Sample records for shift vector length

  1. Computational Study of Fluidic Thrust Vectoring using Separation Control in a Nozzle

    NASA Technical Reports Server (NTRS)

    Deere, Karen; Berrier, Bobby L.; Flamm, Jeffrey D.; Johnson, Stuart K.

    2003-01-01

    A computational investigation of a two- dimensional nozzle was completed to assess the use of fluidic injection to manipulate flow separation and cause thrust vectoring of the primary jet thrust. The nozzle was designed with a recessed cavity to enhance the throat shifting method of fluidic thrust vectoring. The structured-grid, computational fluid dynamics code PAB3D was used to guide the design and analyze over 60 configurations. Nozzle design variables included cavity convergence angle, cavity length, fluidic injection angle, upstream minimum height, aft deck angle, and aft deck shape. All simulations were computed with a static freestream Mach number of 0.05. a nozzle pressure ratio of 3.858, and a fluidic injection flow rate equal to 6 percent of the primary flow rate. Results indicate that the recessed cavity enhances the throat shifting method of fluidic thrust vectoring and allows for greater thrust-vector angles without compromising thrust efficiency.

  2. Computational Study of an Axisymmetric Dual Throat Fluidic Thrust Vectoring Nozzle for a Supersonic Aircraft Application

    NASA Technical Reports Server (NTRS)

    Deere, Karen A.; Flamm, Jeffrey D.; Berrier, Bobby L.; Johnson, Stuart K.

    2007-01-01

    A computational investigation of an axisymmetric Dual Throat Nozzle concept has been conducted. This fluidic thrust-vectoring nozzle was designed with a recessed cavity to enhance the throat shifting technique for improved thrust vectoring. The structured-grid, unsteady Reynolds- Averaged Navier-Stokes flow solver PAB3D was used to guide the nozzle design and analyze performance. Nozzle design variables included extent of circumferential injection, cavity divergence angle, cavity length, and cavity convergence angle. Internal nozzle performance (wind-off conditions) and thrust vector angles were computed for several configurations over a range of nozzle pressure ratios from 1.89 to 10, with the fluidic injection flow rate equal to zero and up to 4 percent of the primary flow rate. The effect of a variable expansion ratio on nozzle performance over a range of freestream Mach numbers up to 2 was investigated. Results indicated that a 60 circumferential injection was a good compromise between large thrust vector angles and efficient internal nozzle performance. A cavity divergence angle greater than 10 was detrimental to thrust vector angle. Shortening the cavity length improved internal nozzle performance with a small penalty to thrust vector angle. Contrary to expectations, a variable expansion ratio did not improve thrust efficiency at the flight conditions investigated.

  3. A study of real-time computer graphic display technology for aeronautical applications

    NASA Technical Reports Server (NTRS)

    Rajala, S. A.

    1981-01-01

    The development, simulation, and testing of an algorithm for anti-aliasing vector drawings is discussed. The pseudo anti-aliasing line drawing algorithm is an extension to Bresenham's algorithm for computer control of a digital plotter. The algorithm produces a series of overlapping line segments where the display intensity shifts from one segment to the other in this overlap (transition region). In this algorithm the length of the overlap and the intensity shift are essentially constants because the transition region is an aid to the eye in integrating the segments into a single smooth line.

  4. A Probabilistic Cell Tracking Algorithm

    NASA Astrophysics Data System (ADS)

    Steinacker, Reinhold; Mayer, Dieter; Leiding, Tina; Lexer, Annemarie; Umdasch, Sarah

    2013-04-01

    The research described below was carried out during the EU-Project Lolight - development of a low cost, novel and accurate lightning mapping and thunderstorm (supercell) tracking system. The Project aims to develop a small-scale tracking method to determine and nowcast characteristic trajectories and velocities of convective cells and cell complexes. The results of the algorithm will provide a higher accuracy than current locating systems distributed on a coarse scale. Input data for the developed algorithm are two temporally separated lightning density fields. Additionally a Monte Carlo method minimizing a cost function is utilizied which leads to a probabilistic forecast for the movement of thunderstorm cells. In the first step the correlation coefficients between the first and the second density field are computed. Hence, the first field is shifted by all shifting vectors which are physically allowed. The maximum length of each vector is determined by the maximum possible speed of thunderstorm cells and the difference in time for both density fields. To eliminate ambiguities in determination of directions and velocities, the so called Random Walker of the Monte Carlo process is used. Using this method a grid point is selected at random. Moreover, one vector out of all predefined shifting vectors is suggested - also at random but with a probability that is related to the correlation coefficient. If this exchange of shifting vectors reduces the cost function, the new direction and velocity are accepted. Otherwise it is discarded. This process is repeated until the change of cost functions falls below a defined threshold. The Monte Carlo run gives information about the percentage of accepted shifting vectors for all grid points. In the course of the forecast, amplifications of cell density are permitted. For this purpose, intensity changes between the investigated areas of both density fields are taken into account. Knowing the direction and speed of thunderstorm cells is important for nowcasting. Therefore, the presented method is based on IC discharges which account for most lightning discharges and occur minutes before the first CG discharge. The cell tracking algorithm will be used as part of the integrated LoLight system. The research leading to these results has received funding from the European Union's Seventh Framework Programme managed by REA-Research Executive Agency http://ec.europa.eu/research/rea ([FP7/2007-2013] [FP7/2007-2011]) under grant agreement n° [262200].

  5. An analysis of clock-shift experiments: is scatter increased and deflection reduced in clock-shifted homing pigeons?

    PubMed

    Chappell

    1997-01-01

    Clock-shifting (altering the phase of the internal clock) in homing pigeons leads to a deflection in the vanishing bearing of the clock-shifted group relative to controls. However, two unexplained phenomena are common in clock-shift experiments: the vanishing bearings of the clock-shifted group are often more scattered (with a shorter vector length) than those of the control group, and the deflection of the mean bearing of the clock-shifted group from that of the controls is often smaller than expected theoretically. Here, an analysis of 55 clock-shift experiments performed in four countries over 21 years is reported. The bearings of the clock-shifted groups were significantly more scattered than those of controls and less deflected than expected, but these effects were not significantly different at familiar and unfamiliar sites. The possible causes of the effects are discussed and evaluated with reference to this analysis and other experiments. The most likely causes appear to be conflict between the directions indicated by the sun compass and either unshifted familiar visual landmarks (at familiar sites only) or the unshifted magnetic compass (possible at both familiar and unfamiliar sites).

  6. Combined dispersive/interference spectroscopy for producing a vector spectrum

    DOEpatents

    Erskine, David J.

    2002-01-01

    A method of measuring the spectral properties of broadband waves that combines interferometry with a wavelength disperser having many spectral channels to produce a fringing spectrum. Spectral mapping, Doppler shifts, metrology of angles, distances and secondary effects such as temperature, pressure, and acceleration which change an interferometer cavity length can be measured accurately by a compact instrument using broadband illumination. Broadband illumination avoids the fringe skip ambiguities of monochromatic waves. The interferometer provides arbitrarily high spectral resolution, simple instrument response, compactness, low cost, high field of view and high efficiency. The inclusion of a disperser increases fringe visibility and signal to noise ratio over an interferometer used alone for broadband waves. The fringing spectrum is represented as a wavelength dependent 2-d vector, which describes the fringe amplitude and phase. Vector mathematics such as generalized dot products rapidly computes average broadband phase shifts to high accuracy. A Moire effect between the interferometer's sinusoidal transmission and the illumination heterodynes high resolution spectral detail to low spectral detail, allowing the use of a low resolution disperser. Multiple parallel interferometer cavities of fixed delay allow the instantaneous mapping of a spectrum, with an instrument more compact for the same spectral resolution than a conventional dispersive spectrometer, and not requiring a scanning delay.

  7. The Design of a Templated C++ Small Vector Class for Numerical Computing

    NASA Technical Reports Server (NTRS)

    Moran, Patrick J.

    2000-01-01

    We describe the design and implementation of a templated C++ class for vectors. The vector class is templated both for vector length and vector component type; the vector length is fixed at template instantiation time. The vector implementation is such that for a vector of N components of type T, the total number of bytes required by the vector is equal to N * size of (T), where size of is the built-in C operator. The property of having a size no bigger than that required by the components themselves is key in many numerical computing applications, where one may allocate very large arrays of small, fixed-length vectors. In addition to the design trade-offs motivating our fixed-length vector design choice, we review some of the C++ template features essential to an efficient, succinct implementation. In particular, we highlight some of the standard C++ features, such as partial template specialization, that are not supported by all compilers currently. This report provides an inventory listing the relevant support currently provided by some key compilers, as well as test code one can use to verify compiler capabilities.

  8. Quantifying adsorption-induced deformation of nanoporous materials on different length scales

    PubMed Central

    Morak, Roland; Braxmeier, Stephan; Ludescher, Lukas; Hüsing, Nicola; Reichenauer, Gudrung

    2017-01-01

    A new in situ setup combining small-angle neutron scattering (SANS) and dilatometry was used to measure water-adsorption-induced deformation of a monolithic silica sample with hierarchical porosity. The sample exhibits a disordered framework consisting of macropores and struts containing two-dimensional hexagonally ordered cylindrical mesopores. The use of an H2O/D2O water mixture with zero scattering length density as an adsorptive allows a quantitative determination of the pore lattice strain from the shift of the corresponding diffraction peak. This radial strut deformation is compared with the simultaneously measured macroscopic length change of the sample with dilatometry, and differences between the two quantities are discussed on the basis of the deformation mechanisms effective at the different length scales. It is demonstrated that the SANS data also provide a facile way to quantitatively determine the adsorption isotherm of the material by evaluating the incoherent scattering contribution of H2O at large scattering vectors. PMID:29021735

  9. Multimode excitation-induced phase shifts in intrinsic Fabry-Perot interferometric fiber sensor spectra.

    PubMed

    Ma, Cheng; Wang, Anbo

    2010-09-01

    We report the modal analysis of optical fiber single-mode-multimode-single-mode intrinsic Fabry-Perot interferometer sensors. The multimode nature of the Fabry-Perot cavity gives rise to an additional phase term in the spectrogram due to intermodal dispersion-induced wavefront distortion, which could significantly affect the cavity length demodulation accuracy. By using an exact model to analyze the modal behavior, this phase term is explained by employing a rotating vector approach. Comparison of the theoretical analysis with experimental results is presented.

  10. Effects of Circular DNA Length on Transfection Efficiency by Electroporation into HeLa Cells.

    PubMed

    Hornstein, Benjamin D; Roman, Dany; Arévalo-Soliz, Lirio M; Engevik, Melinda A; Zechiedrich, Lynn

    2016-01-01

    The ability to produce extremely small and circular supercoiled vectors has opened new territory for improving non-viral gene therapy vectors. In this work, we compared transfection of supercoiled DNA vectors ranging from 383 to 4,548 bp, each encoding shRNA against GFP under control of the H1 promoter. We assessed knockdown of GFP by electroporation into HeLa cells. All of our vectors entered cells in comparable numbers when electroporated with equal moles of DNA. Despite similar cell entry, we found length-dependent differences in how efficiently the vectors knocked down GFP. As vector length increased up to 1,869 bp, GFP knockdown efficiency per mole of transfected DNA increased. From 1,869 to 4,257 bp, GFP knockdown efficiency per mole was steady, then decreased with increasing vector length. In comparing GFP knockdown with equal masses of vectors, we found that the shorter vectors transfect more efficiently per nanogram of DNA transfected. Our results rule out cell entry and DNA mass as determining factors for gene knockdown efficiency via electroporation. The length-dependent effects we have uncovered are likely explained by differences in nuclear translocation or transcription. These data add an important step towards clinical applications of non-viral vector delivery.

  11. Effects of Circular DNA Length on Transfection Efficiency by Electroporation into HeLa Cells

    PubMed Central

    Hornstein, Benjamin D.; Roman, Dany; Arévalo-Soliz, Lirio M.; Engevik, Melinda A.

    2016-01-01

    The ability to produce extremely small and circular supercoiled vectors has opened new territory for improving non-viral gene therapy vectors. In this work, we compared transfection of supercoiled DNA vectors ranging from 383 to 4,548 bp, each encoding shRNA against GFP under control of the H1 promoter. We assessed knockdown of GFP by electroporation into HeLa cells. All of our vectors entered cells in comparable numbers when electroporated with equal moles of DNA. Despite similar cell entry, we found length-dependent differences in how efficiently the vectors knocked down GFP. As vector length increased up to 1,869 bp, GFP knockdown efficiency per mole of transfected DNA increased. From 1,869 to 4,257 bp, GFP knockdown efficiency per mole was steady, then decreased with increasing vector length. In comparing GFP knockdown with equal masses of vectors, we found that the shorter vectors transfect more efficiently per nanogram of DNA transfected. Our results rule out cell entry and DNA mass as determining factors for gene knockdown efficiency via electroporation. The length-dependent effects we have uncovered are likely explained by differences in nuclear translocation or transcription. These data add an important step towards clinical applications of non-viral vector delivery. PMID:27918590

  12. LBSizeCleav: improved support vector machine (SVM)-based prediction of Dicer cleavage sites using loop/bulge length.

    PubMed

    Bao, Yu; Hayashida, Morihiro; Akutsu, Tatsuya

    2016-11-25

    Dicer is necessary for the process of mature microRNA (miRNA) formation because the Dicer enzyme cleaves pre-miRNA correctly to generate miRNA with correct seed regions. Nonetheless, the mechanism underlying the selection of a Dicer cleavage site is still not fully understood. To date, several studies have been conducted to solve this problem, for example, a recent discovery indicates that the loop/bulge structure plays a central role in the selection of Dicer cleavage sites. In accordance with this breakthrough, a support vector machine (SVM)-based method called PHDCleav was developed to predict Dicer cleavage sites which outperforms other methods based on random forest and naive Bayes. PHDCleav, however, tests only whether a position in the shift window belongs to a loop/bulge structure. In this paper, we used the length of loop/bulge structures (in addition to their presence or absence) to develop an improved method, LBSizeCleav, for predicting Dicer cleavage sites. To evaluate our method, we used 810 empirically validated sequences of human pre-miRNAs and performed fivefold cross-validation. In both 5p and 3p arms of pre-miRNAs, LBSizeCleav showed greater prediction accuracy than PHDCleav did. This result suggests that the length of loop/bulge structures is useful for prediction of Dicer cleavage sites. We developed a novel algorithm for feature space mapping based on the length of a loop/bulge for predicting Dicer cleavage sites. The better performance of our method indicates the usefulness of the length of loop/bulge structures for such predictions.

  13. Short wavelength ion waves upstream of the earth's bow shock

    NASA Technical Reports Server (NTRS)

    Fuselier, S. A.; Gurnett, D. A.

    1984-01-01

    The identification and explanation of short wavelength antenna interference effects observed in spacecraft plasma wave data have provided an important new method of determining limits on the wavelength, direction of propagation, and Doppler shift of short wavelength electrostatic waves. Using the ISEE-1 wideband electric field data, antenna interference effects have been identified in the ion waves upstream of the earth's bow shock. This identification implies that wavelengths of the upstream ion waves are shorter than the antenna length. The interference effects also provide new measurements of the direction of propagation of the ion waves. The new measurements show that the wave vectors of the ion waves are not parallel to the interplanetary magnetic field (IMF) as previously reported. The direction of propagation does not appear to be controlled by the IMF. In addition, analysis of the Doppler shift of the short wavelength ion waves has provided a measurement of the dispersion relation. The upper limit of the rest frame frequency was found to be on the order of the ion plasma frequency. At this frequency, the wavelength is on the order of a few times the Debye length. The results of this study now provide strong evidence that the ion waves in the upstream region are Doppler-shifted ion acoustic waves. Previously announced in STAR as N83-36328

  14. Effects of Homology Length in the Repeat Region on Minus-Strand DNA Transfer and Retroviral Replication

    PubMed Central

    Dang, Que; Hu, Wei-Shau

    2001-01-01

    Homology between the two repeat (R) regions in the retroviral genome mediates minus-strand DNA transfer during reverse transcription. We sought to define the effects of R homology lengths on minus-strand DNA transfer. We generated five murine leukemia virus (MLV)-based vectors that contained identical sequences but different lengths of the 3′ R (3, 6, 12, 24 and 69 nucleotides [nt]); 69 nt is the full-length MLV R. After one round of replication, viral titers from the vector with a full-length downstream R were compared with viral titers generated from the other four vectors with reduced R lengths. Viral titers generated from vectors with R lengths reduced to one-third (24 nt) or one-sixth (12 nt) that of the wild type were not significantly affected; however, viral titers generated from vectors with only 3- or 6-nt homology in the R region were significantly lower. Because expression and packaging of the RNA were similar among all the vectors, the differences in the viral titers most likely reflected the impact of the homology lengths on the efficiency of minus-strand DNA transfer. The molecular nature of minus-strand DNA transfer was characterized in 63 proviruses. Precise R-to-R transfer was observed in most proviruses generated from vectors with 12-, 24-, or 69-nt homology in R, whereas aberrant transfers were predominantly used to generate proviruses from vectors with 3- or 6-nt homology. Reverse transcription using RNA transcribed from an upstream promoter, termed read-in RNA transcripts, resulted in most of the aberrant transfers. These data demonstrate that minus-strand DNA transfer is homology driven and a minimum homology length is required for accurate and efficient minus-strand DNA transfer. PMID:11134294

  15. Averaging of random walks and shift-invariant measures on a Hilbert space

    NASA Astrophysics Data System (ADS)

    Sakbaev, V. Zh.

    2017-06-01

    We study random walks in a Hilbert space H and representations using them of solutions of the Cauchy problem for differential equations whose initial conditions are numerical functions on H. We construct a finitely additive analogue of the Lebesgue measure: a nonnegative finitely additive measure λ that is defined on a minimal subset ring of an infinite-dimensional Hilbert space H containing all infinite-dimensional rectangles with absolutely converging products of the side lengths and is invariant under shifts and rotations in H. We define the Hilbert space H of equivalence classes of complex-valued functions on H that are square integrable with respect to a shift-invariant measure λ. Using averaging of the shift operator in H over random vectors in H with a distribution given by a one-parameter semigroup (with respect to convolution) of Gaussian measures on H, we define a one-parameter semigroup of contracting self-adjoint transformations on H, whose generator is called the diffusion operator. We obtain a representation of solutions of the Cauchy problem for the Schrödinger equation whose Hamiltonian is the diffusion operator.

  16. [Difference and distance between the central and thinnest points of the cornea: impact of refractive state, age and ocular side].

    PubMed

    Steinberg, J; Kohl, C; Katz, T; Richard, G; Linke, S J

    2014-04-01

    The aim of the study was to quantify the difference in corneal thickness between the central and thinnest points (∆PachyZ-PachyD), the distance between the center of the cornea and its thinnest point (vector length PachyD) and to explore the impact of refractive state, age and ocular side. This was a multicenter, retrospective, cross-sectional study and medical records of 16,872 eyes were reviewed. The Orbscan® (Bausch and Lomb) procedure was used for pachymetry and keratometry. The results showed that ∆PachyZ-PachyD and vector length PachyD were higher in hyperopic eyes (∆PachyZ-PachyD: 11.99 ± 12.08 µm, vector length PachyD: 0.85 ± 0.44 mm) compared to myopic eyes (∆PachyZ-PachyD: 9.2 ± 7.86 µm, vector length PachyD: 0.7 ± 0.37 mm; p < 0.001). Refractive state, age and ocular side demonstrated an independent, statistically significant impact on ∆PachyZ-PachyD and vector length PachyD. As a result of the significant impact of refractive state, age and ocular side on ∆PachyZ-PachyD and vector length PachyD, these variables should be considered in a normative data collection.

  17. A cross-sectional evaluation of meditation experience on electroencephalography data by artificial neural network and support vector machine classifiers

    PubMed Central

    Lee, Yu-Hao; Hsieh, Ya-Ju; Shiah, Yung-Jong; Lin, Yu-Huei; Chen, Chiao-Yun; Tyan, Yu-Chang; GengQiu, JiaCheng; Hsu, Chung-Yao; Chen, Sharon Chia-Ju

    2017-01-01

    Abstract To quantitate the meditation experience is a subjective and complex issue because it is confounded by many factors such as emotional state, method of meditation, and personal physical condition. In this study, we propose a strategy with a cross-sectional analysis to evaluate the meditation experience with 2 artificial intelligence techniques: artificial neural network and support vector machine. Within this analysis system, 3 features of the electroencephalography alpha spectrum and variant normalizing scaling are manipulated as the evaluating variables for the detection of accuracy. Thereafter, by modulating the sliding window (the period of the analyzed data) and shifting interval of the window (the time interval to shift the analyzed data), the effect of immediate analysis for the 2 methods is compared. This analysis system is performed on 3 meditation groups, categorizing their meditation experiences in 10-year intervals from novice to junior and to senior. After an exhausted calculation and cross-validation across all variables, the high accuracy rate >98% is achievable under the criterion of 0.5-minute sliding window and 2 seconds shifting interval for both methods. In a word, the minimum analyzable data length is 0.5 minute and the minimum recognizable temporal resolution is 2 seconds in the decision of meditative classification. Our proposed classifier of the meditation experience promotes a rapid evaluation system to distinguish meditation experience and a beneficial utilization of artificial techniques for the big-data analysis. PMID:28422856

  18. A cross-sectional evaluation of meditation experience on electroencephalography data by artificial neural network and support vector machine classifiers.

    PubMed

    Lee, Yu-Hao; Hsieh, Ya-Ju; Shiah, Yung-Jong; Lin, Yu-Huei; Chen, Chiao-Yun; Tyan, Yu-Chang; GengQiu, JiaCheng; Hsu, Chung-Yao; Chen, Sharon Chia-Ju

    2017-04-01

    To quantitate the meditation experience is a subjective and complex issue because it is confounded by many factors such as emotional state, method of meditation, and personal physical condition. In this study, we propose a strategy with a cross-sectional analysis to evaluate the meditation experience with 2 artificial intelligence techniques: artificial neural network and support vector machine. Within this analysis system, 3 features of the electroencephalography alpha spectrum and variant normalizing scaling are manipulated as the evaluating variables for the detection of accuracy. Thereafter, by modulating the sliding window (the period of the analyzed data) and shifting interval of the window (the time interval to shift the analyzed data), the effect of immediate analysis for the 2 methods is compared. This analysis system is performed on 3 meditation groups, categorizing their meditation experiences in 10-year intervals from novice to junior and to senior. After an exhausted calculation and cross-validation across all variables, the high accuracy rate >98% is achievable under the criterion of 0.5-minute sliding window and 2 seconds shifting interval for both methods. In a word, the minimum analyzable data length is 0.5 minute and the minimum recognizable temporal resolution is 2 seconds in the decision of meditative classification. Our proposed classifier of the meditation experience promotes a rapid evaluation system to distinguish meditation experience and a beneficial utilization of artificial techniques for the big-data analysis.

  19. Millimeter Wave Generation by Relativistic Electron Beams.

    DTIC Science & Technology

    1984-12-01

    frequency and wave vector matching relations for influence of various nonlinear effects on this instability is this four-wave interaction require...following coupled mode equations _ 6 = 6 _ (14)-- v vx (14) ." .’ for the lower hybrid sidebands: v - V 2 - The x component of the resultant vector equation...involves a purely growing modte, a four-wave interaction plitoces is analysed, including a u ap ti wave- vector up-shifted and ilown-shiftes upper

  20. Pixel-By Estimation of Scene Motion in Video

    NASA Astrophysics Data System (ADS)

    Tashlinskii, A. G.; Smirnov, P. V.; Tsaryov, M. G.

    2017-05-01

    The paper considers the effectiveness of motion estimation in video using pixel-by-pixel recurrent algorithms. The algorithms use stochastic gradient decent to find inter-frame shifts of all pixels of a frame. These vectors form shift vectors' field. As estimated parameters of the vectors the paper studies their projections and polar parameters. It considers two methods for estimating shift vectors' field. The first method uses stochastic gradient descent algorithm to sequentially process all nodes of the image row-by-row. It processes each row bidirectionally i.e. from the left to the right and from the right to the left. Subsequent joint processing of the results allows compensating inertia of the recursive estimation. The second method uses correlation between rows to increase processing efficiency. It processes rows one after the other with the change in direction after each row and uses obtained values to form resulting estimate. The paper studies two criteria of its formation: gradient estimation minimum and correlation coefficient maximum. The paper gives examples of experimental results of pixel-by-pixel estimation for a video with a moving object and estimation of a moving object trajectory using shift vectors' field.

  1. Hairy black hole solutions in U(1) gauge-invariant scalar-vector-tensor theories

    NASA Astrophysics Data System (ADS)

    Heisenberg, Lavinia; Tsujikawa, Shinji

    2018-05-01

    In U (1) gauge-invariant scalar-vector-tensor theories with second-order equations of motion, we study the properties of black holes (BH) on a static and spherically symmetric background. In shift-symmetric theories invariant under the shift of scalar ϕ → ϕ + c, we show the existence of new hairy BH solutions where a cubic-order scalar-vector interaction gives rise to a scalar hair manifesting itself around the event horizon. In the presence of a quartic-order interaction besides the cubic coupling, there are also regular BH solutions endowed with scalar and vector hairs.

  2. Multiple polarization states of vector soliton in fiber laser

    NASA Astrophysics Data System (ADS)

    Chen, Weicheng; Xu, Wencheng; Cao, Hui; Han, Dingan

    2007-11-01

    Vector soliton is obtained in erbium-doped fiber laser via nonlinear polarization rotation techniques. In experiment, we observe the every 4- and 7-pulse sinusoidal peak modulation. Temporal pulse sinusoidal peak modulation owes to evolution behavior of vector solitons in multiple polarization states. The polarizer in the laser modulates the mode-locked pulses with different polarization states into periodical pulse train intensities modulation. Moreover, the increasing pumping power lead to the appearance of the harmonic pulses and change the equivalent beat length to accelerate the polarization rotation. When the laser cavity length is the n-th multiple ratios to the beat length to maintain the mode-locking, the mode-locked vector soliton is in n-th multiple polarization states, exhibiting every n-pulse sinusoidal peak modulation.

  3. A diagram for evaluating multiple aspects of model performance in simulating vector fields

    NASA Astrophysics Data System (ADS)

    Xu, Zhongfeng; Hou, Zhaolu; Han, Ying; Guo, Weidong

    2016-12-01

    Vector quantities, e.g., vector winds, play an extremely important role in climate systems. The energy and water exchanges between different regions are strongly dominated by wind, which in turn shapes the regional climate. Thus, how well climate models can simulate vector fields directly affects model performance in reproducing the nature of a regional climate. This paper devises a new diagram, termed the vector field evaluation (VFE) diagram, which is a generalized Taylor diagram and able to provide a concise evaluation of model performance in simulating vector fields. The diagram can measure how well two vector fields match each other in terms of three statistical variables, i.e., the vector similarity coefficient, root mean square length (RMSL), and root mean square vector difference (RMSVD). Similar to the Taylor diagram, the VFE diagram is especially useful for evaluating climate models. The pattern similarity of two vector fields is measured by a vector similarity coefficient (VSC) that is defined by the arithmetic mean of the inner product of normalized vector pairs. Examples are provided, showing that VSC can identify how close one vector field resembles another. Note that VSC can only describe the pattern similarity, and it does not reflect the systematic difference in the mean vector length between two vector fields. To measure the vector length, RMSL is included in the diagram. The third variable, RMSVD, is used to identify the magnitude of the overall difference between two vector fields. Examples show that the VFE diagram can clearly illustrate the extent to which the overall RMSVD is attributed to the systematic difference in RMSL and how much is due to the poor pattern similarity.

  4. Analyzing neural responses with vector fields.

    PubMed

    Buneo, Christopher A

    2011-04-15

    Analyzing changes in the shape and scale of single cell response fields is a key component of many neurophysiological studies. Typical analyses of shape change involve correlating firing rates between experimental conditions or "cross-correlating" single cell tuning curves by shifting them with respect to one another and correlating the overlapping data. Such shifting results in a loss of data, making interpretation of the resulting correlation coefficients problematic. The problem is particularly acute for two dimensional response fields, which require shifting along two axes. Here, an alternative method for quantifying response field shape and scale based on correlation of vector field representations is introduced. The merits and limitations of the methods are illustrated using both simulated and experimental data. It is shown that vector correlation provides more information on response field changes than scalar correlation without requiring field shifting and concomitant data loss. An extension of this vector field approach is also demonstrated which can be used to identify the manner in which experimental variables are encoded in studies of neural reference frames. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Periodical plasma structures controlled by external magnetic field

    NASA Astrophysics Data System (ADS)

    Schweigert, I. V.; Keidar, M.

    2017-11-01

    The plasma of Hall thruster type in external magnetic field is studied in 2D3V kinetic simulations using PIC MCC method. The periodical structure with maxima of electron and ion densities is formed and becomes more pronounced with increase of magnetic field incidence angle in the plasma. These ridges of electron and ion densities are aligned with the magnetic field vector and shifted relative each other. This leads to formation of two-dimensional double-layers structure in cylindrical plasma chamber. Depending on Larmor radius and Debye length up to nineteen potential steps appear across the oblique magnetic field. The electrical current gathered on the wall is associated with the electron and ion density ridges.

  6. Electrostatic Ion-Cyclotron Waves in Magnetospheric Plasmas: Non-Local Aspects.

    DTIC Science & Technology

    1983-10-14

    moving observer will see a Doppler shifted frequency --- S where is the velocity vector of the observer (satellite) and k is the wave vector. Since k...direction) will not see any Doppler -shift, irrespective of the size of ky . Such a statement could not be made in the purely local theory, since there...a local theory, a wide range of Doppler shifts would be produced, from -kivs to +kivs, since the maximum value of kx is k1. Some of the observations

  7. Characterization of vector stimulated Brillouin scattering gain over wide power range

    NASA Astrophysics Data System (ADS)

    Li, Yongqian; An, Qi; Li, Xiaojuan; Zhang, Lixin

    2017-07-01

    The wide range power dependence of vector stimulated Brillouin scattering (SBS) gain is theoretically and experimentally characterized by a mathematical model and measurement system based on the heterodyne pump-Stokes technique. The results show that SBS phase shift is much more tolerant of pump depletion than SBS amplitude gain, hence the performance improvement of the SBS-based distributed sensing system can be achieved by measuring the SBS phase shift spectrum. The discussion about the measured Brillouin spectrum width versus pump power at different Stokes powers reveals that the occurrence of nonnegligible pump depletion imposes a restriction on the determination of pump and Stokes powers in an SBS amplitude gain-based application system. The amplitude gain and phase shift of vector SBS gain increase with the increase of pump power and decrease with the increase of Stokes power, which indicates that the design strategy with smaller Stokes power and higher pump power is reasonable. And the measured center-asymmetry of the SBS phase shift spectrum is mainly caused by the nonlinear refractive index, which puts a limitation on the maximum pump power. The obtained results can provide a useful basis for the optimal design of practical vector SBS gain-based application systems.

  8. A Language-Independent Approach to Automatic Text Difficulty Assessment for Second-Language Learners

    DTIC Science & Technology

    2013-08-01

    best-suited for regression. Our baseline uses z-normalized shallow length features and TF -LOG weighted vectors on bag-of-words for Arabic, Dari...length features and TF -LOG weighted vectors on bag-of-words for Arabic, Dari, English and Pashto. We compare Support Vector Machines and the Margin...football, whereas they are much less common in documents about opera). We used TF -LOG weighted word frequencies on bag-of-words for each document

  9. On the correlation between bond-length change and vibrational frequency shift in halogen-bonded complexes

    NASA Astrophysics Data System (ADS)

    Wang, Weizhou; Zhang, Yu; Ji, Baoming; Tian, Anmin

    2011-06-01

    The C-Hal (Hal = Cl, Br, or I) bond-length change and the corresponding vibrational frequency shift of the C-Hal stretch upon the C-Hal ⋯Y (Y is the electron donor) halogen bond formation have been determined by using density functional theory computations. Plots of the C-Hal bond-length change versus the corresponding vibrational frequency shift of the C-Hal stretch all give straight lines. The coefficients of determination range from 0.94366 to 0.99219, showing that the correlation between the C-Hal bond-length change and the corresponding frequency shift is very good in the halogen-bonded complexes. The possible effects of vibrational coupling, computational method, and anharmonicity on the bond-length change-frequency shift correlation are discussed in detail.

  10. Declining Prevalence of Disease Vectors Under Climate Change

    NASA Astrophysics Data System (ADS)

    Escobar, Luis E.; Romero-Alvarez, Daniel; Leon, Renato; Lepe-Lopez, Manuel A.; Craft, Meggan E.; Borbor-Cordova, Mercy J.; Svenning, Jens-Christian

    2016-12-01

    More than half of the world population is at risk of vector-borne diseases including dengue fever, chikungunya, zika, yellow fever, leishmaniasis, chagas disease, and malaria, with highest incidences in tropical regions. In Ecuador, vector-borne diseases are present from coastal and Amazonian regions to the Andes Mountains; however, a detailed characterization of the distribution of their vectors has never been carried out. We estimate the distribution of 14 vectors of the above vector-borne diseases under present-day and future climates. Our results consistently suggest that climate warming is likely threatening some vector species with extinction, locally or completely. These results suggest that climate change could reduce the burden of specific vector species. Other vector species are likely to shift and constrain their geographic range to the highlands in Ecuador potentially affecting novel areas and populations. These forecasts show the need for development of early prevention strategies for vector species currently absent in areas projected as suitable under future climate conditions. Informed interventions could reduce the risk of human exposure to vector species with distributional shifts, in response to current and future climate changes. Based on the mixed effects of future climate on human exposure to disease vectors, we argue that research on vector-borne diseases should be cross-scale and include climatic, demographic, and landscape factors, as well as forces facilitating disease transmission at fine scales.

  11. Chroma Shift and Gamut Shape: Going Beyond Average Color Fidelity and Gamut Area

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Royer, Michael P.; Houser, Kevin W.; David, Aurelien

    Though sometimes referred to as a two-measure system for evaluating color rendition, IES TM-30-15 includes key components that go beyond the two high-level average values, Fidelity Index (IES Rf) and Gamut Index (IES Rg). This article focuses on the Color Vector Graphic and Local Chroma Shift (IES Rcs,hj), discussing the calculation methods for these evaluation tools and providing context for the interpretation of the values. We illustrate why and how the Color Vector Graphic and Local Chroma Shift values capture information about color rendition that is impossible to describe with average measures (such as CIE Ra, IES Rf, or IESmore » Rg), but that is pertinent to more completely quantifying color rendition, and to understanding human evaluations of color quality in the built environment. We also present alternatives for quantifying the Color Vector Graphic and Local Chroma Shift values, which can inform the development of future measures.« less

  12. Potential impacts of climate change on the ecology of dengue and its mosquito vector the Asian tiger mosquito (Aedes albopictus)

    NASA Astrophysics Data System (ADS)

    Erickson, R. A.; Hayhoe, K.; Presley, S. M.; Allen, L. J. S.; Long, K. R.; Cox, S. B.

    2012-09-01

    Shifts in temperature and precipitation patterns caused by global climate change may have profound impacts on the ecology of certain infectious diseases. We examine the potential impacts of climate change on the transmission and maintenance dynamics of dengue, a resurging mosquito-vectored infectious disease. In particular, we project changes in dengue season length for three cities: Atlanta, GA; Chicago, IL and Lubbock, TX. These cities are located on the edges of the range of the Asian tiger mosquito within the United States of America and were chosen as test cases. We use a disease model that explicitly incorporates mosquito population dynamics and high-resolution climate projections. Based on projected changes under the Special Report on Emissions Scenarios (SRES) A1fi (higher) and B1 (lower) emission scenarios as simulated by four global climate models, we found that the projected warming shortened mosquito lifespan, which in turn decreased the potential dengue season. These results illustrate the difficulty in predicting how climate change may alter complex systems.

  13. Evaluation of helmet-mounted display targeting symbology based on eye tracking technology

    NASA Astrophysics Data System (ADS)

    Wang, Lijing; Wen, Fuzhen; Ma, Caixin; Zhao, Shengchu; Liu, Xiaodong

    2014-06-01

    The purpose of this paper is to find the Target Locator Lines (TLLs) which perform best by contrasting and comparing experiment based on three kinds of TTLs of fighter HMD. 10 university students, male, with an average age of 21-23, corrected visual acuity 1.5, participated in the experiment. In the experiment, head movement data was obtained by TrackIR. The geometric relationship between the coordinates of the real world and coordinates of the visual display was obtained by calculating the distance from viewpoint to midpoint of both eyes and the head movement data. Virtual helmet system simulation experiment environment was created by drawing TLLs of fighter HMD in the flight simulator visual scene. In the experiment, eye tracker was used to record the time and saccade trajectory. The results were evaluated by the duration of the time and saccade trajectory. The results showed that the symbol"locator line with digital vector length indication" cost most time and had the longest length of the saccade trajectory. It is the most ineffective and most unacceptable way. "Locator line with extending head vector length symbol" cost less time and had less length of the saccade trajectory. It is effective and acceptable;"Locator line with reflected vector length symbol" cost the least time and had the least length of the saccade trajectory. It is the most effective and most acceptable way. "Locator line with reflected vector length symbol" performs best. The results will provide reference value for the research of TTLs in future.

  14. Climate and environmental change drives Ixodes ricinus geographical expansion at the northern range margin.

    PubMed

    Jore, Solveig; Vanwambeke, Sophie O; Viljugrein, Hildegunn; Isaksen, Ketil; Kristoffersen, Anja B; Woldehiwet, Zerai; Johansen, Bernt; Brun, Edgar; Brun-Hansen, Hege; Westermann, Sebastian; Larsen, Inger-Lise; Ytrehus, Bjørnar; Hofshagen, Merete

    2014-01-08

    Global environmental change is causing spatial and temporal shifts in the distribution of species and the associated diseases of humans, domesticated animals and wildlife. In the on-going debate on the influence of climate change on vectors and vector-borne diseases, there is a lack of a comprehensive interdisciplinary multi-factorial approach utilizing high quality spatial and temporal data. We explored biotic and abiotic factors associated with the latitudinal and altitudinal shifts in the distribution of Ixodes ricinus observed during the last three decades in Norway using antibodies against Anaplasma phagocytophilum in sheep as indicators for tick presence. Samples obtained from 2963 sheep from 90 farms in 3 ecologically different districts during 1978 - 2008 were analysed. We modelled the presence of antibodies against A. phagocytophilum to climatic-, environmental and demographic variables, and abundance of wild cervids and domestic animals, using mixed effect logistic regressions. Significant predictors were large diurnal fluctuations in ground surface temperature, spring precipitation, duration of snow cover, abundance of red deer and farm animals and bush encroachment/ecotones. The length of the growth season, mean temperature and the abundance of roe deer were not significant in the model. Our results highlight the need to consider climatic variables year-round to disentangle important seasonal variation, climatic threshold changes, climate variability and to consider the broader environmental change, including abiotic and biotic factors. The results offer novel insight in how tick and tick-borne disease distribution might be modified by future climate and environmental change.

  15. Elimination of projection effects from vector magnetograms - The pre-flare configuration of active region AR 4474

    NASA Technical Reports Server (NTRS)

    Venkatakrishnan, P.; Hagyard, M. J.; Hathaway, D. H.

    1988-01-01

    A simple method of transforming vector magnetograms to heliographic coordinates is demonstrated. The merits of this transformation are illustrated using a vector magnetogram obtained with the MSFC vector magnetograph 80 minutes prior to a white light flare in active region AR 4474 on April 25, 1984. The original magnetogram shows strong magnetic shear along the neutral line at both the flare site and a nonflaring site. The transformation of the magnetogram to heliographic coordinates shows that the elimination of projection effects results in a much shorter length of the sheared region at the nonflaring site than what is inferred from the image plane vector magnetogram. The length of the sheared region at the flare site is relatively less affected by the transformation.

  16. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    PubMed

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  17. Genetic shifting: a novel approach for controlling vector-borne diseases.

    PubMed

    Powell, Jeffrey R; Tabachnick, Walter J

    2014-06-01

    Rendering populations of vectors of diseases incapable of transmitting pathogens through genetic methods has long been a goal of vector geneticists. We outline a method to achieve this goal that does not involve the introduction of any new genetic variants to the target population. Rather we propose that shifting the frequencies of naturally occurring alleles that confer refractoriness to transmission can reduce transmission below a sustainable level. The program employs methods successfully used in plant and animal breeding. Because no artificially constructed genetically modified organisms (GMOs) are introduced into the environment, the method is minimally controversial. We use Aedes aegypti and dengue virus (DENV) for illustrative purposes but point out that the proposed program is generally applicable to vector-borne disease control. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Incubation Patterns in a Central-Place Forager Affect Lifetime Reproductive Success: Scaling of Patterns from a Foraging Bout to a Lifetime

    PubMed Central

    Shoji, Akiko; Elliott, Kyle H.; Aris-Brosou, Stéphane; Crump, Doug; Gaston, Anthony J.

    2011-01-01

    Background Long-lived seabirds face a conflict between current and lifelong reproductive success. During incubation shifts, egg neglect is sometimes necessary to avoid starvation, but may compromise the current reproductive attempt. However, factors underlying this decision process are poorly understood. We focus on the ancient murrelet, Synthliboramphus antiquus, an alcid with exceptionally long incubation shift lengths, and test the impact of environmental factors on incubation shift length in relation to reproductive success. Methodology/Principal Findings Using an information theoretic approach, we show that incubation shift length was a strong predictor of reproductive success for ancient murrelets at Reef Island, Haida Gwaii, British Columbia, Canada during the 2007 and 2008 breeding seasons. The most important factors explaining an individual's shift length were egg size, wind speed and the length of the mate's previous shift. Wind speed and tide height were the two most important factors for determining foraging behavior, as measured by dive frequency and depth. Conclusions/Significance Our study demonstrates that (i) species-specific reproductive strategies interact with environmental conditions such as wind speed to form multiple incubation patterns and (ii) maintaining regular incubation shifts is an essential component of reproductive success. PMID:21423631

  19. Cross-sectional examination of the association between shift length and hospital nurses job satisfaction and nurse reported quality measures.

    PubMed

    Ball, Jane; Day, Tina; Murrells, Trevor; Dall'Ora, Chiara; Rafferty, Anne Marie; Griffiths, Peter; Maben, Jill

    2017-01-01

    Twenty-four hour nursing care involves shift work including 12-h shifts. England is unusual in deploying a mix of shift patterns. International evidence on the effects of such shifts is growing. A secondary analysis of data collected in England exploring outcomes with 12-h shifts examined the association between shift length, job satisfaction, scheduling flexibility, care quality, patient safety, and care left undone. Data were collected from a questionnaire survey of nurses in a sample of English hospitals, conducted as part of the RN4CAST study, an EU 7 th Framework funded study. The sample comprised 31 NHS acute hospital Trusts from 401 wards, in 46 acute hospital sites. Descriptive analysis included frequencies, percentages and mean scores by shift length, working beyond contracted hours and day or night shift. Multi-level regression models established statistical associations between shift length and nurse self-reported measures. Seventy-four percent (1898) of nurses worked a day shift and 26% (670) a night shift. Most Trusts had a mixture of shifts lengths. Self-reported quality of care was higher amongst nurses working ≤8 h (15.9%) compared to those working longer hours (20.0 to 21.1%). The odds of poor quality care were 1.64 times higher for nurses working ≥12 h (OR = 1.64, 95% CI 1.18-2.28, p  = 0.003). Mean 'care left undone' scores varied by shift length: 3.85 (≤8 h), 3.72 (8.01-10.00 h), 3.80 (10.01-11.99 h) and were highest amongst those working ≥12 h (4.23) ( p  < 0.001). The rate of care left undone was 1.13 times higher for nurses working ≥12 h (RR = 1.13, 95% CI 1.06-1.20, p  < 0.001). Job dissatisfaction was higher the longer the shift length: 42.9% (≥12 h (OR = 1.51, 95% CI 1.17-1.95, p  = .001); 35.1% (≤8 h) 45.0% (8.01-10.00 h), 39.5% (10.01-11.99 h). Our findings add to the growing international body of evidence reporting that ≥12 shifts are associated with poor ratings of quality of care and higher rates of care left undone. Future research should focus on how 12-h shifts can be optimised to minimise potential risks.

  20. Bioelectrical impedance vector distribution in the first year of life.

    PubMed

    Savino, Francesco; Grasso, Giulia; Cresi, Francesco; Oggero, Roberto; Silvestro, Leandra

    2003-06-01

    We assessed the bioelectrical impedance vector distribution in a sample of healthy infants in the first year of life, which is not available in literature. The study was conducted as a cross-sectional study in 153 healthy Caucasian infants (90 male and 63 female) younger than 1 y, born at full term, adequate for gestational age, free from chronic diseases or growth problems, and not feverish. Z scores for weight, length, cranial circumference, and body mass index for the study population were within the range of +/-1.5 standard deviations according to the Euro-Growth Study references. Concurrent anthropometrics (weight, length, and cranial circumference), body mass index, and bioelectrical impedance (resistance and reactance) measurements were made by the same operator. Whole-body (hand to foot) tetrapolar measurements were performed with a single-frequency (50 kHz), phase-sensitive impedance analyzer. The study population was subdivided into three classes of age for statistical analysis: 0 to 3.99 mo, 4 to 7.99 mo, and 8 to 11.99 mo. Using the bivariate normal distribution of resistance and reactance components standardized by the infant's length, the bivariate 95% confidence limits for the mean impedance vector separated by sex and age groups were calculated and plotted. Further, the bivariate 95%, 75%, and 50% tolerance intervals for individual vector measurements in the first year of life were plotted. Resistance and reactance values often fluctuated during the first year of life, particularly as raw measurements (without normalization by subject's length). However, 95% confidence ellipses of mean vectors from the three age groups overlapped each other, as did confidence ellipses by sex for each age class, indicating no significant vector migration during the first year of life. We obtained an estimate of mean impedance vector in a sample of healthy infants in the first year of life and calculated the bivariate values for an individual vector (95%, 75%, and 50% tolerance ellipses).

  1. Optimal cue integration in ants.

    PubMed

    Wystrach, Antoine; Mangan, Michael; Webb, Barbara

    2015-10-07

    In situations with redundant or competing sensory information, humans have been shown to perform cue integration, weighting different cues according to their certainty in a quantifiably optimal manner. Ants have been shown to merge the directional information available from their path integration (PI) and visual memory, but as yet it is not clear that they do so in a way that reflects the relative certainty of the cues. In this study, we manipulate the variance of the PI home vector by allowing ants (Cataglyphis velox) to run different distances and testing their directional choice when the PI vector direction is put in competition with visual memory. Ants show progressively stronger weighting of their PI direction as PI length increases. The weighting is quantitatively predicted by modelling the expected directional variance of home vectors of different lengths and assuming optimal cue integration. However, a subsequent experiment suggests ants may not actually compute an internal estimate of the PI certainty, but are using the PI home vector length as a proxy. © 2015 The Author(s).

  2. Correlation of the bond-length change and vibrational frequency shift in model hydrogen-bonded complexes of pyrrole

    NASA Astrophysics Data System (ADS)

    McDowell, Sean A. C.

    2017-04-01

    An MP2 computational study of model hydrogen-bonded pyrrole⋯YZ (YZ = NH3, NCH, BF, CO, N2, OC, FB) complexes was undertaken in order to examine the variation of the Nsbnd H bond length change and its associated vibrational frequency shift. The chemical hardness of Y, as well as the YZ dipole moment, were found to be important parameters in modifying the bond length change/frequency shift. The basis set effect on the computed properties was also assessed. A perturbative model, which accurately reproduced the ab initio Nsbnd H bond length changes and frequency shifts, was useful in rationalizing the observed trends.

  3. Discrimination thresholds of normal and anomalous trichromats: Model of senescent changes in ocular media density on the Cambridge Colour Test

    PubMed Central

    Shinomori, Keizo; Panorgias, Athanasios; Werner, John S.

    2017-01-01

    Age-related changes in chromatic discrimination along dichromatic confusion lines were measured with the Cambridge Colour Test (CCT). One hundred and sixty-two individuals (16 to 88 years old) with normal Rayleigh matches were the major focus of this paper. An additional 32 anomalous trichromats classified by their Rayleigh matches were also tested. All subjects were screened to rule out abnormalities of the anterior and posterior segments. Thresholds on all three chromatic vectors measured with the CCT showed age-related increases. Protan and deutan vector thresholds increased linearly with age while the tritan vector threshold was described with a bilinear model. Analysis and modeling demonstrated that the nominal vectors of the CCT are shifted by senescent changes in ocular media density, and a method for correcting the CCT vectors is demonstrated. A correction for these shifts indicates that classification among individuals of different ages is unaffected. New vector thresholds for elderly observers and for all age groups are suggested based on calculated tolerance limits. PMID:26974943

  4. Crosstalk Cancellation for a Simultaneous Phase Shifting Interferometer

    NASA Technical Reports Server (NTRS)

    Olczak, Eugene (Inventor)

    2014-01-01

    A method of minimizing fringe print-through in a phase-shifting interferometer, includes the steps of: (a) determining multiple transfer functions of pixels in the phase-shifting interferometer; (b) computing a crosstalk term for each transfer function; and (c) displaying, to a user, a phase-difference map using the crosstalk terms computed in step (b). Determining a transfer function in step (a) includes measuring intensities of a reference beam and a test beam at the pixels, and measuring an optical path difference between the reference beam and the test beam at the pixels. Computing crosstalk terms in step (b) includes computing an N-dimensional vector, where N corresponds to the number of transfer functions, and the N-dimensional vector is obtained by minimizing a variance of a modulation function in phase shifted images.

  5. Proposed ultralow-energy dual photonic-crystal nanobeam devices for on-chip N x N switching, logic, and wavelength multiplexing.

    PubMed

    Soref, Richard; Hendrickson, Joshua

    2015-12-14

    Silicon-on-insulator Mach-Zehnder interferometer structures that utilize a photonic crystal nanobeam waveguide in each of two connecting arms are proposed here as efficient 2 × 2 resonant, wavelength-selective electro-optical routing switches that are readily cascaded into on-chip N × N switching networks. A localized lateral PN junction of length ~2 μm within each of two identical nanobeams is proposed as a means of shifting the transmission resonance by 400 pm within the 1550 nm band. Using a bias swing ΔV = 2.7 V, the 474 attojoules-per-bit switching mechanism is free-carrier sweepout due to PN depletion layer widening. Simulations of the 2 × 2 outputs versus voltage are presented. Dual-nanobeam designs are given for N × N data-routing matrix switches, electrooptical logic unit cells, N × M wavelength selective switches, and vector matrix multipliers. Performance penalties are analyzed for possible fabrication induced errors such as non-ideal 3-dB couplers, differences in optical path lengths, and variations in photonic crystal cavity resonances.

  6. Effects of Ionic Dependence of DNA Persistence Length on the DNA Condensation at Room Temperature

    NASA Astrophysics Data System (ADS)

    Mao, Wei; Liu, Yan-Hui; Hu, Lin; Xu, Hou-Qiang

    2016-05-01

    DNA persistence length is a key parameter for quantitative interpretation of the conformational properties of DNA and related to the bending rigidity of DNA. A series of experiments pointed out that, in the DNA condensation process by multivalent cations, the condensed DNA takes elongated coil or compact globule states and the population of the compact globule states increases with an increase in ionic concentration. At the same time, single molecule experiments carried out in solution with multivalent cations (such as spermidine, spermine) indicated that DNA persistence length strongly depends on the ionic concentration. In order to revolve the effects of ionic concentration dependence of persistence length on DNA condensation, a model including the ionic concentration dependence of persistence length and strong correlation of multivalent cation on DNA is provided. The autocorrelation function of the tangent vectors is found as an effective way to detect the ionic concentration dependence of toroidal conformations. With an increase in ion concentration, the first periodic oscillation contained in the autocorrelation function shifts, the number of segment contained in the first periodic oscillation decreases gradually. According to the experiments, the average long-axis length is defined to estimate the ionic concentration dependence of condensation process further. The relation between long-axis length and ionic concentration matches the experimental results qualitatively. Supported by National Natural Science Foundation of China under Grant Nos. 11047022, 11204045, 11464004 and 31360215; The Research Foundation from Ministry of Education of China (212152), Guizhou Provincial Tracking Key Program of Social Development (SY20123089, SZ20113069); The General Financial Grant from the China Postdoctoral Science Foundation (2014M562341); The Research Foundation for Young University Teachers from Guizhou University (201311); The West Light Foundation (2015) and College Innovation Talent Team of Guizhou Province, (2014) 32

  7. Extending the length and time scales of Gram-Schmidt Lyapunov vector computations

    NASA Astrophysics Data System (ADS)

    Costa, Anthony B.; Green, Jason R.

    2013-08-01

    Lyapunov vectors have found growing interest recently due to their ability to characterize systems out of thermodynamic equilibrium. The computation of orthogonal Gram-Schmidt vectors requires multiplication and QR decomposition of large matrices, which grow as N2 (with the particle count). This expense has limited such calculations to relatively small systems and short time scales. Here, we detail two implementations of an algorithm for computing Gram-Schmidt vectors. The first is a distributed-memory message-passing method using Scalapack. The second uses the newly-released MAGMA library for GPUs. We compare the performance of both codes for Lennard-Jones fluids from N=100 to 1300 between Intel Nahalem/Infiniband DDR and NVIDIA C2050 architectures. To our best knowledge, these are the largest systems for which the Gram-Schmidt Lyapunov vectors have been computed, and the first time their calculation has been GPU-accelerated. We conclude that Lyapunov vector calculations can be significantly extended in length and time by leveraging the power of GPU-accelerated linear algebra.

  8. Climate and environmental change drives Ixodes ricinus geographical expansion at the northern range margin

    PubMed Central

    2014-01-01

    Background Global environmental change is causing spatial and temporal shifts in the distribution of species and the associated diseases of humans, domesticated animals and wildlife. In the on-going debate on the influence of climate change on vectors and vector-borne diseases, there is a lack of a comprehensive interdisciplinary multi-factorial approach utilizing high quality spatial and temporal data. Methods We explored biotic and abiotic factors associated with the latitudinal and altitudinal shifts in the distribution of Ixodes ricinus observed during the last three decades in Norway using antibodies against Anaplasma phagocytophilum in sheep as indicators for tick presence. Samples obtained from 2963 sheep from 90 farms in 3 ecologically different districts during 1978 – 2008 were analysed. We modelled the presence of antibodies against A. phagocytophilum to climatic-, environmental and demographic variables, and abundance of wild cervids and domestic animals, using mixed effect logistic regressions. Results Significant predictors were large diurnal fluctuations in ground surface temperature, spring precipitation, duration of snow cover, abundance of red deer and farm animals and bush encroachment/ecotones. The length of the growth season, mean temperature and the abundance of roe deer were not significant in the model. Conclusions Our results highlight the need to consider climatic variables year-round to disentangle important seasonal variation, climatic threshold changes, climate variability and to consider the broader environmental change, including abiotic and biotic factors. The results offer novel insight in how tick and tick-borne disease distribution might be modified by future climate and environmental change. PMID:24401487

  9. Induction of humoral responses to BHV-1 glycoprotein D expressed by HSV-1 amplicon vectors

    PubMed Central

    Blanc, Andrea Maria; Berois, Mabel Beatriz; Tomé, Lorena Magalí; Epstein, Alberto L.

    2012-01-01

    Herpes simplex virus type-1 (HSV-1) amplicon vectors are versatile and useful tools for transferring genes into cells that are capable of stimulating a specific immune response to their expressed antigens. In this work, two HSV-1-derived amplicon vectors were generated. One of these expressed the full-length glycoprotein D (gD) of bovine herpesvirus 1 while the second expressed the truncated form of gD (gDtr) which lacked the trans-membrane region. After evaluating gD expression in the infected cells, the ability of both vectors to induce a specific gD immune response was tested in BALB/c mice that were intramuscularly immunized. Specific serum antibody responses were detected in mice inoculated with both vectors, and the response against truncated gD was higher than the response against full-length gD. These results reinforce previous findings that HSV-1 amplicon vectors can potentially deliver antigens to animals and highlight the prospective use of these vectors for treating infectious bovine rhinotracheitis disease. PMID:22437537

  10. Chroma Shift and Gamut Shape: Going Beyond Average Color Fidelity and Gamut Area

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Royer, Michael P.; Houser, Kevin W.; David, Aurélien

    Though sometimes referred to as a two-measure system for evaluating color rendition, IES TM-30-15 includes other key components that go beyond the high-level average values IES Rf and IES Rg. This article focuses on the Color Vector Graphic and Local Chroma Shift (IES Rcs,hj), discussing the calculation methods for these evaluation tools and providing context for the interpretation of the values. It also presents alternatives for quantifying the same characteristics, which can inform the development of future measures. The Color Vector Graphic (CVG) is a visual representation of hue and chroma shifts across different hues. It quickly communicates complex informationmore » about how object colors will be rendered by a light source, although it is difficult or impossible to use for writing a specification. CVGs demonstrate that increases in chroma for certain hues sometimes means a decrease in chroma for other hues, and illustrates hue shifts for intermediate colors. The combination of shifts over different hues can be referred to as gamut shape. Complementing this information are the IES Rcs,hj values, which quantify the average relative chroma shift for samples in each of the 16 hue-angle bins (j) specified in IES TM-30-15. Unlike measures of average color fidelity and gamut area, gamut shape and hue-specific chroma shift are new concepts with no directly-comparable historical references. It will be critical to incorporate the Color Vector Graphic and Local Chroma Shift values into practice because they capture information about color rendition that is impossible to describe with average measures (such as CIE Ra, IES Rf, or IES Rg), but that is critical to understanding human evaluations of color quality in architectural environments.« less

  11. Heart Electrical Actions as Biometric Indicia

    NASA Technical Reports Server (NTRS)

    Schipper, John F. (Inventor); Dusan, Sorin V. (Inventor); Jorgensen, Charles C. (Inventor); Belousof, Eugene (Inventor)

    2013-01-01

    A method and associated system for use of statistical parameters based on peak amplitudes and/or time interval lengths and/or depolarization-repolarization vector angles and/or depolarization-repolarization vector lengths for PQRST electrical signals associated with heart waves, to identify a person. The statistical parameters, estimated to be at least 192, serve as biometric indicia, to authenticate, or to decline to authenticate, an asserted identity of a candidate person.

  12. Vehicle Based Vector Sensor

    DTIC Science & Technology

    2015-09-28

    buoyant underwater vehicle with an interior space in which a length of said underwater vehicle is equal to one tenth of the acoustic wavelength...underwater vehicle with an interior space in which a length of said underwater vehicle is equal to one tenth of the acoustic wavelength; an...unmanned underwater vehicle that can function as an acoustic vector sensor. (2) Description of the Prior Art [0004] It is known that a propagating

  13. Accounting for phase drifts in SSVEP-based BCIs by means of biphasic stimulation.

    PubMed

    Wu, Hung-Yi; Lee, Po-Lei; Chang, Hsiang-Chih; Hsieh, Jen-Chuen

    2011-05-01

    This study proposes a novel biphasic stimulation technique to solve the issue of phase drifts in steady-state visual evoked potential (SSVEPs) in phase-tagged systems. Phase calibration was embedded in stimulus sequences using a biphasic flicker, which is driven by a sequence with alternating reference and phase-shift states. Nine subjects were recruited to participate in off-line and online tests. Signals were bandpass filtered and segmented by trigger signals into reference and phase-shift epochs. Frequency components of SSVEP in the reference and phase-shift epochs were extracted using the Fourier method with a 50% overlapped sliding window. The real and imaginary parts of the SSVEP frequency components were organized into complex vectors in each epoch. Hotelling's t-square test was used to determine the significances of nonzero mean vectors. The rejection of noisy data segments and the validation of gaze detections were made based on p values. The phase difference between the valid mean vectors of reference and phase-shift epochs was used to identify user's gazed targets in this system. Data showed an average information transfer rate of 44.55 and 38.21 bits/min in off-line and online tests, respectively. © 2011 IEEE

  14. Performance Improvements of the Phoneme Recognition Algorithm.

    DTIC Science & Technology

    1984-06-01

    VECTOR NUNDIRt"tIVECTj Beginning vector ; of speech to be extracted INDEX * MOD(IVECT,4) ICheck for vector being ; last vector in block 63 ILE u ((JUICT...1fIER0) ; Read header block. CALL CHECK(IERO) IHEADER(57) : ICOfP ; Change a of freq. components ICHECK : (IHEADER(56) - ([LENGTH - 1)) * ILENGTH...ICONT .Al. ICHECK ) GO TO 55 ; Check to make sure correct ;amount of vectors have been created# INCR u INCR + 32 ;Jump over last set of components

  15. Transient radiative transfer in a scattering slab considering polarization.

    PubMed

    Yi, Hongliang; Ben, Xun; Tan, Heping

    2013-11-04

    The characteristics of the transient and polarization must be considered for a complete and correct description of short-pulse laser transfer in a scattering medium. A Monte Carlo (MC) method combined with a time shift and superposition principle is developed to simulate transient vector (polarized) radiative transfer in a scattering medium. The transient vector radiative transfer matrix (TVRTM) is defined to describe the transient polarization behavior of short-pulse laser propagating in the scattering medium. According to the definition of reflectivity, a new criterion of reflection at Fresnel surface is presented. In order to improve the computational efficiency and accuracy, a time shift and superposition principle is applied to the MC model for transient vector radiative transfer. The results for transient scalar radiative transfer and steady-state vector radiative transfer are compared with those in published literatures, respectively, and an excellent agreement between them is observed, which validates the correctness of the present model. Finally, transient radiative transfer is simulated considering the polarization effect of short-pulse laser in a scattering medium, and the distributions of Stokes vector in angular and temporal space are presented.

  16. Systematic review: association of shift length, protected sleep time, and night float with patient care, residents' health, and education.

    PubMed

    Reed, Darcy A; Fletcher, Kathlyn E; Arora, Vineet M

    2010-12-21

    The Accreditation Council for Graduate Medical Education's new duty-hour standards limit interns' shifts to 16 hours and night float to 6 consecutive nights. Protected sleep time (that is, "nap") is strongly encouraged. As duty-hour reforms are implemented, examination of the quality and outcomes of the relevant literature is important. To systematically review the literature examining shift length, protected sleep time, and night float. MEDLINE, PREMEDLINE, and EMBASE from January 1989 through May 2010. Studies examined the associations of shift length, protected sleep time, or night float with patient care, resident health, and education outcomes among residents in practice settings. Study quality was measured by using the validated Medical Education Research Study Quality Instrument and the U.S. Preventive Services Task Force criteria. Two investigators independently rated study quality, and interrater agreement was calculated. Sixty-four studies met inclusion criteria. Most studies used single-group cross-sectional (19 studies [29.7%]) or pre-post (41 studies [64.1%]) designs, and 4 (6.3%) were randomized, controlled trials. Five studies (7.8%) were multi-institutional. Twenty-four of 33 (72.7%) studies examining shift length reported that shorter shifts were associated with decreased medical errors, motor vehicle crashes, and percutaneous injuries. Only 2 studies assessed protected sleep time and reported that residents' adherence to naps was poor. Night floats described in 33 studies involved 5 to 7 consecutive nights. Most studies used single-institution, observational designs. Publication bias is likely but difficult to assess in this methodologically weak and heterogeneous body of evidence. For the limited outcomes measured, most studies supported reducing shift length but did not adequately address the optimal shift duration. Studies had numerous methodological limitations and unclear generalizability for most outcomes. Specific recommendations about shift length, protected sleep time, and night float should acknowledge the limitations of this evidence. Accreditation Council for Graduate Medical Education.

  17. Quadrature demultiplexing using a degenerate vector parametric amplifier.

    PubMed

    Lorences-Riesgo, Abel; Liu, Lan; Olsson, Samuel L I; Malik, Rohit; Kumpera, Aleš; Lundström, Carl; Radic, Stojan; Karlsson, Magnus; Andrekson, Peter A

    2014-12-01

    We report on quadrature demultiplexing of a quadrature phase-shift keying (QPSK) signal into two cross-polarized binary phase-shift keying (BPSK) signals with negligible penalty at bit-error rate (BER) equal to 10(-9). The all-optical quadrature demultiplexing is achieved using a degenerate vector parametric amplifier operating in phase-insensitive mode. We also propose and demonstrate the use of a novel and simple phase-locked loop (PLL) scheme based on detecting the envelope of one of the signals after demultiplexing in order to achieve stable quadrature decomposition.

  18. Extending the length and time scales of Gram–Schmidt Lyapunov vector computations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Costa, Anthony B., E-mail: acosta@northwestern.edu; Green, Jason R., E-mail: jason.green@umb.edu; Department of Chemistry, University of Massachusetts Boston, Boston, MA 02125

    Lyapunov vectors have found growing interest recently due to their ability to characterize systems out of thermodynamic equilibrium. The computation of orthogonal Gram–Schmidt vectors requires multiplication and QR decomposition of large matrices, which grow as N{sup 2} (with the particle count). This expense has limited such calculations to relatively small systems and short time scales. Here, we detail two implementations of an algorithm for computing Gram–Schmidt vectors. The first is a distributed-memory message-passing method using Scalapack. The second uses the newly-released MAGMA library for GPUs. We compare the performance of both codes for Lennard–Jones fluids from N=100 to 1300 betweenmore » Intel Nahalem/Infiniband DDR and NVIDIA C2050 architectures. To our best knowledge, these are the largest systems for which the Gram–Schmidt Lyapunov vectors have been computed, and the first time their calculation has been GPU-accelerated. We conclude that Lyapunov vector calculations can be significantly extended in length and time by leveraging the power of GPU-accelerated linear algebra.« less

  19. It's Not Just the "Heavy NP": Relative Phrase Length Modulates the Production of Heavy-NP Shift

    ERIC Educational Resources Information Center

    Stallings, Lynne M.; MacDonald, Maryellen C.

    2011-01-01

    Heavy-NP shift is the tendency for speakers to place long direct object phrases at the end of a clause rather than next to the verb. Though some analyses have focused on length of the direct object phrase alone, results from two experiments demonstrate that the length of the direct object relative to that of other phrases, and not the length of…

  20. Testing resonating vector strength: Auditory system, electric fish, and noise

    NASA Astrophysics Data System (ADS)

    Leo van Hemmen, J.; Longtin, André; Vollmayr, Andreas N.

    2011-12-01

    Quite often a response to some input with a specific frequency ν○ can be described through a sequence of discrete events. Here, we study the synchrony vector, whose length stands for the vector strength, and in doing so focus on neuronal response in terms of spike times. The latter are supposed to be given by experiment. Instead of singling out the stimulus frequency ν○ we study the synchrony vector as a function of the real frequency variable ν. Its length turns out to be a resonating vector strength in that it shows clear maxima in the neighborhood of ν○ and multiples thereof, hence, allowing an easy way of determining response frequencies. We study this "resonating" vector strength for two concrete but rather different cases, viz., a specific midbrain neuron in the auditory system of cat and a primary detector neuron belonging to the electric sense of the wave-type electric fish Apteronotus leptorhynchus. We show that the resonating vector strength always performs a clear resonance correlated with the phase locking that it quantifies. We analyze the influence of noise and demonstrate how well the resonance associated with maximal vector strength indicates the dominant stimulus frequency. Furthermore, we exhibit how one can obtain a specific phase associated with, for instance, a delay in auditory analysis.

  1. Zoom in at African country level: potential climate induced changes in areas of suitability for survival of malaria vectors.

    PubMed

    Tonnang, Henri E Z; Tchouassi, David P; Juarez, Henry S; Igweta, Lilian K; Djouaka, Rousseau F

    2014-05-07

    Predicting anopheles vectors' population densities and boundary shifts is crucial in preparing for malaria risks and unanticipated outbreaks. Although shifts in the distribution and boundaries of the major malaria vectors (Anopheles gambiae s.s. and An. arabiensis) across Africa have been predicted, quantified areas of absolute change in zone of suitability for their survival have not been defined. In this study, we have quantified areas of absolute change conducive for the establishment and survival of these vectors, per African country, under two climate change scenarios and based on our findings, highlight practical measures for effective malaria control in the face of changing climatic patterns. We developed a model using CLIMEX simulation platform to estimate the potential geographical distribution and seasonal abundance of these malaria vectors in relation to climatic factors (temperature, rainfall and relative humidity). The model yielded an eco-climatic index (EI) describing the total favourable geographical locations for the species. The EI values were classified and exported to a GIS package. Using ArcGIS, the EI shape points were clipped to the extent of Africa and then converted to a raster layer using Inverse Distance Weighted (IDW) interpolation method. Generated maps were then transformed into polygon-based geo-referenced data set and their areas computed and expressed in square kilometers (km(2)). Five classes of EI were derived indicating the level of survivorship of these malaria vectors. The proportion of areas increasing or decreasing in level of survival of these malaria vectors will be more pronounced in eastern and southern African countries than those in western Africa. Angola, Ethiopia, Kenya, Mozambique, Tanzania, South Africa and Zambia appear most likely to be affected in terms of absolute change of malaria vectors suitability zones under the selected climate change scenarios. The potential shifts of these malaria vectors have implications for human exposure to malaria, as recrudescence of the disease is likely to be recorded in several new areas and regions. Therefore, the need to develop, compile and share malaria preventive measures, which can be adapted to different climatic scenarios, remains crucial.

  2. Incubation rhythm in the Fulmar Fulmarus glacialis: Annual variation and sex roles

    USGS Publications Warehouse

    Hatch, Scott A.

    1990-01-01

    I monitored the incubation schedules of Fulmars Fulmarus glacialis in an Alaskan colony by observing nests where the male and female were of different colour phases. Complete shifts of up to 16 days were recorded; the average shift in mid-incubation was 4–6 days. Mean shift length was inversely correlated with hatching success in 5 years, suggesting that Fulmars adjusted their foraging patterns to annual differences in food availability. Males assumed the larger share (55%) of incubation on average, and a larger share in years with lower hatching success. Serial correlation in the length of incubation shifts had two components - the influence of prior shift lengths on time spent foraging and individual variation. Failure of the male to relieve the female soon after laying resulted in a few breeding failures and egg losses were associated with exceptionally long shifts throughout incubation.

  3. Generation of an infectious clone of a new Korean isolate of apple chlorotic leaf spot virus (ACLSV) driven by dual 35S and T7 promoters in a versatile binary vector

    USDA-ARS?s Scientific Manuscript database

    The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacter...

  4. Using time-varying asymptotic length and body condition of top piscivores to indicate ecosystem regime shift in the main basin of Lake Huron: a Bayesian hierarchical modeling approach

    USGS Publications Warehouse

    He, Ji X.; Bence, James R.; Roseman, Edward F.; Fielder, David G.; Ebener, Mark P.

    2015-01-01

    We evaluated the ecosystem regime shift in the main basin of Lake Huron that was indicated by the 2003 collapse of alewives, and dramatic declines in Chinook salmon abundance thereafter. We found that the period of 1995-2002 should be considered as the early phase of the final regime shift. We developed two Bayesian hierarchical models to describe time-varying growth based on the von Bertalanffy growth function and the length-mass relationship. We used asymptotic length as an index of growth potential, and predicted body mass at a given length as an index of body condition. Modeling fits to length and body mass at age of lake trout, Chinook salmon, and walleye were excellent. Based on posterior distributions, we evaluated the shifts in among-year geometric means of the growth potential and body condition. For a given top piscivore, one of the two indices responded to the regime shift much earlier than the 2003 collapse of alewives, the other corresponded to the 2003 changes, and which index provided the early signal differed among the three top piscivores.

  5. Path length dependent neutron diffraction peak shifts observed during residual strain measurements in U–8 wt% Mo castings

    DOE PAGES

    Steiner, M. A.; Bunn, J. R.; Einhorn, J. R.; ...

    2017-05-16

    This study reports an angular diffraction peak shift that scales linearly with the neutron beam path length traveled through a diffracting sample. This shift was observed in the context of mapping the residual stress state of a large U–8 wt% Mo casting, as well as during complementary measurements on a smaller casting of the same material. If uncorrected, this peak shift implies a non-physical level of residual stress. A hypothesis for the origin of this shift is presented, based upon non-ideal focusing of the neutron monochromator in combination with changes to the wavelength distribution reaching the detector due to factorsmore » such as attenuation. The magnitude of the shift is observed to vary linearly with the width of the diffraction peak reaching the detector. Consideration of this shift will be important for strain measurements requiring long path lengths through samples with significant attenuation. This effect can probably be reduced by selecting smaller voxel slit widths.« less

  6. Adding localization information in a fingerprint binary feature vector representation

    NASA Astrophysics Data System (ADS)

    Bringer, Julien; Despiegel, Vincent; Favre, Mélanie

    2011-06-01

    At BTAS'10, a new framework to transform a fingerprint minutiae template into a binary feature vector of fixed length is described. A fingerprint is characterized by its similarity with a fixed number set of representative local minutiae vicinities. This approach by representative leads to a fixed length binary representation, and, as the approach is local, it enables to deal with local distortions that may occur between two acquisitions. We extend this construction to incorporate additional information in the binary vector, in particular on localization of the vicinities. We explore the use of position and orientation information. The performance improvement is promising for utilization into fast identification algorithms or into privacy protection algorithms.

  7. Attenuated Human Parainfluenza Virus Type 1 Expressing the Respiratory Syncytial Virus (RSV) Fusion (F) Glycoprotein from an Added Gene: Effects of Prefusion Stabilization and Packaging of RSV F

    PubMed Central

    Liu, Xiang; Liang, Bo; Ngwuta, Joan; Liu, Xueqiao; Surman, Sonja; Lingemann, Matthias; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.

    2017-01-01

    ABSTRACT Human respiratory syncytial virus (RSV) is the most prevalent worldwide cause of severe respiratory tract infection in infants and young children. Human parainfluenza virus type 1 (HPIV1) also causes severe pediatric respiratory illness, especially croup. Both viruses lack vaccines. Here, we describe the preclinical development of a bivalent RSV/HPIV1 vaccine based on a recombinant HPIV1 vector, attenuated by a stabilized mutation, that expresses RSV F protein modified for increased stability in the prefusion (pre-F) conformation by previously described disulfide bond (DS) and hydrophobic cavity-filling (Cav1) mutations. RSV F was expressed from the first or second gene position as the full-length protein or as a chimeric protein with its transmembrane and cytoplasmic tail (TMCT) domains substituted with those of HPIV1 F in an effort to direct packaging in the vector particles. All constructs were recovered by reverse genetics. The TMCT versions of RSV F were packaged in the rHPIV1 particles much more efficiently than their full-length counterparts. In hamsters, the presence of the RSV F gene, and in particular the TMCT versions, was attenuating and resulted in reduced immunogenicity. However, the vector expressing full-length RSV F from the pre-N position was immunogenic for RSV and HPIV1. It conferred complement-independent high-quality RSV-neutralizing antibodies at titers similar to those of wild-type RSV and provided protection against RSV challenge. The vectors exhibited stable RSV F expression in vitro and in vivo. In conclusion, an attenuated rHPIV1 vector expressing a pre-F-stabilized form of RSV F demonstrated promising immunogenicity and should be further developed as an intranasal pediatric vaccine. IMPORTANCE RSV and HPIV1 are major viral causes of acute pediatric respiratory illness for which no vaccines or suitable antiviral drugs are available. The RSV F glycoprotein is the major RSV neutralization antigen. We used a rHPIV1 vector, bearing a stabilized attenuating mutation, to express the RSV F glycoprotein bearing amino acid substitutions that increase its stability in the pre-F form, the most immunogenic form that elicits highly functional virus-neutralizing antibodies. RSV F was expressed from the pre-N or N-P gene position of the rHPIV1 vector as a full-length protein or as a chimeric form with its TMCT domain derived from HPIV1 F. TMCT modification greatly increased packaging of RSV F into the vector particles but also increased vector attenuation in vivo, resulting in reduced immunogenicity. In contrast, full-length RSV F expressed from the pre-N position was immunogenic, eliciting complement-independent RSV-neutralizing antibodies and providing protection against RSV challenge. PMID:28835504

  8. Weak localization of magnons in chiral magnets

    NASA Astrophysics Data System (ADS)

    Evers, Martin; Müller, Cord A.; Nowak, Ulrich

    2018-05-01

    We report on the impact of the Dzyaloshinskii-Moriya interaction on the coherent backscattering of spin waves in a disordered magnetic material. This interaction breaks the inversion symmetry of the spin-wave dispersion relation, such that ωk=ω2 KI-k≠ω-k , where KI is related to the Dzyaloshinskii-Moriya vectors. The nonequivalence of k and -k also means that time-reversal symmetry is broken. As a result of numerical investigations we find that the backscattering peak of a wave packet with initial wave vector k0 shifts from -k0 to 2 KI-k0 , such that the backscattering wave vector and the initial wave vector are in general no longer antiparallel. The shifted coherence condition is explained by a diagrammatic approach and opens up an avenue to measure sign and magnitude of the Dzyaloshinskii-Moriya interaction in weakly disordered chiral magnets. Surprisingly, although time-reversal symmetry is broken, our system shows coherent backscattering as a manifestation of weak localization, which is due to the fact that reciprocity is still preserved.

  9. Identification of Migratory Insects from their Physical Features using a Decision-Tree Support Vector Machine and its Application to Radar Entomology.

    PubMed

    Hu, Cheng; Kong, Shaoyang; Wang, Rui; Long, Teng; Fu, Xiaowei

    2018-04-03

    Migration is a key process in the population dynamics of numerous insect species, including many that are pests or vectors of disease. Identification of insect migrants is critically important to studies of insect migration. Radar is an effective means of monitoring nocturnal insect migrants. However, species identification of migrating insects is often unachievable with current radar technology. Special-purpose entomological radar can measure radar cross-sections (RCSs) from which the insect mass, wingbeat frequency and body length-to-width ratio (a measure of morphological form) can be estimated. These features may be valuable for species identification. This paper explores the identification of insect migrants based on the mass, wingbeat frequency and length-to-width ratio, and body length is also introduced to assess the benefit of adding another variable. A total of 23 species of migratory insects captured by a searchlight trap are used to develop a classification model based on decision-tree support vector machine method. The results reveal that the identification accuracy exceeds 80% for all species if the mass, wingbeat frequency and length-to-width ratio are utilized, and the addition of body length is shown to further increase accuracy. It is also shown that improving the precision of the measurements leads to increased identification accuracy.

  10. Predicted altitudinal shifts and reduced spatial distribution of Leishmania infantum vector species under climate change scenarios in Colombia.

    PubMed

    González, Camila; Paz, Andrea; Ferro, Cristina

    2014-01-01

    Visceral leishmaniasis (VL) is caused by the trypanosomatid parasite Leishmania infantum (=Leishmania chagasi), and is epidemiologically relevant due to its wide geographic distribution, the number of annual cases reported and the increase in its co-infection with HIV. Two vector species have been incriminated in the Americas: Lutzomyia longipalpis and Lutzomyia evansi. In Colombia, L. longipalpis is distributed along the Magdalena River Valley while L. evansi is only found in the northern part of the Country. Regarding the epidemiology of the disease, in Colombia the incidence of VL has decreased over the last few years without any intervention being implemented. Additionally, changes in transmission cycles have been reported with urban transmission occurring in the Caribbean Coast. In Europe and North America climate change seems to be driving a latitudinal shift of leishmaniasis transmission. Here, we explored the spatial distribution of the two known vector species of L. infantum in Colombia and projected its future distribution into climate change scenarios to establish the expansion potential of the disease. An updated database including L. longipalpis and L. evansi collection records from Colombia was compiled. Ecological niche models were performed for each species using the Maxent software and 13 Worldclim bioclimatic coverages. Projections were made for the pessimistic CSIRO A2 scenario, which predicts the higher increase in temperature due to non-emission reduction, and the optimistic Hadley B2 Scenario predicting the minimum increase in temperature. The database contained 23 records for L. evansi and 39 records for L. longipalpis, distributed along the Magdalena River Valley and the Caribbean Coast, where the potential distribution areas of both species were also predicted by Maxent. Climate change projections showed a general overall reduction in the spatial distribution of the two vector species, promoting a shift in altitudinal distribution for L. longipalpis and confining L. evansi to certain regions in the Caribbean Coast. Altitudinal shifts have been reported for cutaneous leishmaniasis vectors in Colombia and Peru. Here, we predict the same outcome for VL vectors in Colombia. Changes in spatial distribution patterns could be affecting local abundances due to climatic pressures on vector populations thus reducing the incidence of human cases. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Resurgent vector-borne diseases as a global health problem.

    PubMed Central

    Gubler, D. J.

    1998-01-01

    Vector-borne infectious diseases are emerging or resurging as a result of changes in public health policy, insecticide and drug resistance, shift in emphasis from prevention to emergency response, demographic and societal changes, and genetic changes in pathogens. Effective prevention strategies can reverse this trend. Research on vaccines, environmentally safe insecticides, alternative approaches to vector control, and training programs for health-care workers are needed. PMID:9716967

  12. Advances in Non-Viral DNA Vectors for Gene Therapy

    PubMed Central

    Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn

    2017-01-01

    Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635

  13. Zoom in at African country level: potential climate induced changes in areas of suitability for survival of malaria vectors

    PubMed Central

    2014-01-01

    Background Predicting anopheles vectors’ population densities and boundary shifts is crucial in preparing for malaria risks and unanticipated outbreaks. Although shifts in the distribution and boundaries of the major malaria vectors (Anopheles gambiae s.s. and An. arabiensis) across Africa have been predicted, quantified areas of absolute change in zone of suitability for their survival have not been defined. In this study, we have quantified areas of absolute change conducive for the establishment and survival of these vectors, per African country, under two climate change scenarios and based on our findings, highlight practical measures for effective malaria control in the face of changing climatic patterns. Methods We developed a model using CLIMEX simulation platform to estimate the potential geographical distribution and seasonal abundance of these malaria vectors in relation to climatic factors (temperature, rainfall and relative humidity). The model yielded an eco-climatic index (EI) describing the total favourable geographical locations for the species. The EI values were classified and exported to a GIS package. Using ArcGIS, the EI shape points were clipped to the extent of Africa and then converted to a raster layer using Inverse Distance Weighted (IDW) interpolation method. Generated maps were then transformed into polygon-based geo-referenced data set and their areas computed and expressed in square kilometers (km2). Results Five classes of EI were derived indicating the level of survivorship of these malaria vectors. The proportion of areas increasing or decreasing in level of survival of these malaria vectors will be more pronounced in eastern and southern African countries than those in western Africa. Angola, Ethiopia, Kenya, Mozambique, Tanzania, South Africa and Zambia appear most likely to be affected in terms of absolute change of malaria vectors suitability zones under the selected climate change scenarios. Conclusion The potential shifts of these malaria vectors have implications for human exposure to malaria, as recrudescence of the disease is likely to be recorded in several new areas and regions. Therefore, the need to develop, compile and share malaria preventive measures, which can be adapted to different climatic scenarios, remains crucial. PMID:24885061

  14. The Performance of the NAS HSPs in 1st Half of 1994

    NASA Technical Reports Server (NTRS)

    Bergeron, Robert J.; Walter, Howard (Technical Monitor)

    1995-01-01

    During the first six months of 1994, the NAS (National Airspace System) 16-CPU Y-MP C90 Von Neumann (VN) delivered an average throughput of 4.045 GFLOPS while the ACSF (Aeronautics Consolidated Supercomputer Facility) 8-CPU Y-MP C90 Eagle averaged 1.658 GFLOPS. The VN rate represents a machine efficiency of 26.3% whereas the Eagle rate corresponds to a machine efficiency of 21.6%. VN displayed a greater efficiency than Eagle primarily because the stronger workload demand for its CPU cycles allowed it to devote more time to user programs and less time to idle. An additional factor increasing VN efficiency was the ability of the UNICOS 8.0 Operating System to deliver a larger fraction of CPU time to user programs. Although measurements indicate increasing vector length for both workloads, insufficient vector lengths continue to hinder HSP (High Speed Processor) performance. To improve HSP performance, NAS should continue to encourage the HSP users to modify their codes to increase program vector length.

  15. Optical Fibers Would Sense Local Strains

    NASA Technical Reports Server (NTRS)

    Egalon, Claudio O.; Rogowski, Robert S.

    1994-01-01

    Proposed fiber-optic transducers measure local strains. Includes lead-in and lead-out lengths producing no changes in phase shifts, plus short sensing length in which phase shift is sensitive to strain. Phase shifts in single-mode fibers vary with strains. In alternative version, multiple portions of optical fiber sensitive to strains characteristic of specific vibrational mode of object. Same principle also used with two-mode fiber.

  16. Reduction in fecundity and shifts in cellular processes by a native virus on an invasive insect

    USDA-ARS?s Scientific Manuscript database

    Pathogens and their vectors have co-evolutionary histories that are intricately intertwined with their ecologies, environments and genetic interactions. The majority of non-persistently transmitted plant viruses are transmitted by aphid species. One important aphid vector in soybean-growing regions ...

  17. Global positioning system measurements for crustal deformation: Precision and accuracy

    USGS Publications Warehouse

    Prescott, W.H.; Davis, J.L.; Svarc, J.L.

    1989-01-01

    Analysis of 27 repeated observations of Global Positioning System (GPS) position-difference vectors, up to 11 kilometers in length, indicates that the standard deviation of the measurements is 4 millimeters for the north component, 6 millimeters for the east component, and 10 to 20 millimeters for the vertical component. The uncertainty grows slowly with increasing vector length. At 225 kilometers, the standard deviation of the measurement is 6, 11, and 40 millimeters for the north, east, and up components, respectively. Measurements with GPS and Geodolite, an electromagnetic distance-measuring system, over distances of 10 to 40 kilometers agree within 0.2 part per million. Measurements with GPS and very long baseline interferometry of the 225-kilometer vector agree within 0.05 part per million.

  18. Klein tunneling in Weyl semimetals under the influence of magnetic field.

    PubMed

    Yesilyurt, Can; Tan, Seng Ghee; Liang, Gengchiau; Jalil, Mansoor B A

    2016-12-12

    Klein tunneling refers to the absence of normal backscattering of electrons even under the case of high potential barriers. At the barrier interface, the perfect matching of electron and hole wavefunctions enables a unit transmission probability for normally incident electrons. It is theoretically and experimentally well understood in two-dimensional relativistic materials such as graphene. Here we investigate the Klein tunneling effect in Weyl semimetals under the influence of magnetic field induced by ferromagnetic stripes placed at barrier boundaries. Our results show that the resonance of Fermi wave vector at specific barrier lengths gives rise to perfect transmission rings, i.e., three-dimensional analogue of the so-called magic transmission angles in two-dimensional Dirac semimetals. Besides, the transmission profile can be shifted by application of magnetic field in the central region, a property which may be utilized in electro-optic applications. When the applied potential is close to the Fermi level, a particular incident vector can be selected by tuning the magnetic field, thus enabling highly selective transmission of electrons in the bulk of Weyl semimetals. Our analytical and numerical calculations obtained by considering Dirac electrons in three regions and using experimentally feasible parameters can pave the way for relativistic tunneling applications in Weyl semimetals.

  19. 3D temporal subtraction on multislice CT images using nonlinear warping technique

    NASA Astrophysics Data System (ADS)

    Ishida, Takayuki; Katsuragawa, Shigehiko; Kawashita, Ikuo; Kim, Hyounseop; Itai, Yoshinori; Awai, Kazuo; Li, Qiang; Doi, Kunio

    2007-03-01

    The detection of very subtle lesions and/or lesions overlapped with vessels on CT images is a time consuming and difficult task for radiologists. In this study, we have developed a 3D temporal subtraction method to enhance interval changes between previous and current multislice CT images based on a nonlinear image warping technique. Our method provides a subtraction CT image which is obtained by subtraction of a previous CT image from a current CT image. Reduction of misregistration artifacts is important in the temporal subtraction method. Therefore, our computerized method includes global and local image matching techniques for accurate registration of current and previous CT images. For global image matching, we selected the corresponding previous section image for each current section image by using 2D cross-correlation between a blurred low-resolution current CT image and a blurred previous CT image. For local image matching, we applied the 3D template matching technique with translation and rotation of volumes of interests (VOIs) which were selected in the current and the previous CT images. The local shift vector for each VOI pair was determined when the cross-correlation value became the maximum in the 3D template matching. The local shift vectors at all voxels were determined by interpolation of shift vectors of VOIs, and then the previous CT image was nonlinearly warped according to the shift vector for each voxel. Finally, the warped previous CT image was subtracted from the current CT image. The 3D temporal subtraction method was applied to 19 clinical cases. The normal background structures such as vessels, ribs, and heart were removed without large misregistration artifacts. Thus, interval changes due to lung diseases were clearly enhanced as white shadows on subtraction CT images.

  20. Video data compression using artificial neural network differential vector quantization

    NASA Technical Reports Server (NTRS)

    Krishnamurthy, Ashok K.; Bibyk, Steven B.; Ahalt, Stanley C.

    1991-01-01

    An artificial neural network vector quantizer is developed for use in data compression applications such as Digital Video. Differential Vector Quantization is used to preserve edge features, and a new adaptive algorithm, known as Frequency-Sensitive Competitive Learning, is used to develop the vector quantizer codebook. To develop real time performance, a custom Very Large Scale Integration Application Specific Integrated Circuit (VLSI ASIC) is being developed to realize the associative memory functions needed in the vector quantization algorithm. By using vector quantization, the need for Huffman coding can be eliminated, resulting in superior performance against channel bit errors than methods that use variable length codes.

  1. Estimation of Discontinuous Displacement Vector Fields with the Minimum Description Length Criterion.

    DTIC Science & Technology

    1990-10-01

    type of approach for finding a dense displacement vector field has a time complexity that allows a real - time implementation when an appropriate control...hardly vector fields as they appear in Stereo or motion. The reason for this is the fact that local displacement vector field ( DVF ) esti- mates bave...2 objects’ motion, but that the quantitative optical flow is not a reliable measure of the real motion [VP87, SU87]. This applies even more to the

  2. Attenuated Human Parainfluenza Virus Type 1 Expressing the Respiratory Syncytial Virus (RSV) Fusion (F) Glycoprotein from an Added Gene: Effects of Prefusion Stabilization and Packaging of RSV F.

    PubMed

    Liu, Xiang; Liang, Bo; Ngwuta, Joan; Liu, Xueqiao; Surman, Sonja; Lingemann, Matthias; Kwong, Peter D; Graham, Barney S; Collins, Peter L; Munir, Shirin

    2017-11-15

    Human respiratory syncytial virus (RSV) is the most prevalent worldwide cause of severe respiratory tract infection in infants and young children. Human parainfluenza virus type 1 (HPIV1) also causes severe pediatric respiratory illness, especially croup. Both viruses lack vaccines. Here, we describe the preclinical development of a bivalent RSV/HPIV1 vaccine based on a recombinant HPIV1 vector, attenuated by a stabilized mutation, that expresses RSV F protein modified for increased stability in the prefusion (pre-F) conformation by previously described disulfide bond (DS) and hydrophobic cavity-filling (Cav1) mutations. RSV F was expressed from the first or second gene position as the full-length protein or as a chimeric protein with its transmembrane and cytoplasmic tail (TMCT) domains substituted with those of HPIV1 F in an effort to direct packaging in the vector particles. All constructs were recovered by reverse genetics. The TMCT versions of RSV F were packaged in the rHPIV1 particles much more efficiently than their full-length counterparts. In hamsters, the presence of the RSV F gene, and in particular the TMCT versions, was attenuating and resulted in reduced immunogenicity. However, the vector expressing full-length RSV F from the pre-N position was immunogenic for RSV and HPIV1. It conferred complement-independent high-quality RSV-neutralizing antibodies at titers similar to those of wild-type RSV and provided protection against RSV challenge. The vectors exhibited stable RSV F expression in vitro and in vivo In conclusion, an attenuated rHPIV1 vector expressing a pre-F-stabilized form of RSV F demonstrated promising immunogenicity and should be further developed as an intranasal pediatric vaccine. IMPORTANCE RSV and HPIV1 are major viral causes of acute pediatric respiratory illness for which no vaccines or suitable antiviral drugs are available. The RSV F glycoprotein is the major RSV neutralization antigen. We used a rHPIV1 vector, bearing a stabilized attenuating mutation, to express the RSV F glycoprotein bearing amino acid substitutions that increase its stability in the pre-F form, the most immunogenic form that elicits highly functional virus-neutralizing antibodies. RSV F was expressed from the pre-N or N-P gene position of the rHPIV1 vector as a full-length protein or as a chimeric form with its TMCT domain derived from HPIV1 F. TMCT modification greatly increased packaging of RSV F into the vector particles but also increased vector attenuation in vivo , resulting in reduced immunogenicity. In contrast, full-length RSV F expressed from the pre-N position was immunogenic, eliciting complement-independent RSV-neutralizing antibodies and providing protection against RSV challenge. Copyright © 2017 American Society for Microbiology.

  3. Shifts in malaria vector species composition and transmission dynamics along the Kenyan coast over the past 20 years.

    PubMed

    Mwangangi, Joseph M; Mbogo, Charles M; Orindi, Benedict O; Muturi, Ephantus J; Midega, Janet T; Nzovu, Joseph; Gatakaa, Hellen; Githure, John; Borgemeister, Christian; Keating, Joseph; Beier, John C

    2013-01-08

    Over the past 20 years, numerous studies have investigated the ecology and behaviour of malaria vectors and Plasmodium falciparum malaria transmission on the coast of Kenya. Substantial progress has been made to control vector populations and reduce high malaria prevalence and severe disease. The goal of this paper was to examine trends over the past 20 years in Anopheles species composition, density, blood-feeding behaviour, and P. falciparum sporozoite transmission along the coast of Kenya. Using data collected from 1990 to 2010, vector density, species composition, blood-feeding patterns, and malaria transmission intensity was examined along the Kenyan coast. Mosquitoes were identified to species, based on morphological characteristics and DNA extracted from Anopheles gambiae for amplification. Using negative binomial generalized estimating equations, mosquito abundance over the period were modelled while adjusting for season. A multiple logistic regression model was used to analyse the sporozoite rates. Results show that in some areas along the Kenyan coast, Anopheles arabiensis and Anopheles merus have replaced An. gambiae sensu stricto (s.s.) and Anopheles funestus as the major mosquito species. Further, there has been a shift from human to animal feeding for both An. gambiae sensu lato (s.l.) (99% to 16%) and An. funestus (100% to 3%), and P. falciparum sporozoite rates have significantly declined over the last 20 years, with the lowest sporozoite rates being observed in 2007 (0.19%) and 2008 (0.34%). There has been, on average, a significant reduction in the abundance of An. gambiae s.l. over the years (IRR = 0.94, 95% CI 0.90-0.98), with the density standing at low levels of an average 0.006 mosquitoes/house in the year 2010. Reductions in the densities of the major malaria vectors and a shift from human to animal feeding have contributed to the decreased burden of malaria along the Kenyan coast. Vector species composition remains heterogeneous but in many areas An. arabiensis has replaced An. gambiae as the major malaria vector. This has important implications for malaria epidemiology and control given that this vector predominately rests and feeds on humans outdoors. Strategies for vector control need to continue focusing on tools for protecting residents inside houses but additionally employ outdoor control tools because these are essential for further reducing the levels of malaria transmission.

  4. Digital Biological Converter

    DTIC Science & Technology

    2013-06-28

    of cuts that each fragment should be cut into so the fragments are no greater than a specific length threshold. Additionally, vector sequences and...restriction sites are attached to each fragment while ensuring the restriction sites are unique to each sequence. The vector sequences serve as hooks...for assembly into vector for cloning purposes, and also as primer binding domains for PCR ampl ification. The restriction sites are added to

  5. Use of exocentric and egocentric representations in the concurrent planning of sequential saccades.

    PubMed

    Sharika, K M; Ramakrishnan, Arjun; Murthy, Aditya

    2014-11-26

    The concurrent planning of sequential saccades offers a simple model to study the nature of visuomotor transformations since the second saccade vector needs to be remapped to foveate the second target following the first saccade. Remapping is thought to occur through egocentric mechanisms involving an efference copy of the first saccade that is available around the time of its onset. In contrast, an exocentric representation of the second target relative to the first target, if available, can be used to directly code the second saccade vector. While human volunteers performed a modified double-step task, we examined the role of exocentric encoding in concurrent saccade planning by shifting the first target location well before the efference copy could be used by the oculomotor system. The impact of the first target shift on concurrent processing was tested by examining the end-points of second saccades following a shift of the second target during the first saccade. The frequency of second saccades to the old versus new location of the second target, as well as the propagation of first saccade localization errors, both indices of concurrent processing, were found to be significantly reduced in trials with the first target shift compared to those without it. A similar decrease in concurrent processing was obtained when we shifted the first target but kept constant the second saccade vector. Overall, these results suggest that the brain can use relatively stable visual landmarks, independent of efference copy-based egocentric mechanisms, for concurrent planning of sequential saccades. Copyright © 2014 the authors 0270-6474/14/3416009-13$15.00/0.

  6. Noise-like pulse trapping in a figure-eight fiber laser.

    PubMed

    Luo, Ai-Ping; Luo, Zhi-Chao; Liu, Hao; Zheng, Xu-Wu; Ning, Qiu-Yi; Zhao, Nian; Chen, Wei-Cheng; Xu, Wen-Cheng

    2015-04-20

    We report on the trapping of noise-like pulse in a figure-eight fiber laser mode locked by nonlinear amplifier loop mirror (NALM). After achievement of noise-like vector pulse, it was found that the wavelength shift of the two resolved polarization components responsible for the pulse trapping was very sensitive to the cavity birefringence. By properly rotating the polarization controllers (PCs), the wavelength shift could be up to 4.8 nm, which is much larger than that of conventional soliton trapping. The observed results would shed some light on the fundamental physics of noise-like pulse as well as its vector features in fiber lasers.

  7. Vibration responses of h-BN sheet to charge doping and external strain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Wei; Yang, Yu; Zheng, Fawei

    2013-12-07

    Based on density functional theory and density functional perturbation theory calculations, we systematically investigate the vibration responses of h-BN sheet to charge doping and external strains. It is found that under hole doping, the phonon frequencies of the ZO and TO branches at different wave vector q shift linearly with different slopes. Under electron doping, although the phonon frequencies shift irregularly, the shifting values are different at different phonon wave vectors. Interestingly, we find that external strain can restrain the irregular vibration responses of h-BN sheet to electron doping. The critical factor is revealed to be the relative position ofmore » the nearly free electron and boron p{sub z} states of h-BN sheet. Under external strains, the vibration responses of h-BN sheet are also found to be highly dependent on the phonon branches. Different vibration modes at different q points are revealed to be responsible for the vibration responses of h-BN sheet to charge doping and external strain. Our results point out a new way to detect the doping or strain status of h-BN sheet by measuring the vibration frequencies at different wave vector.« less

  8. [Orthogonal Vector Projection Algorithm for Spectral Unmixing].

    PubMed

    Song, Mei-ping; Xu, Xing-wei; Chang, Chein-I; An, Ju-bai; Yao, Li

    2015-12-01

    Spectrum unmixing is an important part of hyperspectral technologies, which is essential for material quantity analysis in hyperspectral imagery. Most linear unmixing algorithms require computations of matrix multiplication and matrix inversion or matrix determination. These are difficult for programming, especially hard for realization on hardware. At the same time, the computation costs of the algorithms increase significantly as the number of endmembers grows. Here, based on the traditional algorithm Orthogonal Subspace Projection, a new method called. Orthogonal Vector Projection is prompted using orthogonal principle. It simplifies this process by avoiding matrix multiplication and inversion. It firstly computes the final orthogonal vector via Gram-Schmidt process for each endmember spectrum. And then, these orthogonal vectors are used as projection vector for the pixel signature. The unconstrained abundance can be obtained directly by projecting the signature to the projection vectors, and computing the ratio of projected vector length and orthogonal vector length. Compared to the Orthogonal Subspace Projection and Least Squares Error algorithms, this method does not need matrix inversion, which is much computation costing and hard to implement on hardware. It just completes the orthogonalization process by repeated vector operations, easy for application on both parallel computation and hardware. The reasonability of the algorithm is proved by its relationship with Orthogonal Sub-space Projection and Least Squares Error algorithms. And its computational complexity is also compared with the other two algorithms', which is the lowest one. At last, the experimental results on synthetic image and real image are also provided, giving another evidence for effectiveness of the method.

  9. GNSS Single Frequency, Single Epoch Reliable Attitude Determination Method with Baseline Vector Constraint.

    PubMed

    Gong, Ang; Zhao, Xiubin; Pang, Chunlei; Duan, Rong; Wang, Yong

    2015-12-02

    For Global Navigation Satellite System (GNSS) single frequency, single epoch attitude determination, this paper proposes a new reliable method with baseline vector constraint. First, prior knowledge of baseline length, heading, and pitch obtained from other navigation equipment or sensors are used to reconstruct objective function rigorously. Then, searching strategy is improved. It substitutes gradually Enlarged ellipsoidal search space for non-ellipsoidal search space to ensure correct ambiguity candidates are within it and make the searching process directly be carried out by least squares ambiguity decorrelation algorithm (LAMBDA) method. For all vector candidates, some ones are further eliminated by derived approximate inequality, which accelerates the searching process. Experimental results show that compared to traditional method with only baseline length constraint, this new method can utilize a priori baseline three-dimensional knowledge to fix ambiguity reliably and achieve a high success rate. Experimental tests also verify it is not very sensitive to baseline vector error and can perform robustly when angular error is not great.

  10. The Probability of Exceedance as a Nonparametric Person-Fit Statistic for Tests of Moderate Length

    ERIC Educational Resources Information Center

    Tendeiro, Jorge N.; Meijer, Rob R.

    2013-01-01

    To classify an item score pattern as not fitting a nonparametric item response theory (NIRT) model, the probability of exceedance (PE) of an observed response vector x can be determined as the sum of the probabilities of all response vectors that are, at most, as likely as x, conditional on the test's total score. Vector x is to be considered…

  11. Scaling behavior of nonisothermal phase separation.

    PubMed

    Rüllmann, Max; Alig, Ingo

    2004-04-22

    The phase separation process in a critical mixture of polydimethylsiloxane and polyethylmethylsiloxane (PDMS/PEMS, a system with an upper critical solution temperature) was investigated by time-resolved light scattering during continuous quenches from the one-phase into the two-phase region. Continuous quenches were realized by cooling ramps with different cooling rates kappa. Phase separation kinetics is studied by means of the temporal evolution of the scattering vector qm and the intensity Im at the scattering peak. The curves qm(t) for different cooling rates can be shifted onto a single mastercurve. The curves Im(t) show similar behavior. As shift factors, a characteristic length Lc and a characteristic time tc are introduced. Both characteristic quantities depend on the cooling rate through power laws: Lc approximately kappa(-delta) and tc approximately kappa(-rho). Scaling behavior in isothermal critical demixing is well known. There the temporal evolutions of qm and Im for different quench depths DeltaT can be scaled with the correlation length xi and the interdiffusion coefficient D, both depending on DeltaT through critical power laws. We show in this paper that the cooling rate scaling in nonisothermal demixing is a consequence of the quench depth scaling in the isothermal case. The exponents delta and rho are related to the critical exponents nu and nu* of xi and D, respectively. The structure growth during nonisothermal demixing can be described with a semiempirical model based on the hydrodynamic coarsening mechanism well known in the isothermal case. In very late stages of nonisothermal phase separation a secondary scattering maximum appears. This is due to secondary demixing. We explain the onset of secondary demixing by a competition between interdiffusion and coarsening. (c) 2004 American Institute of Physics

  12. Genetic stability of gene targeted immunoglobulin loci. I. Heavy chain isotype exchange induced by a universal gene replacement vector.

    PubMed Central

    Kardinal, C; Selmayr, M; Mocikat, R

    1996-01-01

    Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation. Images Figure 2 PMID:8958041

  13. Genetic stability of gene targeted immunoglobulin loci. I. Heavy chain isotype exchange induced by a universal gene replacement vector.

    PubMed

    Kardinal, C; Selmayr, M; Mocikat, R

    1996-11-01

    Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.

  14. Summary of Fluidic Thrust Vectoring Research Conducted at NASA Langley Research Center

    NASA Technical Reports Server (NTRS)

    Deere, Karen A.

    2003-01-01

    Interest in low-observable aircraft and in lowering an aircraft's exhaust system weight sparked decades of research for fixed geometry exhaust nozzles. The desire for such integrated exhaust nozzles was the catalyst for new fluidic control techniques; including throat area control, expansion control, and thrust-vector angle control. This paper summarizes a variety of fluidic thrust vectoring concepts that have been tested both experimentally and computationally at NASA Langley Research Center. The nozzle concepts are divided into three categories according to the method used for fluidic thrust vectoring: the shock vector control method, the throat shifting method, and the counterflow method. This paper explains the thrust vectoring mechanism for each fluidic method, provides examples of configurations tested for each method, and discusses the advantages and disadvantages of each method.

  15. Sympatric diversification vs. immigration: deciphering host-plant specialization in a polyphagous insect, the stolbur phytoplasma vector Hyalesthes obsoletus (Cixiidae).

    PubMed

    Imo, Miriam; Maixner, Michael; Johannesen, Jes

    2013-04-01

    The epidemiology of vector transmitted plant diseases is highly influenced by dispersal and the host-plant range of the vector. Widening the vector's host range may increase transmission potential, whereas specialization may induce specific disease cycles. The process leading to a vector's host shift and its epidemiological outcome is therefore embedded in the frameworks of sympatric evolution vs. immigration of preadapted populations. In this study, we analyse whether a host shift of the stolbur phytoplasma vector, Hyalesthes obsoletus from field bindweed to stinging nettle in its northern distribution range evolved sympatrically or by immigration. The exploitation of stinging nettle has led to outbreaks of the grapevine disease bois noir caused by a stinging nettle-specific phytoplasma strain. Microsatellite data from populations from northern and ancestral ranges provide strong evidence for sympatric host-race evolution in the northern range: Host-plant associated populations were significantly differentiated among syntopic sites (0.054 < F(HT) < 0.098) and constant over 5 years. While gene flow was asymmetric from the old into the predicted new host race, which had significantly reduced genetic diversity, the genetic identity between syntopic host-race populations in the northern range was higher than between these populations and syntopic populations in ancestral ranges, where there was no evidence for genetic host races. Although immigration was detected in the northern field bindweed population, it cannot explain host-race diversification but suggests the introduction of a stinging nettle-specific phytoplasma strain by plant-unspecific vectors. The evolution of host races in the northern range has led to specific vector-based bois noir disease cycles. © 2013 Blackwell Publishing Ltd.

  16. Simultaneously frequency down-conversion, independent multichannel phase shifting and zero-IF receiving using a phase modulator in a sagnac loop and balanced detection

    NASA Astrophysics Data System (ADS)

    Zhu, Zihang; Zhao, Shanghong; Li, Xuan; Lin, Tao; Hu, Dapeng

    2018-03-01

    Photonic microwave frequency down-conversion with independent multichannel phase shifting and zero-intermediate frequency (IF) receiving is proposed and demonstrated by simulation. By combined use of a phase modulator (PM) in a sagnac loop and an optical bandpass filter (OBPF), orthogonal polarized carrier suppression single sideband (CS-SSB) signals are obtained. By adjusting the polarization controllers (PCs) to introduce the phase difference in the optical domain and using balanced detection to eliminate the direct current components, the phase of the generated IF signal can be arbitrarily tuned. Besides, the radio frequency (RF) vector signal can be also frequency down-converted to baseband directly by choosing two quadrature channels. In the simulation, high gain and continuously tunable phase shifts over the 360 degree range are verified. Furthermore, 2.5 Gbit/s RF vector signals centered at 10 GHz with different modulation formats are successfully demodulated.

  17. Red-shifted fluorescent proteins mPlum and mRaspberry and polynucleotides encoding the same

    DOEpatents

    Tsien, Roger Y [La Jolla, CA; Wang, Lei [San Diego, CA

    2008-07-01

    Methods using somatic hypermutation (SHM) for producing polypeptide and nucleic acid variants, and nucleic acids encoding such polypeptide variants are disclosed. Such variants may have desired properties. Also disclosed are novel polypeptides, such as improved fluorescent proteins, produced by the novel methods, and nucleic acids, vectors, and host cells comprising such vectors.

  18. Spatially-Explicit Simulation Modeling of Ecological Response to Climate Change: Methodological Considerations in Predicting Shifting Population Dynamics of Infectious Disease Vectors.

    PubMed

    Dhingra, Radhika; Jimenez, Violeta; Chang, Howard H; Gambhir, Manoj; Fu, Joshua S; Liu, Yang; Remais, Justin V

    2013-09-01

    Poikilothermic disease vectors can respond to altered climates through spatial changes in both population size and phenology. Quantitative descriptors to characterize, analyze and visualize these dynamic responses are lacking, particularly across large spatial domains. In order to demonstrate the value of a spatially explicit, dynamic modeling approach, we assessed spatial changes in the population dynamics of Ixodes scapularis , the Lyme disease vector, using a temperature-forced population model simulated across a grid of 4 × 4 km cells covering the eastern United States, using both modeled (Weather Research and Forecasting (WRF) 3.2.1) baseline/current (2001-2004) and projected (Representative Concentration Pathway (RCP) 4.5 and RCP 8.5; 2057-2059) climate data. Ten dynamic population features (DPFs) were derived from simulated populations and analyzed spatially to characterize the regional population response to current and future climate across the domain. Each DPF under the current climate was assessed for its ability to discriminate observed Lyme disease risk and known vector presence/absence, using data from the US Centers for Disease Control and Prevention. Peak vector population and month of peak vector population were the DPFs that performed best as predictors of current Lyme disease risk. When examined under baseline and projected climate scenarios, the spatial and temporal distributions of DPFs shift and the seasonal cycle of key questing life stages is compressed under some scenarios. Our results demonstrate the utility of spatial characterization, analysis and visualization of dynamic population responses-including altered phenology-of disease vectors to altered climate.

  19. Spatially-Explicit Simulation Modeling of Ecological Response to Climate Change: Methodological Considerations in Predicting Shifting Population Dynamics of Infectious Disease Vectors

    PubMed Central

    Dhingra, Radhika; Jimenez, Violeta; Chang, Howard H.; Gambhir, Manoj; Fu, Joshua S.; Liu, Yang; Remais, Justin V.

    2014-01-01

    Poikilothermic disease vectors can respond to altered climates through spatial changes in both population size and phenology. Quantitative descriptors to characterize, analyze and visualize these dynamic responses are lacking, particularly across large spatial domains. In order to demonstrate the value of a spatially explicit, dynamic modeling approach, we assessed spatial changes in the population dynamics of Ixodes scapularis, the Lyme disease vector, using a temperature-forced population model simulated across a grid of 4 × 4 km cells covering the eastern United States, using both modeled (Weather Research and Forecasting (WRF) 3.2.1) baseline/current (2001–2004) and projected (Representative Concentration Pathway (RCP) 4.5 and RCP 8.5; 2057–2059) climate data. Ten dynamic population features (DPFs) were derived from simulated populations and analyzed spatially to characterize the regional population response to current and future climate across the domain. Each DPF under the current climate was assessed for its ability to discriminate observed Lyme disease risk and known vector presence/absence, using data from the US Centers for Disease Control and Prevention. Peak vector population and month of peak vector population were the DPFs that performed best as predictors of current Lyme disease risk. When examined under baseline and projected climate scenarios, the spatial and temporal distributions of DPFs shift and the seasonal cycle of key questing life stages is compressed under some scenarios. Our results demonstrate the utility of spatial characterization, analysis and visualization of dynamic population responses—including altered phenology—of disease vectors to altered climate. PMID:24772388

  20. Predicting the effect of climate change on African trypanosomiasis: integrating epidemiology with parasite and vector biology

    PubMed Central

    Moore, Sean; Shrestha, Sourya; Tomlinson, Kyle W.; Vuong, Holly

    2012-01-01

    Climate warming over the next century is expected to have a large impact on the interactions between pathogens and their animal and human hosts. Vector-borne diseases are particularly sensitive to warming because temperature changes can alter vector development rates, shift their geographical distribution and alter transmission dynamics. For this reason, African trypanosomiasis (sleeping sickness), a vector-borne disease of humans and animals, was recently identified as one of the 12 infectious diseases likely to spread owing to climate change. We combine a variety of direct effects of temperature on vector ecology, vector biology and vector–parasite interactions via a disease transmission model and extrapolate the potential compounding effects of projected warming on the epidemiology of African trypanosomiasis. The model predicts that epidemics can occur when mean temperatures are between 20.7°C and 26.1°C. Our model does not predict a large-range expansion, but rather a large shift of up to 60 per cent in the geographical extent of the range. The model also predicts that 46–77 million additional people may be at risk of exposure by 2090. Future research could expand our analysis to include other environmental factors that influence tsetse populations and disease transmission such as humidity, as well as changes to human, livestock and wildlife distributions. The modelling approach presented here provides a framework for using the climate-sensitive aspects of vector and pathogen biology to predict changes in disease prevalence and risk owing to climate change. PMID:22072451

  1. Pollinator shifts and the evolution of spur length in the moth-pollinated orchid Platanthera bifolia.

    PubMed

    Boberg, Elin; Alexandersson, Ronny; Jonsson, Magdalena; Maad, Johanne; Ågren, Jon; Nilsson, L Anders

    2014-01-01

    Plant-pollinator interactions are thought to have shaped much of floral evolution. Yet the relative importance of pollinator shifts and coevolutionary interactions for among-population variation in floral traits in animal-pollinated species is poorly known. This study examined the adaptive significance of spur length in the moth-pollinated orchid Platanthera bifolia. Geographical variation in the length of the floral spur of P. bifolia was documented in relation to variation in the pollinator fauna across Scandinavia, and a reciprocal translocation experiment was conducted in south-east Sweden between a long-spurred woodland population and a short-spurred grassland population. Spur length and pollinator fauna varied among regions and habitats, and spur length was positively correlated with the proboscis length of local pollinators. In the reciprocal translocation experiment, long-spurred woodland plants had higher pollination success than short-spurred grassland plants at the woodland site, while no significant difference was observed at the grassland site. The results are consistent with the hypothesis that optimal floral phenotype varies with the morphology of the local pollinators, and that the evolution of spur length in P. bifolia has been largely driven by pollinator shifts.

  2. Pollinator shifts and the evolution of spur length in the moth-pollinated orchid Platanthera bifolia

    PubMed Central

    Boberg, Elin; Alexandersson, Ronny; Jonsson, Magdalena; Maad, Johanne; Ågren, Jon; Nilsson, L. Anders

    2014-01-01

    Background and Aims Plant–pollinator interactions are thought to have shaped much of floral evolution. Yet the relative importance of pollinator shifts and coevolutionary interactions for among-population variation in floral traits in animal-pollinated species is poorly known. This study examined the adaptive significance of spur length in the moth-pollinated orchid Platanthera bifolia. Methods Geographical variation in the length of the floral spur of P. bifolia was documented in relation to variation in the pollinator fauna across Scandinavia, and a reciprocal translocation experiment was conducted in south-east Sweden between a long-spurred woodland population and a short-spurred grassland population. Key Results Spur length and pollinator fauna varied among regions and habitats, and spur length was positively correlated with the proboscis length of local pollinators. In the reciprocal translocation experiment, long-spurred woodland plants had higher pollination success than short-spurred grassland plants at the woodland site, while no significant difference was observed at the grassland site. Conclusions The results are consistent with the hypothesis that optimal floral phenotype varies with the morphology of the local pollinators, and that the evolution of spur length in P. bifolia has been largely driven by pollinator shifts. PMID:24169591

  3. Propagation of partially coherent vector anomalous vortex beam in turbulent atmosphere

    NASA Astrophysics Data System (ADS)

    Zhang, Xu; Wang, Haiyan; Tang, Lei

    2018-01-01

    A theoretical model is proposed to describe a partially coherent vector anomalous vortex(AV) beam. Based on the extended Huygens-Fresnel principle, analytical propagation formula for the proposed beams in turbulent atmosphere is derived. The spectral properties of the partially coherent vector AV beam are explored by using the unified theory of coherence and polarization in detail. It is interesting to find that the turbulence of atmosphere and the source parameter of the partially coherent vector AV beam( order, topological charge, coherence length, beam waist size etc) have significantly impacted the propagation properties of the partially coherent vector AV beam in turbulent atmosphere.

  4. West Nile Virus Epidemics in North America Are Driven by Shifts in Mosquito Feeding Behavior

    PubMed Central

    Kramer, Laura D; Jones, Matthew J; Marra, Peter P; Daszak, Peter

    2006-01-01

    West Nile virus (WNV) has caused repeated large-scale human epidemics in North America since it was first detected in 1999 and is now the dominant vector-borne disease in this continent. Understanding the factors that determine the intensity of the spillover of this zoonotic pathogen from birds to humans (via mosquitoes) is a prerequisite for predicting and preventing human epidemics. We integrated mosquito feeding behavior with data on the population dynamics and WNV epidemiology of mosquitoes, birds, and humans. We show that Culex pipiens, the dominant enzootic (bird-to-bird) and bridge (bird-to-human) vector of WNV in urbanized areas in the northeast and north-central United States, shifted its feeding preferences from birds to humans by 7-fold during late summer and early fall, coinciding with the dispersal of its preferred host (American robins, Turdus migratorius) and the rise in human WNV infections. We also show that feeding shifts in Cx. tarsalis amplify human WNV epidemics in Colorado and California and occur during periods of robin dispersal and migration. Our results provide a direct explanation for the timing and intensity of human WNV epidemics. Shifts in feeding from competent avian hosts early in an epidemic to incompetent humans after mosquito infection prevalences are high result in synergistic effects that greatly amplify the number of human infections of this and other pathogens. Our results underscore the dramatic effects of vector behavior in driving the transmission of zoonotic pathogens to humans. PMID:16494532

  5. Measurement of operator workload in an information processing task

    NASA Technical Reports Server (NTRS)

    Jenney, L. L.; Older, H. J.; Cameron, B. J.

    1972-01-01

    This was an experimental study to develop an improved methodology for measuring workload in an information processing task and to assess the effects of shift length and communication density (rate of information flow) on the ability to process and classify verbal messages. Each of twelve subjects was exposed to combinations of three shift lengths and two communication densities in a counterbalanced, repeated measurements experimental design. Results indicated no systematic variation in task performance measures or in other dependent measures as a function of shift length or communication density. This is attributed to the absence of a secondary loading task, an insufficiently taxing work schedule, and the lack of psychological stress. Subjective magnitude estimates of workload showed fatigue (and to a lesser degree, tension) to be a power function of shift length. Estimates of task difficulty and fatigue were initially lower but increased more sharply over time under low density than under high density conditions. An interpretation of findings and recommedations for furture research are included. This research has major implications to human workload problems in information processing of air traffic control verbal data.

  6. Uncoupled poroelastic and intrinsic viscoelastic dissipation in cartilage.

    PubMed

    Han, Guebum; Hess, Cole; Eriten, Melih; Henak, Corinne R

    2018-04-26

    This paper studies uncoupled poroelastic (flow-dependent) and intrinsic viscoelastic (flow-independent) energy dissipation mechanisms via their dependence on characteristic lengths to understand the root of cartilage's broadband dissipation behavior. Phase shift and dynamic modulus were measured from dynamic microindentation tests conducted on hydrated cartilage at different contact radii, as well as on dehydrated cartilage. Cartilage weight and thickness were recorded during dehydration. Phase shifts revealed poroelastic- and viscoelastic-dominant dissipation regimes in hydrated cartilage. Specifically, phase shift at a relatively small radius was governed by poroviscoelasticity, while phase shift at a relatively large radius was dominantly governed by intrinsic viscoelasticity. The uncoupled dissipation mechanisms demonstrated that intrinsic viscoelastic dissipation provided sustained broadband dissipation for all length scales, and additional poroelastic dissipation increased total dissipation at small length scales. Dehydration decreased intrinsic viscoelastic dissipation of cartilage. The findings demonstrated a possibility to measure poroelastic and intrinsic viscoelastic properties of cartilage at similar microscale lengths. Also they encouraged development of broadband cartilage like-dampers and provided important design parameters to maximize their performance. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Elucidating the Potential of Plant Rhabdoviruses as Vector Expressions Systems

    USDA-ARS?s Scientific Manuscript database

    Maize fine streak virus (MFSV) is a member of the genus Nucleorhabdovirus that is transmitted by the leafhopper Graminella nigrifons. The virus replicates in both its maize host and its insect vector. To determine whether Drosophila S2 cells support the production of full-length MFSV proteins, we ...

  8. Impact of climate change on vector transmission of Trypanosoma cruzi (Chagas, 1909) in North America.

    PubMed

    Carmona-Castro, O; Moo-Llanes, D A; Ramsey, J M

    2018-03-01

    Climate change can influence the geographical range of the ecological niche of pathogens by altering biotic interactions with vectors and reservoirs. The distributions of 20 epidemiologically important triatomine species in North America were modelled, comparing the genetic algorithm for rule-set prediction (GARP) and maximum entropy (MaxEnt), with or without topographical variables. Potential shifts in transmission niche for Trypanosoma cruzi (Trypanosomatida: Trypanosomatidae) (Chagas, 1909) were analysed for 2050 and 2070 in Representative Concentration Pathway (RCP) 4.5 and RCP 8.5. There were no significant quantitative range differences between the GARP and MaxEnt models, but GARP models best represented known distributions for most species [partial-receiver operating characteristic (ROC) > 1]; elevation was an important variable contributing to the ecological niche model (ENM). There was little difference between niche breadth projections for RCP 4.5 and RCP 8.5; the majority of species shifted significantly in both periods. Those species with the greatest current distribution range are expected to have the greatest shifts. Positional changes in the centroid, although reduced for most species, were associated with latitude. A significant increase or decrease in mean niche elevation is expected principally for Neotropical 1 species. The impact of climate change will be specific to each species, its biogeographical region and its latitude. North American triatomines with the greatest current distribution ranges (Nearctic 2 and Nearctic/Neotropical) will have the greatest future distribution shifts. Significant shifts (increases or decreases) in mean elevation over time are projected principally for the Neotropical species with the broadest current distributions. Changes in the vector exposure threat to the human population were significant for both future periods, with a 1.48% increase for urban populations and a 1.76% increase for rural populations in 2050. © 2017 The Royal Entomological Society.

  9. Implications of solar p-mode frequency shifts

    NASA Technical Reports Server (NTRS)

    Goldreich, Peter; Murray, Norman; Willette, Gregory; Kumar, Pawan

    1991-01-01

    An expression is derived that relates solar p-mode frequency shifts to changes in the entropy and magnetic field of the sun. The frequency variations result from changes in path length and propagation speed. Path length changes dominate for entropy perturbations, and propagation speed changes dominate for most types of magnetic field peturbations. The p-mode frequencies increased along with solar activity between 1986 and 1989; these frequency shifts exhibited a rapid rise with increasing frequency followed by a precipitous drop. The positive component of the shifts can be accounted for by variations of the mean square magnetic field strength in the vicinity of the photosphere. The magnetic stress perturbation decays above the top of the convection zone on a length scale comparable to the pressure scale height and grows gradually with depth below. The presence of a resonance in the chromospheric cavity means that the transition layer maintains enough coherence to partially reflect acoustic waves even near cycle maximum.

  10. Wireless Intrusion Detection

    DTIC Science & Technology

    2007-03-01

    32 4.4 Algorithm Pseudo - Code ...................................................................................34 4.5 WIND Interface With a...difference estimates of xc temporal derivatives, or by using a polynomial fit to the previous values of xc. 34 4.4 ALGORITHM PSEUDO - CODE Pseudo ...Phase Shift Keying DQPSK Differential Quadrature Phase Shift Keying EVM Error Vector Magnitude FFT Fast Fourier Transform FPGA Field Programmable

  11. Continuous Faraday measurement of spin precession without light shifts

    NASA Astrophysics Data System (ADS)

    Jasperse, M.; Kewming, M. Â. J.; Fischer, S. Â. N.; Pakkiam, P.; Anderson, R. Â. P.; Turner, L. Â. D.

    2017-12-01

    We describe a dispersive Faraday optical probe of atomic spin which performs a weak measurement of spin projection of a quantum gas continuously for more than one second. To date, focusing bright far-off-resonance probes onto quantum gases has proved invasive due to strong scalar and vector light shifts exerting dipole and Stern-Gerlach forces. We show that tuning the probe near the magic-zero wavelength at 790 nm between the fine-structure doublet of 87Rb cancels the scalar light shift, and careful control of polarization eliminates the vector light shift. Faraday rotations due to each fine-structure line reinforce at this wavelength, enhancing the signal-to-noise ratio for a fixed rate of probe-induced decoherence. Using this minimally invasive spin probe, we perform microscale atomic magnetometry at high temporal resolution. Spectrogram analysis of the Larmor precession signal of a single spinor Bose-Einstein condensate measures a time-varying magnetic field strength with 1 μ G accuracy every 5 ms; or, equivalently, makes more than 200 successive measurements each at 10 pT /√{Hz } sensitivity.

  12. An efficient Foxtail mosaic virus vector system with reduced environmental risk

    PubMed Central

    2010-01-01

    Background Plant viral vectors offer high-yield expression of pharmaceutical and commercially important proteins with a minimum of cost and preparation time. The use of Agrobacterium tumefaciens has been introduced to deliver the viral vector as a transgene to each plant cell via a simple, nonsterile infiltration technique called "agroinoculation". With agroinoculation, a full length, systemically moving virus is no longer necessary for excellent protein yield, since the viral transgene is transcribed and replicates in every infiltrated cell. Viral genes may therefore be deleted to decrease the potential for accidental spread and persistence of the viral vector in the environment. Results In this study, both the coat protein (CP) and triple gene block (TGB) genetic segments were eliminated from Foxtail mosaic virus to create the "FECT" vector series, comprising a deletion of 29% of the genome. This viral vector is highly crippled and expresses little or no marker gene within the inoculated leaf. However, when co-agroinoculated with a silencing suppressor (p19 or HcPro), FECT expressed GFP at 40% total soluble protein in the tobacco host, Nicotiana benthamiana. The modified FoMV vector retained the full-length replicase ORF, the TGB1 subgenomic RNA leader sequence and either 0, 22 or 40 bases of TGB1 ORF (in vectors FECT0, FECT22 and FECT40, respectively). As well as N. benthamiana, infection of legumes was demonstrated. Despite many attempts, expression of GFP via syringe agroinoculation of various grass species was very low, reflecting the low Agrobacterium-mediated transformation rate of monocots. Conclusions The FECT/40 vector expresses foreign genes at a very high level, and yet has a greatly reduced biohazard potential. It can form no virions and can effectively replicate only in a plant with suppressed silencing. PMID:21162736

  13. Studies on deflection area vectors of QRS and T and ventricular gradient in right ventricular hypertrophy.

    PubMed

    Kawaguchi, Y

    1985-04-01

    QRS deflection area vector (Aqrs), T deflection area vector (At) and ventricular gradient (G) in right ventricular hypertrophy were studied in 53 subjects divided on the basis of cardiac catheterization data into four subgroups; normal controls, mild MS group, right ventricular pressure overload group and right ventricular volume overload group. Aqrs, At and G of the four subgroups were calculated using a microcomputer and compared. Aqrs in right ventricular pressure overload group and volume overload group was shifted to the right and slightly anteriorly from that in normal control group. At in right ventricular pressure overload group and volume overload group was shifted slightly upwards and significantly posteriorly from that in the normal control and mild MS groups. G in right ventricular pressure overload group and volume overload group was shifted to the right and significantly posteriorly from that in normal control and mild MS groups. Using multivariative analysis, we developed criteria for diagnosing right ventricular hypertrophy with At: 0.059At(Z) - 0.0145 [At] - 0.2608 less than or equal to 0. Application of this criteria achieved 82.4% (28 of 34) sensitivity in the patients with right ventricular hypertrophy and 90.9% (10 of 11) specificity in the normal control subjects.

  14. Importance of the residue Asp 290 on chain length selectivity and catalytic efficiency of recombinant Staphylococcus simulans lipase expressed in E. coli.

    PubMed

    Sayari, Adel; Mosbah, Habib; Gargouri, Youssef

    2007-05-01

    In addition to their physiological importance, microbial lipases, like staphylococcal ones, are of considerable commercial interest for biotechnological applications such as detergents, food production, and pharmaceuticals and industrial synthesis of fine chemicals. The gene encoding the extracellular lipase of Staphylococcus simulans (SSL) was subcloned in the pET-14b expression vector and expressed in Esherichia coli BL21 (DE3). The wild-type SSL was expressed as amino terminal His6-tagged recombinant protein. One-step purification of the recombinant lipase was achieved with nickel metal affinity column. The purified His-tagged SSL (His6-SSL) is able to hydrolyse triacylglycerols without chain length selectivity. The major differences among lipases are reflected in their chemical specificity in the hydrolysis of peculiar ester bonds, and their respective capacity to hydrolyse substrates having different physico-chemical properties. It has been proposed, using homology alignment, that the region around the residue 290 of Staphylococcus hyicus lipase could be involved in the selection of the substrate. To evaluate the importance of this environment, the residue Asp290 of Staphylococcus simulans lipase was mutated to Ala using site-directed mutagenesis. The mutant expression plasmid was also overexpressed in Esherichia coli and purified with a nickel metal affinity column. The substitution of Asp290 by Ala was accompanied by a significant shift of the acyl-chain length specificity of the mutant towards short chain fatty acid esters. Kinetic studies of wild-type SSL and its mutant D290A were carried out, and show essentially that the catalytic efficiency (k cat /K M ) of the mutant was affected. Our results confirmed that Asp290 is important for the chain length selectivity and catalytic efficiency of Staphylococcus simulans lipase.

  15. Multiscale vector fields for image pattern recognition

    NASA Technical Reports Server (NTRS)

    Low, Kah-Chan; Coggins, James M.

    1990-01-01

    A uniform processing framework for low-level vision computing in which a bank of spatial filters maps the image intensity structure at each pixel into an abstract feature space is proposed. Some properties of the filters and the feature space are described. Local orientation is measured by a vector sum in the feature space as follows: each filter's preferred orientation along with the strength of the filter's output determine the orientation and the length of a vector in the feature space; the vectors for all filters are summed to yield a resultant vector for a particular pixel and scale. The orientation of the resultant vector indicates the local orientation, and the magnitude of the vector indicates the strength of the local orientation preference. Limitations of the vector sum method are discussed. Investigations show that the processing framework provides a useful, redundant representation of image structure across orientation and scale.

  16. Acquisition and expression of memories of distance and direction in navigating wood ants.

    PubMed

    Fernandes, A Sofia D; Philippides, Andrew; Collett, Tom S; Niven, Jeremy E

    2015-11-01

    Wood ants, like other central place foragers, rely on route memories to guide them to and from a reliable food source. They use visual memories of the surrounding scene and probably compass information to control their direction. Do they also remember the length of their route and do they link memories of direction and distance? To answer these questions, we trained wood ant (Formica rufa) foragers in a channel to perform either a single short foraging route or two foraging routes in opposite directions. By shifting the starting position of the route within the channel, but keeping the direction and distance fixed, we tried to ensure that the ants would rely upon vector memories rather than visual memories to decide when to stop. The homeward memories that the ants formed were revealed by placing fed or unfed ants directly into a channel and assessing the direction and distance that they walked without prior performance of the food-ward leg of the journey. This procedure prevented the distance and direction walked being affected by a home vector derived from path integration. Ants that were unfed walked in the feeder direction. Fed ants walked in the opposite direction for a distance related to the separation between start and feeder. Vector memories of a return route can thus be primed by the ants' feeding state and expressed even when the ants have not performed the food-ward route. Tests on ants that have acquired two routes indicate that memories of the direction and distance of the return routes are linked, suggesting that they may be encoded by a common neural population within the ant brain. © 2015. Published by The Company of Biologists Ltd.

  17. Photorefractive Tungsten Bronze Crystals for Optical Limiters and Filters.

    DTIC Science & Technology

    1996-01-01

    vector , X is the laser light wavelength, 0 is the half- angle between the two crossing laser beams, and k0 is the Debye screening wave vector given by...between the grating and the dielectric constant E’ = 950) such that the grating’ vector is interference pattern, the intensities of the output beams from...substituting Io, I, and Id into expression 0 ple d 2o0o 25i00 (8), we can calculate the phase shift between the grating and Applied Electric Feild in V

  18. Extended Closed-form Expressions for the Robust Symmetrical Number System Dynamic Range and an Efficient Algorithm for its Computation

    DTIC Science & Technology

    2014-01-01

    and distance between all of the vector ambiguity pairs for the combined N−sequences. To simplify our derivation, we define the center of ambiguity (COA...modulo N . The resulting structure of the N sequences ensures that two successive RSNS vectors (paired terms from all N sequences) when considered...represented by a vector , Xh = [x1,h, x2,h, . . . , xN,h] T , of N paired integers from each se- quence at h. For example, a left-shifted, three-sequence

  19. Feasibility of Bioelectrical Impedance Spectroscopy Measurement before and after Thoracentesis

    PubMed Central

    Weyer, Sören; Pauly, Karolin; Napp, Andreas; Dreher, Michael; Leonhardt, Steffen; Marx, Nikolaus; Schauerte, Patrick; Mischke, Karl

    2015-01-01

    Background. Bioelectrical impedance spectroscopy is applied to measure changes in tissue composition. The aim of this study was to evaluate its feasibility in measuring the fluid shift after thoracentesis in patients with pleural effusion. Methods. 45 participants (21 with pleural effusion and 24 healthy subjects) were included. Bioelectrical impedance was analyzed for “Transthoracic,” “Foot to Foot,” “Foot to Hand,” and “Hand to Hand” vectors in low and high frequency domain before and after thoracentesis. Healthy subjects were measured at a single time point. Results. The mean volume of removed pleural effusion was 1169 ± 513 mL. The “Foot to Foot,” “Hand to Hand,” and “Foot to Hand” vector indicated a trend for increased bioelectrical impedance after thoracentesis. Values for the low frequency domain in the “Transthoracic” vector increased significantly (P < 0.001). A moderate correlation was observed between the amount of removed fluid and impedance change in the low frequency domain using the “Foot to Hand” vector (r = −0.7). Conclusion. Bioelectrical impedance changes in correlation with the thoracic fluid level. It was feasible to monitor significant fluid shifts and loss after thoracentesis in the “Transthoracic” vector by means of bioelectrical impedance spectroscopy. The trial is registered with Registration Numbers IRB EK206/11 and NCT01778270. PMID:25861647

  20. Specific insertions of zinc finger domains into Gag-Pol yield engineered retroviral vectors with selective integration properties

    PubMed Central

    Lim, Kwang-il; Klimczak, Ryan; Yu, Julie H.; Schaffer, David V.

    2010-01-01

    Retroviral vectors offer benefits of efficient delivery and stable gene expression; however, their clinical use raises the concerns of insertional mutagenesis and potential oncogenesis due to genomic integration preferences in transcriptional start sites (TSS). We have shifted the integration preferences of retroviral vectors by generating a library of viral variants with a DNA-binding domain inserted at random positions throughout murine leukemia virus Gag-Pol, then selecting for variants that are viable and exhibit altered integration properties. We found seven permissive zinc finger domain (ZFD) insertion sites throughout Gag-Pol, including within p12, reverse transcriptase, and integrase. Comprehensive genome integration analysis showed that several ZFD insertions yielded retroviral vector variants with shifted integration patterns that did not favor TSS. Furthermore, integration site analysis revealed selective integration for numerous mutants. For example, two retroviral variants with a given ZFD at appropriate positions in Gag-Pol strikingly integrated primarily into four common sites out of 3.1 × 109 possible human genome locations (P = 4.6 × 10-29). Our findings demonstrate that insertion of DNA-binding motifs into multiple locations in Gag-Pol can make considerable progress toward engineering safer retroviral vectors that integrate into a significantly narrowed pool of sites on human genome and overcome the preference for TSS. PMID:20616052

  1. Lower-Hybrid-Drift Wave Turbulence in the Distant Magnetotail

    DTIC Science & Technology

    1978-05-01

    kV ɘ with =• Y ~~ <» (Krall and Liewer, 1971). In this situation a Doppler shifted ,1; lower hybrid wave (u), - kV, . = ± u...satellite includes the relevant Doppler shifts since, in general, proton bulk flows are not directed parallel to the local magnetic field vector...theory of Section II predicts a relatively narrow frequency spectrum, the dominance of the Doppler shifting term k • Vp in Eq.(23)acts to

  2. Analysis of Links Positions in Landing Gear Mechanism

    NASA Astrophysics Data System (ADS)

    Brewczyński, D.; Tora, G.

    2014-08-01

    This article contains a kinematic analysis of an aircraft chassis mechanism in a range of positions. The mechanism of the chassis is made up of several smaller subsystems with different functions. The first mechanism is used to eject the chassis before landing (touchdown) and fold it to hatchway after the lift off. The second mechanism is designed to perform rotation of the crossover with the wheel, in order to adjust the position of the wheel to fit it in the limited space in the hold. The third mechanism allows movement of the chassis resulting from the change in length of the damper. To determine the position of the following links of the mechanism calculus of vectors was applied in which unit vectors were used to represent the angular position of the links. The aim of the analysis is to determine the angle of convergence and the angle of heel wheels as a function of the variable length of hydraulic cylinder, length of the shock absorber, length of the regulations rods

  3. Nodal distances for rooted phylogenetic trees.

    PubMed

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

    2010-08-01

    Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

  4. Ultra narrow flat-top filter based on multiple equivalent phase shifts

    NASA Astrophysics Data System (ADS)

    Wang, Fei; Zou, Xihua; Yin, Zuowei; Chen, Xiangfei; Shen, Haisong

    2008-11-01

    Instead of real phase shifts, equivalent phase shifts (EPS) are adopted to construct ultra narrow phase-shifted band-pass filer in sampled Bragg gratings (SBG). Two optimized distributions of multiple equivalent phase shifts, using 2 and 5 EPSs respectively, are given in this paper to realize flat-top and ripple-free transmission characteristics simultaneously. Also two demonstrations with 5 EPSs both on hydrogen-loaded and photosensitive fibers are presented and their spectrums are examined by an optical vector analyzer (OVA). Given only ordinary phase mask and sub-micrometer precision control, ultra-narrowband flat-top filters with expected performance can be achieved flexibly and cost-effectively.

  5. Pharmacological interventions for sleepiness and sleep disturbances caused by shift work.

    PubMed

    Liira, Juha; Verbeek, Jos H; Costa, Giovanni; Driscoll, Tim R; Sallinen, Mikael; Isotalo, Leena K; Ruotsalainen, Jani H

    2014-08-12

    Shift work results in sleep-wake disturbances, which cause sleepiness during night shifts and reduce sleep length and quality in daytime sleep after the night shift. In its serious form it is also called shift work sleep disorder. Various pharmacological products are used to ameliorate symptoms of sleepiness or poor sleep length and quality. To evaluate the effects of pharmacological interventions to reduce sleepiness or to improve alertness at work and decrease sleep disturbances whilst off work, or both, in workers undertaking shift work in their present job and to assess their cost-effectiveness. We searched CENTRAL, MEDLINE, EMBASE, PubMed and PsycINFO up to 20 September 2013 and ClinicalTrials.gov up to July 2013. We also screened reference lists of included trials and relevant reviews. We included all eligible randomised controlled trials (RCTs), including cross-over RCTs, of pharmacological products among workers who were engaged in shift work (including night shifts) in their present jobs and who may or may not have had sleep problems. Primary outcomes were sleep length and sleep quality while off work, alertness and sleepiness, or fatigue at work. Two authors independently selected studies, extracted data and assessed risk of bias in included trials. We performed meta-analyses where appropriate. We included 15 randomised placebo-controlled trials with 718 participants. Nine trials evaluated the effect of melatonin and two the effect of hypnotics for improving sleep problems. One trial assessed the effect of modafinil, two of armodafinil and one examined caffeine plus naps to decrease sleepiness or to increase alertness.Melatonin (1 to 10 mg) after the night shift may increase sleep length during daytime sleep (mean difference (MD) 24 minutes, 95% confidence interval (CI) 9.8 to 38.9; seven trials, 263 participants, low quality evidence) and night-time sleep (MD 17 minutes, 95% CI 3.71 to 30.22; three trials, 234 participants, low quality evidence) compared to placebo. We did not find a dose-response effect. Melatonin may lead to similar sleep latency times as placebo (MD 0.37minutes, 95% CI - 1.55 to 2.29; five trials, 74 participants, low quality evidence).Hypnotic medication, zopiclone, did not result in significantly longer daytime sleep length compared to placebo in one low quality trial and we could not use the data from the study on lormetazepam.Armodafinil taken before the night shift probably reduces sleepiness by one point on the Karolinska Sleepiness Scale (KSS) (MD -0.99, 95% CI -1.32 to -0.67; range 1 to 10; two trials, 572 participants, moderate quality evidence) and increases alertness by 50 ms in a simple reaction time test (MD -50.0, 95% CI -85.5 to -15.5) at three months' follow-up in shift work sleep disorder patients. Modafinil probably has similar effects on sleepiness (KSS) (MD -0.90, 95% CI -1.45 to -0.35; one trial, 183 participants, moderate quality evidence) and alertness in the psychomotor vigilance test in the same patient group. Post-marketing, severe skin reactions have been reported. Adverse effects reported by trial participants were headache, nausea and a rise in blood pressure. There were no trials in non-patient shift workers.Based on one trial, caffeine plus pre-shift naps taken before the night shift decreased sleepiness (KSS) (MD -0.63, 95% CI -1.09 to -0.17).We judged most trials to have a low risk of bias even though the randomisation method and allocation concealment were often not described. There is low quality evidence that melatonin improves sleep length after a night shift but not other sleep quality parameters. Both modafinil and armodafinil increase alertness and reduce sleepiness to some extent in employees who suffer from shift work sleep disorder but they are associated with adverse events. Caffeine plus naps reduces sleepiness during the night shift, but the quality of evidence is low. Based on one low quality trial, hypnotics did not improve sleep length and quality after a night shift.We need more and better quality trials on the beneficial and adverse effects and costs of all pharmacological agents that induce sleep or promote alertness in shift workers both with and without a diagnosis of shift work sleep disorder. We also need systematic reviews of their adverse effects.

  6. A mapping of an ensemble of mitochondrial sequences for various organisms into 3D space based on the word composition.

    PubMed

    Aita, Takuyo; Nishigaki, Koichi

    2012-11-01

    To visualize a bird's-eye view of an ensemble of mitochondrial genome sequences for various species, we recently developed a novel method of mapping a biological sequence ensemble into Three-Dimensional (3D) vector space. First, we represented a biological sequence of a species s by a word-composition vector x(s), where its length [absolute value]x(s)[absolute value] represents the sequence length, and its unit vector x(s)/[absolute value]x(s)[absolute value] represents the relative composition of the K-tuple words through the sequence and the size of the dimension, N=4(K), is the number of all possible words with the length of K. Second, we mapped the vector x(s) to the 3D position vector y(s), based on the two following simple principles: (1) [absolute value]y(s)[absolute value]=[absolute value]x(s)[absolute value] and (2) the angle between y(s) and y(t) maximally correlates with the angle between x(s) and x(t). The mitochondrial genome sequences for 311 species, including 177 Animalia, 85 Fungi and 49 Green plants, were mapped into 3D space by using K=7. The mapping was successful because the angles between vectors before and after the mapping highly correlated with each other (correlation coefficients were 0.92-0.97). Interestingly, the Animalia kingdom is distributed along a single arc belt (just like the Milky Way on a Celestial Globe), and the Fungi and Green plant kingdoms are distributed in a similar arc belt. These two arc belts intersect at their respective middle regions and form a cross structure just like a jet aircraft fuselage and its wings. This new mapping method will allow researchers to intuitively interpret the visual information presented in the maps in a highly effective manner. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. AZTEC. Parallel Iterative method Software for Solving Linear Systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hutchinson, S.; Shadid, J.; Tuminaro, R.

    1995-07-01

    AZTEC is an interactive library that greatly simplifies the parrallelization process when solving the linear systems of equations Ax=b where A is a user supplied n X n sparse matrix, b is a user supplied vector of length n and x is a vector of length n to be computed. AZTEC is intended as a software tool for users who want to avoid cumbersome parallel programming details but who have large sparse linear systems which require an efficiently utilized parallel processing system. A collection of data transformation tools are provided that allow for easy creation of distributed sparse unstructured matricesmore » for parallel solutions.« less

  8. The effect of leg preference on postural stability in healthy athletes.

    PubMed

    Huurnink, Arnold; Fransz, Duncan P; Kingma, Idsart; Hupperets, Maarten D W; van Dieën, Jaap H

    2014-01-03

    In research regarding postural stability, leg preference is often tested and controlled for. However, leg preference may vary between tasks. As athletes are a group of interest for postural stability testing, we evaluated the effect of five leg preference tasks categorization (step up, hop, ball kick, balance, pick up) on single-leg postural stability of 16 field hockey athletes. The 'center of pressure speed' was calculated as the primary outcome variable of single-leg postural stability. Secondary variables were 'mean length of the GRF vector in the horizontal plane', 'mean length of the ankle angular velocity vector', and 'mean length of the hip angular velocity vector', as well as the separate outcomes per degree of freedom. Results showed that leg preference was inconsistent between leg preference tasks. Moreover, the primary and secondary variables yielded no significant difference between the preferred and non-preferred legs, regardless of the applied leg preference task categorization (p>0.05). The present findings do not support the usability of leg preference tasks in controlling for bias of postural stability. In conclusion, none of the applied leg preference tasks revealed a significant effect on postural stability in healthy field hockey athletes. © 2013 Published by Elsevier Ltd.

  9. Generalized extended Navier-Stokes theory: multiscale spin relaxation in molecular fluids.

    PubMed

    Hansen, J S

    2013-09-01

    This paper studies the relaxation of the molecular spin angular velocity in the framework of generalized extended Navier-Stokes theory. Using molecular dynamics simulations, it is shown that for uncharged diatomic molecules the relaxation time decreases with increasing molecular moment of inertia per unit mass. In the regime of large moment of inertia the fast relaxation is wave-vector independent and dominated by the coupling between spin and the fluid streaming velocity, whereas for small inertia the relaxation is slow and spin diffusion plays a significant role. The fast wave-vector-independent relaxation is also observed for highly packed systems. The transverse and longitudinal spin modes have, to a good approximation, identical relaxation, indicating that the longitudinal and transverse spin viscosities have same value. The relaxation is also shown to be isomorphic invariant. Finally, the effect of the coupling in the zero frequency and wave-vector limit is quantified by a characteristic length scale; if the system dimension is comparable to this length the coupling must be included into the fluid dynamical description. It is found that the length scale is independent of moment of inertia but dependent on the state point.

  10. Nurses' shift length and overtime working in 12 European countries: the association with perceived quality of care and patient safety.

    PubMed

    Griffiths, Peter; Dall'Ora, Chiara; Simon, Michael; Ball, Jane; Lindqvist, Rikard; Rafferty, Anne-Marie; Schoonhoven, Lisette; Tishelman, Carol; Aiken, Linda H

    2014-11-01

    Despite concerns as to whether nurses can perform reliably and effectively when working longer shifts, a pattern of two 12- to 13-hour shifts per day is becoming common in many hospitals to reduce shift to shift handovers, staffing overlap, and hence costs. To describe shift patterns of European nurses and investigate whether shift length and working beyond contracted hours (overtime) is associated with nurse-reported care quality, safety, and care left undone. Cross-sectional survey of 31,627 registered nurses in general medical/surgical units within 488 hospitals across 12 European countries. A total of 50% of nurses worked shifts of ≤ 8 hours, but 15% worked ≥ 12 hours. Typical shift length varied between countries and within some countries. Nurses working for ≥ 12 hours were more likely to report poor or failing patient safety [odds ratio (OR)=1.41; 95% confidence interval (CI), 1.13-1.76], poor/fair quality of care (OR=1.30; 95% CI, 1.10-1.53), and more care activities left undone (RR=1.13; 95% CI, 1.09-1.16). Working overtime was also associated with reports of poor or failing patient safety (OR=1.67; 95% CI, 1.51-1.86), poor/fair quality of care (OR=1.32; 95% CI, 1.23-1.42), and more care left undone (RR=1.29; 95% CI, 1.27-1.31). European registered nurses working shifts of ≥ 12 hours and those working overtime report lower quality and safety and more care left undone. Policies to adopt a 12-hour nursing shift pattern should proceed with caution. Use of overtime working to mitigate staffing shortages or increase flexibility may also incur additional risk to quality.

  11. Nurses’ Shift Length and Overtime Working in 12 European Countries

    PubMed Central

    Dall’Ora, Chiara; Simon, Michael; Ball, Jane; Lindqvist, Rikard; Rafferty, Anne-Marie; Schoonhoven, Lisette; Tishelman, Carol; Aiken, Linda H.

    2014-01-01

    Background: Despite concerns as to whether nurses can perform reliably and effectively when working longer shifts, a pattern of two 12- to 13-hour shifts per day is becoming common in many hospitals to reduce shift to shift handovers, staffing overlap, and hence costs. Objectives: To describe shift patterns of European nurses and investigate whether shift length and working beyond contracted hours (overtime) is associated with nurse-reported care quality, safety, and care left undone. Methods: Cross-sectional survey of 31,627 registered nurses in general medical/surgical units within 488 hospitals across 12 European countries. Results: A total of 50% of nurses worked shifts of ≤8 hours, but 15% worked ≥12 hours. Typical shift length varied between countries and within some countries. Nurses working for ≥12 hours were more likely to report poor or failing patient safety [odds ratio (OR)=1.41; 95% confidence interval (CI), 1.13–1.76], poor/fair quality of care (OR=1.30; 95% CI, 1.10–1.53), and more care activities left undone (RR=1.13; 95% CI, 1.09–1.16). Working overtime was also associated with reports of poor or failing patient safety (OR=1.67; 95% CI, 1.51–1.86), poor/fair quality of care (OR=1.32; 95% CI, 1.23–1.42), and more care left undone (RR=1.29; 95% CI, 1.27–1.31). Conclusions: European registered nurses working shifts of ≥12 hours and those working overtime report lower quality and safety and more care left undone. Policies to adopt a 12-hour nursing shift pattern should proceed with caution. Use of overtime working to mitigate staffing shortages or increase flexibility may also incur additional risk to quality. PMID:25226543

  12. Tracking lags in historical plant species' shifts in relation to regional climate change.

    PubMed

    Ash, Jeremy D; Givnish, Thomas J; Waller, Donald M

    2017-03-01

    Can species shift their distributions fast enough to track changes in climate? We used abundance data from the 1950s and the 2000s in Wisconsin to measure shifts in the distribution and abundance of 78 forest-understory plant species over the last half-century and compare these shifts to changes in climate. We estimated temporal shifts in the geographic distribution of each species using vectors to connect abundance-weighted centroids from the 1950s and 2000s. These shifts in distribution reflect colonization, extirpation, and changes in abundance within sites, separately quantified here. We then applied climate analog analyses to compute vectors representing the climate change that each species experienced. Species shifted mostly to the northwest (mean: 49 ± 29 km) primarily reflecting processes of colonization and changes in local abundance. Analog climates for these species shifted even further to the northwest, however, exceeding species' shifts by an average of 90 ± 40 km. Most species thus failed to match recent rates of climate change. These lags decline in species that have colonized more sites and those with broader site occupancy, larger seed mass, and higher habitat fidelity. Thus, species' traits appear to affect their responses to climate change, but relationships are weak. As climate change accelerates, these lags will likely increase, potentially threatening the persistence of species lacking the capacity to disperse to new sites or locally adapt. However, species with greater lags have not yet declined more in abundance. The extent of these threats will likely depend on how other drivers of ecological change and interactions among species affect their responses to climate change. © 2016 John Wiley & Sons Ltd.

  13. Two-Dimensional Supersonic Nozzle Thrust Vectoring Using Staggered Ramps

    NASA Astrophysics Data System (ADS)

    Montes, Carlos Fernando

    A novel mechanism for vectoring the thrust of a supersonic, air-breathing engine was analyzed numerically using ANSYS Fluent. The mechanism uses two asymmetrically staggered ramps; one placed at the throat, the other positioned at the exit lip of the nozzle. The nozzle was designed using published flow data, isentropic relationships, and piecewise quartic splines. The design was verified numerically and was in fair agreement with the analytical data. Using the steady-state pressure-based solver, along with the realizable kappa - epsilon turbulence model, a total of eighteen simulations were conducted: three ramp lengths at three angles, using two sets of inlet boundary conditions (non-afterburning and afterburning). The vectoring simulations showed that the afterburning flow yields a lower flow deflection distribution, shown by the calculated average deflection angle and area-weighted integrals of the distributions. The data implies that an aircraft can achieve an average thrust vectoring angle of approximately 30° in a given direction with the longest ramp length and largest ramp angle configuration. With increasing ramp angle, the static pressure across the nozzle inlet increased, causing concern for potential negative effects on the engine's turbine. The mechanism, for which a provisional patent application has been filed, will require further work to investigate the maximum possible thrust vectoring angle, including experiments.

  14. Static internal performance of an axisymmetric nozzle with multiaxis thrust-vectoring capability

    NASA Technical Reports Server (NTRS)

    Carson, George T., Jr.; Capone, Francis J.

    1991-01-01

    An investigation was conducted in the static test facility of the Langley 16 Foot Transonic Tunnel in order to determine the internal performance characteristics of a multiaxis thrust vectoring axisymmetric nozzle. Thrust vectoring for this nozzle was achieved by deflection of only the divergent section of this nozzle. The effects of nozzle power setting and divergent flap length were studied at nozzle deflection angles of 0 to 30 at nozzle pressure ratios up to 8.0.

  15. Pharmacological interventions for sleepiness and sleep disturbances caused by shift work.

    PubMed

    Liira, Juha; Verbeek, Jos H; Costa, Giovanni; Driscoll, Tim R; Sallinen, Mikael; Isotalo, Leena K; Ruotsalainen, Jani H

    2015-02-01

    Shift work results in sleep-wake disturbances, which cause sleepiness during night shifts and reduce sleep length and quality in daytime sleep after the night shift. In its serious form it is also called shift work sleep disorder. Various pharmacological products are used to ameliorate symptoms of sleepiness or poor sleep length and quality. To evaluate the effects of pharmacological interventions to reduce sleepiness or to improve alertness at work and decrease sleep disturbances whilst of work, or both, in workers undertaking shift work. We searched CENTRAL, MEDLINE, EMBASE, PubMed and PsycINFO up to 20 September 2013 and ClinicalTrials.gov up to July 2013. We also screened reference lists of included trials and relevant reviews. We included all eligible randomised controlled trials (RCTs), including cross-over RCTs, of pharmacological products among workers who were engaged in shift work (including night shifts) in their present jobs and who may or may not have had sleep problems. Primary outcomes were sleep length and sleep quality while of work, alertness and sleepiness, or fatigue at work. Two authors independently selected studies, extracted data and assessed risk of bias in included trials. We performed meta-analyses where appropriate. We included 15 randomised placebo-controlled trials with 718 participants. Nine trials evaluated the effect of melatonin and two the effect of hypnotics for improving sleep problems. One trial assessed the effect of modafinil, two of armodafinil and one examined caffeine plus naps to decrease sleepiness or to increase alertness.

  16. On the Partitioning of Squared Euclidean Distance and Its Applications in Cluster Analysis.

    ERIC Educational Resources Information Center

    Carter, Randy L.; And Others

    1989-01-01

    The partitioning of squared Euclidean--E(sup 2)--distance between two vectors in M-dimensional space into the sum of squared lengths of vectors in mutually orthogonal subspaces is discussed. Applications to specific cluster analysis problems are provided (i.e., to design Monte Carlo studies for performance comparisons of several clustering methods…

  17. Enhanced Central Nervous System Transduction with Lentiviral Vectors Pseudotyped with RVG/HIV-1gp41 Chimeric Envelope Glycoproteins

    PubMed Central

    Trabalza, Antonio; Eleftheriadou, Ioanna; Sgourou, Argyro; Liao, Ting-Yi; Patsali, Petros; Lee, Heyne

    2014-01-01

    ABSTRACT To investigate the potential benefits which may arise from pseudotyping the HIV-1 lentiviral vector with its homologous gp41 envelope glycoprotein (GP) cytoplasmic tail (CT), we created chimeric RVG/HIV-1gp41 GPs composed of the extracellular and transmembrane sequences of RVG and either the full-length gp41 CT or C terminus gp41 truncations sequentially removing existing conserved motifs. Lentiviruses (LVs) pseudotyped with the chimeric GPs were evaluated in terms of particle release (physical titer), biological titers, infectivity, and in vivo central nervous system (CNS) transduction. We report here that LVs carrying shorter CTs expressed higher levels of envelope GP and showed a higher average infectivity than those bearing full-length GPs. Interestingly, complete removal of GP CT led to vectors with the highest transduction efficiency. Removal of all C-terminal gp41 CT conserved motifs, leaving just 17 amino acids (aa), appeared to preserve infectivity and resulted in a significantly increased physical titer. Furthermore, incorporation of these 17 aa in the RVG CT notably enhanced the physical titer. In vivo stereotaxic delivery of LV vectors exhibiting the best in vitro titers into rodent striatum facilitated efficient transduction of the CNS at the site of injection. A particular observation was the improved retrograde transduction of neurons in connected distal sites that resulted from the chimeric envelope R5 which included the “Kennedy” sequence (Ken) and lentivirus lytic peptide 2 (LLP2) conserved motifs in the CT, and although it did not exhibit a comparable high titer upon pseudotyping, it led to a significant increase in distal retrograde transduction of neurons. IMPORTANCE In this study, we have produced novel chimeric envelopes bearing the extracellular domain of rabies fused to the cytoplasmic tail (CT) of gp41 and pseudotyped lentiviral vectors with them. Here we report novel effects on the transduction efficiency and physical titer of these vectors, depending on CT length and context. We also managed to achieve increased neuronal transduction in vivo in the rodent CNS, thus demonstrating that the efficiency of these vectors can be enhanced following merely CT manipulation. We believe that this paper is a novel contribution to the field and opens the way for further attempts to surface engineer lentiviral vectors and make them more amenable for applications in human disease. PMID:24371049

  18. Efficient generation of transgene-free human induced pluripotent stem cells (iPSCs) by temperature-sensitive Sendai virus vectors

    PubMed Central

    Ban, Hiroshi; Nishishita, Naoki; Fusaki, Noemi; Tabata, Toshiaki; Saeki, Koichi; Shikamura, Masayuki; Takada, Nozomi; Inoue, Makoto; Hasegawa, Mamoru; Kawamata, Shin; Nishikawa, Shin-Ichi

    2011-01-01

    After the first report of induced pluripotent stem cells (iPSCs), considerable efforts have been made to develop more efficient methods for generating iPSCs without foreign gene insertions. Here we show that Sendai virus vector, an RNA virus vector that carries no risk of integrating into the host genome, is a practical solution for the efficient generation of safer iPSCs. We improved the Sendai virus vectors by introducing temperature-sensitive mutations so that the vectors could be easily removed at nonpermissive temperatures. Using these vectors enabled the efficient production of viral/factor-free iPSCs from both human fibroblasts and CD34+ cord blood cells. Temperature-shift treatment was more effective in eliminating remaining viral vector-related genes. The resulting iPSCs expressed human embryonic stem cell markers and exhibited pluripotency. We suggest that generation of transgene-free iPSCs from cord blood cells should be an important step in providing allogeneic iPSC-derived therapy in the future. PMID:21821793

  19. Continuum in the X-Z---Y weak bonds: Z= main group elements.

    PubMed

    Joy, Jyothish; Jose, Anex; Jemmis, Eluvathingal D

    2016-01-15

    The Continuum in the variation of the X-Z bond length change from blue-shifting to red-shifting through zero- shifting in the X-Z---Y complex is inevitable. This has been analyzed by ab-initio molecular orbital calculations using Z= Hydrogen, Halogens, Chalcogens, and Pnicogens as prototypical examples. Our analysis revealed that, the competition between negative hyperconjugation within the donor (X-Z) molecule and Charge Transfer (CT) from the acceptor (Y) molecule is the primary reason for the X-Z bond length change. Here, we report that, the proper tuning of X- and Y-group for a particular Z- can change the blue-shifting nature of X-Z bond to zero-shifting and further to red-shifting. This observation led to the proposal of a continuum in the variation of the X-Z bond length during the formation of X-Z---Y complex. The varying number of orbitals and electrons available around the Z-atom differentiates various classes of weak interactions and leads to interactions dramatically different from the H-Bond. Our explanations based on the model of anti-bonding orbitals can be transferred from one class of weak interactions to another. We further take the idea of continuum to the nature of chemical bonding in general. © 2015 Wiley Periodicals, Inc.

  20. Survival relative to new and ancestral host plants, phytoplasma infection, and genetic constitution in host races of a polyphagous insect disease vector

    PubMed Central

    Maixner, Michael; Albert, Andreas; Johannesen, Jes

    2014-01-01

    Dissemination of vectorborne diseases depends strongly on the vector's host range and the pathogen's reservoir range. Because vectors interact with pathogens, the direction and strength of a vector's host shift is vital for understanding epidemiology and is embedded in the framework of ecological specialization. This study investigates survival in host-race evolution of a polyphagous insect disease vector, Hyalesthes obsoletus, whether survival is related to the direction of the host shift (from field bindweed to stinging nettle), the interaction with plant-specific strains of obligate vectored pathogens/symbionts (stolbur phytoplasma), and whether survival is related to genetic differentiation between the host races. We used a twice repeated, identical nested experimental design to study survival of the vector on alternative hosts and relative to infection status. Survival was tested with Kaplan–Meier analyses, while genetic differentiation between vector populations was quantified with microsatellite allele frequencies. We found significant direct effects of host plant (reduced survival on wrong hosts) and sex (males survive longer than females) in both host races and relative effects of host (nettle animals more affected than bindweed animals) and sex (males more affected than females). Survival of bindweed animals was significantly higher on symptomatic than nonsymptomatic field bindweed, but in the second experiment only. Infection potentially had a positive effect on survival in nettle animals but due to low infection rates the results remain suggestive. Genetic differentiation was not related to survival. Greater negative plant-transfer effect but no negative effect of stolbur in the derived host race suggests preadaptation to the new pathogen/symbiont strain before strong diversifying selection during the specialization process. Physiological maladaptation or failure to accept the ancestral plant will have similar consequences, namely positive assortative mating within host races and a reduction in the likelihood of oviposition on the alternative plant and thus the acquisition of alternative stolbur strains. PMID:25247065

  1. Survival relative to new and ancestral host plants, phytoplasma infection, and genetic constitution in host races of a polyphagous insect disease vector.

    PubMed

    Maixner, Michael; Albert, Andreas; Johannesen, Jes

    2014-08-01

    Dissemination of vectorborne diseases depends strongly on the vector's host range and the pathogen's reservoir range. Because vectors interact with pathogens, the direction and strength of a vector's host shift is vital for understanding epidemiology and is embedded in the framework of ecological specialization. This study investigates survival in host-race evolution of a polyphagous insect disease vector, Hyalesthes obsoletus, whether survival is related to the direction of the host shift (from field bindweed to stinging nettle), the interaction with plant-specific strains of obligate vectored pathogens/symbionts (stolbur phytoplasma), and whether survival is related to genetic differentiation between the host races. We used a twice repeated, identical nested experimental design to study survival of the vector on alternative hosts and relative to infection status. Survival was tested with Kaplan-Meier analyses, while genetic differentiation between vector populations was quantified with microsatellite allele frequencies. We found significant direct effects of host plant (reduced survival on wrong hosts) and sex (males survive longer than females) in both host races and relative effects of host (nettle animals more affected than bindweed animals) and sex (males more affected than females). Survival of bindweed animals was significantly higher on symptomatic than nonsymptomatic field bindweed, but in the second experiment only. Infection potentially had a positive effect on survival in nettle animals but due to low infection rates the results remain suggestive. Genetic differentiation was not related to survival. Greater negative plant-transfer effect but no negative effect of stolbur in the derived host race suggests preadaptation to the new pathogen/symbiont strain before strong diversifying selection during the specialization process. Physiological maladaptation or failure to accept the ancestral plant will have similar consequences, namely positive assortative mating within host races and a reduction in the likelihood of oviposition on the alternative plant and thus the acquisition of alternative stolbur strains.

  2. Application of Genomics for Understanding Plant Virus-Insect Vector Interactions and Insect Vector Control.

    PubMed

    Kaur, Navneet; Hasegawa, Daniel K; Ling, Kai-Shu; Wintermantel, William M

    2016-10-01

    The relationships between plant viruses and their vectors have evolved over the millennia, and yet, studies on viruses began <150 years ago and investigations into the virus and vector interactions even more recently. The advent of next generation sequencing, including rapid genome and transcriptome analysis, methods for evaluation of small RNAs, and the related disciplines of proteomics and metabolomics offer a significant shift in the ability to elucidate molecular mechanisms involved in virus infection and transmission by insect vectors. Genomic technologies offer an unprecedented opportunity to examine the response of insect vectors to the presence of ingested viruses through gene expression changes and altered biochemical pathways. This review focuses on the interactions between viruses and their whitefly or thrips vectors and on potential applications of genomics-driven control of the insect vectors. Recent studies have evaluated gene expression in vectors during feeding on plants infected with begomoviruses, criniviruses, and tospoviruses, which exhibit very different types of virus-vector interactions. These studies demonstrate the advantages of genomics and the potential complementary studies that rapidly advance our understanding of the biology of virus transmission by insect vectors and offer additional opportunities to design novel genetic strategies to manage insect vectors and the viruses they transmit.

  3. A Novel Three-Dimensional Vector Analysis of Axial Globe Position in Thyroid Eye Disease

    PubMed Central

    Guo, Jie; Yuan, Yifei; Zhang, Rui; Huang, Wenhu

    2017-01-01

    Purpose. To define a three-dimensional (3D) vector method to describe the axial globe position in thyroid eye disease (TED). Methods. CT data from 59 patients with TED were collected and 3D images were reconstructed. A reference coordinate system was established, and the coordinates of the corneal apex and the eyeball center were calculated to obtain the globe vector EC→. The measurement reliability was evaluated. The parameters of EC→ were analyzed and compared with the results of two-dimensional (2D) CT measurement, Hertel exophthalmometry, and strabismus tests. Results. The reliability of EC→ measurement was excellent. The difference between EC→ and 2D CT measurement was significant (p = 0.003), and EC→ was more consistent with Hertel exophthalmometry than with 2D CT measurement (p < 0.001). There was no significant difference between EC→ and Hirschberg test, and a strong correlation was found between EC→ and synoptophore test. When one eye had a larger deviation angle than its fellow, its corneal apex shifted in the corresponding direction, but the shift of the eyeball center was not significant. The parameters of EC→ were almost perfectly consistent with the geometrical equation. Conclusions. The establishment of a 3D globe vector is feasible and reliable, and it could provide more information in the axial globe position. PMID:28491471

  4. Aerial images visual localization on a vector map using color-texture segmentation

    NASA Astrophysics Data System (ADS)

    Kunina, I. A.; Teplyakov, L. M.; Gladkov, A. P.; Khanipov, T. M.; Nikolaev, D. P.

    2018-04-01

    In this paper we study the problem of combining UAV obtained optical data and a coastal vector map in absence of satellite navigation data. The method is based on presenting the territory as a set of segments produced by color-texture image segmentation. We then find such geometric transform which gives the best match between these segments and land and water areas of the georeferenced vector map. We calculate transform consisting of an arbitrary shift relatively to the vector map and bound rotation and scaling. These parameters are estimated using the RANSAC algorithm which matches the segments contours and the contours of land and water areas of the vector map. To implement this matching we suggest computing shape descriptors robust to rotation and scaling. We performed numerical experiments demonstrating the practical applicability of the proposed method.

  5. An investigative study of multispectral data compression for remotely-sensed images using vector quantization and difference-mapped shift-coding

    NASA Technical Reports Server (NTRS)

    Jaggi, S.

    1993-01-01

    A study is conducted to investigate the effects and advantages of data compression techniques on multispectral imagery data acquired by NASA's airborne scanners at the Stennis Space Center. The first technique used was vector quantization. The vector is defined in the multispectral imagery context as an array of pixels from the same location from each channel. The error obtained in substituting the reconstructed images for the original set is compared for different compression ratios. Also, the eigenvalues of the covariance matrix obtained from the reconstructed data set are compared with the eigenvalues of the original set. The effects of varying the size of the vector codebook on the quality of the compression and on subsequent classification are also presented. The output data from the Vector Quantization algorithm was further compressed by a lossless technique called Difference-mapped Shift-extended Huffman coding. The overall compression for 7 channels of data acquired by the Calibrated Airborne Multispectral Scanner (CAMS), with an RMS error of 15.8 pixels was 195:1 (0.41 bpp) and with an RMS error of 3.6 pixels was 18:1 (.447 bpp). The algorithms were implemented in software and interfaced with the help of dedicated image processing boards to an 80386 PC compatible computer. Modules were developed for the task of image compression and image analysis. Also, supporting software to perform image processing for visual display and interpretation of the compressed/classified images was developed.

  6. Development and validation of novel AAV2 random libraries displaying peptides of diverse lengths and at diverse capsid positions.

    PubMed

    Naumer, Matthias; Ying, Ying; Michelfelder, Stefan; Reuter, Antje; Trepel, Martin; Müller, Oliver J; Kleinschmidt, Jürgen A

    2012-05-01

    Libraries based on the insertion of random peptide ligands into the capsid of adeno-associated virus type 2 (AAV2) have been widely used to improve the efficiency and selectivity of the AAV vector system. However, so far only libraries of 7-mer peptide ligands have been inserted at one well-characterized capsid position. Here, we expanded the combinatorial AAV2 display system to a panel of novel AAV libraries, displaying peptides of 5, 7, 12, 19, or 26 amino acids in length at capsid position 588 or displaying 7-mer peptides at position 453, the most prominently exposed region of the viral capsid. Library selections on two unrelated cell types-human coronary artery endothelial cells and rat cardiomyoblasts-revealed the isolation of cell type-characteristic peptides of different lengths mediating strongly improved target-cell transduction, except for the 26-mer peptide ligands. Characterization of vector selectivity by transduction of nontarget cells and comparative gene-transduction analysis using a panel of 44 human tumor cell lines revealed that insertion of different-length peptides allows targeting of distinct cellular receptors for cell entry with similar efficiency, but with different selectivity. The application of such novel AAV2 libraries broadens the spectrum of targetable receptors by capsid-modified AAV vectors and provides the opportunity to choose the best suited targeting ligand for a certain application from a number of different candidates.

  7. Expressing Transgenes That Exceed the Packaging Capacity of Adeno-Associated Virus Capsids

    PubMed Central

    Chamberlain, Kyle; Riyad, Jalish Mahmud; Weber, Thomas

    2016-01-01

    Recombinant adeno-associated virus vectors (rAAV) are being explored as gene delivery vehicles for the treatment of various inherited and acquired disorders. rAAVs are attractive vectors for several reasons: wild-type AAVs are nonpathogenic, and rAAVs can trigger long-term transgene expression even in the absence of genome integration—at least in postmitotic tissues. Moreover, rAAVs have a low immunogenic profile, and the various AAV serotypes and variants display broad but distinct tropisms. One limitation of rAAVs is that their genome-packaging capacity is only ∼5 kb. For most applications this is not of major concern because the median human protein size is 375 amino acids. Excluding the ITRs, for a protein of typical length, this allows the incorporation of ∼3.5 kb of DNA for the promoter, polyadenylation sequence, and other regulatory elements into a single AAV vector. Nonetheless, for certain diseases the packaging limit of AAV does not allow the delivery of a full-length therapeutic protein by a single AAV vector. Hence, approaches to overcome this limitation have become an important area of research for AAV gene therapy. Among the most promising approaches to overcome the limitation imposed by the packaging capacity of AAV is the use of dual-vector approaches, whereby a transgene is split across two separate AAV vectors. Coinfection of a cell with these two rAAVs will then—through a variety of mechanisms—result in the transcription of an assembled mRNA that could not be encoded by a single AAV vector because of the DNA packaging limits of AAV. The main purpose of this review is to assess the current literature with respect to dual-AAV-vector design, to highlight the effectiveness of the different methodologies and to briefly discuss future areas of research to improve the efficiency of dual-AAV-vector transduction. PMID:26757051

  8. Supercoiled Minivector DNA resists shear forces associated with gene therapy delivery

    PubMed Central

    Catanese, D J; Fogg, J M; Schrock, D E; Gilbert, B E; Zechiedrich, L

    2012-01-01

    Supercoiled DNAs varying from 281 to 5302 bp were subjected to shear forces generated by aerosolization or sonication. DNA shearing strongly correlated with length. Typical sized plasmids (⩾3000 bp) degraded rapidly. DNAs 2000–3000 bp persisted ∼10 min. Even in the absence of condensing agents, supercoiled DNA <1200 bp survived nebulization, and increased forces of sonication were necessary to shear it. Circular vectors were considerably more resistant to shearing than linear vectors of the same length. DNA supercoiling afforded additional protection. These results show the potential of shear-resistant Minivector DNAs to overcome one of the major challenges associated with gene therapy delivery. PMID:21633394

  9. Experimental Study of an Axisymmetric Dual Throat Fluidic Thrust Vectoring Nozzle for Supersonic Aircraft Application

    NASA Technical Reports Server (NTRS)

    Flamm, Jeffrey D.; Deere, Karen A.; Mason, Mary L.; Berrier, Bobby L.; Johnson, Stuart K.

    2007-01-01

    An axisymmetric version of the Dual Throat Nozzle concept with a variable expansion ratio has been studied to determine the impacts on thrust vectoring and nozzle performance. The nozzle design, applicable to a supersonic aircraft, was guided using the unsteady Reynolds-averaged Navier-Stokes computational fluid dynamics code, PAB3D. The axisymmetric Dual Throat Nozzle concept was tested statically in the Jet Exit Test Facility at the NASA Langley Research Center. The nozzle geometric design variables included circumferential span of injection, cavity length, cavity convergence angle, and nozzle expansion ratio for conditions corresponding to take-off and landing, mid climb and cruise. Internal nozzle performance and thrust vectoring performance was determined for nozzle pressure ratios up to 10 with secondary injection rates up to 10 percent of the primary flow rate. The 60 degree span of injection generally performed better than the 90 degree span of injection using an equivalent injection area and number of holes, in agreement with computational results. For injection rates less than 7 percent, thrust vector angle for the 60 degree span of injection was 1.5 to 2 degrees higher than the 90 degree span of injection. Decreasing cavity length improved thrust ratio and discharge coefficient, but decreased thrust vector angle and thrust vectoring efficiency. Increasing cavity convergence angle from 20 to 30 degrees increased thrust vector angle by 1 degree over the range of injection rates tested, but adversely affected system thrust ratio and discharge coefficient. The dual throat nozzle concept generated the best thrust vectoring performance with an expansion ratio of 1.0 (a cavity in between two equal minimum areas). The variable expansion ratio geometry did not provide the expected improvements in discharge coefficient and system thrust ratio throughout the flight envelope of typical a supersonic aircraft. At mid-climb and cruise conditions, the variable geometry design compromised thrust vector angle achieved, but some thrust vector control would be available, potentially for aircraft trim. The fixed area, expansion ratio of 1.0, Dual Throat Nozzle provided the best overall compromise for thrust vectoring and nozzle internal performance over the range of NPR tested compared to the variable geometry Dual Throat Nozzle.

  10. Optoelectronic tuning of organoborylazadipyrromethenes via effective electronegativity at the metalloid center.

    PubMed

    Berhe, Seare A; Rodriguez, Marco T; Park, Eunsol; Nesterov, Vladimir N; Pan, Hongjun; Youngblood, W Justin

    2014-03-03

    Organoborylazadipyrromethenes were synthesized from free base and fluoroborylazadipyrromethenes and characterized with regard to their structural and electronic properties. B-N bond lengths, along with photophysical and redox behavior, appear dependent on the effective electronegativity at the boron atom as tuned by its substituents, with stronger electronegativity correlating to a shorter B-N bond length, red-shifted absorbance, enhanced fluorescence lifetime and yield, and positively shifted redox potentials.

  11. High speed thin plate fatigue crack monitor

    NASA Technical Reports Server (NTRS)

    Wincheski, Buzz A. (Inventor); Heyman, Joseph S. (Inventor); Namkung, Min (Inventor); Fulton, James P. (Inventor)

    1996-01-01

    A device and method are provided which non-destructively detect crack length and crack geometry in thin metallic plates. A non-contacting vibration apparatus produces resonant vibrations without introducing extraneous noise. Resulting resonant vibration shifts in cracked plates are correlated to known crack length in plates with similar resonant vibration shifts. In addition, acoustic emissions of cracks at resonance frequencies are correlated to acoustic emissions from known crack geometries.

  12. Predicting and mapping malaria under climate change scenarios: the potential redistribution of malaria vectors in Africa.

    PubMed

    Tonnang, Henri E Z; Kangalawe, Richard Y M; Yanda, Pius Z

    2010-04-23

    Malaria is rampant in Africa and causes untold mortality and morbidity. Vector-borne diseases are climate sensitive and this has raised considerable concern over the implications of climate change on future disease risk. The problem of malaria vectors (Anopheles mosquitoes) shifting from their traditional locations to invade new zones is an important concern. The vision of this study was to exploit the sets of information previously generated by entomologists, e.g. on geographical range of vectors and malaria distribution, to build models that will enable prediction and mapping the potential redistribution of Anopheles mosquitoes in Africa. The development of the modelling tool was carried out through calibration of CLIMEX parameters. The model helped estimate the potential geographical distribution and seasonal abundance of the species in relation to climatic factors. These included temperature, rainfall and relative humidity, which characterized the living environment for Anopheles mosquitoes. The same parameters were used in determining the ecoclimatic index (EI). The EI values were exported to a GIS package for special analysis and proper mapping of the potential future distribution of Anopheles gambiae and Anophles arabiensis within the African continent under three climate change scenarios. These results have shown that shifts in these species boundaries southward and eastward of Africa may occur rather than jumps into quite different climatic environments. In the absence of adequate control, these predictions are crucial in understanding the possible future geographical range of the vectors and the disease, which could facilitate planning for various adaptation options. Thus, the outputs from this study will be helpful at various levels of decision making, for example, in setting up of an early warning and sustainable strategies for climate change and climate change adaptation for malaria vectors control programmes in Africa.

  13. A new molecular evolution model for limited insertion independent of substitution.

    PubMed

    Lèbre, Sophie; Michel, Christian J

    2013-10-01

    We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Negative hyperconjugation and red-, blue- or zero-shift in X-Z∙∙∙Y complexes.

    PubMed

    Joy, Jyothish; Jemmis, Eluvathingal D; Vidya, Kaipanchery

    2015-01-01

    A generalized explanation is provided for the existence of the red- and blue-shifting nature of X-Z bonds (Z=H, halogens, chalcogens, pnicogens, etc.) in X-Z∙∙∙Y complexes based on computational studies on a selected set of weakly bonded complexes and analysis of existing literature data. The additional electrons and orbitals available on Z in comparison to H make for dramatic differences between the H-bond and the rest of the Z-bonds. The nature of the X-group and its influence on the X-Z bond length in the parent X-Z molecule largely controls the change in the X-Z bond length on X-Z∙∙∙Y bond formation; the Y-group usually influences only the magnitude of the effects controlled by X. The major factors which control the X-Z bond length change are: (a) negative hyperconjugative donation of electron density from X-group to X-Z σ* antibonding molecular orbital (ABMO) in the parent X-Z, (b) induced negative hyperconjugation from the lone pair of electrons on Z to the antibonding orbitals of the X-group, and (c) charge transfer (CT) from the Y-group to the X-Z σ* orbital. The exchange repulsion from the Y-group that shifts partial electron density at the X-Z σ* ABMO back to X leads to blue-shifting and the CT from the Y-group to the σ* ABMO of X-Z leads to red-shifting. The balance between these two opposing forces decides red-, zero- or blue-shifting. A continuum of behaviour of X-Z bond length variation is inevitable in X-Z∙∙∙Y complexes.

  15. Implementation of a Configurable Fault Tolerant Processor (CFTP)

    DTIC Science & Technology

    2003-03-01

    internal structure ARCHITECTURE rtl OF log_barrel IS signal sel1, sel2, sel3, sel4 : std_logic_vector ( 1 downto 0); signal buf0b, buf0c...sel3(1) <= l_or_r and shift(2); sel3(0) <= ar_or_log and shift(2); sel4 (1) <= l_or_r and shift(3); sel4 (0) <= ar_or_log and shift(3); buf0b...out_word => buf3a ); mux4: word_mux4 port map ( a => buf3a, b => buf3b, c => buf3c, d => buf3d, sel => sel4

  16. Triple Modular Redundancy (TMR) in a Configurable Fault-Tolerant Processor (CFTP) for Space Applications

    DTIC Science & Technology

    2003-12-01

    internal structure ARCHITECTURE rtl OF log_barrel IS signal sel1, sel2, sel3, sel4 : std_logic_vector ( 1 downto 0); signal buf0b, buf0c, buf0d...shift(2); sel3(0) <= ar_or_log and shift(2); sel4 (1) <= l_or_r and shift(3); sel4 (0) <= ar_or_log and shift(3); buf0b <= in_word(14 downto 0...mux4: word_mux4 port map ( a => buf3a, b => buf3b, c => buf3c, d => buf3d, sel => sel4 , out_word => out_word

  17. Coupling of Carbon Nanotubes to Metallic Contacts

    NASA Technical Reports Server (NTRS)

    Anantram, M. P.; Datta, S.; Xue, Yong-Xiang; Govindan, T. R. (Technical Monitor)

    1999-01-01

    The modeling of carbon nanotube-metal contacts is important from both basic and applied view points. For many applications, it is important to design contacts such that the transmission is dictated by intrinsic properties of the nanotube rather than by details of the contact. In this paper, we calculate the electron transmission probability from a nanotube to a free electron metal, which is side-contacted. If the metal-nanotube interface is sufficiently ordered, we find that k-vector conservation plays an important role in determining the coupling, with the physics depending on the area of contact, tube diameter, and chirality. The main results of this paper are: (1) conductance scales with contact length, a phenomena that has been observed in experiments and (2) in the case of uniform coupling between metal and nanotube, the threshold value of the metal Fermi wave vector (below which coupling is insignificant) depends on chirality. Disorder and small phase coherence length relax the need for k-vector conservation, thereby making the coupling stronger.

  18. Sentence alignment using feed forward neural network.

    PubMed

    Fattah, Mohamed Abdel; Ren, Fuji; Kuroiwa, Shingo

    2006-12-01

    Parallel corpora have become an essential resource for work in multi lingual natural language processing. However, sentence aligned parallel corpora are more efficient than non-aligned parallel corpora for cross language information retrieval and machine translation applications. In this paper, we present a new approach to align sentences in bilingual parallel corpora based on feed forward neural network classifier. A feature parameter vector is extracted from the text pair under consideration. This vector contains text features such as length, punctuate score, and cognate score values. A set of manually prepared training data has been assigned to train the feed forward neural network. Another set of data was used for testing. Using this new approach, we could achieve an error reduction of 60% over length based approach when applied on English-Arabic parallel documents. Moreover this new approach is valid for any language pair and it is quite flexible approach since the feature parameter vector may contain more/less or different features than that we used in our system such as lexical match feature.

  19. Modeling control of eye orientation in three dimensions. I. Role of muscle pulleys in determining saccadic trajectory.

    PubMed

    Raphan, T

    1998-05-01

    This study evaluates the effects of muscle axis shifts on the performance of a vector velocity-position integrator in the CNS. Earlier models of the oculomotor plant assumed that the muscle axes remained fixed relative to the head as the eye rotated into secondary and tertiary eye positions. Under this assumption, the vector integrator model generates torsional transients as the eye moves from secondary to tertiary positions of fixation. The torsional transient represents an eye movement response to a spatial mismatch between the torque axes that remain fixed in the head and the displacement plane that changes by half the angle of the change in eye orientation. When muscle axis shifts were incorporated into the model, the torque axes were closer to the displacement plane at each eye orientation throughout the trajectory, and torsional transients were reduced dramatically. Their size and dynamics were close to reported data. It was also shown that when the muscle torque axes were rotated by 50% of the eye rotation, there was no torsional transient and Listing's law was perfectly obeyed. When muscle torque axes rotated >50%, torsional transients reversed direction compared with what occurred for muscle axis shifts of <50%. The model indicates that Listing's law is implemented by the oculomotor plant subject to a two-dimensional command signal that is confined to the pitch-yaw plane, having zero torsion. Saccades that bring the eye to orientations outside Listing's plane could easily be corrected by a roll pulse that resets the roll state of the velocity-position integrator to zero. This would be a simple implementation of the corrective controller suggested by Van Opstal and colleagues. The model further indicates that muscle axis shifts together with the torque orientation relationship for tissue surrounding the eye and Newton's laws of motion form a sufficient plant model to explain saccadic trajectories and periods of fixation when driven by a vector command confined to the pitch-yaw plane. This implies that the velocity-position integrator is probably realized as a subtractive feedback vector integrator and not as a quaternion-based integrator that implements kinematic transformations to orient the eye.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beckman, D.E.

    The structures of 0-0-dimethyl-0-(3,5,6-trichloro-2-pyridyl) phosphorothioate (Dowco 214) and dicarbonylbis(eta-cyclopentadienyl)-..mu..-carbonyl-..mu..-thiocarbonyldiiron have been solved by single crystal x-ray diffraction and use of a modified Patterson superposition technique that uses two multiple vectors to define a structural parallelogram. This method results in a simpler and more accurate shift vector position determination and a general improvement in map clarity. Dowco 214 crystallizes in the space group P/sub 1//sup -/ with a = 11.598(2) A, b = 13.619(3) A, c = 8.281(1) A, ..cap alpha.. = 94.65(1)/sup 0/, ..beta.. = 94.87(2)/sup 0/, ..gamma.. = 79.97(2)/sup 0/ and four molecules per cell (two per asymmetric unit).more » A CNDO II calculation was performed and partial charge densities assigned. The molecule contains distances between positively charged centers that correspond well to the reported anionic-esteratic distance (a possible reaction variable) in AChE. Additional reaction variables are discussed. Cp/sub 2/Fe/sub 2/(CO)/sub 3/CS crystallizes in the space group P2/sub 1//c with a = 14.508(8) A, b = 13.618(5) A, c = 15.193(7) A, ..beta.. = 110.50(6)/sup 0/ and eight molecules per unit cell (two per asymmetric unit). The compound contains both a carbonyl and thiocarbonyl bridge and ..pi..-bonded cyclopentadienyl rings that are cis to one another. The iron--iron bond length is intermediate to that of its carbonyl and thiocarbonyl analogs.« less

  1. Influence of conversion on the location of points and lines: The change of location entropy and the probability of a vector point inside the converted grid point

    NASA Astrophysics Data System (ADS)

    Chen, Nan

    2018-03-01

    Conversion of points or lines from vector to grid format, or vice versa, is the first operation required for most spatial analysis. Conversion, however, usually causes the location of points or lines to change, which influences the reliability of the results of spatial analysis or even results in analysis errors. The purpose of this paper is to evaluate the change of the location of points and lines during conversion using the concepts of probability and entropy. This paper shows that when a vector point is converted to a grid point, the vector point may be outside or inside the grid point. This paper deduces a formula for computing the probability that the vector point is inside the grid point. It was found that the probability increased with the side length of the grid and with the variances of the coordinates of the vector point. In addition, the location entropy of points and lines are defined in this paper. Formulae for computing the change of the location entropy during conversion are deduced. The probability mentioned above and the change of location entropy may be used to evaluate the location reliability of points and lines in Geographic Information Systems and may be used to choose an appropriate range of the side length of grids before conversion. The results of this study may help scientists and users to avoid mistakes caused by the change of location during conversion as well as in spatial decision and analysis.

  2. Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease

    PubMed Central

    Trapani, Ivana; Toriello, Elisabetta; de Simone, Sonia; Colella, Pasqualina; Iodice, Carolina; Polishchuk, Elena V.; Sommella, Andrea; Colecchi, Linda; Rossi, Settimio; Simonelli, Francesca; Giunti, Massimo; Bacci, Maria L.; Polishchuk, Roman S.; Auricchio, Alberto

    2015-01-01

    Stargardt disease (STGD1) due to mutations in the large ABCA4 gene is the most common inherited macular degeneration in humans. We have shown that dual adeno-associated viral (AAV) vectors effectively transfer ABCA4 to the retina of Abca4−/− mice. However, they express both lower levels of transgene compared with a single AAV and truncated proteins. To increase productive dual AAV concatemerization, which would overcome these limitations, we have explored the use of either various regions of homology or heterologous inverted terminal repeats (ITR). In addition, we tested the ability of various degradation signals to decrease the expression of truncated proteins. We found the highest levels of transgene expression using regions of homology based on either alkaline phosphatase or the F1 phage (AK). The use of heterologous ITR does not decrease the levels of truncated proteins relative to full-length ABCA4 and impairs AAV vector production. Conversely, the inclusion of the CL1 degradation signal results in the selective degradation of truncated proteins from the 5′-half without affecting full-length protein production. Therefore, we developed dual AAV hybrid ABCA4 vectors including homologous ITR2, the photoreceptor-specific G protein-coupled receptor kinase 1 promoter, the AK region of homology and the CL1 degradation signal. We show that upon subretinal administration these vectors are both safe in pigs and effective in Abca4−/− mice. Our data support the use of improved dual AAV vectors for gene therapy of STGD1. PMID:26420842

  3. Compass cues used by a nocturnal bull ant, Myrmecia midas.

    PubMed

    Freas, Cody A; Narendra, Ajay; Cheng, Ken

    2017-05-01

    Ants use both terrestrial landmarks and celestial cues to navigate to and from their nest location. These cues persist even as light levels drop during the twilight/night. Here, we determined the compass cues used by a nocturnal bull ant, Myrmecia midas , in which the majority of individuals begin foraging during the evening twilight period. Myrmecia midas foragers with vectors of ≤5   m when displaced to unfamiliar locations did not follow the home vector, but instead showed random heading directions. Foragers with larger home vectors (≥10   m) oriented towards the fictive nest, indicating a possible increase in cue strength with vector length. When the ants were displaced locally to create a conflict between the home direction indicated by the path integrator and terrestrial landmarks, foragers oriented using landmark information exclusively and ignored any accumulated home vector regardless of vector length. When the visual landmarks at the local displacement site were blocked, foragers were unable to orient to the nest direction and their heading directions were randomly distributed. Myrmecia midas ants typically nest at the base of the tree and some individuals forage on the same tree. Foragers collected on the nest tree during evening twilight were unable to orient towards the nest after small lateral displacements away from the nest. This suggests the possibility of high tree fidelity and an inability to extrapolate landmark compass cues from information collected on the tree and at the nest site to close displacement sites. © 2017. Published by The Company of Biologists Ltd.

  4. Application of Hyperspectal Techniques to Monitoring & Management of Invasive Plant Species Infestation

    DTIC Science & Technology

    2008-01-09

    The image data as acquired from the sensor is a data cloud in multi- dimensional space with each band generating an axis of dimension. When the data... The color of a material is defined by the direction of its unit vector in n- dimensional spectral space . The length of the vector relates only to how...to n- dimensional space . SAM determines the similarity

  5. Existence of a Size-Dependent Stokes Shift in CsPbBr 3 Perovskite Nanocrystals

    DOE PAGES

    Brennan, Michael C.; Zinna, Jessica; Kuno, Masaru

    2017-05-31

    The existence of a size-dependent Stokes shift is observed in CsPbBr 3 perovskite nanocrystals for the first time. Stokes shifts range from ~100 to 30 meV for particles with edge lengths between ~4 and 12 nm, respectively.

  6. Existence of a Size-Dependent Stokes Shift in CsPbBr 3 Perovskite Nanocrystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brennan, Michael C.; Zinna, Jessica; Kuno, Masaru

    The existence of a size-dependent Stokes shift is observed in CsPbBr 3 perovskite nanocrystals for the first time. Stokes shifts range from ~100 to 30 meV for particles with edge lengths between ~4 and 12 nm, respectively.

  7. The Interaction between Vector Life History and Short Vector Life in Vector-Borne Disease Transmission and Control.

    PubMed

    Brand, Samuel P C; Rock, Kat S; Keeling, Matt J

    2016-04-01

    Epidemiological modelling has a vital role to play in policy planning and prediction for the control of vectors, and hence the subsequent control of vector-borne diseases. To decide between competing policies requires models that can generate accurate predictions, which in turn requires accurate knowledge of vector natural histories. Here we highlight the importance of the distribution of times between life-history events, using short-lived midge species as an example. In particular we focus on the distribution of the extrinsic incubation period (EIP) which determines the time between infection and becoming infectious, and the distribution of the length of the gonotrophic cycle which determines the time between successful bites. We show how different assumptions for these periods can radically change the basic reproductive ratio (R0) of an infection and additionally the impact of vector control on the infection. These findings highlight the need for detailed entomological data, based on laboratory experiments and field data, to correctly construct the next-generation of policy-informing models.

  8. Vector and scalar charmonium resonances with lattice QCD

    DOE PAGES

    Lang, C. B.; Leskovec, Luka; Mohler, Daniel; ...

    2015-09-15

    We perform an exploratory lattice QCD simulation of DD¯ scattering, aimed at determining the masses as well as the decay widths of charmonium resonances above open charm threshold. Neglecting coupling to other channels, the resulting phase shift for DD¯ scattering in p-wave yields the well-known vector resonance ψ(3770). For m π = 156 MeV, the extracted resonance mass and the decay width agree with experiment within large statistical uncertainty. The scalar charmonium resonances present a puzzle, since only the ground state Χc0(1P) is well understood, while there is no commonly accepted candidate for its first excitation. We simulate DD¯ scatteringmore » in s-wave in order to shed light on this puzzle. The resulting phase shift supports the existence of a yet-unobserved narrow resonance with a mass slightly below 4 GeV. A scenario with this narrow resonance and a pole at Χc0(1P) agrees with the energy-dependence of our phase shift. In addition, further lattice QCD simulations and experimental efforts are needed to resolve the puzzle of the excited scalar charmonia.« less

  9. [INVITED] Magnetic field vector sensor by a nonadiabatic tapered Hi-Bi fiber and ferrofluid nanoparticles

    NASA Astrophysics Data System (ADS)

    Layeghi, Azam; Latifi, Hamid

    2018-06-01

    A magnetic field vector sensor based on super-paramagnetic fluid and tapered Hi-Bi fiber (THB) in fiber loop mirror (FLM) is proposed. A two-dimensional detection of external magnetic field (EMF) is experimentally demonstrated and theoretically simulated by Jones matrix to analyze the physical operation in detail. A birefringence is obtained due to magnetic fluid (MF) in applied EMF. By surrounding the THB with MF, a tunable birefringence of MF affect the transmission of the sensor. Slow and fast axes of this obtained birefringence are determined by the direction of applied EMF. In this way, the transmission response of the sensor is depended on the angle between the EMF orientation and the main axes of polarization maintaining fiber (PMF) in FLM. The wavelength shift and intensity shift versus EMF orientation show a sinusoidal behavior, while the applied EMF is constant. Also, the changes in the intensity of EMF in a certain direction results in wavelength shift in the sensor spectrum. The maximum wavelength sensitivity of 214 pm/mT is observed.

  10. Inhibition of prohormone convertase 1 (PC1) expression in cholecystokinin (CCK) expressing At-T20 cells decreased cellular content and secretion of CCK and caused a shift in molecular forms of CCK secreted.

    PubMed

    Beinfeld, Margery C; Vishnuvardhan, Daesety; Blum, Alissa; Reynolds, Nicole; Fannous, Sanya; Kitagawa, Kouki; Marchand, James E

    2006-04-01

    Two different RNAi methods were used to inhibit the expression of prohormone convertase 1 (PC1) in At-T20 cells. Transient transfection of double stranded RNA and stable expression of a vector expressing hairpin-loop RNA targeting PC1 reduced cholecystokinin (CCK) secretion from At-T20 cells. PC1 mRNA and protein were also decreased in the vector transfected cells. This treatment caused a shift in the forms of cholecystokinin (CCK) secreted, decreasing CCK 22 and increasing CCK 8. Stable expression of RNAi effectively decreased PC1 expression. The observed decrease in CCK seen with these RNAi treatments further supports a role for PC1 in CCK processing in these cells.

  11. Invariant object recognition based on the generalized discrete radon transform

    NASA Astrophysics Data System (ADS)

    Easley, Glenn R.; Colonna, Flavia

    2004-04-01

    We introduce a method for classifying objects based on special cases of the generalized discrete Radon transform. We adjust the transform and the corresponding ridgelet transform by means of circular shifting and a singular value decomposition (SVD) to obtain a translation, rotation and scaling invariant set of feature vectors. We then use a back-propagation neural network to classify the input feature vectors. We conclude with experimental results and compare these with other invariant recognition methods.

  12. Observation of giant Goos-Hänchen and angular shifts at designed metasurfaces

    PubMed Central

    Yallapragada, Venkata Jayasurya; Ravishankar, Ajith P.; Mulay, Gajendra L.; Agarwal, Girish S.; Achanta, Venu Gopal

    2016-01-01

    Metasurfaces with sub-wavelength features are useful in modulating the phase, amplitude or polarization of electromagnetic fields. While several applications are reported for light manipulation and control, the sharp phase changes would be useful in enhancing the beam shifts at reflection from a metasurface. In designed periodic patterns on metal film, at surface plasmon resonance, we demonstrate Goos-Hanchen shift of the order of 70 times the incident wavelength and the angular shifts of several hundred microradians. We have designed the patterns using rigorous coupled wave analysis (RCWA) together with S-matrices and have used a complete vector theory to calculate the shifts as well as demonstrate a versatile experimental setup to directly measure the shifts. The giant shifts demonstrated could prove to be useful in enhancing the sensitivity of experiments ranging from atomic force microscopy to gravitational wave detection. PMID:26758471

  13. The effects of consecutive night shifts and shift length on cognitive performance and sleepiness: a field study.

    PubMed

    Haidarimoghadam, Rashid; Kazemi, Reza; Motamedzadeh, Majid; Golmohamadi, Rostam; Soltanian, Alireza; Zoghipaydar, Mohamad Reza

    2017-06-01

    The aim of this study was to evaluate the effects of consecutive night shifts (CNS) and shift length on cognitive performance and sleepiness. This study evaluated the sleepiness and performance of 30 control room operators (CROs) working in 7 nights, 7 days, 7 days off (7N7D7O) and 30 CROs working in 4 nights, 7 days, 3 nights, 7 days off (4N7D3N7O) shift patterns in a petrochemical complex on the last night shift before swinging into the day shift. To assess cognitive performance, the n-back test, continuous performance test and simple reaction time test were employed. To assess sleepiness, the Karolinska sleepiness scale was used. Both schedules indicated that the correct responses and response times of working memory were reduced (p = 0.001), while intentional errors and sleepiness increased during the shift work (p = 0.001). CNS had a significant impact on reaction time and commission errors (p = 0.001). The main duty of CROs at a petrochemical plant is checking hazardous processes which require appropriate alertness and cognitive performance. As a result, planning for appropriate working hours and suitable number of CNS in a rotating shift system is a contribution to improving CRO performance and enhancing safety.

  14. Anomalous Anderson localization

    NASA Astrophysics Data System (ADS)

    Deng, Wenji

    2000-04-01

    We propose a generalized Anderson model and study numerically the localization phenomena in one dimension. In our model, not all the sites take on-site random site energy. The on-site energy εn on the nth site is assigned as follows. If n+P-1=0 ( mod P) , where P is a positive integer, εn is assumed to be randomly distributed between - W/2 and W/2. On the other lattice sites, the site energy is fixed, say εn=0.The localization length ξ defined as | t| 2=e -2 L/ ξ, where t is the transmission coefficient, is calculated using the transfer matrix method. It is found that the single-electron states with wave vectors k= π/P, 2 π/P,…,(P-1) π/P are no longer localized as in the standard Anderson model. Compared with the smooth localization length spectrum of the Anderson model, there appear P-1 sharp peaks periodically located at P-1 values of wave vector on the localization length spectrum of the generalized Anderson model with parameter P.

  15. Image coding using entropy-constrained residual vector quantization

    NASA Technical Reports Server (NTRS)

    Kossentini, Faouzi; Smith, Mark J. T.; Barnes, Christopher F.

    1993-01-01

    The residual vector quantization (RVQ) structure is exploited to produce a variable length codeword RVQ. Necessary conditions for the optimality of this RVQ are presented, and a new entropy-constrained RVQ (ECRVQ) design algorithm is shown to be very effective in designing RVQ codebooks over a wide range of bit rates and vector sizes. The new EC-RVQ has several important advantages. It can outperform entropy-constrained VQ (ECVQ) in terms of peak signal-to-noise ratio (PSNR), memory, and computation requirements. It can also be used to design high rate codebooks and codebooks with relatively large vector sizes. Experimental results indicate that when the new EC-RVQ is applied to image coding, very high quality is achieved at relatively low bit rates.

  16. A note on chaotic unimodal maps and applications.

    PubMed

    Zhou, C T; He, X T; Yu, M Y; Chew, L Y; Wang, X G

    2006-09-01

    Based on the word-lift technique of symbolic dynamics of one-dimensional unimodal maps, we investigate the relation between chaotic kneading sequences and linear maximum-length shift-register sequences. Theoretical and numerical evidence that the set of the maximum-length shift-register sequences is a subset of the set of the universal sequence of one-dimensional chaotic unimodal maps is given. By stabilizing unstable periodic orbits on superstable periodic orbits, we also develop techniques to control the generation of long binary sequences.

  17. Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease.

    PubMed

    Trapani, Ivana; Toriello, Elisabetta; de Simone, Sonia; Colella, Pasqualina; Iodice, Carolina; Polishchuk, Elena V; Sommella, Andrea; Colecchi, Linda; Rossi, Settimio; Simonelli, Francesca; Giunti, Massimo; Bacci, Maria L; Polishchuk, Roman S; Auricchio, Alberto

    2015-12-01

    Stargardt disease (STGD1) due to mutations in the large ABCA4 gene is the most common inherited macular degeneration in humans. We have shown that dual adeno-associated viral (AAV) vectors effectively transfer ABCA4 to the retina of Abca4-/- mice. However, they express both lower levels of transgene compared with a single AAV and truncated proteins. To increase productive dual AAV concatemerization, which would overcome these limitations, we have explored the use of either various regions of homology or heterologous inverted terminal repeats (ITR). In addition, we tested the ability of various degradation signals to decrease the expression of truncated proteins. We found the highest levels of transgene expression using regions of homology based on either alkaline phosphatase or the F1 phage (AK). The use of heterologous ITR does not decrease the levels of truncated proteins relative to full-length ABCA4 and impairs AAV vector production. Conversely, the inclusion of the CL1 degradation signal results in the selective degradation of truncated proteins from the 5'-half without affecting full-length protein production. Therefore, we developed dual AAV hybrid ABCA4 vectors including homologous ITR2, the photoreceptor-specific G protein-coupled receptor kinase 1 promoter, the AK region of homology and the CL1 degradation signal. We show that upon subretinal administration these vectors are both safe in pigs and effective in Abca4-/- mice. Our data support the use of improved dual AAV vectors for gene therapy of STGD1. © The Author 2015. Published by Oxford University Press.

  18. Multiplex analysis of DNA

    DOEpatents

    Church, George M.; Kieffer-Higgins, Stephen

    1992-01-01

    This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

  19. Support Vector Machines Model of Computed Tomography for Assessing Lymph Node Metastasis in Esophageal Cancer with Neoadjuvant Chemotherapy.

    PubMed

    Wang, Zhi-Long; Zhou, Zhi-Guo; Chen, Ying; Li, Xiao-Ting; Sun, Ying-Shi

    The aim of this study was to diagnose lymph node metastasis of esophageal cancer by support vector machines model based on computed tomography. A total of 131 esophageal cancer patients with preoperative chemotherapy and radical surgery were included. Various indicators (tumor thickness, tumor length, tumor CT value, total number of lymph nodes, and long axis and short axis sizes of largest lymph node) on CT images before and after neoadjuvant chemotherapy were recorded. A support vector machines model based on these CT indicators was built to predict lymph node metastasis. Support vector machines model diagnosed lymph node metastasis better than preoperative short axis size of largest lymph node on CT. The area under the receiver operating characteristic curves were 0.887 and 0.705, respectively. The support vector machine model of CT images can help diagnose lymph node metastasis in esophageal cancer with preoperative chemotherapy.

  20. Investigations on the hierarchy of reference frames in geodesy and geodynamics

    NASA Technical Reports Server (NTRS)

    Grafarend, E. W.; Mueller, I. I.; Papo, H. B.; Richter, B.

    1979-01-01

    Problems related to reference directions were investigated. Space and time variant angular parameters are illustrated in hierarchic structures or towers. Using least squares techniques, model towers of triads are presented which allow the formation of linear observation equations. Translational and rotational degrees of freedom (origin and orientation) are discussed along with and the notion of length and scale degrees of freedom. According to the notion of scale parallelism, scale factors with respect to a unit length are given. Three-dimensional geodesy was constructed from the set of three base vectors (gravity, earth-rotation and the ecliptic normal vector). Space and time variations are given with respect to a polar and singular value decomposition or in terms of changes in translation, rotation, deformation (shear, dilatation or angular and scale distortions).

  1. Dengue fever in Pakistan: a paradigm shift; changing epidemiology and clinical patterns.

    PubMed

    Haider, Zahra; Ahmad, Farina Zia; Mahmood, Asif; Waseem, Tariq; Shafiq, Irfan; Raza, Tanzeem; Qazi, Javaria; Siddique, Nasir; Humayun, Malik Asif

    2015-11-01

    Dengue fever has huge public health implications and affects over 100 million people worldwide. This review pictures the current situation of Dengue in Pakistan and presents a review of published literature. Pakistan has seen recurrent epidemics of Dengue Fever recently. Unfortunately, these epidemics are becoming more severe in their clinical manifestation. Pakistan experienced large epidemics of dengue fever during 2008, 2010 and 2011 affecting thousands of people and claiming hundreds of deaths. A comparison of data during these epidemics indicates a shift from mild to a more severe disease, which could be interpreted as an epidemiologic transition pattern in the country. Expansion of Dengue in Pakistan seems to be multifactorial, including the climate change, frequent natural disasters, vector resistance to insecticides and lack of resources. This highlights the need for rigorous vector control. Continuing education of primary care physicians is crucial for early appropriate management to reduce mortality. © Royal Society for Public Health 2015.

  2. Chiral magnetic effect of light

    NASA Astrophysics Data System (ADS)

    Hayata, Tomoya

    2018-05-01

    We study a photonic analog of the chiral magnetic (vortical) effect. We discuss that the vector component of magnetoelectric tensors plays a role of "vector potential," and its rotation is understood as "magnetic field" of a light. Using the geometrical optics approximation, we show that "magnetic fields" cause an anomalous shift of a wave packet of a light through an interplay with the Berry curvature of photons. The mechanism is the same as that of the chiral magnetic (vortical) effect of a chiral fermion, so that we term the anomalous shift "chiral magnetic effect of a light." We further study the chiral magnetic effect of a light beyond geometric optics by directly solving the transmission problem of a wave packet at a surface of a magnetoelectric material. We show that the experimental signal of the chiral magnetic effect of a light is the nonvanishing of transverse displacements for the beam normally incident to a magnetoelectric material.

  3. Stokes' theorem, gauge symmetry and the time-dependent Aharonov-Bohm effect

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Macdougall, James, E-mail: jbm34@mail.fresnostate.edu; Singleton, Douglas, E-mail: dougs@csufresno.edu

    2014-04-15

    Stokes' theorem is investigated in the context of the time-dependent Aharonov-Bohm effect—the two-slit quantum interference experiment with a time varying solenoid between the slits. The time varying solenoid produces an electric field which leads to an additional phase shift which is found to exactly cancel the time-dependent part of the usual magnetic Aharonov-Bohm phase shift. This electric field arises from a combination of a non-single valued scalar potential and/or a 3-vector potential. The gauge transformation which leads to the scalar and 3-vector potentials for the electric field is non-single valued. This feature is connected with the non-simply connected topology ofmore » the Aharonov-Bohm set-up. The non-single valued nature of the gauge transformation function has interesting consequences for the 4-dimensional Stokes' theorem for the time-dependent Aharonov-Bohm effect. An experimental test of these conclusions is proposed.« less

  4. Reproductive dynamics of Pacific sanddab, Citharichthys sordidus, off the central coast of California

    NASA Astrophysics Data System (ADS)

    Lefebvre, Lyndsey S.; Payne, Amber M.; Field, John C.

    2016-01-01

    Female Pacific sanddab were collected from the Monterey Bay, California to describe their reproductive strategy and annual reproductive cycle, as well as to estimate length at maturity, fecundity, spawning fraction (SF), and spawning interval (SI). Captive females were held to examine degradation of spawning markers and confirmed the biological spawning capabilities of the species. The reproductive season extended from May through January, as determined through macroscopic and histological examination of ovaries. Oocyte development was asynchronous, and an indeterminate fecundity pattern was displayed. Absolute and relative batch fecundity values were variable (means = 6663 eggs and 54 eggs g- 1 somatic weight, respectively) and significantly related to maternal length. During the period of highest reproductive activity, SF ranged from 0.42 to 0.98, suggesting some females were spawning on a daily basis. Monthly SF and SI were related to length, with smaller females having a truncated season and lower SF compared to larger females. Lengths at 50% (119 mm) and 95% (149 mm) maturity showed a downward shift relative to the 1940s, though the magnitude and cause of this shift remain unknown. This study highlights the importance of considering demographic shifts and size-related dynamics when modeling a stock's reproductive potential.

  5. 4 × 20 Gbit/s mode division multiplexing over free space using vector modes and a q-plate mode (de)multiplexer

    NASA Astrophysics Data System (ADS)

    Milione, Giovanni; Lavery, Martin P. J.; Huang, Hao; Ren, Yongxiong; Xie, Guodong; Nguyen, Thien An; Karimi, Ebrahim; Marrucci, Lorenzo; Nolan, Daniel A.; Alfano, Robert R.; Willner, Alan E.

    2015-05-01

    Vector modes are spatial modes that have spatially inhomogeneous states of polarization, such as, radial and azimuthal polarization. They can produce smaller spot sizes and stronger longitudinal polarization components upon focusing. As a result, they are used for many applications, including optical trapping and nanoscale imaging. In this work, vector modes are used to increase the information capacity of free space optical communication via the method of optical communication referred to as mode division multiplexing. A mode (de)multiplexer for vector modes based on a liquid crystal technology referred to as a q-plate is introduced. As a proof of principle, using the mode (de)multiplexer four vector modes each carrying a 20 Gbit/s quadrature phase shift keying signal on a single wavelength channel (~1550nm), comprising an aggregate 80 Gbit/s, were transmitted ~1m over the lab table with <-16.4 dB (<2%) mode crosstalk. Bit error rates for all vector modes were measured at the forward error correction threshold with power penalties < 3.41dB.

  6. Spatial filtering and spatial primitives in early vision: an explanation of the Zöllner-Judd class of geometrical illusion.

    PubMed

    Morgan, M J; Casco, C

    1990-10-22

    The apparent length and orientation of short lines is altered when they abut against oblique lines (the Zöllner and Judd illusions). Here we present evidence that the length and orientation biases are geometrically related and probably depend upon the same underlying mechanism. Measurements were done with an 'H' figure, in which the apparent length and orientation of the cross-bar was assessed by the method of adjustment while the orientation of the outer flanking lines was varied. When the flanking lines are oblique the apparent length of the central line is reduced and its orientation is shifted so that it appears more nearly at right-angles to the obliques than is in fact the case. Measurements of the orientation and length effects were made in three observers, over a range of flanking-line angles (90, 63, 45, 34 and 27 deg) and central line lengths (9, 17, 33 and 67 arc min). The biases increased with the tilt of the flanking-lines, and decreased with central line length. The extent of the length bias could be accurately predicted from the angular shift by simple trigonometry. We describe physiological and computational models to account for the relation between the orientation and length biases.

  7. Use of the piggyBac transposon to create stable packaging cell lines for the production of clinical-grade self-inactivating γ-retroviral vectors.

    PubMed

    Feldman, Steven A; Xu, Hui; Black, Mary A; Park, Tristen S; Robbins, Paul F; Kochenderfer, James N; Morgan, Richard A; Rosenberg, Steven A

    2014-08-01

    Efforts to improve the biosafety of γ-retroviral-mediated gene therapy have resulted in a shift toward the use of self-inactivating (SIN) γ-retroviral vectors. However, scale-up and manufacturing of such vectors requires significant optimization of transient transfection-based processes or development of novel platforms for the generation of stable producer cell clones. To that end, we describe the use of the piggybac transposon to generate stable producer cell clones for the production of SIN γ-retroviral vectors. The piggybac transposon is a universal tool allowing for the stable integration of SIN γ-retroviral constructs into murine (PG13) and human 293-based Phoenix (GALV and RD114, respectively) packaging cell lines without reverse transcription. Following transposition, a high-titer clone is selected for manufacture of a master cell bank and subsequent γ-retroviral vector supernatant production. Packaging cell clones created using the piggybac transposon have comparable titers to non-SIN vectors generated via conventional methods. We describe herein the use of the piggybac transposon for the production of stable packaging cell clones for the manufacture of clinical-grade SIN γ-retroviral vectors for ex vivo gene therapy clinical trials.

  8. The effect of transverse wave vector and magnetic fields on resonant tunneling times in double-barrier structures

    NASA Astrophysics Data System (ADS)

    Wang, Hongmei; Zhang, Yafei; Xu, Huaizhe

    2007-01-01

    The effect of transverse wave vector and magnetic fields on resonant tunneling times in double-barrier structures, which is significant but has been frequently omitted in previous theoretical methods, has been reported in this paper. The analytical expressions of the longitudinal energies of quasibound levels (LEQBL) and the lifetimes of quasibound levels (LQBL) in symmetrical double-barrier (SDB) structures have been derived as a function of transverse wave vector and longitudinal magnetic fields perpendicular to interfaces. Based on our derived analytical expressions, the LEQBL and LQBL dependence upon transverse wave vector and longitudinal magnetic fields has been explored numerically for a SDB structure. Model calculations show that the LEQBL decrease monotonically and the LQBL shorten with increasing transverse wave vector, and each original LEQBL splits to a series of sub-LEQBL which shift nearly linearly toward the well bottom and the lifetimes of quasibound level series (LQBLS) shorten with increasing Landau-level indices and magnetic fields.

  9. Current and Future Niche of North and Central American Sand Flies (Diptera: Psychodidae) in Climate Change Scenarios

    PubMed Central

    Moo-Llanes, David; Ibarra-Cerdeña, Carlos N.; Rebollar-Téllez, Eduardo A.; Ibáñez-Bernal, Sergio; González, Camila; Ramsey, Janine M.

    2013-01-01

    Ecological niche models are useful tools to infer potential spatial and temporal distributions in vector species and to measure epidemiological risk for infectious diseases such as the Leishmaniases. The ecological niche of 28 North and Central American sand fly species, including those with epidemiological relevance, can be used to analyze the vector's ecology and its association with transmission risk, and plan integrated regional vector surveillance and control programs. In this study, we model the environmental requirements of the principal North and Central American phlebotomine species and analyze three niche characteristics over future climate change scenarios: i) potential change in niche breadth, ii) direction and magnitude of niche centroid shifts, iii) shifts in elevation range. Niche identity between confirmed or incriminated Leishmania vector sand flies in Mexico, and human cases were analyzed. Niche models were constructed using sand fly occurrence datapoints from Canada, USA, Mexico, Guatemala and Belize. Nine non-correlated bioclimatic and four topographic data layers were used as niche components using GARP in OpenModeller. Both B2 and A2 climate change scenarios were used with two general circulation models for each scenario (CSIRO and HadCM3), for 2020, 2050 and 2080. There was an increase in niche breadth to 2080 in both scenarios for all species with the exception of Lutzomyia vexator. The principal direction of niche centroid displacement was to the northwest (64%), while the elevation range decreased greatest for tropical, and least for broad-range species. Lutzomyia cruciata is the only epidemiologically important species with high niche identity with that of Leishmania spp. in Mexico. Continued landscape modification in future climate change will provide an increased opportunity for the geographic expansion of NCA sand flys' ENM and human exposure to vectors of Leishmaniases. PMID:24069478

  10. Current and future niche of North and Central American sand flies (Diptera: psychodidae) in climate change scenarios.

    PubMed

    Moo-Llanes, David; Ibarra-Cerdeña, Carlos N; Rebollar-Téllez, Eduardo A; Ibáñez-Bernal, Sergio; González, Camila; Ramsey, Janine M

    2013-01-01

    Ecological niche models are useful tools to infer potential spatial and temporal distributions in vector species and to measure epidemiological risk for infectious diseases such as the Leishmaniases. The ecological niche of 28 North and Central American sand fly species, including those with epidemiological relevance, can be used to analyze the vector's ecology and its association with transmission risk, and plan integrated regional vector surveillance and control programs. In this study, we model the environmental requirements of the principal North and Central American phlebotomine species and analyze three niche characteristics over future climate change scenarios: i) potential change in niche breadth, ii) direction and magnitude of niche centroid shifts, iii) shifts in elevation range. Niche identity between confirmed or incriminated Leishmania vector sand flies in Mexico, and human cases were analyzed. Niche models were constructed using sand fly occurrence datapoints from Canada, USA, Mexico, Guatemala and Belize. Nine non-correlated bioclimatic and four topographic data layers were used as niche components using GARP in OpenModeller. Both B2 and A2 climate change scenarios were used with two general circulation models for each scenario (CSIRO and HadCM3), for 2020, 2050 and 2080. There was an increase in niche breadth to 2080 in both scenarios for all species with the exception of Lutzomyia vexator. The principal direction of niche centroid displacement was to the northwest (64%), while the elevation range decreased greatest for tropical, and least for broad-range species. Lutzomyia cruciata is the only epidemiologically important species with high niche identity with that of Leishmania spp. in Mexico. Continued landscape modification in future climate change will provide an increased opportunity for the geographic expansion of NCA sand flys' ENM and human exposure to vectors of Leishmaniases.

  11. Targeting male mosquito swarms to control malaria vector density

    PubMed Central

    Sawadogo, Simon Peguedwinde; Niang, Abdoulaye; Bilgo, Etienne; Millogo, Azize; Maïga, Hamidou; Dabire, Roch K.; Tripet, Frederic; Diabaté, Abdoulaye

    2017-01-01

    Malaria control programs are being jeopardized by the spread of insecticide resistance in mosquito vector populations. It has been estimated that the spread of resistance could lead to an additional 120000 deaths per year, and interfere with the prospects for sustained control or the feasibility of achieving malaria elimination. Another complication for the development of resistance management strategies is that, in addition to insecticide resistance, mosquito behavior evolves in a manner that diminishes the impact of LLINs and IRS. Mosquitoes may circumvent LLIN and IRS control through preferential feeding and resting outside human houses and/or being active earlier in the evening before people go to sleep. Recent developments in our understanding of mosquito swarming suggest that new tools targeting mosquito swarms can be designed to cut down the high reproductive rate of malaria vectors. Targeting swarms of major malaria vectors may provide an effective control method to counteract behavioral resistance developed by mosquitoes. Here, we evaluated the impact of systematic spraying of swarms of Anopheles gambiae s.l. using a mixed carbamate and pyrethroid aerosol. The impact of this intervention on vector density, female insemination rates and the age structure of males was measured. We showed that the resulting mass killing of swarming males and some mate-seeking females resulted in a dramatic 80% decrease in population size compared to a control population. A significant decrease in female insemination rate and a significant shift in the age structure of the male population towards younger males incapable of mating were observed. This paradigm-shift study therefore demonstrates that targeting primarily males rather than females, can have a drastic impact on mosquito population. PMID:28278212

  12. Nonlinear Decay of Alfvén Waves Driven by Interplaying Two- and Three-dimensional Nonlinear Interactions

    NASA Astrophysics Data System (ADS)

    Zhao, J. S.; Voitenko, Y.; De Keyser, J.; Wu, D. J.

    2018-04-01

    We study the decay of Alfvén waves in the solar wind, accounting for the joint operation of two-dimensional (2D) scalar and three-dimensional (3D) vector nonlinear interactions between Alfvén and slow waves. These interactions have previously been studied separately in long- and short-wavelength limits where they lead to 2D scalar and 3D vector decays, correspondingly. The joined action of the scalar and vector interactions shifts the transition between 2D and 3D decays to significantly smaller wavenumbers than was predicted by Zhao et al. who compared separate scalar and vector decays. In application to the broadband Alfvén waves in the solar wind, this means that the vector nonlinear coupling dominates in the extended wavenumber range 5 × 10‑4 ≲ ρ i k 0⊥ ≲ 1, where the decay is essentially 3D and nonlocal, generating product Alfvén and slow waves around the ion gyroscale. Here ρ i is the ion gyroradius, and k 0⊥ is the pump Alfvén wavenumber. It appears that, except for the smallest wavenumbers at and below {ρ }i{k}0\\perp ∼ {10}-4 in Channel I, the nonlinear decay of magnetohydrodynamic Alfvén waves propagating from the Sun is nonlocal and cannot generate counter-propagating Alfvén waves with similar scales needed for the turbulent cascade. Evaluation of the nonlinear frequency shift shows that product Alfvén waves can still be approximately described as normal Alfvénic eigenmodes. On the contrary, nonlinearly driven slow waves deviate considerably from normal modes and are therefore difficult to identify on the basis of their phase velocities and/or polarization.

  13. Impact of Vector Dispersal and Host-Plant Fidelity on the Dissemination of an Emerging Plant Pathogen

    PubMed Central

    Johannesen, Jes; Foissac, Xavier; Kehrli, Patrik; Maixner, Michael

    2012-01-01

    Dissemination of vector-transmitted pathogens depend on the survival and dispersal of the vector and the vector's ability to transmit the pathogen, while the host range of vector and pathogen determine the breath of transmission possibilities. In this study, we address how the interaction between dispersal and plant fidelities of a pathogen (stolbur phytoplasma tuf-a) and its vector (Hyalesthes obsoletus: Cixiidae) affect the emergence of the pathogen. Using genetic markers, we analysed the geographic origin and range expansion of both organisms in Western Europe and, specifically, whether the pathogen's dissemination in the northern range is caused by resident vectors widening their host-plant use from field bindweed to stinging nettle, and subsequent host specialisation. We found evidence for common origins of pathogen and vector south of the European Alps. Genetic patterns in vector populations show signals of secondary range expansion in Western Europe leading to dissemination of tuf-a pathogens, which might be newly acquired and of hybrid origin. Hence, the emergence of stolbur tuf-a in the northern range was explained by secondary immigration of vectors carrying stinging nettle-specialised tuf-a, not by widening the host-plant spectrum of resident vectors with pathogen transmission from field bindweed to stinging nettle nor by primary co-migration from the resident vector's historical area of origin. The introduction of tuf-a to stinging nettle in the northern range was therefore independent of vector's host-plant specialisation but the rapid pathogen dissemination depended on the vector's host shift, whereas the general dissemination elsewhere was linked to plant specialisation of the pathogen but not of the vector. PMID:23284774

  14. Impact of vector dispersal and host-plant fidelity on the dissemination of an emerging plant pathogen.

    PubMed

    Johannesen, Jes; Foissac, Xavier; Kehrli, Patrik; Maixner, Michael

    2012-01-01

    Dissemination of vector-transmitted pathogens depend on the survival and dispersal of the vector and the vector's ability to transmit the pathogen, while the host range of vector and pathogen determine the breath of transmission possibilities. In this study, we address how the interaction between dispersal and plant fidelities of a pathogen (stolbur phytoplasma tuf-a) and its vector (Hyalesthes obsoletus: Cixiidae) affect the emergence of the pathogen. Using genetic markers, we analysed the geographic origin and range expansion of both organisms in Western Europe and, specifically, whether the pathogen's dissemination in the northern range is caused by resident vectors widening their host-plant use from field bindweed to stinging nettle, and subsequent host specialisation. We found evidence for common origins of pathogen and vector south of the European Alps. Genetic patterns in vector populations show signals of secondary range expansion in Western Europe leading to dissemination of tuf-a pathogens, which might be newly acquired and of hybrid origin. Hence, the emergence of stolbur tuf-a in the northern range was explained by secondary immigration of vectors carrying stinging nettle-specialised tuf-a, not by widening the host-plant spectrum of resident vectors with pathogen transmission from field bindweed to stinging nettle nor by primary co-migration from the resident vector's historical area of origin. The introduction of tuf-a to stinging nettle in the northern range was therefore independent of vector's host-plant specialisation but the rapid pathogen dissemination depended on the vector's host shift, whereas the general dissemination elsewhere was linked to plant specialisation of the pathogen but not of the vector.

  15. Direct measurement of Lorentz transformation with Doppler effects

    NASA Astrophysics Data System (ADS)

    Chen, Shao-Guang

    For space science and astronomy the fundamentality of one-way velocity of light (OWVL) is selfevident. The measurement of OWVL (distance/interval) and the clock synchronization with light-signal transfer make a logical circulation. This means that OWVL could not be directly measured but only come indirectly from astronomical method (Romer's Io eclipse and Bradley's sidereal aberration), furthermore, the light-year by definitional OWVL and the trigonometry distance with AU are also un-measurable. For to solve this problem two methods of clock synchronization were proposed: The direct method is that at one end of dual-speed transmissionline with single clock measure the arriving-time difference of longitudinal wave and transverse wave or ordinary light and extraordinary light, again to calculate the collective sending-time of two wave with Yang's /shear elastic-modulus ratio (E/k) or extraordinary/ordinary light refractive-index ratio (ne/no), which work as one earthquake-station with single clock measures first-shake time and the distance to epicenter; The indirect method is that the one-way wavelength l is measured by dual-counters Ca and Cb and computer's real-time operation of reading difference (Nb - Na) of two counters, the frequency f is also simultaneously measured, then l f is just OWVL. Therefore, with classical Newtonian mechanics and ether wave optics, OWVL can be measured in the Galileo coordinate system with an isotropic length unit (1889 international meter definition). Without any hypotheses special relativity can entirely establish on the metrical results. When a certain wavelength l is defined as length unit, foregoing measurement of one-way wavelength l will become as the measurement of rod's length. Let a rigidity-rod connecting Ca and Cb moves relative to lamp-house with velocity v, rod's length L = (Nb - Na) l will change follow v by known Doppler effect, i.e., L(q) =L0 (1+ (v/c) cos q), where L0 is the proper length when v= 0, v• r = v cos q, r is the unit vector from lamphouse point to counters. Or: L (0) L (pi) =L0 (1+(v/c)) L0 (1 - (v/c)) =L0 2 y2 =L2 Or: L ≡ [L(0)L(pi)]1/2 =L0 y , which y ≡ (1 - (v/c)2 )1/2 is just Fitzgerald-Lorentzian contraction-factor. Also, when a light-wave period p is defined as time unit, from Doppler's frequency-shift the count N with p of one period T of moving-clock is: T(q) = N(q) p = T0 /(1+(v/c) cos q) Or: T ≡ (T(0) T(pi))1/2 = T 0 /y , where T0 is the proper period when v = 0, which is just the moving-clock-slower effect. Let r from clock point to lamp-house ((v/c) symbol reverse), Doppler formula in the usual form is: f (q) = 1/T(q) = f0 (1 - (v/c) cos q). Therefore, Lorentz transformation is the square root average of positive and negative directions twice metrical results of Doppler's frequency-shift, which Doppler's once items ( positive and negative v/c ) are counteract only residual twice item (v/c)2 (relativity-factor). Then Lorentz transformation can be directly measured by Doppler's frequency-shift method. The half-life of moving mu-meson is statistical average of many particles, the usual explanation using relativity-factor y is correct. An airship moving simultaneously along contrary directions is impossible, which makes that the relativity-factor y and the twin-paradox are inexistent in the macroscopical movement. Thereby, in the navigations of airship or satellite only use the measurement of Doppler's frequency-shift but have no use for Lorentz transformation.

  16. Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

    PubMed

    Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

    2001-04-01

    Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

  17. Giardia canis: ultrastructural analysis of G. canis trophozoites transfected with full length G. canis virus cDNA transcripts

    USDA-ARS?s Scientific Manuscript database

    Giardia canis virus (GCV) is a double-stranded RNA (dsRNA) virus of the family Totiviridae. In this study, the full-length cDNA of the G. canis virus was constructed in pPoly2/sfinot vector and RNA was transcribed in vitro. Virus-free G. canis trophozoites were transfected with in vitro transcribed ...

  18. Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

    PubMed Central

    Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

    2009-01-01

    Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

  19. Tunable optical filter based on Sagnac phase-shift using single optical ring resonator

    NASA Astrophysics Data System (ADS)

    Seraji, Faramarz E.; Asghari, Fatemeh

    2010-02-01

    In this paper, a single optical ring resonator connected to a Sagnac loop is used to demonstrate theoretically a novel narrow band optical filter response that is based on Sagnac phase-shift Δ φ. The given filter structure permits the Sagnac rotation to control the filter response. It is shown that by changing the Sagnac rotation rate, we can tune the filter response for desired bandwidths. To increase the wavelength selectivity of the filter, the Sagnac phase-shift should be as small as possible that is limited by the loop length. For Δ φ=0.1 rad, the obtained FWHM is 2.63 MHz for tuning loop length of 2 m. The simulation response agrees fairly with the recently reported experimental result.

  20. The correlation structure of several popular pseudorandom number generators

    NASA Technical Reports Server (NTRS)

    Neuman, F.; Merrick, R.; Martin, C. F.

    1973-01-01

    One of the desirable properties of a pseudorandom number generator is that the sequence of numbers it generates should have very low autocorrelation for all shifts except for zero shift and those that are multiples of its cycle length. Due to the simple methods of constructing random numbers, the ideal is often not quite fulfilled. A simple method of examining any random generator for previously unsuspected regularities is discussed. Once they are discovered it is often easy to derive the mathematical relationships, which describe the mathematical relationships, which describe the regular behavior. As examples, it is shown that high correlation exists in mixed and multiplicative congruential random number generators and prime moduli Lehmer generators for shifts a fraction of their cycle lengths.

  1. Effects of internal yaw-vectoring devices on the static performance of a pitch-vectoring nonaxisymmetric convergent-divergent nozzle

    NASA Technical Reports Server (NTRS)

    Asbury, Scott C.

    1993-01-01

    An investigation was conducted in the static test facility of the Langley 16-Foot Transonic Tunnel to evaluate the internal performance of a nonaxisymmetric convergent divergent nozzle designed to have simultaneous pitch and yaw thrust vectoring capability. This concept utilized divergent flap deflection for thrust vectoring in the pitch plane and flow-turning deflectors installed within the divergent flaps for yaw thrust vectoring. Modifications consisting of reducing the sidewall length and deflecting the sidewall outboard were investigated as means to increase yaw-vectoring performance. This investigation studied the effects of multiaxis (pitch and yaw) thrust vectoring on nozzle internal performance characteristics. All tests were conducted with no external flow, and nozzle pressure ratio was varied from 2.0 to approximately 13.0. The results indicate that this nozzle concept can successfully generate multiaxis thrust vectoring. Deflection of the divergent flaps produced resultant pitch vector angles that, although dependent on nozzle pressure ratio, were nearly equal to the geometric pitch vector angle. Losses in resultant thrust due to pitch vectoring were small or negligible. The yaw deflectors produced resultant yaw vector angles up to 21 degrees that were controllable by varying yaw deflector rotation. However, yaw deflector rotation resulted in significant losses in thrust ratios and, in some cases, nozzle discharge coefficient. Either of the sidewall modifications generally reduced these losses and increased maximum resultant yaw vector angle. During multiaxis (simultaneous pitch and yaw) thrust vectoring, little or no cross coupling between the thrust vectoring processes was observed.

  2. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

  3. Development of a vector-tensor system to measure the absolute magnetic flux density and its gradient in magnetically shielded rooms.

    PubMed

    Voigt, J; Knappe-Grüneberg, S; Gutkelch, D; Haueisen, J; Neuber, S; Schnabel, A; Burghoff, M

    2015-05-01

    Several experiments in fundamental physics demand an environment of very low, homogeneous, and stable magnetic fields. For the magnetic characterization of such environments, we present a portable SQUID system that measures the absolute magnetic flux density vector and the gradient tensor. This vector-tensor system contains 13 integrated low-critical temperature (LTc) superconducting quantum interference devices (SQUIDs) inside a small cylindrical liquid helium Dewar with a height of 31 cm and 37 cm in diameter. The achievable resolution depends on the flux density of the field under investigation and its temporal drift. Inside a seven-layer mu-metal shield, an accuracy better than ±23 pT for the components of the static magnetic field vector and ±2 pT/cm for each of the nine components of the gradient tensor is reached by using the shifting method.

  4. Development of a vector-tensor system to measure the absolute magnetic flux density and its gradient in magnetically shielded rooms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Voigt, J.; Knappe-Grüneberg, S.; Gutkelch, D.

    2015-05-15

    Several experiments in fundamental physics demand an environment of very low, homogeneous, and stable magnetic fields. For the magnetic characterization of such environments, we present a portable SQUID system that measures the absolute magnetic flux density vector and the gradient tensor. This vector-tensor system contains 13 integrated low-critical temperature (LTc) superconducting quantum interference devices (SQUIDs) inside a small cylindrical liquid helium Dewar with a height of 31 cm and 37 cm in diameter. The achievable resolution depends on the flux density of the field under investigation and its temporal drift. Inside a seven-layer mu-metal shield, an accuracy better than ±23more » pT for the components of the static magnetic field vector and ±2 pT/cm for each of the nine components of the gradient tensor is reached by using the shifting method.« less

  5. SU-E-J-115: Correlation of Displacement Vector Fields Calculated by Deformable Image Registration Algorithms with Motion Parameters of CT Images with Well-Defined Targets and Controlled-Motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaskowiak, J; Ahmad, S; Ali, I

    Purpose: To investigate correlation of displacement vector fields (DVF) calculated by deformable image registration algorithms with motion parameters in helical axial and cone-beam CT images with motion artifacts. Methods: A mobile thorax phantom with well-known targets with different sizes that were made from water-equivalent material and inserted in foam to simulate lung lesions. The thorax phantom was imaged with helical, axial and cone-beam CT. The phantom was moved with a cyclic motion with different motion amplitudes and frequencies along the superior-inferior direction. Different deformable image registration algorithms including demons, fast demons, Horn-Shunck and iterative-optical-flow from the DIRART software were usedmore » to deform CT images for the phantom with different motion patterns. The CT images of the mobile phantom were deformed to CT images of the stationary phantom. Results: The values of displacement vectors calculated by deformable image registration algorithm correlated strongly with motion amplitude where large displacement vectors were calculated for CT images with large motion amplitudes. For example, the maximal displacement vectors were nearly equal to the motion amplitudes (5mm, 10mm or 20mm) at interfaces between the mobile targets lung tissue, while the minimal displacement vectors were nearly equal to negative the motion amplitudes. The maximal and minimal displacement vectors matched with edges of the blurred targets along the Z-axis (motion-direction), while DVF’s were small in the other directions. This indicates that the blurred edges by phantom motion were shifted largely to match with the actual target edge. These shifts were nearly equal to the motion amplitude. Conclusions: The DVF from deformable-image registration algorithms correlated well with motion amplitude of well-defined mobile targets. This can be used to extract motion parameters such as amplitude. However, as motion amplitudes increased, image artifacts increased significantly and that limited image quality and poor correlation between the motion amplitude and DVF was obtained.« less

  6. PlasmoGEM, a database supporting a community resource for large-scale experimental genetics in malaria parasites.

    PubMed

    Schwach, Frank; Bushell, Ellen; Gomes, Ana Rita; Anar, Burcu; Girling, Gareth; Herd, Colin; Rayner, Julian C; Billker, Oliver

    2015-01-01

    The Plasmodium Genetic Modification (PlasmoGEM) database (http://plasmogem.sanger.ac.uk) provides access to a resource of modular, versatile and adaptable vectors for genome modification of Plasmodium spp. parasites. PlasmoGEM currently consists of >2000 plasmids designed to modify the genome of Plasmodium berghei, a malaria parasite of rodents, which can be requested by non-profit research organisations free of charge. PlasmoGEM vectors are designed with long homology arms for efficient genome integration and carry gene specific barcodes to identify individual mutants. They can be used for a wide array of applications, including protein localisation, gene interaction studies and high-throughput genetic screens. The vector production pipeline is supported by a custom software suite that automates both the vector design process and quality control by full-length sequencing of the finished vectors. The PlasmoGEM web interface allows users to search a database of finished knock-out and gene tagging vectors, view details of their designs, download vector sequence in different formats and view available quality control data as well as suggested genotyping strategies. We also make gDNA library clones and intermediate vectors available for researchers to produce vectors for themselves. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Investigation on partially coherent vector beams and their propagation and focusing properties.

    PubMed

    Hu, Kelei; Chen, Ziyang; Pu, Jixiong

    2012-11-01

    The propagation and focusing properties of partially coherent vector beams including radially polarized and azimuthally polarized (AP) beams are theoretically and experimentally investigated. The beam profile of a partially coherent radially or AP beam can be shaped by adjusting the initial spatial coherence length. The dark hollow, flat-topped, and Gaussian beam spots can be obtained, which will be useful in trapping particles. The experimental observations are consistent with the theoretical results.

  8. A new radar determination of the spin vector of Venus

    NASA Technical Reports Server (NTRS)

    Zohar, S.; Goldstein, R. M.; Rumsey, H. C.

    1980-01-01

    Two radar observations of a set of three relatively small features on the surface of Venus have facilitated a refined determination of the spin vector of Venus. The period is found to be 243.019 + or 0.014 days, while the obliquity is 177.22 + or - 0.18 deg. The effects of deviations from exact sphericity on the interpretation of the measurements are discussed at length and the question of resonance with earth is reexamined.

  9. Spin wave filtering and guiding in Permalloy/iron nanowires

    NASA Astrophysics Data System (ADS)

    Silvani, R.; Kostylev, M.; Adeyeye, A. O.; Gubbiotti, G.

    2018-03-01

    We have investigated the spin wave filtering and guiding properties of periodic array of single (Permalloy and Fe) and bi-layer (Py/Fe) nanowires (NWs) by means of Brillouin light scattering measurements and micromagnetic simulations. For all the nanowire arrays, the thickness of the layers is 10 nm while all NWs have the same width of 340 nm and edge-to-edge separation of 100 nm. Spin wave dispersion has been measured in the Damon-Eshbach configuration for wave vector either parallel or perpendicular to the nanowire length. This study reveals the filtering property of the spin waves when the wave vector is perpendicular to the NW length, with frequency ranges where the spin wave propagation is permitted separated by frequency band gaps, and the guiding property of NW when the wave vector is oriented parallel to the NW, with spin wave modes propagating in parallel channels in the central and edge regions of the NW. The measured dispersions were well reproduced by micromagnetic simulations, which also deliver the spatial profiles for the modes at zero wave vector. To reproduce the dispersion of the modes localized close to the NW edges, uniaxial anisotropy has been introduced. In the case of Permalloy/iron NWs, the obtained results have been compared with those for a 20 nm thick effective NW having average magnetic properties of the two materials.

  10. Modelling and simulation of particle-particle interaction in a magnetophoretic bio-separation chip

    NASA Astrophysics Data System (ADS)

    Alam, Manjurul; Golozar, Matin; Darabi, Jeff

    2018-04-01

    A Lagrangian particle trajectory model is developed to predict the interaction between cell-bead particle complexes and to track their trajectories in a magnetophoretic bio-separation chip. Magnetic flux gradients are simulated in the OpenFOAM CFD software and imported into MATLAB to obtain the trapping lengths and trajectories of the particles. A connector vector is introduced to calculate the interaction force between cell-bead complexes as they flow through a microfluidic device. The interaction force calculations are performed for cases where the connector vector is parallel, perpendicular, and at an angle of 45° with the applied magnetic field. The trajectories of the particles are simulated by solving a system of eight ordinary differential equations using a fourth order Runge-Kutta method. The model is then used to study the effects of geometric positions and angles of the connector vector between the particles as well as the cell size, number of beads per cell, and flow rate on the interaction force and trajectories of the particles. The results show that the interaction forces may be attractive or repulsive, depending on the orientation of the connector vector distance between the particle complexes and the applied magnetic field. When the interaction force is attractive, the particles are observed to merge and trap sooner than a single particle, whereas a repulsive interaction force has little or no effect on the trapping length.

  11. [The application of vector analysis for evaluation of astigmatism correction in the corneal refractive surgery].

    PubMed

    Zhang, Jiamei; Wang, Yan

    2016-01-01

    Since sixty percent of ametropes obtain astigmatism, which has influence on the visual quality, correcting the astigmatism is always the focus of concerns during visual correction procedures especially for the corneal refractive surgery. The postoperative spherical equivalent or residual cylindrical dioptors was used as quantitative index to evaluate the correction of astigmatism previously; however, such results neglect the effect of astigmatic axis shift on the treatment. Taking astigmatism as a vector parameter could describe the magnitude and direction of astigmatism accurately, thus it was increasingly applied in the evaluation of astigmatism correction. This paper reviews the present vector analysis methods, evaluation indexes and its application for the correction of astigmatism in the corneal refractive surgery.

  12. Acoustic nonreciprocity in Coriolis mean flow systems.

    PubMed

    Naghdi, Masoud; Farzbod, Farhad

    2018-01-01

    One way to break acoustic reciprocity is to have a moving wave propagation medium. If the acoustic wave vector and the moving fluid velocity are collinear, the wave vector shift caused by the fluid flow can be used to break. In this paper, an alternative approach is investigated in which the fluid velocity enters the differential equation of the system as a cross product term with the wave vector. A circular field where the fluid velocity increases radially has a Coriolis acceleration term. In such a system, the acoustic wave enters from the central wall and exits from the perimeter wall. In this paper, the differential equation is solved numerically and the effect of fluid velocity on the nonreciprocity factor is examined.

  13. Associations between heat exposure, vigilance, and balance performance in summer tree fruit harvesters.

    PubMed

    Spector, June T; Krenz, Jennifer; Calkins, Miriam; Ryan, Dawn; Carmona, Jose; Pan, Mengjie; Zemke, Anna; Sampson, Paul D

    2018-02-01

    We sought to evaluate potential mediators of the relationship between heat exposure and traumatic injuries in outdoor agricultural workers. Linear mixed models were used to estimate associations between maximum work-shift Wet Bulb Globe Temperature (WBGT max ) and post-shift vigilance (reaction time) and postural sway (total path length) in a cross-sectional sample of 46 Washington State tree fruit harvesters in August-September 2015. The mean (SD) WBGT max was 27.4 (3.2)°C in August and 21.2 (2.0)°C in September. The mean pre-work-shift participant urine specific gravity indicated minimal dehydration. Twenty-four percent of participants exhibited possible excessive sleepiness. There was no association between WBGT max and post-shift reaction time or total path length. Heat exposure was not associated with impaired vigilance or balance in this study, in which the overall mean (SD) WBGT max was 25.9 (4.2)°C. However, the study identified opportunities to ensure adequate pre-work-shift hydration and to optimize sleep and work-shift timing in order to reduce occupational injury and heat-related illness risk. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Radius correction formula for capacitances and effective length vectors of monopole and dipole antenna systems

    NASA Astrophysics Data System (ADS)

    Macher, W.; Oswald, T. H.

    2011-02-01

    In the investigation of antenna systems which consist of one or several monopoles, a realistic modeling of the monopole radii is not always feasible. In particular, physical scale models for electrolytic tank measurements of effective length vectors (rheometry) of spaceborne monopoles are so small that a correct scaling of monopole radii often results in very thin, flexible antenna wires which bend too much under their own weight. So one has to use monopoles in the model which are thicker than the correct scale diameters. The opposite case, where the monopole radius has to be modeled too thin, appears with certain numerical antenna programs based on wire grid modeling. This problem arises if the underlying algorithm assumes that the wire segments are much longer than their diameters. In such a case it is eventually not possible to use wires of correct thickness to model the monopoles. In order that these numerical and experimental techniques can be applied nonetheless to determine the capacitances and effective length vectors of such monopoles (with an inaccurate modeling of monopole diameters), an analytical correction method is devised. It enables one to calculate the quantities for the real antenna system from those obtained for the model antenna system with wrong monopole radii. Since a typical application of the presented formalism is the analysis of spaceborne antenna systems, an illustration for the monopoles of the WAVES experiment on board the STEREO-A spacecraft is given.

  15. Statistical Mechanical Analysis of Online Learning with Weight Normalization in Single Layer Perceptron

    NASA Astrophysics Data System (ADS)

    Yoshida, Yuki; Karakida, Ryo; Okada, Masato; Amari, Shun-ichi

    2017-04-01

    Weight normalization, a newly proposed optimization method for neural networks by Salimans and Kingma (2016), decomposes the weight vector of a neural network into a radial length and a direction vector, and the decomposed parameters follow their steepest descent update. They reported that learning with the weight normalization achieves better converging speed in several tasks including image recognition and reinforcement learning than learning with the conventional parameterization. However, it remains theoretically uncovered how the weight normalization improves the converging speed. In this study, we applied a statistical mechanical technique to analyze on-line learning in single layer linear and nonlinear perceptrons with weight normalization. By deriving order parameters of the learning dynamics, we confirmed quantitatively that weight normalization realizes fast converging speed by automatically tuning the effective learning rate, regardless of the nonlinearity of the neural network. This property is realized when the initial value of the radial length is near the global minimum; therefore, our theory suggests that it is important to choose the initial value of the radial length appropriately when using weight normalization.

  16. Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

    PubMed

    Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

    2004-12-15

    cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

  17. Perioperative Modulating Factors on Astigmatism in Sutured Cataract Surgery

    PubMed Central

    Cho, Yang Kyeung

    2009-01-01

    Purpose To evaluate the factors that affect postoperative astigmatism and post-suture removal astigmatism, and to evaluate the risk factors associated with astigmatism axis shift. Methods We performed a retrospective chart review of 130 eyes that had undergone uneventful phacoemulsification cataract surgery. Preoperative astigmatism was divided into four groups (Groups I, II, III, and IV) according to the differences between the axis of preoperative astigmatism (flattest axis) and the incision axis (105 degrees). We analyzed the magnitude and axis of the induced astigmatism after the operation and after suture removal in each group. We also analyzed the factors which affected the postoperative astigmatism and post-suture removal astigmatism in each sub-group of Groups I, II, III, and IV, excluding postoperative or post-suture removal axis shift (specifically, Group IWAS, IIWAS, IIIWAS, and IVWAS). We identified the variables associated with the prevalence of postoperative astigmatism axis shift and those associated with the prevalence of post-suture removal axis shift. Results An increase in the magnitude of postoperative astigmatism was associated with an increase in the preoperative magnitude of astigmatism in Groups IWAS, IIWAS, and IIIWAS (p<0.05), and with an increase in the corneal tunnel length in Group IWAS. A decrease in the magnitude of postoperative astigmatism was associated with an increase in the corneal tunnel length in Groups IIIWAS and IVWAS (p<0.05). An increase in the magnitude of post-suture removal astigmatism was associated with an increase in the magnitude of postoperative astigmatism in Groups IWAS and IVWAS (p<0.05), and with late suture removal in Group IVWAS (p<0.05). A decrease in the magnitude of post-suture removal astigmatism was associated with late suture removal in Groups IWAS and IIWAS. A logistic regression analysis showed that the prevalence of post-suture removal astigmatism axis shift was associated with increased corneal tunnel length, decreased magnitude of postoperative astigmatism, and early suture removal. Conclusions In order to reduce postoperative and post-suture removal astigmatism, we recommend a short corneal tunnel length and late suture removal in patients with Group IWAS characteristics, late suture removal in Group IIWAS-like patients, long corneal tunnel length in Group IIIWAS-like patients, and long corneal tunnel length and early suture removal in patients with characteristics of Group IVWAS. PMID:20046682

  18. Generalized Preconditioned Locally Harmonic Residual Eigensolver (GPLHR) v0.1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    VECHARYNSKI, EUGENE; YANG, CHAO

    The software contains a MATLAB implementation of the Generalized Preconditioned Locally Harmonic Residual (GPLHR) method for solving standard and generalized non-Hermitian eigenproblems. The method is particularly useful for computing a subset of eigenvalues, and their eigen- or Schur vectors, closest to a given shift. The proposed method is based on block iterations and can take advantage of a preconditioner if it is available. It does not need to perform exact shift-and-invert transformation. Standard and generalized eigenproblems are handled in a unified framework.

  19. Dynamical polarizability of atoms in arbitrary light fields: general theory and application to cesium

    NASA Astrophysics Data System (ADS)

    Le Kien, Fam; Schneeweiss, Philipp; Rauschenbeutel, Arno

    2013-05-01

    We present a systematic derivation of the dynamical polarizability and the ac Stark shift of the ground and excited states of atoms interacting with a far-off-resonance light field of arbitrary polarization. We calculate the scalar, vector, and tensor polarizabilities of atomic cesium using resonance wavelengths and reduced matrix elements for a large number of transitions. We analyze the properties of the fictitious magnetic field produced by the vector polarizability in conjunction with the ellipticity of the polarization of the light field.

  20. Nonparaxial and paraxial focusing of azimuthal-variant vector beams.

    PubMed

    Gu, Bing; Cui, Yiping

    2012-07-30

    Based on the vectorial Rayleigh-Sommerfeld formulas under the weak nonparaxial approximation, we investigate the propagation behavior of a lowest-order Laguerre-Gaussian beam with azimuthal-variant states of polarization. We present the analytical expressions for the radial, azimuthal, and longitudinal components of the electric field with an arbitrary integer topological charge m focused by a nonaperturing thin lens. We illustrate the three-dimensional optical intensities, energy flux distributions, beam waists, and focal shifts of the focused azimuthal-variant vector beams under the nonparaxial and paraxial approximations.

  1. Sleep and satisfaction in 8- and 12-h forward-rotating shift systems: Industrial employees prefer 12-h shifts.

    PubMed

    Karhula, Kati; Härmä, Mikko; Ropponen, Annina; Hakola, Tarja; Sallinen, Mikael; Puttonen, Sampsa

    2016-01-01

    Twelve-hour shift systems have become more popular in industry. Survey data of shift length, shift rotation speed, self-rated sleep, satisfaction and perceived health were investigated for the associations among 599 predominantly male Finnish industrial employees. The studied forward-rotating shift systems were 12-h fast (12fast, DDNN------, n = 268), 8-h fast (8fast, MMEENN----, n = 161) and 8-h slow (8slow, MMMM-EEEE-NNNN, n = 170). Satisfaction with shift system differed between the groups (p < 0.01) after controlling for age, gender, shift work experience and self-rated stress. In the 12fast, 98% of employees were satisfied with their shift system (75% 8fast, 54% 8slow). Negative effects on sleep and alertness were rare (8%) in the 12fast group (53% 8fast, 66% 8 slow, p < 0.01) and self-reported sleep difficulties were less frequent than in the 8fast and 8slow groups (8%, 27%, 41%, respectively, p < 0.01). The self-reported average sleep duration (12fast 7:50, 8fast 7:24, 8slow 7:15, p < 0.01), and shift-specific sleep before and between morning shifts and after first night shift were longer in the 12fast group. Perceived negative effects of the current shift system on general health (12fast 4%, 8fast 30%, 8slow 41%, p < 0.001) and work-life balance (12fast 8%, 8fast 52%, 8slow 63%, p < 0.001) differed strongly between the groups. In conclusion, the perceived effects of shift work were dependent on both shift length and shift rotation speed: employees in the 12-h rapidly forward-rotating shift system were most satisfied, perceived better work-life balance and slept better than the employees in the 8fast or especially the employees in the 8-h slowly rotating systems.

  2. A Parallel Framework with Block Matrices of a Discrete Fourier Transform for Vector-Valued Discrete-Time Signals.

    PubMed

    Soto-Quiros, Pablo

    2015-01-01

    This paper presents a parallel implementation of a kind of discrete Fourier transform (DFT): the vector-valued DFT. The vector-valued DFT is a novel tool to analyze the spectra of vector-valued discrete-time signals. This parallel implementation is developed in terms of a mathematical framework with a set of block matrix operations. These block matrix operations contribute to analysis, design, and implementation of parallel algorithms in multicore processors. In this work, an implementation and experimental investigation of the mathematical framework are performed using MATLAB with the Parallel Computing Toolbox. We found that there is advantage to use multicore processors and a parallel computing environment to minimize the high execution time. Additionally, speedup increases when the number of logical processors and length of the signal increase.

  3. Phase-Shifted Laser Feedback Interferometry

    NASA Technical Reports Server (NTRS)

    Ovryn, Benjie

    1999-01-01

    Phase-shifted, laser feedback interferometry is a new diagnostic tool developed at the NASA Lewis Research Center under the Advanced Technology Development (ATD) Program directed by NASA Headquarters Microgravity Research Division. It combines the principles of phase-shifting interferometry (PSI) and laser-feedback interferometry (LFI) to produce an instrument that can quantify both optical path length changes and sample reflectivity variations. In a homogenous medium, the optical path length between two points is the product of the index of refraction and the geometric distance between the two points. LFI differs from other forms of interferometry by using the laser as both the source and the phase detector. In LFI, coherent feedback of the incident light either reflected directly from a surface or reflected after transmission through a region of interest will modulate the output intensity of the laser. The combination of PSI and LFI has produced a robust instrument, based on a low-power helium-neon (HeNe) gas laser, with a high dynamic range that can be used to measure either static or oscillatory changes of the optical path length. Small changes in optical path length are limited by the fraction of a fringe that can be measured; we can measure nonoscillatory changes with a root mean square (rms) error of the wavelength/1000 without averaging.

  4. Effect of spaceflight on the spatial orientation of the vestibulo-ocular reflex during eccentric roll rotation: A case report.

    PubMed

    Reschke, Millard F; Wood, Scott J; Clément, Gilles

    2018-01-01

    Ground-based studies have reported shifts of the vestibulo-ocular reflex (VOR) slow phase velocity (SPV) axis toward the resultant gravito-inertial force vector. The VOR was examined during eccentric roll rotation before, during and after an 8-day orbital mission. On orbit this vector is aligned with the head z-axis. Our hypothesis was that eccentric roll rotation on orbit would generate horizontal eye movements. Two subjects were rotated in a semi-supine position with the head nasal-occipital axis parallel to the axis of rotation and 0.5 m off-center. The chair accelerated at 120 deg/s2 to 120 deg/s, rotated at constant velocity for one minute, and then decelerated to a stop in similar fashion. On Earth, the stimulation primarily generated torsional VOR. During spaceflight, in one subject torsional VOR became horizontal VOR, and then decayed very slowly. In the other subject, torsional VOR was reduced on orbit relative to pre- and post-flight, but the SPV axis did not rotate. We attribute the shift from torsional to horizontal VOR on orbit to a spatial orientation of velocity storage toward alignment with the gravito-inertial force vector, and the inter-individual difference to cognitive factors related to the subjective straight-ahead.

  5. Modified cantilevers to probe unambiguously out-of-plane piezoresponse

    NASA Astrophysics Data System (ADS)

    Alyabyeva, Natalia; Ouvrard, Aimeric; Lindfors-Vrejoiu, Ionela; Kolomiytsev, Alexey; Solodovnik, Maxim; Ageev, Oleg; McGrouther, Damien

    2018-06-01

    We demonstrate and investigate the coupling of contributions from both in-plane (IP) polarization and out-of-plane (OP) components in BiFeO3 (BFO) thin-film polarization probed by piezoresponse force microscopy (PFM). Such coupling leads to image artifacts which prevent the correct determination of OP polarization vector directions and the corresponding piezoelectric coefficient d33. Using material strength theory with a one-dimensional modeling of the cantilever oscillation amplitude under electrostatic and elastic forces as a function of the tip length, we have evidenced the impact of IP piezoresponse to the OP signal for tip length longer than 4 μm. The IP polarization vector induces a significant longitudinal bending of the cantilever, due to the small spring constant of long tips, which provokes a normal deviation superimposed to the OP piezoresponse. These artifacts can be reduced by increasing the longitudinal spring constant of the cantilever by shortening the tip length. Standard cantilevers with 15-μm-long tips were modified to reach the desired tip length, using focused ion-beam techniques and tested using PFM on the same BFO thin film. Tip length shortening has strongly reduced IP artifacts as expected, while the impact of nonlocal electrostatic forces, becoming predominant for tips shorter than 1 μm, has led to a non-negligible deflection offset. For shorter tips, a strong electric field from a cantilever beam can induce polarization switching as observed for a 0.5-μm-long tip. Tip length ranging from 1 to 4 μm allowed minimizing both artifacts to probe unambiguously OP piezoresponse and quantify the d33 piezoelectric coefficient.

  6. Static internal performance including thrust vectoring and reversing of two-dimensional convergent-divergent nozzles

    NASA Technical Reports Server (NTRS)

    Re, R. J.; Leavitt, L. D.

    1984-01-01

    The effects of geometric design parameters on two dimensional convergent-divergent nozzles were investigated at nozzle pressure ratios up to 12 in the static test facility. Forward flight (dry and afterburning power settings), vectored-thrust (afterburning power setting), and reverse-thrust (dry power setting) nozzles were investigated. The nozzles had thrust vector angles from 0 deg to 20.26 deg, throat aspect ratios of 3.696 to 7.612, throat radii from sharp to 2.738 cm, expansion ratios from 1.089 to 1.797, and various sidewall lengths. The results indicate that unvectored two dimensional convergent-divergent nozzles have static internal performance comparable to axisymmetric nozzles with similar expansion ratios.

  7. Measurements of Vorticity Vectors in Couette Flow with the Vorticity Optical Probe

    DTIC Science & Technology

    1991-05-01

    Web 1981). The three components of the vorticity vector are measured, any two of them quite accurately. Multipoint measurement arrangements have been...the distribution of trajectory lengths is given by POrN ) rN O<rN<R. fwio-R R -rN where R is the angular measure of the detector radius. (The random...orticitv were performed deep within the viscous sublaver v 2.3). .At y < 10. the fluctuating vortici, ,tatistics show good agreement with the simulatins of

  8. X-ray absorption spectral studies of copper (II) mixed ligand complexes

    NASA Astrophysics Data System (ADS)

    Soni, B.; Dar, Davood Ah; Shrivastava, B. D.; Prasad, J.; Srivastava, K.

    2014-09-01

    X-ray absorption spectra at the K-edge of copper have been studied in two copper mixed ligand complexes, one having tetramethyethylenediamine (tmen) and the other having tetraethyethylenediamine (teen) as one of the ligands. The spectra have been recorded at BL-8 dispersive extended X-ray absorption fine structure (EXAFS) beamline at the 2.5 GeV INDUS- 2 synchrotron, RRCAT, Indore, India. The data obtained has been processed using the data analysis program Athena. The energy of the K-absorption edge, chemical shift, edge-width and shift of the principal absorption maximum in the complexes have been determined and discussed. The values of these parameters have been found to be approximately the same in both the complexes indicating that the two complexes possess similar chemical environment around the copper metal atom. The chemical shift has been utilized to estimate effective nuclear charge on the absorbing atom. The normalized EXAFS spectra have been Fourier transformed. The position of the first peak in the Fourier transform gives the value of first shell bond length, which is shorter than the actual bond length because of energy dependence of the phase factors in the sine function of the EXAFS equation. This distance is thus the phase- uncorrected bond length. Bond length has also been determined by Levy's, Lytle's and Lytle, Sayers and Stern's (LSS) methods. The results obtained from LSS and the Fourier transformation methods are comparable with each other, since both are phase uncorrected bond lengths.

  9. X-ray beam transfer between hollow fibers for long-distance transport

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Yoshihito, E-mail: tanaka@sci.u-hyogo.ac.jp; Matsushita, Ryuki; Shiraishi, Ryutaro

    2016-07-27

    Fiber optics for controlling the x-ray beam trajectory has been examined at the synchrotron facility of SPring-8. Up to now, we have achieved beam deflection by several tens of milli-radian and axis shift of around 75 mm with a 1.5 m-long flexible hollow glass capillary. The achievable beam deflecting angle, axis shift, and timing delay are, in principle, proportional to the length, the square of length and the cube of length, respectively. Thus, for further applications, requiring larger beam shift and pulse delay, longer fibers are indispensable. In order to achieve long-distance transport using the fiber, we thus examined themore » connection transferring x-rays between fibers in an experimental hutch. The acceptance angle at the input end and the throughput efficiency of the second fiber is consistent with the consideration of the output beam divergence of the first fiber. The enhancement of the transfer efficiency is also discussed for the cases of a closer joint and the use of a refractive lens as a coupler.« less

  10. A Software Package for Neural Network Applications Development

    NASA Technical Reports Server (NTRS)

    Baran, Robert H.

    1993-01-01

    Original Backprop (Version 1.2) is an MS-DOS package of four stand-alone C-language programs that enable users to develop neural network solutions to a variety of practical problems. Original Backprop generates three-layer, feed-forward (series-coupled) networks which map fixed-length input vectors into fixed length output vectors through an intermediate (hidden) layer of binary threshold units. Version 1.2 can handle up to 200 input vectors at a time, each having up to 128 real-valued components. The first subprogram, TSET, appends a number (up to 16) of classification bits to each input, thus creating a training set of input output pairs. The second subprogram, BACKPROP, creates a trilayer network to do the prescribed mapping and modifies the weights of its connections incrementally until the training set is leaned. The learning algorithm is the 'back-propagating error correction procedures first described by F. Rosenblatt in 1961. The third subprogram, VIEWNET, lets the trained network be examined, tested, and 'pruned' (by the deletion of unnecessary hidden units). The fourth subprogram, DONET, makes a TSR routine by which the finished product of the neural net design-and-training exercise can be consulted under other MS-DOS applications.

  11. On the Impact of Widening Vector Registers on Sequence Alignment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daily, Jeffrey A.; Kalyanaraman, Anantharaman; Krishnamoorthy, Sriram

    2016-09-22

    Vector extensions, such as SSE, have been part of the x86 since the 1990s, with applications in graphics, signal processing, and scientific applications. Although many algorithms and applications can naturally benefit from automatic vectorization techniques, there are still many that are difficult to vectorize due to their dependence on irregular data structures, dense branch operations, or data dependencies. Sequence alignment, one of the most widely used operations in bioinformatics workflows, has a computational footprint that features complex data dependencies. In this paper, we demonstrate that the trend of widening vector registers adversely affects the state-of-the-art sequence alignment algorithm based onmore » striped data layouts. We present a practically efficient SIMD implementation of a parallel scan based sequence alignment algorithm that can better exploit wider SIMD units. We conduct comprehensive workload and use case analyses to characterize the relative behavior of the striped and scan approaches and identify the best choice of algorithm based on input length and SIMD width.« less

  12. Percentiles of the run-length distribution of the Exponentially Weighted Moving Average (EWMA) median chart

    NASA Astrophysics Data System (ADS)

    Tan, K. L.; Chong, Z. L.; Khoo, M. B. C.; Teoh, W. L.; Teh, S. Y.

    2017-09-01

    Quality control is crucial in a wide variety of fields, as it can help to satisfy customers’ needs and requirements by enhancing and improving the products and services to a superior quality level. The EWMA median chart was proposed as a useful alternative to the EWMA \\bar{X} chart because the median-type chart is robust against contamination, outliers or small deviation from the normality assumption compared to the traditional \\bar{X}-type chart. To provide a complete understanding of the run-length distribution, the percentiles of the run-length distribution should be investigated rather than depending solely on the average run length (ARL) performance measure. This is because interpretation depending on the ARL alone can be misleading, as the process mean shifts change according to the skewness and shape of the run-length distribution, varying from almost symmetric when the magnitude of the mean shift is large, to highly right-skewed when the process is in-control (IC) or slightly out-of-control (OOC). Before computing the percentiles of the run-length distribution, optimal parameters of the EWMA median chart will be obtained by minimizing the OOC ARL, while retaining the IC ARL at a desired value.

  13. Vector species richness increases haemorrhagic disease prevalence through functional diversity modulating the duration of seasonal transmission.

    PubMed

    Park, Andrew W; Cleveland, Christopher A; Dallas, Tad A; Corn, Joseph L

    2016-06-01

    Although many parasites are transmitted between hosts by a suite of arthropod vectors, the impact of vector biodiversity on parasite transmission is poorly understood. Positive relationships between host infection prevalence and vector species richness (SR) may operate through multiple mechanisms, including (i) increased vector abundance, (ii) a sampling effect in which species of high vectorial capacity are more likely to occur in species-rich communities, and (iii) functional diversity whereby communities comprised species with distinct phenologies may extend the duration of seasonal transmission. Teasing such mechanisms apart is impeded by a lack of appropriate data, yet could highlight a neglected role for functional diversity in parasite transmission. We used statistical modelling of extensive host, vector and microparasite data to test the hypothesis that functional diversity leading to longer seasonal transmission explained variable levels of disease in a wildlife population. We additionally developed a simple transmission model to guide our expectation of how an increased transmission season translates to infection prevalence. Our study demonstrates that vector SR is associated with increased levels of disease reporting, but not via increases in vector abundance or via a sampling effect. Rather, the relationship operates by extending the length of seasonal transmission, in line with theoretical predictions.

  14. Performance characteristics of two multiaxis thrust-vectoring nozzles at Mach numbers up to 1.28

    NASA Technical Reports Server (NTRS)

    Wing, David J.; Capone, Francis J.

    1993-01-01

    The thrust-vectoring axisymmetric (VA) nozzle and a spherical convergent flap (SCF) thrust-vectoring nozzle were tested along with a baseline nonvectoring axisymmetric (NVA) nozzle in the Langley 16-Foot Transonic Tunnel at Mach numbers from 0 to 1.28 and nozzle pressure ratios from 1 to 8. Test parameters included geometric yaw vector angle and unvectored divergent flap length. No pitch vectoring was studied. Nozzle drag, thrust minus drag, yaw thrust vector angle, discharge coefficient, and static thrust performance were measured and analyzed, as well as external static pressure distributions. The NVA nozzle and the VA nozzle displayed higher static thrust performance than the SCF nozzle throughout the nozzle pressure ratio (NPR) range tested. The NVA nozzle had higher overall thrust minus drag than the other nozzles throughout the NPR and Mach number ranges tested. The SCF nozzle had the lowest jet-on nozzle drag of the three nozzles throughout the test conditions. The SCF nozzle provided yaw thrust angles that were equal to the geometric angle and constant with NPR. The VA nozzle achieved yaw thrust vector angles that were significantly higher than the geometric angle but not constant with NPR. Nozzle drag generally increased with increases in thrust vectoring for all the nozzles tested.

  15. Molecular insights into human daily behavior

    PubMed Central

    Brown, Steven A.; Kunz, Dieter; Dumas, Amelie; Westermark, Pål O.; Vanselow, Katja; Tilmann-Wahnschaffe, Amely; Herzel, Hanspeter; Kramer, Achim

    2008-01-01

    Human beings exhibit wide variation in their timing of daily behavior. We and others have suggested previously that such differences might arise because of alterations in the period length of the endogenous human circadian oscillator. Using dermal fibroblast cells from skin biopsies of 28 subjects of early and late chronotype (11 “larks” and 17 “owls”), we have studied the circadian period lengths of these two groups, as well as their ability to phase-shift and entrain to environmental and chemical signals. We find not only period length differences between the two classes, but also significant changes in the amplitude and phase-shifting properties of the circadian oscillator among individuals with identical “normal” period lengths. Mathematical modeling shows that these alterations could also account for the extreme behavioral phenotypes of these subjects. We conclude that human chronotype may be influenced not only by the period length of the circadian oscillator, but also by cellular components that affect its amplitude and phase. In many instances, these changes can be studied at the molecular level in primary dermal cells. PMID:18227513

  16. Exact density-potential pairs from complex-shifted axisymmetric systems

    NASA Astrophysics Data System (ADS)

    Ciotti, Luca; Marinacci, Federico

    2008-07-01

    In a previous paper, the complex-shift method has been applied to self-gravitating spherical systems, producing new analytical axisymmetric density-potential pairs. We now extend the treatment to the Miyamoto-Nagai disc and the Binney logarithmic halo, and we study the resulting axisymmetric and triaxial analytical density-potential pairs; we also show how to obtain the surface density of shifted systems from the complex shift of the surface density of the parent model. In particular, the systems obtained from Miyamoto-Nagai discs can be used to describe disc galaxies with a peanut-shaped bulge or with a central triaxial bar, depending on the direction of the shift vector. By using a constructive method that can be applied to generic axisymmetric systems, we finally show that the Miyamoto-Nagai and the Satoh discs, and the Binney logarithmic halo cannot be obtained from the complex shift of any spherical parent distribution. As a by-product of this study, we also found two new generating functions in closed form for even and odd Legendre polynomials, respectively.

  17. Multiple-stage ambiguity in motion perception reveals global computation of local motion directions.

    PubMed

    Rider, Andrew T; Nishida, Shin'ya; Johnston, Alan

    2016-12-01

    The motion of a 1D image feature, such as a line, seen through a small aperture, or the small receptive field of a neural motion sensor, is underconstrained, and it is not possible to derive the true motion direction from a single local measurement. This is referred to as the aperture problem. How the visual system solves the aperture problem is a fundamental question in visual motion research. In the estimation of motion vectors through integration of ambiguous local motion measurements at different positions, conventional theories assume that the object motion is a rigid translation, with motion signals sharing a common motion vector within the spatial region over which the aperture problem is solved. However, this strategy fails for global rotation. Here we show that the human visual system can estimate global rotation directly through spatial pooling of locally ambiguous measurements, without an intervening step that computes local motion vectors. We designed a novel ambiguous global flow stimulus, which is globally as well as locally ambiguous. The global ambiguity implies that the stimulus is simultaneously consistent with both a global rigid translation and an infinite number of global rigid rotations. By the standard view, the motion should always be seen as a global translation, but it appears to shift from translation to rotation as observers shift fixation. This finding indicates that the visual system can estimate local vectors using a global rotation constraint, and suggests that local motion ambiguity may not be resolved until consistencies with multiple global motion patterns are assessed.

  18. Positive focal shift of gallium nitride high contrast grating focusing reflectors

    NASA Astrophysics Data System (ADS)

    He, Shumin; Wang, Zhenhai; Liu, Qifa

    2016-09-01

    We design a type of metasurfaces capable of serving as a visible-light focusing reflector based on gallium nitride (GaN) high contrast gratings (HCGs). The wavefront of the reflected light is precisely manipulated by spatial variation of the grating periods along the subwavelength ridge array to achieve light focusing. Different from conventional negative focal shift effect, a positive focal shift is observed in such focusing reflectors. Detailed investigations of the influence of device size on the focusing performance, especially the focal length, are preformed via a finite element method . The results show that all performance parameters are greatly affected by the reflector size. A more concentrated focal point, or a better focusing capability, can be achieved by larger size. With increasing reflector size, the achieved focal length decreases and gradually approaches to the design, thus the corresponding positive focal shift decreases. Our results are helpful for understanding the visible-light control of the planar HCG-based focusing reflectors.

  19. Terahertz generation by beating two Langmuir waves in a warm and collisional plasma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Xiao-Bo; Qiao, Xin; Cheng, Li-Hong

    2015-09-15

    Terahertz (THz) radiation generated by beating of two Langmuir waves in a warm and collisional plasma is discussed theoretically. The critical angle between the two Langmuir waves and the critical wave-length (wave vector) of Langmuir waves for generating THz radiation are obtained analytically. Furthermore, the maximum radiation energy is obtained. We find that the critical angle, the critical wave-length, and the generated radiation energy strongly depend on plasma temperature and wave-length of the Langmuir waves. That is, the THz radiation generated by beating of two Langmuir waves in a warm and collisional plasma can be controlled by adjusting the plasmamore » temperature and the Langmuir wave-length.« less

  20. Influence of vectors' risk-spreading strategies and environmental stochasticity on the epidemiology and evolution of vector-borne diseases: the example of Chagas' disease.

    PubMed

    Pelosse, Perrine; Kribs-Zaleta, Christopher M; Ginoux, Marine; Rabinovich, Jorge E; Gourbière, Sébastien; Menu, Frédéric

    2013-01-01

    Insects are known to display strategies that spread the risk of encountering unfavorable conditions, thereby decreasing the extinction probability of genetic lineages in unpredictable environments. To what extent these strategies influence the epidemiology and evolution of vector-borne diseases in stochastic environments is largely unknown. In triatomines, the vectors of the parasite Trypanosoma cruzi, the etiological agent of Chagas' disease, juvenile development time varies between individuals and such variation most likely decreases the extinction risk of vector populations in stochastic environments. We developed a simplified multi-stage vector-borne SI epidemiological model to investigate how vector risk-spreading strategies and environmental stochasticity influence the prevalence and evolution of a parasite. This model is based on available knowledge on triatomine biodemography, but its conceptual outcomes apply, to a certain extent, to other vector-borne diseases. Model comparisons between deterministic and stochastic settings led to the conclusion that environmental stochasticity, vector risk-spreading strategies (in particular an increase in the length and variability of development time) and their interaction have drastic consequences on vector population dynamics, disease prevalence, and the relative short-term evolution of parasite virulence. Our work shows that stochastic environments and associated risk-spreading strategies can increase the prevalence of vector-borne diseases and favor the invasion of more virulent parasite strains on relatively short evolutionary timescales. This study raises new questions and challenges in a context of increasingly unpredictable environmental variations as a result of global climate change and human interventions such as habitat destruction or vector control.

  1. [Working time and sleep in nursing staff employed in "3 x 8" and "2 x 12" fast rotating shift schedules].

    PubMed

    Castellini, G; Anelli, M M; Punzi, S; Boari, P; Camerino, D; Costa, G

    2011-01-01

    The study is aimed at assessing, in 200 nurses shift workers, the impact on sleep of two different working areas ("emergency" and "hospitalization") having the same "3 x 8" shift system, and of two different shift schedules at quick rotation ("2 x 12" and "3 x 8") in the same working area ("emergency"). Night and morning shifts prove to interfere to a greater extent with sleep in relation to both "2 x 12" and "3 x 8" shift systems as well as to the two operative areas. Hence the importance to consider in shift work planning, the direction of shift rotation and the length of the duty period according to the type of activity.

  2. Constraining new physics models with isotope shift spectroscopy

    NASA Astrophysics Data System (ADS)

    Frugiuele, Claudia; Fuchs, Elina; Perez, Gilad; Schlaffer, Matthias

    2017-07-01

    Isotope shifts of transition frequencies in atoms constrain generic long- and intermediate-range interactions. We focus on new physics scenarios that can be most strongly constrained by King linearity violation such as models with B -L vector bosons, the Higgs portal, and chameleon models. With the anticipated precision, King linearity violation has the potential to set the strongest laboratory bounds on these models in some regions of parameter space. Furthermore, we show that this method can probe the couplings relevant for the protophobic interpretation of the recently reported Be anomaly. We extend the formalism to include an arbitrary number of transitions and isotope pairs and fit the new physics coupling to the currently available isotope shift measurements.

  3. An efficient and portable SIMD algorithm for charge/current deposition in Particle-In-Cell codes

    DOE PAGES

    Vincenti, H.; Lobet, M.; Lehe, R.; ...

    2016-09-19

    In current computer architectures, data movement (from die to network) is by far the most energy consuming part of an algorithm (≈20pJ/word on-die to ≈10,000 pJ/word on the network). To increase memory locality at the hardware level and reduce energy consumption related to data movement, future exascale computers tend to use many-core processors on each compute nodes that will have a reduced clock speed to allow for efficient cooling. To compensate for frequency decrease, machine vendors are making use of long SIMD instruction registers that are able to process multiple data with one arithmetic operator in one clock cycle. SIMD registermore » length is expected to double every four years. As a consequence, Particle-In-Cell (PIC) codes will have to achieve good vectorization to fully take advantage of these upcoming architectures. In this paper, we present a new algorithm that allows for efficient and portable SIMD vectorization of current/charge deposition routines that are, along with the field gathering routines, among the most time consuming parts of the PIC algorithm. Our new algorithm uses a particular data structure that takes into account memory alignment constraints and avoids gather/scat;ter instructions that can significantly affect vectorization performances on current CPUs. The new algorithm was successfully implemented in the 3D skeleton PIC code PICSAR and tested on Haswell Xeon processors (AVX2-256 bits wide data registers). Results show a factor of ×2 to ×2.5 speed-up in double precision for particle shape factor of orders 1–3. The new algorithm can be applied as is on future KNL (Knights Landing) architectures that will include AVX-512 instruction sets with 512 bits register lengths (8 doubles/16 singles). Program summary Program Title: vec_deposition Program Files doi:http://dx.doi.org/10.17632/nh77fv9k8c.1 Licensing provisions: BSD 3-Clause Programming language: Fortran 90 External routines/libraries:  OpenMP > 4.0 Nature of problem: Exascale architectures will have many-core processors per node with long vector data registers capable of performing one single instruction on multiple data during one clock cycle. Data register lengths are expected to double every four years and this pushes for new portable solutions for efficiently vectorizing Particle-In-Cell codes on these future many-core architectures. One of the main hotspot routines of the PIC algorithm is the current/charge deposition for which there is no efficient and portable vector algorithm. Solution method: Here we provide an efficient and portable vector algorithm of current/charge deposition routines that uses a new data structure, which significantly reduces gather/scatter operations. Vectorization is controlled using OpenMP 4.0 compiler directives for vectorization which ensures portability across different architectures. Restrictions: Here we do not provide the full PIC algorithm with an executable but only vector routines for current/charge deposition. These scalar/vector routines can be used as library routines in your 3D Particle-In-Cell code. However, to get the best performances out of vector routines you have to satisfy the two following requirements: (1) Your code should implement particle tiling (as explained in the manuscript) to allow for maximized cache reuse and reduce memory accesses that can hinder vector performances. The routines can be used directly on each particle tile. (2) You should compile your code with a Fortran 90 compiler (e.g Intel, gnu or cray) and provide proper alignment flags and compiler alignment directives (more details in README file).« less

  4. An efficient and portable SIMD algorithm for charge/current deposition in Particle-In-Cell codes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vincenti, H.; Lobet, M.; Lehe, R.

    In current computer architectures, data movement (from die to network) is by far the most energy consuming part of an algorithm (≈20pJ/word on-die to ≈10,000 pJ/word on the network). To increase memory locality at the hardware level and reduce energy consumption related to data movement, future exascale computers tend to use many-core processors on each compute nodes that will have a reduced clock speed to allow for efficient cooling. To compensate for frequency decrease, machine vendors are making use of long SIMD instruction registers that are able to process multiple data with one arithmetic operator in one clock cycle. SIMD registermore » length is expected to double every four years. As a consequence, Particle-In-Cell (PIC) codes will have to achieve good vectorization to fully take advantage of these upcoming architectures. In this paper, we present a new algorithm that allows for efficient and portable SIMD vectorization of current/charge deposition routines that are, along with the field gathering routines, among the most time consuming parts of the PIC algorithm. Our new algorithm uses a particular data structure that takes into account memory alignment constraints and avoids gather/scat;ter instructions that can significantly affect vectorization performances on current CPUs. The new algorithm was successfully implemented in the 3D skeleton PIC code PICSAR and tested on Haswell Xeon processors (AVX2-256 bits wide data registers). Results show a factor of ×2 to ×2.5 speed-up in double precision for particle shape factor of orders 1–3. The new algorithm can be applied as is on future KNL (Knights Landing) architectures that will include AVX-512 instruction sets with 512 bits register lengths (8 doubles/16 singles). Program summary Program Title: vec_deposition Program Files doi:http://dx.doi.org/10.17632/nh77fv9k8c.1 Licensing provisions: BSD 3-Clause Programming language: Fortran 90 External routines/libraries:  OpenMP > 4.0 Nature of problem: Exascale architectures will have many-core processors per node with long vector data registers capable of performing one single instruction on multiple data during one clock cycle. Data register lengths are expected to double every four years and this pushes for new portable solutions for efficiently vectorizing Particle-In-Cell codes on these future many-core architectures. One of the main hotspot routines of the PIC algorithm is the current/charge deposition for which there is no efficient and portable vector algorithm. Solution method: Here we provide an efficient and portable vector algorithm of current/charge deposition routines that uses a new data structure, which significantly reduces gather/scatter operations. Vectorization is controlled using OpenMP 4.0 compiler directives for vectorization which ensures portability across different architectures. Restrictions: Here we do not provide the full PIC algorithm with an executable but only vector routines for current/charge deposition. These scalar/vector routines can be used as library routines in your 3D Particle-In-Cell code. However, to get the best performances out of vector routines you have to satisfy the two following requirements: (1) Your code should implement particle tiling (as explained in the manuscript) to allow for maximized cache reuse and reduce memory accesses that can hinder vector performances. The routines can be used directly on each particle tile. (2) You should compile your code with a Fortran 90 compiler (e.g Intel, gnu or cray) and provide proper alignment flags and compiler alignment directives (more details in README file).« less

  5. Influence of dielectric substrate on the responsivity of microstrip dipole-antenna-coupled infrared microbolometers.

    PubMed

    Codreanu, Iulian; Boreman, Glenn D

    2002-04-01

    We report on the influence of the dielectric substrate on the performance of microstrip dipole-antenna-coupled microbolometers. The location, the width, and the magnitude of the resonance of a printed dipole are altered when the dielectric substrate is backed by a ground plane. A thicker dielectric substrate shifts the antenna resonance toward shorter dipole lengths and leads to a stronger and slower detector response. The incorporation of an air layer into the antenna substrate further increases thermal impedance, leading to an even stronger response and shifting the antenna resonance toward longer dipole lengths.

  6. Rotation Detection Using the Precession of Molecular Electric Dipole Moment

    NASA Astrophysics Data System (ADS)

    Ke, Yi; Deng, Xiao-Bing; Hu, Zhong-Kun

    2017-11-01

    We present a method to detect the rotation by using the precession of molecular electric dipole moment in a static electric field. The molecular electric dipole moments are polarized under the static electric field and a nonzero electric polarization vector emerges in the molecular gas. A resonant radio-frequency pulse electric field is applied to realize a 90° flip of the electric polarization vector of a particular rotational state. After the pulse electric field, the electric polarization vector precesses under the static electric field. The rotation induces a shift in the precession frequency which is measured to deduce the angular velocity of the rotation. The fundamental sensitivity limit of this method is estimated. This work is only a proposal and does not involve experimental results.

  7. BIOELECTRICAL IMPEDANCE VECTOR ANALYSIS IDENTIFIES SARCOPENIA IN NURSING HOME RESIDENTS

    USDA-ARS?s Scientific Manuscript database

    Loss of muscle mass and water shifts between body compartments are contributing factors to frailty in the elderly. The body composition changes are especially pronounced in institutionalized elderly. We investigated the ability of single-frequency bioelectrical impedance analysis (BIA) to identify b...

  8. Moving Object Detection Using a Parallax Shift Vector Algorithm

    NASA Astrophysics Data System (ADS)

    Gural, Peter S.; Otto, Paul R.; Tedesco, Edward F.

    2018-07-01

    There are various algorithms currently in use to detect asteroids from ground-based observatories, but they are generally restricted to linear or mildly curved movement of the target object across the field of view. Space-based sensors in high inclination, low Earth orbits can induce significant parallax in a collected sequence of images, especially for objects at the typical distances of asteroids in the inner solar system. This results in a highly nonlinear motion pattern of the asteroid across the sensor, which requires a more sophisticated search pattern for detection processing. Both the classical pattern matching used in ground-based asteroid search and the more sensitive matched filtering and synthetic tracking techniques, can be adapted to account for highly complex parallax motion. A new shift vector generation methodology is discussed along with its impacts on commonly used detection algorithms, processing load, and responsiveness to asteroid track reporting. The matched filter, template generator, and pattern matcher source code for the software described herein are available via GitHub.

  9. Word embeddings quantify 100 years of gender and ethnic stereotypes.

    PubMed

    Garg, Nikhil; Schiebinger, Londa; Jurafsky, Dan; Zou, James

    2018-04-17

    Word embeddings are a powerful machine-learning framework that represents each English word by a vector. The geometric relationship between these vectors captures meaningful semantic relationships between the corresponding words. In this paper, we develop a framework to demonstrate how the temporal dynamics of the embedding helps to quantify changes in stereotypes and attitudes toward women and ethnic minorities in the 20th and 21st centuries in the United States. We integrate word embeddings trained on 100 y of text data with the US Census to show that changes in the embedding track closely with demographic and occupation shifts over time. The embedding captures societal shifts-e.g., the women's movement in the 1960s and Asian immigration into the United States-and also illuminates how specific adjectives and occupations became more closely associated with certain populations over time. Our framework for temporal analysis of word embedding opens up a fruitful intersection between machine learning and quantitative social science.

  10. A computational study of hydrogen-bonded X3CH⋯YZ (X = Cl, F, NC; YZ = FLi, BF, CO, N2) complexes

    NASA Astrophysics Data System (ADS)

    McDowell, Sean A. C.

    2018-03-01

    An MP2/6-311++G(3df,3pd) computational study of a series of hydrogen-bonded complexes X3CH⋯YZ (X = Cl, F, NC; YZ = FLi, BF, CO, N2) was undertaken to assess the trends in the relative stability and other molecular properties with variation of both the X group and the chemical hardness of the Y atom of YZ. The red- and blue-shifting propensities of the proton donor X3CH were investigated by considering the Csbnd H bond length change and its associated vibrational frequency shift. The proton donor Cl3CH, which has a positive dipole moment derivative with respect to Csbnd H bond extension, tends to form red-shifted complexes, this tendency being modified by the hardness (and dipole moment) associated with the proton acceptor. On the other hand, F3CH has a negative dipole moment derivative and tends to form blue-shifted complexes, suggesting that as X becomes more electron-withdrawing, the proton donor should have a negative dipole moment derivative and form blue-shifted complexes. Surprisingly, the most polar proton donor (NC)3CH was found to have a positive dipole moment derivative and produces red-shifted complexes. A perturbative model was found useful in rationalizing the trends for the Csbnd H bond length change and associated frequency shift.

  11. Communication networks, soap films and vectors

    NASA Astrophysics Data System (ADS)

    Clark, R. C.

    1981-01-01

    The problem of constructing the least-cost network of connections between arbitrarily placed points is one that is common and which can be very important financially. The network may consist of motorways between towns, a grid of electric power lines, buried gas or oil pipe lines or telephone cables. Soap films trapped between parallel planes with vertical pins between them provide a 'shortest path' network and Isenberg (1975) has suggested that soap films of this sort be used to model communication networks. However soap films are unable to simulate the different costs of laying, say, a three-lane motorway instead of a two-lane one or of using a larger pipeline to take the flow from two smaller ones. Soap films, however, have considerable intrinsic interest. In the article the emphasis is on the use of soap films and communication networks as a practical means of illustrating the importance of vector and matrix methods in geometry. The power of vector methods is illustrated by the fact that given any soap film network the total length of the film can be written down by inspection if the vector positions of the pins are known. It is also possible to predict the boundaries at which 'catastrophes' occur and to decide which network has the least total length. In the field of communication networks a method is given of designing the minimum cost network linking, say, a number of oilwells, which produce at different rates to an outlet terminal.

  12. Derivation of the Lorentz force law, the magnetic field concept and the Faraday Lenz and magnetic Gauss laws using an invariant formulation of the Lorentz transformation

    NASA Astrophysics Data System (ADS)

    Field, J. H.

    2006-06-01

    It is demonstrated how the right-hand sides of the Lorentz transformation equations may be written, in a Lorentz-invariant manner, as 4-vector scalar products. This implies the existence of invariant length intervals analogous to invariant proper time intervals. An important distinction between the physical meanings of the space time and energy momentum 4-vectors is pointed out. The formalism is shown to provide a short derivation of the Lorentz force law of classical electrodynamics, and the conventional definition of the magnetic field, in terms of spatial derivatives of the 4-vector potential, as well as the Faraday Lenz law and the Gauss law for magnetic fields. The connection between the Gauss law for the electric field and the electrodynamic Ampère law, due to the 4-vector character of the electromagnetic potential, is also pointed out.

  13. Comparison of SOM point densities based on different criteria.

    PubMed

    Kohonen, T

    1999-11-15

    Point densities of model (codebook) vectors in self-organizing maps (SOMs) are evaluated in this article. For a few one-dimensional SOMs with finite grid lengths and a given probability density function of the input, the numerically exact point densities have been computed. The point density derived from the SOM algorithm turned out to be different from that minimizing the SOM distortion measure, showing that the model vectors produced by the basic SOM algorithm in general do not exactly coincide with the optimum of the distortion measure. A new computing technique based on the calculus of variations has been introduced. It was applied to the computation of point densities derived from the distortion measure for both the classical vector quantization and the SOM with general but equal dimensionality of the input vectors and the grid, respectively. The power laws in the continuum limit obtained in these cases were found to be identical.

  14. Dissociation of eye and head components of gaze shifts by stimulation of the omnipause neuron region.

    PubMed

    Gandhi, Neeraj J; Sparks, David L

    2007-07-01

    Natural movements often include actions integrated across multiple effectors. Coordinated eye-head movements are driven by a command to shift the line of sight by a desired displacement vector. Yet because extraocular and neck motoneurons are separate entities, the gaze shift command must be separated into independent signals for eye and head movement control. We report that this separation occurs, at least partially, at or before the level of pontine omnipause neurons (OPNs). Stimulation of the OPNs prior to and during gaze shifts temporally decoupled the eye and head components by inhibiting gaze and eye saccades. In contrast, head movements were consistently initiated before gaze onset, and ongoing head movements continued along their trajectories, albeit with some characteristic modulations. After stimulation offset, a gaze shift composed of an eye saccade, and a reaccelerated head movement was produced to preserve gaze accuracy. We conclude that signals subject to OPN inhibition produce the eye-movement component of a coordinated eye-head gaze shift and are not the only signals involved in the generation of the head component of the gaze shift.

  15. Recovery of infectious virus from full-length cowpox virus (CPXV) DNA cloned as a bacterial artificial chromosome (BAC)

    PubMed Central

    2011-01-01

    Transmission from pet rats and cats to humans as well as severe infection in felids and other animal species have recently drawn increasing attention to cowpox virus (CPXV). We report the cloning of the entire genome of cowpox virus strain Brighton Red (BR) as a bacterial artificial chromosome (BAC) in Escherichia coli and the recovery of infectious virus from cloned DNA. Generation of a full-length CPXV DNA clone was achieved by first introducing a mini-F vector, which allows maintenance of large circular DNA in E. coli, into the thymidine kinase locus of CPXV by homologous recombination. Circular replication intermediates were then electroporated into E. coli DH10B cells. Upon successful establishment of the infectious BR clone, we modified the full-length clone such that recombination-mediated excision of bacterial sequences can occur upon transfection in eukaryotic cells. This self-excision of the bacterial replicon is made possible by a sequence duplication within mini-F sequences and allows recovery of recombinant virus progeny without remaining marker or vector sequences. The in vitro growth properties of viruses derived from both BAC clones were determined and found to be virtually indistinguishable from those of parental, wild-type BR. Finally, the complete genomic sequence of the infectious clone was determined and the cloned viral genome was shown to be identical to that of the parental virus. In summary, the generated infectious clone will greatly facilitate studies on individual genes and pathogenesis of CPXV. Moreover, the vector potential of CPXV can now be more systematically explored using this newly generated tool. PMID:21314965

  16. The Effect of Reducing Maximum Shift Lengths to 16 Hours on Internal Medicine Interns’ Educational Opportunities

    PubMed Central

    Theobald, Cecelia N.; Stover, Daniel G.; Choma, Neesha N.; Hathaway, Jacob; Green, Jennifer K.; Peterson, Neeraja B.; Sponsler, Kelly C.; Vasilevskis, Eduard E.; Kripalani, Sunil; Sergent, John; Brown, Nancy J.; Denny, Joshua C.

    2013-01-01

    Purpose To evaluate educational experiences of internal medicine interns before and after maximum shift lengths were decreased from 30 hours to 16 hours. Method The authors compared educational experiences of internal medicine interns at Vanderbilt University Medical Center before (2010, 47 interns) and after (2011, 50 interns) duty hour restrictions were implemented in July 2011. The authors compared number of inpatient encounters, breadth of concepts in notes, exposure to five common presenting problems, procedural experience, and attendance at teaching conferences. Results Following the duty hour restrictions, interns cared for more unique patients (mean 118 versus 140 patients per intern, P = .005) and wrote more history and physicals (mean 73 versus 88, P = .005). Documentation included more total concepts after the 16-hour maximum shift implementation, with a 14% increase for history and physicals (338 versus 387, P < .001) and a 10% increase for progress notes (316 versus 349, P < .001). There was no difference in the median number of selected procedures performed (6 versus 6, P = .94). Attendance was higher at the weekly chief resident conference (60% versus 68% of expected attendees, P < .001) but unchanged at morning report conferences (79% versus 78%, P = .49). Conclusions Intern clinical exposure did not decrease after implementation of the 16-hour shift length restriction. In fact, interns saw more patients, produced more detailed notes, and attended more conferences following duty hour restrictions. PMID:23425987

  17. Minimal entropy probability paths between genome families.

    PubMed

    Ahlbrandt, Calvin; Benson, Gary; Casey, William

    2004-05-01

    We develop a metric for probability distributions with applications to biological sequence analysis. Our distance metric is obtained by minimizing a functional defined on the class of paths over probability measures on N categories. The underlying mathematical theory is connected to a constrained problem in the calculus of variations. The solution presented is a numerical solution, which approximates the true solution in a set of cases called rich paths where none of the components of the path is zero. The functional to be minimized is motivated by entropy considerations, reflecting the idea that nature might efficiently carry out mutations of genome sequences in such a way that the increase in entropy involved in transformation is as small as possible. We characterize sequences by frequency profiles or probability vectors, in the case of DNA where N is 4 and the components of the probability vector are the frequency of occurrence of each of the bases A, C, G and T. Given two probability vectors a and b, we define a distance function based as the infimum of path integrals of the entropy function H( p) over all admissible paths p(t), 0 < or = t< or =1, with p(t) a probability vector such that p(0)=a and p(1)=b. If the probability paths p(t) are parameterized as y(s) in terms of arc length s and the optimal path is smooth with arc length L, then smooth and "rich" optimal probability paths may be numerically estimated by a hybrid method of iterating Newton's method on solutions of a two point boundary value problem, with unknown distance L between the abscissas, for the Euler-Lagrange equations resulting from a multiplier rule for the constrained optimization problem together with linear regression to improve the arc length estimate L. Matlab code for these numerical methods is provided which works only for "rich" optimal probability vectors. These methods motivate a definition of an elementary distance function which is easier and faster to calculate, works on non-rich vectors, does not involve variational theory and does not involve differential equations, but is a better approximation of the minimal entropy path distance than the distance //b-a//(2). We compute minimal entropy distance matrices for examples of DNA myostatin genes and amino-acid sequences across several species. Output tree dendograms for our minimal entropy metric are compared with dendograms based on BLAST and BLAST identity scores.

  18. Search for Medium Modifications of the ρ Meson

    NASA Astrophysics Data System (ADS)

    Nasseripour, R.; Wood, M. H.; Djalali, C.; Weygand, D. P.; Tur, C.; Mosel, U.; Muehlich, P.; Adams, G.; Amaryan, M. J.; Ambrozewicz, P.; Anghinolfi, M.; Asryan, G.; Avakian, H.; Bagdasaryan, H.; Baillie, N.; Ball, J. P.; Baltzell, N. A.; Barrow, S.; Battaglieri, M.; Bedlinskiy, I.; Bektasoglu, M.; Bellis, M.; Benmouna, N.; Berman, B. L.; Biselli, A. S.; Blaszczyk, L.; Bouchigny, S.; Boiarinov, S.; Bradford, R.; Branford, D.; Briscoe, W. J.; Brooks, W. K.; Bültmann, S.; Burkert, V. D.; Butuceanu, C.; Calarco, J. R.; Careccia, S. L.; Carman, D. S.; Carnahan, B.; Casey, L.; Chen, S.; Cole, P. L.; Collins, P.; Coltharp, P.; Crabb, D.; Crannell, H.; Crede, V.; Cummings, J. P.; Dashyan, N.; de Masi, R.; de Vita, R.; de Sanctis, E.; Degtyarenko, P. V.; Denizli, H.; Dennis, L.; Deur, A.; Dharmawardane, K. V.; Dickson, R.; Dodge, G. E.; Doughty, D.; Dugger, M.; Dytman, S.; Dzyubak, O. P.; Egiyan, H.; Egiyan, K. S.; El Fassi, L.; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Feldman, G.; Feuerbach, R. J.; Funsten, H.; Garçon, M.; Gavalian, G.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gordon, C. I. O.; Gothe, R. W.; Griffioen, K. A.; Guidal, M.; Guler, N.; Guo, L.; Gyurjyan, V.; Hadjidakis, C.; Hafidi, K.; Hakobyan, H.; Hakobyan, R. S.; Hanretty, C.; Hardie, J.; Hersman, F. W.; Hicks, K.; Hleiqawi, I.; Holtrop, M.; Hyde-Wright, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Ito, M. M.; Jenkins, D.; Jo, H. S.; Johnstone, J. R.; Joo, K.; Juengst, H. G.; Kalantarians, N.; Kellie, J. D.; Khandaker, M.; Kim, W.; Klein, A.; Klein, F. J.; Klimenko, A. V.; Kossov, M.; Krahn, Z.; Kramer, L. H.; Kubarovsky, V.; Kuhn, J.; Kuhn, S. E.; Kuleshov, S. V.; Lachniet, J.; Laget, J. M.; Langheinrich, J.; Lawrence, D.; Li, Ji; Livingston, K.; Lu, H. Y.; MacCormick, M.; Markov, N.; Mattione, P.; McAleer, S.; McKinnon, B.; McNabb, J. W. C.; Mecking, B. A.; Mehrabyan, S.; Melone, J. J.; Mestayer, M. D.; Meyer, C. A.; Mibe, T.; Mikhailov, K.; Minehart, R.; Mirazita, M.; Miskimen, R.; Mokeev, V.; Moriya, K.; Morrow, S. A.; Moteabbed, M.; Mueller, J.; Munevar, E.; Mutchler, G. S.; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Niczyporuk, B. B.; Niroula, M. R.; Niyazov, R. A.; Nozar, M.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Paterson, C.; Pereira, S. Anefalos; Pierce, J.; Pivnyuk, N.; Pocanic, D.; Pogorelko, O.; Pozdniakov, S.; Preedom, B. M.; Price, J. W.; Prok, Y.; Protopopescu, D.; Raue, B. A.; Riccardi, G.; Ricco, G.; Ripani, M.; Ritchie, B. G.; Ronchetti, F.; Rosner, G.; Rossi, P.; Sabatié, F.; Salamanca, J.; Salgado, C.; Santoro, J. P.; Sapunenko, V.; Schumacher, R. A.; Serov, V. S.; Sharabian, Y. G.; Sharov, D.; Shvedunov, N. V.; Smith, E. S.; Smith, L. C.; Sober, D. I.; Sokhan, D.; Stavinsky, A.; Stepanyan, S. S.; Stepanyan, S.; Stokes, B. E.; Stoler, P.; Strakovsky, I. I.; Strauch, S.; Taiuti, M.; Tedeschi, D. J.; Tkabladze, A.; Tkachenko, S.; Todor, L.; Ungaro, M.; Vineyard, M. F.; Vlassov, A. V.; Watts, D. P.; Weinstein, L. B.; Williams, M.; Wolin, E.; Yegneswaran, A.; Zana, L.; Zhang, B.; Zhang, J.; Zhao, B.; Zhao, Z. W.

    2007-12-01

    The photoproduction of vector mesons on various nuclei has been studied using the CLAS detector at Jefferson Laboratory. The vector mesons, ρ, ω, and ϕ, are observed via their decay to e+e-, in order to reduce the effects of final-state interactions in the nucleus. Of particular interest are possible in-medium effects on the properties of the ρ meson. The ρ mass spectrum is extracted from the data on various nuclei, H2, C, Fe, and Ti. We observe no significant mass shift and some broadening consistent with expected collisional broadening for the ρ meson.

  19. Multi-indexed (q-)Racah polynomials

    NASA Astrophysics Data System (ADS)

    Odake, Satoru; Sasaki, Ryu

    2012-09-01

    As the second stage of the project multi-indexed orthogonal polynomials, we present, in the framework of ‘discrete quantum mechanics’ with real shifts in one dimension, the multi-indexed (q-)Racah polynomials. They are obtained from the (q-)Racah polynomials by the multiple application of the discrete analogue of the Darboux transformations or the Crum-Krein-Adler deletion of ‘virtual state’ vectors, in a similar way to the multi-indexed Laguerre and Jacobi polynomials reported earlier. The virtual state vectors are the ‘solutions’ of the matrix Schrödinger equation with negative ‘eigenvalues’, except for one of the two boundary points.

  20. THRESHOLD ELEMENTS AND THE DESIGN OF SEQUENTIAL SWITCHING NETWORKS.

    DTIC Science & Technology

    The report covers research performed from March 1966 to March 1967. The major topics treated are: (1) methods for finding weight- threshold vectors...that realize a given switching function in multi- threshold linear logic; (2) synthesis of sequential machines by means of shift registers and simple

  1. Electric and magnetic superlattices in trilayer graphene

    NASA Astrophysics Data System (ADS)

    Uddin, Salah; Chan, K. S.

    2016-01-01

    The properties of one dimensional Kronig-Penney type of periodic electric and vector potential on ABC-trilayer graphene superlattices are investigated. The energy spectra obtained with periodic vector potentials shows the emergence of extra Dirac points in the energy spectrum with finite energies. For identical barrier and well widths, the original as well as the extra Dirac points are located in the ky = 0 plane. An asymmetry between the barrier and well widths causes a shift in the extra Dirac points away from the ky = 0 plane. Extra Dirac points having same electron hole crossing energy as that of the original Dirac point as well as finite energy Dirac points are generated in the energy spectrum when periodic electric potential is applied to the system. By applying electric and vector potential together, the symmetry of the energy spectrum about the Fermi level is broken. A tunable band gap is induced in the energy spectrum by applying both electric and vector potential simultaneously with different barrier and well widths.

  2. Influence of Vectors’ Risk-Spreading Strategies and Environmental Stochasticity on the Epidemiology and Evolution of Vector-Borne Diseases: The Example of Chagas’ Disease

    PubMed Central

    Pelosse, Perrine; Kribs-Zaleta, Christopher M.; Ginoux, Marine; Rabinovich, Jorge E.; Gourbière, Sébastien; Menu, Frédéric

    2013-01-01

    Insects are known to display strategies that spread the risk of encountering unfavorable conditions, thereby decreasing the extinction probability of genetic lineages in unpredictable environments. To what extent these strategies influence the epidemiology and evolution of vector-borne diseases in stochastic environments is largely unknown. In triatomines, the vectors of the parasite Trypanosoma cruzi, the etiological agent of Chagas’ disease, juvenile development time varies between individuals and such variation most likely decreases the extinction risk of vector populations in stochastic environments. We developed a simplified multi-stage vector-borne SI epidemiological model to investigate how vector risk-spreading strategies and environmental stochasticity influence the prevalence and evolution of a parasite. This model is based on available knowledge on triatomine biodemography, but its conceptual outcomes apply, to a certain extent, to other vector-borne diseases. Model comparisons between deterministic and stochastic settings led to the conclusion that environmental stochasticity, vector risk-spreading strategies (in particular an increase in the length and variability of development time) and their interaction have drastic consequences on vector population dynamics, disease prevalence, and the relative short-term evolution of parasite virulence. Our work shows that stochastic environments and associated risk-spreading strategies can increase the prevalence of vector-borne diseases and favor the invasion of more virulent parasite strains on relatively short evolutionary timescales. This study raises new questions and challenges in a context of increasingly unpredictable environmental variations as a result of global climate change and human interventions such as habitat destruction or vector control. PMID:23951018

  3. When and Why Threats Go Undetected: Impacts of Event Rate and Shift Length on Threat Detection Accuracy During Airport Baggage Screening.

    PubMed

    Meuter, Renata F I; Lacherez, Philippe F

    2016-03-01

    We aimed to assess the impact of task demands and individual characteristics on threat detection in baggage screeners. Airport security staff work under time constraints to ensure optimal threat detection. Understanding the impact of individual characteristics and task demands on performance is vital to ensure accurate threat detection. We examined threat detection in baggage screeners as a function of event rate (i.e., number of bags per minute) and time on task across 4 months. We measured performance in terms of the accuracy of detection of Fictitious Threat Items (FTIs) randomly superimposed on X-ray images of real passenger bags. Analyses of the percentage of correct FTI identifications (hits) show that longer shifts with high baggage throughput result in worse threat detection. Importantly, these significant performance decrements emerge within the first 10 min of these busy screening shifts only. Longer shift lengths, especially when combined with high baggage throughput, increase the likelihood that threats go undetected. Shorter shift rotations, although perhaps difficult to implement during busy screening periods, would ensure more consistently high vigilance in baggage screeners and, therefore, optimal threat detection and passenger safety. © 2015, Human Factors and Ergonomics Society.

  4. Updating the "Risk Index": A systematic review and meta-analysis of occupational injuries and work schedule characteristics.

    PubMed

    Fischer, Dorothee; Lombardi, David A; Folkard, Simon; Willetts, Joanna; Christiani, David C

    2017-01-01

    Fatigue is a major risk factor for occupational 'accidents' and injuries, and involves dimensions of physical, mental, and muscular fatigue. These dimensions are largely influenced by temporal aspects of work schedules. The "Risk Index" combines four fatigue-related components of work schedules to estimate occupational 'accident' and injury risk based on empirical trends: shift type (morning, afternoon/evening, night), length and consecutive number, and on-shift rest breaks. Since its first introduction in 2004, several additional studies have been published that allow the opportunity to improve the internal and external validity of the "Risk Index". Thus, we updated the model's estimates by systematically reviewing the literature and synthesizing study results using meta-analysis. Cochrane Collaboration directives and MOOSE guidelines were followed. We conducted systematic literature searches on each model component in Medline. An inverse variance approach to meta-analysis was used to synthesize study effect sizes and estimate between-studies variance ('heterogeneity'). Meta-regression models were conducted to explain the heterogeneity using several effect modifiers, including the sample age and sex ratio. Among 3,183 initially identified abstracts, after screening by two independent raters (95-98% agreement), 29 high-quality studies were included in the meta-analysis. The following trends were observed: Shift type. Compared to morning shifts, injury risk significantly increased on night shifts (RR = 1.36 [95%CI = 1.15-1.60], n = 14 studies), while risk was slightly elevated on afternoon/evening shifts, although non-significantly (RR = 1.12 [0.76-1.64], n = 9 studies). Meta-regressions revealed worker's age as a significant effect modifier: adolescent workers (≤ 20 y) showed a decreased risk on the afternoon/evening shift compared to both morning shifts and adult workers (p < 0.05). Number of consecutive shifts. Compared to the first shift in a block of consecutive shifts, risk increased exponentially for morning shifts (e.g., 4th: RR = 1.09 [0.90-1.32]; n = 6 studies) and night shifts (e.g., 4th: RR = 1.36 [1.14-1.62]; n = 8 studies), while risk on afternoon/evening shifts appeared unsystematic. Shift length. Injury risk rose substantially beyond the 9th hour on duty, a trend that was mirrored when looking at shift lengths (e.g., >12 h: RR = 1.34 [1.04-1.51], n = 3 studies). Rest breaks. Risk decreased for any rest break duration (e.g., 31-60 min: RR = 0.35 [0.29-0.43], n = 2 studies). With regards to time between breaks, risk increased with every additional half hour spent on the work task compared to the first 30 min (e.g., 90-119 min: RR = 1.62 [1.00-2.62], n = 3 studies). Rest break duration and interval seem to interact such that with increasing duration, the time between breaks becomes irrelevant. The updated "Risk Index". All four components were combined to form the updated model and the relative risk values estimated for a variety of work schedules. The resulting "Risk Map" shows regions of highest risk when rest breaks are not taken frequently enough (i.e. <4 h) or are too short (i.e. <30 min), when shift length exceeds 11 h, and when work takes place during the night (particularly for >3 consecutive night shifts). The "Risk Index" is proposed as an empirical model to predict occupational 'accident' and injury risk based on the most recent data in the field, and can serve as a tool to evaluate hazards and maximize safety across different work schedules.

  5. An Analysis of the Potential Impact of Climate Change on Dengue Transmission in the Southeastern United States.

    PubMed

    Butterworth, Melinda K; Morin, Cory W; Comrie, Andrew C

    2017-04-01

    Dengue fever, caused by a mosquito-transmitted virus, is an increasing health concern in the Americas. Meteorological variables such as temperature and precipitation can affect disease distribution and abundance through biophysical impacts on the vector and on the virus. Such tightly coupled links may facilitate further spread of dengue fever under a changing climate. In the southeastern United States, the dengue vector is widely established and exists on the current fringe of dengue transmission. We assessed projected climate change-driven shifts in dengue transmission risk in this region. We used a dynamic mosquito population and virus transmission model driven by meteorological data to simulate Aedes aegypti populations and dengue cases in 23 locations in the southeastern United States under current climate conditions and future climate projections. We compared estimates for each location with simulations based on observed data from San Juan, Puerto Rico, where dengue is endemic. Our simulations based on current climate data suggest that dengue transmission at levels similar to those in San Juan is possible at several U.S. locations during the summer months, particularly in southern Florida and Texas. Simulations that include climate change projections suggest that conditions may become suitable for virus transmission in a larger number of locations and for a longer period of time during each year. However, in contrast with San Juan, U.S. locations would not sustain year-round dengue transmission according to our model. Our findings suggest that Dengue virus (DENV) transmission is limited by low winter temperatures in the mainland United States, which are likely to prevent its permanent establishment. Although future climate conditions may increase the length of the mosquito season in many locations, projected increases in dengue transmission are limited to the southernmost locations.

  6. Vector Graph Assisted Pedestrian Dead Reckoning Using an Unconstrained Smartphone

    PubMed Central

    Qian, Jiuchao; Pei, Ling; Ma, Jiabin; Ying, Rendong; Liu, Peilin

    2015-01-01

    The paper presents a hybrid indoor positioning solution based on a pedestrian dead reckoning (PDR) approach using built-in sensors on a smartphone. To address the challenges of flexible and complex contexts of carrying a phone while walking, a robust step detection algorithm based on motion-awareness has been proposed. Given the fact that step length is influenced by different motion states, an adaptive step length estimation algorithm based on motion recognition is developed. Heading estimation is carried out by an attitude acquisition algorithm, which contains a two-phase filter to mitigate the distortion of magnetic anomalies. In order to estimate the heading for an unconstrained smartphone, principal component analysis (PCA) of acceleration is applied to determine the offset between the orientation of smartphone and the actual heading of a pedestrian. Moreover, a particle filter with vector graph assisted particle weighting is introduced to correct the deviation in step length and heading estimation. Extensive field tests, including four contexts of carrying a phone, have been conducted in an office building to verify the performance of the proposed algorithm. Test results show that the proposed algorithm can achieve sub-meter mean error in all contexts. PMID:25738763

  7. Agroinoculation of Beet necrotic yellow vein virus cDNA clones results in plant systemic infection and efficient Polymyxa betae transmission.

    PubMed

    Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio

    2013-05-01

    Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.

  8. Study of field shifts of Ramsey resonances on ultracold atoms and ions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tabatchikova, K. S., E-mail: k.tabatchikova@gmail.com; Taichenachev, A. V.; Dmitriev, A. K.

    2015-02-15

    The effect of the finite laser radiation line width and spontaneous relaxation of levels on the efficiency of the suppression of the field shift of the central resonance for the generalized Ramsey scheme with pulses of different lengths and with a phase jump in the second pulse has been considered. The optimal parameters of the scheme corresponding to the minimum frequency shift and maximum amplitude of the resonance have been determined.

  9. Burgers vector content of an interfacial ledge

    NASA Astrophysics Data System (ADS)

    Bonnet, R.; Loubradou, M.; Pénisson, J. M.

    1992-07-01

    A new way of investigating the elastic field around a ledge of a faceted interface is proposed for crystalline materials. The length and/or angular misfits along two adjacent facets are accommodated by slightly deforming the atomic structural units with an appropriate distribution of translation dislocations. The Burgers vector content of the ledge is not defined as usual from a circuit crossing the interface twice, a method which proves to be sometimes misleading. An example treats, at the atomic scale, an unusual ledge of the interface TiAl/Ti3Al.

  10. An integrated vector system for cellular studies of phage display-derived peptides.

    PubMed

    Voss, Stephan D; DeGrand, Alec M; Romeo, Giulio R; Cantley, Lewis C; Frangioni, John V

    2002-09-15

    Peptide phage display is a method by which large numbers of diverse peptides can be screened for binding to a target of interest. Even when successful, the rate-limiting step is usually validation of peptide bioactivity using living cells. In this paper, we describe an integrated system of vectors that expedites both the screening and the characterization processes. Library construction and screening is performed using an optimized type 3 phage display vector, mJ(1), which is shown to accept peptide libraries of at least 23 amino acids in length. Peptide coding sequences are shuttled from mJ(1) into one of three families of mammalian expression vectors for cell physiological studies. The vector pAL(1) expresses phage display-derived peptides as Gal4 DNA binding domain fusion proteins for transcriptional activation studies. The vectors pG(1), pG(1)N, and pG(1)C express phage display-derived peptides as green fluorescent protein fusions targeted to the entire cell, nucleus, or cytoplasm, respectively. The vector pAP(1) expresses phage display-derived peptides as fusions to secreted placental alkaline phosphatase. Such enzyme fusions can be used as highly sensitive affinity reagents for high-throughput assays and for cloning of peptide-binding cell surface receptors. Taken together, this system of vectors should facilitate the development of phage display-derived peptides into useful biomolecules.

  11. A vector-based representation of the chemical bond for the substituted torsion of biphenyl

    NASA Astrophysics Data System (ADS)

    Li, Jiahui; Huang, Weijie; Xu, Tianlv; Kirk, Steven R.; Jenkins, Samantha

    2018-06-01

    We use a new interpretation of the chemical bond within QTAIM, the bond-path framework set B = {p, q, r} with associated linkages with lengths H∗, H and the familiar bond-path length is used to describe a torsion θ, 0.0° ≤ θ < 22.0° of para-substituted biphenyl, C12H9-x, x = N(CH3)2, NH2, CH3, CHO, CN, NO2. We include consideration of the H--H bonding interactions and find that the lengths H > H∗ that we explain in terms of the most and least preferred directions of charge density accumulation. We also consider the fractional eigenvector-following path with lengths Hf and Hfθmin.

  12. Vector-borne diseases and climate change: a European perspective

    PubMed Central

    Suk, Jonathan E

    2017-01-01

    Abstract Climate change has already impacted the transmission of a wide range of vector-borne diseases in Europe, and it will continue to do so in the coming decades. Climate change has been implicated in the observed shift of ticks to elevated altitudes and latitudes, notably including the Ixodes ricinus tick species that is a vector for Lyme borreliosis and tick-borne encephalitis. Climate change is also thought to have been a factor in the expansion of other important disease vectors in Europe: Aedes albopictus (the Asian tiger mosquito), which transmits diseases such as Zika, dengue and chikungunya, and Phlebotomus sandfly species, which transmits diseases including Leishmaniasis. In addition, highly elevated temperatures in the summer of 2010 have been associated with an epidemic of West Nile Fever in Southeast Europe and subsequent outbreaks have been linked to summer temperature anomalies. Future climate-sensitive health impacts are challenging to project quantitatively, in part due to the intricate interplay between non-climatic and climatic drivers, weather-sensitive pathogens and climate-change adaptation. Moreover, globalisation and international air travel contribute to pathogen and vector dispersion internationally. Nevertheless, monitoring forecasts of meteorological conditions can help detect epidemic precursors of vector-borne disease outbreaks and serve as early warning systems for risk reduction. PMID:29149298

  13. Vector-borne diseases and climate change: a European perspective.

    PubMed

    Semenza, Jan C; Suk, Jonathan E

    2018-02-01

    Climate change has already impacted the transmission of a wide range of vector-borne diseases in Europe, and it will continue to do so in the coming decades. Climate change has been implicated in the observed shift of ticks to elevated altitudes and latitudes, notably including the Ixodes ricinus tick species that is a vector for Lyme borreliosis and tick-borne encephalitis. Climate change is also thought to have been a factor in the expansion of other important disease vectors in Europe: Aedes albopictus (the Asian tiger mosquito), which transmits diseases such as Zika, dengue and chikungunya, and Phlebotomus sandfly species, which transmits diseases including Leishmaniasis. In addition, highly elevated temperatures in the summer of 2010 have been associated with an epidemic of West Nile Fever in Southeast Europe and subsequent outbreaks have been linked to summer temperature anomalies. Future climate-sensitive health impacts are challenging to project quantitatively, in part due to the intricate interplay between non-climatic and climatic drivers, weather-sensitive pathogens and climate-change adaptation. Moreover, globalisation and international air travel contribute to pathogen and vector dispersion internationally. Nevertheless, monitoring forecasts of meteorological conditions can help detect epidemic precursors of vector-borne disease outbreaks and serve as early warning systems for risk reduction. © FEMS 2017.

  14. Monitoring Poisson observations using combined applications of Shewhart and EWMA charts

    NASA Astrophysics Data System (ADS)

    Abujiya, Mu'azu Ramat

    2017-11-01

    The Shewhart and exponentially weighted moving average (EWMA) charts for nonconformities are the most widely used procedures of choice for monitoring Poisson observations in modern industries. Individually, the Shewhart EWMA charts are only sensitive to large and small shifts, respectively. To enhance the detection abilities of the two schemes in monitoring all kinds of shifts in Poisson count data, this study examines the performance of combined applications of the Shewhart, and EWMA Poisson control charts. Furthermore, the study proposes modifications based on well-structured statistical data collection technique, ranked set sampling (RSS), to detect shifts in the mean of a Poisson process more quickly. The relative performance of the proposed Shewhart-EWMA Poisson location charts is evaluated in terms of the average run length (ARL), standard deviation of the run length (SDRL), median run length (MRL), average ratio ARL (ARARL), average extra quadratic loss (AEQL) and performance comparison index (PCI). Consequently, all the new Poisson control charts based on RSS method are generally more superior than most of the existing schemes for monitoring Poisson processes. The use of these combined Shewhart-EWMA Poisson charts is illustrated with an example to demonstrate the practical implementation of the design procedure.

  15. Optimized Design of Spacer in Electrodialyzer Using CFD Simulation Method

    NASA Astrophysics Data System (ADS)

    Jia, Yuxiang; Yan, Chunsheng; Chen, Lijun; Hu, Yangdong

    2018-06-01

    In this study, the effects of length-width ratio and diversion trench of the spacer on the fluid flow behavior in an electrodialyzer have been investigated through CFD simulation method. The relevant information, including the pressure drop, velocity vector distribution and shear stress distribution, demonstrates the importance of optimized design of the spacer in an electrodialysis process. The results show width of the diversion trench has a great effect on the fluid flow compared with length. Increase of the diversion trench width could strength the fluid flow, but also increase the pressure drop. Secondly, the dead zone of the fluid flow decreases with increase of length-width ratio of the spacer, but the pressure drop increases with the increase of length-width ratio of the spacer. So the appropriate length-width ratio of the space should be moderate.

  16. Relative Energy Shift of a Two-Level Atom in a Cylindrical Spacetime

    NASA Astrophysics Data System (ADS)

    Zhang, Jia-Lin

    2012-11-01

    We investigate the evolution dynamics of a two-level atom system interacting with the massless scalar field in a Cylindrical spacetime. We find that both the energy shifts of ground state and excited state can be separated into two parts due to the vacuum fluctuations. One is the corresponding energy shift for a rest atom in four-dimensional Minkowski space without spatial compactification, the other is just the modification of the spatial compactified periodic length. It will reveal that the influence of the presence of one spatial compactified dimension can not be neglected in Lamb shift as the relative energy level shift of an atom.

  17. Impact of El Niño Southern Oscillation on infectious disease hospitalization risk in the United States.

    PubMed

    Fisman, David N; Tuite, Ashleigh R; Brown, Kevin A

    2016-12-20

    Although the global climate is changing at an unprecedented rate, links between weather and infectious disease have received little attention in high income countries. The "El Niño Southern Oscillation" (ENSO) occurs irregularly and is associated with changing temperature and precipitation patterns. We studied the impact of ENSO on infectious diseases in four census regions in the United States. We evaluated infectious diseases requiring hospitalization using the US National Hospital Discharge Survey (1970-2010) and five disease groupings that may undergo epidemiological shifts with changing climate: (i) vector-borne diseases, (ii) pneumonia and influenza, (iii) enteric disease, (iv) zoonotic bacterial disease, and (v) fungal disease. ENSO exposure was based on the Multivariate ENSO Index. Distributed lag models, with adjustment for seasonal oscillation and long-term trends, were used to evaluate the impact of ENSO on disease incidence over lags of up to 12 mo. ENSO was associated more with vector-borne disease [relative risk (RR) 2.96, 95% confidence interval (CI) 1.03-8.48] and less with enteric disease (0.73, 95% CI 0.62-0.87) in the Western region; the increase in vector-borne disease was attributable to increased risk of rickettsioses and tick-borne infectious diseases. By contrast, ENSO was associated with more enteric disease in non-Western regions (RR 1.12, 95% CI 1.02-1.15). The periodic nature of ENSO may make it a useful natural experiment for evaluation of the impact of climatic shifts on infectious disease risk. The impact of ENSO suggests that warmer temperatures and extreme variation in precipitation events influence risks of vector-borne and enteric disease in the United States.

  18. Dopants concentration effects on the wavelength shift of long-period fiber gratings used as liquid level detectors

    NASA Astrophysics Data System (ADS)

    Mao, Barerem-Melgueba; Zhou, Bin

    2011-12-01

    Two liquid level sensors based on different long-period fiber gratings are proposed and compared. The long-period gratings have the same characteristics (length, grating period) but are fabricated in different optical fibers (photosensitive B-Ge codoped optical fibers with different dopants concentrations). The principle of this type of sensor is based on the refractive index sensitivity of long-period fiber gratings. By monitoring the resonant wavelength shifts of a given attenuation band, one can measure the immersed lengths of long-period fiber gratings and then the liquid level. The levels of two different solutions are measured. The maximum shift (7.69 nm) of the investigated resonance wavelength was observed in LPG1 (fabricated in Fibercore PS1250/1500). By controlling the fiber dopants concentrations one can improve the readouts of a fiber-optic liquid level sensor based on long-period fiber gratings.

  19. Measuring the topology of large-scale structure in the universe

    NASA Technical Reports Server (NTRS)

    Gott, J. Richard, III

    1988-01-01

    An algorithm for quantitatively measuring the topology of large-scale structure has now been applied to a large number of observational data sets. The present paper summarizes and provides an overview of some of these observational results. On scales significantly larger than the correlation length, larger than about 1200 km/s, the cluster and galaxy data are fully consistent with a sponge-like random phase topology. At a smoothing length of about 600 km/s, however, the observed genus curves show a small shift in the direction of a meatball topology. Cold dark matter (CDM) models show similar shifts at these scales but not generally as large as those seen in the data. Bubble models, with voids completely surrounded on all sides by wall of galaxies, show shifts in the opposite direction. The CDM model is overall the most successful in explaining the data.

  20. Measuring the topology of large-scale structure in the universe

    NASA Astrophysics Data System (ADS)

    Gott, J. Richard, III

    1988-11-01

    An algorithm for quantitatively measuring the topology of large-scale structure has now been applied to a large number of observational data sets. The present paper summarizes and provides an overview of some of these observational results. On scales significantly larger than the correlation length, larger than about 1200 km/s, the cluster and galaxy data are fully consistent with a sponge-like random phase topology. At a smoothing length of about 600 km/s, however, the observed genus curves show a small shift in the direction of a meatball topology. Cold dark matter (CDM) models show similar shifts at these scales but not generally as large as those seen in the data. Bubble models, with voids completely surrounded on all sides by wall of galaxies, show shifts in the opposite direction. The CDM model is overall the most successful in explaining the data.

  1. Mutants with Altered Sensitivity to a Calmodulin Antagonist Affect the Circadian Clock in Neurospora Crassa

    PubMed Central

    Suzuki, S.; Katagiri, S.; Nakashima, H.

    1996-01-01

    Two newly isolated mutant strains of Neurospora crassa, cpz-1 and cpz-2, were hypersensitive to chlorpromazine with respect to mycelial growth but responded differently to the drug with respect to the circadian conidiation rhythm. In the wild type, chlorpromazine caused shortening of the period length of the conidiation rhythm. Pulse treatment with the drug shifted the phase and inhibited light-induced phase shifting in Neurospora. By contrast to the wild type, the cpz-2 strain was resistant to these inhibitory effects of chlorpromazine. Inhibition of cpz-2 function by chlorpromazine affected three different parameters of circadian conidiation rhythm, namely, period length, phase and light-induced phase shifting. These results indicate that the cpz-2 gene must be involved in or related closely to the clock mechanism of Neurospora. By contrast, the cpz-1 strain was hypersensitive to chlorpromazine with respect to the circadian conidiation rhythm. PMID:8807291

  2. Definition of the persistence length in the coarse-grained models of DNA elasticity.

    PubMed

    Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

    2012-11-01

    By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

  3. Work hours, workload, sleep and fatigue in Australian Rail Industry employees.

    PubMed

    Dorrian, Jillian; Baulk, Stuart D; Dawson, Drew

    2011-01-01

    Research suggests that less than 5 h sleep in the 24 h prior to work and/or more than 16 h of wakefulness can significantly increase the likelihood of fatigue-related impairment and error at work. Studies have also shown exponential safety declines with time on shift, with roughly double the likelihood of accident or injury after 10 h relative to the first 8h. While it is acknowledged that reduced sleep, increased wakefulness and longer work hours produce work-related fatigue, few studies have examined the impact of workload on this relationship. Studies in the rail industry have focused on drivers. This study investigated fatigue in a large sample of Australian Rail Industry Employees. Participants were from four companies (n = 90: 85m, 5f; mean age 40.2 ± 8.6 y). Data was analysed for a total of 713 shifts. Subjects wore wrist actigraphs and completed sleep and work diaries for 14-days. They also completed the Samn-Perelli Fatigue Scale at the beginning and end of shifts, and the NASA-TLX workload scale at least twice during each shift. Average (±SD) sleep length (7.2 ± 2.6h), prior wake at shift end (12.0 ± 4.7h), shift duration (8.0 ± 1.3) and fatigue (4.1 ± 1.3, "a little tired, less than fresh") were within limits generally considered acceptable from a fatigue perspective. However, participants received 5 h or less sleep in the prior 24 h on 13%, were awake for at least 16 h at the end of 16% and worked at least 10 h on 7% of shifts. Subjects reported that they felt "extremely tired, very difficult to concentrate," or "completely exhausted, unable to function effectively" on 13% of shifts. Sleep length (OR = 0.88, p < 0.01), shift duration (OR = 1.18, p < 0.05), night shift (REF = morning shift, OR = 2.12, p < 0.05) and workload ratings (OR = 1.2, p < 0.05) were significant predictors of ratings of extreme tiredness/exhaustion (yes/no). While on average, sleep loss, extended wakefulness, longer work hours and work-related fatigue do not appear problematic in this sample, there is still a notable percentage of shifts that are likely to be associated with high levels of work-related fatigue. Given the size of the Australian Rail Industry, with thousands of shifts occurring each day, this is potentially of operational concern. Further, results indicate that, in addition to sleep length, wakefulness and work hours, workload significantly influences fatigue. This has possible implications for bio-mathematical predictions of fatigue and for fatigue management more generally. Copyright © 2010. Published by Elsevier Ltd.

  4. Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression.

    PubMed

    Lim, Hyoun-Sub; Vaira, Anna Maria; Domier, Leslie L; Lee, Sung Chul; Kim, Hong Gi; Hammond, John

    2010-06-20

    We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS. Published by Elsevier Inc.

  5. Autorotation

    NASA Astrophysics Data System (ADS)

    Bohr, Jakob; Markvorsen, Steen

    2016-02-01

    A continuous autorotation vector field along a framed space curve is defined, which describes the rotational progression of the frame. We obtain an exact integral for the length of the autorotation vector. This invokes the infinitesimal rotation vector of the frame progression and the unit vector field for the corresponding autorotation vector field. For closed curves we define an autorotation number whose integer value depends on the starting point of the curve. Upon curve deformations, the autorotation number is either constant, or can make a jump of (multiples of) plus-minus two, which corresponds to a change in rotation of multiples of 4π. The autorotation number is therefore not topologically conserved under all transformations. We discuss this within the context of generalised inflection points and of frame revisit points. The results may be applicable to physical systems such as polymers, proteins, and DNA. Finally, turbulence is discussed in the light of autorotation, as is the Philippine wine dance, the Dirac belt trick, and the 4π cycle of the flying snake. This paper is dedicated to Ian K Robinson on the occasion of Ian receiving the Gregori Aminoff Prize 2015.

  6. [Cloning and sequence analysis of tomato fruit-specific E8 promoter from Lycopersicon esculentum (Zhongshu No.5)].

    PubMed

    Zhou, Xiao-hong; Chen, Xiao-guang; Zhang, Xiao-dong; Wang, Ya-nan; Li, Lin; Xi, Jia-fei; Hu, Jian-jun

    2003-01-01

    To obtain the gene encoding tomato fruit-specific E8 promoter therefore to prepare for exogenous gene transcription and expression in transgenic tomato fruit. The cotyledons of tomato Lycopersicon esculentum (Zhongshu No.5) were collected for extracting the genomic DNA of this plant. The fruit-specific E81.1 and E82.2 promoter DNA were then amplified by PCR, the product of which was subcloned into pGEM-T vector. After identification by restriction enzymes, the recombinant T-vectors were subjected to sequence analysis. The fragments of the promoter as amplified by PCR were of predicted length. Digestion with Xba I and Hind III /BamH I proved correct insertion of the target fragments with expected length into the recombinant T vectors. As indicated by homology analysis, the resultant tomato fruit-specific E8 promoter was highly conservative, and E82.2 promoter of Zhongshu No.5, with GenBank submission number of AF515784, proved to share 99% homology with E82.2 promoter of Zhongshu No.5 Cherry as reported by Deikman J. Tomato fruit-specific E8 promoter of Zhongshu No.5 has been successfully cloned, thus making possible the subsequent research in oral vaccine of transgenic tomato.

  7. [Construction and expression of recombinant lentiviral vectors of AKT2,PDK1 and BAD].

    PubMed

    Zhu, Jing; Chen, Bo-Jiang; Huang, Na; Li, Wei-Min

    2014-03-01

    To construct human protein kinase B (ATK2), phosphoinositide-dependent kinase 1 (PDK1) and bcl-2-associated death protein (BAD) lentiviral expression vector, and to determine their expressions in 293T cells. Total RNA was extracted from lung cancer tissues. The full-length coding regions of human ATK2, BAD and PDK1 cDNA were amplified via RT-PCR using specific primers, subcloned into PGEM-Teasy and then sequenced for confirmation. The full-length coding sequence was cut out with a specific restriction enzyme digest and subclone into pCDF1-MCS2-EF1-copGFP. The plasmids were transfected into 293T cells using the calcium phosphate method. The over expression of AKT2, BAD and PDK1 were detected by Western blot. AKT2, PDK1 and BAD were subcloned into pCDF1-MCS2-EF1-copGFP, with an efficiency of transfection of 100%, 95%, and 90% respectively. The virus titers were 6.7 x 10(6) PFU/mL in the supernatant. After infection, the proteins of AKT2, PDK1 and BAD were detected by Western blot. The lentivial vector pCDF1-MCS2-EF1-copGFP containing AKT2, BAD and PDK1 were successfully constructed and expressed in 293T cells.

  8. Impact of insecticide-treated bed nets on malaria transmission indices on the south coast of Kenya

    PubMed Central

    2011-01-01

    Background Besides significantly reducing malaria vector densities, prolonged usage of bed nets has been linked to decline of Anopheles gambiae s.s. relative to Anopheles arabiensis, changes in host feeding preference of malaria vectors, and behavioural shifts to exophagy (outdoor biting) for the two important malaria vectors in Africa, An. gambiae s.l. and Anopheles funestus. In southern coastal Kenya, bed net use was negligible in 1997-1998 when Anopheles funestus and An. gambiae s.s. were the primary malaria vectors, with An. arabiensis and Anopheles merus playing a secondary role. Since 2001, bed net use has increased progressively and reached high levels by 2009-2010 with corresponding decline in malaria transmission. Methods To evaluate the impact of the substantial increase in household bed net use within this area on vector density, vector composition, and human-vector contact, indoor and outdoor resting mosquitoes were collected in the same region during 2009-2010 using pyrethrum spray catches and clay pots for indoor and outdoor collections respectively. Information on bed net use per sleeping spaces and factors influencing mosquito density were determined in the same houses using Poisson regression analysis. Species distribution was determined, and number of mosquitoes per house, human-biting rates (HBR), and entomological inoculation rate (EIR) were compared to those reported for the same area during 1997-1998, when bed net coverage had been minimal. Results Compared to 1997-1998, a significant decline in the relative proportion of An. gambiae s.s. among collected mosquitoes was noted, coupled with a proportionate increase of An. arabiensis. Following > 5 years of 60-86% coverage with bed nets, the density, human biting rate and EIR of indoor resting mosquitoes were reduced by more than 92% for An. funestus and by 75% for An. gambiae s.l. In addition, the host feeding choice of both vectors shifted more toward non-human vertebrates. Besides bed net use, malaria vector abundance was also influenced by type of house construction and according to whether one sleeps on a bed or a mat (both of these are associated with household wealth). Mosquito density was positively associated with presence of domestic animals. Conclusions These entomological indices indicate a much reduced human biting rate and a diminishing role of An. gambiae s.s. in malaria transmission following high bed net coverage. While increasing bed net coverage beyond the current levels may not significantly reduce the transmission potential of An. arabiensis, it is anticipated that increasing or at least sustaining high bed net coverage will result in a diminished role for An. funestus in malaria transmission. PMID:22165904

  9. Recent warming by latitude associated with increased length of ragweed pollen season in central North America

    USDA-ARS?s Scientific Manuscript database

    A fundamental aspect regarding the impact of climate change are shifts in flowering phenology associated with milder winters, warmer seasonal air temperature and potential shifts in pollen release. Earlier floral initiation has been suggested to have a role in health impacts by contributing to grea...

  10. Optimal transfers between libration-point orbits in the elliptic restricted three-body problem

    NASA Astrophysics Data System (ADS)

    Hiday, Lisa Ann

    1992-09-01

    A strategy is formulated to design optimal impulsive transfers between three-dimensional libration-point orbits in the vicinity of the interior L(1) libration point of the Sun-Earth/Moon barycenter system. Two methods of constructing nominal transfers, for which the fuel cost is to be minimized, are developed; both inferior and superior transfers between two halo orbits are considered. The necessary conditions for an optimal transfer trajectory are stated in terms of the primer vector. The adjoint equation relating reference and perturbed trajectories in this formulation of the elliptic restricted three-body problem is shown to be distinctly different from that obtained in the analysis of trajectories in the two-body problem. Criteria are established whereby the cost on a nominal transfer can be improved by the addition of an interior impulse or by the implementation of coastal arcs in the initial and final orbits. The necessary conditions for the local optimality of a time-fixed transfer trajectory possessing additional impulses are satisfied by requiring continuity of the Hamiltonian and the derivative of the primer vector at all interior impulses. The optimality of a time-free transfer containing coastal arcs is surmised by examination of the slopes at the endpoints of a plot of the magnitude of the primer vector over the duration of the transfer path. If the initial and final slopes of the primer magnitude are zero, the transfer trajectory is optimal; otherwise, the execution of coasts is warranted. The position and timing of each interior impulse applied to a time-fixed transfer as well as the direction and length of coastal periods implemented on a time-free transfer are specified by the unconstrained minimization of the appropriate variation in cost utilizing a multivariable search technique. Although optimal solutions in some instances are elusive, the time-fixed and time-free optimization algorithms prove to be very successful in diminishing costs on nominal transfer trajectories. The inclusion of coastal arcs on time-free superior and inferior transfers results in significant modification of the transfer time of flight caused by shifts in departure and arrival locations on the halo orbits.

  11. Progress on adenovirus-vectored universal influenza vaccines.

    PubMed

    Xiang, Kui; Ying, Guan; Yan, Zhou; Shanshan, Yan; Lei, Zhang; Hongjun, Li; Maosheng, Sun

    2015-01-01

    Influenza virus (IFV) infection causes serious health problems and heavy financial burdens each year worldwide. The classical inactivated influenza virus vaccine (IIVV) and live attenuated influenza vaccine (LAIV) must be updated regularly to match the new strains that evolve due to antigenic drift and antigenic shift. However, with the discovery of broadly neutralizing antibodies that recognize conserved antigens, and the CD8(+) T cell responses targeting viral internal proteins nucleoprotein (NP), matrix protein 1 (M1) and polymerase basic 1 (PB1), it is possible to develop a universal influenza vaccine based on the conserved hemagglutinin (HA) stem, NP, and matrix proteins. Recombinant adenovirus (rAd) is an ideal influenza vaccine vector because it has an ideal stability and safety profile, induces balanced humoral and cell-mediated immune responses due to activation of innate immunity, provides 'self-adjuvanting' activity, can mimic natural IFV infection, and confers seamless protection against mucosal pathogens. Moreover, this vector can be developed as a low-cost, rapid-response vaccine that can be quickly manufactured. Therefore, an adenovirus vector encoding conserved influenza antigens holds promise in the development of a universal influenza vaccine. This review will summarize the progress in adenovirus-vectored universal flu vaccines and discuss future novel approaches.

  12. A Translational Pathway Toward a Clinical Trial Using the Second-Generation AAV Micro-Dystrophin Vector

    DTIC Science & Technology

    2016-09-01

    minidystrophin gene (a gift from Dr Jeffrey Chamberlain at the University of Washington, Seattle, WA) and the bovine growth hormone polyadenylation...full-length micro-dystrophin protein. Dys-2 is a short peptide in the wild-type full-length dystrophin. It can be recognized by the Dys-2...muscle. In one approach, a muscle homing peptide is inserted on the surface of the capsid to facilitate the entry of AAV into muscle cells. In the

  13. Ontogenetic shifts of heart position in snakes.

    PubMed

    Lillywhite, Harvey B; Lillywhite, Steven M

    2017-08-01

    Heart position relative to total body length (TL) varies among snakes, with anterior hearts in arboreal species and more centrally located hearts in aquatic or ground-dwelling species. Anterior hearts decrease the cardiac work associated with cranial blood flow and minimize drops in cranial pressure and flow during head-up climbing. Here, we investigate whether heart position shifts intraspecifically during ontogenetic increases in TL. Insular Florida cottonmouth snakes, Agkistrodon conanti, are entirely ground-dwelling and have a mean heart position that is 33.32% TL from the head. In contrast, arboreal rat snakes, Pantherophis obsoleta, of similar lengths have a mean heart position that is 17.35% TL from the head. In both species, relative heart position shifts craniad during ontogeny, with negative slopes = -.035 and -.021% TL/cm TL in Agkistrodon and Pantherophis, respectively. Using a large morphometric data set available for Agkistrodon (N = 192 individuals, 23-140 cm TL), we demonstrate there is an anterior ontogenetic shift of the heart position within the trunk (= 4.56% trunk length from base of head to cloacal vent), independent of head and tail allometry which are both negative. However, in longer snakes > 100 cm, the heart position reverses and shifts caudally in longer Agkistrodon but continues toward the head in longer individuals of Pantherophis. Examination of data sets for two independent lineages of fully marine snakes (Acrochordus granulatus and Hydrophis platurus), which do not naturally experience postural gravity stress, demonstrate both ontogenetic patterns for heart position that are seen in the terrestrial snakes. The anterior migration of the heart is greater in the terrestrial species, even if TL is standardized to that of the longer P. obsoleta, and compensates for about 5 mmHg gravitational pressure head if they are fully upright. © 2017 Wiley Periodicals, Inc.

  14. Bi-cubic interpolation for shift-free pan-sharpening

    NASA Astrophysics Data System (ADS)

    Aiazzi, Bruno; Baronti, Stefano; Selva, Massimo; Alparone, Luciano

    2013-12-01

    Most of pan-sharpening techniques require the re-sampling of the multi-spectral (MS) image for matching the size of the panchromatic (Pan) image, before the geometric details of Pan are injected into the MS image. This operation is usually performed in a separable fashion by means of symmetric digital low-pass filtering kernels with odd lengths that utilize piecewise local polynomials, typically implementing linear or cubic interpolation functions. Conversely, constant, i.e. nearest-neighbour, and quadratic kernels, implementing zero and two degree polynomials, respectively, introduce shifts in the magnified images, that are sub-pixel in the case of interpolation by an even factor, as it is the most usual case. However, in standard satellite systems, the point spread functions (PSF) of the MS and Pan instruments are centered in the middle of each pixel. Hence, commercial MS and Pan data products, whose scale ratio is an even number, are relatively shifted by an odd number of half pixels. Filters of even lengths may be exploited to compensate the half-pixel shifts between the MS and Pan sampling grids. In this paper, it is shown that separable polynomial interpolations of odd degrees are feasible with linear-phase kernels of even lengths. The major benefit is that bi-cubic interpolation, which is known to represent the best trade-off between performances and computational complexity, can be applied to commercial MS + Pan datasets, without the need of performing a further half-pixel registration after interpolation, to align the expanded MS with the Pan image.

  15. Raman spectroscopic determination of the length, strength, compressibility, Debye temperature, elasticity, and force constant of the C-C bond in graphene.

    PubMed

    Yang, X X; Li, J W; Zhou, Z F; Wang, Y; Yang, L W; Zheng, W T; Sun, Chang Q

    2012-01-21

    From the perspective of bond relaxation and bond vibration, we have formulated the Raman phonon relaxation of graphene, under the stimuli of the number-of-layers, the uni-axial strain, the pressure, and the temperature, in terms of the response of the length and strength of the representative bond of the entire specimen to the applied stimuli. Theoretical unification of the measurements clarifies that: (i) the opposite trends of the Raman shifts, which are due to the number-of-layers reduction, of the G-peak shift and arises from the vibration of a pair of atoms, while the D- and the 2D-peak shifts involve the z-neighbor of a specific atom; (ii) the tensile strain-induced phonon softening and phonon-band splitting arise from the asymmetric response of the C(3v) bond geometry to the C(2v) uni-axial bond elongation; (iii) the thermal softening of the phonons originates from bond expansion and weakening; and (iv) the pressure stiffening of the phonons results from bond compression and work hardening. Reproduction of the measurements has led to quantitative information about the referential frequencies from which the Raman frequencies shift as well as the length, energy, force constant, Debye temperature, compressibility and elastic modulus of the C-C bond in graphene, which is of instrumental importance in the understanding of the unusual behavior of graphene.

  16. Shafranov shift bifurcation of turbulent transport in the high βp scenario on DIII-D

    NASA Astrophysics Data System (ADS)

    McClenaghan, J.; Garofalo, A. M.; Staebler, G. M.; Qian, J.; Gong, X.; Ding, S. Y.

    2017-10-01

    The Shafranov shift stabilization of turbulence creates a bifurcation in transport leading to formation of a large radius internal transport barrier (ITB) in the high βp scenario on DIII-D. The high βp scenario exhibits high confinement at high βN and high bootstrap fraction in the absence of rapid rotation or negative central shear. Spontaneous formation of an ITB at fixed βN is examined. The energy confinement improves following formation of the ITB. The improvement is associated with a decrease in the minimum mid-radius characteristic turbulence parameter associated with the Shafranov shift: α - s , where α =q2 Rdβ / dρ is a measure of the Shafranov shift, and s is the magnetic shear. After ITB formation, α - s > 0 within region of ITB and α - s < 0 outside the ITB. Before ITB formation, α - s < 0 throughout the entire core. TGLF transport simulations show a bifurcation of the transport depending on the electron pressure gradient scale length. Before ITB formation, the experimental scale length is on the high-transport side of bifurcation. After ITB formation, experimental scale length is on the low-transport side of the bifurcation in the region of the ITB. Work supported in part by the US Department of Energy, Office of Science, Office of Fusion Energy Sciences DE-FC02-04ER54698 (Cooperative Agreement #DE-SC0010685), and by the National Magnetic Confinement Fusion Program of China (No. 2015GB102002, 2015GB10.

  17. Transport in a magnetic field modulated graphene superlattice.

    PubMed

    Li, Yu-Xian

    2010-01-13

    Using the transfer matrix method, we study the transport properties through a magnetic field modulated graphene superlattice. It is found that the electrostatic barrier, the magnetic vector potential, and the number of wells in a superlattice modify the transmission remarkably. The angular dependent transmission is blocked by the magnetic vector potential because of the appearance of the evanescent states at certain incident angles, and the region of Klein tunneling shifts to the left. The angularly averaged conductivities exhibit oscillatory behavior. The magnitude and period of oscillation depend sensitively on the height of the electrostatic barrier, the number of wells, and the strength of the modulated magnetic field.

  18. Multi-Modulator for Bandwidth-Efficient Communication

    NASA Technical Reports Server (NTRS)

    Gray, Andrew; Lee, Dennis; Lay, Norman; Cheetham, Craig; Fong, Wai; Yeh, Pen-Shu; King, Robin; Ghuman, Parminder; Hoy, Scott; Fisher, Dave

    2009-01-01

    A modulator circuit board has recently been developed to be used in conjunction with a vector modulator to generate any of a large number of modulations for bandwidth-efficient radio transmission of digital data signals at rates than can exceed 100 Mb/s. The modulations include quadrature phaseshift keying (QPSK), offset quadrature phase-shift keying (OQPSK), Gaussian minimum-shift keying (GMSK), and octonary phase-shift keying (8PSK) with square-root raised-cosine pulse shaping. The figure is a greatly simplified block diagram showing the relationship between the modulator board and the rest of the transmitter. The role of the modulator board is to encode the incoming data stream and to shape the resulting pulses, which are fed as inputs to the vector modulator. The combination of encoding and pulse shaping in a given application is chosen to maximize the bandwidth efficiency. The modulator board includes gallium arsenide serial-to-parallel converters at its input end. A complementary metal oxide/semiconductor (CMOS) field-programmable gate array (FPGA) performs the coding and modulation computations and utilizes parallel processing in doing so. The results of the parallel computation are combined and converted to pulse waveforms by use of gallium arsenide parallel-to-serial converters integrated with digital-to-analog converters. Without changing the hardware, one can configure the modulator to produce any of the designed combinations of coding and modulation by loading the appropriate bit configuration file into the FPGA.

  19. Fast Eigensolver for Computing 3D Earth's Normal Modes

    NASA Astrophysics Data System (ADS)

    Shi, J.; De Hoop, M. V.; Li, R.; Xi, Y.; Saad, Y.

    2017-12-01

    We present a novel parallel computational approach to compute Earth's normal modes. We discretize Earth via an unstructured tetrahedral mesh and apply the continuous Galerkin finite element method to the elasto-gravitational system. To resolve the eigenvalue pollution issue, following the analysis separating the seismic point spectrum, we utilize explicitly a representation of the displacement for describing the oscillations of the non-seismic modes in the fluid outer core. Effectively, we separate out the essential spectrum which is naturally related to the Brunt-Väisälä frequency. We introduce two Lanczos approaches with polynomial and rational filtering for solving this generalized eigenvalue problem in prescribed intervals. The polynomial filtering technique only accesses the matrix pair through matrix-vector products and is an ideal candidate for solving three-dimensional large-scale eigenvalue problems. The matrix-free scheme allows us to deal with fluid separation and self-gravitation in an efficient way, while the standard shift-and-invert method typically needs an explicit shifted matrix and its factorization. The rational filtering method converges much faster than the standard shift-and-invert procedure when computing all the eigenvalues inside an interval. Both two Lanczos approaches solve for the internal eigenvalues extremely accurately, comparing with the standard eigensolver. In our computational experiments, we compare our results with the radial earth model benchmark, and visualize the normal modes using vector plots to illustrate the properties of the displacements in different modes.

  20. A Few Discrete Lattice Systems and Their Hamiltonian Structures, Conservation Laws

    NASA Astrophysics Data System (ADS)

    Guo, Xiu-Rong; Zhang, Yu-Feng; Zhang, Xiang-Zhi; Yue, Rong

    2017-04-01

    With the help of three shift operators and r-matrix theory, a few discrete lattice systems are obtained which can be reduced to the well-known Toda lattice equation with a constraint whose Hamiltonian structures are generated by Poisson tensors of some induced Lie-Poisson bracket. The recursion operators of these lattice systems are constructed starting from Lax representations. Finally, reducing the given shift operators to get a simpler one and its expanding shift operators, we produce a lattice system with three vector fields whose recursion operator is given. Furthermore, we reduce the lattice system with three vector fields to get a lattice system whose Lax pair and conservation laws are obtained, respectively. Supported by the National Natural Science Foundation of China under Grant No. 11371361, the Innovation Team of Jiangsu Province Hosted by China University of Mining and Technology (2014), the the Key Discipline Construction by China University of Mining and Technology under Grant No. XZD201602, the Shandong Provincial Natural Science Foundation, China under Grant Nos. ZR2016AM31, ZR2016AQ19, ZR2015EM042, the Development of Science and Technology Plan Projects of TaiAn City under Grant No. 2015NS1048, National Social Science Foundation of China under Grant No. 13BJY026, and A Project of Shandong Province Higher Educational Science and Technology Program under Grant No. J14LI58

  1. Adaptive metalenses with simultaneous electrical control of focal length, astigmatism, and shift.

    PubMed

    She, Alan; Zhang, Shuyan; Shian, Samuel; Clarke, David R; Capasso, Federico

    2018-02-01

    Focal adjustment and zooming are universal features of cameras and advanced optical systems. Such tuning is usually performed longitudinally along the optical axis by mechanical or electrical control of focal length. However, the recent advent of ultrathin planar lenses based on metasurfaces (metalenses), which opens the door to future drastic miniaturization of mobile devices such as cell phones and wearable displays, mandates fundamentally different forms of tuning based on lateral motion rather than longitudinal motion. Theory shows that the strain field of a metalens substrate can be directly mapped into the outgoing optical wavefront to achieve large diffraction-limited focal length tuning and control of aberrations. We demonstrate electrically tunable large-area metalenses controlled by artificial muscles capable of simultaneously performing focal length tuning (>100%) as well as on-the-fly astigmatism and image shift corrections, which until now were only possible in electron optics. The device thickness is only 30 μm. Our results demonstrate the possibility of future optical microscopes that fully operate electronically, as well as compact optical systems that use the principles of adaptive optics to correct many orders of aberrations simultaneously.

  2. Constant volume gas cell optical phase-shifter

    DOEpatents

    Phillion, Donald W.

    2002-01-01

    A constant volume gas cell optical phase-shifter, particularly applicable for phase-shifting interferometry, contains a sealed volume of atmospheric gas at a pressure somewhat different than atmospheric. An optical window is present at each end of the cell, and as the length of the cell is changed, the optical path length of a laser beam traversing the cell changes. The cell comprises movable coaxial tubes with seals and a volume equalizing opening. Because the cell is constant volume, the pressure, temperature, and density of the contained gas do not change as the cell changes length. This produces an exactly linear relationship between the change in the length of the gas cell and the change in optical phase of the laser beam traversing it. Because the refractive index difference between the gas inside and the atmosphere outside is very much the same, a large motion must be made to change the optical phase by the small fraction of a wavelength that is required by phase-shifting interferometry for its phase step. This motion can be made to great fractional accuracy.

  3. Electromagnetic scattering by a uniaxial anisotropic sphere located in an off-axis Bessel beam.

    PubMed

    Qu, Tan; Wu, Zhen-Sen; Shang, Qing-Chao; Li, Zheng-Jun; Bai, Lu

    2013-08-01

    Electromagnetic scattering of a zero-order Bessel beam by an anisotropic spherical particle in the off-axis configuration is investigated. Based on the spherical vector wave functions, the expansion expression of the zero-order Bessel beam is derived, and its convergence is numerically discussed in detail. Utilizing the tangential continuity of the electromagnetic fields, the expressions of scattering coefficients are given. The effects of the conical angle of the wave vector components of the zero-order Bessel beam, the ratio of the radius of the sphere to the central spot radius of the zero-order Bessel beam, the shift of the beam waist center position along both the x and y axes, the permittivity and permeability tensor elements, and the loss of the sphere on the radar cross section (RCS) are numerically analyzed. It is revealed that the maximum RCS appears in the conical direction or neighboring direction when the sphere is illuminated by a zero-order Bessel beam. Furthermore, the RCS will decrease and the symmetry is broken with the shift of the beam waist center.

  4. Changes in species richness and spatial distribution of mosquitoes (Diptera: Culicidae) inferred from museum specimen records and a recent inventory: a case study from Belgium suggests recent expanded distribution of arbovirus and malaria vectors.

    PubMed

    Dekoninck, W; Hendrickx, F; Versteirt, V; Coosemans, M; De Clercq, E M; Hendrickx, G; Hance, T; Grootaert, P

    2013-03-01

    Mosquito (Diptera: Culicidae) distribution data from a recent inventory of native and invading mosquito species in Belgium were compared with historical data from the period 1900-1960 that were retrieved from a revision of the Belgian Culicidae collection at the Royal Belgian Institute of Natural Sciences. Both data sets were used to investigate trends in mosquito species richness in several regions in Belgium. The relative change in distribution area of mosquito species was particularly important for species that use waste waters and used tires as larval habitats and species that recently shifted their larval habitat to artificial larval habitats. More importantly, several of these species are known as vectors of arboviruses and Plasmodium sp. and the apparent habitat shift of some of them brought these species in proximity to humans. Similar studies comparing current mosquito richness with former distribution data retrieved from voucher specimens from collections is therefore encouraged because they can generate important information concerning health risk assessment at both regional and national scale.

  5. Practical somewhat-secure quantum somewhat-homomorphic encryption with coherent states

    NASA Astrophysics Data System (ADS)

    Tan, Si-Hui; Ouyang, Yingkai; Rohde, Peter P.

    2018-04-01

    We present a scheme for implementing homomorphic encryption on coherent states encoded using phase-shift keys. The encryption operations require only rotations in phase space, which commute with computations in the code space performed via passive linear optics, and with generalized nonlinear phase operations that are polynomials of the photon-number operator in the code space. This encoding scheme can thus be applied to any computation with coherent-state inputs, and the computation proceeds via a combination of passive linear optics and generalized nonlinear phase operations. An example of such a computation is matrix multiplication, whereby a vector representing coherent-state amplitudes is multiplied by a matrix representing a linear optics network, yielding a new vector of coherent-state amplitudes. By finding an orthogonal partitioning of the support of our encoded states, we quantify the security of our scheme via the indistinguishability of the encrypted code words. While we focus on coherent-state encodings, we expect that this phase-key encoding technique could apply to any continuous-variable computation scheme where the phase-shift operator commutes with the computation.

  6. Characterization and expression analysis of gene encoding heme peroxidase HPX15 in major Indian malaria vector Anopheles stephensi (Diptera: Culicidae).

    PubMed

    Kajla, Mithilesh; Kakani, Parik; Choudhury, Tania Pal; Gupta, Kuldeep; Gupta, Lalita; Kumar, Sanjeev

    2016-06-01

    The interaction of mosquito immune system with Plasmodium is critical in determining the vector competence. Thus, blocking the crucial mosquito molecules that regulate parasite development might be effective in controlling the disease transmission. In this study, we characterized a full-length AsHPX15 gene from the major Indian malaria vector Anopheles stephensi. This gene is true ortholog of Anopheles gambiae heme peroxidase AgHPX15 (AGAP013327), which modulates midgut immunity and regulates Plasmodium falciparum development. We found that AsHPX15 is highly induced in mosquito developmental stages and blood fed midguts. In addition, this is a lineage-specific gene that has identical features and 65-99% amino acids identity with other HPX15 genes present in eighteen worldwide-distributed anophelines. We discuss that the conserved HPX15 gene might serve as a common target to manipulate mosquito immunity and arresting Plasmodium development inside the vector host. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

    PubMed

    Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

    2014-01-01

    The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

  8. Noise-induced hearing loss and associated factors among vector control workers in a Malaysian state.

    PubMed

    Masilamani, Retneswari; Rasib, Abdul; Darus, Azlan; Ting, Anselm Su

    2014-11-01

    This study aims to determine the prevalence and associated factors of noise-induced hearing loss (NIHL) among vector control workers in the state of Negeri Sembilan, Malaysia. This was an analytical cross-sectional study conducted on 181 vector control workers who were working in district health offices in a state in Malaysia. Data were collected using a self-administered questionnaire and audiometry. Prevalence of NIHL was 26% among this group of workers. NIHL was significantly associated with the age-group of 40 years and older, length of service of 10 or more years, current occupational noise exposure, listening to loud music, history of firearms use, and history of mumps/measles infection. Following logistic regression, age of more than 40 years and noise exposure in current occupation were associated with NIHL with an odds ratio of 3.45 (95% confidence interval = 1.68-7.07) and 6.87 (95% confidence interval = 1.54-30.69), respectively, among this group of vector control workers. © 2012 APJPH.

  9. The nondeterministic divide

    NASA Technical Reports Server (NTRS)

    Charlesworth, Arthur

    1990-01-01

    The nondeterministic divide partitions a vector into two non-empty slices by allowing the point of division to be chosen nondeterministically. Support for high-level divide-and-conquer programming provided by the nondeterministic divide is investigated. A diva algorithm is a recursive divide-and-conquer sequential algorithm on one or more vectors of the same range, whose division point for a new pair of recursive calls is chosen nondeterministically before any computation is performed and whose recursive calls are made immediately after the choice of division point; also, access to vector components is only permitted during activations in which the vector parameters have unit length. The notion of diva algorithm is formulated precisely as a diva call, a restricted call on a sequential procedure. Diva calls are proven to be intimately related to associativity. Numerous applications of diva calls are given and strategies are described for translating a diva call into code for a variety of parallel computers. Thus diva algorithms separate logical correctness concerns from implementation concerns.

  10. Protein Kinase Classification with 2866 Hidden Markov Models and One Support Vector Machine

    NASA Technical Reports Server (NTRS)

    Weber, Ryan; New, Michael H.; Fonda, Mark (Technical Monitor)

    2002-01-01

    The main application considered in this paper is predicting true kinases from randomly permuted kinases that share the same length and amino acid distributions as the true kinases. Numerous methods already exist for this classification task, such as HMMs, motif-matchers, and sequence comparison algorithms. We build on some of these efforts by creating a vector from the output of thousands of structurally based HMMs, created offline with Pfam-A seed alignments using SAM-T99, which then must be combined into an overall classification for the protein. Then we use a Support Vector Machine for classifying this large ensemble Pfam-Vector, with a polynomial and chisquared kernel. In particular, the chi-squared kernel SVM performs better than the HMMs and better than the BLAST pairwise comparisons, when predicting true from false kinases in some respects, but no one algorithm is best for all purposes or in all instances so we consider the particular strengths and weaknesses of each.

  11. Shape Sensing Using a Multi-Core Optical Fiber Having an Arbitrary Initial Shape in the Presence of Extrinsic Forces

    NASA Technical Reports Server (NTRS)

    Rogge, Matthew D. (Inventor); Moore, Jason P. (Inventor)

    2014-01-01

    Shape of a multi-core optical fiber is determined by positioning the fiber in an arbitrary initial shape and measuring strain over the fiber's length using strain sensors. A three-coordinate p-vector is defined for each core as a function of the distance of the corresponding cores from a center point of the fiber and a bending angle of the cores. The method includes calculating, via a controller, an applied strain value of the fiber using the p-vector and the measured strain for each core, and calculating strain due to bending as a function of the measured and the applied strain values. Additionally, an apparent local curvature vector is defined for each core as a function of the calculated strain due to bending. Curvature and bend direction are calculated using the apparent local curvature vector, and fiber shape is determined via the controller using the calculated curvature and bend direction.

  12. Magnetic resonance image compression using scalar-vector quantization

    NASA Astrophysics Data System (ADS)

    Mohsenian, Nader; Shahri, Homayoun

    1995-12-01

    A new coding scheme based on the scalar-vector quantizer (SVQ) is developed for compression of medical images. SVQ is a fixed-rate encoder and its rate-distortion performance is close to that of optimal entropy-constrained scalar quantizers (ECSQs) for memoryless sources. The use of a fixed-rate quantizer is expected to eliminate some of the complexity issues of using variable-length scalar quantizers. When transmission of images over noisy channels is considered, our coding scheme does not suffer from error propagation which is typical of coding schemes which use variable-length codes. For a set of magnetic resonance (MR) images, coding results obtained from SVQ and ECSQ at low bit-rates are indistinguishable. Furthermore, our encoded images are perceptually indistinguishable from the original, when displayed on a monitor. This makes our SVQ based coder an attractive compression scheme for picture archiving and communication systems (PACS), currently under consideration for an all digital radiology environment in hospitals, where reliable transmission, storage, and high fidelity reconstruction of images are desired.

  13. Emerging and Submerging Shorelines: Impacts of Physical Change on Bioband Length

    NASA Astrophysics Data System (ADS)

    Kruger, L. E.; Johnson, A. C.; Gregovich, D.; Buma, B.; Noel, J.

    2017-12-01

    We approximated shifts in coastal benthic species for shoreline length units undergoing both sea level rise and relative sea level lowering (often post-glacial, termed isostatic rebound) where subsistence-based, southeast Alaska Natives reside. From six community centers, we examined 30 km radii shoreline reaches by merging relevant portions of the NOAA ShoreZone database with near shore bathymetry and measures of mean global sea level rise with local global positioning system information (GIS) of tectonic shift and isostatic rebound. For our analysis, we estimated change for 9,868 assessed shoreline length units having uniform substrate and biologic type over a 100-yr time span (2008-2108) using geometric analysis of shoreline attributes. For each shoreline length unit we assessed relationships among substrate, slope, exposure, and presence of five benthic species including eel grass (Zostera marina), blue mussel (Mytilus edulis), butter clams (Saxidomus gigantean), bull kelp (Nereocytis leutkeana), and foliose red algae including ribbon kelp (Palmaria sp.). Our research indicates that both emergence, up to 1.8 m, and submergence, up 0.2 m, of the land will result in disportionately larger shoreline length segment alterations for habitats in protected low-slope gradient bays and estuaries (dominated by eelgrass and butter clam habitats) with less change for rocky steep-gradient exposed penninsulas (red algae and canopy kelp). This trend, holding true regardless of isostatic rebound, tectonic shift or sea level rise rate, highlights the importance of initial geomorphology-based assessments serving to improve bio-physical, chemical, and socially-related coastal research. Where shorelines are emerging 30% decreases in estuary lengths are predicted, but where shorelines are submerging up to 3% increases in estuaries are expected. Our research results are consistent with anthropology studies assessing past coastal change. Coastal change, influencing subsistance foods, salmon rearing areas, ocean acidification rate, and ocean carbon sequestration rate, have relevance to community resilience.

  14. Predicting the host of influenza viruses based on the word vector.

    PubMed

    Xu, Beibei; Tan, Zhiying; Li, Kenli; Jiang, Taijiao; Peng, Yousong

    2017-01-01

    Newly emerging influenza viruses continue to threaten public health. A rapid determination of the host range of newly discovered influenza viruses would assist in early assessment of their risk. Here, we attempted to predict the host of influenza viruses using the Support Vector Machine (SVM) classifier based on the word vector, a new representation and feature extraction method for biological sequences. The results show that the length of the word within the word vector, the sequence type (DNA or protein) and the species from which the sequences were derived for generating the word vector all influence the performance of models in predicting the host of influenza viruses. In nearly all cases, the models built on the surface proteins hemagglutinin (HA) and neuraminidase (NA) (or their genes) produced better results than internal influenza proteins (or their genes). The best performance was achieved when the model was built on the HA gene based on word vectors (words of three-letters long) generated from DNA sequences of the influenza virus. This results in accuracies of 99.7% for avian, 96.9% for human and 90.6% for swine influenza viruses. Compared to the method of sequence homology best-hit searches using the Basic Local Alignment Search Tool (BLAST), the word vector-based models still need further improvements in predicting the host of influenza A viruses.

  15. Parallel processors and nonlinear structural dynamics algorithms and software

    NASA Technical Reports Server (NTRS)

    Belytschko, Ted

    1990-01-01

    Techniques are discussed for the implementation and improvement of vectorization and concurrency in nonlinear explicit structural finite element codes. In explicit integration methods, the computation of the element internal force vector consumes the bulk of the computer time. The program can be efficiently vectorized by subdividing the elements into blocks and executing all computations in vector mode. The structuring of elements into blocks also provides a convenient way to implement concurrency by creating tasks which can be assigned to available processors for evaluation. The techniques were implemented in a 3-D nonlinear program with one-point quadrature shell elements. Concurrency and vectorization were first implemented in a single time step version of the program. Techniques were developed to minimize processor idle time and to select the optimal vector length. A comparison of run times between the program executed in scalar, serial mode and the fully vectorized code executed concurrently using eight processors shows speed-ups of over 25. Conjugate gradient methods for solving nonlinear algebraic equations are also readily adapted to a parallel environment. A new technique for improving convergence properties of conjugate gradients in nonlinear problems is developed in conjunction with other techniques such as diagonal scaling. A significant reduction in the number of iterations required for convergence is shown for a statically loaded rigid bar suspended by three equally spaced springs.

  16. Professor Herman Burger (1893-1965), eminent teacher and scientist, who laid the theoretical foundations of vectorcardiography--and electrocardiography.

    PubMed

    van Herpen, Gerard

    2014-01-01

    Einthoven not only designed a high quality instrument, the string galvanometer, for recording the ECG, he also shaped the conceptual framework to understand it. He reduced the body to an equilateral triangle and the cardiac electric activity to a dipole, represented by an arrow (i.e. a vector) in the triangle's center. Up to the present day the interpretation of the ECG is based on the model of a dipole vector being projected on the various leads. The model is practical but intuitive, not physically founded. Burger analysed the relation between heart vector and leads according to the principles of physics. It then follows that an ECG lead must be treated as a vector (lead vector) and that the lead voltage is not simply proportional to the projection of the vector on the lead, but must be multiplied by the value (length) of the lead vector, the lead strength. Anatomical lead axis and electrical lead axis are different entities and the anatomical body space must be distinguished from electrical space. Appreciation of these underlying physical principles should contribute to a better understanding of the ECG. The development of these principles by Burger is described, together with some personal notes and a sketch of the personality of this pioneer of medical physics. Copyright © 2014. Published by Elsevier Inc.

  17. Using Grid Cells for Navigation

    PubMed Central

    Bush, Daniel; Barry, Caswell; Manson, Daniel; Burgess, Neil

    2015-01-01

    Summary Mammals are able to navigate to hidden goal locations by direct routes that may traverse previously unvisited terrain. Empirical evidence suggests that this “vector navigation” relies on an internal representation of space provided by the hippocampal formation. The periodic spatial firing patterns of grid cells in the hippocampal formation offer a compact combinatorial code for location within large-scale space. Here, we consider the computational problem of how to determine the vector between start and goal locations encoded by the firing of grid cells when this vector may be much longer than the largest grid scale. First, we present an algorithmic solution to the problem, inspired by the Fourier shift theorem. Second, we describe several potential neural network implementations of this solution that combine efficiency of search and biological plausibility. Finally, we discuss the empirical predictions of these implementations and their relationship to the anatomy and electrophysiology of the hippocampal formation. PMID:26247860

  18. Optical vector network analysis of ultranarrow transitions in 166Er3+ : 7LiYF4 crystal.

    PubMed

    Kukharchyk, N; Sholokhov, D; Morozov, O; Korableva, S L; Cole, J H; Kalachev, A A; Bushev, P A

    2018-02-15

    We present optical vector network analysis (OVNA) of an isotopically purified Er166 3+ :LiYF 4 7 crystal. The OVNA method is based on generation and detection of a modulated optical sideband by using a radio-frequency vector network analyzer. This technique is widely used in the field of microwave photonics for the characterization of optical responses of optical devices such as filters and high-Q resonators. However, dense solid-state atomic ensembles induce a large phase shift on one of the optical sidebands that results in the appearance of extra features on the measured transmission response. We present a simple theoretical model that accurately describes the observed spectra and helps to reconstruct the absorption profile of a solid-state atomic ensemble as well as corresponding change of the refractive index in the vicinity of atomic resonances.

  19. Multi-indexed Meixner and little q-Jacobi (Laguerre) polynomials

    NASA Astrophysics Data System (ADS)

    Odake, Satoru; Sasaki, Ryu

    2017-04-01

    As the fourth stage of the project multi-indexed orthogonal polynomials, we present the multi-indexed Meixner and little q-Jacobi (Laguerre) polynomials in the framework of ‘discrete quantum mechanics’ with real shifts defined on the semi-infinite lattice in one dimension. They are obtained, in a similar way to the multi-indexed Laguerre and Jacobi polynomials reported earlier, from the quantum mechanical systems corresponding to the original orthogonal polynomials by multiple application of the discrete analogue of the Darboux transformations or the Crum-Krein-Adler deletion of virtual state vectors. The virtual state vectors are the solutions of the matrix Schrödinger equation on all the lattice points having negative energies and infinite norm. This is in good contrast to the (q-)Racah systems defined on a finite lattice, in which the ‘virtual state’ vectors satisfy the matrix Schrödinger equation except for one of the two boundary points.

  20. Polarization masks: concept and initial assessment

    NASA Astrophysics Data System (ADS)

    Lam, Michael; Neureuther, Andrew R.

    2002-07-01

    Polarization from photomasks can be used as a new lever to improve lithographic performance in both binary and phase-shifting masks (PSMs). While PSMs manipulate the phase of light to control the temporal addition of electric field vectors, polarization masks manipulate the vector direction of electric field vectors to control the spatial addition of electric field components. This paper explores the theoretical possibilities of polarization masks, showing that it is possible to use bar structures within openings on the mask itself to polarize incident radiation. Rigorous electromagnetic scattering simulations using TEMPEST and imaging with SPLAT are used to give an initial assessment on the functionality of polarization masks, discussing the polarization quality and throughputs achieved with the masks. Openings between 1/8 and 1/3 of a wavelength provide both a low polarization ratio and good transmission. A final overall throughput of 33% - 40% is achievable, corresponding to a dose hit of 2.5x - 3x.

  1. Influence of nanotube length and density on the plasmonic terahertz response of single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Karlsen, P.; Shuba, M. V.; Beckerleg, C.; Yuko, D. I.; Kuzhir, P. P.; Maksimenko, S. A.; Ksenevich, V.; Viet, Ho; Nasibulin, A. G.; Tenne, R.; Hendry, E.

    2018-01-01

    We measure the conductivity spectra of thin films comprising bundled single-walled carbon nanotubes (CNTs) of different average lengths in the frequency range 0.3-1000 THz and temperature interval 10-530 K. The observed temperature-induced changes in the terahertz conductivity spectra are shown to depend strongly on the average CNT length, with a conductivity around 1 THz that increases/decreases as the temperature increases for short/long tubes. This behaviour originates from the temperature dependence of the electron scattering rate, which we obtain from Drude fits of the measured conductivity in the range 0.3-2 THz for 10 μm length CNTs. This increasing scattering rate with temperature results in a subsequent broadening of the observed THz conductivity peak at higher temperatures and a shift to lower frequencies for increasing CNT length. Finally, we show that the change in conductivity with temperature depends not only on tube length, but also varies with tube density. We record the effective conductivities of composite films comprising mixtures of WS2 nanotubes and CNTs versus CNT density for frequencies in the range 0.3-1 THz, finding that the conductivity increases/decreases for low/high density films as the temperature increases. This effect arises due to the density dependence of the effective length of conducting pathways in the composite films, which again leads to a shift and temperature dependent broadening of the THz conductivity peak.

  2. Length limits fail to restructure a Largemouth Bass population: A 28‐year case history

    USGS Publications Warehouse

    Miranda, Leandro E.; Colvin, M.E.; Shamaskin, A. C.; Bull, L. A.; Holman, T.; Jones, R.

    2017-01-01

    Length limits have been implemented by fisheries management agencies to achieve population density, size structure, and angler satisfaction objectives. By redirecting harvest towards or away from particular length‐ or age‐groups, length limits rely on harvest by anglers to maintain a population at or near a desired state. The fish population changes that follow the implementation of harvest regulations may take several years to manifest, so long‐term monitoring may be needed to adequately evaluate length limits. We used an innovative application of cluster analysis to facilitate evaluation of the effects of three consecutive length limits on a population of Largemouth Bass Micropterus salmoides over a 28‐year period in Ross Barnett Reservoir, Mississippi. A 13–16‐in protected slot length limit (10 years), followed by a 15‐in minimum length limit (MLL; 11 years), followed by a 12‐in MLL (7 years) failed to restructure the Largemouth Bass population due to what we suggest was the expansion of a voluntary catch‐and‐release attitude that started in the first decade of the study period. Various population metrics shifted towards values expected in an unharvested population, and the observed shifts can be attributed to a harvest deficit created by the prevailing catch‐and‐release attitude. Largemouth Bass harvest regulations may no longer be relevant in many waters. The utility of regulations for restructuring Largemouth Bass populations is largely dependent on harvesting attitudes that vary geographically, depending on cultural characteristics and demographics.

  3. Static internal performance of a two-dimensional convergent-divergent nozzle with thrust vectoring

    NASA Technical Reports Server (NTRS)

    Bare, E. Ann; Reubush, David E.

    1987-01-01

    A parametric investigation of the static internal performance of multifunction two-dimensional convergent-divergent nozzles has been made in the static test facility of the Langley 16-Foot Transonic Tunnel. All nozzles had a constant throat area and aspect ratio. The effects of upper and lower flap angles, divergent flap length, throat approach angle, sidewall containment, and throat geometry were determined. All nozzles were tested at a thrust vector angle that varied from 5.60 tp 23.00 deg. The nozzle pressure ratio was varied up to 10 for all configurations.

  4. Effects of infectious virus dose and bloodmeal delivery method on susceptibility of Aedes aegypti and Aedes albopictus to chikungunya virus.

    PubMed

    Pesko, Kendra; Westbrook, Catherine J; Mores, Christopher N; Lounibos, L Philip; Reiskind, Michael H

    2009-03-01

    Chikungunya virus (CHIKV) is an arbovirus (genus Alphavirus, family Togaviridae) that has recently caused disease outbreaks in the Indian Ocean basin and southern Europe. These outbreaks could be associated with a possible shift in primary vector from Aedes aegypti to Ae. albopictus. To evaluate vector competence differences in possible CHIKV vectors, we evaluated the dose-dependant susceptibility of Florida strains of Ae. albopictus and Ae. aegypti for infection with a La Réunion island strain of CHIKV. Pledget and water-jacketed membrane feeding systems were also evaluated. We show that both Aedes spp. were susceptible to the highest CHIKV doses, whereas only Ae. albopictus developed disseminated infections after exposure to the two lowest doses. Infection rates for both mosquito species were significantly affected by the bloodmeal delivery method used. This information is important in assessing risk of an outbreak of imported CHIKV in the United States, in determining differences in vectorial capacity of these two vector species, and in evaluating arbovirus delivery methods in the laboratory.

  5. Effects of Infectious Virus Dose and Bloodmeal Delivery Method on Susceptibility of Aedes aegypti and Aedes albopictus to Chikungunya Virus

    PubMed Central

    Pesko, Kendra; Westbrook, Catherine J.; Mores, Christopher N.; Lounibos, L. Philip; Reiskind, Michael H.

    2009-01-01

    Chikungunya virus (CHIKV) is an arbovirus (genus Alphavirus, family Togaviridae) that has recently caused disease outbreaks in the Indian Ocean basin and southern Europe. These outbreaks could be associated with a possible shift in primary vector from Aedes aegypti to Ae. albopictus. To evaluate vector competence differences in possible CHIKV vectors, we evaluated the dose-dependant susceptibility of Florida strains of Ae. albopictus and Ae. aegypti for infection with a La Réunion island strain of CHIKV. Pledget and water-jacketed membrane feeding systems were also evaluated. We show that both Aedes spp. were susceptible to the highest CHIKV doses, whereas only Ae. albopictus developed disseminated infections after exposure to the two lowest doses. Infection rates for both mosquito species were significantly affected by the bloodmeal delivery method used. This information is important in assessing risk of an outbreak of imported CHIKV in the United States, in determining differences in vectorial capacity of these two vector species, and in evaluating arbovirus delivery methods in the laboratory. PMID:19351094

  6. Lentiviral Vector Induced Insertional Haploinsufficiency of Ebf1 Causes Murine Leukemia

    PubMed Central

    Heckl, Dirk; Schwarzer, Adrian; Haemmerle, Reinhard; Steinemann, Doris; Rudolph, Cornelia; Skawran, Britta; Knoess, Sabine; Krause, Johanna; Li, Zhixiong; Schlegelberger, Brigitte; Baum, Christopher; Modlich, Ute

    2012-01-01

    Integrating vectors developed on the basis of various retroviruses have demonstrated therapeutic potential following genetic modification of long-lived hematopoietic stem and progenitor cells. Lentiviral vectors (LV) are assumed to circumvent genotoxic events previously observed with γ-retroviral vectors, due to their integration bias to transcription units in comparison to the γ-retroviral preference for promoter regions and CpG islands. However, recently several studies have revealed the potential for gene activation by LV insertions. Here, we report a murine acute B-lymphoblastic leukemia (B-ALL) triggered by insertional gene inactivation. LV integration occurred into the 8th intron of Ebf1, a major regulator of B-lymphopoiesis. Various aberrant splice variants could be detected that involved splice donor and acceptor sites of the lentiviral construct, inducing downregulation of Ebf1 full-length message. The transcriptome signature was compatible with loss of this major determinant of B-cell differentiation, with partial acquisition of myeloid markers, including Csf1r (macrophage colony-stimulating factor (M-CSF) receptor). This was accompanied by receptor phosphorylation and STAT5 activation, both most likely contributing to leukemic progression. Our results highlight the risk of intragenic vector integration to initiate leukemia by inducing haploinsufficiency of a tumor suppressor gene. We propose to address this risk in future vector design. PMID:22472950

  7. Adenoviral vectors elicit humoral immunity against variable loop 2 of clade C HIV-1 gp120 via "Antigen Capsid-Incorporation" strategy.

    PubMed

    Gu, Linlin; Krendelchtchikova, Valentina; Krendelchtchikov, Alexandre; Farrow, Anitra L; Derdeyn, Cynthia A; Matthews, Qiana L

    2016-01-01

    Adenoviral (Ad) vectors in combination with the "Antigen Capsid-Incorporation" strategy have been applied in developing HIV-1 vaccines, due to the vectors׳ abilities in incorporating and inducing immunity of capsid-incorporated antigens. Variable loop 2 (V2)-specific antibodies were suggested in the RV144 trial to correlate with reduced HIV-1 acquisition, which highlights the importance of developing novel HIV-1 vaccines by targeting the V2 loop. Therefore, the V2 loop of HIV-1 has been incorporated into the Ad capsid protein. We generated adenovirus serotype 5 (Ad5) vectors displaying variable loop 2 (V2) of HIV-1 gp120, with the "Antigen Capsid-Incorporation" strategy. To assess the incorporation capabilities on hexon hypervariable region1 (HVR1) and protein IX (pIX), 20aa or full length (43aa) of V2 and V1V2 (67aa) were incorporated, respectively. Immunizations with the recombinant vectors significantly generated antibodies against both linear and discontinuous V2 epitopes. The immunizations generated durable humoral immunity against V2. This study will lead to more stringent development of various serotypes of adenovirus-vectored V2 vaccine candidates, based on breakthroughs regarding the immunogenicity of V2. Copyright © 2015. Published by Elsevier Inc.

  8. [Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

    PubMed

    Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

    2009-04-01

    This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

  9. A Computational Study of a New Dual Throat Fluidic Thrust Vectoring Nozzle Concept

    NASA Technical Reports Server (NTRS)

    Deere, Karen A.; Berrier, Bobby L.; Flamm, Jeffrey D.; Johnson, Stuart K.

    2005-01-01

    A computational investigation of a two-dimensional nozzle was completed to assess the use of fluidic injection to manipulate flow separation and cause thrust vectoring of the primary jet thrust. The nozzle was designed with a recessed cavity to enhance the throat shifting method of fluidic thrust vectoring. Several design cycles with the structured-grid, computational fluid dynamics code PAB3D and with experiments in the NASA Langley Research Center Jet Exit Test Facility have been completed to guide the nozzle design and analyze performance. This paper presents computational results on potential design improvements for best experimental configuration tested to date. Nozzle design variables included cavity divergence angle, cavity convergence angle and upstream throat height. Pulsed fluidic injection was also investigated for its ability to decrease mass flow requirements. Internal nozzle performance (wind-off conditions) and thrust vector angles were computed for several configurations over a range of nozzle pressure ratios from 2 to 7, with the fluidic injection flow rate equal to 3 percent of the primary flow rate. Computational results indicate that increasing cavity divergence angle beyond 10 is detrimental to thrust vectoring efficiency, while increasing cavity convergence angle from 20 to 30 improves thrust vectoring efficiency at nozzle pressure ratios greater than 2, albeit at the expense of discharge coefficient. Pulsed injection was no more efficient than steady injection for the Dual Throat Nozzle concept.

  10. Vector control in developed countries

    PubMed Central

    Peters, Richard F.

    1963-01-01

    The recent rapid growth of California's population, leading to competition for space between residential, industrial and agricultural interests, the development of its water resources and increasing water pollution provide the basic ingredients of its present vector problems. Within the past half-century, the original mosquito habitats provided by nature have gradually given place to even more numerous and productive habitats of man-made character. At the same time, emphasis in mosquito control has shifted from physical to chemical, with the more recent extension to biological approaches as well. The growing domestic fly problem, continuing despite the virtual disappearance of the horse, is attributable to an increasing amount of organic by-products, stemming from growing communities, expanding industries and changing agriculture. The programme for the control of disease vectors and pest insects and animals directs its major effort to the following broad areas: (1) water management (including land preparation), (2) solid organic wastes management (emphasizing utilization), (3) community management (including design, layout, and storage practices of buildings and grounds), and (4) recreational area management (related to wildlife management). It is apparent that vector control can often employ economics as an ally in securing its objectives. Effective organization of the environment to produce maximum economic benefits to industry, agriculture, and the community results generally in conditions unfavourable to the survival of vector and noxious animal species. Hence, vector prevention or suppression is preferable to control as a programme objective. PMID:20604166

  11. UltraPse: A Universal and Extensible Software Platform for Representing Biological Sequences.

    PubMed

    Du, Pu-Feng; Zhao, Wei; Miao, Yang-Yang; Wei, Le-Yi; Wang, Likun

    2017-11-14

    With the avalanche of biological sequences in public databases, one of the most challenging problems in computational biology is to predict their biological functions and cellular attributes. Most of the existing prediction algorithms can only handle fixed-length numerical vectors. Therefore, it is important to be able to represent biological sequences with various lengths using fixed-length numerical vectors. Although several algorithms, as well as software implementations, have been developed to address this problem, these existing programs can only provide a fixed number of representation modes. Every time a new sequence representation mode is developed, a new program will be needed. In this paper, we propose the UltraPse as a universal software platform for this problem. The function of the UltraPse is not only to generate various existing sequence representation modes, but also to simplify all future programming works in developing novel representation modes. The extensibility of UltraPse is particularly enhanced. It allows the users to define their own representation mode, their own physicochemical properties, or even their own types of biological sequences. Moreover, UltraPse is also the fastest software of its kind. The source code package, as well as the executables for both Linux and Windows platforms, can be downloaded from the GitHub repository.

  12. Correlation between solar flare productivity and photospheric vector magnetic fields

    NASA Astrophysics Data System (ADS)

    Cui, Yanmei; Wang, Huaning

    2008-11-01

    Studying the statistical correlation between the solar flare productivity and photospheric magnetic fields is very important and necessary. It is helpful to set up a practical flare forecast model based on magnetic properties and improve the physical understanding of solar flare eruptions. In the previous study ([Cui, Y.M., Li, R., Zhang, L.Y., He, Y.L., Wang, H.N. Correlation between solar flare productivity and photospheric magnetic field properties 1. Maximum horizontal gradient, length of neutral line, number of singular points. Sol. Phys. 237, 45 59, 2006]; from now on we refer to this paper as ‘Paper I’), three measures of the maximum horizontal gradient, the length of the neutral line, and the number of singular points are computed from 23990 SOHO/MDI longitudinal magnetograms. The statistical relationship between the solar flare productivity and these three measures is well fitted with sigmoid functions. In the current work, the three measures of the length of strong-shear neutral line, total unsigned current, and total unsigned current helicity are computed from 1353 vector magnetograms observed at Huairou Solar Observing Station. The relationship between the solar flare productivity and the current three measures can also be well fitted with sigmoid functions. These results are expected to be beneficial to future operational flare forecasting models.

  13. Pilot study evaluating the effects of a cervical headgear on the C-axis: the growth axis of the dentomaxillary complex.

    PubMed

    Braun, Stanley; Bottrel, J Alexandre

    2004-12-01

    The C-axis, a growth vector for the dentomaxillary complex, is a means of quantifying complex maxillary growth in the sagittal plane through 3 key cephalometric measurements. This pilot study examined the effect of a cervical headgear, worn 8 to 10 hours per day, on the growth axis. The mean velocity of C-axis length increase in normally growing boys in the age range studied is 1.14 mm per year. In normally growing girls, the C-axis length increase is nonlinear, varying from a mean of 1.67 mm per year at age 9 and to 0.78 mm per year at 13.5 years of age. The cervical headgear reduced the C-axis length increases by 73.7% in boys and 61.1% in girls. The growth axis vector angle theta; was not clinically affected in either sex, but the palatal plane angle alpha became more acute in both sexes, rather than becoming more obtuse as it does in normally growing adolescents. Additional research should be undertaken to determine the effects on the C-axis by other cervical headgears having different lines of action relative to the center of resistance of the dentomaxillary complex, as well as occipital-pull and straight distal-pull headgear.

  14. The effect of seat position on manual wheelchair propulsion biomechanics: a quasi-static model-based approach.

    PubMed

    Richter, W M

    2001-12-01

    The position of the seat relative to the rear wheels is generally adjusted to modify the rearward stability of the wheelchair. Recent studies have shown that seat position also has an effect on propulsion biomechanics and suggest that seat position can be optimized. A quasi-static wheelchair propulsion model was developed to investigate the mechanism by which seat position affects propulsion biomechanics. Inputs to the model include the length of the user's arm segments, the position of the user's shoulder, the size of handrim used and the force profile on the handrim. Outputs from the model include joint kinematics, joint torques, push angle, and push frequency. Handrim force profile was determined by averaging the force profile of five wheelchair users. Force profiles were measured using the SMARTWheel. The effect of seat position on push angle was found to be directly affected by the length of the position vector from the hub of the wheel to the shoulder and indirectly affected by the angular orientation of the vector. Decreasing hub to shoulder length was found to increase push angle, decrease push frequency, decrease shoulder torque and increase elbow extension torque. It is suggested that future research investigating the role of seat position on propulsion biomechanics include both the kinematics and kinetics of the upper extremity.

  15. Absence from work in relation to length and distribution of shift hours

    PubMed Central

    Walker, J.; Mare, Gwynneth de la

    1971-01-01

    Walker, J., and de la Mare, Gwynneth (1971). Brit. J. industr. Med., 28, 36-44. Absence from work in relation to length and distribution of shift hours. A long period on night shift or even permanent night work has sometimes been suggested for those on continuous shift work to allow circadian rhythms to adapt. As the weekly hours of work have been reduced there is some evidence that a permanent night shift is practical, and about 12% of all shift workers are on this type of work. However, the case for permanent night shift must be established on grounds of both effectiveness and acceptability. The present study compares the absence experience, including sickness absence, of permanent day workers and permanent night workers matched for age and job in three undertakings which contained a range of working conditions. The question of the relationship between absence from work and total hours worked including overtime has been reopened, and in comparing absence from work according to the type of shift the total hours worked must also be taken into account. The relationship between the average hours when a man was at work and the amount of absence was tested. The men in the three undertakings worked a wide range of voluntary overtime. The results showed that in two undertakings long-term absence, mainly sickness absence, was higher on the night shift than on the day shift; and, in the third, absence was about the same on the two shifts. As the work load was less in the two undertakings with a higher absence on the night shift it was suggested that selective factors were operating. These results may be contrasted to studies which have compared the absence of rotating shift workers and day workers. In all three undertakings there was a tendency for absence to be less among high overtime workers than among those who worked medium or small amounts of overtime, although the trends were not consistent. There was no evidence at all that high overtime and absence from work were positively associated. The implications of these results are discussed. PMID:5101167

  16. Do closed-system hospitals shift care under case payment? Early experiences comparing five surgeries in Taiwan.

    PubMed

    Wen, Yu-Ping; Wen, Shiow-Ying

    2008-01-01

    Recently, Japan, Korea, and Taiwan have adopted prospective payment systems (PPS) for healthcare. Experiences of the United States Medicare show that PPS reduces length of stay but creates incentives to shift care from regulated to un-regulated settings. In this study we investigated whether closed-system hospitals in Taiwan responded to case payment (CP) - one type of PPS, and if so, how this was managed. Data were derived from three Taiwanese hospitals for five different surgical procedures (N = 22,327). The study period covered from October 1996 through August 1999, with CP commencing on October 1, 1997. Important dependent variables included inpatient medical claims, outpatient medical claims, and number of outpatient visits. Outpatient utilization from the period four weeks prior to admission and four weeks following discharge were merged for each patient. Ordinary Least Square (OLS) and Poisson regression were used to test the study's shifting hypotheses, controlling for gender, age, patient diagnoses, and institution attended. Length of hospital stay, amount of inpatient claims, and inpatient x-ray and lab-test claims were significantly reduced after CP. Corresponding OLS coefficients for the second year of implementation were, respectively, -.86, -.06, -.15, and -.04 (p < 0.01). Significant forward shifting of outpatient care, (79%), was found during the second year of CP. Despite the care-shifting effects noted herein, the average per-capita total claims reduced by 12%. Significant institutional effects were associated with the pattern of care-shifting. Our results indicate that CP reduced total claims for the selected surgical procedures, even under evident forward care-shifting.

  17. Rotating shift work and menstrual characteristics in a cohort of Chinese nurses.

    PubMed

    Wang, Yizi; Gu, Fang; Deng, Mingfen; Guo, Lan; Lu, Ciyong; Zhou, Canquan; Chen, Shouzhen; Xu, Yanwen

    2016-05-04

    Shift work disrupts the circadian rhythm and may cause menstruation disorders. This study assessed the impact of shift work on menstrual cycle in a population of Chinese nurses. Questionnaires on menstrual characteristics and shift schedules were sent to female nurses of the First Affiliated Hospital of Sun Yat-sen University (FAHSYSU) and Guanghua Hospital of Stomatology (GHHS), affiliated to Sun Yat-sen University. Part I was a cross-sectional study and included 139 nurses in GHHS who had regular 8:00-17:30 working (non-shift group), and 334 nurses from FAHSYSU who worked shifts, a response rate of 67.5 % and 59.6 %, respectively (age ≤ 50 years). Menstrual patterns were compared and age-adjusted relative risks of shift work were analyzed. Part II was a nested case-control study. Cases were nurses in Part I who had regular cycle with mean cycle length (MCL) of 25-31 days and but at least 3 days variation in MCL after starting shift work (n = 45). Controls consisted of 67 nurses with matching shift patterns and age, but no MCL changes. A control non-shift age-matched group consisted of 30 GHHS nurses with no MCL changes. A follow-up second questionnaire was sent 2 years later. In Part I, the shift group had a significantly higher proportion of nurses with menstrual cycle irregularity. The proportion of nurses with a cycle of 25-31 days decreased from 81.7 to 67.8 % after changing to shift work. Logistic regression analysis showed that night shift frequency was the only risk factor associated with cycle shortening. After adjusting for age, MCL was shorter when night work was performed > 7 times per month. In Part II, the mean change in MCL in the case group, including prolongation or shortening, was 4.115 ± 2.084 days after shift working. In the 2 years' follow-up, the MCL of the study group did not recover to the original length. Rotating shift work can increase the prevalence of menstrual cycle irregularity. Night shift frequency was the only risk factor associated with cycle reduced. Changes in MCL did not show recovery over a follow-up period of 2 years.

  18. A method for generating double-ring-shaped vector beams

    NASA Astrophysics Data System (ADS)

    Huan, Chen; Xiao-Hui, Ling; Zhi-Hong, Chen; Qian-Guang, Li; Hao, Lv; Hua-Qing, Yu; Xu-Nong, Yi

    2016-07-01

    We propose a method for generating double-ring-shaped vector beams. A step phase introduced by a spatial light modulator (SLM) first makes the incident laser beam have a nodal cycle. This phase is dynamic in nature because it depends on the optical length. Then a Pancharatnam-Berry phase (PBP) optical element is used to manipulate the local polarization of the optical field by modulating the geometric phase. The experimental results show that this scheme can effectively create double-ring-shaped vector beams. It provides much greater flexibility to manipulate the phase and polarization by simultaneously modulating the dynamic and the geometric phases. Project supported by the National Natural Science Foundation of China (Grant No. 11547017), the Hubei Engineering University Research Foundation, China (Grant No. z2014001), and the Natural Science Foundation of Hubei Province, China (Grant No. 2014CFB578).

  19. Achievement of needle-like focus by engineering radial-variant vector fields.

    PubMed

    Gu, Bing; Wu, Jia-Lu; Pan, Yang; Cui, Yiping

    2013-12-16

    We present and demonstrate a novel method for engineering the radial-variant polarization on the incident field to achieve a needle of transversally polarized field without any pupil filters. We generate a new kind of localized linearly-polarized vector fields with distributions of states of polarization (SoPs) describing by the radius to the power p and explore its tight focusing, nonparaxial focusing, and paraxial focusing properties. By tuning the power p, we obtain the needle-like focal field with hybrid SoPs and give the formula for describing the length of the needle. Experimentally, we systematically investigate both the intensity distributions and the polarization evolution of the optical needle by paraxial focusing the generated vector field. Such an optical needle, which enhances the light-matter interaction, has intriguing applications in optical microma-chining and nonlinear optics.

  20. Effects of experimental leg length discrepancies on body posture and dental occlusion.

    PubMed

    Maeda, Nozomi; Sakaguchi, Kiwamu; Mehta, Noshir R; Abdallah, Emad F; Forgione, Albert G; Yokoyama, Atsuro

    2011-07-01

    The purpose of this study was to quantitatively evaluate the effects of experimental leg length discrepancies on body posture and dental occlusion. Thirty asymptomatic subjects (15 males and 15 females, ages 19-33, mean age 25.6 years) were included in this study and randomly assigned to one of two groups based on a table of random numbers. The only difference between group A and group B was the sequence of testing. Experimental leg length discrepancies were provided by using ten types of insoles with heights ranging from one to ten mm at one mm intervals, placed under both feet. The MatScan (Nitta Corp., Osaka, Japan) system was used to measure changes in body posture (center of foot pressure: COP) while subjects maintained the following three postural positions: 1. natural standing posture (control); 2. control with a heel lift under the right foot; or 3. control with a heel lift under the left foot. The T-Scan II system (Nitta Corp., Osaka, Japan) was used to analyze the results of changes in dental occlusion (center of occlusal force: COF) in the above-mentioned three postural positions. When subjects used a heel lift of six mm or more under the right foot, lateral weight distribution (LWD) shifted to the right side compared to the control (p<0.05). When a heel lift of four mm or more was used under the left foot, LWD shifted to the left side compared to the control (p<0.05). When subjects used a heel lift of eight mm or more under the right foot, occlusal force shifted to the right side compared to the control (p<0.05). When subjects used a heel lift of seven mm or more under the left foot, occlusal force shifted to the left side compared to the control (p<0.05). Based on these findings, it was concluded that leg length discrepancy affected body posture and dental occlusion.

  1. Cre-lox Univector acceptor vectors for functional screening in protoplasts: analysis of Arabidopsis donor cDNAs encoding ABSCISIC ACID INSENSITIVE1-Like protein phosphatases

    PubMed Central

    Jia, Fan; Gampala, Srinivas S.L.; Mittal, Amandeep; Luo, Qingjun; Rock, Christopher D.

    2009-01-01

    The 14,200 available full length Arabidopsis thaliana cDNAs in the Universal Plasmid System (UPS) donor vector pUNI51 should be applied broadly and efficiently to leverage a “functional map-space” of homologous plant genes. We have engineered Cre-lox UPS host acceptor vectors (pCR701- 705) with N-terminal epitope tags in frame with the loxH site and downstream from the maize Ubiquitin promoter for use in transient protoplast expression assays and particle bombardment transformation of monocots. As an example of the utility of these vectors, we recombined them with several Arabidopsis cDNAs encoding Ser/Thr protein phosphatase type 2C (PP2Cs) known from genetic studies or predicted by hierarchical clustering meta-analysis to be involved in ABA and stress responses. Our functional results in Zea mays mesophyll protoplasts on ABA-inducible expression effects on the Late Embryogenesis Abundant promoter ProEm:GUS reporter were consistent with predictions and resulted in identification of novel activities of some PP2Cs. Deployment of these vectors can facilitate functional genomics and proteomics and identification of novel gene activities. PMID:19499346

  2. Mucosal vaccination by adenoviruses displaying reovirus sigma 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weaver, Eric A.; Camacho, Zenaido T.; Hillestad, Matthew L.

    We developed adenovirus serotype 5 (Ad5) vectors displaying the sigma 1 protein from reovirus as mucosal vaccines. Ad5-sigma retargets to JAM-1 and sialic acid, but has 40-fold reduced gene delivery when compared to Ad5. While weaker at transduction, Ad5-sigma generates stronger T cell responses than Ad5 when used for mucosal immunization. In this work, new Ad5-fiber-sigma vectors were generated by varying the number of fiber β-spiral shaft repeats (R) between the fiber tail and sigma. Increasing chimera length led to decreasing insertion of these proteinsAd5 virions. Ad-R3 and R14 vectors effectively targeted JAM-1 in vitro while R20 did not. Whenmore » wereused to immunize mice by the intranasal route, Ad5-R3-sigma produced higher serum and vaginal antibody responses than Ad5. These data suggest optimized Ad-sigma vectors may be useful vectors for mucosal vaccination. - Highlights: • Constructed adenoviruses (Ads) displaying different reovirus sigma 1 fusion proteins. • Progressively longer chimeras were more poorly encapsidated onto Ad virions. • Ad5-R3-sigma mediated better systemic and mucosal immune responses than Ad5.« less

  3. Aztec user`s guide. Version 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hutchinson, S.A.; Shadid, J.N.; Tuminaro, R.S.

    1995-10-01

    Aztec is an iterative library that greatly simplifies the parallelization process when solving the linear systems of equations Ax = b where A is a user supplied n x n sparse matrix, b is a user supplied vector of length n and x is a vector of length n to be computed. Aztec is intended as a software tool for users who want to avoid cumbersome parallel programming details but who have large sparse linear systems which require an efficiently utilized parallel processing system. A collection of data transformation tools are provided that allow for easy creation of distributed sparsemore » unstructured matrices for parallel solution. Once the distributed matrix is created, computation can be performed on any of the parallel machines running Aztec: nCUBE 2, IBM SP2 and Intel Paragon, MPI platforms as well as standard serial and vector platforms. Aztec includes a number of Krylov iterative methods such as conjugate gradient (CG), generalized minimum residual (GMRES) and stabilized biconjugate gradient (BICGSTAB) to solve systems of equations. These Krylov methods are used in conjunction with various preconditioners such as polynomial or domain decomposition methods using LU or incomplete LU factorizations within subdomains. Although the matrix A can be general, the package has been designed for matrices arising from the approximation of partial differential equations (PDEs). In particular, the Aztec package is oriented toward systems arising from PDE applications.« less

  4. Ceramic components manufacturing by selective laser sintering

    NASA Astrophysics Data System (ADS)

    Bertrand, Ph.; Bayle, F.; Combe, C.; Goeuriot, P.; Smurov, I.

    2007-12-01

    In the present paper, technology of selective laser sintering/melting is applied to manufacture net shaped objects from pure yttria-zirconia powders. Experiments are carried out on Phenix Systems PM100 machine with 50 W fibre laser. Powder is spread by a roller over the surface of 100 mm diameter alumina cylinder. Design of experiments is applied to identify influent process parameters (powder characteristics, powder layering and laser manufacturing strategy) to obtain high-quality ceramic components (density and micro-structure). The influence of the yttria-zirconia particle size and morphology onto powder layering process is analysed. The influence of the powder layer thickness on laser sintering/melting is studied for different laser beam velocity V ( V = 1250-2000 mm/s), defocalisation (-6 to 12 mm), distance between two neighbour melted lines (so-called "vectors") (20-40 μm), vector length and temperature in the furnace. The powder bed density before laser sintering/melting also has significant influence on the manufactured samples density. Different manufacturing strategies are applied and compared: (a) different laser beam scanning paths to fill the sliced surfaces of the manufactured object, (b) variation of vector length (c) different strategies of powder layering, (d) temperature in the furnace and (e) post heat treatment in conventional furnace. Performance and limitations of different strategies are analysed applying the following criteria: geometrical accuracy of the manufactured samples, porosity. The process stability is proved by fabrication of 1 cm 3 volume cube.

  5. A theoretical perspective of the nature of hydrogen-bond types - the atoms in molecules approach

    NASA Astrophysics Data System (ADS)

    Vijaya Pandiyan, B.; Kolandaivel, P.; Deepa, P.

    2014-06-01

    Hydrogen bonds and their strength were analysed based on their X-H proton-donor bond properties and the parameters of the H-Y distance (Y proton acceptor). Strong, moderate and weak interactions in hydrogen-bond types were verified through the proton affinities of bases (PA), deprotanation enthalpies of acids (DPE) and the chemical shift (σ). The aromaticity and anti-aromaticity were analysed by means of the NICS (0) (nucleus-independent chemical shift), NICS (1) and ΔNICS (0), ΔNICS (1) of hydrogen-bonded molecules. The strength of a hydrogen bond depends on the capacity of hydrogen atom engrossing into the electronegative acceptor atom. The correlation between the above parameters and their relations were discussed through curve fitting. Bader's theory of atoms in molecules has been applied to estimate the occurrence of hydrogen bonds through eight criteria reported by Popelier et al. The lengths and potential energy shifts have been found to have a strong negative linear correlation, whereas the lengths and Laplacian shifts have a strong positive linear correlation. This study illustrates the common factors responsible for strong, moderate and weak interactions in hydrogen-bond types.

  6. Mode conversion in metal-insulator-metal waveguide with a shifted cavity

    NASA Astrophysics Data System (ADS)

    Wang, Yueke; Yan, Xin

    2018-01-01

    We propose a method, which is utilized to achieve the plasmonic mode conversion in metal-insulator-metal (MIM) waveguide, theoretically. Our proposed structure is composed of bus waveguides and a shifted cavity. The shifted cavity can choose out a plasmonic mode (a- or s-mode) when it is in Fabry-Perot (FP) resonance. The length of the shifted cavity L is carefully chosen, and our structure can achieve the mode conversion between a- and s-mode in the communication region. Besides, our proposed structure can also achieve plasmonic mode-division multiplexing. All the numerical simulations are carried on by the finite element method to verify our design.

  7. Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

    PubMed Central

    Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

    2010-01-01

    Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

  8. Noninvasive evaluation of contractile behavior of cardiomyocyte monolayers based on motion vector analysis.

    PubMed

    Hayakawa, Tomohiro; Kunihiro, Takeshi; Dowaki, Suguru; Uno, Hatsume; Matsui, Eriko; Uchida, Masashi; Kobayashi, Seiji; Yasuda, Akio; Shimizu, Tatsuya; Okano, Teruo

    2012-01-01

    A noninvasive method for the characterization of cardiomyocyte contractile behavior is presented. Light microscopic video images of cardiomyocytes were captured with a high-speed camera, and motion vectors (which have a velocity dimension) were calculated with a high spatiotemporal resolution using a block-matching algorithm. This method could extract contraction and relaxation motions of cardiomyocytes separately and evaluate characteristics such as the beating rate, orientation of contraction, beating cooperativity/homogeneity in the monolayer, and wave propagation of impulses. Simultaneous phase-contrast imaging and calcium (Ca2+) fluorescence measurements confirmed that the timing of the maximum shortening velocity of cardiomyocytes correlated well with intracellular Ca2+ transients. Based on our analysis, gap junction inhibitors, 1-heptanol (2 mM) or 18-β-glycyrrhetinic acid (30 μM), resulted in clear changes in beating cooperativity and the propagation pattern of impulses in the cardiomyocyte monolayer. Additionally, the time dependence of the motion vector length indicated a prolonged relaxation process in the presence of potassium (K+) channel blockers, dl-sotalol (1 μM), E-4031 (100 nM), or terfenadine (100 nM), reflecting the prolonged QT (Q wave and T wave) interval of cardiomyocytes. Effects of autonomic agents (acetylcholine or epinephrine [EPI]) or EPI and propranolol on cardiomyocytes were clearly detected by the alterations of beating rate and the motion vector length in contraction and relaxation processes. This method was noninvasive and could sensitively evaluate the contractile behavior of cardiomyocytes; therefore, it may be used to study and/or monitor cardiomyocyte tissue during prolonged culture periods and in screens for drugs that may alter the contraction of cardiomyocytes.

  9. Putting Community College Enrollment Trends in Perspective by the Use of Census Data and Market Measurement Techniques

    ERIC Educational Resources Information Center

    Boughan, Karl; Robinson, Ophelia

    2003-01-01

    Over the decade of the 1990s, the student body of Prince George's Community College underwent dramatic shifts in its demographic makeup, as did the school's service area. This paper illustrates the importance, especially in these circumstances, of systematically comparing college enrollment trends with the demographic vectors of the surrounding…

  10. High capacity reversible watermarking for audio by histogram shifting and predicted error expansion.

    PubMed

    Wang, Fei; Xie, Zhaoxin; Chen, Zuo

    2014-01-01

    Being reversible, the watermarking information embedded in audio signals can be extracted while the original audio data can achieve lossless recovery. Currently, the few reversible audio watermarking algorithms are confronted with following problems: relatively low SNR (signal-to-noise) of embedded audio; a large amount of auxiliary embedded location information; and the absence of accurate capacity control capability. In this paper, we present a novel reversible audio watermarking scheme based on improved prediction error expansion and histogram shifting. First, we use differential evolution algorithm to optimize prediction coefficients and then apply prediction error expansion to output stego data. Second, in order to reduce location map bits length, we introduced histogram shifting scheme. Meanwhile, the prediction error modification threshold according to a given embedding capacity can be computed by our proposed scheme. Experiments show that this algorithm improves the SNR of embedded audio signals and embedding capacity, drastically reduces location map bits length, and enhances capacity control capability.

  11. Measurements of the intrinsic quantum efficiency and absorption length of tetraphenyl butadiene thin films in the vacuum ultraviolet regime

    NASA Astrophysics Data System (ADS)

    Benson, Christopher; Gann, Gabriel Orebi; Gehman, Victor

    2018-04-01

    A key enabling technology for many liquid noble gas (LNG) detectors is the use of the common wavelength shifting medium tetraphenyl butadiene (TPB). TPB thin films are used to shift ultraviolet scintillation light into the visible spectrum for detection and event reconstruction. Understanding the wavelength shifting efficiency and optical properties of these films are critical aspects in detector performance and modeling and hence in the ultimate physics sensitivity of such experiments. This article presents the first measurements of the room-temperature microphysical quantum efficiency for vacuum-deposited TPB thin films - a result that is independent of the optics of the TPB or substrate. Also presented are measurements of the absorption length in the vacuum ultraviolet regime, the secondary re-emission efficiency, and more precise results for the "black-box" efficiency across a broader spectrum of wavelengths than previous results. The low-wavelength sensitivity, in particular, would allow construction of LNG scintillator detectors with lighter elements (Ne, He) to target light mass WIMPs.

  12. Disease Vector Ecology Profile: Somalia. Fourth Edition

    DTIC Science & Technology

    1993-09-15

    excrement, decaying plant material and other debris). Eggs hatch in 1-3 weeks. Larval stage 4-6 weeks. Often associated with termite mounds . Biting...lengths of up to 14 feet. It occurs primarily in the forest and open bush country of northern Somalia, where it is found in tree stumps, termite mounds

  13. Properties of the tick-borne encephalitis virus population during persistent infection of ixodid ticks and tick cell lines.

    PubMed

    Belova, Oxana A; Litov, Alexander G; Kholodilov, Ivan S; Kozlovskaya, Liubov I; Bell-Sakyi, Lesley; Romanova, Lidiya Iu; Karganova, Galina G

    2017-10-01

    Tick-borne encephalitis virus (TBEV) is the causative agent of tick-borne encephalitis (TBE), a vector-borne zoonotic neuroinfection. For successful circulation in natural foci the virus has to survive in the vector for a long period of time. Information about the effect of long-term infection of ticks on properties of the viral population is of great importance. In recent years, changes in the eco-epidemiology of TBEV due to changes in distribution of ixodid ticks have been observed. These changes in TBEV-endemic areas could result in a shift of the main tick vector species, which in turn may lead to changes in properties of the virus. In the present study we evaluated the selective pressure on the TBEV population during persistent infection of various species of ticks and tick cell lines. TBEV effectively replicated and formed persistent infection in ticks and tick cell lines of the vector species (Ixodes spp.), potential vectors (Dermacentor spp.) and non-vector ticks (Hyalomma spp.). During TBEV persistence in Ixodes and Dermacentor ticks, properties of the viral population remained virtually unchanged. In contrast, persistent TBEV infection of tick cell lines from both vector and non-vector ticks favoured selection of viral variants with low neuroinvasiveness for laboratory mice and substitutions in the E protein that increased local positive charge of the virion. Thus, selective pressure on viral population may differ in ticks and tick cell lines during persistent infection. Nevertheless, virus variants with properties of the original strain adapted to mouse CNS were not eliminated from the viral population during long-term persistence of TBEV in ticks and tick cell lines. Copyright © 2017 Elsevier GmbH. All rights reserved.

  14. Static performance investigation of a skewed-throat multiaxis thrust-vectoring nozzle concept

    NASA Technical Reports Server (NTRS)

    Wing, David J.

    1994-01-01

    The static performance of a jet exhaust nozzle which achieves multiaxis thrust vectoring by physically skewing the geometric throat has been characterized in the static test facility of the 16-Foot Transonic Tunnel at NASA Langley Research Center. The nozzle has an asymmetric internal geometry defined by four surfaces: a convergent-divergent upper surface with its ridge perpendicular to the nozzle centerline, a convergent-divergent lower surface with its ridge skewed relative to the nozzle centerline, an outwardly deflected sidewall, and a straight sidewall. The primary goal of the concept is to provide efficient yaw thrust vectoring by forcing the sonic plane (nozzle throat) to form at a yaw angle defined by the skewed ridge of the lower surface contour. A secondary goal is to provide multiaxis thrust vectoring by combining the skewed-throat yaw-vectoring concept with upper and lower pitch flap deflections. The geometric parameters varied in this investigation included lower surface ridge skew angle, nozzle expansion ratio (divergence angle), aspect ratio, pitch flap deflection angle, and sidewall deflection angle. Nozzle pressure ratio was varied from 2 to a high of 11.5 for some configurations. The results of the investigation indicate that efficient, substantial multiaxis thrust vectoring was achieved by the skewed-throat nozzle concept. However, certain control surface deflections destabilized the internal flow field, which resulted in substantial shifts in the position and orientation of the sonic plane and had an adverse effect on thrust-vectoring and weight flow characteristics. By increasing the expansion ratio, the location of the sonic plane was stabilized. The asymmetric design resulted in interdependent pitch and yaw thrust vectoring as well as nonzero thrust-vector angles with undeflected control surfaces. By skewing the ridges of both the upper and lower surface contours, the interdependency between pitch and yaw thrust vectoring may be eliminated and the location of the sonic plane may be further stabilized.

  15. Pipeline synthetic aperture radar data compression utilizing systolic binary tree-searched architecture for vector quantization

    NASA Technical Reports Server (NTRS)

    Chang, Chi-Yung (Inventor); Fang, Wai-Chi (Inventor); Curlander, John C. (Inventor)

    1995-01-01

    A system for data compression utilizing systolic array architecture for Vector Quantization (VQ) is disclosed for both full-searched and tree-searched. For a tree-searched VQ, the special case of a Binary Tree-Search VQ (BTSVQ) is disclosed with identical Processing Elements (PE) in the array for both a Raw-Codebook VQ (RCVQ) and a Difference-Codebook VQ (DCVQ) algorithm. A fault tolerant system is disclosed which allows a PE that has developed a fault to be bypassed in the array and replaced by a spare at the end of the array, with codebook memory assignment shifted one PE past the faulty PE of the array.

  16. Structures and interactions in N-methylacetamide-water mixtures studied by IR spectra and density functional theory

    NASA Astrophysics Data System (ADS)

    Zhang, Rong; Li, Haoran; Lei, Yi; Han, Shijun

    2004-05-01

    IR spectra have been performed to study the structures and interactions in N-methylacetamide and water mixtures. Because of the competitions of acceptor and donor of the strong hydrogen bonds, some interesting phenomena of red shifts and blue shifts are observed in νCO and νN-H. It is due to the blue-shifting C-H⋯O hydrogen bond, the νC-H blue shifts more obviously. Then some representative cluster structures are suggested and further investigated by density functional theory method. The changes in bond length and frequency shift of the structures give good reasons for the red shift and blue shift, which represents excellent agreement with the IR experiment. The investigations of IR spectra and DFT calculations reveal that the weak C-H⋯O interactions play different roles compared with the classical strong hydrogen bonds in the NMA-water mixtures.

  17. Digitally controlled distributed phase shifter

    DOEpatents

    Hietala, V.M.; Kravitz, S.H.; Vawter, G.A.

    1993-08-17

    A digitally controlled distributed phase shifter is comprised of N phase shifters. Digital control is achieved by using N binary length-weighted electrodes located on the top surface of a waveguide. A control terminal is attached to each electrode thereby allowing the application of a control signal. The control signal is either one or two discrete bias voltages. The application of the discrete bias voltages changes the modal index of a portion of the waveguide that corresponds to a length of the electrode to which the bias voltage is applied, thereby causing the phase to change through the underlying portion of the waveguide. The digitally controlled distributed phase shift network has a total phase shift comprised of the sum of the individual phase shifters.

  18. Digitally controlled distributed phase shifter

    DOEpatents

    Hietala, Vincent M.; Kravitz, Stanley H.; Vawter, Gregory A.

    1993-01-01

    A digitally controlled distributed phase shifter is comprised of N phase shifters. Digital control is achieved by using N binary length-weighted electrodes located on the top surface of a waveguide. A control terminal is attached to each electrode thereby allowing the application of a control signal. The control signal is either one or two discrete bias voltages. The application of the discrete bias voltages changes the modal index of a portion of the waveguide that corresponds to a length of the electrode to which the bias voltage is applied, thereby causing the phase to change through the underlying portion of the waveguide. The digitally controlled distributed phase shift network has a total phase shift comprised of the sum of the individual phase shifters.

  19. Identification of Human Semiochemicals Attractive to the Major Vectors of Onchocerciasis

    PubMed Central

    Young, Ryan M.; Burkett-Cadena, Nathan D.; McGaha, Tommy W.; Rodriguez-Perez, Mario A.; Toé, Laurent D.; Adeleke, Monsuru A.; Sanfo, Moussa; Soungalo, Traore; Katholi, Charles R.; Noblet, Raymond; Fadamiro, Henry; Torres-Estrada, Jose L.; Salinas-Carmona, Mario C.; Baker, Bill; Unnasch, Thomas R.; Cupp, Eddie W.

    2015-01-01

    Background Entomological indicators are considered key metrics to document the interruption of transmission of Onchocerca volvulus, the etiological agent of human onchocerciasis. Human landing collection is the standard employed for collection of the vectors for this parasite. Recent studies reported the development of traps that have the potential for replacing humans for surveillance of O. volvulus in the vector population. However, the key chemical components of human odor that are attractive to vector black flies have not been identified. Methodology/Principal Findings Human sweat compounds were analyzed using GC-MS analysis and compounds common to three individuals identified. These common compounds, with others previously identified as attractive to other hematophagous arthropods were evaluated for their ability to stimulate and attract the major onchocerciasis vectors in Africa (Simulium damnosum sensu lato) and Latin America (Simulium ochraceum s. l.) using electroantennography and a Y tube binary choice assay. Medium chain length carboxylic acids and aldehydes were neurostimulatory for S. damnosum s.l. while S. ochraceum s.l. was stimulated by short chain aliphatic alcohols and aldehydes. Both species were attracted to ammonium bicarbonate and acetophenone. The compounds were shown to be attractive to the relevant vector species in field studies, when incorporated into a formulation that permitted a continuous release of the compound over time and used in concert with previously developed trap platforms. Conclusions/Significance The identification of compounds attractive to the major vectors of O. volvulus will permit the development of optimized traps. Such traps may replace the use of human vector collectors for monitoring the effectiveness of onchocerciasis elimination programs and could find use as a contributing component in an integrated vector control/drug program aimed at eliminating river blindness in Africa. PMID:25569240

  20. Identification of human semiochemicals attractive to the major vectors of onchocerciasis.

    PubMed

    Young, Ryan M; Burkett-Cadena, Nathan D; McGaha, Tommy W; Rodriguez-Perez, Mario A; Toé, Laurent D; Adeleke, Monsuru A; Sanfo, Moussa; Soungalo, Traore; Katholi, Charles R; Noblet, Raymond; Fadamiro, Henry; Torres-Estrada, Jose L; Salinas-Carmona, Mario C; Baker, Bill; Unnasch, Thomas R; Cupp, Eddie W

    2015-01-01

    Entomological indicators are considered key metrics to document the interruption of transmission of Onchocerca volvulus, the etiological agent of human onchocerciasis. Human landing collection is the standard employed for collection of the vectors for this parasite. Recent studies reported the development of traps that have the potential for replacing humans for surveillance of O. volvulus in the vector population. However, the key chemical components of human odor that are attractive to vector black flies have not been identified. Human sweat compounds were analyzed using GC-MS analysis and compounds common to three individuals identified. These common compounds, with others previously identified as attractive to other hematophagous arthropods were evaluated for their ability to stimulate and attract the major onchocerciasis vectors in Africa (Simulium damnosum sensu lato) and Latin America (Simulium ochraceum s. l.) using electroantennography and a Y tube binary choice assay. Medium chain length carboxylic acids and aldehydes were neurostimulatory for S. damnosum s.l. while S. ochraceum s.l. was stimulated by short chain aliphatic alcohols and aldehydes. Both species were attracted to ammonium bicarbonate and acetophenone. The compounds were shown to be attractive to the relevant vector species in field studies, when incorporated into a formulation that permitted a continuous release of the compound over time and used in concert with previously developed trap platforms. The identification of compounds attractive to the major vectors of O. volvulus will permit the development of optimized traps. Such traps may replace the use of human vector collectors for monitoring the effectiveness of onchocerciasis elimination programs and could find use as a contributing component in an integrated vector control/drug program aimed at eliminating river blindness in Africa.

  1. Doppler color imaging. Principles and instrumentation.

    PubMed

    Kremkau, F W

    1992-01-01

    DCI acquires Doppler-shifted echoes from a cross-section of tissue scanned by an ultrasound beam. These echoes are then presented in color and superimposed on the gray-scale anatomic image of non-Doppler-shifted echoes received during the scan. The flow echoes are assigned colors according to the color map chosen. Usually red, yellow, or white indicates positive Doppler shifts (approaching flow) and blue, cyan, or white indicates negative shifts (receding flow). Green is added to indicate variance (disturbed or turbulent flow). Several pulses (the number is called the ensemble length) are needed to generate a color scan line. Linear, convex, phased, and annular arrays are used to acquire the gray-scale and color-flow information. Doppler color-flow instruments are pulsed-Doppler instruments and are subject to the same limitations, such as Doppler angle dependence and aliasing, as other Doppler instruments. Color controls include gain, TGC, map selection, variance on/off, persistence, ensemble length, color/gray priority. Nyquist limit (PRF), baseline shift, wall filter, and color window angle, location, and size. Doppler color-flow instruments generally have output intensities intermediate between those of gray-scale imaging and pulsed-Doppler duplex instruments. Although there is no known risk with the use of color-flow instruments, prudent practice dictates that they be used for medical indications and with the minimum exposure time and instrument output required to obtain the needed diagnostic information.

  2. Construction of heat-inducible expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes.

    PubMed

    Park, Jong-Uk; Jo, Jae-Hyung; Kim, Young-Ji; Chung, So-Sun; Lee, Jin-Ho; Lee, Hyune Hwan

    2008-04-01

    The heat-inducible expression vectors for Corynebacterium glutamicum and C. ammoniagenes were constructed by using the lambdaOL1 and the cryptic promoters, CJ1 and CJ4 that express genes constitutively in C. ammoniagenes.. Although the promoters were isolated from C. ammoniagenes, CJ1 and CJ4 were also active in C. glutamicum. To construct vectors, the OL1 from the lambdaPL promoter was isolated and fused to the CJ1 and CJ4 promoters by recombinant PCR. The resulting artificial promoters, CJ1O and CJ4O, which have one lambdaOL1, and CJ1OX2, which has two successive lambdaOL1, were fused to the green fluorescent protein (GFP) gene followed by subcloning into pCES208. The expression of GFP in the corynebacteria harboring the vectors was regulated successfully by the temperature sensitive cI857 repressor. Among them, C. ammoniagenes harboring plasmid pCJ1OX2G containing GFP fused to CJ1OX2 showed more GFP than the other ones and the expression was tightly regulated by the repressor. To construct the generally applicable expression vector using the plasmid pCJ1OX2G, the His-tag, enterokinase (EK) moiety, and the MCS were inserted in front of the GFP gene. Using the vector, the expression of pyrR from C. glutamicum was tried by temperature shift-up. The results indicated that the constructed vectors (pCeHEMG) can be successfully used in the expression and regulation of foreign genes in corynebacteria.

  3. The characteristics of grating structure in magnetic field measurements based on polarization properties of fiber gratings

    NASA Astrophysics Data System (ADS)

    Su, Yang; Peng, Hui; Feng, Kui; Li, Yu-quan

    2009-11-01

    In this paper the characteristics of grating structure in magnetic field measurements based on differential group delay of fiber gratings are analyzed. Theoretical simulations are realized using the coupled-mode theory and transfer matrix method. The effects of grating parameters of uniform Bragg grating on measurement range and sensitivity are analyzed. The impacts of chirped, phase-shifted and apodized gratings on DGD peak values are also monitored. FBG transmitted spectrums and DGD spectrums are recorded by means of an optical vector analyzer (OVA). Both the simulations and experiments demonstrate that the phase-shifted gratings can obviously improve the sensitivity.

  4. 49 CFR 393.110 - What else do I have to do to determine the minimum number of tiedowns?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... SAFETY REGULATIONS PARTS AND ACCESSORIES NECESSARY FOR SAFE OPERATION Protection Against Shifting and... meters), and one additional tiedown for every 10 feet (3.04 meters) of article length, or fraction... secured by at least one tiedown for every 3.04 meters (10 feet) of article length, or fraction thereof. (d...

  5. Of Mice and Snakes: A Tail of Oct4.

    PubMed

    Shylo, Natalia A; Weatherbee, Scott D

    2016-08-08

    The vertebrate axial skeleton comprises regions of specialized vertebrae, which vary in length between lineages. Aires et al. (2016) uncover a key role for Oct4 in determining trunk length in mice. Additionally, a heterochronic shift in Oct4 expression may underlie the extreme elongation of the trunk in snakes. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Relationships for electron-vibrational coupling in conjugated π organic systems

    NASA Astrophysics Data System (ADS)

    O'Neill, L.; Lynch, P.; McNamara, M.; Byrne, H. J.

    2005-06-01

    A series of π conjugated systems were studied by absorption, photoluminescence and vibrational spectroscopy. As is common for these systems, a linear relationship between the positioning of the absorption and photoluminescence maxima plotted against inverse conjugation length is observed. The relationships are in good agreement with the simple particle in a box method, one of the earliest descriptions of the properties of one-dimensional organic molecules. In addition to the electronic transition energies, it was observed that the Stokes shift also exhibited a well-defined relationship with increasing conjugation length, implying a correlation between the electron-vibrational coupling and chain length. This correlation is further examined using Raman spectroscopy, whereby the integrated Raman scattering is seen to behave superlinearly with chain length. There is a clear indication that the vibrational activity and thus nonradiative decay processes are controllable through molecular structure. The correlations between the Stokes energies and the vibrational structure are also observed in a selection of PPV based polymers and a clear trend of increasing luminescence efficiency with decreasing vibrational activity and Stokes shift is observable. The implications of such structure property relationships in terms of materials design are discussed.

  7. Static investigation of a two-dimensional convergent-divergent exhaust nozzle with multiaxis thrust-vectoring capability

    NASA Technical Reports Server (NTRS)

    Taylor, John G.

    1990-01-01

    An investigation was conducted in the Static Test Facility of the NASA Langley 16-Foot Transonic Tunnel to determine the internal performance of two-dimensional convergent-divergent nozzles designed to have simultaneous pitch and yaw thrust vectoring capability. This concept utilized divergent flap rotation of thrust vectoring in the pitch plane and deflection of flat yaw flaps hinged at the end of the sidewalls for yaw thrust vectoring. The hinge location of the yaw flaps was varied at four positions from the nozzle exit plane to the throat plane. The yaw flaps were designed to contain the flow laterally independent of power setting. In order to eliminate any physical interference between the yaw flap deflected into the exhaust stream and the divergent flaps, the downstream corners of both upper and lower divergent flaps were cut off to allow for up to 30 deg of yaw flap deflection. The impact of varying the nozzle pitch vector angle, throat area, yaw flap hinge location, yaw flap length, and yaw flap deflection angle on nozzle internal performance characteristics, was studied. High-pressure air was used to simulate jet exhaust at nozzle pressure ratios up to 7.0. Static results indicate that configurations with the yaw flap hinge located upstream of the exit plane provide relatively high levels of thrust vectoring efficiency without causing large losses in resultant thrust ratio. Therefore, these configurations represent a viable concept for providing simultaneous pitch and yaw thrust vectoring.

  8. The Unified Floating Point Vector Coprocessor for Reconfigurable Hardware

    NASA Astrophysics Data System (ADS)

    Kathiara, Jainik

    There has been an increased interest recently in using embedded cores on FPGAs. Many of the applications that make use of these cores have floating point operations. Due to the complexity and expense of floating point hardware, these algorithms are usually converted to fixed point operations or implemented using floating-point emulation in software. As the technology advances, more and more homogeneous computational resources and fixed function embedded blocks are added to FPGAs and hence implementation of floating point hardware becomes a feasible option. In this research we have implemented a high performance, autonomous floating point vector Coprocessor (FPVC) that works independently within an embedded processor system. We have presented a unified approach to vector and scalar computation, using a single register file for both scalar operands and vector elements. The Hybrid vector/SIMD computational model of FPVC results in greater overall performance for most applications along with improved peak performance compared to other approaches. By parameterizing vector length and the number of vector lanes, we can design an application specific FPVC and take optimal advantage of the FPGA fabric. For this research we have also initiated designing a software library for various computational kernels, each of which adapts FPVC's configuration and provide maximal performance. The kernels implemented are from the area of linear algebra and include matrix multiplication and QR and Cholesky decomposition. We have demonstrated the operation of FPVC on a Xilinx Virtex 5 using the embedded PowerPC.

  9. Lattice-Induced Frequency Shifts in Sr Optical Lattice Clocks at the 10{sup -17} Level

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Westergaard, P. G.; Lodewyck, J.; Lecallier, A.

    2011-05-27

    We present a comprehensive study of the frequency shifts associated with the lattice potential in a Sr lattice clock by comparing two such clocks with a frequency stability reaching 5x10{sup -17} after a 1 h integration time. We put the first experimental upper bound on the multipolar M1 and E2 interactions, significantly smaller than the recently predicted theoretical upper limit, and give a 30-fold improved upper limit on the effect of hyperpolarizability. Finally, we report on the first observation of the vector and tensor shifts in a Sr lattice clock. Combining these measurements, we show that all known lattice relatedmore » perturbations will not affect the clock accuracy down to the 10{sup -17} level, even for lattices as deep as 150 recoil energies.« less

  10. Characterization of biomolecular nanoconjugates by high-throughput delivery and spectroscopic difference

    PubMed Central

    DeLong, Robert K; Risor, Azure; Kanomata, Masaaki; Laymon, Amanda; Jones, Brooke; Zimmerman, Scott D; Williams, Joseph; Witkowski, Colette; Warner, Mathew; Ruff, Michael; Garrad, Richard; Fallon, John K; Hickey, Anthony J; Sedaghat-Herati, Reza

    2013-01-01

    Aims Nanoparticle conjugates have the potential for delivering siRNA, splice-shifting oligomers or nucleic acid vaccines, and can be applicable to anticancer therapeutics. This article compares tripartite conjugates with gold nanoparticles or synthetic methoxypoly(ethylene glycol)-block-polyamidoamine dendrimers. Materials & methods Interactions with model liposomes of a 1:1 molar ratio of tripalmitin:cholesterol or phospholipid:cholesterol were investigated by high-throughput absorbance, as well as fluorescence difference and cellular luminescence assays. Results Spectral differences and dynamic light-scattering spectroscopy shifts demonstrated the interaction of conjugates with liposomes. Biological activity was demonstrated by upregulation of gene expression via splice-shifting oligomers, delivery of anti-B-Raf siRNA in cultured human cancer cells or tuberculosis antigen 85B plasmid expression vector in a coculture model of antigen presentation. Conclusion The data suggests that gold nanoparticles and methoxypoly(ethylene glycol)-block-polyamidoamine dendrimer nanoconjugates may have potential for binding, stabilization and delivery of splice-shifting oligomers, siRNA and nucleic acid vaccines for preclinical trials. PMID:22943129

  11. Classifier transfer with data selection strategies for online support vector machine classification with class imbalance

    NASA Astrophysics Data System (ADS)

    Krell, Mario Michael; Wilshusen, Nils; Seeland, Anett; Kim, Su Kyoung

    2017-04-01

    Objective. Classifier transfers usually come with dataset shifts. To overcome dataset shifts in practical applications, we consider the limitations in computational resources in this paper for the adaptation of batch learning algorithms, like the support vector machine (SVM). Approach. We focus on data selection strategies which limit the size of the stored training data by different inclusion, exclusion, and further dataset manipulation criteria like handling class imbalance with two new approaches. We provide a comparison of the strategies with linear SVMs on several synthetic datasets with different data shifts as well as on different transfer settings with electroencephalographic (EEG) data. Main results. For the synthetic data, adding only misclassified samples performed astoundingly well. Here, balancing criteria were very important when the other criteria were not well chosen. For the transfer setups, the results show that the best strategy depends on the intensity of the drift during the transfer. Adding all and removing the oldest samples results in the best performance, whereas for smaller drifts, it can be sufficient to only add samples near the decision boundary of the SVM which reduces processing resources. Significance. For brain-computer interfaces based on EEG data, models trained on data from a calibration session, a previous recording session, or even from a recording session with another subject are used. We show, that by using the right combination of data selection criteria, it is possible to adapt the SVM classifier to overcome the performance drop from the transfer.

  12. Shifts in the ecological niche of Lutzomyia peruensis under climate change scenarios in Peru.

    PubMed

    Moo-Llanes, D A; Arque-Chunga, W; Carmona-Castro, O; Yañez-Arenas, C; Yañez-Trujillano, H H; Cheverría-Pacheco, L; Baak-Baak, C M; Cáceres, A G

    2017-06-01

    The Peruvian Andes presents a climate suitable for many species of sandfly that are known vectors of leishmaniasis or bartonellosis, including Lutzomyia peruensis (Diptera: Psychodidae), among others. In the present study, occurrences data for Lu. peruensis were compiled from several items in the scientific literature from Peru published between 1927 and 2015. Based on these data, ecological niche models were constructed to predict spatial distributions using three algorithms [Support vector machine (SVM), the Genetic Algorithm for Rule-set Prediction (GARP) and Maximum Entropy (MaxEnt)]. In addition, the environmental requirements of Lu. peruensis and three niche characteristics were modelled in the context of future climate change scenarios: (a) potential changes in niche breadth; (b) shifts in the direction and magnitude of niche centroids, and (c) shifts in elevation range. The model identified areas that included environments suitable for Lu. peruensis in most regions of Peru (45.77%) and an average altitude of 3289 m a.s.l. Under climate change scenarios, a decrease in the distribution areas of Lu. peruensis was observed for all representative concentration pathways. However, the centroid of the species' ecological niche showed a northwest direction in all climate change scenarios. The information generated in this study may help health authorities responsible for the supervision of strategies to control leishmaniasis to coordinate, plan and implement appropriate strategies for each area of risk, taking into account the geographic distribution and potential dispersal of Lu. peruensis. © 2017 The Royal Entomological Society.

  13. Scalar and vector Keldysh models in the time domain

    NASA Astrophysics Data System (ADS)

    Kiselev, M. N.; Kikoin, K. A.

    2009-04-01

    The exactly solvable Keldysh model of disordered electron system in a random scattering field with extremely long correlation length is converted to the time-dependent model with extremely long relaxation. The dynamical problem is solved for the ensemble of two-level systems (TLS) with fluctuating well depths having the discrete Z 2 symmetry. It is shown also that the symmetric TLS with fluctuating barrier transparency may be described in terms of the vector Keldysh model with dime-dependent random planar rotations in xy plane having continuous SO(2) symmetry. Application of this model to description of dynamic fluctuations in quantum dots and optical lattices is discussed.

  14. Vector rectangular-shape laser based on reduced graphene oxide interacting with a long fiber taper.

    PubMed

    Gao, Lei; Zhu, Tao; Huang, Wei; Zeng, Jing

    2014-10-01

    A vector dual-wavelength rectangular-shape laser (RSL) based on a long fiber taper deposited with reduced graphene oxide is proposed, where nonlinearity is enhanced due to a large evanescent-field-interacting length and strong field confinement of an 8 mm fiber taper with a waist diameter of 4 μm. Graphene flakes are deposited uniformly on the taper waist with light pressure effect, so this structure guarantees both excellent saturable absorption and high nonlinearity. The RSL with a repetition rate of 7.9 MHz shows fast polarization switching in two orthogonal polarization directions, and temporal and spectral characteristics are investigated.

  15. Shaping-lathe headrig yields solid and molded-flake hardwood products.

    Treesearch

    P. Koch; R.A. Caughey

    1978-01-01

    A shaping-lathe headrig, operated one shift daily, can be used to manufacture hardwood cants to be resawed into pallet shook, one-piece and dowel-laminated crossties, posts and rail, and other solid wood products in lengths from 6 to 9 feet. Residual flakes machined by the headrig supply a three-shift operation in which molded pallets and 4- by 8-foot sheets of...

  16. shaping-lathe headrig yields solid and molded-flake hardwood products

    Treesearch

    Peter Koch; R.A. Caughey

    1978-01-01

    A shaping-lathe headrig, operated one shift daily, can be used to manufacture hardwood cants to be resawed into pallet shook, one-piece and dowel-laminated crossties, posts and rails, and other solid wood products in lengths from 6 to 9 feet. Residual flakes machined by the headrig supply a three-shift operation in which molded pallets and 4- by 8-foot sheets of...

  17. Mechanisms of breast cancer risk in shift workers: association of telomere shortening with the duration and intensity of night work.

    PubMed

    Samulin Erdem, Johanna; Notø, Heidi Ødegaard; Skare, Øivind; Lie, Jenny-Anne S; Petersen-Øverleir, Marte; Reszka, Edyta; Pepłońska, Beata; Zienolddiny, Shanbeh

    2017-08-01

    Occupational factors such as shiftwork and especially night work that involves disruption of the circadian rhythm may contribute to increased breast cancer risk. Circadian disruption may also affect telomere length (TL). While short TL generally is associated with increased cancer risk, its association with breast cancer risk is inconclusive. We suggest that working schedules might be an important factor in assessment of effects of TL on breast cancer risk. Moreover, telomere shortening might be a potential mechanism for night work-related breast cancer. In this study, effects of shift work on TL and its association with breast cancer risk were investigated in a nested breast cancer case-control study of Norwegian nurses. TL was assessed by qPCR in DNA from 563 breast cancer patients and 619 controls. Here, we demonstrate that TL is affected by intensive night work schedules, as work with six consecutive night for a period of more than 5 years was associated with decreased telomere lengths (-3.18, 95% CI: -6.46 to -0.58, P = 0.016). Furthermore, telomere shortening is associated with increased breast cancer risk in workers with long periods of consecutive night shifts. Thus, nurses with longer telomere lengths had a lower risk for breast cancer if they had worked more than four (OR: 0.37, 95% CI: 0.16-0.79, P = 0.014) or five (OR: 0.31, 95% CI: 0.10-0.83, P = 0.029) consecutive night shifts for a period of 5 years or more. These data suggest that telomere shortening is associated with the duration and intensity of night work and may be a contributing factor for breast cancer risk among female shift workers. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  18. A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

    PubMed

    Tesar, Devin; Hötzel, Isidro

    2013-10-01

    A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

  19. A novel representation for apoptosis protein subcellular localization prediction using support vector machine.

    PubMed

    Zhang, Li; Liao, Bo; Li, Dachao; Zhu, Wen

    2009-07-21

    Apoptosis, or programmed cell death, plays an important role in development of an organism. Obtaining information on subcellular location of apoptosis proteins is very helpful to understand the apoptosis mechanism. In this paper, based on the concept that the position distribution information of amino acids is closely related with the structure and function of proteins, we introduce the concept of distance frequency [Matsuda, S., Vert, J.P., Ueda, N., Toh, H., Akutsu, T., 2005. A novel representation of protein sequences for prediction of subcellular location using support vector machines. Protein Sci. 14, 2804-2813] and propose a novel way to calculate distance frequencies. In order to calculate the local features, each protein sequence is separated into p parts with the same length in our paper. Then we use the novel representation of protein sequences and adopt support vector machine to predict subcellular location. The overall prediction accuracy is significantly improved by jackknife test.

  20. Modeling node bandwidth limits and their effects on vector combining algorithms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Littlefield, R.J.

    Each node in a message-passing multicomputer typically has several communication links. However, the maximum aggregate communication speed of a node is often less than the sum of its individual link speeds. Such computers are called node bandwidth limited (NBL). The NBL constraint is important when choosing algorithms because it can change the relative performance of different algorithms that accomplish the same task. This paper introduces a model of communication performance for NBL computers and uses the model to analyze the overall performance of three algorithms for vector combining (global sum) on the Intel Touchstone DELTA computer. Each of the threemore » algorithms is found to be at least 33% faster than the other two for some combinations of machine size and vector length. The NBL constraint is shown to significantly affect the conditions under which each algorithm is fastest.« less

  1. Development of new plasmid DNA vaccine vectors with R1-based replicons

    PubMed Central

    2012-01-01

    Background There has been renewed interest in biopharmaceuticals based on plasmid DNA (pDNA) in recent years due to the approval of several veterinary DNA vaccines, on-going clinical trials of human pDNA-based therapies, and significant advances in adjuvants and delivery vehicles that have helped overcome earlier efficacy deficits. With this interest comes the need for high-yield, cost-effective manufacturing processes. To this end, vector engineering is one promising strategy to improve plasmid production. Results In this work, we have constructed a new DNA vaccine vector, pDMB02-GFP, containing the runaway R1 origin of replication. The runaway replication phenotype should result in plasmid copy number amplification after a temperature shift from 30°C to 42°C. However, using Escherichia coli DH5α as a host, we observed that the highest yields of pDMB02-GFP were achieved during constant-temperature culture at 30°C, with a maximum yield of approximately 19 mg pDNA/g DCW being observed. By measuring mRNA and protein levels of the R1 replication initiator protein, RepA, we determined that RepA may be limiting pDMB02-GFP yield at 42°C. A mutant plasmid, pDMB-ATG, was constructed by changing the repA start codon from the sub-optimal GTG to ATG. In cultures of DH5α[pDMB-ATG], temperature-induced plasmid amplification was more dramatic than that observed with pDMB02-GFP, and RepA protein was detectable for several hours longer than in cultures of pDMB02-GFP at 42°C. Conclusions Overall, we have demonstrated that R1-based plasmids can produce high yields of high-quality pDNA without the need for a temperature shift, and have laid the groundwork for further investigation of this class of vectors in the context of plasmid DNA production. PMID:22889338

  2. Preventing malaria in the Peruvian Amazon: a qualitative study in Iquitos, Peru.

    PubMed

    Newell, Ian; Wiskin, Connie; Anthoney, James; Meza, Graciela; de Wildt, Gilles

    2018-01-16

    In Peru, despite decades of concerted control efforts, malaria remains a significant public health burden. Peru has recently exhibited a dramatic rise in malaria incidence, impeding South America's progress towards malaria elimination. The Amazon basin, in particular the Loreto region of Peru, has been identified as a target for the implementation of intensified control strategies, aiming for elimination. No research has addressed why vector control strategies in Loreto have had limited impact in the past, despite vector control elsewhere being highly effective in reducing malaria transmission. This study employed qualitative methods to explore factors limiting the success of vector control strategies in the region. Twenty semi-structured interviews were conducted among adults attending a primary care centre in Iquitos, Peru, together with 3 interviews with key informants (health care professionals). The interviews focussed on how local knowledge, together with social and cultural attitudes, determined the use of vector control methods. Five themes emerged. (a) Participants believed malaria to be embedded within their culture, and commonly blamed this for a lack of regard for prevention. (b) They perceived a shift in mosquito biting times to early evening, rendering night-time use of bed nets less effective. (c) Poor preventive practices were compounded by a consensus that malaria prevention was the government's responsibility, and that this reduced motivation for personal prevention. (d) Participants confused the purpose of space-spraying. (e) Participants' responses also exposed persisting misconceptions, mainly concerning the cause of malaria and best practices for its prevention. To eliminate malaria from the Americas, region-specific strategies need to be developed that take into account the local social and cultural contexts. In Loreto, further research is needed to explore the potential shift in biting behaviour of Anopheles darlingi, and how this interacts with the population's social behaviours and current use of preventive measures. Attitudes concerning personal responsibility for malaria prevention and long-standing misconceptions as to the cause of malaria and best preventive practices also need to be addressed.

  3. The rise of neglected tropical diseases in the "new Texas".

    PubMed

    Hotez, Peter J

    2018-01-01

    Within the last five years, the State of Texas has experienced either transmission or outbreaks of Ebola, chikungunya, West Nile, and Zika virus infections. Autochthonous transmission of neglected parasitic and bacterial diseases has also become increasingly reported. The rise of such emerging and neglected tropical diseases (NTDs) has not occurred by accident but instead reflects rapidly evolving changes and shifts in a "new" Texas beset by modern and globalizing forces that include rapid expansions in population together with urbanization and human migrations, altered transportation patterns, climate change, steeply declining vaccination rates, and a new paradigm of poverty known as "blue marble health." Summarized here are the major NTDs now affecting Texas. In addition to the vector-borne viral diseases highlighted above, there also is a high level of parasitic infections, including Chagas disease, trichomoniasis, and possibly leishmaniasis and toxocariasis, as well as typhus-group rickettsiosis, a vector-borne bacterial infection. I also highlight some of the key shifts in emerging and neglected disease patterns, partly due to an altered and evolving economic and ecological landscape in the new Texas, and provide some preliminary disease burden estimates for the major prevalent and incident NTDs.

  4. Introduction of a 14-hour work shift model for housestaff in the medical ICU.

    PubMed

    Afessa, Bekele; Kennedy, Cassie C; Klarich, Kyle W; Aksamit, Timothy R; Kolars, Joseph C; Hubmayr, Rolf D

    2005-12-01

    To describe the outcomes of switching housestaff from a traditional model of "long-call" every 4 days to a 14-h work-shift model in a medical ICU (MICU) over a 5-week pilot period. Retrospective comparison of a 5-week pilot period for a 14-h work-shift model vs a 4-month period for the traditional model. The MICU of a tertiary medical center. A total of 626 patients admitted to the MICU and 34 internal medicine residents taking care of them. None. Severity-adjusted patient outcomes, housestaff performance on end-of-rotation examinations, and scheduled duty hours during the 5-week 14-h work-shift pilot period compared to a 16-week traditional nonpilot work period. There were no statistically significant differences in patients' adjusted mortality rates, hospital lengths of stay, or housestaff performance on end-of-rotation knowledge assessment examinations between the pilot and nonpilot periods. During the pilot period, each resident was scheduled to work for an average of 61.3 h weekly, and each fellow for 65.3 h weekly. In comparison, each resident and fellow was scheduled to work for an average of 73.3 h weekly during the nonpilot period. The 14-h work shift is a feasible option for housestaff rotation in the MICU. Although the power of our study to detect significant differences in mortality, length of stay, and educational outcomes was low, there was no evidence of compromised patient care or housestaff education associated with the 14-h shift model over the course of this 5-week pilot study.

  5. Modeling and experimental investigation of an integrated optical microheater in silicon-on-insulator.

    PubMed

    Kaushal, Saket; Das, Bijoy Krishna

    2016-04-10

    A linear piecewise model has been formulated to analyze the performance of a metallic microheater integrated with single-mode waveguides (λ∼1550  nm) in silicon-on-insulator (SOI). The model has been used to evaluate integrated optical microheaters fabricated in a SOI substrate with 2 µm device layer thickness. The Fabry-Perot modulation technique has been used to extract the effective thermo-optic phase shift and response time. The effective thermal power budget of Peff,π∼500  µW (out of actually consumed power Pπ=1.1  mW) for a π phase shift and a switching time of τ∼9  µs, have been recorded for a typical Ti heater stripe of length LH=50  µm, width WH=2  µm, and thickness tH∼150  nm, integrated with a Fabry-Perot waveguide cavity of length ∼20  mm. It has been shown that the performance of a heater improves (in terms of power budget) as the length of a microheater decreases. However, smaller heater size requires higher joule heating to obtain a desired phase shift, which is again found to be dependent on polarization of the guided mode because of thermal stress.

  6. Non-stationary recruitment dynamics of rainbow smelt: the influence of environmental variables and variation in size structure and length-at-maturation

    USGS Publications Warehouse

    Feiner, Zachary S.; Bunnell, David B.; Hook, Tomas O.; Madenjian, Charles P.; Warner, David M.; Collingsworth, Paris D.

    2015-01-01

    Fish stock-recruitment dynamics may be difficult to elucidate because of nonstationary relationships resulting from shifting environmental conditions and fluctuations in important vital rates such as individual growth or maturation. The Great Lakes have experienced environmental stressors that may have changed population demographics and stock-recruitment relationships while causing the declines of several prey fish species, including rainbow smelt (Osmerus mordax). We investigated changes in the size and maturation of rainbow smelt in Lake Michigan and Lake Huron and recruitment dynamics of the Lake Michigan stock over the past four decades. Mean lengths and length-at-maturation of rainbow smelt generally declined over time in both lakes. To evaluate recruitment, we used both a Ricker model and a Kalman filter-random walk (KF-RW) model which incorporated nonstationarity in stock productivity by allowing the productivity term to vary over time. The KF-RW model explained nearly four times more variation in recruitment than the Ricker model, indicating the productivity of the Lake Michigan stock has increased. By accounting for this nonstationarity, we were able identify significant variations in stock productivity, evaluate its importance to rainbow smelt recruitment, and speculate on potential environmental causes for the shift. Our results suggest that investigating mechanisms driving nonstationary shifts in stock-recruit relationships can provide valuable insights into temporal variation in fish population dynamics.

  7. Phase shift of TE and TM modes in an optical fiber due to axial strain (exact solution)

    NASA Technical Reports Server (NTRS)

    Egalon, Claudio O.; Rogowski, Robert S.

    1992-01-01

    Axial strain may be determined by monitoring the phase shift of modes of a variety of optical fiber sensors. In this paper, the exact solution of a circular optical fiber is used to calculate the phase shift of the TE and TM modes. Whenever an optical fiber is stressed, the optical path length, the index of refraction, and the propagation constants of each fiber mode change. In consequence, the modal phase term, beta(ln)z, of the fields is shifted by an amount Delta phi. In certain cases, it is desirable to control the phase shift term in order to make the fiber either more or less sensitive to certain kinds of strain. It is shown that it can be accomplished by choosing appropriate fiber parameters.

  8. Deriving Stopping Rules for Multidimensional Computerized Adaptive Testing

    ERIC Educational Resources Information Center

    Wang, Chun; Chang, Hua-Hua; Boughton, Keith A.

    2013-01-01

    Multidimensional computerized adaptive testing (MCAT) is able to provide a vector of ability estimates for each examinee, which could be used to provide a more informative profile of an examinee's performance. The current literature on MCAT focuses on the fixed-length tests, which can generate less accurate results for those examinees whose…

  9. Climate change velocity underestimates climate change exposure in mountainous regions

    Treesearch

    Solomon Z. Dobrowski; Sean A. Parks

    2016-01-01

    Climate change velocity is a vector depiction of the rate of climate displacement used for assessing climate change impacts. Interpreting velocity requires an assumption that climate trajectory length is proportional to climate change exposure; longer paths suggest greater exposure. However, distance is an imperfect measure of exposure because it does not...

  10. Vectorial mask optimization methods for robust optical lithography

    NASA Astrophysics Data System (ADS)

    Ma, Xu; Li, Yanqiu; Guo, Xuejia; Dong, Lisong; Arce, Gonzalo R.

    2012-10-01

    Continuous shrinkage of critical dimension in an integrated circuit impels the development of resolution enhancement techniques for low k1 lithography. Recently, several pixelated optical proximity correction (OPC) and phase-shifting mask (PSM) approaches were developed under scalar imaging models to account for the process variations. However, the lithography systems with larger-NA (NA>0.6) are predominant for current technology nodes, rendering the scalar models inadequate to describe the vector nature of the electromagnetic field that propagates through the optical lithography system. In addition, OPC and PSM algorithms based on scalar models can compensate for wavefront aberrations, but are incapable of mitigating polarization aberrations in practical lithography systems, which can only be dealt with under the vector model. To this end, we focus on developing robust pixelated gradient-based OPC and PSM optimization algorithms aimed at canceling defocus, dose variation, wavefront and polarization aberrations under a vector model. First, an integrative and analytic vector imaging model is applied to formulate the optimization problem, where the effects of process variations are explicitly incorporated in the optimization framework. A steepest descent algorithm is then used to iteratively optimize the mask patterns. Simulations show that the proposed algorithms can effectively improve the process windows of the optical lithography systems.

  11. Study of the correlation parameters of the surface structure of disordered semiconductors by the two-dimensional DFA and average mutual information methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alpatov, A. V.; Vikhrov, S. P.; Rybina, N. V., E-mail: pgnv@mail.ru

    The processes of self-organization of the surface structure of hydrogenated amorphous silicon are studied by the methods of fluctuation analysis and average mutual information on the basis of atomic-force-microscopy images of the surface. It is found that all of the structures can be characterized by a correlation vector and represented as a superposition of harmonic components and noise. It is shown that, under variations in the technological parameters of the production of a-Si:H films, the correlation properties of their structure vary as well. As the substrate temperature is increased, the formation of structural irregularities becomes less efficient; in this case,more » the length of the correlation vector and the degree of structural ordering increase. It is shown that the procedure based on the method of fluctuation analysis in combination with the method of average mutual information provides a means for studying the self-organization processes in any structures on different length scales.« less

  12. Vectorial structures of linear-polarized Butterfly-Gauss vortex beams in the far zone

    NASA Astrophysics Data System (ADS)

    Cheng, Ke; Zhou, Yan; Lu, Gang; Yao, Na; Zhong, Xianqiong

    2018-05-01

    By introducing the Butterfly catastrophe to optics, the far-zone vectorial structures of Butterfly-Gauss beam with vortex and non-vortex are studied using the angular spectrum representation and stationary phase method. The influence of topological charge, linear-polarized angle, off-axis distance and scaling length on the far-zone vectorial structures, especially in the Poynting vector and angular momentum density of the corresponding beam is emphasized. The results show that the embedded optical vortex at source plane lead to special dark zones in the far zone, where the number of dark zone equals the absolute value of topological charge of optical vortex. Furthermore, the symmetry and direction of the special dark zones can be controlled by off-axis distance and scaling length, respectively. The linear-polarized angle adjusts only the Poynting vectors of TE and TM terms, but it does not affect those of whole beam. Finally, the vectorial expressions also indicate that the total angular momentum density is certainly zero owing to the far-zone stable structures rather than rotation behaviors.

  13. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    PubMed Central

    Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

    2014-01-01

    Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

  14. System for monitoring an industrial or biological process

    DOEpatents

    Gross, Kenneth C.; Wegerich, Stephan W.; Vilim, Rick B.; White, Andrew M.

    1998-01-01

    A method and apparatus for monitoring and responding to conditions of an industrial process. Industrial process signals, such as repetitive manufacturing, testing and operational machine signals, are generated by a system. Sensor signals characteristic of the process are generated over a time length and compared to reference signals over the time length. The industrial signals are adjusted over the time length relative to the reference signals, the phase shift of the industrial signals is optimized to the reference signals and the resulting signals output for analysis by systems such as SPRT.

  15. System for monitoring an industrial or biological process

    DOEpatents

    Gross, K.C.; Wegerich, S.W.; Vilim, R.B.; White, A.M.

    1998-06-30

    A method and apparatus are disclosed for monitoring and responding to conditions of an industrial process. Industrial process signals, such as repetitive manufacturing, testing and operational machine signals, are generated by a system. Sensor signals characteristic of the process are generated over a time length and compared to reference signals over the time length. The industrial signals are adjusted over the time length relative to the reference signals, the phase shift of the industrial signals is optimized to the reference signals and the resulting signals output for analysis by systems such as SPRT. 49 figs.

  16. Final bubble lengths for aqueous foam coarsened in a horizontal cylinder

    NASA Astrophysics Data System (ADS)

    Sebag, V.; Roth, A. E.; Durian, D. J.

    2011-12-01

    We report on length statistics measured for bubbles in the equilibrium bamboo state, achieved by the coarsening of aqueous foam in long cylindrical tubes, such that the soap films are all flat and perpendicular to the axis of the tube. The average bubble length is found to be 0.88 times the tube diameter, independent of variation of the liquid filling fraction by a factor of nearly three. The actual distribution is well-approximated by a shifted Rayleigh form, with a minimum bubble size of 0.28 tube diameters. And, perhaps surprisingly, no correlations are found in the lengths of neighboring bubbles. The observed length distribution agrees with that of Fortes et al. for short bubbles, but not for long bubbles.

  17. Light vector mesons in the nuclear medium

    NASA Astrophysics Data System (ADS)

    Wood, M. H.; Nasseripour, R.; Weygand, D. P.; Djalali, C.; Tur, C.; Mosel, U.; Muehlich, P.; Adams, G.; Amaryan, M. J.; Ambrozewicz, P.; Anghinolfi, M.; Asryan, G.; Avakian, H.; Bagdasaryan, H.; Baillie, N.; Ball, J. P.; Baltzell, N. A.; Barrow, S.; Battaglieri, M.; Bedlinskiy, I.; Bektasoglu, M.; Bellis, M.; Benmouna, N.; Berman, B. L.; Biselli, A. S.; Blaszczyk, L.; Bouchigny, S.; Boiarinov, S.; Bradford, R.; Branford, D.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Butuceanu, C.; Calarco, J. R.; Careccia, S. L.; Carman, D. S.; Carnahan, B.; Casey, L.; Chen, S.; Cheng, L.; Cole, P. L.; Collins, P.; Coltharp, P.; Crabb, D.; Crannell, H.; Crede, V.; Cummings, J. P.; Dashyan, N.; de Vita, R.; de Sanctis, E.; Degtyarenko, P. V.; Denizli, H.; Dennis, L.; Deur, A.; Dharmawardane, K. V.; Dickson, R.; Dodge, G. E.; Doughty, D.; Dugger, M.; Dytman, S.; Dzyubak, O. P.; Egiyan, H.; Egiyan, K. S.; El Fassi, L.; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Feldman, G.; Feuerbach, R. J.; Fradi, A.; Funsten, H.; Garçon, M.; Gavalian, G.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gordon, C. I. O.; Gothe, R. W.; Griffioen, K. A.; Guidal, M.; Guler, N.; Guo, L.; Gyurjyan, V.; Hadjidakis, C.; Hafidi, K.; Hakobyan, H.; Hakobyan, R. S.; Hanretty, C.; Hardie, J.; Hassall, N.; Hersman, F. W.; Hicks, K.; Hleiqawi, I.; Holtrop, M.; Hyde-Wright, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Ito, M. M.; Jenkins, D.; Jo, H. S.; Johnstone, J. R.; Joo, K.; Juengst, H. G.; Kalantarians, N.; Kellie, J. D.; Khandaker, M.; Khetarpal, P.; Kim, W.; Klein, A.; Klein, F. J.; Klimenko, A. V.; Kossov, M.; Krahn, Z.; Kramer, L. H.; Kubarovsky, V.; Kuhn, J.; Kuhn, S. E.; Kuleshov, S. V.; Lachniet, J.; Laget, J. M.; Langheinrich, J.; Lawrence, D.; Li, Ji; Livingston, K.; Lu, H. Y.; MacCormick, M.; Markov, N.; Mattione, P.; McAleer, S.; McKinnon, B.; McNabb, J. W. C.; Mecking, B. A.; Mehrabyan, S.; Melone, J. J.; Mestayer, M. D.; Meyer, C. A.; Mibe, T.; Mikhailov, K.; Minehart, R.; Mirazita, M.; Miskimen, R.; Mokeev, V.; Moriya, K.; Morrow, S. A.; Moteabbed, M.; Mueller, J.; Munevar, E.; Mutchler, G. S.; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Niczyporuk, B. B.; Niroula, M. R.; Niyazov, R. A.; Nozar, M.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Paterson, C.; Pereira, S. Anefalos; Pierce, J.; Pivnyuk, N.; Pocanic, D.; Pogorelko, O.; Pozdniakov, S.; Preedom, B. M.; Price, J. W.; Prok, Y.; Protopopescu, D.; Raue, B. A.; Riccardi, G.; Ricco, G.; Ripani, M.; Ritchie, B. G.; Ronchetti, F.; Rosner, G.; Rossi, P.; Sabatié, F.; Salamanca, J.; Salgado, C.; Santoro, J. P.; Sapunenko, V.; Schumacher, R. A.; Serov, V. S.; Sharabian, Y. G.; Sharov, D.; Shvedunov, N. V.; Smith, E. S.; Smith, L. C.; Sober, D. I.; Sokhan, D.; Stavinsky, A.; Stepanyan, S.; Stepanyan, S. S.; Stokes, B. E.; Stoler, P.; Strakovsky, I. I.; Strauch, S.; Taiuti, M.; Tedeschi, D. J.; Tkabladze, A.; Tkachenko, S.; Todor, L.; Ungaro, M.; Vineyard, M. F.; Vlassov, A. V.; Watts, D. P.; Weinstein, L. B.; Williams, M.; Wolin, E.; Yegneswaran, A.; Zana, L.; Zhang, B.; Zhang, J.; Zhao, B.; Zhao, Z. W.

    2008-07-01

    The light vector mesons (ρ,ω, and ϕ) were produced in deuterium, carbon, titanium, and iron targets in a search for possible in-medium modifications to the properties of the ρ meson at normal nuclear densities and zero temperature. The vector mesons were detected with the CEBAF Large Acceptance Spectrometer (CLAS) via their decays to e+e-. The rare leptonic decay was chosen to reduce final-state interactions. A combinatorial background was subtracted from the invariant mass spectra using a well-established event-mixing technique. The ρ-meson mass spectrum was extracted after the ω and ϕ signals were removed in a nearly model-independent way. Comparisons were made between the ρ mass spectra from the heavy targets (A>2) with the mass spectrum extracted from the deuterium target. With respect to the ρ-meson mass, we obtain a small shift compatible with zero. Also, we measure widths consistent with standard nuclear many-body effects such as collisional broadening and Fermi motion.

  18. Using Grid Cells for Navigation.

    PubMed

    Bush, Daniel; Barry, Caswell; Manson, Daniel; Burgess, Neil

    2015-08-05

    Mammals are able to navigate to hidden goal locations by direct routes that may traverse previously unvisited terrain. Empirical evidence suggests that this "vector navigation" relies on an internal representation of space provided by the hippocampal formation. The periodic spatial firing patterns of grid cells in the hippocampal formation offer a compact combinatorial code for location within large-scale space. Here, we consider the computational problem of how to determine the vector between start and goal locations encoded by the firing of grid cells when this vector may be much longer than the largest grid scale. First, we present an algorithmic solution to the problem, inspired by the Fourier shift theorem. Second, we describe several potential neural network implementations of this solution that combine efficiency of search and biological plausibility. Finally, we discuss the empirical predictions of these implementations and their relationship to the anatomy and electrophysiology of the hippocampal formation. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Spaceflight Ka-Band High-Rate Radiation-Hard Modulator

    NASA Technical Reports Server (NTRS)

    Jaso, Jeffery M.

    2011-01-01

    A document discusses the creation of a Ka-band modulator developed specifically for the NASA/GSFC Solar Dynamics Observatory (SDO). This flight design consists of a high-bandwidth, Quadriphase Shift Keying (QPSK) vector modulator with radiation-hardened, high-rate driver circuitry that receives I and Q channel data. The radiationhard design enables SDO fs Ka-band communications downlink system to transmit 130 Mbps (300 Msps after data encoding) of science instrument data to the ground system continuously throughout the mission fs minimum life of five years. The low error vector magnitude (EVM) of the modulator lowers the implementation loss of the transmitter in which it is used, thereby increasing the overall communication system link margin. The modulator comprises a component within the SDO transmitter, and meets the following specifications over a 0 to 40 C operational temperature range: QPSK/OQPSK modulator, 300-Msps symbol rate, 26.5-GHz center frequency, error vector magnitude less than or equal to 10 percent rms, and compliance with the NTIA (National Telecommunications and Information Administration) spectral mask.

  20. Study of chemical shift in Kα, Kβ1,3 and Kβ// X-ray emission lines of 37Rb compounds with WDXRF

    NASA Astrophysics Data System (ADS)

    Kainth, Harpreet Singh; Singh, Ranjit; Singh, Tejbir; Mehta, D.; Shahi, J. S.; Kumar, Sanjeev

    2018-05-01

    The positive and negative chemical shifts in Kα, Kβ1,3 and Kβ// X-ray emission lines of rubidium compounds were measured with high resolution WDXRF spectrometer. The measured energy shifts in Kα emission lines ranges from -2.95 eV to -3.64 eV, Kβ1,3 emission lines ranges from 1.16 eV to 1.32 eV and Kβ// emission lines ranges from 1.31 eV to 4.36 eV respectively. In the present work, it has been found that chemical shift in Kβ// X-ray emission lines were found to be larger than Kα and Kβ1,3 X-ray emission lines. To find the cause of chemical shift, various factors like effective charge, line intensity ratio, bond length and electro-negativity were calculated and correlated with the chemical shift.

  1. Influence of laser linewidth and polarization modulator length on polarization shift keying for free space optical communication.

    PubMed

    Han, Biao; Zhao, Wei; Xie, Xiaoping; Su, Yulong; Wang, Wei; Hu, Hui

    2015-04-06

    Modulating signal with polarization modulator (PolM) is the simplest method for polarization shift keying (PolSK) in free space optical communication. However, this method has an intrinsic drawback on degree of polarization (DOP) reduction for the existence of polarization mode dispersion (PMD) in PolM. In this work, we analyze this change of DOP and its influence on PolSK using coherency matrix. We demonstrate that the decrease of DOP after PolM will generate extra loss and bit error ratio (BER) for PolSK communication, while this loss and BER will aggravate with the increase of laser linewidth and PolM length. For a practical PolSK system, laser linewidth should be less than 0.008nm.

  2. On the origin of Poincaré gauge gravity

    NASA Astrophysics Data System (ADS)

    Chkareuli, J. L.

    2017-06-01

    We argue that the origin of Poincaré gauge gravity (PGG) may be related to spontaneous violation of underlying spacetime symmetries involved and appearance of gauge fields as vector Goldstone bosons. In essence, we start with an arbitrary theory of some vector and fermion fields which possesses only global spacetime symmetries, such as Lorentz and translational invariance, in flat Minkowski space. The two vector field multiplets involved are assumed to belong, respectively, to the adjoint (Aμij) and vector (eμi) representations of the starting global Lorentz symmetry. We propose that these prototype vector fields are covariantly constrained, Aμij Aijμ = ±MA2 and eμi eiμ = ±Me2 , that causes a spontaneous violation of the accompanying global symmetries (MA,e are their presumed violation scales). It then follows that the only possible theory compatible with these length-preserving constraints is turned out to be the gauge invariant PGG, while the corresponding massless (pseudo)Goldstone modes are naturally collected in the emergent gauge fields of tetrads and spin-connections. In a minimal theory case being linear in a curvature we unavoidably come to the Einstein-Cartan theory. The extended theories with propagating spin-connection and tetrad modes are also considered and their possible unification with the Standard Model is briefly discussed.

  3. Supercomputer implementation of finite element algorithms for high speed compressible flows

    NASA Technical Reports Server (NTRS)

    Thornton, E. A.; Ramakrishnan, R.

    1986-01-01

    Prediction of compressible flow phenomena using the finite element method is of recent origin and considerable interest. Two shock capturing finite element formulations for high speed compressible flows are described. A Taylor-Galerkin formulation uses a Taylor series expansion in time coupled with a Galerkin weighted residual statement. The Taylor-Galerkin algorithms use explicit artificial dissipation, and the performance of three dissipation models are compared. A Petrov-Galerkin algorithm has as its basis the concepts of streamline upwinding. Vectorization strategies are developed to implement the finite element formulations on the NASA Langley VPS-32. The vectorization scheme results in finite element programs that use vectors of length of the order of the number of nodes or elements. The use of the vectorization procedure speeds up processing rates by over two orders of magnitude. The Taylor-Galerkin and Petrov-Galerkin algorithms are evaluated for 2D inviscid flows on criteria such as solution accuracy, shock resolution, computational speed and storage requirements. The convergence rates for both algorithms are enhanced by local time-stepping schemes. Extension of the vectorization procedure for predicting 2D viscous and 3D inviscid flows are demonstrated. Conclusions are drawn regarding the applicability of the finite element procedures for realistic problems that require hundreds of thousands of nodes.

  4. Napping during the night shift and recovery after work among hospital nurses1

    PubMed Central

    Palermo, Thaís Aparecida de Castro; Rotenberg, Lúcia; Zeitoune, Regina Célia Gollner; Silva-Costa, Aline; Souto, Ester Paiva; Griep, Rosane Härter

    2015-01-01

    OBJECTIVE: To analyze the association between the length of napping during the night shift and the recovery after work among nurses. METHOD: Cross-sectional epidemiological study involving 1940 nurses from 18 public hospitals in the City of Rio de Janeiro. A multidimensional and self-applied questionnaire was used with information about health, sociodemographic and occupational characteristics, health-related behaviors and housework. Multiple logistic regression was applied to identify the association, adjusted for confounding variables. RESULTS: The gross analyses showed 44%, 127% and 66% higher chances of a high level of recovery after work for nurses who sleep up to two hours, between 2.1 and 3 hours and 3.1 hours or more, respectively, when compared to the nurses who do not sleep. After adjusting for confounding variables, the association only continues significant for the group that sleeps 2.1 to 3 hours during the night shift (OR=1.79; 95%CI=1.33-2.41). CONCLUSION: The association between the length of napping and the high level of recovery after work, confirmed in the present results, can be included in the studies that aim to support more appropriate policies aimed at improving the workers' work, life and health conditions, not only in nursing, but night-shift workers in general. PMID:25806639

  5. Gallid herpesvirus 3 SB-1 strain as a recombinant viral vector for poultry vaccination.

    PubMed

    Sadigh, Yashar; Powers, Claire; Spiro, Simon; Pedrera, Miriam; Broadbent, Andrew; Nair, Venugopal

    2018-01-01

    Live herpesvirus-vectored vaccines are widely used in veterinary medicine to protect against many infectious diseases. In poultry, three strains of herpesvirus vaccines are used against Marek's disease (MD). However, of these, only the herpesvirus of turkeys (HVT) has been successfully developed and used as a recombinant vaccine vector to induce protection against other avian viral diseases such as infectious bursal disease (IBD), Newcastle disease (ND) or avian influenza (AI). Although effective when administered individually, recombinant HVT vectors have limitations when combined in multivalent vaccines. Thus there is a need for developing additional viral vectors that could be combined with HVT in inducing protection against multiple avian diseases in multivalent vaccines. Gallid herpesvirus 3 (GaHV3) strain SB-1 is widely used by the poultry industry as bivalent vaccine in combination with HVT to exploit synergistic effects against MD. Here, we report the development and application of SB-1 as a vaccine vector to express the VP2 capsid antigen of IBD virus. A VP2 expression cassette was introduced into the SB-1 genome at three intergenic locations (UL3/UL4, UL10/UL11 and UL21/UL22) using recombineering methods on the full-length pSB-1 infectious clone of the virus. We show that the recombinant SB-1 vectors expressing VP2 induced neutralising antibody responses at levels comparable to that of commercial HVT-based VAXXITEK HVT+IBD vaccine. Birds vaccinated with the experimental recombinant SB-1 vaccine were protected against clinical disease after challenge with the very virulent UK661 IBDV isolate, demonstrating its value as an efficient viral vector for developing multivalent vaccines against avian diseases.

  6. Vectorized and multitasked solution of the few-group neutron diffusion equations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zee, S.K.; Turinsky, P.J.; Shayer, Z.

    1989-03-01

    A numerical algorithm with parallelism was used to solve the two-group, multidimensional neutron diffusion equations on computers characterized by shared memory, vector pipeline, and multi-CPU architecture features. Specifically, solutions were obtained on the Cray X/MP-48, the IBM-3090 with vector facilities, and the FPS-164. The material-centered mesh finite difference method approximation and outer-inner iteration method were employed. Parallelism was introduced in the inner iterations using the cyclic line successive overrelaxation iterative method and solving in parallel across lines. The outer iterations were completed using the Chebyshev semi-iterative method that allows parallelism to be introduced in both space and energy groups. Formore » the three-dimensional model, power, soluble boron, and transient fission product feedbacks were included. Concentrating on the pressurized water reactor (PWR), the thermal-hydraulic calculation of moderator density assumed single-phase flow and a closed flow channel, allowing parallelism to be introduced in the solution across the radial plane. Using a pinwise detail, quarter-core model of a typical PWR in cycle 1, for the two-dimensional model without feedback the measured million floating point operations per second (MFLOPS)/vector speedups were 83/11.7. 18/2.2, and 2.4/5.6 on the Cray, IBM, and FPS without multitasking, respectively. Lower performance was observed with a coarser mesh, i.e., shorter vector length, due to vector pipeline start-up. For an 18 x 18 x 30 (x-y-z) three-dimensional model with feedback of the same core, MFLOPS/vector speedups of --61/6.7 and an execution time of 0.8 CPU seconds on the Cray without multitasking were measured. Finally, using two CPUs and the vector pipelines of the Cray, a multitasking efficiency of 81% was noted for the three-dimensional model.« less

  7. “Stealth” Adenoviruses Blunt Cell-Mediated and Humoral Immune Responses against the Virus and Allow for Significant Gene Expression upon Readministration in the Lung

    PubMed Central

    Croyle, Maria A.; Chirmule, Narendra; Zhang, Yi; Wilson, James M.

    2001-01-01

    Most of the early gene therapy trials for cystic fibrosis have been with adenovirus vectors. First-generation viruses with E1a and E1b deleted are limited by transient expression of the transgene and substantial inflammatory responses. Gene transfer is also significantly curtailed following a second dose of virus. In an effort to reduce adenovirus-associated inflammation, capsids of first-generation vectors were modified with various activated monomethoxypolyethylene glycols. Cytotoxic T-lymphocyte production was significantly reduced in C57BL/6 mice after a single intratracheal administration of modified vectors, and length of gene expression was extended from 4 to 42 days. T-cell subsets from mice exposed to the conjugated vectors demonstrated a marked decrease in Th1 responses and slight enhancement of Th2 responses compared to animals dosed with native virus. Neutralizing antibodies (NAB) against adenovirus capsid proteins were reduced in serum and bronchoalveolar lavage fluid of animals after a single dose of modified virus, allowing significant levels of gene expression upon rechallenge with native adenovirus. Modification with polyethylene glycol (PEG) also allowed substantial gene expression from the new vectors in animals previously immunized with unmodified virus. However, gene expression was significantly reduced after two doses of the same PEG-conjugated vector. Alternating the activation group of PEG between doses did produce significant gene expression upon readministration. This technology in combination with second-generation or helper-dependent adenovirus could produce dosing strategies which promote successful readministration of vector in clinical trials and marked expression in patients with significant anti-adenovirus NAB levels and reduce the possibility of immune reactions against viral vectors for gene therapy. PMID:11312351

  8. Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli

    PubMed Central

    Jacobus, Ana Paula; Gross, Jeferson

    2015-01-01

    PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5′ termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories. PMID:25774528

  9. Modeling and parameterization of photoelectrons emitted in condensed matter by linearly polarized synchrotron radiation

    NASA Astrophysics Data System (ADS)

    Jablonski, A.

    2018-01-01

    Growing availability of synchrotron facilities stimulates an interest in quantitative applications of hard X-ray photoemission spectroscopy (HAXPES) using linearly polarized radiation. An advantage of this approach is the possibility of continuous variation of radiation energy that makes it possible to control the sampling depth for a measurement. Quantitative applications are based on accurate and reliable theory relating the measured spectral features to needed characteristics of the surface region of solids. A major complication in the case of polarized radiation is an involved structure of the photoemission cross-section for hard X-rays. In the present work, details of the relevant formalism are described and algorithms implementing this formalism for different experimental configurations are proposed. The photoelectron signal intensity may be considerably affected by variation in the positioning of the polarization vector with respect to the surface plane. This information is critical for any quantitative application of HAXPES by polarized X-rays. Different quantitative applications based on photoelectrons with energies up to 10 keV are considered here: (i) determination of surface composition, (ii) estimation of sampling depth, and (iii) measurements of an overlayer thickness. Parameters facilitating these applications (mean escape depths, information depths, effective attenuation lengths) were calculated for a number of photoelectron lines in four elemental solids (Si, Cu, Ag and Au) in different experimental configurations and locations of the polarization vector. One of the considered configurations, with polarization vector located in a plane perpendicular to the surface, was recommended for quantitative applications of HAXPES. In this configurations, it was found that the considered parameters vary weakly in the range of photoelectron emission angles from normal emission to about 50° with respect to the surface normal. The averaged values of the mean escape depth and effective attenuation length were approximated with accurate predictive formulas. The predicted effective attenuation lengths were compared with published values; major discrepancies observed can be ascribed to a possibility of discontinuous structure of the deposited overlayer.

  10. Comprehensive Study on the Impact of the Cation Alkyl Side Chain Length on the Solubility of Water in Ionic Liquids.

    PubMed

    Kurnia, Kiki A; Neves, Catarina M S S; Freire, Mara G; Santos, Luís M N B F; Coutinho, João A P

    2015-10-01

    A comprehensive study on the phase behaviour of two sets of ionic liquids (ILs) and their interactions with water is here presented through combining experimental and theoretical approaches. The impact of the alkyl side chain length and the cation symmetry on the water solubility in the asymmetric [C N- 1 C 1 im][NTf 2 ] and symmetric [C N- 1 C N- 1 im][NTf 2 ] series of ILs ( N up to 22), from 288.15 K to 318.15 K and at atmospheric pressure, was studied. The experimental data reveal that the solubility of water in ILs with an asymmetric cation is higher than in those with the symmetric isomer. Several trend shifts on the water solubility as a function of the alkyl side chain length were identified, namely at [C 6 C 1 im][NTf 2 ] for asymmetric ILs and at [C 4 C 4 im][NTf 2 ] and [C 7 C 7 im][NTf 2 ] for the symmetric ILs. To complement the experimental data and to further investigate the molecular-level mechanisms behind the dissolution process, Density Functional Theory calculations, using the Conductor-like Screening Model for Real Solvents (COSMO-RS) and the Electrostatic potential-derived CHelpG, were performed. The COSMO-RS model is able to qualitatively predict water solubility as function of temperature and alkyl chain lengths of both symmetric and asymmetric cations. Furthermore, the model is also capable to predict the somewhat higher water solubility in the asymmetric cation, as well as the trend shift as function of alkyl chain lengths experimentally observed. Both COSMO-RS and the electrostatic potential-derived CHelpG show that the interactions of water and the IL cation take place on the IL polar region, namely on the aromatic head and adjacent methylene groups what explains the differences in water solubility observed for cations with different chain lengths. Furthermore, the CHelpG calculations for the isolated cations in the gas phase indicates that the trend shift of water solubility as function of alkyl chain lengths and the difference of water solubility in symmetric may also result from the partial positive charge distribution/contribution of the cation.

  11. Bartonella quintana Deploys Host and Vector Temperature-Specific Transcriptomes

    PubMed Central

    Previte, Domenic; Yoon, Kyong S.; Clark, J. Marshall; DeRisi, Joseph L.; Koehler, Jane E.

    2013-01-01

    The bacterial pathogen Bartonella quintana is passed between humans by body lice. B. quintana has adapted to both the human host and body louse vector niches, producing persistent infection with high titer bacterial loads in both the host (up to 105 colony-forming units [CFU]/ml) and vector (more than 108 CFU/ml). Using a novel custom microarray platform, we analyzed bacterial transcription at temperatures corresponding to the host (37°C) and vector (28°C), to probe for temperature-specific and growth phase-specific transcriptomes. We observed that transcription of 7% (93 genes) of the B. quintana genome is modified in response to change in growth phase, and that 5% (68 genes) of the genome is temperature-responsive. Among these transcriptional changes in response to temperature shift and growth phase was the induction of known B. quintana virulence genes and several previously unannotated genes. Hemin binding proteins, secretion systems, response regulators, and genes for invasion and cell attachment were prominent among the differentially-regulated B. quintana genes. This study represents the first analysis of global transcriptional responses by B. quintana. In addition, the in vivo experiments provide novel insight into the B. quintana transcriptional program within the body louse environment. These data and approaches will facilitate study of the adaptation mechanisms employed by Bartonella during the transition between human host and arthropod vector. PMID:23554923

  12. Early effects of climate change: do they include changes in vector-borne disease?

    PubMed Central

    Kovats, R S; Campbell-Lendrum, D H; McMichael, A J; Woodward, A; Cox, J S

    2001-01-01

    The world's climate appears now to be changing at an unprecedented rate. Shifts in the distribution and behaviour of insect and bird species indicate that biological systems are already responding to this change. It is well established that climate is an important determinant of the spatial and temporal distribution of vectors and pathogens. In theory, a change in climate would be expected to cause changes in the geographical range, seasonality (intra-annual variability), and in the incidence rate (with or without changes in geographical or seasonal patterns). The detection and then attribution of such changes to climate change is an emerging task for scientists. We discuss the evidence required to attribute changes in disease and vectors to the early effects of anthropogenic climate change. The literature to date indicates that there is a lack of strong evidence of the impact of climate change on vector-borne diseases (i.e. malaria, dengue, leishmaniasis, tick-borne diseases). New approaches to monitoring, such as frequent and long-term sampling along transects to monitor the full latitudinal and altitudinal range of specific vector species, are necessary in order to provide convincing direct evidence of climate change effects. There is a need to reassess the appropriate levels of evidence, including dealing with the uncertainties attached to detecting the health impacts of global change. PMID:11516383

  13. Distribution of AAV8 particles in cell lysates and culture media changes with time and is dependent on the recombinant vector

    PubMed Central

    Piras, Bryan A; Drury, Jason E; Morton, Christopher L; Spence, Yunyu; Lockey, Timothy D; Nathwani, Amit C; Davidoff, Andrew M; Meagher, Michael M

    2016-01-01

    With clinical trials ongoing, efficient clinical production of adeno-associated virus (AAV) to treat large numbers of patients remains a challenge. We compared distribution of AAV8 packaged with Factor VIII (FVIII) in cell culture media and lysates on days 3, 5, 6, and 7 post-transfection and found increasing viral production through day 6, with the proportion of viral particles in the media increasing from 76% at day 3 to 94% by day 7. Compared to FVIII, AAV8 packaged with Factor IX and Protective Protein/Cathepsin A vectors demonstrated a greater shift from lysate towards media from day 3 to 6, implying that particle distribution is dependent on recombinant vector. Larger-scale productions showed that the ratio of full-to-empty AAV particles is similar in media and lysate, and that AAV harvested on day 6 post-transfection provides equivalent function in mice compared to AAV harvested on day 3. This demonstrates that AAV8 production can be optimized by prolonging the duration of culture post-transfection, and simplified by allowing harvest of media only, with disposal of cells that contain 10% or less of total vector yield. Additionally, the difference in particle distribution with different expression cassettes implies a recombinant vector-dependent processing mechanism which should be taken into account during process development. PMID:27069949

  14. Morphometric discrimination of two sympatric sibling species in the Palaearctic region, Culicoides obsoletus Meigen and C. scoticus Downes & Kettle (Diptera: Ceratopogonidae), vectors of bluetongue and Schmallenberg viruses.

    PubMed

    Kluiters, G; Pagès, N; Carpenter, S; Gardès, L; Guis, H; Baylis, M; Garros, C

    2016-05-04

    Some Palaearctic biting midge species (subgenus Avaritia) have been implicated as vectors of bluetongue virus in northern Europe. Separation of two species (C. obsoletus and C. scoticus) is considered difficult morphologically and, often, these female specimens are grouped in entomological studies. However, species-specific identification is desirable to understand their life history characteristics, assess their roles in disease transmission or measure their abundance during arboviral outbreaks. This study aims to investigate whether morphometric identification techniques can be applied to female C. obsoletus and C. scoticus individuals trapped at different geographical regions and time periods during the vector season. C. obsoletus and C. scoticus were collected using light-suction traps from the UK, France and Spain, with two geographical locations sampled per country. A total of 759 C. obsoletus/C. scoticus individuals were identified using a molecular assay based on the cytochrome c oxidase subunit I gene. Fifteen morphometric measurements were taken from the head, wings and abdomen of slide-mounted specimens, and ratios calculated between these measurements. Multivariate analyses explored whether a combination of morphometric variables could lead to accurate species identification. Finally, Culicoides spp. collected in France at the start, middle and end of the adult vector season were compared, to determine whether seasonal variation exists in any of the morphometric measurements. The principal component analyses revealed that abdominal characteristics: length and width of the smaller and larger spermathecae, and the length of the chitinous plates and width between them, are the most reliable morphometric characteristics to differentiate between the species. Seasonal variation in the size of each species was observed for head and wing measurements, but not abdominal measurements. Geographical variation in the size of Culicoides spp. was also observed and is likely to be related to temperature at the trapping sites, with smaller individuals trapped at more southern latitudes. Our results suggest that female C. obsoletus and C. scoticus individuals can be separated under a stereomicroscope using abdominal measurements. Although we show the length and width of the spermathecae can be used to differentiate between the species, this can be time-consuming, so we recommend undertaking this using standardized subsampling of catches.

  15. Why is it important to study malaria epidemiology in India?

    PubMed

    Singh, Vineeta; Mishra, Neelima; Awasthi, Gauri; Dash, Aditya P; Das, Aparup

    2009-10-01

    Malaria is a major vector-borne disease in India. Based on vast geographic areas with associated topographic and climatic diversity, the variable malaria epidemiology in India is associated with high parasite genetic diversity and rapidly evolving drug resistance, differential distribution of vector species and emerging insecticide resistance and underlying human genetic diversity and past evolutionary histories. Further, changing climatic patterns have possibly changed malaria epidemiology to a great extent. The outcome of these changes is an increased incidence of Plasmodium falciparum over the P. vivax malaria in recent years. Accordingly, the drug and insecticide application policy in India has changed too. The above facts and associated rapid shifting trend of malaria epidemiology makes India a hot-spot for malaria research.

  16. Helicons in uniform fields. II. Poynting vector and angular momenta

    NASA Astrophysics Data System (ADS)

    Stenzel, R. L.; Urrutia, J. M.

    2018-03-01

    The orbital and spin angular momenta of helicon modes have been determined quantitatively from laboratory experiments. The current density is obtained unambiguously from three dimensional magnetic field measurements. The only approximation made is to obtain the electric field from Hall Ohm's law which is usually the case for low frequency whistler modes. This allows the evaluation of the Poynting vector from which the angular momentum is obtained. Comparing two helicon modes (m = 0 and m = 1), one can separate the contribution of angular momentum of a rotating and non-rotating wave field. The orbital angular momentum is important to assess the wave-particle interaction by the transverse Doppler shift of rotating waves which has not been considered so far.

  17. Valley-isospin dependence of the quantum Hall effect in a graphene p-n junction

    NASA Astrophysics Data System (ADS)

    Tworzydło, J.; Snyman, I.; Akhmerov, A. R.; Beenakker, C. W. J.

    2007-07-01

    We calculate the conductance G of a bipolar junction in a graphene nanoribbon, in the high-magnetic-field regime where the Hall conductance in the p -doped and n -doped regions is 2e2/h . In the absence of intervalley scattering, the result G=(e2/h)(1-cosΦ) depends only on the angle Φ between the valley isospins ( =Bloch vectors representing the spinor of the valley polarization) at the two opposite edges. This plateau in the conductance versus Fermi energy is insensitive to electrostatic disorder, while it is destabilized by the dispersionless edge state which may exist at a zigzag boundary. A strain-induced vector potential shifts the conductance plateau up or down by rotating the valley isospin.

  18. Protection from Muscle Damage in the Absence of Changes in Muscle Mechanical Behavior.

    PubMed

    Hoffman, Ben W; Cresswell, Andrew G; Carroll, Timothy J; Lichtwark, Glen A

    2016-08-01

    The repeated bout effect characterizes the protective adaptation after a single bout of unaccustomed eccentric exercise that induces muscle damage. Sarcomerogenesis and increased tendon compliance have been suggested as potential mechanisms for the repeated bout effect by preventing muscle fascicles from being stretched onto the descending limb of the length-tension curve (the region where sarcomere damage is thought to occur). In this study, evidence was sought for three possible mechanical changes that would support either the sarcomerogenesis or the increased tendon compliance hypotheses: a sustained rightward shift in the fascicle length-tension relationship, reduced fascicle strain amplitude, and reduced starting fascicle length. Subjects (n = 10) walked backward downhill (5 km·h, 20% incline) on a treadmill for 30 min on two occasions separated by 7 d. Kinematic data and medial gastrocnemius fascicle lengths (ultrasonography) were recorded at 10-min intervals to compare fascicle strains between bouts. Fascicle length-torque curves from supramaximal tibial nerve stimulation were constructed before, 2 h after, and 2 d after each exercise bout. Maximum torque decrement and elevated muscle soreness were present after the first, but not the second, backward downhill walking bout signifying a protective repeated bout effect. There was no sustained rightward shift in the length-torque relationship between exercise bouts, nor decreases in fascicle strain amplitude or shortening of the starting fascicle length. Protection from a repeated bout of eccentric exercise was conferred without changes in muscle fascicle strain behavior, indicating that sarcomerogenesis and increased tendon compliance were unlikely to be responsible. As fascicle strains are relatively small in humans, we suggest that changes to connective tissue structures, such as extracellular matrix remodeling, are better able to explain the repeated bout effect observed here.

  19. Improvements in Block-Krylov Ritz Vectors and the Boundary Flexibility Method of Component Synthesis

    NASA Technical Reports Server (NTRS)

    Carney, Kelly Scott

    1997-01-01

    A method of dynamic substructuring is presented which utilizes a set of static Ritz vectors as a replacement for normal eigenvectors in component mode synthesis. This set of Ritz vectors is generated in a recurrence relationship, proposed by Wilson, which has the form of a block-Krylov subspace. The initial seed to the recurrence algorithm is based upon the boundary flexibility vectors of the component. Improvements have been made in the formulation of the initial seed to the Krylov sequence, through the use of block-filtering. A method to shift the Krylov sequence to create Ritz vectors that will represent the dynamic behavior of the component at target frequencies, the target frequency being determined by the applied forcing functions, has been developed. A method to terminate the Krylov sequence has also been developed. Various orthonormalization schemes have been developed and evaluated, including the Cholesky/QR method. Several auxiliary theorems and proofs which illustrate issues in component mode synthesis and loss of orthogonality in the Krylov sequence have also been presented. The resulting methodology is applicable to both fixed and free- interface boundary components, and results in a general component model appropriate for any type of dynamic analysis. The accuracy is found to be comparable to that of component synthesis based upon normal modes, using fewer generalized coordinates. In addition, the block-Krylov recurrence algorithm is a series of static solutions and so requires significantly less computation than solving the normal eigenspace problem. The requirement for less vectors to form the component, coupled with the lower computational expense of calculating these Ritz vectors, combine to create a method more efficient than traditional component mode synthesis.

  20. Shift work parameters and disruption of diurnal cortisol production in female hospital employees.

    PubMed

    Hung, Eleanor Wai Man; Aronson, Kristan J; Leung, Michael; Day, Andrew; Tranmer, Joan

    2016-01-01

    Shift work is associated with an increased risk of cardiovascular diseases (CVD). Disruption of cortisol production is a potential underlying mechanism. This study explored the associations of diurnal quantity and pattern of cortisol production in relation to (1) current shift work status (exclusive day versus rotating days and nights), (2) years of past shift work and (3) parameters of rotating shift work (timing, length and intensity). Female hospital employees (160 day workers and 168 rotating shift workers) from southeastern Ontario, Canada, participated in a cross-sectional study. Participants completed a baseline questionnaire and measures of body height, weight, and waist circumference were taken. Midstream urine samples were collected over two separate 24-hour periods to measure creatinine-adjusted cortisol. Total diurnal cortisol production and pattern were described with two measures of the area under the curve. The effect of shift work on cortisol was modeled using multivariable linear regression analyses. Cortisol production in day workers and shift workers on their day shift were similar; however, shift workers on the night shift had flatter diurnal cortisol curves and produced less cortisol. This suggests that night work is associated with an acute attenuation of cortisol production.

  1. Nanoscale shift of the intensity distribution of dipole radiation.

    PubMed

    Shu, Jie; Li, Xin; Arnoldus, Henk F

    2009-02-01

    The energy flow lines (field lines of the Poynting vector) for radiation emitted by a dipole are in general curves, rather than straight lines. For a linear dipole the field lines are straight, but when the dipole moment of a source rotates, the field lines wind numerous times around an axis, which is perpendicular to the plane of rotation, before asymptotically approaching a straight line. We consider an elliptical dipole moment, representing the most general state of oscillation, and this includes the linear dipole as a special case. Due to the spiraling near the source, for the case of a rotating dipole moment, the field lines in the far field are displaced with respect to the outward radial direction, and this leads to a shift of the intensity distribution of the radiation in the far field. This shift is shown to be independent of the distance to the source and, although of nanoscale dimension, should be experimentally observable.

  2. Relativistic Quark Model Based Description of Low Energy NN Scattering

    NASA Astrophysics Data System (ADS)

    Antalik, R.; Lyubovitskij, V. E.

    A model describing the NN scattering phase shifts is developed. Two nucleon interactions induced by meson exchange forces are constructed starting from π, η, η‧ pseudoscalar-, the ρ, ϕ, ω vector-, and the ɛ(600), a0, f0(1400) scalar — meson-nucleon coupling constants, which we obtained within a relativistic quantum field theory based quark model. Working within the Blankenbecler-Sugar-Logunov-Tavkhelidze quasipotential dynamics, we describe the NN phase shifts in a relativistically invariant way. In this procedure we use phenomenological form factor cutoff masses and effective ɛ and ω meson-nucleon coupling constants, only. Resulting NN phase shifts are in a good agreement with both, the empirical data, and the entirely phenomenological Bonn OBEP model fit. While the quality of our description, evaluated as a ratio of our results to the Bonn OBEP model χ2 ones is about 1.2, other existing (semi)microscopic results gave qualitative results only.

  3. Validation of a recombinant human bactericidal/permeability-increasing protein (hBPI) expression vector using murine mammary gland tumor cells and the early development of hBPI transgenic goat embryos.

    PubMed

    Gui, Tao; Liu, Xing; Tao, Jia; Chen, Jianwen; Li, Yunsheng; Zhang, Meiling; Wu, Ronghua; Zhang, Yuanliang; Peng, Kaisong; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai

    2013-12-01

    Human bactericidal/permeability-increasing protein (hBPI) is the only antibacterial peptide which acts against both gram-negative bacteria and neutralizes endotoxins in human polymorphonuclear neutrophils; therefore, hBPI is of great value in clinical applications. In the study, we constructed a hBPI expression vector (pBC1-Loxp-Neo-Loxp-hBPI) containing the full-length hBPI coding sequence which could be specifically expressed in the mammary gland. To validate the function of the vector, in vitro cultured C127 (mouse mammary Carcinoma Cells) were transfected with the vector, and the transgenic cell clones were selected to express hBPI by hormone induction. The mRNA and protein expression of hBPI showed that the constructed vector was effective and suitable for future application in producing mammary gland bioreactor. Then, female and male goat fibroblasts were transfected with the vector, and two male and two female transgenic clonal cell lines were obtained. Using the transgenic cell lines as nuclear donors for somatic cell nuclear transfer, the reconstructed goat embryos produced from all four clones could develop to blastocysts in vitro. In conclusion, we constructed and validated an efficient mammary gland-specific hBPI expression vector, pBC1-Loxp-Neo-Loxp-hBPI, and transgenic hBPI goat embryos were successfully produced, laying foundations for future production of recombinant hBPI in goat mammary gland. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Three-dimensional motion-picture imaging of dynamic object by parallel-phase-shifting digital holographic microscopy using an inverted magnification optical system

    NASA Astrophysics Data System (ADS)

    Fukuda, Takahito; Shinomura, Masato; Xia, Peng; Awatsuji, Yasuhiro; Nishio, Kenzo; Matoba, Osamu

    2017-04-01

    We constructed a parallel-phase-shifting digital holographic microscopy (PPSDHM) system using an inverted magnification optical system, and succeeded in three-dimensional (3D) motion-picture imaging for 3D displacement of a microscopic object. In the PPSDHM system, the inverted and afocal magnification optical system consisted of a microscope objective (16.56 mm focal length and 0.25 numerical aperture) and a convex lens (300 mm focal length and 82 mm aperture diameter). A polarization-imaging camera was used to record multiple phase-shifted holograms with a single-shot exposure. We recorded an alum crystal, sinking down in aqueous solution of alum, by the constructed PPSDHM system at 60 frames/s for about 20 s and reconstructed high-quality 3D motion-picture image of the crystal. Then, we calculated amounts of displacement of the crystal from the amounts in the focus plane and the magnifications of the magnification optical system, and obtained the 3D trajectory of the crystal by that amounts.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schmidt, T.; Imhof, A.; Ingold, G.

    To vary the polarization vector of an APPLE II undulator continuously from 0 - 180 deg., all four magnet arrays need to be movable. Following the adjustable-phase undulator approach by R. Carr, a 3.4 m long fixed gap undulator for SLS with a gap of 11.6 mm has been constructed. It will be installed in fall 2006. The gap drive is replaced by a pair-wise shift of the magnet arrays to change the energy, while the polarization is changed by shifts of diagonal arrays. The high injection efficiency and standard operation top-up mode at the SLS allows this simplified undulatormore » design. The design as well as the operational aspects will be discussed.« less

  6. D mesons in a magnetic field

    DOE PAGES

    Gubler, Philipp; Hattori, Koichi; Lee, Su Houng; ...

    2016-03-15

    In this paper, we investigate the mass spectra of open heavy flavor mesons in an external constant magnetic field within QCD sum rules. Spectral Ansatze on the phenomenological side are proposed in order to properly take into account mixing effects between the pseudoscalar and vector channels, and the Landau levels of charged mesons. The operator product expansion is implemented up to dimension-5 operators. As a result, we find for neutral D mesons a significant positive mass shift that goes beyond simple mixing effects. In contrast, charged D mesons are further subject to Landau level effects, which together with the mixingmore » effects almost completely saturate the mass shifts obtained in our sum rule analysis.« less

  7. Numerical analysis for trajectory controllability of a coupled multi-order fractional delay differential system via the shifted Jacobi method

    NASA Astrophysics Data System (ADS)

    Priya, B. Ganesh; Muthukumar, P.

    2018-02-01

    This paper deals with the trajectory controllability for a class of multi-order fractional linear systems subject to a constant delay in state vector. The solution for the coupled fractional delay differential equation is established by the Mittag-Leffler function. The necessary and sufficient condition for the trajectory controllability is formulated and proved by the generalized Gronwall's inequality. The approximate trajectory for the proposed system is obtained through the shifted Jacobi operational matrix method. The numerical simulation of the approximate solution shows the theoretical results. Finally, some remarks and comments on the existing results of constrained controllability for the fractional dynamical system are also presented.

  8. Packing of poly(tetrafluoroethylene) in the liquid state: Molecular dynamics simulation and theory

    NASA Astrophysics Data System (ADS)

    Tsige, Mesfin; Curro, John G.; Grest, Gary S.

    2008-12-01

    Molecular dynamics simulations and polymer reference interaction site model theory calculations were carried out on the C48F98 oligomer of poly(tetrafluoroethylene) (PTFE) at 500 and 600 K. The exp-6 force field of Borodin, Smith, and Bedrov, was used in both the simulation and theory. The agreement between theory and simulation was equivalent to earlier studies on polyolefin melts. The intermolecular pair correlation functions of PTFE were shifted to larger distances relative to polyethylene (PE) due to the difference in the van der Waals radii of F and H atoms. A similar shift to lower wave vectors was found in the structure factor of PTFE relative to PE.

  9. Femtosecond-pulse inscription of fiber Bragg gratings with single or multiple phase-shifts in the structure

    NASA Astrophysics Data System (ADS)

    Wolf, Alexey; Dostovalov, Alexandr; Skvortsov, Mikhail; Raspopin, Kirill; Parygin, Alexandr; Babin, Sergey

    2018-05-01

    In this work, long high-quality fiber Bragg gratings with phase shifts in the structure are inscribed directly in the optical fiber by point-by-point technique using femtosecond laser pulses. Phase shifts are introduced during the inscription process with a piezoelectric actuator, which rapidly shifts the fiber along the direction of its movement in a chosen point of the grating with a chosen shift value. As examples, single and double π phase shifts are introduced in fiber Bragg gratings with a length up to 34 mm in passive fibers, which provide corresponding transmission peaks with bandwidth less than 1 pm. It is shown that 37 mm π -phase-shifted grating inscribed in an active Er-doped fiber forms high-quality DFB laser cavity generating single-frequency radiation at 1550 nm with bandwidth of 20 kHz and signal-to-noise ratio of >70 dB. The inscription technique has a high degree of performance and flexibility and can be easily implemented in fibers of various types.

  10. Evaluation of setup uncertainties for single-fraction SRS by comparing two different mask-creation methods

    NASA Astrophysics Data System (ADS)

    Baek, Jong Geun; Jang, Hyun Soo; Oh, Young Kee; Lee, Hyun Jeong; Kim, Eng Chan

    2015-07-01

    The purpose of this study was to evaluate the setup uncertainties for single-fraction stereotactic radiosurgery (SF-SRS) based on clinical data with two different mask-creation methods using pretreatment con-beam computed tomography imaging guidance. Dedicated frameless fixation Brain- LAB masks for 23 patients were created as a routine mask (R-mask) making method, as explained in the BrainLAB's user manual. Alternative masks (A-masks), which were created by modifying the cover range of the R-masks for the patient's head, were used for 23 patients. The systematic errors including these for each mask and stereotactic target localizer were analyzed, and the errors were calculated as the means ± standard deviations (SD) from the left-right (LR), superior-inferior (SI), anterior-posterior (AP), and yaw setup corrections. In addition, the frequencies of the threedimensional (3D) vector length were analyzed. The values of the mean setup corrections for the R-mask in all directions were < 0.7 mm and < 0.1°, whereas the magnitudes of the SDs were relatively large compared to the mean values. In contrast, the means and SDs of the A-mask were smaller than those for the R-mask with the exception of the SD in the AP direction. The means and SDs in the yaw rotational direction for the R-mask and the A-mask system were comparable. 3D vector shifts of larger magnitude occurred more frequently for the R-mask than the A-mask. The setup uncertainties for each mask with the stereotactic localizing system had an asymmetric offset towards the positive AP direction. The A-mask-creation method, which is capable of covering the top of the patient's head, is superior to that for the R-mask, so the use of the A-mask is encouraged for SF-SRS to reduce the setup uncertainties. Moreover, careful mask-making is required to prevent possible setup uncertainties.

  11. A motion picture presentation of magnetic pulsations

    NASA Technical Reports Server (NTRS)

    Suzuki, A.; Kim, J. S.; Sugura, M.; Nagano, H.

    1981-01-01

    Using the data obtained from the IMS North American magnetometer network stations at high latitudes, a motion picture was made by a computer technique, describing time changes of Pc5 and Pi3 magnetic pulsation vectors. Examples of pulsation characteristics derived from this presentation are regional polarization changes including shifts of polarization demarcation lines, changes in the extent of an active region and its movement with time.

  12. Development of an hypothesis for simulating anti-orthostatic bed rest

    NASA Technical Reports Server (NTRS)

    Leonard, J. I.; Grounds, D. J.; Fitzjerrell, D. G.

    1978-01-01

    The Guyton model, modified by the addition of leg compartments and the effect of the gravity vector, was used to evaluate hypotheses describing leg dehydration and fluid shifts. While the study is not complete, the basic approach was shown to be useful by identifying important mechanisms, identifying systems which need further experimental description and by assisting in the development of a general hypothesis.

  13. Cancelable biometrics realization with multispace random projections.

    PubMed

    Teoh, Andrew Beng Jin; Yuang, Chong Tze

    2007-10-01

    Biometric characteristics cannot be changed; therefore, the loss of privacy is permanent if they are ever compromised. This paper presents a two-factor cancelable formulation, where the biometric data are distorted in a revocable but non-reversible manner by first transforming the raw biometric data into a fixed-length feature vector and then projecting the feature vector onto a sequence of random subspaces that were derived from a user-specific pseudorandom number (PRN). This process is revocable and makes replacing biometrics as easy as replacing PRNs. The formulation has been verified under a number of scenarios (normal, stolen PRN, and compromised biometrics scenarios) using 2400 Facial Recognition Technology face images. The diversity property is also examined.

  14. Design of single-polarization wavelength splitter based on photonic crystal fiber.

    PubMed

    Zhang, Shanshan; Zhang, Weigang; Geng, Pengcheng; Li, Xiaolan; Ruan, Juan

    2011-12-20

    A new single-polarization wavelength splitter based on the photonic crystal fiber (PCF) has been proposed. The full-vector finite-element method (FEM) is applied to analyze the single-polarization single-mode guiding properties. Splitting of two different wavelengths is realized by adjusting the structural parameters. The semi-vector three-dimensional beam propagation method is employed to confirm the wavelength splitting characteristics of the PCF. Numerical simulations show that the wavelengths of 1.3 μm and 1.55 μm are split for a fiber length of 10.7 mm with single-polarization guiding in each core. The crosstalk between the two cores is low over appreciable optical bandwidths.

  15. The inference of vector magnetic fields from polarization measurements with limited spectral resolution

    NASA Technical Reports Server (NTRS)

    Lites, B. W.; Skumanich, A.

    1985-01-01

    A method is presented for recovery of the vector magnetic field and thermodynamic parameters from polarization measurement of photospheric line profiles measured with filtergraphs. The method includes magneto-optic effects and may be utilized on data sampled at arbitrary wavelengths within the line profile. The accuracy of this method is explored through inversion of synthetic Stokes profiles subjected to varying levels of random noise, instrumental wave-length resolution, and line profile sampling. The level of error introduced by the systematic effect of profile sampling over a finite fraction of the 5 minute oscillation cycle is also investigated. The results presented here are intended to guide instrumental design and observational procedure.

  16. Cross-Sectional and Longitudinal Investigation of the Power Vector in Astigmatism: The Yamagata Study (Funagata).

    PubMed

    Namba, Hiroyuki; Kawasaki, Ryo; Sugano, Akira; Nishi, Katsuhiro; Murakami, Takanori; Nishitsuka, Koichi; Kato, Takeo; Kayama, Takamasa; Yamashita, Hidetoshi

    2018-01-01

    To investigate how age and other factors affect astigmatism in Japanese adults over a period of 5 years. We included 512 Japanese participants who had undergone systemic and ophthalmological examinations both in 2005-2007 and in 2010-2012 in Funagata town, Yamagata, Japan. Astigmatism was evaluated using power vector analyses, where J0 represents the power of orthogonal astigmatism. Positive values of J0 indicate with-the-rule astigmatism, whereas negative values indicate against-the-rule (ATR). In this cross-sectional investigation, J0 represented the power of orthogonal astigmatism, and multivariate regression revealed that both J0 and corneal J0 (cJ0) declined with increasing age (both P < 0.001). In a longitudinal investigation spanning 5 years, the mean amounts of change (Δ) in J0 and ΔcJ0 were -0.045 ± 0.308 and -0.072 ± 0.278, respectively. This confirmed an ATR shift with increasing age in most individuals. The age-divided distribution of the magnitude of differences indicated that older age was associated with a larger astigmatic change over a 5-year period in both the cornea and the entire eye. Using multivariate logistic regression, we observed that older age at baseline was a risk factor for low ΔJ0, indicating a large shift toward ATR astigmatism. We confirmed that a refractive and keratometric shift toward ATR astigmatism occurs with aging. Older age at baseline was also associated with a larger magnitude of astigmatic changes over the subsequent 5 years.

  17. Corneal Astigmatism Stability in Descemet Membrane Endothelial Keratoplasty for Fuchs Corneal Dystrophy.

    PubMed

    Yokogawa, Hideaki; Sanchez, P James; Mayko, Zachary M; Straiko, Michael D; Terry, Mark A

    2016-07-01

    To calculate the magnitude and angle of the shift in corneal astigmatism associated with Descemet membrane endothelial keratoplasty (DMEK) surgery to determine the feasibility of concurrent astigmatism correction at the time of DMEK triple procedures. Retrospective study. Forty-seven eyes that previously underwent the DMEK procedure for Fuchs endothelial corneal dystrophy and that had more than 1.0 diopter (D) of front corneal astigmatism preoperatively were identified. All DMEK surgeries used a clear corneal temporal incision of 3.2 mm. Surgically induced astigmatism (SIA) was evaluated 6 months postsurgery with vector analysis using Scheimpflug image reading. We did not find a difference between pre- and postoperative magnitude of front astigmatism (P = 0.88; paired t test). The magnitude of the SIA front surface was 0.77 ± 0.63 D (range, 0.10-3.14 D). The centroid vector of the SIA front surface was 0.14 at 89.3°. A hyperopic corneal power shift was noted in both the front surface by 0.26 ± 0.74 D (range, 0.45-3.05 D) (P = 0.018; paired t test) and back surface by 0.56 ± 0.55 D (range, 0.25-2.40 D) (P < 0.01; paired t test). DMEK surgery induces minimal amounts of corneal astigmatism that is a with-the-rule shift associated with a temporal clear corneal incision. The stability of these data from preop to postop supports the plausibility of incorporating astigmatism correction with the cautious use of toric intraocular lenses for patients with Fuchs corneal dystrophy and cataract.

  18. French invasive Asian tiger mosquito populations harbor reduced bacterial microbiota and genetic diversity compared to Vietnamese autochthonous relatives

    PubMed Central

    Minard, G.; Tran, F. H.; Van, Van Tran; Goubert, C.; Bellet, C.; Lambert, G.; Kim, Khanh Ly Huynh; Thuy, Trang Huynh Thi; Mavingui, P.; Valiente Moro, C.

    2015-01-01

    The Asian tiger mosquito Aedes albopictus is one of the most significant pathogen vectors of the twenty-first century. Originating from Asia, it has invaded a wide range of eco-climatic regions worldwide. The insect-associated microbiota is now recognized to play a significant role in host biology. While genetic diversity bottlenecks are known to result from biological invasions, the resulting shifts in host-associated microbiota diversity has not been thoroughly investigated. To address this subject, we compared four autochthonous Ae. albopictus populations in Vietnam, the native area of Ae. albopictus, and three populations recently introduced to Metropolitan France, with the aim of documenting whether these populations display differences in host genotype and bacterial microbiota. Population-level genetic diversity (microsatellite markers and COI haplotype) and bacterial diversity (16S rDNA metabarcoding) were compared between field-caught mosquitoes. Bacterial microbiota from the whole insect bodies were largely dominated by Wolbachia pipientis. Targeted analysis of the gut microbiota revealed a greater bacterial diversity in which a fraction was common between French and Vietnamese populations. The genus Dysgonomonas was the most prevalent and abundant across all studied populations. Overall genetic diversities of both hosts and bacterial microbiota were significantly reduced in recently established populations of France compared to the autochthonous populations of Vietnam. These results open up many important avenues of investigation in order to link the process of geographical invasion to shifts in commensal and symbiotic microbiome communities, as such shifts may have dramatic impacts on the biology and/or vector competence of invading hematophagous insects. PMID:26441903

  19. Cloning of a very virulent plus, 686 strain of Marek’s disease virus as a bacterial artificial chromosome

    USDA-ARS?s Scientific Manuscript database

    Bacterial artificial chromosome (BAC) vectors were first developed to facilitate propagation and manipulation of large DNA fragments. This technology was later used to clone full-length genomes of large DNA viruses to study viral gene function. Marek’s disease virus (MDV) is a highly oncogenic herpe...

  20. Non-specific Patterns of Vector, Host, and Avian Malaria Parasite Associations in a Central African Rainforest

    PubMed Central

    Njabo, Kevin Y; Cornel, Anthony J.; Bonneaud, Camille; Toffelmier, Erin; Sehgal, R.N.M.; Valkiūnas, Gediminas; Russell, Andrew F.; Smith, Thomas B.

    2010-01-01

    Malaria parasites use vertebrate hosts for asexual multiplication and Culicidae mosquitoes for sexual and asexual development, yet the literature on avian malaria remains biased towards examining the asexual stages of the life cycle in birds. To fully understand parasite evolution and mechanism of malaria transmission, knowledge of all three components of the vector-host-parasite system is essential. Little is known about avian parasite-vector associations in African rainforests where numerous species of birds are infected with avian haemosporidians of the genera Plasmodium and Haemoproteus. Here we applied high resolution melt qPCR-based techniques and nested PCR to examine the occurrence and diversity of mitochondrial cytochrome b gene sequences of haemosporidian parasites in wild-caught mosquitoes sampled across 12 sites in Cameroon. In all, 3134 mosquitoes representing 27 species were screened. Mosquitoes belonging to four genera (Aedes, Coquillettidia, Culex, and Mansonia) were infected with twenty-two parasite lineages (18 Plasmodium spp. and 4 Haemoproteus spp.). Presence of Plasmodium sporozoites in salivary glands of Coquillettidia aurites further established these mosquitoes as likely vectors. Occurrence of parasite lineages differed significantly among genera, as well as their probability of being infected with malaria across species and sites. Approximately one-third of these lineages were previously detected in other avian host species from the region, indicating that vertebrate host sharing is a common feature and that avian Plasmodium spp. vector breadth does not always accompany vertebrate-host breadth. This study suggests extensive invertebrate host shifts in mosquito-parasite interactions and that avian Plasmodium species are most likely not tightly coevolved with vector species. PMID:21134011

  1. Switching non-local vector median filter

    NASA Astrophysics Data System (ADS)

    Matsuoka, Jyohei; Koga, Takanori; Suetake, Noriaki; Uchino, Eiji

    2016-04-01

    This paper describes a novel image filtering method that removes random-valued impulse noise superimposed on a natural color image. In impulse noise removal, it is essential to employ a switching-type filtering method, as used in the well-known switching median filter, to preserve the detail of an original image with good quality. In color image filtering, it is generally preferable to deal with the red (R), green (G), and blue (B) components of each pixel of a color image as elements of a vectorized signal, as in the well-known vector median filter, rather than as component-wise signals to prevent a color shift after filtering. By taking these fundamentals into consideration, we propose a switching-type vector median filter with non-local processing that mainly consists of a noise detector and a noise removal filter. Concretely, we propose a noise detector that proactively detects noise-corrupted pixels by focusing attention on the isolation tendencies of pixels of interest not in an input image but in difference images between RGB components. Furthermore, as the noise removal filter, we propose an extended version of the non-local median filter, we proposed previously for grayscale image processing, named the non-local vector median filter, which is designed for color image processing. The proposed method realizes a superior balance between the preservation of detail and impulse noise removal by proactive noise detection and non-local switching vector median filtering, respectively. The effectiveness and validity of the proposed method are verified in a series of experiments using natural color images.

  2. Constraints on muon-specific dark forces

    NASA Astrophysics Data System (ADS)

    Karshenboim, Savely G.; McKeen, David; Pospelov, Maxim

    2014-10-01

    The recent measurement of the Lamb shift in muonic hydrogen allows for the most precise extraction of the charge radius of the proton which is currently in conflict with other determinations based on e-p scattering and hydrogen spectroscopy. This discrepancy could be the result of some new muon-specific force with O(1-100) MeV force carrier—in this paper we concentrate on vector mediators. Such an explanation faces challenges from the constraints imposed by the g-2 of the muon and electron as well as precision spectroscopy of muonic atoms. In this work we complement the family of constraints by calculating the contribution of hypothetical forces to the muonium hyperfine structure. We also compute the two-loop contribution to the electron parity-violating amplitude due to a muon loop, which is sensitive to the muon axial-vector coupling. Overall, we find that the combination of low-energy constraints favors the mass of the mediator to be below 10 MeV and that a certain degree of tuning is required between vector and axial-vector couplings of new vector particles to muons in order to satisfy constraints from muon g-2. However, we also observe that in the absence of a consistent standard model embedding high-energy weak-charged processes accompanied by the emission of new vector particles are strongly enhanced by (E/mV)2, with E a characteristic energy scale and mV the mass of the mediator. In particular, leptonic W decays impose the strongest constraints on such models completely disfavoring the remainder of the parameter space.

  3. Multi-color incomplete Cholesky conjugate gradient methods for vector computers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poole, E.L.

    1986-01-01

    This research is concerned with the solution on vector computers of linear systems of equations. Ax = b, where A is a large, sparse symmetric positive definite matrix with non-zero elements lying only along a few diagonals of the matrix. The system is solved using the incomplete Cholesky conjugate gradient method (ICCG). Multi-color orderings are used of the unknowns in the linear system to obtain p-color matrices for which a no-fill block ICCG method is implemented on the CYBER 205 with O(N/p) length vector operations in both the decomposition of A and, more importantly, in the forward and back solvesmore » necessary at each iteration of the method. (N is the number of unknowns and p is a small constant). A p-colored matrix is a matrix that can be partitioned into a p x p block matrix where the diagonal blocks are diagonal matrices. The matrix is stored by diagonals and matrix multiplication by diagonals is used to carry out the decomposition of A and the forward and back solves. Additionally, if the vectors across adjacent blocks line up, then some of the overhead associated with vector startups can be eliminated in the matrix vector multiplication necessary at each conjugate gradient iteration. Necessary and sufficient conditions are given to determine which multi-color orderings of the unknowns correspond to p-color matrices, and a process is indicated for choosing multi-color orderings.« less

  4. Species composition, seasonal occurrence, habitat preference and altitudinal distribution of malaria and other disease vectors in eastern Nepal.

    PubMed

    Dhimal, Meghnath; Ahrens, Bodo; Kuch, Ulrich

    2014-11-28

    It is increasingly recognized that climate change can alter the geographical distribution of vector-borne diseases (VBDs) with shifts of disease vectors to higher altitudes and latitudes. In particular, an increasing risk of malaria and dengue fever epidemics in tropical highlands and temperate regions has been predicted in different climate change scenarios. The aim of this paper is to expand the current knowledge on the seasonal occurrence and altitudinal distribution of malaria and other disease vectors in eastern Nepal. Adult mosquitoes resting indoors and outdoors were collected using CDC light trap and aspirators with the support of flash light. Mosquito larvae were collected using locally constructed dippers. We assessed the local residents' perceptions of the distribution and occurrence of mosquitoes using key informant interview techniques. Generalized linear models were fitted to assess the effect of season, resting site and topography on the abundance of malaria vectors. The known malaria vectors in Nepal, Anopheles fluviatilis, Anopheles annularis and Anopheles maculatus complex members were recorded from 70 to 1,820 m above sea level (asl). The vectors of chikungunya and dengue virus, Aedes aegypti and Aedes albopictus, the vector of lymphatic filariasis, Culex quinquefasciatus, and that of Japanese encephalitis, Culex tritaeniorhynchus, were found from 70 to 2,000 m asl in eastern Nepal. Larvae of Anopheles, Culex and Aedes species were recorded up to 2,310 m asl. Only season had a significant effect on the abundance of An. fluviatilis, season and resting site on the abundance of An. maculatus complex members, and season, resting site and topography on the abundance of An. annularis. The perceptions of people on mosquito occurrence are consistent with entomological findings. This study provides the first vertical distribution records of vector mosquitoes in eastern Nepal and suggests that the vectors of malaria and other diseases have already established populations in the highlands due to climatic and other environmental changes. As VBD control programmes have not been focused on the highlands of Nepal, these findings call for actions to start monitoring, surveillance and research on VBDs in these previously disease-free, densely populated and economically important regions.

  5. Effects of extended work shifts and shift work on patient safety, productivity, and employee health.

    PubMed

    Keller, Simone M

    2009-12-01

    It is estimated 1.3 million health care errors occur each year and of those errors 48,000 to 98,000 result in the deaths of patients (Barger et al., 2006). Errors occur for a variety of reasons, including the effects of extended work hours and shift work. The need for around-the-clock staff coverage has resulted in creative ways to maintain quality patient care, keep health care errors or adverse events to a minimum, and still meet the needs of the organization. One way organizations have attempted to alleviate staff shortages is to create extended work shifts. Instead of the standard 8-hour shift, workers are now working 10, 12, 16, or more hours to provide continuous patient care. Although literature does support these staffing patterns, it cannot be denied that shifts beyond the traditional 8 hours increase staff fatigue, health care errors, and adverse events and outcomes and decrease alertness and productivity. This article includes a review of current literature on shift work, the definition of shift work, error rates and adverse outcomes related to shift work, health effects on shift workers, shift work effects on older workers, recommended optimal shift length, positive and negative effects of shift work on the shift worker, hazards associated with driving after extended shifts, and implications for occupational health nurses. Copyright 2009, SLACK Incorporated.

  6. Effect of Channel Thickness, Annealing Temperature and Channel Length on Nanoscale Ga2O3-In2O3-ZnO Thin Film Transistor Performance.

    PubMed

    Kumaresan, Yogeenth; Pak, Yusin; Lim, Namsoo; Lee, Ryeri; Song, Hui; Kim, Tae Heon; Choi, Boran; Jung, Gun Young

    2016-06-01

    We demonstrated the effect of active layer (channel) thickness and annealing temperature on the electrical performances of Ga2O3-In2O3-ZnO (GIZO) thin film transistor (TFT) having nanoscale channel width (W/L: 500 nm/100 μm). We found that the electron carrier concentration of the channel was decreased significantly with increasing the annealing temperature (100 degrees C to 300 degrees C). Accordingly, the threshold voltage (V(T)) was shifted towards positive voltage (-12.2 V to 10.8 V). In case of channel thickness, the V(T) was shifted towards negative voltage with increasing the channel thickness. The device with channel thickness of 90 nm annealed at 200 degrees C revealed the best device performances in terms of mobility (10.86 cm2/Vs) and V(T) (0.8 V). The effect of channel length was also studied, in which the channel width, thickness and annealing temperature were kept constant such as 500 nm, 90 nm and 200 degrees C, respectively. The channel length influenced the on-current level significantly with small variation of V(T), resulting in lower value of on/off current ratio with increasing the channel length. The device with channel length of 0.5 μm showed enhanced on/off current ratio of 10(6) with minimum V(T) of 0.26 V.

  7. SU-E-J-16: A Review of the Magnitude of Patient Imaging Shifts in Relation to Departmental Policy Changes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    O'Connor, M; Sansourekidou, P

    2014-06-01

    Purpose: To evaluate how changes in imaging policy affect the magnitude of shifts applied to patients. Methods: In June 2012, the department's imaging policy was altered to require that any shifts derived from imaging throughout the course of treatment shall be considered systematic only after they were validated with two data points that are consistent in the same direction. Multiple additions and clarifications to the imaging policy were implemented throughout the course of the data collection, but they were mostly of administrative nature. Entered shifts were documented in MOSAIQ (Elekta AB) through the localization offset. The MOSAIQ database was queriedmore » to identify a possible trend. A total of 25,670 entries were analyzed, including four linear accelerators with a combination of MV planar, kV planar and kV three dimensional imaging. The monthly average of the magnitude of the vector was used. Plan relative offsets were excluded. During the evaluated period of time, one of the satellite facilities acquired and implemented Vision RT (AlignRT Inc). Results: After the new policy was implemented the shifts variance and standard deviation decreased. The decrease is linear with time elapsed. Vision RT implementation at one satellite facility reduced the number of overall shifts, specifically for breast patients. Conclusion: Changes in imaging policy have a significant effect on the magnitude of shifts applied to patients. Using two statistical points before applying a shift as persistent decreased the overall magnitude of the shifts applied to patients.« less

  8. Terahertz bandwidth all-optical Hilbert transformers based on long-period gratings.

    PubMed

    Ashrafi, Reza; Azaña, José

    2012-07-01

    A novel, all-optical design for implementing terahertz (THz) bandwidth real-time Hilbert transformers is proposed and numerically demonstrated. An all-optical Hilbert transformer can be implemented using a uniform-period long-period grating (LPG) with a properly designed amplitude-only grating apodization profile, incorporating a single π-phase shift in the middle of the grating length. The designed LPG-based Hilbert transformers can be practically implemented using either fiber-optic or integrated-waveguide technologies. As a generalization, photonic fractional Hilbert transformers are also designed based on the same optical platform. In this general case, the resulting LPGs have multiple π-phase shifts along the grating length. Our numerical simulations confirm that all-optical Hilbert transformers capable of processing arbitrary optical signals with bandwidths well in the THz range can be implemented using feasible fiber/waveguide LPG designs.

  9. Interferometric measurement of refractive index modification in a single mode microfiber

    NASA Astrophysics Data System (ADS)

    Ahmed, Farid; Ahsani, Vahid; Jun, Martin B. G.

    2017-02-01

    Efficient and cost effective measurement of the refractive index profile in an optical fiber is a significant technical job to design and manufacture in-fiber photonic devices and communication systems. For instance, to design fiber gratings, it is required to estimate the refractive index modulation to be inscribed by the fabrication apparatus such as ultraviolet or infrared lasers. Mach-Zehnder interferometer (MZI) based quantification of refractive index change written in single mode microfiber by femtosecond laser radiation is presented in this study. The MZI is constructed by splicing a microfiber (core diameter: 3.75 μm, cladding diameter: 40 μm) between standard single mode fibers. To measure the RI inscribed by infrared femtosecond laser, 200 μm length of the core within the MZI was scanned with laser radiation. As the higher index was written within 200 μm length of the core, the transmission spectrum of the interferometer displayed a corresponding red shift. The observed spectral shift was used to calculate the amount of refractive index change inscribed by the femtosecond irradiation. For the MZI length of 3.25 mm, and spectral shift of 0.8 nm, the calculated refractive index was found to be 0.00022. The reported results display excellent agreement between theory and experimental findings. Demonstrated method provides simple yet very effective on-site measurement of index change in optical fibers. Since the MZI can be constructed in diverse fiber types, this technique offers flexibility to quantify index change in various optical fibers.

  10. Reproductive and developmental costs of deltamethrin resistance in the Chagas disease vector Triatoma infestans.

    PubMed

    Germano, Mónica Daniela; Inés Picollo, María

    2015-06-01

    Effective chemical control relies on reducing vector population size. However, insecticide selection pressure is often associated with the development of resistant populations that reduce control success. In treated areas, these resistant individuals present an adaptive advantage due to enhanced survival. Resistance can also lead to negative effects when the insecticide pressure ceases. In this study, the biological effects of deltamethrin resistance were assessed in the Chagas disease vector Triatoma infestans. The length of each developmental stage and complete life cycle, mating rate, and fecundity were evaluated. Susceptible and resistant insects presented similar mating rates. A reproductive cost of resistance was expressed as a lower fecundity in the resistant colony. Developmental costs in the resistant colony were in the form of a shortening of the second and third nymph stage duration and an extension of the fifth stage. A maternal effect of deltamethrin resistance is suggested as these effects were identified in resistant females and their progeny independently of the mated male's deltamethrin response. Our results suggest the presence of pleiotropic effects of deltamethrin resistance. Possible associations of these characters to other traits such as developmental delays and behavioral resistance are discussed. © 2015 The Society for Vector Ecology.

  11. A Radiation Chemistry Code Based on the Greens Functions of the Diffusion Equation

    NASA Technical Reports Server (NTRS)

    Plante, Ianik; Wu, Honglu

    2014-01-01

    Ionizing radiation produces several radiolytic species such as.OH, e-aq, and H. when interacting with biological matter. Following their creation, radiolytic species diffuse and chemically react with biological molecules such as DNA. Despite years of research, many questions on the DNA damage by ionizing radiation remains, notably on the indirect effect, i.e. the damage resulting from the reactions of the radiolytic species with DNA. To simulate DNA damage by ionizing radiation, we are developing a step-by-step radiation chemistry code that is based on the Green's functions of the diffusion equation (GFDE), which is able to follow the trajectories of all particles and their reactions with time. In the recent years, simulations based on the GFDE have been used extensively in biochemistry, notably to simulate biochemical networks in time and space and are often used as the "gold standard" to validate diffusion-reaction theories. The exact GFDE for partially diffusion-controlled reactions is difficult to use because of its complex form. Therefore, the radial Green's function, which is much simpler, is often used. Hence, much effort has been devoted to the sampling of the radial Green's functions, for which we have developed a sampling algorithm This algorithm only yields the inter-particle distance vector length after a time step; the sampling of the deviation angle of the inter-particle vector is not taken into consideration. In this work, we show that the radial distribution is predicted by the exact radial Green's function. We also use a technique developed by Clifford et al. to generate the inter-particle vector deviation angles, knowing the inter-particle vector length before and after a time step. The results are compared with those predicted by the exact GFDE and by the analytical angular functions for free diffusion. This first step in the creation of the radiation chemistry code should help the understanding of the contribution of the indirect effect in the formation of DNA damage and double-strand breaks.

  12. A Correlation Between Length of Strong-Shear Neutral Lines and Total X-Ray Brightness in Active Regions

    NASA Technical Reports Server (NTRS)

    Falconer, D. A.

    1997-01-01

    From a sample of 7 MSFC vector magnetograms,of active regions and 17 Yohkoh SXT soft X-ray images of these active regions, we have found that the total x-ray brightness of an entire active region is correlated with the total length of neutral lines on which the magnetic field is both strong (less than 250 G) and strongly sheared (shear angle greater than 75 deg) in the same active region. This correlation, if not fortuitous, is additional evidence of the importance of strong-shear strong-field neutral lines to strong heating in active regions.

  13. Calculation of gravity and magnetic anomalies of finite-length right polygonal prisms.

    USGS Publications Warehouse

    Cady, J.W.

    1980-01-01

    An equation is derived for the vertical gravity field due to a homogeneous body with polygonal cross‐section and finite strike‐length. The equation can be separated into the two‐dimensional (2-D) terms of Talwani et al. (1959) and exact terms for the contributions of the ends of the prism. Equations for the magnetic field due to a similar body were derived by Shuey and Pasquale (1973), who coined the term “two‐and‐a‐half dimensional” (2 1/2-D) to describe the geometry. Magnetic intensities are expressed as a vector sum, from which the common dot product formulation can be obtained by binomial expansion.

  14. Device and method for noresonantly Raman shifting ultraviolet radiation

    DOEpatents

    Loree, Thomas R.; Barker, Dean L.

    1979-01-01

    A device and method for nonresonantly Raman shifting broad band uv excimer laser radiation, which enhances preselected Stokes signals by varying the pressure of the Raman scattering medium, the focal interaction length of the incident radiation within the Raman scattering medium and its power density level. Gaseous molecular H.sub.2, D.sub.2, CH.sub.4 (methane), HD and mixes thereof, and liquid N.sub.2 are used as the Raman scattering medium to frequency shift the outputs of high power KrF and ArF lasers. A cable fed discharge with an unstable resonant cavity configuration is utilized to produce the output laser power levels required for operation.

  15. Quality Control Studies of Wavelength Shifting Fibers for a Scintillator-Based Tail Catcher Muon Tracker for Linear Collider Prototype Detector

    NASA Astrophysics Data System (ADS)

    Dyshkant, A.; Beznosko, D.; Blazey, G.; Fisk, E.; Hahn, E.; Rykalin, V.; Wayne, M.; Zutshi, V.

    2006-12-01

    Detailed measurements of the wavelength shifting fiber response to a stable and reliable light source are presented. Particulars about materials, a double reference method, and measurement technique are included. The fibers studied were several hundred Kuraray, Y-11, multiclad, 1.2-mm outer diameter wavelength shifting fibers, each cut from a reel to about one meter length. The fibers were polished, mirrored, and the mirrors were UV epoxy protected. Each fiber passed quality control requirements before installation. About 94% of the fibers tested have a response within 1% of the overall mean

  16. High-resolution optical measurements of atmospheric winds from space. I - Lower atmosphere molecular absorption

    NASA Technical Reports Server (NTRS)

    Hays, P. B.

    1982-01-01

    A high-resolution spectroscopic technique, analogous to that used in the thermosphere to measure the vector wind fields in the upper troposphere and stratosphere, is described which uses narrow features in the spectrum of light scattered from the earth's lower atmosphere to provide Doppler information on atmospheric scattering and absorption. It is demonstrated that vector winds can be measured from a satellite throughout the lower atmosphere, using a multiple-etalon Fabry-Perot interferometer of modest aperture. It is found that molecular oxygen and water vapor absorption lines in the spectrum of sunlight scattered by the atmosphere are Doppler-shifted by the line of sight wind, so that they may be used to monitor the global wind systems in the upper troposphere and stratosphere.

  17. Assessing the Role of Climate Change in Malaria Transmission in Africa.

    PubMed

    Ngarakana-Gwasira, E T; Bhunu, C P; Masocha, M; Mashonjowa, E

    2016-01-01

    The sensitivity of vector borne diseases like malaria to climate continues to raise considerable concern over the implications of climate change on future disease dynamics. The problem of malaria vectors shifting from their traditional locations to invade new zones is of important concern. A mathematical model incorporating rainfall and temperature is constructed to study the transmission dynamics of malaria. The reproduction number obtained is applied to gridded temperature and rainfall datasets for baseline climate and future climate with aid of GIS. As a result of climate change, malaria burden is likely to increase in the tropics, the highland regions, and East Africa and along the northern limit of falciparum malaria. Falciparum malaria will spread into the African highlands; however it is likely to die out at the southern limit of the disease.

  18. Global warming and the potential spread of vector-borne diseases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patz, J.

    1996-12-31

    Climatic factors influence many vector-borne infectious diseases, in addition to demographic, biological, and ecological determinants. The United Nation`s Intergovernmental Panel on Climate Change (IPCC) estimates an unprecedented global rise of 2.0 C by the year 2100. Of major concern is that these changes can affect the spread of many serious infectious diseases, including malaria and dengue fever. Global warming would directly affect disease transmission by shifting the mosquito`s geographic range, increasing reproductive and biting rates, and shortening pathogen incubation period. Human migration and damage to health infrastructures from the projected increase in climate variability and sea level rise could indirectlymore » contribute to disease transmission. A review of this literature, as well as preliminary data from ongoing studies will be presented.« less

  19. CFD Research, Parallel Computation and Aerodynamic Optimization

    NASA Technical Reports Server (NTRS)

    Ryan, James S.

    1995-01-01

    During the last five years, CFD has matured substantially. Pure CFD research remains to be done, but much of the focus has shifted to integration of CFD into the design process. The work under these cooperative agreements reflects this trend. The recent work, and work which is planned, is designed to enhance the competitiveness of the US aerospace industry. CFD and optimization approaches are being developed and tested, so that the industry can better choose which methods to adopt in their design processes. The range of computer architectures has been dramatically broadened, as the assumption that only huge vector supercomputers could be useful has faded. Today, researchers and industry can trade off time, cost, and availability, choosing vector supercomputers, scalable parallel architectures, networked workstations, or heterogenous combinations of these to complete required computations efficiently.

  20. What is a vector?

    PubMed Central

    Morgan, Eric René; Booth, Mark; Norman, Rachel; Mideo, Nicole; McCallum, Hamish; Fenton, Andy

    2017-01-01

    Many important and rapidly emerging pathogens of humans, livestock and wildlife are ‘vector-borne’. However, the term ‘vector’ has been applied to diverse agents in a broad range of epidemiological systems. In this perspective, we briefly review some common definitions, identify the strengths and weaknesses of each and consider the functional differences between vectors and other hosts from a range of ecological, evolutionary and public health perspectives. We then consider how the use of designations can afford insights into our understanding of epidemiological and evolutionary processes that are not otherwise apparent. We conclude that from a medical and veterinary perspective, a combination of the ‘haematophagous arthropod’ and ‘mobility’ definitions is most useful because it offers important insights into contact structure and control and emphasizes the opportunities for pathogen shifts among taxonomically similar species with similar feeding modes and internal environments. From a population dynamics and evolutionary perspective, we suggest that a combination of the ‘micropredator’ and ‘sequential’ definition is most appropriate because it captures the key aspects of transmission biology and fitness consequences for the pathogen and vector itself. However, we explicitly recognize that the value of a definition always depends on the research question under study. This article is part of the themed issue ‘Opening the black box: re-examining the ecology and evolution of parasite transmission’. PMID:28289253

  1. Dual targeting of gene delivery by genetic modification of adenovirus serotype 5 fibers and cell-selective transcriptional control.

    PubMed

    Work, L M; Ritchie, N; Nicklin, S A; Reynolds, P N; Baker, A H

    2004-08-01

    Adenovirus (Ad)-mediated gene delivery is a promising approach for genetic manipulation of the vasculature and is being used in both preclinical models and clinical trials. However, safety concerns relating to infection of nontarget tissue and the poor infectivity of vascular cells compared to other cell types necessitates Ad vector refinement. Here, we combine a transductional targeting approach to improve vascular cell infectivity through RGD peptide insertion into adenovirus fibers, combined with transcriptional targeting to endothelial cells using a approximately 1 kb fragment of the fms-like tyrosine kinase receptor-1 (FLT-1) promoter. Single- and double-modified vectors were characterized in human cell lines that either support or have silenced FLT-1 expression. In rat hepatocytes and endothelial cells, the double modification substantially shifted transduction profiles toward vascular endothelial cells. Furthermore, in intact aortae derived from spontaneously hypertensive rats that display enhanced alphav integrin expression on dysfunctional endothelium, enhanced levels of transduction were observed using the double-modified vector but not in aortae derived from normotensive control rats. Our data indicate that Ad-mediated transduction can be beneficially modified in vitro and in vivo by combining fiber modification and a cell-selective promoter within a single-component vector system.

  2. Intercomparison of Registration Techniques and Interactive 3D Visualization of Differential LiDAR from the 2010 El Mayor-Cucapah Earthquake

    NASA Astrophysics Data System (ADS)

    Banesh, D.; Oskin, M. E.; Mu, A.; Vu, C.; Westerteiger, R.; Krishnan, A.; Hamann, B.; Glennie, C. L.; Hinojosa, A.; Borsa, A. A.

    2013-12-01

    Differential LiDAR provides unprecedented images of the near-field ground deformation and fault slip due to earthquakes. Here we examine the performance of the Iterative Closest Point (ICP) technique for data registration between pre- and post-earthquake LiDAR point clouds of varying density. We use the 2010 El Mayor-Cucapah data set as our region of interest since this earthquake produced different types of surface ruptures, yielding a variety of deformation styles for analysis. We also test a more simplistic, Chi-Squared minimization approach and find that it produces good results when compared to ICP. We present different techniques for visualizing large vector fields, and show how each method highlights a unique feature in the data set. Dense vector fields are useful when analyzing smaller deformations in the surface. A sparse, averaged vector field analyzes the bigger, overall shifts without interference caused by small details. Flow-based visualizations like Line Integral Convolution (LIC) graphs, provide insight into particular artifacts of data collection, such as distortions due to uncorrected pitch and yaw of the aircraft during the survey. Animations of the vector field establish the direction of movement in the landscape, quickly highlighting areas of interest.

  3. Influence of OPD in wavelength-shifting interferometry

    NASA Astrophysics Data System (ADS)

    Wang, Hongjun; Tian, Ailing; Liu, Bingcai; Dang, Juanjuan

    2009-12-01

    Phase-shifting interferometry is a powerful tool for high accuracy optical measurement. It operates by change the optical path length in the reference arm or test arm. This method practices by move optical device. So it has much problem when the optical device is very large and heavy. For solve this problem, the wavelength-shifting interferometry was put forwarded. In wavelength-shifting interferometry, the phase shifting angle was achieved by change the wavelength of optical source. The phase shifting angle was decided by wavelength and OPD (Optical Path Difference) between test and reference wavefront. So the OPD is an important factor to measure results. But in measurement, because the positional error and profile error of under testing optical element is exist, the phase shifting angle is different in different test point when wavelength scanning, it will introduce phase shifting angle error, so it will introduce optical surface measure error. For analysis influence of OPD on optical surface error, the relation between surface error and OPD was researched. By simulation, the relation between phase shifting error and OPD was established. By analysis, the error compensation method was put forward. After error compensation, the measure results can be improved to great extend.

  4. Influence of OPD in wavelength-shifting interferometry

    NASA Astrophysics Data System (ADS)

    Wang, Hongjun; Tian, Ailing; Liu, Bingcai; Dang, Juanjuan

    2010-03-01

    Phase-shifting interferometry is a powerful tool for high accuracy optical measurement. It operates by change the optical path length in the reference arm or test arm. This method practices by move optical device. So it has much problem when the optical device is very large and heavy. For solve this problem, the wavelength-shifting interferometry was put forwarded. In wavelength-shifting interferometry, the phase shifting angle was achieved by change the wavelength of optical source. The phase shifting angle was decided by wavelength and OPD (Optical Path Difference) between test and reference wavefront. So the OPD is an important factor to measure results. But in measurement, because the positional error and profile error of under testing optical element is exist, the phase shifting angle is different in different test point when wavelength scanning, it will introduce phase shifting angle error, so it will introduce optical surface measure error. For analysis influence of OPD on optical surface error, the relation between surface error and OPD was researched. By simulation, the relation between phase shifting error and OPD was established. By analysis, the error compensation method was put forward. After error compensation, the measure results can be improved to great extend.

  5. Rapid Adjustment of Circadian Clocks to Simulated Travel to Time Zones across the Globe.

    PubMed

    Harrison, Elizabeth M; Gorman, Michael R

    2015-12-01

    Daily rhythms in mammalian physiology and behavior are generated by a central pacemaker located in the hypothalamic suprachiasmatic nuclei (SCN), the timing of which is set by light from the environment. When the ambient light-dark cycle is shifted, as occurs with travel across time zones, the SCN and its output rhythms must reset or re-entrain their phases to match the new schedule-a sluggish process requiring about 1 day per hour shift. Using a global assay of circadian resetting to 6 equidistant time-zone meridians, we document this characteristically slow and distance-dependent resetting of Syrian hamsters under typical laboratory lighting conditions, which mimic summer day lengths. The circadian pacemaker, however, is additionally entrainable with respect to its waveform (i.e., the shape of the 24-h oscillation) allowing for tracking of seasonally varying day lengths. We here demonstrate an unprecedented, light exposure-based acceleration in phase resetting following 2 manipulations of circadian waveform. Adaptation of circadian waveforms to long winter nights (8 h light, 16 h dark) doubled the shift response in the first 3 days after the shift. Moreover, a bifurcated waveform induced by exposure to a novel 24-h light-dark-light-dark cycle permitted nearly instant resetting to phase shifts from 4 to 12 h in magnitude, representing a 71% reduction in the mismatch between the activity rhythm and the new photocycle. Thus, a marked enhancement of phase shifting can be induced via nonpharmacological, noninvasive manipulation of the circadian pacemaker waveform in a model species for mammalian circadian rhythmicity. Given the evidence of conserved flexibility in the human pacemaker waveform, these findings raise the promise of flexible resetting applicable to circadian disruption in shift workers, frequent time-zone travelers, and any individual forced to adjust to challenging schedules. © 2015 The Author(s).

  6. Vector spherical quasi-Gaussian vortex beams

    NASA Astrophysics Data System (ADS)

    Mitri, F. G.

    2014-02-01

    Model equations for describing and efficiently computing the radiation profiles of tightly spherically focused higher-order electromagnetic beams of vortex nature are derived stemming from a vectorial analysis with the complex-source-point method. This solution, termed as a high-order quasi-Gaussian (qG) vortex beam, exactly satisfies the vector Helmholtz and Maxwell's equations. It is characterized by a nonzero integer degree and order (n,m), respectively, an arbitrary waist w0, a diffraction convergence length known as the Rayleigh range zR, and an azimuthal phase dependency in the form of a complex exponential corresponding to a vortex beam. An attractive feature of the high-order solution is the rigorous description of strongly focused (or strongly divergent) vortex wave fields without the need of either the higher-order corrections or the numerically intensive methods. Closed-form expressions and computational results illustrate the analysis and some properties of the high-order qG vortex beams based on the axial and transverse polarization schemes of the vector potentials with emphasis on the beam waist.

  7. Perspective on Adeno-Associated Virus Capsid Modification for Duchenne Muscular Dystrophy Gene Therapy.

    PubMed

    Nance, Michael E; Duan, Dongsheng

    2015-12-01

    Duchenne muscular dystrophy (DMD) is a X-linked, progressive childhood myopathy caused by mutations in the dystrophin gene, one of the largest genes in the genome. It is characterized by skeletal and cardiac muscle degeneration and dysfunction leading to cardiac and/or respiratory failure. Adeno-associated virus (AAV) is a highly promising gene therapy vector. AAV gene therapy has resulted in unprecedented clinical success for treating several inherited diseases. However, AAV gene therapy for DMD remains a significant challenge. Hurdles for AAV-mediated DMD gene therapy include the difficulty to package the full-length dystrophin coding sequence in an AAV vector, the necessity for whole-body gene delivery, the immune response to dystrophin and AAV capsid, and the species-specific barriers to translate from animal models to human patients. Capsid engineering aims at improving viral vector properties by rational design and/or forced evolution. In this review, we discuss how to use the state-of-the-art AAV capsid engineering technologies to overcome hurdles in AAV-based DMD gene therapy.

  8. Natural Infection of Phlebotomus sergenti by Leishmania tropica in Libya.

    PubMed

    Dokhan, Mostafa Ramadhan; Jaouadi, Kaouther; Salem, Sadok; Zenbil, Osama; Gonzalez, Jean Paul; Ben Salah, Afif; Annajar, Badreddin Bashir

    2018-03-12

    Cutaneous leishmaniasis (CL) is a public health concern caused by Leishmania ( L. ) major and ( L. ) tropica in Libya. Information on sandfly vectors, as well as their associated Leishmania species, is of paramount importance because vector dispersion is one of the major factors responsible for pathogen dissemination. A number of 515 sandflies (275 males and 240 females) were collected during June-November 2012 using the CDC miniature light traps from Al Rabta, northwest of Libya. Two hundred and forty unfed females were identified; Phlebotomus ( Ph. ) papatasi ( N = 97), Ph. sergenti ( N = 27), Ph. longicuspis ( N = 32), Sergentomyia ( Se. ) minuta ( N = 38), and Se. fallax ( N = 46). These flies were screened for Leishmania DNA using the polymerase chain reaction-restriction fragment length polymorphism analysis of the internal transcribed spacer 1 and sequencing. Two Ph. sergenti were found positive to L. tropica DNA. This finding should be considered for any further vector surveillance and epidemiological studies of CL in endemic areas across Libya.

  9. [Construction of Plasmodium falciparum signal peptide peptidase-GFP mutant and its expression analysis in the malaria parasite].

    PubMed

    Li, Xue-rong; Wu, Yin-juan; Shang, Mei; Li, Ye; Xu, Jin; Yu, Xin-bing; Athar, Chishti

    2014-08-01

    To construct recombinant plasmid pSPPcGT which contains signal peptide peptidase gene of Plasmodium falciparum (PJSPP) and GFP, and transfect into P. falciparum (3D7 strain) to obtain mutant parasites which can express PJSPP-GFP. Plasmodium falciparum(3D7 strain) genomic DNA was extracted from cultured malaria parasites. The C-terminal region of PJSPP, an 883 bp gene fragment was amplified by PCR, and then cloned into pPM2GT vector to get recombinant vector pSPPcGT. The recombinant vectors were identified by PCR, double restriction enzyme digestion and DNA sequencing. pSPPcGT vector was transfected into malaria parasites. The positive clones were selected by adding inhibitor of Plasmodium falciparum dihydrofolate reductase WR99210 to the culture medium. The pSPP-GFP-transfected parasites were fixed with methanol, stained with DAPI, and observed under immunofluorescence microscope. The PJSPP-GFP expression in P. falciparum was identified by SDS-PAGE and Western blotting. The C-terminal region of PJSPP was amplified from P.falciparum (3D7 strain) genomic DNA by PCR with the length of 883 bp. The constructed recombinant vectors were identified by PCR screening, double restriction enzyme digestion and DNA sequencing. The pSPPcGT vector was transfected into P. falciparum and the positive clones were selected by WR99210. GFP fluorescence was observed in transfected parasites by immunofluorescence microscopy, and mainly located in the cytoplasm. The PJSPP-GFP expression in malaria parasites was confirmed by Western blotting with a relative molecular mass of Mr 64,000. Recombinant vector PJSPP-GFP is constructed and transfected into P. falciparum to obtain P. falciparum mutant clone which can express PfSPP-GFP.

  10. An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

    PubMed

    Cui, Hongguang; Wang, Aiming

    2017-03-01

    RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Excess Entropy Production in Quantum System: Quantum Master Equation Approach

    NASA Astrophysics Data System (ADS)

    Nakajima, Satoshi; Tokura, Yasuhiro

    2017-12-01

    For open systems described by the quantum master equation (QME), we investigate the excess entropy production under quasistatic operations between nonequilibrium steady states. The average entropy production is composed of the time integral of the instantaneous steady entropy production rate and the excess entropy production. We propose to define average entropy production rate using the average energy and particle currents, which are calculated by using the full counting statistics with QME. The excess entropy production is given by a line integral in the control parameter space and its integrand is called the Berry-Sinitsyn-Nemenman (BSN) vector. In the weakly nonequilibrium regime, we show that BSN vector is described by ln \\breve{ρ }_0 and ρ _0 where ρ _0 is the instantaneous steady state of the QME and \\breve{ρ }_0 is that of the QME which is given by reversing the sign of the Lamb shift term. If the system Hamiltonian is non-degenerate or the Lamb shift term is negligible, the excess entropy production approximately reduces to the difference between the von Neumann entropies of the system. Additionally, we point out that the expression of the entropy production obtained in the classical Markov jump process is different from our result and show that these are approximately equivalent only in the weakly nonequilibrium regime.

  12. Supersuppression: Reservoir Competency and Timing of Mosquito Host Shifts Combine to Reduce Spillover of West Nile Virus.

    PubMed

    Levine, Rebecca S; Mead, Daniel G; Hamer, Gabriel L; Brosi, Berry J; Hedeen, David L; Hedeen, Meghan W; McMillan, Joseph R; Bisanzio, Donal; Kitron, Uriel D

    2016-11-02

    In the eastern United States, human cases of West Nile virus (WNV) result from spillover from urban epizootic transmission between passerine birds and Culex mosquitoes. In Atlanta, GA, substantial WNV presence in hosts and vectors has not resulted in the human disease burden observed in cities with similar infection pressure. Our study goal was to investigate extrinsic ecological conditions that potentially contribute to these reduced transmission rates. We conducted WNV surveillance among hosts and vectors in urban Atlanta and recorded an overall avian seroprevalence of nearly 30%, which was significantly higher among northern cardinals, blue jays, and members of the mimid family, and notably low among American robins. Examination of temporal Culex feeding patterns showed a marked feeding shift from American robins in the early season to northern cardinals in the late season. We therefore rule out American robins as superspreaders in the Atlanta area and suggest instead that northern cardinals and mimids act as WNV "supersuppressor" species, which slow WNV transmission by drawing many infectious bites during the critical virus amplification period, yet failing to amplify transmission due to low host competencies. Of particular interest, urban forest patches provide spillover protection by increasing the WNV amplification fraction on supersuppressor species. © The American Society of Tropical Medicine and Hygiene.

  13. The importance of temperature fluctuations in understanding mosquito population dynamics and malaria risk.

    PubMed

    Beck-Johnson, Lindsay M; Nelson, William A; Paaijmans, Krijn P; Read, Andrew F; Thomas, Matthew B; Bjørnstad, Ottar N

    2017-03-01

    Temperature is a key environmental driver of Anopheles mosquito population dynamics; understanding its central role is important for these malaria vectors. Mosquito population responses to temperature fluctuations, though important across the life history, are poorly understood at a population level. We used stage-structured, temperature-dependent delay-differential equations to conduct a detailed exploration of the impacts of diurnal and annual temperature fluctuations on mosquito population dynamics. The model allows exploration of temperature-driven temporal changes in adult age structure, giving insights into the population's capacity to vector malaria parasites. Because of temperature-dependent shifts in age structure, the abundance of potentially infectious mosquitoes varies temporally, and does not necessarily mirror the dynamics of the total adult population. In addition to conducting the first comprehensive theoretical exploration of fluctuating temperatures on mosquito population dynamics, we analysed observed temperatures at four locations in Africa covering a range of environmental conditions. We found both temperature and precipitation are needed to explain the observed malaria season in these locations, enhancing our understanding of the drivers of malaria seasonality and how temporal disease risk may shift in response to temperature changes. This approach, tracking both mosquito abundance and age structure, may be a powerful tool for understanding current and future malaria risk.

  14. To compare growth outcomes and cost-effectiveness of "Kangaroo ward care" with "intermediate intensive care" in stable extremely low birth weight infants: randomized control trial.

    PubMed

    Sharma, Deepak; Murki, Srinivas; Pratap, Oleti Tejo

    2017-07-01

    To compare growth outcome and cost-effectiveness of "Kangaroo ward care" (KWC) with "Intermediate intensive care" (IIC) in stable extremely low birth weight (ELBW) infants. This is secondary analysis of the study and we analyzed 62 ELBW infants, 33 were randomized to KWC and 29 to IIC once the infant reached a weight of 1150 g. Infants in the KWC group were shifted to the Kangaroo ward immediately after randomization and in the IIC group received IIC care till they attain a weight of 1250 g before shifting to Kangaroo ward. The gain in weight (g/day), length (cm/week), and head circumference (cm/week) were comparable between the two groups. The mean weight, length, and head circumference were comparable at term gestational age. The infants in KWC group were shifted five days earlier to Kangaroo ward when compared to IIC group. The cost-effective analysis using "top-down" and "bottom-up" accounting method showed that there was significant reduction of hospital and parents expenditure in KWC group (p < 0.001) with approximate saving of 452 USD for each patient in the KWC group. Early shifting of ELBW infants for KWC is very efficacious and cost-effective intervention when compared to IIC. (CTRI/2014/05/004625).

  15. On the use of finite difference matrix-vector products in Newton-Krylov solvers for implicit climate dynamics with spectral elements

    DOE PAGES

    Woodward, Carol S.; Gardner, David J.; Evans, Katherine J.

    2015-01-01

    Efficient solutions of global climate models require effectively handling disparate length and time scales. Implicit solution approaches allow time integration of the physical system with a step size governed by accuracy of the processes of interest rather than by stability of the fastest time scales present. Implicit approaches, however, require the solution of nonlinear systems within each time step. Usually, a Newton's method is applied to solve these systems. Each iteration of the Newton's method, in turn, requires the solution of a linear model of the nonlinear system. This model employs the Jacobian of the problem-defining nonlinear residual, but thismore » Jacobian can be costly to form. If a Krylov linear solver is used for the solution of the linear system, the action of the Jacobian matrix on a given vector is required. In the case of spectral element methods, the Jacobian is not calculated but only implemented through matrix-vector products. The matrix-vector multiply can also be approximated by a finite difference approximation which may introduce inaccuracy in the overall nonlinear solver. In this paper, we review the advantages and disadvantages of finite difference approximations of these matrix-vector products for climate dynamics within the spectral element shallow water dynamical core of the Community Atmosphere Model.« less

  16. Optimal multiguidance integration in insect navigation.

    PubMed

    Hoinville, Thierry; Wehner, Rüdiger

    2018-03-13

    In the last decades, desert ants have become model organisms for the study of insect navigation. In finding their way, they use two major navigational routines: path integration using a celestial compass and landmark guidance based on sets of panoramic views of the terrestrial environment. It has been claimed that this information would enable the insect to acquire and use a centralized cognitive map of its foraging terrain. Here, we present a decentralized architecture, in which the concurrently operating path integration and landmark guidance routines contribute optimally to the directions to be steered, with "optimal" meaning maximizing the certainty (reliability) of the combined information. At any one time during its journey, the animal computes a path integration (global) vector and landmark guidance (local) vector, in which the length of each vector is proportional to the certainty of the individual estimates. Hence, these vectors represent the limited knowledge that the navigator has at any one place about the direction of the goal. The sum of the global and local vectors indicates the navigator's optimal directional estimate. Wherever applied, this decentralized model architecture is sufficient to simulate the results of quite a number of diverse cue-conflict experiments, which have recently been performed in various behavioral contexts by different authors in both desert ants and honeybees. They include even those experiments that have deliberately been designed by former authors to strengthen the evidence for a metric cognitive map in bees.

  17. Dextran and protamine-based solid lipid nanoparticles as potential vectors for the treatment of X-linked juvenile retinoschisis.

    PubMed

    Delgado, Diego; del Pozo-Rodríguez, Ana; Solinís, Maria Ángeles; Avilés-Triqueros, Marcelino; Weber, Bernhard H F; Fernández, Eduardo; Gascón, Alicia R

    2012-04-01

    The goal of the present study was to analyze the potential application of nonviral vectors based on solid lipid nanoparticles (SLN) for the treatment of ocular diseases by gene therapy, specifically X-linked juvenile retinoschisis (XLRS). Vectors were prepared with SLN, dextran, protamine, and a plasmid (pCMS-EGFP or pCEP4-RS1). Formulations were characterized and the in vitro transfection capacity as well as the cellular uptake and the intracellular trafficking were studied in ARPE-19 cells. Formulations were also tested in vivo in Wistar rat eyes, and the efficacy was studied by monitoring the expression of enhanced green fluorescent protein (EGFP) after intravitreal, subretinal, and topical administration. The presence of dextran and protamine in the SLN improved greatly the expression of retinoschisin and EGFP in ARPE-19 cells. The nuclear localization signals of protamine, its ability to protect the DNA, and a shift in the entry mechanism from caveola-mediated to clathrin-mediated endocytosis promoted by the dextran, justify the increase in transfection. After ocular administration of the dextran-protamine-DNA-SLN complex to rat eyes, we detected the expression of EGFP in various types of cells depending on the administration route. Our vectors were also able to transfect corneal cells after topical application. We have demonstrated the potential usefulness of our nonviral vectors loaded with XLRS1 plasmid and provided evidence for their potential application for the management or treatment of degenerative retinal disorders as well as ocular surface diseases.

  18. Phylogenetic tree construction using trinucleotide usage profile (TUP).

    PubMed

    Chen, Si; Deng, Lih-Yuan; Bowman, Dale; Shiau, Jyh-Jen Horng; Wong, Tit-Yee; Madahian, Behrouz; Lu, Henry Horng-Shing

    2016-10-06

    It has been a challenging task to build a genome-wide phylogenetic tree for a large group of species containing a large number of genes with long nucleotides sequences. The most popular method, called feature frequency profile (FFP-k), finds the frequency distribution for all words of certain length k over the whole genome sequence using (overlapping) windows of the same length. For a satisfactory result, the recommended word length (k) ranges from 6 to 15 and it may not be a multiple of 3 (codon length). The total number of possible words needed for FFP-k can range from 4 6 =4096 to 4 15 . We propose a simple improvement over the popular FFP method using only a typical word length of 3. A new method, called Trinucleotide Usage Profile (TUP), is proposed based only on the (relative) frequency distribution using non-overlapping windows of length 3. The total number of possible words needed for TUP is 4 3 =64, which is much less than the total count for the recommended optimal "resolution" for FFP. To build a phylogenetic tree, we propose first representing each of the species by a TUP vector and then using an appropriate distance measure between pairs of the TUP vectors for the tree construction. In particular, we propose summarizing a DNA sequence by a matrix of three rows corresponding to three reading frames, recording the frequency distribution of the non-overlapping words of length 3 in each of the reading frame. We also provide a numerical measure for comparing trees constructed with various methods. Compared to the FFP method, our empirical study showed that the proposed TUP method is more capable of building phylogenetic trees with a stronger biological support. We further provide some justifications on this from the information theory viewpoint. Unlike the FFP method, the TUP method takes the advantage that the starting of the first reading frame is (usually) known. Without this information, the FFP method could only rely on the frequency distribution of overlapping words, which is the average (or mixture) of the frequency distributions of three possible reading frames. Consequently, we show (from the entropy viewpoint) that the FFP procedure could dilute important gene information and therefore provides less accurate classification.

  19. Ontogenetic development of intestinal length and relationships to diet in an Australasian fish family (Terapontidae)

    PubMed Central

    2013-01-01

    Background One of the most widely accepted ecomorphological relationships in vertebrates is the negative correlation between intestinal length and proportion of animal prey in diet. While many fish groups exhibit this general pattern, other clades demonstrate minimal, and in some cases contrasting, associations between diet and intestinal length. Moreover, this relationship and its evolutionary derivation have received little attention from a phylogenetic perspective. This study documents the phylogenetic development of intestinal length variability, and resultant correlation with dietary habits, within a molecular phylogeny of 28 species of terapontid fishes. The Terapontidae (grunters), an ancestrally euryhaline-marine group, is the most trophically diverse of Australia’s freshwater fish families, with widespread shifts away from animal-prey-dominated diets occurring since their invasion of fresh waters. Results Description of ontogenetic development of intestinal complexity of terapontid fishes, in combination with ancestral character state reconstruction, demonstrated that complex intestinal looping (convolution) has evolved independently on multiple occasions within the family. This modification of ontogenetic development drives much of the associated interspecific variability in intestinal length evident in terapontids. Phylogenetically informed comparative analyses (phylogenetic independent contrasts) showed that the interspecific differences in intestinal length resulting from these ontogenetic developmental mechanisms explained ~65% of the variability in the proportion of animal material in terapontid diets. Conclusions The ontogenetic development of intestinal complexity appears to represent an important functional innovation underlying the extensive trophic differentiation seen in Australia’s freshwater terapontids, specifically facilitating the pronounced shifts away from carnivorous (including invertebrates and vertebrates) diets evident across the family. The capacity to modify intestinal morphology and physiology may also be an important facilitator of trophic diversification during other phyletic radiations. PMID:23441994

  20. Full vector modal analysis of microstructured optical fiber propagation characteristics

    NASA Astrophysics Data System (ADS)

    Zghal, Mourad; Bahloul, Faouzi; Chatta, Rihab; Attia, Rabah; Pagnoux, Dominique; Roy, Philippe; Melin, Gilles; Gasca, Laurent

    2004-10-01

    Microstructured optical fibers (MOFs) are optical fibers having a periodic air-silica cross-section. The air holes extend along the axis of the fiber for its entire length. The core of the fiber is formed by a missing hole in the periodic structure. Remarkable properties of MOFs have recently been reported. This paper presents new work in the modeling of the propagation characteristics of MOFs using the Finite Element Method (FEM) and the Galerkin Method (GM). This efficient electromagnetic simulation package provides a vectorial description of the electromagnetic fields and of the associated effective index. This information includes accurate determination of the spectral extent of the modes, cutoff properties and mode-field distributions. We show that FEM is well adapted for describing the fields at abrupt transitions of the refractive index while GM has the advantage to accurately analyze MOFs of significant complexity using only modest computational resources. This presentation will focus on the specific techniques required to determine single mode operation, dispersion properties and effective area through careful choice of the geometrical parameters of the fibers. We demonstrate that with suitable geometrical parameters, the zero dispersion wavelength can be shifted. This tool can also provide design criteria for fabricating MOFs and a corresponding map of effective area. This approach is validated by comparison with experimental results and measurements on actual MOFs fabricated at IRCOM and at Alcatel Research and Innovation Center.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feyereisen-Koener, J.M.

    Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

  2. In vitro characterization of felid herpesvirus 1 (FHV-1) mutants generated by recombineering in a recombinant BAC vector

    USDA-ARS?s Scientific Manuscript database

    Felid herpesvirus 1 (FHV-1) mutants were constructed using two-step Red-mediated recombination techniques based on a virulent full-length FHV-1 BAC clone. The individual mutant viruses generated were deficient in glycoprotein C (gC), glycoprotein E (gE),US3 serine/threonine protein kinase (PK), or b...

  3. Focus modulation of cylindrical vector beams by using 1D photonic crystal lens with negative refraction effect.

    PubMed

    Xu, Ji; Zhong, Yi; Wang, Shengming; Lu, Yunqing; Wan, Hongdan; Jiang, Jian; Wang, Jin

    2015-10-19

    Sub-wavelength focusing of cylindrical vector beams (CVBs) has attracted great attention due to the specific physical effects and the applications in many areas. More powerful, flexible and effective ways to modulate the focus transversally and also longitudinally are always being pursued. In this paper, cylindrically symmetric lens composed of negative-index one-dimensional photonic crystal is proposed to make a breakthrough. By revealing the relationship between focal length and the exit surface shape of the lens, a quite simple and effective principle of designing the lens structure is presented to realize specific focus modulation. Plano-concave lenses are parameterized to modulate the focal length and the number of focuses. An axicon constructed by one-dimensional photonic crystal is proposed for the first time to obtain a large depth of focus and an optical needle focal field with almost a theoretical minimum FWHM of 0.362λ is achieved under radially polarized incident light. Because of the almost identical negative refractive index for TE and TM polarization states, all the modulation methods can be applied for any arbitrary polarized CVBs. This work offers a promising methodology for designing negative-index lenses in related application areas.

  4. One-electron densities of freely rotating Wigner molecules

    NASA Astrophysics Data System (ADS)

    Cioslowski, Jerzy

    2017-12-01

    A formalism enabling computation of the one-particle density of a freely rotating assembly of identical particles that vibrate about their equilibrium positions with amplitudes much smaller than their average distances is presented. It produces densities as finite sums of products of angular and radial functions, the length of the expansion being determined by the interplay between the point-group and permutational symmetries of the system in question. Obtaining from a convolution of the rotational and bosonic components of the parent wavefunction, the angular functions are state-dependent. On the other hand, the radial functions are Gaussians with maxima located at the equilibrium lengths of the position vectors of individual particles and exponents depending on the scalar products of these vectors and the eigenvectors of the corresponding Hessian as well as the respective eigenvalues. Although the new formalism is particularly useful for studies of the Wigner molecules formed by electrons subject to weak confining potentials, it is readily adaptable to species (such as ´balliums’ and Coulomb crystals) composed of identical particles with arbitrary spin statistics and permutational symmetry. Several examples of applications of the present approach to the harmonium atoms within the strong-correlation regime are given.

  5. Classifying Physical Morphology of Cocoa Beans Digital Images using Multiclass Ensemble Least-Squares Support Vector Machine

    NASA Astrophysics Data System (ADS)

    Lawi, Armin; Adhitya, Yudhi

    2018-03-01

    The objective of this research is to determine the quality of cocoa beans through morphology of their digital images. Samples of cocoa beans were scattered on a bright white paper under a controlled lighting condition. A compact digital camera was used to capture the images. The images were then processed to extract their morphological parameters. Classification process begins with an analysis of cocoa beans image based on morphological feature extraction. Parameters for extraction of morphological or physical feature parameters, i.e., Area, Perimeter, Major Axis Length, Minor Axis Length, Aspect Ratio, Circularity, Roundness, Ferret Diameter. The cocoa beans are classified into 4 groups, i.e.: Normal Beans, Broken Beans, Fractured Beans, and Skin Damaged Beans. The model of classification used in this paper is the Multiclass Ensemble Least-Squares Support Vector Machine (MELS-SVM), a proposed improvement model of SVM using ensemble method in which the separate hyperplanes are obtained by least square approach and the multiclass procedure uses One-Against- All method. The result of our proposed model showed that the classification with morphological feature input parameters were accurately as 99.705% for the four classes, respectively.

  6. Construction of recombinant FGFR1 containing full-length gene and its potential application.

    PubMed

    Zhou, Yali; Luo, Wenjuan; Zheng, Lei; Li, Miao; Zhang, Yanmin

    2010-07-01

    FGFR1, one of the four fibroblast growth factor receptors, has been found to be over-expressed in many cancers. In this study, a full-length expression plasmid for FGFR1 was obtained by fragment amplification. The amplified PCR product was then digested and inserted into the pcDNA3.1(+) vector. A recombinant eukaryotic expression vector containing the complete CDS region of FGFR1 was successfully constructed. After it was transfected to Hek293 cell, the expression of the FGFR1 receptor in recombinant Hek293/FGFR1 was 18 times higher than that of Hek293 cell. The biological activities of high expression FGFR1 cell (Hek293/FGFR1) were verified by FCM, immunofluorescent, RT-PCR, western blot and cell cycle analysis. Then, Hek293/FGFR1 was used to screen taspine with cell membrane chromatography (CMC). Finally, we analyzed the effects of taspine on Hek293/FGFR1 cell and MCF-7 cell. In conclusion, Hek293/FGFR1 was successfully constructed. The results demonstrate that taspine can down-regulate phosphorylation of FGFR1 and ERK, and inhibit Hek293/FGFR1 and MCF-7 cell proliferation. Copyright 2010 Elsevier Inc. All rights reserved.

  7. Angular momentum and Zeeman effect in the presence of a minimal length based on the Kempf-Mann-Mangano algebra

    NASA Astrophysics Data System (ADS)

    Khosropour, B.

    2016-07-01

    In this work, we consider a D-dimensional ( β, β^' -two-parameters deformed Heisenberg algebra, which was introduced by Kempf et al. The angular-momentum operator in the presence of a minimal length scale based on the Kempf-Mann-Mangano algebra is obtained in the special case of β^' = 2β up to the first order over the deformation parameter β . It is shown that each of the components of the modified angular-momentum operator, commutes with the modified operator {L}2 . We find the magnetostatic field in the presence of a minimal length. The Zeeman effect in the deformed space is studied and also Lande's formula for the energy shift in the presence of a minimal length is obtained. We estimate an upper bound on the isotropic minimal length.

  8. Temporal Comparison Between NIRS and EEG Signals During a Mental Arithmetic Task Evaluated with Self-Organizing Maps.

    PubMed

    Oyama, Katsunori; Sakatani, Kaoru

    2016-01-01

    Simultaneous monitoring of brain activity with near-infrared spectroscopy and electroencephalography allows spatiotemporal reconstruction of the hemodynamic response regarding the concentration changes in oxyhemoglobin and deoxyhemoglobin that are associated with recorded brain activity such as cognitive functions. However, the accuracy of state estimation during mental arithmetic tasks is often different depending on the length of the segment for sampling of NIRS and EEG signals. This study compared the results of a self-organizing map and ANOVA, which were both used to assess the accuracy of state estimation. We conducted an experiment with a mental arithmetic task performed by 10 participants. The lengths of the segment in each time frame for observation of NIRS and EEG signals were compared with the 30-s, 1-min, and 2-min segment lengths. The optimal segment lengths were different for NIRS and EEG signals in the case of classification of feature vectors into the states of performing a mental arithmetic task and being at rest.

  9. Role of color memory in successive color constancy.

    PubMed

    Ling, Yazhu; Hurlbert, Anya

    2008-06-01

    We investigate color constancy for real 2D paper samples using a successive matching paradigm in which the observer memorizes a reference surface color under neutral illumination and after a temporal interval selects a matching test surface under the same or different illumination. We find significant effects of the illumination, reference surface, and their interaction on the matching error. We characterize the matching error in the absence of illumination change as the "pure color memory shift" and introduce a new index for successive color constancy that compares this shift against the matching error under changing illumination. The index also incorporates the vector direction of the matching errors in chromaticity space, unlike the traditional constancy index. With this index, we find that color constancy is nearly perfect.

  10. Evolutionary consequences of climate-induced range shifts in insects.

    PubMed

    Sánchez-Guillén, Rosa A; Córdoba-Aguilar, Alex; Hansson, Bengt; Ott, Jürgen; Wellenreuther, Maren

    2016-11-01

    Range shifts can rapidly create new areas of geographic overlap between formerly allopatric taxa and evidence is accumulating that this can affect species persistence. We review the emerging literature on the short- and long-term consequences of these geographic range shifts. Specifically, we focus on the evolutionary consequences of novel species interactions in newly created sympatric areas by describing the potential (i) short-term processes acting on reproductive barriers between species and (ii) long-term consequences of range shifts on the stability of hybrid zones, introgression and ultimately speciation and extinction rates. Subsequently, we (iii) review the empirical literature on insects to evaluate which processes have been studied, and (iv) outline some areas that deserve increased attention in the future, namely the genomics of hybridisation and introgression, our ability to forecast range shifts and the impending threat from insect vectors and pests on biodiversity, human health and crop production. Our review shows that species interactions in de novo sympatric areas can be manifold, sometimes increasing and sometimes decreasing species diversity. A key issue that emerges is that climate-induced hybridisations in insects are much more widespread than anticipated and that rising temperatures and increased anthropogenic disturbances are accelerating the process of species mixing. The existing evidence only shows the tip of the iceberg and we are likely to see many more cases of species mixing following range shifts in the near future. © 2015 Cambridge Philosophical Society.

  11. Monitoring of the sleep patterns of shift workers in the automotive industry.

    PubMed

    Kawada, Tomoyuki; Shimizu, Takako; Kuratomi, Yushiro; Suto, Sachiko; Kanai, Tomoe; Nishime, Akemi; Nakano, Noriko

    2011-01-01

    The effect of shift schedules on the amount of sleep that workers receive is an important factor in workplace health and safety as well as the employees' overall quality of life. The objective of this study is to compare sleep period among workers engaging in each of the three-shift work. The amount of sleep (sleep period) that male workers with rotating shift schedules received was measured using accelerometers. The mean age of the 16 male workers enrolled in this study was 54.3 years (one standard deviation, 6.7 years). Thirteen participants ranged in age from 51 to 60 years of age, and the other three participants were 32, 48, and 50 years old. Work shifts were rotated on a weekly basis and were categorized into three periods: shift-1 (8:00 to 17:00), shift-2 (15:00 to 23:50), and shift-3 (23:30 to 8:15). Each work week consisted of 5 days. No significant differences were observed in the mean sleep period for each of the three shifts. However, the sleep periods during shift-1 or shift-2 tended to be longer than that obtained during shift-3. No effect of age on the length of the sleep period was observed. Rotating shift-work did not affect the amount of sleep that workers obtained. However, a comparison with previous study results suggests that morning shifts (starting at 6 AM) and day shifts (starting at 8 AM) may have different effects on sleep time.

  12. Automatic Alignment of Displacement-Measuring Interferometer

    NASA Technical Reports Server (NTRS)

    Halverson, Peter; Regehr, Martin; Spero, Robert; Alvarez-Salazar, Oscar; Loya, Frank; Logan, Jennifer

    2006-01-01

    A control system strives to maintain the correct alignment of a laser beam in an interferometer dedicated to measuring the displacement or distance between two fiducial corner-cube reflectors. The correct alignment of the laser beam is parallel to the line between the corner points of the corner-cube reflectors: Any deviation from parallelism changes the length of the optical path between the reflectors, thereby introducing a displacement or distance measurement error. On the basis of the geometrical optics of corner-cube reflectors, the length of the optical path can be shown to be L = L(sub 0)cos theta, where L(sub 0) is the distance between the corner points and theta is the misalignment angle. Therefore, the measurement error is given by DeltaL = L(sub 0)(cos theta - 1). In the usual case in which the misalignment is small, this error can be approximated as DeltaL approximately equal to -L(sub 0)theta sup 2/2. The control system (see figure) is implemented partly in hardware and partly in software. The control system includes three piezoelectric actuators for rapid, fine adjustment of the direction of the laser beam. The voltages applied to the piezoelectric actuators include components designed to scan the beam in a circular pattern so that the beam traces out a narrow cone (60 microradians wide in the initial application) about the direction in which it is nominally aimed. This scan is performed at a frequency (2.5 Hz in the initial application) well below the resonance frequency of any vibration of the interferometer. The laser beam makes a round trip to both corner-cube reflectors and then interferes with the launched beam. The interference is detected on a photodiode. The length of the optical path is measured by a heterodyne technique: A 100- kHz frequency shift between the launched beam and a reference beam imposes, on the detected signal, an interferometric phase shift proportional to the length of the optical path. A phase meter comprising analog filters and specialized digital circuitry converts the phase shift to an indication of displacement, generating a digital signal proportional to the path length.

  13. Gene Addition Strategies for β-Thalassemia and Sickle Cell Anemia.

    PubMed

    Dong, Alisa C; Rivella, Stefano

    2017-01-01

    Beta-thalassemia and sickle cell anemia are two of the most common diseases related to the hemoglobin protein. In these diseases, the beta-globin gene is mutated, causing severe anemia and ineffective erythropoiesis. Patients can additionally present with a number of life-threatening co-morbidities, such as stroke or spontaneous fractures. Current treatment involves transfusion and iron chelation; allogeneic bone marrow transplant is the only curative option, but is limited by the availability of matching donors and graft-versus-host disease. As these two diseases are monogenic diseases, they make an attractive setting for gene therapy. Gene therapy aims to correct the mutated beta-globin gene or add back a functional copy of beta- or gamma-globin. Initial gene therapy work was done with oncoretroviral vectors, but has since shifted to lentiviral vectors. Currently, there are a few clinical trials underway to test the curative potential of some of these lentiviral vectors. This review will highlight the work done thus far, and present the challenges still facing gene therapy, such as genome toxicity concerns and achieving sufficient transgene expression to cure those with the most severe forms of thalassemia.

  14. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao, Xiao; Gang, Yi; Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province

    2015-02-06

    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself.more » The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.« less

  15. Contribution of volcanic forcing to the initiation of the Black Death Epidemic

    NASA Astrophysics Data System (ADS)

    Fell, Henry; Baldini, James; Dodds, Ben

    2017-04-01

    The 14th Century plague epidemic, commonly termed the Black Death, coincided with the tumultuous climatic shift from the relative stability of the Medieval Climate Anomaly (MCA) to the initiation of the Little Ice Age (LIA). Plague is predominantly a vector borne disease that is spread through the transmission of the Yersinia pestis bacteria. This bacterium may have originated in the rodent populations of the Tibetan Plateau and later spread rapidly westward though Eurasia after vector transmission to humans. Several studies have determined that Asian rodent and vector populations are highly sensitive to climatic perturbations. The Samalas eruption of 1257 was the largest injection of aerosols in the Common Era and therefore probably had a significant climatic effect. Through a range of proxy records across Eurasia we reconstruct the climate for the period immediately preceding the outbreak of plague. This study investigates the interaction between the Samalas eruption of 1257, the climatic response to the event and the potential effect on the initiation of the Black Death epidemic which shaped population and culture across Eurasia for centuries.

  16. The q-G method : A q-version of the Steepest Descent method for global optimization.

    PubMed

    Soterroni, Aline C; Galski, Roberto L; Scarabello, Marluce C; Ramos, Fernando M

    2015-01-01

    In this work, the q-Gradient (q-G) method, a q-version of the Steepest Descent method, is presented. The main idea behind the q-G method is the use of the negative of the q-gradient vector of the objective function as the search direction. The q-gradient vector, or simply the q-gradient, is a generalization of the classical gradient vector based on the concept of Jackson's derivative from the q-calculus. Its use provides the algorithm an effective mechanism for escaping from local minima. The q-G method reduces to the Steepest Descent method when the parameter q tends to 1. The algorithm has three free parameters and it is implemented so that the search process gradually shifts from global exploration in the beginning to local exploitation in the end. We evaluated the q-G method on 34 test functions, and compared its performance with 34 optimization algorithms, including derivative-free algorithms and the Steepest Descent method. Our results show that the q-G method is competitive and has a great potential for solving multimodal optimization problems.

  17. Vector wind profile gust model

    NASA Technical Reports Server (NTRS)

    Adelfang, S. I.

    1981-01-01

    To enable development of a vector wind gust model suitable for orbital flight test operations and trade studies, hypotheses concerning the distributions of gust component variables were verified. Methods for verification of hypotheses that observed gust variables, including gust component magnitude, gust length, u range, and L range, are gamma distributed and presented. Observed gust modulus has been drawn from a bivariate gamma distribution that can be approximated with a Weibull distribution. Zonal and meridional gust components are bivariate gamma distributed. An analytical method for testing for bivariate gamma distributed variables is presented. Two distributions for gust modulus are described and the results of extensive hypothesis testing of one of the distributions are presented. The validity of the gamma distribution for representation of gust component variables is established.

  18. Vector wind profile gust model

    NASA Technical Reports Server (NTRS)

    Adelfang, S. I.

    1979-01-01

    Work towards establishing a vector wind profile gust model for the Space Transportation System flight operations and trade studies is reported. To date, all the statistical and computational techniques required were established and partially implemented. An analysis of wind profile gust at Cape Kennedy within the theoretical framework is presented. The variability of theoretical and observed gust magnitude with filter type, altitude, and season is described. Various examples are presented which illustrate agreement between theoretical and observed gust percentiles. The preliminary analysis of the gust data indicates a strong variability with altitude, season, and wavelength regime. An extension of the analyses to include conditional distributions of gust magnitude given gust length, distributions of gust modulus, and phase differences between gust components has begun.

  19. Focusing properties of cylindrical vector vortex beams

    NASA Astrophysics Data System (ADS)

    Xiaoqiang, Zhang; Ruishan, Chen; Anting, Wang

    2018-05-01

    In this paper, following Richards and Wolf vectorial diffraction theory, the focusing properties of cylindrical vector vortex beams (CVVB) are investigated, and a diffractive optical element (DOE) is designed to spatially modulate the amplitude of the CVVB. Simulated results show that the CVVB focused by an objective also carry orbital angular momentum (OAM), and the optical fields near the focal region can be modulated by changing the topological charge of the CVVB. We numerically simulate the focus properties of radially and azimuthally polarized beams with topological charge equal to 0, 1, 2 and 10 respectively. As a result, a dark channel with a length about 20 λ can be obtained. These new properties have the potential applications such as particle acceleration, optical trapping and material processing.

  20. Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

    PubMed

    Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

    2015-04-01

    Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

Top