7·3-11·6) served as control group. The maximum vertical opening, lateral mandibular shift (from maximum vertical opening to maximum intercuspation, from rest position to maximum intercuspation and from maximum vertical opening to rest position) and lateral excursions were recorded before and 4 months after treatment. After treatment, the expansion plate group showed a greater lateral shift from rest position to maximum intercuspation than did the control group. The expansion plate patients also presented greater left/contralateral excursion than did the control group. Comparisons of changes after treatment in the cross-bite groups showed significant decreases in the lateral shift from the maximum vertical opening to maximum intercuspation and from the maximum vertical opening to rest position, a significant increase in the homolateral excursion and a significant decrease in the contralateral excursion in the Hyrax expander group, whereas no significant differences were found in the expansion plate group. In conclusion, the Hyrax expander showed better results than did the expansion plate. The Hyrax expander with acrylic occlusal covering significantly improved the mandibular lateral shift and normalised the range of lateral excursion. © 2014 John Wiley & Sons Ltd.

  3. Visual-auditory integration for visual search: a behavioral study in barn owls

    PubMed Central

    Hazan, Yael; Kra, Yonatan; Yarin, Inna; Wagner, Hermann; Gutfreund, Yoram

    2015-01-01

    Barn owls are nocturnal predators that rely on both vision and hearing for survival. The optic tectum of barn owls, a midbrain structure involved in selective attention, has been used as a model for studying visual-auditory integration at the neuronal level. However, behavioral data on visual-auditory integration in barn owls are lacking. The goal of this study was to examine if the integration of visual and auditory signals contributes to the process of guiding attention toward salient stimuli. We attached miniature wireless video cameras on barn owls’ heads (OwlCam) to track their target of gaze. We first provide evidence that the area centralis (a retinal area with a maximal density of photoreceptors) is used as a functional fovea in barn owls. Thus, by mapping the projection of the area centralis on the OwlCam’s video frame, it is possible to extract the target of gaze. For the experiment, owls were positioned on a high perch and four food items were scattered in a large arena on the floor. In addition, a hidden loudspeaker was positioned in the arena. The positions of the food items and speaker were changed every session. Video sequences from the OwlCam were saved for offline analysis while the owls spontaneously scanned the room and the food items with abrupt gaze shifts (head saccades). From time to time during the experiment, a brief sound was emitted from the speaker. The fixation points immediately following the sounds were extracted and the distances between the gaze position and the nearest items and loudspeaker were measured. The head saccades were rarely toward the location of the sound source but to salient visual features in the room, such as the door knob or the food items. However, among the food items, the one closest to the loudspeaker had the highest probability of attracting a gaze shift. This result supports the notion that auditory signals are integrated with visual information for the selection of the next visual search target. PMID:25762905

  4. Studies on hand-held visual communication device for the deaf and speech-impaired 2. Keyboard design.

    PubMed

    Thurlow, W R

    1980-01-01

    Experiments with keyboard arrangements of letters show that simple alphabetic letter-key sequences with 4 to 5 letters in a row lead to most rapid visual search performance. Such arrangements can be used on keyboards operated by the index finger of one hand. Arrangement of letters in words offers a promising alternative because these arrangements can be readily memorized and can result in small interletter distances on the keyboard for frequently occurring letter sequences. Experiments on operation of keyboards show that a space or shift key operated by the left hand (which also holds the communication device) results in faster keyboard operation than when space or shift keys on the front of the keyboard (operated by right hand) are used. Special problems of the deaf-blind are discussed. Keyboard arrangements are investigated, and matching tactual codes are suggested.

  5. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-05

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

  6. Determination of accurate 1H positions of an alanine tripeptide with anti-parallel and parallel β-sheet structures by high resolution 1H solid state NMR and GIPAW chemical shift calculation.

    PubMed

    Yazawa, Koji; Suzuki, Furitsu; Nishiyama, Yusuke; Ohata, Takuya; Aoki, Akihiro; Nishimura, Katsuyuki; Kaji, Hironori; Shimizu, Tadashi; Asakura, Tetsuo

    2012-11-25

    The accurate (1)H positions of alanine tripeptide, A(3), with anti-parallel and parallel β-sheet structures could be determined by highly resolved (1)H DQMAS solid-state NMR spectra and (1)H chemical shift calculation with gauge-including projector augmented wave calculations.

  7. Two-level QSAR network (2L-QSAR) for peptide inhibitor design based on amino acid properties and sequence positions.

    PubMed

    Du, Q S; Ma, Y; Xie, N Z; Huang, R B

    2014-01-01

    In the design of peptide inhibitors the huge possible variety of the peptide sequences is of high concern. In collaboration with the fast accumulation of the peptide experimental data and database, a statistical method is suggested for peptide inhibitor design. In the two-level peptide prediction network (2L-QSAR) one level is the physicochemical properties of amino acids and the other level is the peptide sequence position. The activity contributions of amino acids are the functions of physicochemical properties and the sequence positions. In the prediction equation two weight coefficient sets {ak} and {bl} are assigned to the physicochemical properties and to the sequence positions, respectively. After the two coefficient sets are optimized based on the experimental data of known peptide inhibitors using the iterative double least square (IDLS) procedure, the coefficients are used to evaluate the bioactivities of new designed peptide inhibitors. The two-level prediction network can be applied to the peptide inhibitor design that may aim for different target proteins, or different positions of a protein. A notable advantage of the two-level statistical algorithm is that there is no need for host protein structural information. It may also provide useful insight into the amino acid properties and the roles of sequence positions.

  8. Toward a preoperative planning tool for brain tumor resection therapies.

    PubMed

    Coffey, Aaron M; Miga, Michael I; Chen, Ishita; Thompson, Reid C

    2013-01-01

    Neurosurgical procedures involving tumor resection require surgical planning such that the surgical path to the tumor is determined to minimize the impact on healthy tissue and brain function. This work demonstrates a predictive tool to aid neurosurgeons in planning tumor resection therapies by finding an optimal model-selected patient orientation that minimizes lateral brain shift in the field of view. Such orientations may facilitate tumor access and removal, possibly reduce the need for retraction, and could minimize the impact of brain shift on image-guided procedures. In this study, preoperative magnetic resonance images were utilized in conjunction with pre- and post-resection laser range scans of the craniotomy and cortical surface to produce patient-specific finite element models of intraoperative shift for 6 cases. These cases were used to calibrate a model (i.e., provide general rules for the application of patient positioning parameters) as well as determine the current model-based framework predictive capabilities. Finally, an objective function is proposed that minimizes shift subject to patient position parameters. Patient positioning parameters were then optimized and compared to our neurosurgeon as a preliminary study. The proposed model-driven brain shift minimization objective function suggests an overall reduction of brain shift by 23 % over experiential methods. This work recasts surgical simulation from a trial-and-error process to one where options are presented to the surgeon arising from an optimization of surgical goals. To our knowledge, this is the first realization of an evaluative tool for surgical planning that attempts to optimize surgical approach by means of shift minimization in this manner.

  9. On Explaining Language Shift: Sociology or Social Psychology of Language?

    ERIC Educational Resources Information Center

    Maitz, Peter

    2011-01-01

    This study investigates the potentials and limits of sociolinguistic research on language shift. Starting from a position that the ultimate goal of the research must be to create a general theory of language shift of predictive power, the author examines the explanatory potential of current mainstream research methodology now regarded as canonical…

  10. Convective blueshifts in the solar atmosphere. I. Absolute measurements with LARS of the spectral lines at 6302 Å

    NASA Astrophysics Data System (ADS)

    Löhner-Böttcher, J.; Schmidt, W.; Stief, F.; Steinmetz, T.; Holzwarth, R.

    2018-03-01

    Context. The solar convection manifests as granulation and intergranulation at the solar surface. In the photosphere, convective motions induce differential Doppler shifts to spectral lines. The observed convective blueshift varies across the solar disk. Aim. We focus on the impact of solar convection on the atmosphere and aim to resolve its velocity stratification in the photosphere. Methods: We performed high-resolution spectroscopic observations of the solar spectrum in the 6302 Å range with the Laser Absolute Reference Spectrograph at the Vacuum Tower Telescope. A laser frequency comb enabled the calibration of the spectra to an absolute wavelength scale with an accuracy of 1 m s-1. We systematically scanned the quiet Sun from the disk center to the limb at ten selected heliocentric positions. The analysis included 99 time sequences of up to 20 min in length. By means of ephemeris and reference corrections, we translated wavelength shifts into absolute line-of-sight velocities. A bisector analysis on the line profiles yielded the shapes and convective shifts of seven photospheric lines. Results: At the disk center, the bisector profiles of the iron lines feature a pronounced C-shape with maximum convective blueshifts of up to -450 m s-1 in the spectral line wings. Toward the solar limb, the bisectors change into a "\\"-shape with a saturation in the line core at a redshift of +100 m s-1. The center-to-limb variation of the line core velocities shows a slight increase in blueshift when departing the disk center for larger heliocentric angles. This increase in blueshift is more pronounced for the magnetically less active meridian than for the equator. Toward the solar limb, the blueshift decreases and can turn into a redshift. In general, weaker lines exhibit stronger blueshifts. Conclusions: Best spectroscopic measurements enabled the accurate determination of absolute convective shifts in the solar photosphere. We convolved the results to lower spectral resolution to permit a comparison with observations from other instruments.

  11. Backbone dynamics of a model membrane protein: measurement of individual amide hydrogen-exchange rates in detergent-solubilized M13 coat protein using /sup 13/C NMR hydrogen/deuterium isotope shifts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henry, G.D.; Weiner, J.H.; Sykes, B.D.

    Hydrogen-exchange rates have been measured for individual assigned amide protons in M13 coat protein, a 50-residue integral membrane protein, using a /sup 13/C nuclear magnetic resonance (NMR) equilibrium isotope shift technique. The locations of the more rapidly exchanging amides have been determined. In D/sub 2/O solutions, a peptide carbonyl resonance undergoes a small upfield isotope shift (0.08-0.09 ppm) from its position in H/sub 2/O solutions; in 1:1 H/sub 2/O/D/sub 2/O mixtures, the carbonyl line shape is determined by the exchange rate at the adjacent nitrogen atom. M13 coat protein was labeled biosynthetically with /sup 13/C at the peptide carbonyls ofmore » alanine, glycine, phenylalanine, proline, and lysine, and the exchange rates of 12 assigned amide protons in the hydrophilic regions were measured as a function of pH by using the isotope shift method. This equilibrium technique is sensitive to the more rapidly exchanging protons which are difficult to measure by classical exchange-out experiments. In proteins, structural factors, notably H bonding, can decrease the exchange rate of an amide proton by many orders of magnitude from that observed in the freely exposed amides of model peptides such as poly(DL-alanine). With corrections for sequence-related inductive effects, the retardation of amide exchange in sodium dodecyl sulfate solubilized coat protein has been calculated with respect to poly(DL-alanine). The most rapidly exchanging protons, which are retarded very little or not at all, are shown to occur at the N- and C-termini of the molecule. A model of the detergent-solubilized coat protein is constructed from these H-exchange data which is consistent with circular dichroism and other NMR results.« less

  12. Impact of field strength and iron oxide nanoparticle concentration on the linearity and diagnostic accuracy of off-resonance imaging.

    PubMed

    Farrar, Christian T; Dai, Guangping; Novikov, Mikhail; Rosenzweig, Anthony; Weissleder, Ralph; Rosen, Bruce R; Sosnovik, David E

    2008-06-01

    Off-resonance imaging (ORI) techniques are being increasingly used to image iron oxide imaging agents such as monocrystalline iron oxide nanoparticles (MION). However, the diagnostic accuracy, linearity, and field dependence of ORI have not been fully characterized. In this study, the sensitivity, specificity, and linearity of ORI were thus examined as a function of both MION concentration and magnetic field strength (4.7 and 14 T). MION phantoms with and without an air interface as well as MION uptake in a mouse model of healing myocardial infarction were imaged. MION-induced resonance shifts were shown to increase linearly with MION concentration. In contrast, the ORI signal/sensitivity was highly non-linear, initially increasing with MION concentration until T2 became comparable to the TE and decreasing thereafter. The specificity of ORI to distinguish MION-induced resonance shifts from on-resonance water was found to decrease with increasing field because of the increased on-resonance water linewidths (15 Hz at 4.7 T versus 45 Hz at 14 T). Large resonance shifts ( approximately 300 Hz) were observed at air interfaces at 4.7 T, both in vitro and in vivo, and led to poor ORI specificity for MION concentrations less than 150 microg Fe/mL. The in vivo ORI sensitivity was sufficient to detect the accumulation of MION in macrophages infiltrating healing myocardial infarcts, but the specificity was limited by non-specific areas of positive contrast at the air/tissue interfaces of the thoracic wall and the descending aorta. Improved specificity and linearity can, however, be expected at lower fields where decreased on-resonance water linewidths, reduced air-induced resonance shifts, and longer T2 relaxation times are observed. The optimal performance of ORI will thus likely be seen at low fields, with moderate MION concentrations and with sequences containing very short TEs. Copyright (c) 2007 John Wiley & Sons, Ltd.

  13. Shape-based retrieval of CNV regions in read coverage data.

    PubMed

    Hong, Sangkyun; Yoon, Jeehee; Hong, Dongwan; Lee, Unjoo; Kim, Baeksop; Park, Sanghyun

    2014-01-01

    This study proposes a novel copy number variation (CNV) detection method, CNV_shape, based on variations in the shape of the read coverage data which are obtained from millions of short reads aligned to a reference sequence. The proposed method carries out two transforms, mean shift transform and mean slope transform, to extract the shape of a CNV more precisely from real human data, which are vulnerable to experimental and biological noises. The mean shift transform is a procedure for gaining a preliminary estimation of the CNVs by statistically evaluating moving averages of given read coverage data. The mean slope transform extracts candidate CNVs by filtering out non-stationary sub-regions from each of the primary CNVs pre-estimated in the mean shift procedure. Each of the candidate CNVs is merged with neighbours depending on the merging score to be finally identified as a putative CNV, where the merging score is estimated by the ratio of the positions with non-zero values of the mean shift transform to the total length of the region including two neighbouring candidate CNVs and the interval between them. The proposed CNV detection method was validated experimentally with simulated data and real human data. The simulated data with coverage in the range of 1x to 10x were generated for various sampling sizes and p-values. Five individual human genomes were used as real human data. The results show that relatively small CNVs (> 1 kbp) can be detected from low coverage (> 1.7x) data. The results also reveal that, in contrast to conventional methods, performance improvement from 8.18 to 87.90% was achieved in CNV_shape. The outcomes suggest that the proposed method is very effective in reducing noises inherent in real data as well as in detecting CNVs of various sizes and types.

  14. [Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

    PubMed

    Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

    2017-08-01

    To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

  15. Effects of strain on Goos-Hänchen shifts of monolayer phosphorene

    NASA Astrophysics Data System (ADS)

    Li, Kaihui; Cheng, Fang

    2018-03-01

    We investigate the Goos-Hänchen(GH) shift for ballistic electrons (i) reflected from a step-like inhomogeneity of strain, and (ii) transmitted through a monolayer phosphoresce junction consisting of a positive strained region and two normal regions (or a normal region and two negative strained regions). Refraction occurs at the interface between the unstrained/positive-strain(negative-strain/unstrained), in analogy with optical refraction. The critical angle is different for different strengths and directions of the strains. The critical angles for electrons tunneling through unstrained/positive-strain junction can even decrease to zero when the positive strain exceeds a critical value. For the monolayer phosphorene junction consisting of a positive strain region and two normal regions (or a normal region and two negative strain regions), we find that the GH shifts resonantly depends on the middle region width. The resonant values and the plus-minus sign of the displacement can be controlled by the incident angle, incident energy and the strain. These properties will be useful for the applications in phosphorene-based electronic devices.

  16. Analysis of the orbit distortion by the use of the wavelet transform

    NASA Astrophysics Data System (ADS)

    Matsushita, T.; Agui, A.; Yoshigoe, A.; Takao, M.; Aoyagi, H.; Takeuchi, M.; Nakatani, T.; Tanaka, H.

    2004-05-01

    We have adopted matching pursuit algorithm of discrete wavelet transform (DWT) for the analysis of the beam position shift correlated with the motion of insertion device(ID). The beam position data measured by the rf beam position monitors have included high-frequency `noises' and fluctuation of background level. Precise evaluation of the electron beam position shift correlated with the motion of the ID is required for estimation of the steering magnet currents in order to suppress the closed orbit distortion (COD). The DWT is a powerful tool for frequency analysis and data processing. The analysis of DWT was applied to the beam position shift correlated with the phase motion of APPLE-2 type undulator (ID23) in SPring-8. The result of the analysis indicated that `noises' are mainly composed of the components of 50 ˜ 6.25Hz and < 0.1Hz. We carried out the data processing to remove the `noises' by the matching pursuit algorithm. Then we have succeeded in suppressing the COD within 2 μm by the use of the steering magnet currents calculated from the processed data.

  17. SU-G-201-13: Investigation of Dose Variation Induced by HDR Ir-192 Source Global Shift Within the Varian Ring Applicator Using Monte Carlo Methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Y; Cai, J; Meltsner, S

    2016-06-15

    Purpose: The Varian tandem and ring applicators are used to deliver HDR Ir-192 brachytherapy for cervical cancer. The source path within the ring is hard to predict due to the larger interior ring lumen. Some studies showed the source could be several millimeters different from planned positions, while other studies demonstrated minimal dosimetric impact. A global shift can be applied to limit the effect of positioning offsets. The purpose of this study was to assess the necessities of implementing a global source shift using Monte Carlo (MC) simulations. Methods: The MCNP5 radiation transport code was used for all MC simulations.more » To accommodate TG-186 guidelines and eliminate inter-source attenuation, a BrachyVision plan with 10 dwell positions (0.5cm step sizes) was simulated as the summation of 10 individual sources with equal dwell times for simplification. To simplify the study, the tandem was also excluded from the MC model. Global shifts of ±0.1, ±0.3, ±0.5 cm were then simulated as distal and proximal from the reference positions. Dose was scored in water for all MC simulations and was normalized to 100% at the normalization point 0.5 cm from the cap in the ring plane. For dose comparison, Point A was 2 cm caudal from the buildup cap and 2 cm lateral on either side of the ring axis. With seventy simulations, 108 photon histories gave a statistical uncertainties (k=1) <2% for (0.1 cm)3 voxels. Results: Compared to no global shift, average Point A doses were 0.0%, 0.4%, and 2.2% higher for distal global shifts, and 0.4%, 2.8%, and 5.1% higher for proximal global shifts, respectively. The MC Point A doses differed by < 1% when compared to BrachyVision. Conclusion: Dose variations were not substantial for ±0.3 cm global shifts, which is common in clinical practice.« less

  18. On-chip beam positioning sensor via frequency locked cascaded ring resonators

    NASA Astrophysics Data System (ADS)

    Naiman, Alex; Stern, Liron; Levy, Uriel

    2018-05-01

    We demonstrate an approach for on-chip beam positioning with a position accuracy of up to 100 nm. This approach is based on tracking the resonance of two adjacent microring resonators that are implemented on a silicon on insulator chip. We demonstrate the functionality of our approach by illuminating the chip through a Near Field Scanning Optical Microscope tip and monitoring the shift of the microring resonances due to the thermo-optic effect. We also discuss the contribution of different effects such as free carrier absorption and dispersion to the resonance shift.

  19. Knight-shift anomalies in heavy-electron materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, E.; Cox, D.L.

    1998-08-01

    We have studied the Knight shift K({rvec r},T) and magnetic susceptibility {chi}(T) of heavy-electron materials, modeled by the infinite-U Anderson model with the noncrossing approximation method. A systematic study of K({rvec r},T) and {chi}(T) for different Kondo temperatures T{sub 0} (which depends on the hybridization width {Gamma}) shows a low-temperature anomaly (nonlinear relation between K and {chi}) which increases as the Kondo temperature T{sub 0} and distance r increase. We carried out an incoherent lattice sum by adding the K({rvec r}) of a few hundred shells of rare-earth atoms around a nucleus and compare the numerically calculated results with themore » experimental results. For CeSn{sub 3}, which is a concentrated heavy-electron material, both the {sup 119}Sn NMR Knight shift and positive muon Knight shift are studied. Also, lattice coherence effects by conduction-electron scattering at every rare-earth site are included using the average-T-matrix approximation. The calculated magnetic susceptibility and {sup 119}Sn NMR Knight shift show excellent agreement with experimental results for both incoherent and coherent calculations. The positive muon Knight shifts are calculated for both possible positions of muon (center of the cubic unit cell and middle of Ce-Ce bond axis). Our numerical results show a low-temperature anomaly for the muons of the correct magnitude but we can only find agreement with experiment if we take a weighted average of the two sites in a calculation with lattice coherence present. For YbCuAl, the measured {sup 27}Al NMR Knight shift shows an anomaly with opposite sign to the CeSn{sub 3} compound. Our calculations agree very well with the experiments. For the proposed quadrupolar Kondo alloy Y{sub 0.8}U{sub 0.2}Pd{sub 3}, our {sup 89}Y NMR Knight-shift calculation do not show the observed Knight-shift anomaly. {copyright} {ital 1998} {ital The American Physical Society}« less

  20. Transcriptional profiling reveals the expression of novel genes in response to various stimuli in the human dermatophyte Trichophyton rubrum

    PubMed Central

    2010-01-01

    Background Cutaneous mycoses are common human infections among healthy and immunocompromised hosts, and the anthropophilic fungus Trichophyton rubrum is the most prevalent microorganism isolated from such clinical cases worldwide. The aim of this study was to determine the transcriptional profile of T. rubrum exposed to various stimuli in order to obtain insights into the responses of this pathogen to different environmental challenges. Therefore, we generated an expressed sequence tag (EST) collection by constructing one cDNA library and nine suppression subtractive hybridization libraries. Results The 1388 unigenes identified in this study were functionally classified based on the Munich Information Center for Protein Sequences (MIPS) categories. The identified proteins were involved in transcriptional regulation, cellular defense and stress, protein degradation, signaling, transport, and secretion, among other functions. Analysis of these unigenes revealed 575 T. rubrum sequences that had not been previously deposited in public databases. Conclusion In this study, we identified novel T. rubrum genes that will be useful for ORF prediction in genome sequencing and facilitating functional genome analysis. Annotation of these expressed genes revealed metabolic adaptations of T. rubrum to carbon sources, ambient pH shifts, and various antifungal drugs used in medical practice. Furthermore, challenging T. rubrum with cytotoxic drugs and ambient pH shifts extended our understanding of the molecular events possibly involved in the infectious process and resistance to antifungal drugs. PMID:20144196

  1. [Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

    PubMed

    Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

    2012-01-01

    Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

  2. Advanced Sine Wave Modulation of Continuous Wave Laser System for Atmospheric CO2 Differential Absorption Measurements

    NASA Technical Reports Server (NTRS)

    Campbell, Joel F.; Lin, Bing; Nehrir, Amin R.

    2014-01-01

    NASA Langley Research Center in collaboration with ITT Exelis have been experimenting with Continuous Wave (CW) laser absorption spectrometer (LAS) as a means of performing atmospheric CO2 column measurements from space to support the Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) mission.Because range resolving Intensity Modulated (IM) CW lidar techniques presented here rely on matched filter correlations, autocorrelation properties without side lobes or other artifacts are highly desirable since the autocorrelation function is critical for the measurements of lidar return powers, laser path lengths, and CO2 column amounts. In this paper modulation techniques are investigated that improve autocorrelation properties. The modulation techniques investigated in this paper include sine waves modulated by maximum length (ML) sequences in various hardware configurations. A CW lidar system using sine waves modulated by ML pseudo random noise codes is described, which uses a time shifting approach to separate channels and make multiple, simultaneous online/offline differential absorption measurements. Unlike the pure ML sequence, this technique is useful in hardware that is band pass filtered as the IM sine wave carrier shifts the main power band. Both amplitude and Phase Shift Keying (PSK) modulated IM carriers are investigated that exibit perfect autocorrelation properties down to one cycle per code bit. In addition, a method is presented to bandwidth limit the ML sequence based on a Gaussian filter implemented in terms of Jacobi theta functions that does not seriously degrade the resolution or introduce side lobes as a means of reducing aliasing and IM carrier bandwidth.

  3. Genetic architecture of the Delis-Kaplan Executive Function System Trail Making Test: evidence for distinct genetic influences on executive function.

    PubMed

    Vasilopoulos, Terrie; Franz, Carol E; Panizzon, Matthew S; Xian, Hong; Grant, Michael D; Lyons, Michael J; Toomey, Rosemary; Jacobson, Kristen C; Kremen, William S

    2012-03-01

    To examine how genes and environments contribute to relationships among Trail Making Test (TMT) conditions and the extent to which these conditions have unique genetic and environmental influences. Participants included 1,237 middle-aged male twins from the Vietnam Era Twin Study of Aging. The Delis-Kaplan Executive Function System TMT included visual searching, number and letter sequencing, and set-shifting components. Phenotypic correlations among TMT conditions ranged from 0.29 to 0.60, and genes accounted for the majority (58-84%) of each correlation. Overall heritability ranged from 0.34 to 0.62 across conditions. Phenotypic factor analysis suggested a single factor. In contrast, genetic models revealed a single common genetic factor but also unique genetic influences separate from the common factor. Genetic variance (i.e., heritability) of number and letter sequencing was completely explained by the common genetic factor while unique genetic influences separate from the common factor accounted for 57% and 21% of the heritabilities of visual search and set shifting, respectively. After accounting for general cognitive ability, unique genetic influences accounted for 64% and 31% of those heritabilities. A common genetic factor, most likely representing a combination of speed and sequencing, accounted for most of the correlation among TMT 1-4. Distinct genetic factors, however, accounted for a portion of variance in visual scanning and set shifting. Thus, although traditional phenotypic shared variance analysis techniques suggest only one general factor underlying different neuropsychological functions in nonpatient populations, examining the genetic underpinnings of cognitive processes with twin analysis can uncover more complex etiological processes.

  4. [Laryngeal Tube Position Shift after Chest Compression: Comparison of Fixation Methods Using Durapore Tape, Multipore Tape, or a Neck Tape].

    PubMed

    Seno, Hisayo; Komasawa, Nobuyasu; Fujiwara, Shunsuke; Miyazaki, Shinichiro; Tatsumi, Shinichi; Minami, Toshiaki

    2015-05-01

    The laryngeal tube (LT ; Smiths Medical, Minnesota, U. S. A) is an inflatable supraglottic device for emergency airway management such as during chest compression, the instability after insertion remains a problem. We investigated the effectiveness of three fixation methods of LT using a manikin and automated chest compressor. After 10-minute chest compression, LT without fixation was shifted by 0.4 ± 0.1 cm, which was greater than with Durapore tape (0.2 ± 0.1 cm), Multipore tape (0.2 ± 0.1 cm), or a neck tape (0.1 ± 0.1 cm). The shift of the position was smaller with neck tape fixation compared to Durapore or Multipore tape fixation. A fixation neck tape may be useful in stabilizing the inserted position of LT during cardiopulmonary resuscitation.

  5. Genetic heterogeneity and actionable mutations in HER2-positive primary breast cancers and their brain metastases.

    PubMed

    De Mattos-Arruda, Leticia; Ng, Charlotte K Y; Piscuoglio, Salvatore; Gonzalez-Cao, Maria; Lim, Raymond S; De Filippo, Maria R; Fusco, Nicola; Schultheis, Anne M; Ortiz, Carolina; Viteri, Santiago; Arias, Alexandra; Macedo, Gabriel S; Oliveira, Mafalda; Gomez, Patricia; Teixidó, Cristina; Nuciforo, Paolo; Peg, Vicente; Saura, Cristina; Ramon Y Cajal, Santiago; Casas, Francesc Tresserra; Weigelt, Britta; Cortes, Javier; Seoane, Joan; Reis-Filho, Jorge S

    2018-04-17

    Brain metastases constitute a challenge in the management of patients with HER2-positive breast cancer treated with anti-HER2 systemic therapies. Here we sought to define the repertoire of mutations private to or enriched for in HER2-positive brain metastases. Massively parallel sequencing targeting all exons of 254 genes frequently mutated in breast cancers and/or related to DNA repair was used to characterize the spatial and temporal heterogeneity of HER2-positive breast cancers and their brain metastases in six patients. Data were analyzed with state-of-the-art bioinformatics algorithms and selected mutations were validated with orthogonal methods. Spatial and temporal inter-lesion genetic heterogeneity was observed in the HER2-positive brain metastases from an index patient subjected to a rapid autopsy. Genetic alterations restricted to the brain metastases included mutations in cancer genes FGFR2, PIK3CA and ATR , homozygous deletion in CDKN2A and amplification in KRAS . Shifts in clonal composition and the acquisition of additional mutations in the progression from primary HER2-positive breast cancer to brain metastases following anti-HER2 therapy were investigated in additional five patients. Likely pathogenic mutations private to or enriched in the brain lesions affected cancer and clinically actionable genes, including ATR, BRAF, FGFR2, MAP2K4, PIK3CA, RAF1 and TP53 . Changes in clonal composition and the acquisition of additional mutations in brain metastases may affect potentially actionable genes in HER2-positive breast cancers. Our observations have potential clinical implications, given that treatment decisions for patients with brain metastatic disease are still mainly based on biomarkers assessed in the primary tumor.

  6. Electronic coupling through natural amino acids.

    PubMed

    Berstis, Laura; Beckham, Gregg T; Crowley, Michael F

    2015-12-14

    Myriad scientific domains concern themselves with biological electron transfer (ET) events that span across vast scales of rate and efficiency through a remarkably fine-tuned integration of amino acid (AA) sequences, electronic structure, dynamics, and environment interactions. Within this intricate scheme, many questions persist as to how proteins modulate electron-tunneling properties. To help elucidate these principles, we develop a model set of peptides representing the common α-helix and β-strand motifs including all natural AAs within implicit protein-environment solvation. Using an effective Hamiltonian strategy with density functional theory, we characterize the electronic coupling through these peptides, furthermore considering side-chain dynamics. For both motifs, predictions consistently show that backbone-mediated electronic coupling is distinctly sensitive to AA type (aliphatic, polar, aromatic, negatively charged and positively charged), and to side-chain orientation. The unique properties of these residues may be employed to design activated, deactivated, or switch-like superexchange pathways. Electronic structure calculations and Green's function analyses indicate that localized shifts in the electron density along the peptide play a role in modulating these pathways, and further substantiate the experimentally observed behavior of proline residues as superbridges. The distinct sensitivities of tunneling pathways to sequence and conformation revealed in this electronic coupling database help improve our fundamental understanding of the broad diversity of ET reactivity and provide guiding principles for peptide design.

  7. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed Central

    Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

    1994-01-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

  8. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed

    Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

    1994-05-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

  9. Mimosoid legume plastome evolution: IR expansion, tandem repeat expansions, and accelerated rate of evolution in clpP.

    PubMed

    Dugas, Diana V; Hernandez, David; Koenen, Erik J M; Schwarz, Erika; Straub, Shannon; Hughes, Colin E; Jansen, Robert K; Nageswara-Rao, Madhugiri; Staats, Martijn; Trujillo, Joshua T; Hajrah, Nahid H; Alharbi, Njud S; Al-Malki, Abdulrahman L; Sabir, Jamal S M; Bailey, C Donovan

    2015-11-23

    The Leguminosae has emerged as a model for studying angiosperm plastome evolution because of its striking diversity of structural rearrangements and sequence variation. However, most of what is known about legume plastomes comes from few genera representing a subset of lineages in subfamily Papilionoideae. We investigate plastome evolution in subfamily Mimosoideae based on two newly sequenced plastomes (Inga and Leucaena) and two recently published plastomes (Acacia and Prosopis), and discuss the results in the context of other legume and rosid plastid genomes. Mimosoid plastomes have a typical angiosperm gene content and general organization as well as a generally slow rate of protein coding gene evolution, but they are the largest known among legumes. The increased length results from tandem repeat expansions and an unusual 13 kb IR-SSC boundary shift in Acacia and Inga. Mimosoid plastomes harbor additional interesting features, including loss of clpP intron1 in Inga, accelerated rates of evolution in clpP for Acacia and Inga, and dN/dS ratios consistent with neutral and positive selection for several genes. These new plastomes and results provide important resources for legume comparative genomics, plant breeding, and plastid genetic engineering, while shedding further light on the complexity of plastome evolution in legumes and angiosperms.

  10. Sequence tagging reveals unexpected modifications in toxicoproteomics

    PubMed Central

    Dasari, Surendra; Chambers, Matthew C.; Codreanu, Simona G.; Liebler, Daniel C.; Collins, Ben C.; Pennington, Stephen R.; Gallagher, William M.; Tabb, David L.

    2010-01-01

    Toxicoproteomic samples are rich in posttranslational modifications (PTMs) of proteins. Identifying these modifications via standard database searching can incur significant performance penalties. Here we describe the latest developments in TagRecon, an algorithm that leverages inferred sequence tags to identify modified peptides in toxicoproteomic data sets. TagRecon identifies known modifications more effectively than the MyriMatch database search engine. TagRecon outperformed state of the art software in recognizing unanticipated modifications from LTQ, Orbitrap, and QTOF data sets. We developed user-friendly software for detecting persistent mass shifts from samples. We follow a three-step strategy for detecting unanticipated PTMs in samples. First, we identify the proteins present in the sample with a standard database search. Next, identified proteins are interrogated for unexpected PTMs with a sequence tag-based search. Finally, additional evidence is gathered for the detected mass shifts with a refinement search. Application of this technology on toxicoproteomic data sets revealed unintended cross-reactions between proteins and sample processing reagents. Twenty five proteins in rat liver showed signs of oxidative stress when exposed to potentially toxic drugs. These results demonstrate the value of mining toxicoproteomic data sets for modifications. PMID:21214251

  11. Unexpected Stability of Bacteroidetes and Firmicutes Communities in Laboratory Biogas Reactors Fed with Different Defined Substrates

    PubMed Central

    Ratering, S.; Kramer, I.; Schmidt, M.; Zerr, W.; Schnell, S.

    2012-01-01

    In the present study, bacterial communities in 200-liter biogas reactors containing liquid manure consecutively fed with casein, starch, and cream were investigated over a period of up to 33 days. A 16S rRNA gene clone library identified Bacteroidetes and Firmicutes as the most abundant bacterial groups in the starting material, at 58.9% and 30.1% of sequences, respectively. The community development of both groups was monitored by real-time PCR and single-strand conformation polymorphism (SSCP) analysis. The Firmicutes and Bacteroidetes communities were unexpectedly stable and hardly influenced by batch-feeding events. The continuous feeding of starch led to community shifts that nevertheless contributed to a stable reactor performance. A longer starving period and a change in the pH value resulted in further community shifts within the Bacteroidetes but did not influence the Firmicutes. Predominant DNA bands from SSCP gels were cloned and sequenced. Sequences related to Peptococcaceae, Cytophagales, and Petrimonas sulfuriphila were found in all samples from all experiments. Real-time PCR demonstrated the abundance of members of the phylum Bacteroidetes and also reflected changes in gene copy numbers in conjunction with a changing pH value and acetate accumulation. PMID:22247168

  12. The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

    PubMed

    Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

    2004-11-15

    Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

  13. Sequence analyses reveal that a TPR-DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR-DP domains and prokaryotic GerD proteins.

    PubMed

    Hernández Torres, Jorge; Papandreou, Nikolaos; Chomilier, Jacques

    2009-05-01

    The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR-DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR-DP domains.

  14. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

    PubMed

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

    2011-10-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

  15. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

    PubMed Central

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

    2011-01-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

  16. Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

    USGS Publications Warehouse

    Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

    2015-01-01

    Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

  17. Piscine Reovirus: Genomic and Molecular Phylogenetic Analysis from Farmed and Wild Salmonids Collected on the Canada/US Pacific Coast

    PubMed Central

    Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul; Richmond, Zina; Johns, Robert; Purcell, Maureen K.; Johnson, Stewart C.; Saksida, Sonja M.

    2015-01-01

    Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period. PMID:26536673

  18. Protein Structure Determination from Pseudocontact Shifts Using ROSETTA

    PubMed Central

    Schmitz, Christophe; Vernon, Robert; Otting, Gottfried; Baker, David; Huber, Thomas

    2013-01-01

    Paramagnetic metal ions generate pseudocontact shifts (PCSs) in nuclear magnetic resonance spectra that are manifested as easily measurable changes in chemical shifts. Metals can be incorporated into proteins through metal binding tags, and PCS data constitute powerful long-range restraints on the positions of nuclear spins relative to the coordinate system of the magnetic susceptibility anisotropy tensor (Δχ-tensor) of the metal ion. We show that three-dimensional structures of proteins can reliably be determined using PCS data from a single metal binding site combined with backbone chemical shifts. The program PCS-ROSETTA automatically determines the Δχ-tensor and metal position from the PCS data during the structure calculations, without any prior knowledge of the protein structure. The program can determine structures accurately for proteins of up to 150 residues, offering a powerful new approach to protein structure determination that relies exclusively on readily measurable backbone chemical shifts and easily discriminates between correctly and incorrectly folded conformations. PMID:22285518

  19. Comparison of menstrual disorders in hospital nursing staff according to shift work pattern.

    PubMed

    Albert-Sabater, Josep Amílcar; Martínez, José Miguel; Baste, Valborg; Moen, Bente E; Ronda-Perez, Elena

    2016-11-01

    To assess the association between work in a rotating shift schedule and menstruation characteristics among nurse staff in a prospective study. Rotating shifts have been linked to alterations in the reproductive cycle. In the case of menstrual alterations, the conclusions are not clear. Prospective epidemiological study with follow-up over four months. All the female nurse staff (<40 years) in a hospital were interviewed, collecting sociodemographic and employment information. They were given a menstrual diary to keep a record of their shifts and characteristics of their menstruation (duration, amount of blood, dysmenorrhoea). They had two types of shifts: (1) Rotating shift schedule (two mornings, two afternoons, one night and two days off) including morning shifts (8:00-15:00), afternoon/evening shifts (15:00-22:00) and night shifts (22:00-8:00), and (2) Day shift schedule including morning shifts (8:00-15:00) and/or afternoon/evening shifts (15:00-22:00). The crude and adjusted odds ratios with 95% confidence interval were calculated using logistic generalised estimating equations (GEE) taking into account the correlations of multiple cycles per worker. One hundred and thirteen workers on the rotating shift and 75 on the day shift participated, and information from 730 menstrual cycles were obtained. There were no differences in prolonged duration, dysmenorrhoea, prolonged duration dysmenorrhoea and excessive bleeding among nurses on rotating shift compared to those on the day shift. For prolonged duration of menstruation, workers with more than five years on the rotating shift showed a slightly lower (nonsignificant) risk compared with those with <5 years. Nurse staff on the rotating shift did not show increased risk of having menstrual disorders comparing with day staff. Shifts with short rotation cycles and a progressive sequence do not appear to cause menstrual disorders in nurse staff who work rotating shifts. © 2016 John Wiley & Sons Ltd.

  20. On the relationship between executive functions of working memory and components derived from fluid intelligence measures.

    PubMed

    Ren, Xuezhu; Schweizer, Karl; Wang, Tengfei; Chu, Pei; Gong, Qin

    2017-10-01

    The aim of the current study is to provide new insights into the relationship between executive functions and intelligence measures in considering the item-position effect observed in intelligence items. Raven's Advanced Progressive Matrices (APM) and Horn's LPS reasoning test were used to assess fluid intelligence which served as criterion in investigating the relationship between intelligence and executive functions. A battery of six experimental tasks measured the updating, shifting, and inhibition processes of executive functions. Data were collected from 205 university students. Fluid intelligence showed substantial correlations with the updating and inhibition processes and no correlation with the shifting process without considering the item-position effect. Next, the fixed-link model was applied to APM and LPS data separately to decompose them into an ability component and an item-position component. The results of relating the components to executive functions showed that the updating and shifting processes mainly contributed to the item-position component whereas the inhibition process was mainly associated with the ability component of each fluid intelligence test. These findings suggest that improvements in the efficiency of updating and shifting processes are likely to occur during the course of completing intelligence measures and inhibition is important for intelligence in general. Copyright © 2017 Elsevier B.V. All rights reserved.

Top