Sample records for show high sequence

  1. Effects of Sequences of Cognitions on Group Performance Over Time

    PubMed Central

    Molenaar, Inge; Chiu, Ming Ming

    2017-01-01

    Extending past research showing that sequences of low cognitions (low-level processing of information) and high cognitions (high-level processing of information through questions and elaborations) influence the likelihoods of subsequent high and low cognitions, this study examines whether sequences of cognitions are related to group performance over time; 54 primary school students (18 triads) discussed and wrote an essay about living in another country (32,375 turns of talk). Content analysis and statistical discourse analysis showed that within each lesson, groups with more low cognitions or more sequences of low cognition followed by high cognition added more essay words. Groups with more high cognitions, sequences of low cognition followed by low cognition, or sequences of high cognition followed by an action followed by low cognition, showed different words and sequences, suggestive of new ideas. The links between cognition sequences and group performance over time can inform facilitation and assessment of student discussions. PMID:28490854

  2. Effects of Sequences of Cognitions on Group Performance Over Time.

    PubMed

    Molenaar, Inge; Chiu, Ming Ming

    2017-04-01

    Extending past research showing that sequences of low cognitions (low-level processing of information) and high cognitions (high-level processing of information through questions and elaborations) influence the likelihoods of subsequent high and low cognitions, this study examines whether sequences of cognitions are related to group performance over time; 54 primary school students (18 triads) discussed and wrote an essay about living in another country (32,375 turns of talk). Content analysis and statistical discourse analysis showed that within each lesson, groups with more low cognitions or more sequences of low cognition followed by high cognition added more essay words. Groups with more high cognitions, sequences of low cognition followed by low cognition, or sequences of high cognition followed by an action followed by low cognition, showed different words and sequences, suggestive of new ideas. The links between cognition sequences and group performance over time can inform facilitation and assessment of student discussions.

  3. PASTA: Ultra-Large Multiple Sequence Alignment for Nucleotide and Amino-Acid Sequences.

    PubMed

    Mirarab, Siavash; Nguyen, Nam; Guo, Sheng; Wang, Li-San; Kim, Junhyong; Warnow, Tandy

    2015-05-01

    We introduce PASTA, a new multiple sequence alignment algorithm. PASTA uses a new technique to produce an alignment given a guide tree that enables it to be both highly scalable and very accurate. We present a study on biological and simulated data with up to 200,000 sequences, showing that PASTA produces highly accurate alignments, improving on the accuracy and scalability of the leading alignment methods (including SATé). We also show that trees estimated on PASTA alignments are highly accurate--slightly better than SATé trees, but with substantial improvements relative to other methods. Finally, PASTA is faster than SATé, highly parallelizable, and requires relatively little memory.

  4. PASTA: Ultra-Large Multiple Sequence Alignment for Nucleotide and Amino-Acid Sequences

    PubMed Central

    Mirarab, Siavash; Nguyen, Nam; Guo, Sheng; Wang, Li-San; Kim, Junhyong

    2015-01-01

    Abstract We introduce PASTA, a new multiple sequence alignment algorithm. PASTA uses a new technique to produce an alignment given a guide tree that enables it to be both highly scalable and very accurate. We present a study on biological and simulated data with up to 200,000 sequences, showing that PASTA produces highly accurate alignments, improving on the accuracy and scalability of the leading alignment methods (including SATé). We also show that trees estimated on PASTA alignments are highly accurate—slightly better than SATé trees, but with substantial improvements relative to other methods. Finally, PASTA is faster than SATé, highly parallelizable, and requires relatively little memory. PMID:25549288

  5. Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment

    PubMed Central

    2013-01-01

    Background Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. Results In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Conclusion Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA. PMID:24564200

  6. Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.

    PubMed

    Nagar, Anurag; Hahsler, Michael

    2013-01-01

    Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA.

  7. cyclostratigraphy, sequence stratigraphy and organic matter accumulation mechanism

    NASA Astrophysics Data System (ADS)

    Cong, F.; Li, J.

    2016-12-01

    The first member of Maokou Formation of Sichuan basin is composed of well preserved carbonate ramp couplets of limestone and marlstone/shale. It acts as one of the potential shale gas source rock, and is suitable for time-series analysis. We conducted time-series analysis to identify high-frequency sequences, reconstruct high-resolution sedimentation rate, estimate detailed primary productivity for the first time in the study intervals and discuss organic matter accumulation mechanism of source rock under sequence stratigraphic framework.Using the theory of cyclostratigraphy and sequence stratigraphy, the high-frequency sequences of one outcrop profile and one drilling well are identified. Two third-order sequences and eight fourth-order sequences are distinguished on outcrop profile based on the cycle stacking patterns. For drilling well, sequence boundary and four system tracts is distinguished by "integrated prediction error filter analysis" (INPEFA) of Gamma-ray logging data, and eight fourth-order sequences is identified by 405ka long eccentricity curve in depth domain which is quantified and filtered by integrated analysis of MTM spectral analysis, evolutive harmonic analysis (EHA), evolutive average spectral misfit (eASM) and band-pass filtering. It suggests that high-frequency sequences correlate well with Milankovitch orbital signals recorded in sediments, and it is applicable to use cyclostratigraphy theory in dividing high-frequency(4-6 orders) sequence stratigraphy.High-resolution sedimentation rate is reconstructed through the study interval by tracking the highly statistically significant short eccentricity component (123ka) revealed by EHA. Based on sedimentation rate, measured TOC and density data, the burial flux, delivery flux and primary productivity of organic carbon was estimated. By integrating redox proxies, we can discuss the controls on organic matter accumulation by primary production and preservation under the high-resolution sequence stratigraphic framework. Results show that high average organic carbon contents in the study interval are mainly attributed to high primary production. The results also show a good correlation between high organic carbon accumulation and intervals of transgression.

  8. Molecular characterization of a distinct monopartite begomovirus associated with betasatellites and alphasatellites infecting Pisum sativum in Nepal.

    PubMed

    Shahid, M S; Pudashini, B J; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

    2017-04-01

    Pea (Pisum sativum) plants exhibiting leaf distortion, yellowing, stunted growth and reduction in leaf size from Rampur, Nepal were shown to be infected by a begomovirus in association with betasatellites and alphasatellites. The begomovirus associated with the disease showed only low levels of nucleotide sequence identity (<91%) to previously characterized begomoviruses. This finding indicates that the pea samples were infected with an as yet undescribed begomovirus for which the name Pea leaf distortion virus (PLDV) is proposed. Two species of betasatellite were identified in association with PLDV. One group of sequences had high (>78%) nucleotide sequence identity to isolates of Ludwigia leaf distortion betasatellite (LuLDB), and the second group had less than 78% to all other betasatellite sequences. This showed PLDV to be associated with either LuLDB or a previously undescribed betasatellite for which the name Pea leaf distortion betasatellite is proposed. Two types of alphasatellites were identified in the PLDV-infected pea plants. The first type showed high levels of sequence identity to Ageratum yellow vein alphasatellite, and the second type showed high levels of identity to isolates of Sida yellow vein China alphasatellite. These are the first begomovirus, betasatellites and alphasatellites isolated from pea.

  9. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

    PubMed

    Schneider, T D

    2001-12-01

    The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

  10. Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

    PubMed Central

    Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2016-01-01

    Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

  11. Low-Cost, High-Throughput Sequencing of DNA Assemblies Using a Highly Multiplexed Nextera Process.

    PubMed

    Shapland, Elaine B; Holmes, Victor; Reeves, Christopher D; Sorokin, Elena; Durot, Maxime; Platt, Darren; Allen, Christopher; Dean, Jed; Serber, Zach; Newman, Jack; Chandran, Sunil

    2015-07-17

    In recent years, next-generation sequencing (NGS) technology has greatly reduced the cost of sequencing whole genomes, whereas the cost of sequence verification of plasmids via Sanger sequencing has remained high. Consequently, industrial-scale strain engineers either limit the number of designs or take short cuts in quality control. Here, we show that over 4000 plasmids can be completely sequenced in one Illumina MiSeq run for less than $3 each (15× coverage), which is a 20-fold reduction over using Sanger sequencing (2× coverage). We reduced the volume of the Nextera tagmentation reaction by 100-fold and developed an automated workflow to prepare thousands of samples for sequencing. We also developed software to track the samples and associated sequence data and to rapidly identify correctly assembled constructs having the fewest defects. As DNA synthesis and assembly become a centralized commodity, this NGS quality control (QC) process will be essential to groups operating high-throughput pipelines for DNA construction.

  12. Enhanced learning of natural visual sequences in newborn chicks.

    PubMed

    Wood, Justin N; Prasad, Aditya; Goldman, Jason G; Wood, Samantha M W

    2016-07-01

    To what extent are newborn brains designed to operate over natural visual input? To address this question, we used a high-throughput controlled-rearing method to examine whether newborn chicks (Gallus gallus) show enhanced learning of natural visual sequences at the onset of vision. We took the same set of images and grouped them into either natural sequences (i.e., sequences showing different viewpoints of the same real-world object) or unnatural sequences (i.e., sequences showing different images of different real-world objects). When raised in virtual worlds containing natural sequences, newborn chicks developed the ability to recognize familiar images of objects. Conversely, when raised in virtual worlds containing unnatural sequences, newborn chicks' object recognition abilities were severely impaired. In fact, the majority of the chicks raised with the unnatural sequences failed to recognize familiar images of objects despite acquiring over 100 h of visual experience with those images. Thus, newborn chicks show enhanced learning of natural visual sequences at the onset of vision. These results indicate that newborn brains are designed to operate over natural visual input.

  13. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  14. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE PAGES

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  15. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

    PubMed

    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

    2014-09-01

    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

  16. Simultaneous mutation and copy number variation (CNV) detection by multiplex PCR-based GS-FLX sequencing.

    PubMed

    Goossens, Dirk; Moens, Lotte N; Nelis, Eva; Lenaerts, An-Sofie; Glassee, Wim; Kalbe, Andreas; Frey, Bruno; Kopal, Guido; De Jonghe, Peter; De Rijk, Peter; Del-Favero, Jurgen

    2009-03-01

    We evaluated multiplex PCR amplification as a front-end for high-throughput sequencing, to widen the applicability of massive parallel sequencers for the detailed analysis of complex genomes. Using multiplex PCR reactions, we sequenced the complete coding regions of seven genes implicated in peripheral neuropathies in 40 individuals on a GS-FLX genome sequencer (Roche). The resulting dataset showed highly specific and uniform amplification. Comparison of the GS-FLX sequencing data with the dataset generated by Sanger sequencing confirmed the detection of all variants present and proved the sensitivity of the method for mutation detection. In addition, we showed that we could exploit the multiplexed PCR amplicons to determine individual copy number variation (CNV), increasing the spectrum of detected variations to both genetic and genomic variants. We conclude that our straightforward procedure substantially expands the applicability of the massive parallel sequencers for sequencing projects of a moderate number of amplicons (50-500) with typical applications in resequencing exons in positional or functional candidate regions and molecular genetic diagnostics. 2008 Wiley-Liss, Inc.

  17. The Sequence of Learning Cycle Activities in High School Chemistry.

    ERIC Educational Resources Information Center

    Abraham, Michael R.; Renner, John W.

    1986-01-01

    Different learning cycle sequences were investigated to determine factors accounting for success of the cycle, compared learning with conventional instruction, and examined relationships between Piaget's theory and learning cycles. Results show that the normal learning cycle sequence is the optimum sequence for achievement of content knowledge in…

  18. Fundamental Bounds for Sequence Reconstruction from Nanopore Sequencers.

    PubMed

    Magner, Abram; Duda, Jarosław; Szpankowski, Wojciech; Grama, Ananth

    2016-06-01

    Nanopore sequencers are emerging as promising new platforms for high-throughput sequencing. As with other technologies, sequencer errors pose a major challenge for their effective use. In this paper, we present a novel information theoretic analysis of the impact of insertion-deletion (indel) errors in nanopore sequencers. In particular, we consider the following problems: (i) for given indel error characteristics and rate, what is the probability of accurate reconstruction as a function of sequence length; (ii) using replicated extrusion (the process of passing a DNA strand through the nanopore), what is the number of replicas needed to accurately reconstruct the true sequence with high probability? Our results provide a number of important insights: (i) the probability of accurate reconstruction of a sequence from a single sample in the presence of indel errors tends quickly (i.e., exponentially) to zero as the length of the sequence increases; and (ii) replicated extrusion is an effective technique for accurate reconstruction. We show that for typical distributions of indel errors, the required number of replicas is a slow function (polylogarithmic) of sequence length - implying that through replicated extrusion, we can sequence large reads using nanopore sequencers. Moreover, we show that in certain cases, the required number of replicas can be related to information-theoretic parameters of the indel error distributions.

  19. Using nearly full-genome HIV sequence data improves phylogeny reconstruction in a simulated epidemic

    PubMed Central

    Yebra, Gonzalo; Hodcroft, Emma B.; Ragonnet-Cronin, Manon L.; Pillay, Deenan; Brown, Andrew J. Leigh; Fraser, Christophe; Kellam, Paul; de Oliveira, Tulio; Dennis, Ann; Hoppe, Anne; Kityo, Cissy; Frampton, Dan; Ssemwanga, Deogratius; Tanser, Frank; Keshani, Jagoda; Lingappa, Jairam; Herbeck, Joshua; Wawer, Maria; Essex, Max; Cohen, Myron S.; Paton, Nicholas; Ratmann, Oliver; Kaleebu, Pontiano; Hayes, Richard; Fidler, Sarah; Quinn, Thomas; Novitsky, Vladimir; Haywards, Andrew; Nastouli, Eleni; Morris, Steven; Clark, Duncan; Kozlakidis, Zisis

    2016-01-01

    HIV molecular epidemiology studies analyse viral pol gene sequences due to their availability, but whole genome sequencing allows to use other genes. We aimed to determine what gene(s) provide(s) the best approximation to the real phylogeny by analysing a simulated epidemic (created as part of the PANGEA_HIV project) with a known transmission tree. We sub-sampled a simulated dataset of 4662 sequences into different combinations of genes (gag-pol-env, gag-pol, gag, pol, env and partial pol) and sampling depths (100%, 60%, 20% and 5%), generating 100 replicates for each case. We built maximum-likelihood trees for each combination using RAxML (GTR + Γ), and compared their topologies to the corresponding true tree’s using CompareTree. The accuracy of the trees was significantly proportional to the length of the sequences used, with the gag-pol-env datasets showing the best performance and gag and partial pol sequences showing the worst. The lowest sampling depths (20% and 5%) greatly reduced the accuracy of tree reconstruction and showed high variability among replicates, especially when using the shortest gene datasets. In conclusion, using longer sequences derived from nearly whole genomes will improve the reliability of phylogenetic reconstruction. With low sample coverage, results can be highly variable, particularly when based on short sequences. PMID:28008945

  20. Using nearly full-genome HIV sequence data improves phylogeny reconstruction in a simulated epidemic.

    PubMed

    Yebra, Gonzalo; Hodcroft, Emma B; Ragonnet-Cronin, Manon L; Pillay, Deenan; Brown, Andrew J Leigh

    2016-12-23

    HIV molecular epidemiology studies analyse viral pol gene sequences due to their availability, but whole genome sequencing allows to use other genes. We aimed to determine what gene(s) provide(s) the best approximation to the real phylogeny by analysing a simulated epidemic (created as part of the PANGEA_HIV project) with a known transmission tree. We sub-sampled a simulated dataset of 4662 sequences into different combinations of genes (gag-pol-env, gag-pol, gag, pol, env and partial pol) and sampling depths (100%, 60%, 20% and 5%), generating 100 replicates for each case. We built maximum-likelihood trees for each combination using RAxML (GTR + Γ), and compared their topologies to the corresponding true tree's using CompareTree. The accuracy of the trees was significantly proportional to the length of the sequences used, with the gag-pol-env datasets showing the best performance and gag and partial pol sequences showing the worst. The lowest sampling depths (20% and 5%) greatly reduced the accuracy of tree reconstruction and showed high variability among replicates, especially when using the shortest gene datasets. In conclusion, using longer sequences derived from nearly whole genomes will improve the reliability of phylogenetic reconstruction. With low sample coverage, results can be highly variable, particularly when based on short sequences.

  1. Assembly of cucumber (Cucumis sativus L.) somaclones

    NASA Astrophysics Data System (ADS)

    Skarzyńska, Agnieszka; Kuśmirek, Wiktor; Pawełkowicz, Magdalena; PlÄ der, Wojciech; Nowak, Robert M.

    2017-08-01

    The development of next generation sequencing opens the possibility of using sequencing in various plant studies, such as finding structural changes and small polymorphisms between species and within them. Most analyzes rely on genomic sequences and it is crucial to use well-assembled genomes of high quality and completeness. Herein we compare commonly available programs for genomic assembling and newly developed software - dnaasm. Assemblies were tested on cucumber (Cucumis sativus L.) lines obtained by in vitro regeneration (somaclones), showing different phenotypes. Obtained results shows that dnaasm assembler is a good tool for short read assembly, which allows obtaining genomes of high quality and completeness.

  2. A generalized theoretical framework for the description of spin decoupling in solid-state MAS NMR: Offset effect on decoupling performance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tan, Kong Ooi; Meier, Beat H., E-mail: beme@ethz.ch, E-mail: maer@ethz.ch; Ernst, Matthias, E-mail: beme@ethz.ch, E-mail: maer@ethz.ch

    2016-09-07

    We present a generalized theoretical framework that allows the approximate but rapid analysis of residual couplings of arbitrary decoupling sequences in solid-state NMR under magic-angle spinning conditions. It is a generalization of the tri-modal Floquet analysis of TPPM decoupling [Scholz et al., J. Chem. Phys. 130, 114510 (2009)] where three characteristic frequencies are used to describe the pulse sequence. Such an approach can be used to describe arbitrary periodic decoupling sequences that differ only in the magnitude of the Fourier coefficients of the interaction-frame transformation. It allows a ∼100 times faster calculation of second-order residual couplings as a function ofmore » pulse sequence parameters than full spin-dynamics simulations. By comparing the theoretical calculations with full numerical simulations, we show the potential of the new approach to examine the performance of decoupling sequences. We exemplify the usefulness of this framework by analyzing the performance of commonly used high-power decoupling sequences and low-power decoupling sequences such as amplitude-modulated XiX (AM-XiX) and its super-cycled variant SC-AM-XiX. In addition, the effect of chemical-shift offset is examined for both high- and low-power decoupling sequences. The results show that the cross-terms between the dipolar couplings are the main contributions to the line broadening when offset is present. We also show that the SC-AM-XIX shows a better offset compensation.« less

  3. A generalized theoretical framework for the description of spin decoupling in solid-state MAS NMR: Offset effect on decoupling performance.

    PubMed

    Tan, Kong Ooi; Agarwal, Vipin; Meier, Beat H; Ernst, Matthias

    2016-09-07

    We present a generalized theoretical framework that allows the approximate but rapid analysis of residual couplings of arbitrary decoupling sequences in solid-state NMR under magic-angle spinning conditions. It is a generalization of the tri-modal Floquet analysis of TPPM decoupling [Scholz et al., J. Chem. Phys. 130, 114510 (2009)] where three characteristic frequencies are used to describe the pulse sequence. Such an approach can be used to describe arbitrary periodic decoupling sequences that differ only in the magnitude of the Fourier coefficients of the interaction-frame transformation. It allows a ∼100 times faster calculation of second-order residual couplings as a function of pulse sequence parameters than full spin-dynamics simulations. By comparing the theoretical calculations with full numerical simulations, we show the potential of the new approach to examine the performance of decoupling sequences. We exemplify the usefulness of this framework by analyzing the performance of commonly used high-power decoupling sequences and low-power decoupling sequences such as amplitude-modulated XiX (AM-XiX) and its super-cycled variant SC-AM-XiX. In addition, the effect of chemical-shift offset is examined for both high- and low-power decoupling sequences. The results show that the cross-terms between the dipolar couplings are the main contributions to the line broadening when offset is present. We also show that the SC-AM-XIX shows a better offset compensation.

  4. Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

    PubMed Central

    Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

    2011-01-01

    Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

  5. Phenotypic and genotypic discrepancy of Streptococcus pneumoniae strains isolated from Asian countries.

    PubMed

    Ko, Kwan Soo; Oh, Won Sup; Peck, Kyong Ran; Lee, Jang Ho; Lee, Nam Yong; Song, Jae-Hoon

    2005-07-01

    Non-typeable isolates of Streptococcus pneumoniae collected from Asian countries were characterized by optochin susceptibility test, bile solubility test, multilocus sequence typing of housekeeping genes, amplification of virulence-related genes, 16S rDNA-RsaI digestion, and 16S rDNA sequencing. Six of 54 non-typeable pneumococcal isolates showed divergence of gene sequences of recP and xpt from typical pneumococcal strains. Of these six atypical pneumococcal strains, two showed different results in optochin susceptibility or bile solubility test from typical pneumococcal strains. All six isolates showed high sequence dissimilarities of multilocus sequence typing, 16S rDNA sequences, and lytA sequences from typical S. pneumoniae strains. Data from this study suggest that classic tests such as optochin susceptibility and bile solubility tests may lead to incorrect identification of S. pneumoniae. These atypical strains may belong to different bacterial species from S. pneumoniae.

  6. The largest subunit of RNA polymerase II as a new marker gene to study assemblages of arbuscular mycorrhizal fungi in the field.

    PubMed

    Stockinger, Herbert; Peyret-Guzzon, Marine; Koegel, Sally; Bouffaud, Marie-Lara; Redecker, Dirk

    2014-01-01

    Due to the potential of arbuscular mycorrhizal fungi (AMF, Glomeromycota) to improve plant growth and soil quality, the influence of agricultural practice on their diversity continues to be an important research question. Up to now studies of community diversity in AMF have exclusively been based on nuclear ribosomal gene regions, which in AMF show high intra-organism polymorphism, seriously complicating interpretation of these data. We designed specific PCR primers for 454 sequencing of a region of the largest subunit of RNA polymerase II gene, and established a new reference dataset comprising all major AMF lineages. This gene is known to be monomorphic within fungal isolates but shows an excellent barcode gap between species. We designed a primer set to amplify all known lineages of AMF and demonstrated its applicability in combination with high-throughput sequencing in a long-term tillage experiment. The PCR primers showed a specificity of 99.94% for glomeromycotan sequences. We found evidence of significant shifts of the AMF communities caused by soil management and showed that tillage effects on different AMF taxa are clearly more complex than previously thought. The high resolving power of high-throughput sequencing highlights the need for quantitative measurements to efficiently detect these effects.

  7. Molecular Characterization of Geographically Different Banana bunchy top virus Isolates in India.

    PubMed

    Selvarajan, R; Mary Sheeba, M; Balasubramanian, V; Rajmohan, R; Dhevi, N Lakshmi; Sasireka, T

    2010-10-01

    Banana bunchy top disease (BBTD) caused by Banana bunchy top virus (BBTV) is one of the most devastating diseases of banana and poses a serious threat for cultivars like Hill Banana (Syn: Virupakshi) and Grand Naine in India. In this study, we have cloned and sequenced the complete genome comprised of six DNA components of BBTV infecting Hill Banana grown in lower Pulney hills, Tamil Nadu State, India. The complete genome sequence of this hill banana isolate showed high degree of similarity with the corresponding sequences of BBTV isolates originating from Lucknow, Uttar Pradesh State, India, and from Fiji, Egypt, Pakistan, and Australia. In addition, sixteen coat protein (CP) and thirteen replicase genes (Rep) sequences of BBTV isolates collected from different banana growing states of India were cloned and sequenced. The replicase sequences of 13 isolates showed high degree of similarity with that of South Pacific group of BBTV isolates. However, the CP gene of BBTV isolates from Shervroy and Kodaikanal hills of Tamil Nadu showed higher amino acid sequence variability compared to other isolates. Another hill banana isolate from Meghalaya state had 23 nucleotide substitutions in the CP gene but the amino acid sequence was conserved. This is the first report of the characterization of a complete genome of BBTV occurring in the high altitudes of India. Our study revealed that the Indian BBTV isolates with distinct geographical origins belongs to the South Pacific group, except Shervroy and Kodaikanal hill isolates which neither belong to the South Pacific nor the Asian group.

  8. Nullomers and High Order Nullomers in Genomic Sequences

    PubMed Central

    Vergni, Davide; Santoni, Daniele

    2016-01-01

    A nullomer is an oligomer that does not occur as a subsequence in a given DNA sequence, i.e. it is an absent word of that sequence. The importance of nullomers in several applications, from drug discovery to forensic practice, is now debated in the literature. Here, we investigated the nature of nullomers, whether their absence in genomes has just a statistical explanation or it is a peculiar feature of genomic sequences. We introduced an extension of the notion of nullomer, namely high order nullomers, which are nullomers whose mutated sequences are still nullomers. We studied different aspects of them: comparison with nullomers of random sequences, CpG distribution and mean helical rise. In agreement with previous results we found that the number of nullomers in the human genome is much larger than expected by chance. Nevertheless antithetical results were found when considering a random DNA sequence preserving dinucleotide frequencies. The analysis of CpG frequencies in nullomers and high order nullomers revealed, as expected, a high CpG content but it also highlighted a strong dependence of CpG frequencies on the dinucleotide position, suggesting that nullomers have their own peculiar structure and are not simply sequences whose CpG frequency is biased. Furthermore, phylogenetic trees were built on eleven species based on both the similarities between the dinucleotide frequencies and the number of nullomers two species share, showing that nullomers are fairly conserved among close species. Finally the study of mean helical rise of nullomers sequences revealed significantly high mean rise values, reinforcing the hypothesis that those sequences have some peculiar structural features. The obtained results show that nullomers are the consequence of the peculiar structure of DNA (also including biased CpG frequency and CpGs islands), so that the hypermutability model, also taking into account CpG islands, seems to be not sufficient to explain nullomer phenomenon. Finally, high order nullomers could emphasize those features that already make simple nullomers useful in several applications. PMID:27906971

  9. HAlign-II: efficient ultra-large multiple sequence alignment and phylogenetic tree reconstruction with distributed and parallel computing.

    PubMed

    Wan, Shixiang; Zou, Quan

    2017-01-01

    Multiple sequence alignment (MSA) plays a key role in biological sequence analyses, especially in phylogenetic tree construction. Extreme increase in next-generation sequencing results in shortage of efficient ultra-large biological sequence alignment approaches for coping with different sequence types. Distributed and parallel computing represents a crucial technique for accelerating ultra-large (e.g. files more than 1 GB) sequence analyses. Based on HAlign and Spark distributed computing system, we implement a highly cost-efficient and time-efficient HAlign-II tool to address ultra-large multiple biological sequence alignment and phylogenetic tree construction. The experiments in the DNA and protein large scale data sets, which are more than 1GB files, showed that HAlign II could save time and space. It outperformed the current software tools. HAlign-II can efficiently carry out MSA and construct phylogenetic trees with ultra-large numbers of biological sequences. HAlign-II shows extremely high memory efficiency and scales well with increases in computing resource. THAlign-II provides a user-friendly web server based on our distributed computing infrastructure. HAlign-II with open-source codes and datasets was established at http://lab.malab.cn/soft/halign.

  10. Comparative analysis of tandem repeats from hundreds of species reveals unique insights into centromere evolution.

    PubMed

    Melters, Daniël P; Bradnam, Keith R; Young, Hugh A; Telis, Natalie; May, Michael R; Ruby, J Graham; Sebra, Robert; Peluso, Paul; Eid, John; Rank, David; Garcia, José Fernando; DeRisi, Joseph L; Smith, Timothy; Tobias, Christian; Ross-Ibarra, Jeffrey; Korf, Ian; Chan, Simon W L

    2013-01-30

    Centromeres are essential for chromosome segregation, yet their DNA sequences evolve rapidly. In most animals and plants that have been studied, centromeres contain megabase-scale arrays of tandem repeats. Despite their importance, very little is known about the degree to which centromere tandem repeats share common properties between different species across different phyla. We used bioinformatic methods to identify high-copy tandem repeats from 282 species using publicly available genomic sequence and our own data. Our methods are compatible with all current sequencing technologies. Long Pacific Biosciences sequence reads allowed us to find tandem repeat monomers up to 1,419 bp. We assumed that the most abundant tandem repeat is the centromere DNA, which was true for most species whose centromeres have been previously characterized, suggesting this is a general property of genomes. High-copy centromere tandem repeats were found in almost all animal and plant genomes, but repeat monomers were highly variable in sequence composition and length. Furthermore, phylogenetic analysis of sequence homology showed little evidence of sequence conservation beyond approximately 50 million years of divergence. We find that despite an overall lack of sequence conservation, centromere tandem repeats from diverse species showed similar modes of evolution. While centromere position in most eukaryotes is epigenetically determined, our results indicate that tandem repeats are highly prevalent at centromeres of both animal and plant genomes. This suggests a functional role for such repeats, perhaps in promoting concerted evolution of centromere DNA across chromosomes.

  11. Comparative analysis of tandem repeats from hundreds of species reveals unique insights into centromere evolution

    PubMed Central

    2013-01-01

    Background Centromeres are essential for chromosome segregation, yet their DNA sequences evolve rapidly. In most animals and plants that have been studied, centromeres contain megabase-scale arrays of tandem repeats. Despite their importance, very little is known about the degree to which centromere tandem repeats share common properties between different species across different phyla. We used bioinformatic methods to identify high-copy tandem repeats from 282 species using publicly available genomic sequence and our own data. Results Our methods are compatible with all current sequencing technologies. Long Pacific Biosciences sequence reads allowed us to find tandem repeat monomers up to 1,419 bp. We assumed that the most abundant tandem repeat is the centromere DNA, which was true for most species whose centromeres have been previously characterized, suggesting this is a general property of genomes. High-copy centromere tandem repeats were found in almost all animal and plant genomes, but repeat monomers were highly variable in sequence composition and length. Furthermore, phylogenetic analysis of sequence homology showed little evidence of sequence conservation beyond approximately 50 million years of divergence. We find that despite an overall lack of sequence conservation, centromere tandem repeats from diverse species showed similar modes of evolution. Conclusions While centromere position in most eukaryotes is epigenetically determined, our results indicate that tandem repeats are highly prevalent at centromeres of both animal and plant genomes. This suggests a functional role for such repeats, perhaps in promoting concerted evolution of centromere DNA across chromosomes. PMID:23363705

  12. The diploid genome sequence of an Asian individual

    PubMed Central

    Wang, Jun; Wang, Wei; Li, Ruiqiang; Li, Yingrui; Tian, Geng; Goodman, Laurie; Fan, Wei; Zhang, Junqing; Li, Jun; Zhang, Juanbin; Guo, Yiran; Feng, Binxiao; Li, Heng; Lu, Yao; Fang, Xiaodong; Liang, Huiqing; Du, Zhenglin; Li, Dong; Zhao, Yiqing; Hu, Yujie; Yang, Zhenzhen; Zheng, Hancheng; Hellmann, Ines; Inouye, Michael; Pool, John; Yi, Xin; Zhao, Jing; Duan, Jinjie; Zhou, Yan; Qin, Junjie; Ma, Lijia; Li, Guoqing; Yang, Zhentao; Zhang, Guojie; Yang, Bin; Yu, Chang; Liang, Fang; Li, Wenjie; Li, Shaochuan; Li, Dawei; Ni, Peixiang; Ruan, Jue; Li, Qibin; Zhu, Hongmei; Liu, Dongyuan; Lu, Zhike; Li, Ning; Guo, Guangwu; Zhang, Jianguo; Ye, Jia; Fang, Lin; Hao, Qin; Chen, Quan; Liang, Yu; Su, Yeyang; san, A.; Ping, Cuo; Yang, Shuang; Chen, Fang; Li, Li; Zhou, Ke; Zheng, Hongkun; Ren, Yuanyuan; Yang, Ling; Gao, Yang; Yang, Guohua; Li, Zhuo; Feng, Xiaoli; Kristiansen, Karsten; Wong, Gane Ka-Shu; Nielsen, Rasmus; Durbin, Richard; Bolund, Lars; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian

    2009-01-01

    Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J. D. Watson and J. C. Venter), and structural variation identification. These variations were considered for their potential biological impact. Our sequence data and analyses demonstrate the potential usefulness of next-generation sequencing technologies for personal genomics. PMID:18987735

  13. Subgrouping Automata: automatic sequence subgrouping using phylogenetic tree-based optimum subgrouping algorithm.

    PubMed

    Seo, Joo-Hyun; Park, Jihyang; Kim, Eun-Mi; Kim, Juhan; Joo, Keehyoung; Lee, Jooyoung; Kim, Byung-Gee

    2014-02-01

    Sequence subgrouping for a given sequence set can enable various informative tasks such as the functional discrimination of sequence subsets and the functional inference of unknown sequences. Because an identity threshold for sequence subgrouping may vary according to the given sequence set, it is highly desirable to construct a robust subgrouping algorithm which automatically identifies an optimal identity threshold and generates subgroups for a given sequence set. To meet this end, an automatic sequence subgrouping method, named 'Subgrouping Automata' was constructed. Firstly, tree analysis module analyzes the structure of tree and calculates the all possible subgroups in each node. Sequence similarity analysis module calculates average sequence similarity for all subgroups in each node. Representative sequence generation module finds a representative sequence using profile analysis and self-scoring for each subgroup. For all nodes, average sequence similarities are calculated and 'Subgrouping Automata' searches a node showing statistically maximum sequence similarity increase using Student's t-value. A node showing the maximum t-value, which gives the most significant differences in average sequence similarity between two adjacent nodes, is determined as an optimum subgrouping node in the phylogenetic tree. Further analysis showed that the optimum subgrouping node from SA prevents under-subgrouping and over-subgrouping. Copyright © 2013. Published by Elsevier Ltd.

  14. High-Resolution Whole-Genome Sequencing Reveals That Specific Chromatin Domains from Most Human Chromosomes Associate with Nucleoli

    PubMed Central

    van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.

    2010-01-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608

  15. High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

    PubMed

    van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

    2010-11-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

  16. AmpliVar: mutation detection in high-throughput sequence from amplicon-based libraries.

    PubMed

    Hsu, Arthur L; Kondrashova, Olga; Lunke, Sebastian; Love, Clare J; Meldrum, Cliff; Marquis-Nicholson, Renate; Corboy, Greg; Pham, Kym; Wakefield, Matthew; Waring, Paul M; Taylor, Graham R

    2015-04-01

    Conventional means of identifying variants in high-throughput sequencing align each read against a reference sequence, and then call variants at each position. Here, we demonstrate an orthogonal means of identifying sequence variation by grouping the reads as amplicons prior to any alignment. We used AmpliVar to make key-value hashes of sequence reads and group reads as individual amplicons using a table of flanking sequences. Low-abundance reads were removed according to a selectable threshold, and reads above this threshold were aligned as groups, rather than as individual reads, permitting the use of sensitive alignment tools. We show that this approach is more sensitive, more specific, and more computationally efficient than comparable methods for the analysis of amplicon-based high-throughput sequencing data. The method can be extended to enable alignment-free confirmation of variants seen in hybridization capture target-enrichment data. © 2015 WILEY PERIODICALS, INC.

  17. Limited copy number - high resolution melting (LCN-HRM) enables the detection and identification by sequencing of low level mutations in cancer biopsies

    PubMed Central

    Do, Hongdo; Dobrovic, Alexander

    2009-01-01

    Background Mutation detection in clinical tumour samples is challenging when the proportion of tumour cells, and thus mutant alleles, is low. The limited sensitivity of conventional sequencing necessitates the adoption of more sensitive approaches. High resolution melting (HRM) is more sensitive than sequencing but identification of the mutation is desirable, particularly when it is important to discriminate false positives due to PCR errors or template degradation from true mutations. We thus developed limited copy number - high resolution melting (LCN-HRM) which applies limiting dilution to HRM. Multiple replicate reactions with a limited number of target sequences per reaction allow low level mutations to be detected. The dilutions used (based on Ct values) are chosen such that mutations, if present, can be detected by the direct sequencing of amplicons with aberrant melting patterns. Results Using cell lines heterozygous for mutations, we found that the mutations were not readily detected when they comprised 10% of total alleles (20% tumour cells) by sequencing, whereas they were readily detectable at 5% total alleles by standard HRM. LCN-HRM allowed these mutations to be identified by direct sequencing of those positive reactions. LCN-HRM was then used to review formalin-fixed paraffin-embedded (FFPE) clinical samples showing discordant findings between sequencing and HRM for KRAS exon 2 and EGFR exons 19 and 21. Both true mutations present at low levels and sequence changes due to artefacts were detected by LCN-HRM. The use of high fidelity polymerases showed that the majority of the artefacts were derived from the damaged template rather than replication errors during amplification. Conclusion LCN-HRM bridges the sensitivity gap between HRM and sequencing and is effective in distinguishing between artefacts and true mutations. PMID:19811662

  18. Limited copy number-high resolution melting (LCN-HRM) enables the detection and identification by sequencing of low level mutations in cancer biopsies.

    PubMed

    Do, Hongdo; Dobrovic, Alexander

    2009-10-08

    Mutation detection in clinical tumour samples is challenging when the proportion of tumour cells, and thus mutant alleles, is low. The limited sensitivity of conventional sequencing necessitates the adoption of more sensitive approaches. High resolution melting (HRM) is more sensitive than sequencing but identification of the mutation is desirable, particularly when it is important to discriminate false positives due to PCR errors or template degradation from true mutations.We thus developed limited copy number - high resolution melting (LCN-HRM) which applies limiting dilution to HRM. Multiple replicate reactions with a limited number of target sequences per reaction allow low level mutations to be detected. The dilutions used (based on Ct values) are chosen such that mutations, if present, can be detected by the direct sequencing of amplicons with aberrant melting patterns. Using cell lines heterozygous for mutations, we found that the mutations were not readily detected when they comprised 10% of total alleles (20% tumour cells) by sequencing, whereas they were readily detectable at 5% total alleles by standard HRM. LCN-HRM allowed these mutations to be identified by direct sequencing of those positive reactions.LCN-HRM was then used to review formalin-fixed paraffin-embedded (FFPE) clinical samples showing discordant findings between sequencing and HRM for KRAS exon 2 and EGFR exons 19 and 21. Both true mutations present at low levels and sequence changes due to artefacts were detected by LCN-HRM. The use of high fidelity polymerases showed that the majority of the artefacts were derived from the damaged template rather than replication errors during amplification. LCN-HRM bridges the sensitivity gap between HRM and sequencing and is effective in distinguishing between artefacts and true mutations.

  19. Targeted Re-Sequencing Emulsion PCR Panel for Myopathies: Results in 94 Cases.

    PubMed

    Punetha, Jaya; Kesari, Akanchha; Uapinyoying, Prech; Giri, Mamta; Clarke, Nigel F; Waddell, Leigh B; North, Kathryn N; Ghaoui, Roula; O'Grady, Gina L; Oates, Emily C; Sandaradura, Sarah A; Bönnemann, Carsten G; Donkervoort, Sandra; Plotz, Paul H; Smith, Edward C; Tesi-Rocha, Carolina; Bertorini, Tulio E; Tarnopolsky, Mark A; Reitter, Bernd; Hausmanowa-Petrusewicz, Irena; Hoffman, Eric P

    2016-05-27

    Molecular diagnostics in the genetic myopathies often requires testing of the largest and most complex transcript units in the human genome (DMD, TTN, NEB). Iteratively targeting single genes for sequencing has traditionally entailed high costs and long turnaround times. Exome sequencing has begun to supplant single targeted genes, but there are concerns regarding coverage and needed depth of the very large and complex genes that frequently cause myopathies. To evaluate efficiency of next-generation sequencing technologies to provide molecular diagnostics for patients with previously undiagnosed myopathies. We tested a targeted re-sequencing approach, using a 45 gene emulsion PCR myopathy panel, with subsequent sequencing on the Illumina platform in 94 undiagnosed patients. We compared the targeted re-sequencing approach to exome sequencing for 10 of these patients studied. We detected likely pathogenic mutations in 33 out of 94 patients with a molecular diagnostic rate of approximately 35%. The remaining patients showed variants of unknown significance (35/94 patients) or no mutations detected in the 45 genes tested (26/94 patients). Mutation detection rates for targeted re-sequencing vs. whole exome were similar in both methods; however exome sequencing showed better distribution of reads and fewer exon dropouts. Given that costs of highly parallel re-sequencing and whole exome sequencing are similar, and that exome sequencing now takes considerably less laboratory processing time than targeted re-sequencing, we recommend exome sequencing as the standard approach for molecular diagnostics of myopathies.

  20. A quantitative study of a physics-first pilot program

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pasero, Spencer Lee; /Northern Illinois U.

    Hundreds of high schools around the United States have inverted the traditional core sequence of high school science courses, putting physics first, followed by chemistry, and then biology. A quarter-century of theory, opinion, and anecdote are available, but the literature lacks empirical evidence of the effects of the program. The current study was designed to investigate the effects of the program on science achievement gain, growth in attitude toward science, and growth in understanding of the nature of scientific knowledge. One hundred eighty-five honor students participated in this quasi-experiment, self-selecting into either the traditional or inverted sequence. Students took themore » Explore test as freshmen, and the Plan test as sophomores. Gain scores were calculated for the composite scores and for the science and mathematics subscale scores. A two-factor analysis of variance (ANOVA) on course sequence and cohort showed significantly greater composite score gains by students taking the inverted sequence. Participants were administered surveys measuring attitude toward science and understanding of the nature of scientific knowledge twice per year. A multilevel growth model, compared across program groups, did not show any significant effect of the inverted sequence on either attitude or understanding of the nature of scientific knowledge. The sole significant parameter showed a decline in student attitude independent of course sequence toward science over the first two years of high school. The results of this study support the theory that moving physics to the front of the science sequence can improve achievement. The importance of the composite gain score on tests vertically aligned with the high-stakes ACT is discussed, and several ideas for extensions of the current study are offered.« less

  1. Hydroquinone: O-glucosyltransferase from cultivated Rauvolfia cells: enrichment and partial amino acid sequences.

    PubMed

    Arend, J; Warzecha, H; Stöckigt, J

    2000-01-01

    Plant cell suspension cultures of Rauvolfia are able to produce a high amount of arbutin by glucosylation of exogenously added hydroquinone. A four step purification procedure using anion exchange, hydrophobic interaction, hydroxyapatite-chromatography and chromatofocusing delivered in a yield of 0.5%, an approximately 390 fold enrichment of the involved glucosyltransferase. SDS-PAGE showed a M(r) for the enzyme of 52 kDa. Proteolysis of the pure enzyme with endoproteinase LysC revealed six peptide fragments with 9-23 amino acids which were sequenced. Sequence alignment of the six peptides showed high homologies to glycosyltransferases from other higher plants.

  2. The Neural Correlates of Implicit Sequence Learning in Schizophrenia

    PubMed Central

    Marvel, Cherie L.; Turner, Beth M.; O’Leary, Daniel S.; Johnson, Hans J.; Pierson, Ronald K.; Boles Ponto, Laura L.; Andreasen, Nancy C.

    2009-01-01

    Twenty-seven schizophrenia spectrum patients and 25 healthy controls performed a probabilistic version of the serial reaction time task (SRT) that included sequence trials embedded within random trials. Patients showed diminished, yet measurable, sequence learning. Postexperimental analyses revealed that a group of patients performed above chance when generating short spans of the sequence. This high-generation group showed SRT learning that was similar in magnitude to that of controls. Their learning was evident from the very 1st block; however, unlike controls, learning did not develop further with continued testing. A subset of 12 patients and 11 controls performed the SRT in conjunction with positron emission tomography. High-generation performance, which corresponded to SRT learning in patients, correlated to activity in the premotor cortex and parahippocampus. These areas have been associated with stimulus-driven visuospatial processing. Taken together, these results suggest that a subset of patients who showed moderate success on the SRT used an explicit stimulus-driven strategy to process the sequential stimuli. This adaptive strategy facilitated sequence learning but may have interfered with conventional implicit learning of the overall stimulus pattern. PMID:17983290

  3. High Genetic Diversity and Novelty in Eukaryotic Plankton Assemblages Inhabiting Saline Lakes in the Qaidam Basin

    PubMed Central

    Wang, Jiali; Wang, Fang; Chu, Limin; Wang, Hao; Zhong, Zhiping; Liu, Zhipei; Gao, Jianyong; Duan, Hairong

    2014-01-01

    Saline lakes are intriguing ecosystems harboring extremely productive microbial communities in spite of their extreme environmental conditions. We performed a comprehensive analysis of the genetic diversity (18S rRNA gene) of the planktonic microbial eukaryotes (nano- and picoeukaryotes) in six different inland saline lakes located in the Qaidam Basin. The novelty level are high, with about 11.23% of the whole dataset showing <90% identity to any previously reported sequence in GenBank. At least 4 operational taxonomic units (OTUs) in mesosaline lakes, while up to eighteen OTUs in hypersaline lakes show very low CCM and CEM scores, indicating that these sequences are highly distantly related to any existing sequence. Most of the 18S rRNA gene sequence reads obtained in investigated mesosaline lakes is closely related to Holozoa group (48.13%), whereas Stramenopiles (26.65%) and Alveolates (10.84%) are the next most common groups. Hypersaline lakes in the Qaidam Basin are also dominated by Holozoa group, accounting for 26.65% of the total number of sequence reads. Notably, Chlorophyta group are only found in high abundance in Lake Gasikule (28.00%), whereas less represented in other hypersaline lakes such as Gahai (0.50%) and Xiaochaidan (1.15%). Further analysis show that the compositions of planktonic eukaryotic assemblages are also most variable between different sampling sites in the same lake. Out of the parameters, four show significant correlation to this CCA: altitude, calcium, sodium and potassium concentrations. Overall, this study shows important gaps in the current knowledge about planktonic microbial eukaryotes inhabiting Qaidam Basin (hyper) saline water bodies. The identified diversity and novelty patterns among eukaryotic plankton assemblages in saline lake are of great importance for understanding and interpreting their ecology and evolution. PMID:25401703

  4. Combining high-throughput sequencing with fruit body surveys reveals contrasting life-history strategies in fungi

    PubMed Central

    Ovaskainen, Otso; Schigel, Dmitry; Ali-Kovero, Heini; Auvinen, Petri; Paulin, Lars; Nordén, Björn; Nordén, Jenni

    2013-01-01

    Before the recent revolution in molecular biology, field studies on fungal communities were mostly confined to fruit bodies, whereas mycelial interactions were studied in the laboratory. Here we combine high-throughput sequencing with a fruit body inventory to study simultaneously mycelial and fruit body occurrences in a community of fungi inhabiting dead wood of Norway spruce. We studied mycelial occurrence by extracting DNA from wood samples followed by 454-sequencing of the ITS1 and ITS2 regions and an automated procedure for species identification. In total, we detected 198 species as mycelia and 137 species as fruit bodies. The correlation between mycelial and fruit body occurrences was high for the majority of the species, suggesting that high-throughput sequencing can successfully characterize the dominating fungal communities, despite possible biases related to sampling, PCR, sequencing and molecular identification. We used the fruit body and molecular data to test hypothesized links between life history and population dynamic parameters. We show that the species that have on average a high mycelial abundance also have a high fruiting rate and produce large fruit bodies, leading to a positive feedback loop in their population dynamics. Earlier studies have shown that species with specialized resource requirements are rarely seen fruiting, for which reason they are often classified as red-listed. We show with the help of high-throughput sequencing that some of these species are more abundant as mycelium in wood than what could be expected from their occurrence as fruit bodies. PMID:23575372

  5. Refining the Results of a Classical SELEX Experiment by Expanding the Sequence Data Set of an Aptamer Pool Selected for Protein A

    PubMed Central

    2018-01-01

    New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aureus. In this study, we show the extension of the SELEX results by re-sequencing of the same aptamer pool using a medium throughput NGS approach and data analysis. Both data pools were compared. They confirm the selection of a highly complex and heterogeneous oligonucleotide pool and show consistently a high content of orphans as well as a similar relative frequency of certain sequence groups. But in contrast to the Sanger data pool, the NGS pool was clearly dominated by one sequence group containing the known Protein A-binding aptamer PA#2/8 as the most frequent sequence in this group. In addition, we found two new sequence groups in the NGS pool represented by PA-C10 and PA-C8, respectively, which also have high specificity for Protein A. Comparative affinity studies reveal differences between the aptamers and confirm that PA#2/8 remains the most potent sequence within the selected aptamer pool reaching affinities in the low nanomolar range of KD = 20 ± 1 nM. PMID:29495282

  6. Refining the Results of a Classical SELEX Experiment by Expanding the Sequence Data Set of an Aptamer Pool Selected for Protein A.

    PubMed

    Stoltenburg, Regina; Strehlitz, Beate

    2018-02-24

    New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aureus . In this study, we show the extension of the SELEX results by re-sequencing of the same aptamer pool using a medium throughput NGS approach and data analysis. Both data pools were compared. They confirm the selection of a highly complex and heterogeneous oligonucleotide pool and show consistently a high content of orphans as well as a similar relative frequency of certain sequence groups. But in contrast to the Sanger data pool, the NGS pool was clearly dominated by one sequence group containing the known Protein A-binding aptamer PA#2/8 as the most frequent sequence in this group. In addition, we found two new sequence groups in the NGS pool represented by PA-C10 and PA-C8, respectively, which also have high specificity for Protein A. Comparative affinity studies reveal differences between the aptamers and confirm that PA#2/8 remains the most potent sequence within the selected aptamer pool reaching affinities in the low nanomolar range of K D = 20 ± 1 nM.

  7. Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

    PubMed Central

    Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

    1998-01-01

    The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

  8. Molecular cloning, sequence characterization and recombinant expression of Nanog gene in goat fibroblast cells using lentiviral based expression system.

    PubMed

    Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba

    2014-01-01

    Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.

  9. Sequence Complexity of Amyloidogenic Regions in Intrinsically Disordered Human Proteins

    PubMed Central

    Das, Swagata; Pal, Uttam; Das, Supriya; Bagga, Khyati; Roy, Anupam; Mrigwani, Arpita; Maiti, Nakul C.

    2014-01-01

    An amyloidogenic region (AR) in a protein sequence plays a significant role in protein aggregation and amyloid formation. We have investigated the sequence complexity of AR that is present in intrinsically disordered human proteins. More than 80% human proteins in the disordered protein databases (DisProt+IDEAL) contained one or more ARs. With decrease of protein disorder, AR content in the protein sequence was decreased. A probability density distribution analysis and discrete analysis of AR sequences showed that ∼8% residue in a protein sequence was in AR and the region was in average 8 residues long. The residues in the AR were high in sequence complexity and it seldom overlapped with low complexity regions (LCR), which was largely abundant in disorder proteins. The sequences in the AR showed mixed conformational adaptability towards α-helix, β-sheet/strand and coil conformations. PMID:24594841

  10. Evidence for the presence of key chlorophyll-biosynthesis-related proteins in the genus Rubrobacter (Phylum Actinobacteria) and its implications for the evolution and origin of photosynthesis.

    PubMed

    Gupta, Radhey S; Khadka, Bijendra

    2016-02-01

    Homologs showing high degree of sequence similarity to the three subunits of the protochlorophyllide oxidoreductase enzyme complex (viz. BchL, BchN, and BchB), which carries out a central role in chlorophyll-bacteriochlorophyll (Bchl) biosynthesis, are uniquely found in photosynthetic organisms. The results of BLAST searches and homology modeling presented here show that proteins exhibiting a high degree of sequence and structural similarity to the BchB and BchN proteins are also present in organisms from the high G+C Gram-positive phylum of Actinobacteria, specifically in members of the genus Rubrobacter (R. x ylanophilus and R. r adiotolerans). The results presented exclude the possibility that the observed BLAST hits are for subunits of the nitrogenase complex or the chlorin reductase complex. The branching in phylogenetic trees and the sequence characteristics of the Rubrobacter BchB/BchN homologs indicate that these homologs are distinct from those found in other photosynthetic bacteria and that they may represent ancestral forms of the BchB/BchN proteins. Although a homolog showing high degree of sequence similarity to the BchL protein was not detected in Rubrobacter, another protein, belonging to the ParA/Soj/MinD family, present in these bacteria, exhibits high degree of structural similarity to the BchL. In addition to the BchB/BchN homologs, Rubrobacter species also contain homologs showing high degree of sequence similarity to different subunits of magnesium chelatase (BchD, BchH, and BchI) as well as proteins showing significant similarity to the BchP and BchG proteins. Interestingly, no homologs corresponding to the BchX, BchY, and BchZ proteins were detected in the Rubrobacter species. These results provide the first suggestive evidence that some form of photosynthesis either exists or was anciently present within the phylum Actinobacteria (high G+C Gram-positive) in members of the genus Rubrobacter. The significance of these results concerning the origin of the Bchl-based photosynthesis is also discussed.

  11. Highly Iterated Palindromic Sequences (HIPs) and Their Relationship to DNA Methyltransferases

    PubMed Central

    Elhai, Jeff

    2015-01-01

    The sequence GCGATCGC (Highly Iterated Palindrome, HIP1) is commonly found in high frequency in cyanobacterial genomes. An important clue to its function may be the presence of two orphan DNA methyltransferases that recognize internal sequences GATC and CGATCG. An examination of genomes from 97 cyanobacteria, both free-living and obligate symbionts, showed that there are exceptional cases in which HIP1 is at a low frequency or nearly absent. In some of these cases, it appears to have been replaced by a different GC-rich palindromic sequence, alternate HIPs. When HIP1 is at a high frequency, GATC- and CGATCG-specific methyltransferases are generally present in the genome. When an alternate HIP is at high frequency, a methyltransferase specific for that sequence is present. The pattern of 1-nt deviations from HIP1 sequences is biased towards the first and last nucleotides, i.e., those distinguish CGATCG from HIP1. Taken together, the results point to a role of DNA methylation in the creation or functioning of HIP sites. A model is presented that postulates the existence of a GmeC-dependent mismatch repair system whose activity creates and maintains HIP sequences. PMID:25789551

  12. Highly Iterated Palindromic Sequences (HIPs) and Their Relationship to DNA Methyltransferases.

    PubMed

    Elhai, Jeff

    2015-03-17

    The sequence GCGATCGC (Highly Iterated Palindrome, HIP1) is commonly found in high frequency in cyanobacterial genomes. An important clue to its function may be the presence of two orphan DNA methyltransferases that recognize internal sequences GATC and CGATCG. An examination of genomes from 97 cyanobacteria, both free-living and obligate symbionts, showed that there are exceptional cases in which HIP1 is at a low frequency or nearly absent. In some of these cases, it appears to have been replaced by a different GC-rich palindromic sequence, alternate HIPs. When HIP1 is at a high frequency, GATC- and CGATCG-specific methyltransferases are generally present in the genome. When an alternate HIP is at high frequency, a methyltransferase specific for that sequence is present. The pattern of 1-nt deviations from HIP1 sequences is biased towards the first and last nucleotides, i.e., those distinguish CGATCG from HIP1. Taken together, the results point to a role of DNA methylation in the creation or functioning of HIP sites. A model is presented that postulates the existence of a GmeC-dependent mismatch repair system whose activity creates and maintains HIP sequences.

  13. SMARTIV: combined sequence and structure de-novo motif discovery for in-vivo RNA binding data.

    PubMed

    Polishchuk, Maya; Paz, Inbal; Yakhini, Zohar; Mandel-Gutfreund, Yael

    2018-05-25

    Gene expression regulation is highly dependent on binding of RNA-binding proteins (RBPs) to their RNA targets. Growing evidence supports the notion that both RNA primary sequence and its local secondary structure play a role in specific Protein-RNA recognition and binding. Despite the great advance in high-throughput experimental methods for identifying sequence targets of RBPs, predicting the specific sequence and structure binding preferences of RBPs remains a major challenge. We present a novel webserver, SMARTIV, designed for discovering and visualizing combined RNA sequence and structure motifs from high-throughput RNA-binding data, generated from in-vivo experiments. The uniqueness of SMARTIV is that it predicts motifs from enriched k-mers that combine information from ranked RNA sequences and their predicted secondary structure, obtained using various folding methods. Consequently, SMARTIV generates Position Weight Matrices (PWMs) in a combined sequence and structure alphabet with assigned P-values. SMARTIV concisely represents the sequence and structure motif content as a single graphical logo, which is informative and easy for visual perception. SMARTIV was examined extensively on a variety of high-throughput binding experiments for RBPs from different families, generated from different technologies, showing consistent and accurate results. Finally, SMARTIV is a user-friendly webserver, highly efficient in run-time and freely accessible via http://smartiv.technion.ac.il/.

  14. Bone morphogenetic protein-binding endothelial regulator of liver sinusoidal endothelial cells induces iron overload in a fatty liver mouse model.

    PubMed

    Hasebe, Takumu; Tanaka, Hiroki; Sawada, Koji; Nakajima, Shunsuke; Ohtake, Takaaki; Fujiya, Mikihiro; Kohgo, Yutaka

    2017-03-01

    Non-alcoholic fatty liver disease (NAFLD) is frequently accompanied by iron overload. However, because of the complex hepcidin-regulating molecules, the molecular mechanism underlying iron overload remains unknown. To identify the key molecule involved in NAFLD-associated iron dysregulation, we performed whole-RNA sequencing on the livers of obese mice. Male C57BL/6 mice were fed a regular or high-fat diet for 16 or 48 weeks. Internal iron was evaluated by plasma iron, ferritin or hepatic iron content. Whole-RNA sequencing was performed by transcriptome analysis using semiconductor high-throughput sequencer. Mouse liver tissues or isolated hepatocytes and sinusoidal endothelial cells were used to assess the expression of iron-regulating molecules. Mice fed a high-fat diet for 16 weeks showed excess iron accumulation. Longer exposure to a high-fat diet increased hepatic fibrosis and intrahepatic iron accumulation. A pathway analysis of the sequencing data showed that several inflammatory pathways, including bone morphogenetic protein (BMP)-SMAD signaling, were significantly affected. Sequencing analysis showed 2314 altered genes, including decreased mRNA expression of the hepcidin-coding gene Hamp. Hepcidin protein expression and SMAD phosphorylation, which induces Hamp, were found to be reduced. The expression of BMP-binding endothelial regulator (BMPER), which inhibits BMP-SMAD signaling by binding BMP extracellularly, was up-regulated in fatty livers. In addition, immunohistochemical and cell isolation analyses showed that BMPER was primarily expressed in the liver sinusoidal endothelial cells (LSECs) rather than hepatocytes. BMPER secretion by LSECs inhibits BMP-SMAD signaling in hepatocytes and further reduces hepcidin protein expression. These intrahepatic molecular interactions suggest a novel molecular basis of iron overload in NAFLD.

  15. The neural correlates of implicit sequence learning in schizophrenia.

    PubMed

    Marvel, Cherie L; Turner, Beth M; O'Leary, Daniel S; Johnson, Hans J; Pierson, Ronald K; Ponto, Laura L Boles; Andreasen, Nancy C

    2007-11-01

    Twenty-seven schizophrenia spectrum patients and 25 healthy controls performed a probabilistic version of the serial reaction time task (SRT) that included sequence trials embedded within random trials. Patients showed diminished, yet measurable, sequence learning. Postexperimental analyses revealed that a group of patients performed above chance when generating short spans of the sequence. This high-generation group showed SRT learning that was similar in magnitude to that of controls. Their learning was evident from the very 1st block; however, unlike controls, learning did not develop further with continued testing. A subset of 12 patients and 11 controls performed the SRT in conjunction with positron emission tomography. High-generation performance, which corresponded to SRT learning in patients, correlated to activity in the premotor cortex and parahippocampus. These areas have been associated with stimulus-driven visuospatial processing. Taken together, these results suggest that a subset of patients who showed moderate success on the SRT used an explicit stimulus-driven strategy to process the sequential stimuli. This adaptive strategy facilitated sequence learning but may have interfered with conventional implicit learning of the overall stimulus pattern. PsycINFO Database Record (c) 2007 APA, all rights reserved.

  16. HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

    PubMed Central

    Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

    1995-01-01

    The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

  17. Pseudouridines have context-dependent mutation and stop rates in high-throughput sequencing.

    PubMed

    Zhou, Katherine I; Clark, Wesley C; Pan, David W; Eckwahl, Matthew J; Dai, Qing; Pan, Tao

    2018-05-11

    The abundant RNA modification pseudouridine (Ψ) has been mapped transcriptome-wide by chemically modifying pseudouridines with carbodiimide and detecting the resulting reverse transcription stops in high-throughput sequencing. However, these methods have limited sensitivity and specificity, in part due to the use of reverse transcription stops. We sought to use mutations rather than just stops in sequencing data to identify pseudouridine sites. Here, we identify reverse transcription conditions that allow read-through of carbodiimide-modified pseudouridine (CMC-Ψ), and we show that pseudouridines in carbodiimide-treated human ribosomal RNA have context-dependent mutation and stop rates in high-throughput sequencing libraries prepared under these conditions. Furthermore, accounting for the context-dependence of mutation and stop rates can enhance the detection of pseudouridine sites. Similar approaches could contribute to the sequencing-based detection of many RNA modifications.

  18. Communicating the Benefits of a Full Sequence of High School Science Courses

    NASA Astrophysics Data System (ADS)

    Nicholas, Catherine Marie

    High school students are generally uninformed about the benefits of enrolling in a full sequence of science courses, therefore only about a third of our nation's high school graduates have completed the science sequence of Biology, Chemistry and Physics. The lack of students completing a full sequence of science courses contributes to the deficit in the STEM degree production rate needed to fill the demand of the current job market and remain competitive as a nation. The purpose of the study was to make a difference in the number of students who have access to information about the benefits of completing a full sequence of science courses. This dissertation study employed qualitative research methodology to gain a broad perspective of staff through a questionnaire and document review and then a deeper understanding through semi-structured interview protocol. The data revealed that a universal sequence of science courses in the high school district did not exist. It also showed that not all students had access to all science courses; students were sorted and tracked according to prerequisites that did not necessarily match the skill set needed for the courses. In addition, the study showed a desire for more support and direction from the district office. It was also apparent that there was a disconnect that existed between who staff members believed should enroll in a full sequence of science courses and who actually enrolled. Finally, communication about science was shown to occur mainly through counseling and peers. A common science sequence, detracking of science courses, increased communication about the postsecondary and academic benefits of a science education, increased district direction and realistic mathematics alignment were all discussed as solutions to the problem.

  19. Flexible theta sequence compression mediated via phase precessing interneurons

    PubMed Central

    Chadwick, Angus; van Rossum, Mark CW; Nolan, Matthew F

    2016-01-01

    Encoding of behavioral episodes as spike sequences during hippocampal theta oscillations provides a neural substrate for computations on events extended across time and space. However, the mechanisms underlying the numerous and diverse experimentally observed properties of theta sequences remain poorly understood. Here we account for theta sequences using a novel model constrained by the septo-hippocampal circuitry. We show that when spontaneously active interneurons integrate spatial signals and theta frequency pacemaker inputs, they generate phase precessing action potentials that can coordinate theta sequences in place cell populations. We reveal novel constraints on sequence generation, predict cellular properties and neural dynamics that characterize sequence compression, identify circuit organization principles for high capacity sequential representation, and show that theta sequences can be used as substrates for association of conditioned stimuli with recent and upcoming events. Our results suggest mechanisms for flexible sequence compression that are suited to associative learning across an animal’s lifespan. DOI: http://dx.doi.org/10.7554/eLife.20349.001 PMID:27929374

  20. FRESCO: Referential compression of highly similar sequences.

    PubMed

    Wandelt, Sebastian; Leser, Ulf

    2013-01-01

    In many applications, sets of similar texts or sequences are of high importance. Prominent examples are revision histories of documents or genomic sequences. Modern high-throughput sequencing technologies are able to generate DNA sequences at an ever-increasing rate. In parallel to the decreasing experimental time and cost necessary to produce DNA sequences, computational requirements for analysis and storage of the sequences are steeply increasing. Compression is a key technology to deal with this challenge. Recently, referential compression schemes, storing only the differences between a to-be-compressed input and a known reference sequence, gained a lot of interest in this field. In this paper, we propose a general open-source framework to compress large amounts of biological sequence data called Framework for REferential Sequence COmpression (FRESCO). Our basic compression algorithm is shown to be one to two orders of magnitudes faster than comparable related work, while achieving similar compression ratios. We also propose several techniques to further increase compression ratios, while still retaining the advantage in speed: 1) selecting a good reference sequence; and 2) rewriting a reference sequence to allow for better compression. In addition,we propose a new way of further boosting the compression ratios by applying referential compression to already referentially compressed files (second-order compression). This technique allows for compression ratios way beyond state of the art, for instance,4,000:1 and higher for human genomes. We evaluate our algorithms on a large data set from three different species (more than 1,000 genomes, more than 3 TB) and on a collection of versions of Wikipedia pages. Our results show that real-time compression of highly similar sequences at high compression ratios is possible on modern hardware.

  1. YAMAT-seq: an efficient method for high-throughput sequencing of mature transfer RNAs

    PubMed Central

    Shigematsu, Megumi; Honda, Shozo; Loher, Phillipe; Telonis, Aristeidis G.; Rigoutsos, Isidore

    2017-01-01

    Abstract Besides translation, transfer RNAs (tRNAs) play many non-canonical roles in various biological pathways and exhibit highly variable expression profiles. To unravel the emerging complexities of tRNA biology and molecular mechanisms underlying them, an efficient tRNA sequencing method is required. However, the rigid structure of tRNA has been presenting a challenge to the development of such methods. We report the development of Y-shaped Adapter-ligated MAture TRNA sequencing (YAMAT-seq), an efficient and convenient method for high-throughput sequencing of mature tRNAs. YAMAT-seq circumvents the issue of inefficient adapter ligation, a characteristic of conventional RNA sequencing methods for mature tRNAs, by employing the efficient and specific ligation of Y-shaped adapter to mature tRNAs using T4 RNA Ligase 2. Subsequent cDNA amplification and next-generation sequencing successfully yield numerous mature tRNA sequences. YAMAT-seq has high specificity for mature tRNAs and high sensitivity to detect most isoacceptors from minute amount of total RNA. Moreover, YAMAT-seq shows quantitative capability to estimate expression levels of mature tRNAs, and has high reproducibility and broad applicability for various cell lines. YAMAT-seq thus provides high-throughput technique for identifying tRNA profiles and their regulations in various transcriptomes, which could play important regulatory roles in translation and other biological processes. PMID:28108659

  2. Streaming fragment assignment for real-time analysis of sequencing experiments

    PubMed Central

    Roberts, Adam; Pachter, Lior

    2013-01-01

    We present eXpress, a software package for highly efficient probabilistic assignment of ambiguously mapping sequenced fragments. eXpress uses a streaming algorithm with linear run time and constant memory use. It can determine abundances of sequenced molecules in real time, and can be applied to ChIP-seq, metagenomics and other large-scale sequencing data. We demonstrate its use on RNA-seq data, showing greater efficiency than other quantification methods. PMID:23160280

  3. Genome sequencing in microfabricated high-density picolitre reactors.

    PubMed

    Margulies, Marcel; Egholm, Michael; Altman, William E; Attiya, Said; Bader, Joel S; Bemben, Lisa A; Berka, Jan; Braverman, Michael S; Chen, Yi-Ju; Chen, Zhoutao; Dewell, Scott B; Du, Lei; Fierro, Joseph M; Gomes, Xavier V; Godwin, Brian C; He, Wen; Helgesen, Scott; Ho, Chun Heen; Ho, Chun He; Irzyk, Gerard P; Jando, Szilveszter C; Alenquer, Maria L I; Jarvie, Thomas P; Jirage, Kshama B; Kim, Jong-Bum; Knight, James R; Lanza, Janna R; Leamon, John H; Lefkowitz, Steven M; Lei, Ming; Li, Jing; Lohman, Kenton L; Lu, Hong; Makhijani, Vinod B; McDade, Keith E; McKenna, Michael P; Myers, Eugene W; Nickerson, Elizabeth; Nobile, John R; Plant, Ramona; Puc, Bernard P; Ronan, Michael T; Roth, George T; Sarkis, Gary J; Simons, Jan Fredrik; Simpson, John W; Srinivasan, Maithreyan; Tartaro, Karrie R; Tomasz, Alexander; Vogt, Kari A; Volkmer, Greg A; Wang, Shally H; Wang, Yong; Weiner, Michael P; Yu, Pengguang; Begley, Richard F; Rothberg, Jonathan M

    2005-09-15

    The proliferation of large-scale DNA-sequencing projects in recent years has driven a search for alternative methods to reduce time and cost. Here we describe a scalable, highly parallel sequencing system with raw throughput significantly greater than that of state-of-the-art capillary electrophoresis instruments. The apparatus uses a novel fibre-optic slide of individual wells and is able to sequence 25 million bases, at 99% or better accuracy, in one four-hour run. To achieve an approximately 100-fold increase in throughput over current Sanger sequencing technology, we have developed an emulsion method for DNA amplification and an instrument for sequencing by synthesis using a pyrosequencing protocol optimized for solid support and picolitre-scale volumes. Here we show the utility, throughput, accuracy and robustness of this system by shotgun sequencing and de novo assembly of the Mycoplasma genitalium genome with 96% coverage at 99.96% accuracy in one run of the machine.

  4. Identification of optimum sequencing depth especially for de novo genome assembly of small genomes using next generation sequencing data.

    PubMed

    Desai, Aarti; Marwah, Veer Singh; Yadav, Akshay; Jha, Vineet; Dhaygude, Kishor; Bangar, Ujwala; Kulkarni, Vivek; Jere, Abhay

    2013-01-01

    Next Generation Sequencing (NGS) is a disruptive technology that has found widespread acceptance in the life sciences research community. The high throughput and low cost of sequencing has encouraged researchers to undertake ambitious genomic projects, especially in de novo genome sequencing. Currently, NGS systems generate sequence data as short reads and de novo genome assembly using these short reads is computationally very intensive. Due to lower cost of sequencing and higher throughput, NGS systems now provide the ability to sequence genomes at high depth. However, currently no report is available highlighting the impact of high sequence depth on genome assembly using real data sets and multiple assembly algorithms. Recently, some studies have evaluated the impact of sequence coverage, error rate and average read length on genome assembly using multiple assembly algorithms, however, these evaluations were performed using simulated datasets. One limitation of using simulated datasets is that variables such as error rates, read length and coverage which are known to impact genome assembly are carefully controlled. Hence, this study was undertaken to identify the minimum depth of sequencing required for de novo assembly for different sized genomes using graph based assembly algorithms and real datasets. Illumina reads for E.coli (4.6 MB) S.kudriavzevii (11.18 MB) and C.elegans (100 MB) were assembled using SOAPdenovo, Velvet, ABySS, Meraculous and IDBA-UD. Our analysis shows that 50X is the optimum read depth for assembling these genomes using all assemblers except Meraculous which requires 100X read depth. Moreover, our analysis shows that de novo assembly from 50X read data requires only 6-40 GB RAM depending on the genome size and assembly algorithm used. We believe that this information can be extremely valuable for researchers in designing experiments and multiplexing which will enable optimum utilization of sequencing as well as analysis resources.

  5. Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China

    PubMed Central

    Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling

    2014-01-01

    Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926

  6. Mining sequence variations in representative polyploid sugarcane germplasm accessions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Xiping; Song, Jian; You, Qian

    Sugarcane (Saccharum spp.) is one of the most important economic crops because of its high sugar production and biofuel potential. Due to the high polyploid level and complex genome of sugarcane, it has been a huge challenge to investigate genomic sequence variations, which are critical for identifying alleles contributing to important agronomic traits. In order to mine the genetic variations in sugarcane, genotyping by sequencing (GBS), was used to genotype 14 representative Saccharum complex accessions. GBS is a method to generate a large number of markers, enabled by next generation sequencing (NGS) and the genome complexity reduction using restriction enzymes.more » To use GBS for high throughput genotyping highly polyploid sugarcane, the GBS analysis pipelines in 14 Saccharum complex accessions were established by evaluating different alignment methods, sequence variants callers, and sequence depth for single nucleotide polymorphism (SNP) filtering. By using the established pipeline, a total of 76,251 non-redundant SNPs, 5642 InDels, 6380 presence/absence variants (PAVs), and 826 copy number variations (CNVs) were detected among the 14 accessions. In addition, non-reference based universal network enabled analysis kit and Stacks de novo called 34,353 and 109,043 SNPs, respectively. In the 14 accessions, the percentages of single dose SNPs ranged from 38.3% to 62.3% with an average of 49.6%, much more than the portions of multiple dosage SNPs. Concordantly called SNPs were used to evaluate the phylogenetic relationship among the 14 accessions. The results showed that the divergence time between the Erianthus genus and the Saccharum genus was more than 10 million years ago (MYA). The Saccharum species separated from their common ancestors ranging from 0.19 to 1.65 MYA. The GBS pipelines including the reference sequences, alignment methods, sequence variant callers, and sequence depth were recommended and discussed for the Saccharum complex and other related species. A large number of sequence variations were discovered in the Saccharum complex, including SNPs, InDels, PAVs, and CNVs. Genome-wide SNPs were further used to illustrate sequence features of polyploid species and demonstrated the divergence of different species in the Saccharum complex. The results of this study showed that GBS was an effective NGS-based method to discover genomic sequence variations in highly polyploid and heterozygous species.« less

  7. Mining sequence variations in representative polyploid sugarcane germplasm accessions

    DOE PAGES

    Yang, Xiping; Song, Jian; You, Qian; ...

    2017-08-09

    Sugarcane (Saccharum spp.) is one of the most important economic crops because of its high sugar production and biofuel potential. Due to the high polyploid level and complex genome of sugarcane, it has been a huge challenge to investigate genomic sequence variations, which are critical for identifying alleles contributing to important agronomic traits. In order to mine the genetic variations in sugarcane, genotyping by sequencing (GBS), was used to genotype 14 representative Saccharum complex accessions. GBS is a method to generate a large number of markers, enabled by next generation sequencing (NGS) and the genome complexity reduction using restriction enzymes.more » To use GBS for high throughput genotyping highly polyploid sugarcane, the GBS analysis pipelines in 14 Saccharum complex accessions were established by evaluating different alignment methods, sequence variants callers, and sequence depth for single nucleotide polymorphism (SNP) filtering. By using the established pipeline, a total of 76,251 non-redundant SNPs, 5642 InDels, 6380 presence/absence variants (PAVs), and 826 copy number variations (CNVs) were detected among the 14 accessions. In addition, non-reference based universal network enabled analysis kit and Stacks de novo called 34,353 and 109,043 SNPs, respectively. In the 14 accessions, the percentages of single dose SNPs ranged from 38.3% to 62.3% with an average of 49.6%, much more than the portions of multiple dosage SNPs. Concordantly called SNPs were used to evaluate the phylogenetic relationship among the 14 accessions. The results showed that the divergence time between the Erianthus genus and the Saccharum genus was more than 10 million years ago (MYA). The Saccharum species separated from their common ancestors ranging from 0.19 to 1.65 MYA. The GBS pipelines including the reference sequences, alignment methods, sequence variant callers, and sequence depth were recommended and discussed for the Saccharum complex and other related species. A large number of sequence variations were discovered in the Saccharum complex, including SNPs, InDels, PAVs, and CNVs. Genome-wide SNPs were further used to illustrate sequence features of polyploid species and demonstrated the divergence of different species in the Saccharum complex. The results of this study showed that GBS was an effective NGS-based method to discover genomic sequence variations in highly polyploid and heterozygous species.« less

  8. Influence of DNA sequence on the structure of minicircles under torsional stress

    PubMed Central

    Wang, Qian; Irobalieva, Rossitza N.; Chiu, Wah; Schmid, Michael F.; Fogg, Jonathan M.; Zechiedrich, Lynn

    2017-01-01

    Abstract The sequence dependence of the conformational distribution of DNA under various levels of torsional stress is an important unsolved problem. Combining theory and coarse-grained simulations shows that the DNA sequence and a structural correlation due to topology constraints of a circle are the main factors that dictate the 3D structure of a 336 bp DNA minicircle under torsional stress. We found that DNA minicircle topoisomers can have multiple bend locations under high torsional stress and that the positions of these sharp bends are determined by the sequence, and by a positive mechanical correlation along the sequence. We showed that simulations and theory are able to provide sequence-specific information about individual DNA minicircles observed by cryo-electron tomography (cryo-ET). We provided a sequence-specific cryo-ET tomogram fitting of DNA minicircles, registering the sequence within the geometric features. Our results indicate that the conformational distribution of minicircles under torsional stress can be designed, which has important implications for using minicircle DNA for gene therapy. PMID:28609782

  9. The Use of Behavioral Skills Training and in situ Feedback to Protect Children with Autism from Abduction Lures

    ERIC Educational Resources Information Center

    Gunby, Kristin V.; Rapp, John T.

    2014-01-01

    We examined the effects of behavioral skills training with in situ feedback on safe responding by children with autism to abduction lures that were presented after a high-probability (high-p) request sequence. This sequence was intended to simulate a grooming or recruitment process. Results show that all 3 participants ultimately acquired the…

  10. Distribution of a Nocardia brasiliensis catalase gene fragment in members of the genera Nocardia, Gordona, and Rhodococcus.

    PubMed

    Vera-Cabrera, L; Johnson, W M; Welsh, O; Resendiz-Uresti, F L; Salinas-Carmona, M C

    1999-06-01

    An immunodominant protein from Nocardia brasiliensis, P61, was subjected to amino-terminal and internal sequence analysis. Three sequences of 22, 17, and 38 residues, respectively, were obtained and compared with the protein database from GenBank by using the BLAST system. The sequences showed homology to some eukaryotic catalases and to a bromoperoxidase-catalase from Streptomyces violaceus. Its identity as a catalase was confirmed by analysis of its enzymatic activity on H2O2 and by a double-staining method on a nondenaturing polyacrylamide gel with 3,3'-diaminobenzidine and ferricyanide; the result showed only catalase activity, but no peroxidase. By using one of the internal amino acid sequences and a consensus catalase motif (VGNNTP), we were able to design a PCR assay that generated a 500-bp PCR product. The amplicon was analyzed, and the nucleotide sequence was compared to the GenBank database with the observation of high homology to other bacterial and eukaryotic catalases. A PCR assay based on this target sequence was performed with primers NB10 and NB11 to confirm the presence of the NB10-NB11 gene fragment in several N. brasiliensis strains isolated from mycetoma. The same assay was used to determine whether there were homologous sequences in several type strains from the genera Nocardia, Rhodococcus, Gordona, and Streptomyces. All of the N. brasiliensis strains presented a positive result but only some of the actinomycetes species tested were positive in the PCR assay. In order to confirm these findings, genomic DNA was subjected to Southern blot analysis. A 1.7-kbp band was observed in the N. brasiliensis strains, and bands of different molecular weight were observed in cross-reacting actinomycetes. Sequence analysis of the amplicons of selected actinomycetes showed high homology in this catalase fragment, thus demonstrating that this protein is highly conserved in this group of bacteria.

  11. Museum genomics: low-cost and high-accuracy genetic data from historical specimens.

    PubMed

    Rowe, Kevin C; Singhal, Sonal; Macmanes, Matthew D; Ayroles, Julien F; Morelli, Toni Lyn; Rubidge, Emily M; Bi, Ke; Moritz, Craig C

    2011-11-01

    Natural history collections are unparalleled repositories of geographical and temporal variation in faunal conditions. Molecular studies offer an opportunity to uncover much of this variation; however, genetic studies of historical museum specimens typically rely on extracting highly degraded and chemically modified DNA samples from skins, skulls or other dried samples. Despite this limitation, obtaining short fragments of DNA sequences using traditional PCR amplification of DNA has been the primary method for genetic study of historical specimens. Few laboratories have succeeded in obtaining genome-scale sequences from historical specimens and then only with considerable effort and cost. Here, we describe a low-cost approach using high-throughput next-generation sequencing to obtain reliable genome-scale sequence data from a traditionally preserved mammal skin and skull using a simple extraction protocol. We show that single-nucleotide polymorphisms (SNPs) from the genome sequences obtained independently from the skin and from the skull are highly repeatable compared to a reference genome. © 2011 Blackwell Publishing Ltd.

  12. Sequence stratigraphy and high-frequency cycles: New aspects for a quantitative evaluation of the Gulf of Suez basin, Egypt

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nio, S.D.; Yang, C.S.; Tewfik, N.

    1993-09-01

    A new development in the application of sequence stratigraphic concepts in marine as well as continental basins is the recognition of high-frequency cyclic patterns in rock successions in the subsurface. Studies of six wells from the northern, central, and southern parts of the Gulf of Suez show the presence of well-preserved, high-frequency cycles with periodicities similar to the orbitally forced Malankovitch parameters. Subsurface rock successions, third-order sequences, and high-frequency cycles were compared with outcrops. After establishing the biostratigraphic framework for the above-mentioned wells, a sequence analysis was performed. Sequence boundaries and maximum flooding positions in each well were calibrated withmore » the occurrences and evaluation of the high-frequency cycles. It became obvious that there is an intimate relationship between these high-frequency Milankovitch cycles and sequence organization. In addition, a close relationship can be observed in the subsurface as well as in outcrops between high-frequency climatic changes (connected to the Milankovitch cycles) and (litho)facies variability. Quantitative evaluations of each sequence and/or systems tract can be computed with the International Geoservices' cyclicity analysis tool (MILABAR). The results are summarized in a well composite chart, rate (NAR), and ratio of preserved time. In correlations between the wells, an accuracy of 500-100 Ka can be obtained. The quantitative evaluation of the sequence and high-frequency cycle analysis gave some new aspects concerning the (litho)facies and geodynamic development during the pre- as well as the synrift stages of the Gulf of Suez Basin.« less

  13. HMM-ModE: implementation, benchmarking and validation with HMMER3

    PubMed Central

    2014-01-01

    Background HMM-ModE is a computational method that generates family specific profile HMMs using negative training sequences. The method optimizes the discrimination threshold using 10 fold cross validation and modifies the emission probabilities of profiles to reduce common fold based signals shared with other sub-families. The protocol depends on the program HMMER for HMM profile building and sequence database searching. The recent release of HMMER3 has improved database search speed by several orders of magnitude, allowing for the large scale deployment of the method in sequence annotation projects. We have rewritten our existing scripts both at the level of parsing the HMM profiles and modifying emission probabilities to upgrade HMM-ModE using HMMER3 that takes advantage of its probabilistic inference with high computational speed. The method is benchmarked and tested on GPCR dataset as an accurate and fast method for functional annotation. Results The implementation of this method, which now works with HMMER3, is benchmarked with the earlier version of HMMER, to show that the effect of local-local alignments is marked only in the case of profiles containing a large number of discontinuous match states. The method is tested on a gold standard set of families and we have reported a significant reduction in the number of false positive hits over the default HMM profiles. When implemented on GPCR sequences, the results showed an improvement in the accuracy of classification compared with other methods used to classify the familyat different levels of their classification hierarchy. Conclusions The present findings show that the new version of HMM-ModE is a highly specific method used to differentiate between fold (superfamily) and function (family) specific signals, which helps in the functional annotation of protein sequences. The use of modified profile HMMs of GPCR sequences provides a simple yet highly specific method for classification of the family, being able to predict the sub-family specific sequences with high accuracy even though sequences share common physicochemical characteristics between sub-families. PMID:25073805

  14. High-resolution sedimentological and subsidence analysis of the Late Neogene, Pannonian Basin, Hungary

    USGS Publications Warehouse

    Juhasz, E.; Muller, P.; Toth-Makk, A.; Hamor, T.; Farkas-Bulla, J.; Suto-Szentai, M.; Phillips, R.L.; Ricketts, B.

    1996-01-01

    Detailed sedimentological and paleontological analyses were carried out on more than 13,000 m of core from ten boreholes in the Late Neogene sediments of the Pannonian Basin, Hungary. These data provide the basis for determining the character of high-order depositional cycles and their stacking patterns. In the Late Neogene sediments of the Pannonian Basin there are two third-order sequences: the Late Miocene and the Pliocene ones. The Miocene sequence shows a regressive, upward-coarsening trend. There are four distinguishable sedimentary units in this sequence: the basal transgressive, the lower aggradational, the progradational and the upper aggradational units. The Pliocene sequence is also of aggradational character. The progradation does not coincide in time in the wells within the basin. The character of the relative water-level curves is similar throughout the basin but shows only very faint similarity to the sea-level curve. Therefore, it is unlikely that eustasy played any significant role in the pattern of basin filling. Rather, the dominant controls were the rapidly changing basin subsidence and high sedimentation rates, together with possible climatic factors.

  15. Complete genome analysis of highly pathogenic bovine ephemeral fever virus isolated in Turkey in 2012.

    PubMed

    Abayli, Hasan; Tonbak, Sukru; Azkur, Ahmet Kursat; Bulut, Hakan

    2017-10-01

    Relatively high prevalence and mortality rates of bovine ephemeral fever (BEF) have been reported in recent epidemics in some countries, including Turkey, when compared with previous outbreaks. A limited number of complete genome sequences of BEF virus (BEFV) are available in the GenBank Database. In this study, the complete genome of highly pathogenic BEFV isolated during an outbreak in Turkey in 2012 was analyzed for genetic characterization. The complete genome of the Turkish BEFV isolate was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and sequenced. It was found that the complete genome of the Turkish BEFV isolate was 14,901 nt in length. The complete genome sequence obtained from the study showed 91-92% identity at nucleotide level to Australian (BB7721) and Chinese (Bovine/China/Henan1/2012) BEFV isolates. Phylogenetic analysis of the glycoprotein gene of the Turkish BEFV isolate also showed that Turkish isolates were closely related to Israeli isolates. Because of the limited number of complete BEFV genome sequences, the results from this study will be useful for understanding the global molecular epidemiology and geodynamics of BEF.

  16. DRS is far less divergent than streptococcal inhibitor of complement of group A streptococcus.

    PubMed

    Sagar, Vivek; Kumar, Rajesh; Ganguly, Nirmal K; Menon, Thangam; Chakraborti, Anuradha

    2007-04-01

    When 100 group A streptococcus isolates were screened, drs, a variant of sic, was identified in emm12 and emm55 isolates. Molecular characterization showed that the drs gene sequence is highly conserved, unlike the sic gene sequence. However, the variation in gene size observed was due to the presence of extra internal repeat sequences.

  17. DRS Is Far Less Divergent than Streptococcal Inhibitor of Complement of Group A Streptococcus▿

    PubMed Central

    Sagar, Vivek; Kumar, Rajesh; Ganguly, Nirmal K.; Menon, Thangam; Chakraborti, Anuradha

    2007-01-01

    When 100 group A streptococcus isolates were screened, drs, a variant of sic, was identified in emm12 and emm55 isolates. Molecular characterization showed that the drs gene sequence is highly conserved, unlike the sic gene sequence. However, the variation in gene size observed was due to the presence of extra internal repeat sequences. PMID:17237170

  18. The Most Deeply Conserved Noncoding Sequences in Plants Serve Similar Functions to Those in Vertebrates Despite Large Differences in Evolutionary Rates[W

    PubMed Central

    Burgess, Diane; Freeling, Michael

    2014-01-01

    In vertebrates, conserved noncoding elements (CNEs) are functionally constrained sequences that can show striking conservation over >400 million years of evolutionary distance and frequently are located megabases away from target developmental genes. Conserved noncoding sequences (CNSs) in plants are much shorter, and it has been difficult to detect conservation among distantly related genomes. In this article, we show not only that CNS sequences can be detected throughout the eudicot clade of flowering plants, but also that a subset of 37 CNSs can be found in all flowering plants (diverging ∼170 million years ago). These CNSs are functionally similar to vertebrate CNEs, being highly associated with transcription factor and development genes and enriched in transcription factor binding sites. Some of the most highly conserved sequences occur in genes encoding RNA binding proteins, particularly the RNA splicing–associated SR genes. Differences in sequence conservation between plants and animals are likely to reflect differences in the biology of the organisms, with plants being much more able to tolerate genomic deletions and whole-genome duplication events due, in part, to their far greater fecundity compared with vertebrates. PMID:24681619

  19. Characterization of a new apple luteovirus identified by high-throughput sequencing.

    PubMed

    Liu, Huawei; Wu, Liping; Nikolaeva, Ekaterina; Peter, Kari; Liu, Zongrang; Mollov, Dimitre; Cao, Mengji; Li, Ruhui

    2018-05-15

    'Rapid Apple Decline' (RAD) is a newly emerging problem of young, dwarf apple trees in the Northeastern USA. The affected trees show trunk necrosis, cracking and canker before collapse in summer. In this study, we discovered and characterized a new luteovirus from apple trees in RAD-affected orchards using high-throughput sequencing (HTS) technology and subsequent Sanger sequencing. Illumina NextSeq sequencing was applied to total RNAs prepared from three diseased apple trees. Sequence reads were de novo assembled, and contigs were annotated by BLASTx. RT-PCR and 5'/3' RACE sequencing were used to obtain the complete genome of a new virus. RT-PCR was used to detect the virus. Three common apple viruses and a new luteovirus were identified from the diseased trees by HTS and RT-PCR. Sequence analyses of the complete genome of the new virus show that it is a new species of the genus Luteovirus in the family Luteoviridae. The virus is graft transmissible and detected by RT-PCR in apple trees in a couple of orchards. A new luteovirus and/or three known viruses were found to be associated with RAD. Molecular characterization of the new luteovirus provides important information for further investigation of its distribution and etiological role.

  20. Severe chronic osteomyelitis caused by Morganella morganii with high population diversity.

    PubMed

    Zhu, Jialiang; Li, Haifeng; Feng, Li; Yang, Min; Yang, Ronggong; Yang, Lin; Li, Li; Li, Ruoyan; Liu, Minshan; Hou, Shuxun; Ke, Yuehua; Li, Wenfeng; Bai, Fan

    2016-09-01

    A case of chronic osteomyelitis probably caused by Morganella morganii, occurring over a period of 30 years, is reported. The organism was identified through a combination of sample culture, direct sequencing, and 16S RNA gene amplicon sequencing. Further whole-genome sequencing and population structure analysis of the isolates from the patient showed the bacterial population to be highly diverse. This case provides a valuable example of a long-term infection caused by an opportunistic pathogen, M. morganii, with high diversity, which might evolve during replication within the host. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

    PubMed

    Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

    1985-09-01

    The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this.

  2. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  3. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  4. RECOVIR Software for Identifying Viruses

    NASA Technical Reports Server (NTRS)

    Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

    2013-01-01

    Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

  5. A New Strategy to Enhance Cavitational Tissue Erosion Using a High-Intensity, Initiating Sequence

    PubMed Central

    Xu, Zhen; Fowlkes, J. Brian; Cain, Charles A.

    2009-01-01

    Our previous studies have shown that pulsed ultrasound can physically remove soft tissue through cavitation. A new strategy to enhance the cavitation-induced erosion is proposed wherein tissue erosion is initiated by a short, high-intensity sequence of pulses and sustained by lower intensity pulses. We investigated effects of the initiating sequence on erosion and cavitation sustained by lower intensity pulses. Multiple three-cycle pulses at a pulse repetition frequency of 20 kHz delivered by a 788-kHz focused transducer were used for tissue erosion. Fixing the initiating sequence at ISPPA of 9000 W/cm2, 16 combinations of different numbers of pulses within the initiating sequence and different sustaining pulse intensities were tested. Results showed: the initiating sequence increases the probability of erosion occurrence and the erosion rate with only slight overall increases in propagated energy; the initiating sequence containing more pulses does not increase the sustained cavitation period; and if extinguished and reinitiated, the sustained cavitation period becomes shorter after each initiation, although the waiting time between adjacent cavitation periods is random. The high-intensity, initiating sequence enhances cavitational tissue erosion and enables erosion at intensities significantly lower than what is required to initiate erosion. PMID:16921893

  6. Sequence-dependent DNA deformability studied using molecular dynamics simulations.

    PubMed

    Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori

    2007-01-01

    Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.

  7. [Genetic analysis of two children patients affected with CHARGE syndrome].

    PubMed

    Li, Guoqiang; Li, Niu; Xu, Yufei; Li, Juan; Ding, Yu; Shen, Yiping; Wang, Xiumin; Wang, Jian

    2018-04-10

    To analyze two Chinese pediatric patients with multiple malformations and growth and development delay. Both patients were subjected to targeted gene sequencing, and the results were analyzed with Ingenuity Variant Analysis software. Suspected pathogenic variations were verified by Sanger sequencing. High-throughput sequencing showed that both patients have carried heterozygous variants of the CHD7 gene. Patient 1 carried a nonsense mutation in exon 36 (c.7957C>T, p.Arg2653*), while patient 2 carried a nonsense mutation of exon 2 (c.718C>T, p.Gln240*). Sanger sequencing confirmed the above mutations in both patients, while their parents were of wild-type for the corresponding sites, indicating that the two mutations have happened de novo. Two patients were diagnosed with CHARGE syndrome by high-throughput sequencing.

  8. Microbial ecological succession during municipal solid waste decomposition.

    PubMed

    Staley, Bryan F; de Los Reyes, Francis L; Wang, Ling; Barlaz, Morton A

    2018-04-28

    The decomposition of landfilled refuse proceeds through distinct phases, each defined by varying environmental factors such as volatile fatty acid concentration, pH, and substrate quality. The succession of microbial communities in response to these changing conditions was monitored in a laboratory-scale simulated landfill to minimize measurement difficulties experienced at field scale. 16S rRNA gene sequences retrieved at separate stages of decomposition showed significant succession in both Bacteria and methanogenic Archaea. A majority of Bacteria sequences in landfilled refuse belong to members of the phylum Firmicutes, while Proteobacteria levels fluctuated and Bacteroidetes levels increased as decomposition proceeded. Roughly 44% of archaeal sequences retrieved under conditions of low pH and high acetate were strictly hydrogenotrophic (Methanomicrobiales, Methanobacteriales). Methanosarcina was present at all stages of decomposition. Correspondence analysis showed bacterial population shifts were attributed to carboxylic acid concentration and solids hydrolysis, while archaeal populations were affected to a higher degree by pH. T-RFLP analysis showed specific taxonomic groups responded differently and exhibited unique responses during decomposition, suggesting that species composition and abundance within Bacteria and Archaea are highly dynamic. This study shows landfill microbial demographics are highly variable across both spatial and temporal transects.

  9. YAMAT-seq: an efficient method for high-throughput sequencing of mature transfer RNAs.

    PubMed

    Shigematsu, Megumi; Honda, Shozo; Loher, Phillipe; Telonis, Aristeidis G; Rigoutsos, Isidore; Kirino, Yohei

    2017-05-19

    Besides translation, transfer RNAs (tRNAs) play many non-canonical roles in various biological pathways and exhibit highly variable expression profiles. To unravel the emerging complexities of tRNA biology and molecular mechanisms underlying them, an efficient tRNA sequencing method is required. However, the rigid structure of tRNA has been presenting a challenge to the development of such methods. We report the development of Y-shaped Adapter-ligated MAture TRNA sequencing (YAMAT-seq), an efficient and convenient method for high-throughput sequencing of mature tRNAs. YAMAT-seq circumvents the issue of inefficient adapter ligation, a characteristic of conventional RNA sequencing methods for mature tRNAs, by employing the efficient and specific ligation of Y-shaped adapter to mature tRNAs using T4 RNA Ligase 2. Subsequent cDNA amplification and next-generation sequencing successfully yield numerous mature tRNA sequences. YAMAT-seq has high specificity for mature tRNAs and high sensitivity to detect most isoacceptors from minute amount of total RNA. Moreover, YAMAT-seq shows quantitative capability to estimate expression levels of mature tRNAs, and has high reproducibility and broad applicability for various cell lines. YAMAT-seq thus provides high-throughput technique for identifying tRNA profiles and their regulations in various transcriptomes, which could play important regulatory roles in translation and other biological processes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Random sequences generation through optical measurements by phase-shifting interferometry

    NASA Astrophysics Data System (ADS)

    François, M.; Grosges, T.; Barchiesi, D.; Erra, R.; Cornet, A.

    2012-04-01

    The development of new techniques for producing random sequences with a high level of security is a challenging topic of research in modern cryptographics. The proposed method is based on the measurement by phase-shifting interferometry of the speckle signals of the interaction between light and structures. We show how the combination of amplitude and phase distributions (maps) under a numerical process can produce random sequences. The produced sequences satisfy all the statistical requirements of randomness and can be used in cryptographic schemes.

  11. Selection of a DNA barcode for Nectriaceae from fungal whole-genomes.

    PubMed

    Zeng, Zhaoqing; Zhao, Peng; Luo, Jing; Zhuang, Wenying; Yu, Zhihe

    2012-01-01

    A DNA barcode is a short segment of sequence that is able to distinguish species. A barcode must ideally contain enough variation to distinguish every individual species and be easily obtained. Fungi of Nectriaceae are economically important and show high species diversity. To establish a standard DNA barcode for this group of fungi, the genomes of Neurospora crassa and 30 other filamentous fungi were compared. The expect value was treated as a criterion to recognize homologous sequences. Four candidate markers, Hsp90, AAC, CDC48, and EF3, were tested for their feasibility as barcodes in the identification of 34 well-established species belonging to 13 genera of Nectriaceae. Two hundred and fifteen sequences were analyzed. Intra- and inter-specific variations and the success rate of PCR amplification and sequencing were considered as important criteria for estimation of the candidate markers. Ultimately, the partial EF3 gene met the requirements for a good DNA barcode: No overlap was found between the intra- and inter-specific pairwise distances. The smallest inter-specific distance of EF3 gene was 3.19%, while the largest intra-specific distance was 1.79%. In addition, there was a high success rate in PCR and sequencing for this gene (96.3%). CDC48 showed sufficiently high sequence variation among species, but the PCR and sequencing success rate was 84% using a single pair of primers. Although the Hsp90 and AAC genes had higher PCR and sequencing success rates (96.3% and 97.5%, respectively), overlapping occurred between the intra- and inter-specific variations, which could lead to misidentification. Therefore, we propose the EF3 gene as a possible DNA barcode for the nectriaceous fungi.

  12. Subset of Kappa and Lambda Germline Sequences Result in Light Chains with a Higher Molecular Mass Phenotype.

    PubMed

    Barnidge, David R; Lundström, Susanna L; Zhang, Bo; Dasari, Surendra; Murray, David L; Zubarev, Roman A

    2015-12-04

    In our previous work, we showed that electrospray ionization of intact polyclonal kappa and lambda light chains isolated from normal serum generates two distinct, Gaussian-shaped, molecular mass distributions representing the light-chain repertoire. During the analysis of a large (>100) patient sample set, we noticed a low-intensity molecular mass distribution with a mean of approximately 24 250 Da, roughly 800 Da higher than the mean of the typical kappa molecular-mass distribution mean of 23 450 Da. We also observed distinct clones in this region that did not appear to contain any typical post-translational modifications that would account for such a large mass shift. To determine the origin of the high molecular mass clones, we performed de novo bottom-up mass spectrometry on a purified IgM monoclonal light chain that had a calculated molecular mass of 24 275.03 Da. The entire sequence of the monoclonal light chain was determined using multienzyme digestion and de novo sequence-alignment software and was found to belong to the germline allele IGKV2-30. The alignment of kappa germline sequences revealed ten IGKV2 and one IGKV4 sequences that contained additional amino acids in their CDR1 region, creating the high-molecular-mass phenotype. We also performed an alignment of lambda germline sequences, which showed additional amino acids in the CDR2 region, and the FR3 region of functional germline sequences that result in a high-molecular-mass phenotype. The work presented here illustrates the ability of mass spectrometry to provide information on the diversity of light-chain molecular mass phenotypes in circulation, which reflects the germline sequences selected by the immunoglobulin-secreting B-cell population.

  13. Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

    PubMed

    Li, Chao; Chang, Wei Shan

    2014-01-01

    Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

  14. Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

    PubMed Central

    Chang, Wei Shan

    2014-01-01

    Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

  15. De novo protein sequencing by combining top-down and bottom-up tandem mass spectra.

    PubMed

    Liu, Xiaowen; Dekker, Lennard J M; Wu, Si; Vanduijn, Martijn M; Luider, Theo M; Tolić, Nikola; Kou, Qiang; Dvorkin, Mikhail; Alexandrova, Sonya; Vyatkina, Kira; Paša-Tolić, Ljiljana; Pevzner, Pavel A

    2014-07-03

    There are two approaches for de novo protein sequencing: Edman degradation and mass spectrometry (MS). Existing MS-based methods characterize a novel protein by assembling tandem mass spectra of overlapping peptides generated from multiple proteolytic digestions of the protein. Because each tandem mass spectrum covers only a short peptide of the target protein, the key to high coverage protein sequencing is to find spectral pairs from overlapping peptides in order to assemble tandem mass spectra to long ones. However, overlapping regions of peptides may be too short to be confidently identified. High-resolution mass spectrometers have become accessible to many laboratories. These mass spectrometers are capable of analyzing molecules of large mass values, boosting the development of top-down MS. Top-down tandem mass spectra cover whole proteins. However, top-down tandem mass spectra, even combined, rarely provide full ion fragmentation coverage of a protein. We propose an algorithm, TBNovo, for de novo protein sequencing by combining top-down and bottom-up MS. In TBNovo, a top-down tandem mass spectrum is utilized as a scaffold, and bottom-up tandem mass spectra are aligned to the scaffold to increase sequence coverage. Experiments on data sets of two proteins showed that TBNovo achieved high sequence coverage and high sequence accuracy.

  16. Investigation of rare and low-frequency variants using high-throughput sequencing with pooled DNA samples

    PubMed Central

    Wang, Jingwen; Skoog, Tiina; Einarsdottir, Elisabet; Kaartokallio, Tea; Laivuori, Hannele; Grauers, Anna; Gerdhem, Paul; Hytönen, Marjo; Lohi, Hannes; Kere, Juha; Jiao, Hong

    2016-01-01

    High-throughput sequencing using pooled DNA samples can facilitate genome-wide studies on rare and low-frequency variants in a large population. Some major questions concerning the pooling sequencing strategy are whether rare and low-frequency variants can be detected reliably, and whether estimated minor allele frequencies (MAFs) can represent the actual values obtained from individually genotyped samples. In this study, we evaluated MAF estimates using three variant detection tools with two sets of pooled whole exome sequencing (WES) and one set of pooled whole genome sequencing (WGS) data. Both GATK and Freebayes displayed high sensitivity, specificity and accuracy when detecting rare or low-frequency variants. For the WGS study, 56% of the low-frequency variants in Illumina array have identical MAFs and 26% have one allele difference between sequencing and individual genotyping data. The MAF estimates from WGS correlated well (r = 0.94) with those from Illumina arrays. The MAFs from the pooled WES data also showed high concordance (r = 0.88) with those from the individual genotyping data. In conclusion, the MAFs estimated from pooled DNA sequencing data reflect the MAFs in individually genotyped samples well. The pooling strategy can thus be a rapid and cost-effective approach for the initial screening in large-scale association studies. PMID:27633116

  17. AfterQC: automatic filtering, trimming, error removing and quality control for fastq data.

    PubMed

    Chen, Shifu; Huang, Tanxiao; Zhou, Yanqing; Han, Yue; Xu, Mingyan; Gu, Jia

    2017-03-14

    Some applications, especially those clinical applications requiring high accuracy of sequencing data, usually have to face the troubles caused by unavoidable sequencing errors. Several tools have been proposed to profile the sequencing quality, but few of them can quantify or correct the sequencing errors. This unmet requirement motivated us to develop AfterQC, a tool with functions to profile sequencing errors and correct most of them, plus highly automated quality control and data filtering features. Different from most tools, AfterQC analyses the overlapping of paired sequences for pair-end sequencing data. Based on overlapping analysis, AfterQC can detect and cut adapters, and furthermore it gives a novel function to correct wrong bases in the overlapping regions. Another new feature is to detect and visualise sequencing bubbles, which can be commonly found on the flowcell lanes and may raise sequencing errors. Besides normal per cycle quality and base content plotting, AfterQC also provides features like polyX (a long sub-sequence of a same base X) filtering, automatic trimming and K-MER based strand bias profiling. For each single or pair of FastQ files, AfterQC filters out bad reads, detects and eliminates sequencer's bubble effects, trims reads at front and tail, detects the sequencing errors and corrects part of them, and finally outputs clean data and generates HTML reports with interactive figures. AfterQC can run in batch mode with multiprocess support, it can run with a single FastQ file, a single pair of FastQ files (for pair-end sequencing), or a folder for all included FastQ files to be processed automatically. Based on overlapping analysis, AfterQC can estimate the sequencing error rate and profile the error transform distribution. The results of our error profiling tests show that the error distribution is highly platform dependent. Much more than just another new quality control (QC) tool, AfterQC is able to perform quality control, data filtering, error profiling and base correction automatically. Experimental results show that AfterQC can help to eliminate the sequencing errors for pair-end sequencing data to provide much cleaner outputs, and consequently help to reduce the false-positive variants, especially for the low-frequency somatic mutations. While providing rich configurable options, AfterQC can detect and set all the options automatically and require no argument in most cases.

  18. Loss of control air at Browns Ferry Unit One: accident sequence analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harrington, R.M.; Hodge, S.A.

    1986-04-01

    This study describes the predicted response of the Browns Ferry Nuclear Plant to a postulated complete failure of plant control air. The failure of plant control air cascades to include the loss of drywell control air at Units 1 and 2. Nevertheless, this is a benign accident unless compounded by simultaneous failures in the turbine-driven high pressure injection systems. Accident sequence calculations are presented for Loss of Control Air sequences with assumed failure upon demand of the Reactor Core Isolation Cooling (RCIC) and the High Pressure Coolant Injection (HPCI) at Unit 1. Sequences with and without operator action are considered.more » Results show that the operators can prevent core uncovery if they take action to utilize the Control Rod Drive Hydraulic System as a backup high pressure injection system.« less

  19. Discovery of DNA viruses in wild-caught mosquitoes using small RNA high throughput sequencing.

    PubMed

    Ma, Maijuan; Huang, Yong; Gong, Zhengda; Zhuang, Lu; Li, Cun; Yang, Hong; Tong, Yigang; Liu, Wei; Cao, Wuchun

    2011-01-01

    Mosquito-borne infectious diseases pose a severe threat to public health in many areas of the world. Current methods for pathogen detection and surveillance are usually dependent on prior knowledge of the etiologic agents involved. Hence, efficient approaches are required for screening wild mosquito populations to detect known and unknown pathogens. In this study, we explored the use of Next Generation Sequencing to identify viral agents in wild-caught mosquitoes. We extracted total RNA from different mosquito species from South China. Small 18-30 bp length RNA molecules were purified, reverse-transcribed into cDNA and sequenced using Illumina GAIIx instrumentation. Bioinformatic analyses to identify putative viral agents were conducted and the results confirmed by PCR. We identified a non-enveloped single-stranded DNA densovirus in the wild-caught Culex pipiens molestus mosquitoes. The majority of the viral transcripts (.>80% of the region) were covered by the small viral RNAs, with a few peaks of very high coverage obtained. The +/- strand sequence ratio of the small RNAs was approximately 7∶1, indicating that the molecules were mainly derived from the viral RNA transcripts. The small viral RNAs overlapped, enabling contig assembly of the viral genome sequence. We identified some small RNAs in the reverse repeat regions of the viral 5'- and 3' -untranslated regions where no transcripts were expected. Our results demonstrate for the first time that high throughput sequencing of small RNA is feasible for identifying viral agents in wild-caught mosquitoes. Our results show that it is possible to detect DNA viruses by sequencing the small RNAs obtained from insects, although the underlying mechanism of small viral RNA biogenesis is unclear. Our data and those of other researchers show that high throughput small RNA sequencing can be used for pathogen surveillance in wild mosquito vectors.

  20. Phylogenetic analysis of simian Plasmodium spp. infecting Anopheles balabacensis Baisas in Sabah, Malaysia

    PubMed Central

    Manin, Benny O.; Daim, Sylvia; Vythilingam, Indra; Drakeley, Chris

    2017-01-01

    Background Anopheles balabacensis of the Leucospyrus group has been confirmed as the primary knowlesi malaria vector in Sabah, Malaysian Borneo for some time now. Presently, knowlesi malaria is the only zoonotic simian malaria in Malaysia with a high prevalence recorded in the states of Sabah and Sarawak. Methodology/Principal findings Anopheles spp. were sampled using human landing catch (HLC) method at Paradason village in Kudat district of Sabah. The collected Anopheles were identified morphologically and then subjected to total DNA extraction and polymerase chain reaction (PCR) to detect Plasmodium parasites in the mosquitoes. Identification of Plasmodium spp. was confirmed by sequencing the SSU rRNA gene with species specific primers. MEGA4 software was then used to analyse the SSU rRNA sequences and bulid the phylogenetic tree for inferring the relationship between simian malaria parasites in Sabah. PCR results showed that only 1.61% (23/1,425) of the screened An. balabacensis were infected with one or two of the five simian Plasmodium spp. found in Sabah, viz. Plasmodium coatneyi, P. inui, P. fieldi, P. cynomolgi and P. knowlesi. Sequence analysis of SSU rRNA of Plasmodium isolates showed high percentage of identity within the same Plasmodium sp. group. The phylogenetic tree based on the consensus sequences of P. knowlesi showed 99.7%–100.0% nucleotide identity among the isolates from An. balabacensis, human patients and a long-tailed macaque from the same locality. Conclusions/Significance This is the first study showing high molecular identity between the P. knowlesi isolates from An. balabacensis, human patients and a long-tailed macaque in Sabah. The other common simian Plasmodium spp. found in long-tailed macaques and also detected in An. balabacensis were P. coatneyi, P. inui, P. fieldi and P. cynomolgi. The high percentage identity of nucleotide sequences between the P. knowlesi isolates from the long-tailed macaque, An. balabacensis and human patients suggests a close genetic relationship between the parasites from these hosts. PMID:28968395

  1. Alignment-free Transcriptomic and Metatranscriptomic Comparison Using Sequencing Signatures with Variable Length Markov Chains.

    PubMed

    Liao, Weinan; Ren, Jie; Wang, Kun; Wang, Shun; Zeng, Feng; Wang, Ying; Sun, Fengzhu

    2016-11-23

    The comparison between microbial sequencing data is critical to understand the dynamics of microbial communities. The alignment-based tools analyzing metagenomic datasets require reference sequences and read alignments. The available alignment-free dissimilarity approaches model the background sequences with Fixed Order Markov Chain (FOMC) yielding promising results for the comparison of microbial communities. However, in FOMC, the number of parameters grows exponentially with the increase of the order of Markov Chain (MC). Under a fixed high order of MC, the parameters might not be accurately estimated owing to the limitation of sequencing depth. In our study, we investigate an alternative to FOMC to model background sequences with the data-driven Variable Length Markov Chain (VLMC) in metatranscriptomic data. The VLMC originally designed for long sequences was extended to apply to high-throughput sequencing reads and the strategies to estimate the corresponding parameters were developed. The flexible number of parameters in VLMC avoids estimating the vast number of parameters of high-order MC under limited sequencing depth. Different from the manual selection in FOMC, VLMC determines the MC order adaptively. Several beta diversity measures based on VLMC were applied to compare the bacterial RNA-Seq and metatranscriptomic datasets. Experiments show that VLMC outperforms FOMC to model the background sequences in transcriptomic and metatranscriptomic samples. A software pipeline is available at https://d2vlmc.codeplex.com.

  2. [Community composition and diversity of endophytic fungi from roots of Sinopodophyllum hexandrum in forest of Upper-north mountain of Qinghai province].

    PubMed

    Ning, Yi; Li, Yan-Ling; Zhou, Guo-Ying; Yang, Lu-Cun; Xu, Wen-Hua

    2016-04-01

    High throughput sequencing technology is also called Next Generation Sequencing (NGS), which can sequence hundreds and thousands sequences in different samples at the same time. In the present study, the culture-independent high throughput sequencing technology was applied to sequence the fungi metagenomic DNA of the fungal internal transcribed spacer 1(ITS 1) in the root of Sinopodophyllum hexandrum. Sequencing data suggested that after the quality control, 22 565 reads were remained. Cluster similarity analysis was done based on 97% sequence similarity, which obtained 517 OTUs for the three samples (LD1, LD2 and LD3). All the fungi which identified from all the reads of OTUs based on 0.8 classification thresholds using the software of RDP classifier were classified as 13 classes, 35 orders, 44 family, 55 genera. Among these genera, the genus of Tetracladium was the dominant genera in all samples(35.49%, 68.55% and 12.96%).The Shannon's diversity indices and the Simpson indices of the endophytic fungi in the samples ranged from 1.75-2.92, 0.11-0.32, respectively.This is the first time for applying high through put sequencing technol-ogyto analyze the community composition and diversity of endophytic fungi in the medicinal plant, and the results showed that there were hyper diver sity and high community composition complexity of endophytic fungi in the root of S. hexandrum. It is also proved that the high through put sequencing technology has great advantage for analyzing ecommunity composition and diversity of endophtye in the plant. Copyright© by the Chinese Pharmaceutical Association.

  3. Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples.

    PubMed

    Günthard, H F; Wong, J K; Ignacio, C C; Havlir, D V; Richman, D D

    1998-07-01

    The performance of the high-density oligonucleotide array methodology (GeneChip) in detecting drug resistance mutations in HIV-1 pol was compared with that of automated dideoxynucleotide sequencing (ABI) of clinical samples, viral stocks, and plasmid-derived NL4-3 clones. Sequences from 29 clinical samples (plasma RNA, n = 17; lymph node RNA, n = 5; lymph node DNA, n = 7) from 12 patients, from 6 viral stock RNA samples, and from 13 NL4-3 clones were generated by both methods. Editing was done independently by a different investigator for each method before comparing the sequences. In addition, NL4-3 wild type (WT) and mutants were mixed in varying concentrations and sequenced by both methods. Overall, a concordance of 99.1% was found for a total of 30,865 bases compared. The comparison of clinical samples (plasma RNA and lymph node RNA and DNA) showed a slightly lower match of base calls, 98.8% for 19,831 nucleotides compared (protease region, 99.5%, n = 8272; RT region, 98.3%, n = 11,316), than for viral stocks and NL4-3 clones (protease region, 99.8%; RT region, 99.5%). Artificial mixing experiments showed a bias toward calling wild-type bases by GeneChip. Discordant base calls are most likely due to differential detection of mixtures. The concordance between GeneChip and ABI was high and appeared dependent on the nature of the templates (directly amplified versus cloned) and the complexity of mixes.

  4. Atropos: specific, sensitive, and speedy trimming of sequencing reads.

    PubMed

    Didion, John P; Martin, Marcel; Collins, Francis S

    2017-01-01

    A key step in the transformation of raw sequencing reads into biological insights is the trimming of adapter sequences and low-quality bases. Read trimming has been shown to increase the quality and reliability while decreasing the computational requirements of downstream analyses. Many read trimming software tools are available; however, no tool simultaneously provides the accuracy, computational efficiency, and feature set required to handle the types and volumes of data generated in modern sequencing-based experiments. Here we introduce Atropos and show that it trims reads with high sensitivity and specificity while maintaining leading-edge speed. Compared to other state-of-the-art read trimming tools, Atropos achieves significant increases in trimming accuracy while remaining competitive in execution times. Furthermore, Atropos maintains high accuracy even when trimming data with elevated rates of sequencing errors. The accuracy, high performance, and broad feature set offered by Atropos makes it an appropriate choice for the pre-processing of Illumina, ABI SOLiD, and other current-generation short-read sequencing datasets. Atropos is open source and free software written in Python (3.3+) and available at https://github.com/jdidion/atropos.

  5. Atropos: specific, sensitive, and speedy trimming of sequencing reads

    PubMed Central

    Collins, Francis S.

    2017-01-01

    A key step in the transformation of raw sequencing reads into biological insights is the trimming of adapter sequences and low-quality bases. Read trimming has been shown to increase the quality and reliability while decreasing the computational requirements of downstream analyses. Many read trimming software tools are available; however, no tool simultaneously provides the accuracy, computational efficiency, and feature set required to handle the types and volumes of data generated in modern sequencing-based experiments. Here we introduce Atropos and show that it trims reads with high sensitivity and specificity while maintaining leading-edge speed. Compared to other state-of-the-art read trimming tools, Atropos achieves significant increases in trimming accuracy while remaining competitive in execution times. Furthermore, Atropos maintains high accuracy even when trimming data with elevated rates of sequencing errors. The accuracy, high performance, and broad feature set offered by Atropos makes it an appropriate choice for the pre-processing of Illumina, ABI SOLiD, and other current-generation short-read sequencing datasets. Atropos is open source and free software written in Python (3.3+) and available at https://github.com/jdidion/atropos. PMID:28875074

  6. The interaction between vocabulary size and phonotactic probability effects on children's production accuracy and fluency in nonword repetition.

    PubMed

    Edwards, Jan; Beckman, Mary E; Munson, Benjamin

    2004-04-01

    Adults' performance on a variety of tasks suggests that phonological processing of nonwords is grounded in generalizations about sublexical patterns over all known words. A small body of research suggests that children's phonological acquisition is similarly based on generalizations over the lexicon. To test this account, production accuracy and fluency were examined in nonword repetitions by 104 children and 22 adults. Stimuli were 22 pairs of nonwords, in which one nonword contained a low-frequency or unattested two-phoneme sequence and the other contained a high-frequency sequence. For a subset of these nonword pairs, segment durations were measured. The same sound was produced with a longer duration (less fluently) when it appeared in a low-frequency sequence, as compared to a high-frequency sequence. Low-frequency sequences were also repeated with lower accuracy than high-frequency sequences. Moreover, children with smaller vocabularies showed a larger influence of frequency on accuracy than children with larger vocabularies. Taken together, these results provide support for a model of phonological acquisition in which knowledge of sublexical units emerges from generalizations made over lexical items.

  7. High-throughput sequencing-based analysis of endogenetic fungal communities inhabiting the Chinese Cordyceps reveals unexpectedly high fungal diversity

    PubMed Central

    Xia, Fei; Chen, Xin; Guo, Meng-Yuan; Bai, Xiao-Hui; Liu, Yan; Shen, Guang-Rong; Li, Yu-Ling; Lin, Juan; Zhou, Xuan-Wei

    2016-01-01

    Chinese Cordyceps, known in Chinese as “DongChong XiaCao”, is a parasitic complex of a fungus (Ophiocordyceps sinensis) and a caterpillar. The current study explored the endogenetic fungal communities inhabiting Chinese Cordyceps. Samples were collected from five different geographical regions of Qinghai and Tibet, and the nuclear ribosomal internal transcribed spacer-1 sequences from each sample were obtained using Illumina high-throughput sequencing. The results showed that Ascomycota was the dominant fungal phylum in Chinese Cordyceps and its soil microhabitat from different sampling regions. Among the Ascomycota, 65 genera were identified, and the abundant operational taxonomic units showed the strongest sequence similarity to Ophiocordyceps, Verticillium, Pseudallescheria, Candida and Ilyonectria Not surprisingly, the genus Ophiocordyceps was the largest among the fungal communities identified in the fruiting bodies and external mycelial cortices of Chinese Cordyceps. In addition, fungal communities in the soil microhabitats were clustered separately from the external mycelial cortices and fruiting bodies of Chinese Cordyceps from different sampling regions. There was no significant structural difference in the fungal communities between the fruiting bodies and external mycelial cortices of Chinese Cordyceps. This study revealed an unexpectedly high diversity of fungal communities inhabiting the Chinese Cordyceps and its microhabitats. PMID:27625176

  8. A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

    PubMed Central

    2013-01-01

    Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

  9. The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

    PubMed

    Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

    2017-07-01

    FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  10. Endogenous Hot Spots of De Novo Telomere Addition in the Yeast Genome Contain Proximal Enhancers That Bind Cdc13

    PubMed Central

    Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.

    2016-01-01

    DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869

  11. Habits as action sequences: hierarchical action control and changes in outcome value

    PubMed Central

    Dezfouli, Amir; Lingawi, Nura W.; Balleine, Bernard W.

    2014-01-01

    Goal-directed action involves making high-level choices that are implemented using previously acquired action sequences to attain desired goals. Such a hierarchical schema is necessary for goal-directed actions to be scalable to real-life situations, but results in decision-making that is less flexible than when action sequences are unfolded and the decision-maker deliberates step-by-step over the outcome of each individual action. In particular, from this perspective, the offline revaluation of any outcomes that fall within action sequence boundaries will be invisible to the high-level planner resulting in decisions that are insensitive to such changes. Here, within the context of a two-stage decision-making task, we demonstrate that this property can explain the emergence of habits. Next, we show how this hierarchical account explains the insensitivity of over-trained actions to changes in outcome value. Finally, we provide new data that show that, under extended extinction conditions, habitual behaviour can revert to goal-directed control, presumably as a consequence of decomposing action sequences into single actions. This hierarchical view suggests that the development of action sequences and the insensitivity of actions to changes in outcome value are essentially two sides of the same coin, explaining why these two aspects of automatic behaviour involve a shared neural structure. PMID:25267824

  12. Large-Scale Biomonitoring of Remote and Threatened Ecosystems via High-Throughput Sequencing

    PubMed Central

    Gibson, Joel F.; Shokralla, Shadi; Curry, Colin; Baird, Donald J.; Monk, Wendy A.; King, Ian; Hajibabaei, Mehrdad

    2015-01-01

    Biodiversity metrics are critical for assessment and monitoring of ecosystems threatened by anthropogenic stressors. Existing sorting and identification methods are too expensive and labour-intensive to be scaled up to meet management needs. Alternately, a high-throughput DNA sequencing approach could be used to determine biodiversity metrics from bulk environmental samples collected as part of a large-scale biomonitoring program. Here we show that both morphological and DNA sequence-based analyses are suitable for recovery of individual taxonomic richness, estimation of proportional abundance, and calculation of biodiversity metrics using a set of 24 benthic samples collected in the Peace-Athabasca Delta region of Canada. The high-throughput sequencing approach was able to recover all metrics with a higher degree of taxonomic resolution than morphological analysis. The reduced cost and increased capacity of DNA sequence-based approaches will finally allow environmental monitoring programs to operate at the geographical and temporal scale required by industrial and regulatory end-users. PMID:26488407

  13. Chromosome rearrangements via template switching between diverged repeated sequences

    PubMed Central

    Anand, Ranjith P.; Tsaponina, Olga; Greenwell, Patricia W.; Lee, Cheng-Sheng; Du, Wei; Petes, Thomas D.

    2014-01-01

    Recent high-resolution genome analyses of cancer and other diseases have revealed the occurrence of microhomology-mediated chromosome rearrangements and copy number changes. Although some of these rearrangements appear to involve nonhomologous end-joining, many must have involved mechanisms requiring new DNA synthesis. Models such as microhomology-mediated break-induced replication (MM-BIR) have been invoked to explain these rearrangements. We examined BIR and template switching between highly diverged sequences in Saccharomyces cerevisiae, induced during repair of a site-specific double-strand break (DSB). Our data show that such template switches are robust mechanisms that give rise to complex rearrangements. Template switches between highly divergent sequences appear to be mechanistically distinct from the initial strand invasions that establish BIR. In particular, such jumps are less constrained by sequence divergence and exhibit a different pattern of microhomology junctions. BIR traversing repeated DNA sequences frequently results in complex translocations analogous to those seen in mammalian cells. These results suggest that template switching among repeated genes is a potent driver of genome instability and evolution. PMID:25367035

  14. Control of transcriptional pausing by biased thermal fluctuations on repetitive genomic sequences

    PubMed Central

    Imashimizu, Masahiko; Afek, Ariel; Takahashi, Hiroki; Lubkowska, Lucyna; Lukatsky, David B.

    2016-01-01

    In the process of transcription elongation, RNA polymerase (RNAP) pauses at highly nonrandom positions across genomic DNA, broadly regulating transcription; however, molecular mechanisms responsible for the recognition of such pausing positions remain poorly understood. Here, using a combination of statistical mechanical modeling and high-throughput sequencing and biochemical data, we evaluate the effect of thermal fluctuations on the regulation of RNAP pausing. We demonstrate that diffusive backtracking of RNAP, which is biased by repetitive DNA sequence elements, causes transcriptional pausing. This effect stems from the increased microscopic heterogeneity of an elongation complex, and thus is entropy-dominated. This report shows a linkage between repetitive sequence elements encoded in the genome and regulation of RNAP pausing driven by thermal fluctuations. PMID:27830653

  15. Development of self-compressing BLSOM for comprehensive analysis of big sequence data.

    PubMed

    Kikuchi, Akihito; Ikemura, Toshimichi; Abe, Takashi

    2015-01-01

    With the remarkable increase in genomic sequence data from various organisms, novel tools are needed for comprehensive analyses of available big sequence data. We previously developed a Batch-Learning Self-Organizing Map (BLSOM), which can cluster genomic fragment sequences according to phylotype solely dependent on oligonucleotide composition and applied to genome and metagenomic studies. BLSOM is suitable for high-performance parallel-computing and can analyze big data simultaneously, but a large-scale BLSOM needs a large computational resource. We have developed Self-Compressing BLSOM (SC-BLSOM) for reduction of computation time, which allows us to carry out comprehensive analysis of big sequence data without the use of high-performance supercomputers. The strategy of SC-BLSOM is to hierarchically construct BLSOMs according to data class, such as phylotype. The first-layer BLSOM was constructed with each of the divided input data pieces that represents the data subclass, such as phylotype division, resulting in compression of the number of data pieces. The second BLSOM was constructed with a total of weight vectors obtained in the first-layer BLSOMs. We compared SC-BLSOM with the conventional BLSOM by analyzing bacterial genome sequences. SC-BLSOM could be constructed faster than BLSOM and cluster the sequences according to phylotype with high accuracy, showing the method's suitability for efficient knowledge discovery from big sequence data.

  16. A weighted U-statistic for genetic association analyses of sequencing data.

    PubMed

    Wei, Changshuai; Li, Ming; He, Zihuai; Vsevolozhskaya, Olga; Schaid, Daniel J; Lu, Qing

    2014-12-01

    With advancements in next-generation sequencing technology, a massive amount of sequencing data is generated, which offers a great opportunity to comprehensively investigate the role of rare variants in the genetic etiology of complex diseases. Nevertheless, the high-dimensional sequencing data poses a great challenge for statistical analysis. The association analyses based on traditional statistical methods suffer substantial power loss because of the low frequency of genetic variants and the extremely high dimensionality of the data. We developed a Weighted U Sequencing test, referred to as WU-SEQ, for the high-dimensional association analysis of sequencing data. Based on a nonparametric U-statistic, WU-SEQ makes no assumption of the underlying disease model and phenotype distribution, and can be applied to a variety of phenotypes. Through simulation studies and an empirical study, we showed that WU-SEQ outperformed a commonly used sequence kernel association test (SKAT) method when the underlying assumptions were violated (e.g., the phenotype followed a heavy-tailed distribution). Even when the assumptions were satisfied, WU-SEQ still attained comparable performance to SKAT. Finally, we applied WU-SEQ to sequencing data from the Dallas Heart Study (DHS), and detected an association between ANGPTL 4 and very low density lipoprotein cholesterol. © 2014 WILEY PERIODICALS, INC.

  17. Differentially Private Frequent Sequence Mining via Sampling-based Candidate Pruning

    PubMed Central

    Xu, Shengzhi; Cheng, Xiang; Li, Zhengyi; Xiong, Li

    2016-01-01

    In this paper, we study the problem of mining frequent sequences under the rigorous differential privacy model. We explore the possibility of designing a differentially private frequent sequence mining (FSM) algorithm which can achieve both high data utility and a high degree of privacy. We found, in differentially private FSM, the amount of required noise is proportionate to the number of candidate sequences. If we could effectively reduce the number of unpromising candidate sequences, the utility and privacy tradeoff can be significantly improved. To this end, by leveraging a sampling-based candidate pruning technique, we propose a novel differentially private FSM algorithm, which is referred to as PFS2. The core of our algorithm is to utilize sample databases to further prune the candidate sequences generated based on the downward closure property. In particular, we use the noisy local support of candidate sequences in the sample databases to estimate which sequences are potentially frequent. To improve the accuracy of such private estimations, a sequence shrinking method is proposed to enforce the length constraint on the sample databases. Moreover, to decrease the probability of misestimating frequent sequences as infrequent, a threshold relaxation method is proposed to relax the user-specified threshold for the sample databases. Through formal privacy analysis, we show that our PFS2 algorithm is ε-differentially private. Extensive experiments on real datasets illustrate that our PFS2 algorithm can privately find frequent sequences with high accuracy. PMID:26973430

  18. An efficient and scalable analysis framework for variant extraction and refinement from population-scale DNA sequence data.

    PubMed

    Jun, Goo; Wing, Mary Kate; Abecasis, Gonçalo R; Kang, Hyun Min

    2015-06-01

    The analysis of next-generation sequencing data is computationally and statistically challenging because of the massive volume of data and imperfect data quality. We present GotCloud, a pipeline for efficiently detecting and genotyping high-quality variants from large-scale sequencing data. GotCloud automates sequence alignment, sample-level quality control, variant calling, filtering of likely artifacts using machine-learning techniques, and genotype refinement using haplotype information. The pipeline can process thousands of samples in parallel and requires less computational resources than current alternatives. Experiments with whole-genome and exome-targeted sequence data generated by the 1000 Genomes Project show that the pipeline provides effective filtering against false positive variants and high power to detect true variants. Our pipeline has already contributed to variant detection and genotyping in several large-scale sequencing projects, including the 1000 Genomes Project and the NHLBI Exome Sequencing Project. We hope it will now prove useful to many medical sequencing studies. © 2015 Jun et al.; Published by Cold Spring Harbor Laboratory Press.

  19. Draft Genome Sequence of the Algicidal Bacterium Mangrovimonas yunxiaonensis Strain LY01

    PubMed Central

    Li, Yi; Zhu, Hong; Li, Chongping; Zhang, Huajun; Chen, Zhangran; Zheng, Wei

    2014-01-01

    Mangrovimonas yunxiaonensis LY01, a novel bacterium isolated from mangrove sediment, showed high algicidal effects on harmful algal blooms of Alexandrium tamarense. Here, we present the first draft genome sequence of this strain to further understanding of the functional genes related to algicidal activity. PMID:25428978

  20. Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

    PubMed Central

    Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

    1985-01-01

    The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this. Images PMID:3016521

  1. High-resolution phylogenetic microbial community profiling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singer, Esther; Coleman-Derr, Devin; Bowman, Brett

    2014-03-17

    The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less

  2. The characterisation of novel secreted Ly-6 proteins from rat urine by the combined use of two-dimensional gel electrophoresis, microbore high performance liquid chromatography and expressed sequence tag data.

    PubMed

    Southan, Christopher; Cutler, Paul; Birrell, Helen; Connell, John; Fantom, Kenneth G M; Sims, Matthew; Shaikh, Narjis; Schneider, Klaus

    2002-02-01

    A proteomic study of rat urine was undertaken using two-dimensional gel electrophoresis, microbore high performance liquid chromatography, mass spectrometry and N-terminal sequencing. Five known urinary proteins were identified but two novel peptide fragments matched a large number of rat expressed sequence tags (ESTs) from a liver library. By combining protein chemical and nucleotide data, two 101-residue open reading frames with 90% amino acid identity were determined, rat urinary protein 1 (RUP-1) and RUP-2. The data established signal peptide removal and provided evidence for N-glycosylation. A third related sequence, rat spleen protein (RSP-1) was confirmed from EST searches. These three proteins have been submitted to SWISS-PROT as P81827, P81828 and Q9QXN2, respectively. A fourth novel homologue was found in porcine and bovine ESTs from embryo libraries. Alignment with known homologues showed conserved cysteine positions characteristic of a secreted subfamily of Ly-6 proteins. In two cases, antineoplastic urinary protein and caltrin, these homologues have unverified functional annotations. The RUP sequences showed high scoring matches to three unrelated rat mRNAs subsequently established to be chimeric. Two of these share extended sectional identity to RUP-1 but the third may represent another novel Ly-6 homologue. These chimeras have caused serious annotation errors in secondary databases.

  3. Molecular analysis of partial VP-2 gene amplified from rectal swab samples of diarrheic dogs in Pakistan confirms the circulation of canine parvovirus genetic variant CPV-2a and detects sequences of feline panleukopenia virus (FPV).

    PubMed

    Ahmed, Nisar; Riaz, Adeel; Zubair, Zahra; Saqib, Muhammad; Ijaz, Sehrish; Nawaz-Ul-Rehman, Muhammad Shah; Al-Qahtani, Ahmed; Mubin, Muhammad

    2018-03-15

    The infection in dogs due to canine parvovirus (CPV), is a highly contagious one with high mortality rate. The present study was undertaken for a detailed genetic analysis of partial VP2 gene i.e., 630 bp isolated from rectal swab samples of infected domestic and stray dogs from all areas of district Faisalabad. Monitoring of viruses is important, as continuous prevalence of viral infection might be associated with emergence of new virulent strains. In the present study, 40 rectal swab samples were collected from diarrheic dogs from different areas of district Faisalabad, Pakistan, in 2014-15 and screened for the presence of CPV by immunochromatography. Most of these dogs were stray dogs showing symptoms of diarrhea. Viral DNA was isolated and partial VP2 gene was amplified using gene specific primer pair Hfor/Hrev through PCR. Amplified fragments were cloned in pTZ57R/T (Fermentas) and completely sequenced. Sequences were analyzed and assembled by the Lasergene DNA analysis package (v8; DNAStar Inc., Madison, WI, USA). The results with immunochromatography showed that 33/40 (82%) of dogs were positive for CPV. We were able to amplify a fragment of 630 bp from 25 samples. In 25 samples the sequences of CPV-2a were detected showing the amino acid substitution Ser297Ala and presence of amino acid (426-Asn) in partial VP2 protein. Interestingly the BLAST analysis showed the of feline panleukopenia virus (FPV) sequences in 3 samples which were already positive for new CPV-2a, with 99% sequence homology to other FPV sequences present in GenBank. Phylogenetic analysis showed clustering of partial CPV-VP-2 gene with viruses from China, India, Japan and Uruguay identifying a new variant, whereas the 3 FPV sequences showed immediate ancestral relationship with viruses from Portugal, South Africa and USA. Interesting observation was that CPV are clustering away from the commercial vaccine strains. In this work we provide a better understanding of CPV prevailing in Pakistan at molecular level. The detection of FPV could be a case of real co-infection or a case of dual presence, due to ingestion of contaminated food.

  4. Determination and analysis of the complete genome sequence of Paralichthys olivaceus rhabdovirus (PORV).

    PubMed

    Zhu, Ruo-Lin; Zhang, Qi-Ya

    2014-04-01

    Paralichthys olivaceus rhabdovirus (PORV), which is associated with high mortality rates in flounder, was isolated in China in 2005. Here, we provide an annotated sequence record of PORV, the genome of which comprises 11,182 nucleotides and contains six genes in the order 3'-N-P-M-G-NV-L-5'. Phylogenetic analysis based on glycoprotein sequences of PORV and other rhabdoviruses showed that PORV clusters with viral haemorrhagic septicemia virus (VHSV), genus Novirhabdovirus, family Rhabdoviridae. Further phylogenetic analysis of the combined amino acid sequences of six proteins of PORV and VHSV strains showed that PORV clusters with Korean strains and is closely related to Asian strains, all of which were isolated from flounder. In a comparison in which the sequences of the six proteins were combined, PORV shared the highest identity (98.3 %) with VHSV strain KJ2008 from Korea.

  5. Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.

    PubMed

    Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N

    1984-03-26

    The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic DNA methylation between sperm and oocyte DNA. The methylation levels of the minor satellite sequences did not change during spermiogenesis, and were not associated with the onset of meiosis or a specific stage in sperm development.

  6. The phosphotransferase system-dependent sucrose utilization regulon in enteropathogenic Escherichia coli strains is located in a variable chromosomal region containing iap sequences.

    PubMed

    Treviño-Quintanilla, Luis Gerardo; Escalante, Adelfo; Caro, Alma Delia; Martínez, Alfredo; González, Ricardo; Puente, José Luis; Bolívar, Francisco; Gosset, Guillermo

    2007-01-01

    The capacity to utilize sucrose as a carbon and energy source (Scr(+) phenotype) is a highly variable trait among Escherichia coli strains. In this study, seven enteropathogenic E. coli (EPEC) strains from different sources were studied for their capacity to grow using sucrose. Liquid media cultures showed that all analyzed strains have the Scr(+) phenotype and two distinct groups were defined: one of five and another of two strains displaying doubling times of 67 and 125 min, respectively. The genes conferring the Scr(+) phenotype in one of the fast-growing strains (T19) were cloned and sequenced. Comparative sequence analysis revealed that this strain possesses the scr regulon genes scrKYABR, encoding phosphoenolpyruvate:phosphotransferase system-dependent sucrose transport and utilization activities. Transcript level quantification revealed sucrose-dependent induction of scrK and scrR genes in fast-growing strains, whereas no transcripts were detected in slow-growing strains. Sequence comparison analysis revealed that the scr genes in strain T19 are almost identical to those present in the scr regulon of prototype EPEC E2348/69 and in both strains, the scr genes are inserted in the chromosomal intergenic region of hypothetical genes ygcE and ygcF. Comparison of the ygcE-ygcF intergenic region sequence of strains MG1655, enterohemorrhagic EDL933, uropathogenic ECFT073 and EPEC T19-E2348/69 revealed that the number of extragenic highly repeated iap sequences corresponded to nine, four, two and none, respectively. These results show that the iap sequence-containing chromosomal ygcE-ygcF intergenic region is highly variable in E. coli. Copyright (c) 2007 S. Karger AG, Basel.

  7. Recovery of symbiotic nitrogen fixing acacia rhizobia from Merzouga Desert sand dunes in South East Morocco--Identification of a probable new species of Ensifer adapted to stressed environments.

    PubMed

    Sakrouhi, Ilham; Belfquih, Meryem; Sbabou, Laïla; Moulin, Patricia; Bena, Gilles; Filali-Maltouf, Abdelkarim; Le Quéré, Antoine

    2016-03-01

    Bacteria capable of nodulating Acacia tortilis and A. gummifera could be recovered from sand dunes collected in the Moroccan Merzouga desert. The trapping approach enabled the recovery of 17 desert rhizobia that all clustered within the Ensifer (Sinorhizobium) genus. Four isolates of the dominant genotype comprising 15 strains as well as 2 divergent strains were further characterized by MLSA. Phylogenetic analyzes indicated that the dominant genetic type was belonging to a new and yet undefined species within the Ensifer genus. Interestingly, housekeeping gene phylogenies showed that this possibly new species is also present in another desert but in India. Phylogenetic analyses of nifH and nodC sequences showed high sequence conservation among the Moroccan strains belonging to the dominant genotype but high divergence with sequences from Indian isolates suggesting acquisition of symbiotic genes through Horizontal Gene Transfer. These desert rhizobia were capable of growing in media containing high salt concentrations, under high pH and most of the strains showed growth at 45°C. Only recovered from desert type of Biome, yet, this new taxon appears particularly adapted to such harsh environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  8. Spatio-temporal Variations of Characteristic Repeating Earthquake Sequences along the Middle America Trench in Mexico

    NASA Astrophysics Data System (ADS)

    Dominguez, L. A.; Taira, T.; Hjorleifsdottir, V.; Santoyo, M. A.

    2015-12-01

    Repeating earthquake sequences are sets of events that are thought to rupture the same area on the plate interface and thus provide nearly identical waveforms. We systematically analyzed seismic records from 2001 through 2014 to identify repeating earthquakes with highly correlated waveforms occurring along the subduction zone of the Cocos plate. Using the correlation coefficient (cc) and spectral coherency (coh) of the vertical components as selection criteria, we found a set of 214 sequences whose waveforms exceed cc≥95% and coh≥95%. Spatial clustering along the trench shows large variations in repeating earthquakes activity. Particularly, the rupture zone of the M8.1, 1985 earthquake shows an almost absence of characteristic repeating earthquakes, whereas the Guerrero Gap zone and the segment of the trench close to the Guerrero-Oaxaca border shows a significantly larger number of repeating earthquakes sequences. Furthermore, temporal variations associated to stress changes due to major shows episodes of unlocking and healing of the interface. Understanding the different components that control the location and recurrence time of characteristic repeating sequences is a key factor to pinpoint areas where large megathrust earthquakes may nucleate and consequently to improve the seismic hazard assessment.

  9. TriageTools: tools for partitioning and prioritizing analysis of high-throughput sequencing data.

    PubMed

    Fimereli, Danai; Detours, Vincent; Konopka, Tomasz

    2013-04-01

    High-throughput sequencing is becoming a popular research tool but carries with it considerable costs in terms of computation time, data storage and bandwidth. Meanwhile, some research applications focusing on individual genes or pathways do not necessitate processing of a full sequencing dataset. Thus, it is desirable to partition a large dataset into smaller, manageable, but relevant pieces. We present a toolkit for partitioning raw sequencing data that includes a method for extracting reads that are likely to map onto pre-defined regions of interest. We show the method can be used to extract information about genes of interest from DNA or RNA sequencing samples in a fraction of the time and disk space required to process and store a full dataset. We report speedup factors between 2.6 and 96, depending on settings and samples used. The software is available at http://www.sourceforge.net/projects/triagetools/.

  10. Modeling read counts for CNV detection in exome sequencing data.

    PubMed

    Love, Michael I; Myšičková, Alena; Sun, Ruping; Kalscheuer, Vera; Vingron, Martin; Haas, Stefan A

    2011-11-08

    Varying depth of high-throughput sequencing reads along a chromosome makes it possible to observe copy number variants (CNVs) in a sample relative to a reference. In exome and other targeted sequencing projects, technical factors increase variation in read depth while reducing the number of observed locations, adding difficulty to the problem of identifying CNVs. We present a hidden Markov model for detecting CNVs from raw read count data, using background read depth from a control set as well as other positional covariates such as GC-content. The model, exomeCopy, is applied to a large chromosome X exome sequencing project identifying a list of large unique CNVs. CNVs predicted by the model and experimentally validated are then recovered using a cross-platform control set from publicly available exome sequencing data. Simulations show high sensitivity for detecting heterozygous and homozygous CNVs, outperforming normalization and state-of-the-art segmentation methods.

  11. Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

    PubMed

    Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

    2008-06-15

    To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

  12. High quality de novo sequencing and assembly of the Saccharomyces arboricolus genome

    PubMed Central

    2013-01-01

    Background Comparative genomics is a formidable tool to identify functional elements throughout a genome. In the past ten years, studies in the budding yeast Saccharomyces cerevisiae and a set of closely related species have been instrumental in showing the benefit of analyzing patterns of sequence conservation. Increasing the number of closely related genome sequences makes the comparative genomics approach more powerful and accurate. Results Here, we report the genome sequence and analysis of Saccharomyces arboricolus, a yeast species recently isolated in China, that is closely related to S. cerevisiae. We obtained high quality de novo sequence and assemblies using a combination of next generation sequencing technologies, established the phylogenetic position of this species and considered its phenotypic profile under multiple environmental conditions in the light of its gene content and phylogeny. Conclusions We suggest that the genome of S. arboricolus will be useful in future comparative genomics analysis of the Saccharomyces sensu stricto yeasts. PMID:23368932

  13. A discrete artificial bee colony algorithm for detecting transcription factor binding sites in DNA sequences.

    PubMed

    Karaboga, D; Aslan, S

    2016-04-27

    The great majority of biological sequences share significant similarity with other sequences as a result of evolutionary processes, and identifying these sequence similarities is one of the most challenging problems in bioinformatics. In this paper, we present a discrete artificial bee colony (ABC) algorithm, which is inspired by the intelligent foraging behavior of real honey bees, for the detection of highly conserved residue patterns or motifs within sequences. Experimental studies on three different data sets showed that the proposed discrete model, by adhering to the fundamental scheme of the ABC algorithm, produced competitive or better results than other metaheuristic motif discovery techniques.

  14. Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.

    PubMed

    Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris

    2010-07-15

    The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net

  15. [Study on the genetic difference of SEO type Hantaviruses].

    PubMed

    Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

    2000-10-01

    To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

  16. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  17. The complete genome sequence of a Neandertal from the Altai Mountains

    PubMed Central

    Prüfer, Kay; Racimo, Fernando; Patterson, Nick; Jay, Flora; Sankararaman, Sriram; Sawyer, Susanna; Heinze, Anja; Renaud, Gabriel; Sudmant, Peter H.; de Filippo, Cesare; Li, Heng; Mallick, Swapan; Dannemann, Michael; Fu, Qiaomei; Kircher, Martin; Kuhlwilm, Martin; Lachmann, Michael; Meyer, Matthias; Ongyerth, Matthias; Siebauer, Michael; Theunert, Christoph; Tandon, Arti; Moorjani, Priya; Pickrell, Joseph; Mullikin, James C.; Vohr, Samuel H.; Green, Richard E.; Hellmann, Ines; Johnson, Philip L. F.; Blanche, Hélène; Cann, Howard; Kitzman, Jacob O.; Shendure, Jay; Eichler, Evan E.; Lein, Ed S.; Bakken, Trygve E.; Golovanova, Liubov V.; Doronichev, Vladimir B.; Shunkov, Michael V.; Derevianko, Anatoli P.; Viola, Bence; Slatkin, Montgomery; Reich, David; Kelso, Janet; Pääbo, Svante

    2014-01-01

    We present a high-quality genome sequence of a Neandertal woman from Siberia. We show that her parents were related at the level of half siblings and that mating among close relatives was common among her recent ancestors. We also sequenced the genome of a Neandertal from the Caucasus to low coverage. An analysis of the relationships and population history of available archaic genomes and 25 present-day human genomes shows that several gene flow events occurred among Neandertals, Denisovans and early modern humans, possibly including gene flow into Denisovans from an unknown archaic group. Thus, interbreeding, albeit of low magnitude, occurred among many hominin groups in the Late Pleistocene. In addition, the high quality Neandertal genome allows us to establish a definitive list of substitutions that became fixed in modern humans after their separation from the ancestors of Neandertals and Denisovans. PMID:24352235

  18. Accurate phylogenetic classification of DNA fragments based onsequence composition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequencemore » characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.« less

  19. Genetic characterization of UCS region of Pneumocystis jirovecii and construction of allelic profiles of Indian isolates based on sequence typing at three regions.

    PubMed

    Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla

    2013-01-01

    Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Importance of Viral Sequence Length and Number of Variable and Informative Sites in Analysis of HIV Clustering.

    PubMed

    Novitsky, Vlad; Moyo, Sikhulile; Lei, Quanhong; DeGruttola, Victor; Essex, M

    2015-05-01

    To improve the methodology of HIV cluster analysis, we addressed how analysis of HIV clustering is associated with parameters that can affect the outcome of viral clustering. The extent of HIV clustering and tree certainty was compared between 401 HIV-1C near full-length genome sequences and subgenomic regions retrieved from the LANL HIV Database. Sliding window analysis was based on 99 windows of 1,000 bp and 45 windows of 2,000 bp. Potential associations between the extent of HIV clustering and sequence length and the number of variable and informative sites were evaluated. The near full-length genome HIV sequences showed the highest extent of HIV clustering and the highest tree certainty. At the bootstrap threshold of 0.80 in maximum likelihood (ML) analysis, 58.9% of near full-length HIV-1C sequences but only 15.5% of partial pol sequences (ViroSeq) were found in clusters. Among HIV-1 structural genes, pol showed the highest extent of clustering (38.9% at a bootstrap threshold of 0.80), although it was significantly lower than in the near full-length genome sequences. The extent of HIV clustering was significantly higher for sliding windows of 2,000 bp than 1,000 bp. We found a strong association between the sequence length and proportion of HIV sequences in clusters, and a moderate association between the number of variable and informative sites and the proportion of HIV sequences in clusters. In HIV cluster analysis, the extent of detectable HIV clustering is directly associated with the length of viral sequences used, as well as the number of variable and informative sites. Near full-length genome sequences could provide the most informative HIV cluster analysis. Selected subgenomic regions with a high extent of HIV clustering and high tree certainty could also be considered as a second choice.

  1. Importance of Viral Sequence Length and Number of Variable and Informative Sites in Analysis of HIV Clustering

    PubMed Central

    Novitsky, Vlad; Moyo, Sikhulile; Lei, Quanhong; DeGruttola, Victor

    2015-01-01

    Abstract To improve the methodology of HIV cluster analysis, we addressed how analysis of HIV clustering is associated with parameters that can affect the outcome of viral clustering. The extent of HIV clustering and tree certainty was compared between 401 HIV-1C near full-length genome sequences and subgenomic regions retrieved from the LANL HIV Database. Sliding window analysis was based on 99 windows of 1,000 bp and 45 windows of 2,000 bp. Potential associations between the extent of HIV clustering and sequence length and the number of variable and informative sites were evaluated. The near full-length genome HIV sequences showed the highest extent of HIV clustering and the highest tree certainty. At the bootstrap threshold of 0.80 in maximum likelihood (ML) analysis, 58.9% of near full-length HIV-1C sequences but only 15.5% of partial pol sequences (ViroSeq) were found in clusters. Among HIV-1 structural genes, pol showed the highest extent of clustering (38.9% at a bootstrap threshold of 0.80), although it was significantly lower than in the near full-length genome sequences. The extent of HIV clustering was significantly higher for sliding windows of 2,000 bp than 1,000 bp. We found a strong association between the sequence length and proportion of HIV sequences in clusters, and a moderate association between the number of variable and informative sites and the proportion of HIV sequences in clusters. In HIV cluster analysis, the extent of detectable HIV clustering is directly associated with the length of viral sequences used, as well as the number of variable and informative sites. Near full-length genome sequences could provide the most informative HIV cluster analysis. Selected subgenomic regions with a high extent of HIV clustering and high tree certainty could also be considered as a second choice. PMID:25560745

  2. High-Throughput Next-Generation Sequencing of Polioviruses

    PubMed Central

    Montmayeur, Anna M.; Schmidt, Alexander; Zhao, Kun; Magaña, Laura; Iber, Jane; Castro, Christina J.; Chen, Qi; Henderson, Elizabeth; Ramos, Edward; Shaw, Jing; Tatusov, Roman L.; Dybdahl-Sissoko, Naomi; Endegue-Zanga, Marie Claire; Adeniji, Johnson A.; Oberste, M. Steven; Burns, Cara C.

    2016-01-01

    ABSTRACT The poliovirus (PV) is currently targeted for worldwide eradication and containment. Sanger-based sequencing of the viral protein 1 (VP1) capsid region is currently the standard method for PV surveillance. However, the whole-genome sequence is sometimes needed for higher resolution global surveillance. In this study, we optimized whole-genome sequencing protocols for poliovirus isolates and FTA cards using next-generation sequencing (NGS), aiming for high sequence coverage, efficiency, and throughput. We found that DNase treatment of poliovirus RNA followed by random reverse transcription (RT), amplification, and the use of the Nextera XT DNA library preparation kit produced significantly better results than other preparations. The average viral reads per total reads, a measurement of efficiency, was as high as 84.2% ± 15.6%. PV genomes covering >99 to 100% of the reference length were obtained and validated with Sanger sequencing. A total of 52 PV genomes were generated, multiplexing as many as 64 samples in a single Illumina MiSeq run. This high-throughput, sequence-independent NGS approach facilitated the detection of a diverse range of PVs, especially for those in vaccine-derived polioviruses (VDPV), circulating VDPV, or immunodeficiency-related VDPV. In contrast to results from previous studies on other viruses, our results showed that filtration and nuclease treatment did not discernibly increase the sequencing efficiency of PV isolates. However, DNase treatment after nucleic acid extraction to remove host DNA significantly improved the sequencing results. This NGS method has been successfully implemented to generate PV genomes for molecular epidemiology of the most recent PV isolates. Additionally, the ability to obtain full PV genomes from FTA cards will aid in facilitating global poliovirus surveillance. PMID:27927929

  3. Sequences of 95 human MHC haplotypes reveal extreme coding variation in genes other than highly polymorphic HLA class I and II

    PubMed Central

    Norman, Paul J.; Norberg, Steven J.; Guethlein, Lisbeth A.; Nemat-Gorgani, Neda; Royce, Thomas; Wroblewski, Emily E.; Dunn, Tamsen; Mann, Tobias; Alicata, Claudia; Hollenbach, Jill A.; Chang, Weihua; Shults Won, Melissa; Gunderson, Kevin L.; Abi-Rached, Laurent; Ronaghi, Mostafa; Parham, Peter

    2017-01-01

    The most polymorphic part of the human genome, the MHC, encodes over 160 proteins of diverse function. Half of them, including the HLA class I and II genes, are directly involved in immune responses. Consequently, the MHC region strongly associates with numerous diseases and clinical therapies. Notoriously, the MHC region has been intractable to high-throughput analysis at complete sequence resolution, and current reference haplotypes are inadequate for large-scale studies. To address these challenges, we developed a method that specifically captures and sequences the 4.8-Mbp MHC region from genomic DNA. For 95 MHC homozygous cell lines we assembled, de novo, a set of high-fidelity contigs and a sequence scaffold, representing a mean 98% of the target region. Included are six alternative MHC reference sequences of the human genome that we completed and refined. Characterization of the sequence and structural diversity of the MHC region shows the approach accurately determines the sequences of the highly polymorphic HLA class I and HLA class II genes and the complex structural diversity of complement factor C4A/C4B. It has also uncovered extensive and unexpected diversity in other MHC genes; an example is MUC22, which encodes a lung mucin and exhibits more coding sequence alleles than any HLA class I or II gene studied here. More than 60% of the coding sequence alleles analyzed were previously uncharacterized. We have created a substantial database of robust reference MHC haplotype sequences that will enable future population scale studies of this complicated and clinically important region of the human genome. PMID:28360230

  4. Identification of a novel bovine enterovirus possessing highly divergent amino acid sequences in capsid protein.

    PubMed

    Tsuchiaka, Shinobu; Rahpaya, Sayed Samim; Otomaru, Konosuke; Aoki, Hiroshi; Kishimoto, Mai; Naoi, Yuki; Omatsu, Tsutomu; Sano, Kaori; Okazaki-Terashima, Sachiko; Katayama, Yukie; Oba, Mami; Nagai, Makoto; Mizutani, Tetsuya

    2017-01-17

    Bovine enterovirus (BEV) belongs to the species Enterovirus E or F, genus Enterovirus and family Picornaviridae. Although numerous studies have identified BEVs in the feces of cattle with diarrhea, the pathogenicity of BEVs remains unclear. Previously, we reported the detection of novel kobu-like virus in calf feces, by metagenomics analysis. In the present study, we identified a novel BEV in diarrheal feces collected for that survey. Complete genome sequences were determined by deep sequencing in feces. Secondary RNA structure analysis of the 5' untranslated region (UTR), phylogenetic tree construction and pairwise identity analysis were conducted. The complete genome sequences of BEV were genetically distant from other EVs and the VP1 coding region contained novel and unique amino acid sequences. We named this strain as BEV AN12/Bos taurus/JPN/2014 (referred to as BEV-AN12). According to genome analysis, the genome length of this virus is 7414 nucleotides excluding the poly (A) tail and its genome consists of a 5'UTR, open reading frame encoding a single polyprotein, and 3'UTR. The results of secondary RNA structure analysis showed that in the 5'UTR, BEV-AN12 had an additional clover leaf structure and small stem loop structure, similarly to other BEVs. In pairwise identity analysis, BEV-AN12 showed high amino acid (aa) identities to Enterovirus F in the polyprotein, P2 and P3 regions (aa identity ≥82.4%). Therefore, BEV-AN12 is closely related to Enterovirus F. However, aa sequences in the capsid protein regions, particularly the VP1 encoding region, showed significantly low aa identity to other viruses in genus Enterovirus (VP1 aa identity ≤58.6%). In addition, BEV-AN12 branched separately from Enterovirus E and F in phylogenetic trees based on the aa sequences of P1 and VP1, although it clustered with Enterovirus F in trees based on sequences in the P2 and P3 genome region. We identified novel BEV possessing highly divergent aa sequences in the VP1 coding region in Japan. According to species definition, we proposed naming this strain as "Enterovirus K", which is a novel species within genus Enterovirus. Further genomic studies are needed to understand the pathogenicity of BEVs.

  5. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    PubMed

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  6. Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq)

    PubMed Central

    Langley, Alexander R.; Gräf, Stefan; Smith, James C.; Krude, Torsten

    2016-01-01

    Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. PMID:27587586

  7. Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

    PubMed

    Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

    2016-12-01

    Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Genetic characterization of the non-structural protein-3 gene of bluetongue virus serotype-2 isolate from India.

    PubMed

    Pudupakam, Raghavendra Sumanth; Raghunath, Shobana; Pudupakam, Meghanath; Daggupati, Sreenivasulu

    2017-03-01

    Sequence analysis and phylogenetic studies based on non-structural protein-3 (NS3) gene are important in understanding the evolution and epidemiology of bluetongue virus (BTV). This study was aimed at characterizing the NS3 gene sequence of Indian BTV serotype-2 (BTV2) to elucidate its genetic relationship to global BTV isolates. The NS3 gene of BTV2 was amplified from infected BHK-21 cell cultures, cloned and subjected to sequence analysis. The generated NS3 gene sequence was compared with the corresponding sequences of different BTV serotypes across the world, and a phylogenetic relationship was established. The NS3 gene of BTV2 showed moderate levels of variability in comparison to different BTV serotypes, with nucleotide sequence identities ranging from 81% to 98%. The region showed high sequence homology of 93-99% at amino acid level with various BTV serotypes. The PPXY/PTAP late domain motifs, glycosylation sites, hydrophobic domains, and the amino acid residues critical for virus-host interactions were conserved in NS3 protein. Phylogenetic analysis revealed that BTV isolates segregate into four topotypes and that the Indian BTV2 in subclade IA is closely related to Asian and Australian origin strains. Analysis of the NS3 gene indicated that Indian BTV2 isolate is closely related to strains from Asia and Australia, suggesting a common origin of infection. Although the pattern of evolution of BTV2 isolate is different from other global isolates, the deduced amino acid sequence of NS3 protein demonstrated high molecular stability.

  9. Genetic characterization of the non-structural protein-3 gene of bluetongue virus serotype-2 isolate from India

    PubMed Central

    Pudupakam, Raghavendra Sumanth; Raghunath, Shobana; Pudupakam, Meghanath; Daggupati, Sreenivasulu

    2017-01-01

    Aim: Sequence analysis and phylogenetic studies based on non-structural protein-3 (NS3) gene are important in understanding the evolution and epidemiology of bluetongue virus (BTV). This study was aimed at characterizing the NS3 gene sequence of Indian BTV serotype-2 (BTV2) to elucidate its genetic relationship to global BTV isolates. Materials and Methods: The NS3 gene of BTV2 was amplified from infected BHK-21 cell cultures, cloned and subjected to sequence analysis. The generated NS3 gene sequence was compared with the corresponding sequences of different BTV serotypes across the world, and a phylogenetic relationship was established. Results: The NS3 gene of BTV2 showed moderate levels of variability in comparison to different BTV serotypes, with nucleotide sequence identities ranging from 81% to 98%. The region showed high sequence homology of 93-99% at amino acid level with various BTV serotypes. The PPXY/PTAP late domain motifs, glycosylation sites, hydrophobic domains, and the amino acid residues critical for virus-host interactions were conserved in NS3 protein. Phylogenetic analysis revealed that BTV isolates segregate into four topotypes and that the Indian BTV2 in subclade IA is closely related to Asian and Australian origin strains. Conclusion: Analysis of the NS3 gene indicated that Indian BTV2 isolate is closely related to strains from Asia and Australia, suggesting a common origin of infection. Although the pattern of evolution of BTV2 isolate is different from other global isolates, the deduced amino acid sequence of NS3 protein demonstrated high molecular stability. PMID:28435199

  10. Molecular analysis of microbial community in a groundwater sample polluted by landfill leachate and seawater*

    PubMed Central

    Tian, Yang-jie; Yang, Hong; Wu, Xiu-juan; Li, Dao-tang

    2005-01-01

    Seashore landfill aquifers are environments of special physicochemical conditions (high organic load and high salinity), and microbes in leachate-polluted aquifers play a significant role for intrinsic bioremediation. In order to characterize microbial diversity and look for clues on the relationship between microbial community structure and hydrochemistry, a culture-independent examination of a typical groundwater sample obtained from a seashore landfill was conducted by sequence analysis of 16S rDNA clone library. Two sets of universal 16S rDNA primers were used to amplify DNA extracted from the groundwater so that problems arising from primer efficiency and specificity could be reduced. Of 74 clones randomly selected from the libraries, 30 contained unique sequences whose analysis showed that the majority of them belonged to bacteria (95.9%), with Proteobacteria (63.5%) being the dominant division. One archaeal sequence and one eukaryotic sequence were found as well. Bacterial sequences belonging to the following phylogenic groups were identified: Bacteroidetes (20.3%), β, γ, δ and ε-subdivisions of Proteobacteria (47.3%, 9.5%, 5.4% and 1.3%, respectively), Firmicutes (1.4%), Actinobacteria (2.7%), Cyanobacteria (2.7%). The percentages of Proteobacteria and Bacteroides in seawater were greater than those in the groundwater from a non-seashore landfill, indicating a possible influence of seawater. Quite a few sequences had close relatives in marine or hypersaline environments. Many sequences showed affiliations with microbes involved in anaerobic fermentation. The remarkable abundance of sequences related to (per)chlorate-reducing bacteria (ClRB) in the groundwater was significant and worthy of further study. PMID:15682499

  11. Draft Genome Sequence of the Algicidal Bacterium Mangrovimonas yunxiaonensis Strain LY01.

    PubMed

    Li, Yi; Zhu, Hong; Li, Chongping; Zhang, Huajun; Chen, Zhangran; Zheng, Wei; Xu, Hong; Zheng, Tianling

    2014-11-26

    Mangrovimonas yunxiaonensis LY01, a novel bacterium isolated from mangrove sediment, showed high algicidal effects on harmful algal blooms of Alexandrium tamarense. Here, we present the first draft genome sequence of this strain to further understanding of the functional genes related to algicidal activity. Copyright © 2014 Li et al.

  12. Low diversity in the mitogenome of sperm whales revealed by next-generation sequencing

    Treesearch

    Alana Alexander; Debbie Steel; Beth Slikas; Kendra Hoekzema; Colm Carraher; Matthew Parks; Richard Cronn; C. Scott Baker

    2012-01-01

    Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20...

  13. Complete genome sequences of two highly divergent Japanese isolates of Plantago asiatica mosaic virus.

    PubMed

    Komatsu, Ken; Yamashita, Kazuo; Sugawara, Kota; Verbeek, Martin; Fujita, Naoko; Hanada, Kaoru; Uehara-Ichiki, Tamaki; Fuji, Shin-Ichi

    2017-02-01

    Plantago asiatica mosaic virus (PlAMV) is a member of the genus Potexvirus and has an exceptionally wide host range. It causes severe damage to lilies. Here we report on the complete nucleotide sequences of two new Japanese PlAMV isolates, one from the eudicot weed Viola grypoceras (PlAMV-Vi), and the other from the eudicot shrub Nandina domestica Thunb. (PlAMV-NJ). Their genomes contain five open reading frames (ORFs), which is characteristic of potexviruses. Surprisingly, the isolates showed only 76.0-78.0 % sequence identity with each other and with other PlAMV isolates, including isolates from Japanese lily and American nandina. Amino acid alignments of the replicase coding region encoded by ORF1 showed that the regions between the methyltransferase and helicase domains were less conserved than other regions, with several insertions and/or deletions. Phylogenetic analyses of the full-length nucleotide sequences revealed a moderate correlation between phylogenetic clustering and the original host plants of the PlAMV isolates. This study revealed the presence of two highly divergent PlAMV isolates in Japan.

  14. Associations among measures of sequential processing in motor and linguistics tasks in adults with and without a family history of childhood apraxia of speech: a replication study.

    PubMed

    Button, Le; Peter, Beate; Stoel-Gammon, Carol; Raskind, Wendy H

    2013-03-01

    The purpose of this study was to address the hypothesis that childhood apraxia of speech (CAS) is influenced by an underlying deficit in sequential processing that is also expressed in other modalities. In a sample of 21 adults from five multigenerational families, 11 with histories of various familial speech sound disorders, 3 biologically related adults from a family with familial CAS showed motor sequencing deficits in an alternating motor speech task. Compared with the other adults, these three participants showed deficits in tasks requiring high loads of sequential processing, including nonword imitation, nonword reading and spelling. Qualitative error analyses in real word and nonword imitations revealed group differences in phoneme sequencing errors. Motor sequencing ability was correlated with phoneme sequencing errors during real word and nonword imitation, reading and spelling. Correlations were characterized by extremely high scores in one family and extremely low scores in another. Results are consistent with a central deficit in sequential processing in CAS of familial origin.

  15. High-throughput sequencing of natively paired antibody chains provides evidence for original antigenic sin shaping the antibody response to influenza vaccination.

    PubMed

    Tan, Yann-Chong; Blum, Lisa K; Kongpachith, Sarah; Ju, Chia-Hsin; Cai, Xiaoyong; Lindstrom, Tamsin M; Sokolove, Jeremy; Robinson, William H

    2014-03-01

    We developed a DNA barcoding method to enable high-throughput sequencing of the cognate heavy- and light-chain pairs of the antibodies expressed by individual B cells. We used this approach to elucidate the plasmablast antibody response to influenza vaccination. We show that >75% of the rationally selected plasmablast antibodies bind and neutralize influenza, and that antibodies from clonal families, defined by sharing both heavy-chain VJ and light-chain VJ sequence usage, do so most effectively. Vaccine-induced heavy-chain VJ regions contained on average >20 nucleotide mutations as compared to their predicted germline gene sequences, and some vaccine-induced antibodies exhibited higher binding affinities for hemagglutinins derived from prior years' seasonal influenza as compared to their affinities for the immunization strains. Our results show that influenza vaccination induces the recall of memory B cells that express antibodies that previously underwent affinity maturation against prior years' seasonal influenza, suggesting that 'original antigenic sin' shapes the antibody response to influenza vaccination. Published by Elsevier Inc.

  16. Associations among measures of sequential processing in motor and linguistics tasks in adults with and without a family history of childhood apraxia of speech: A replication study

    PubMed Central

    BUTTON, LE; PETER, BEATE; STOEL-GAMMON, CAROL; RASKIND, WENDY H.

    2013-01-01

    The purpose of this study was to address the hypothesis that childhood apraxia of speech (CAS) is influenced by an underlying deficit in sequential processing that is also expressed in other modalities. In a sample of 21 adults from five multigenerational families, 11 with histories of various familial speech sound disorders, 3 biologically related adults from a family with familial CAS showed motor sequencing deficits in an alternating motor speech task. Compared with the other adults, these three participants showed deficits in tasks requiring high loads of sequential processing, including nonword imitation, nonword reading and spelling. Qualitative error analyses in real word and nonword imitations revealed group differences in phoneme sequencing errors. Motor sequencing ability was correlated with phoneme sequencing errors during real word and nonword imitation, reading and spelling. Correlations were characterized by extremely high scores in one family and extremely low scores in another. Results are consistent with a central deficit in sequential processing in CAS of familial origin. PMID:23339292

  17. An Integrated Tool to Study MHC Region: Accurate SNV Detection and HLA Genes Typing in Human MHC Region Using Targeted High-Throughput Sequencing

    PubMed Central

    Liu, Xiao; Xu, Yinyin; Liang, Dequan; Gao, Peng; Sun, Yepeng; Gifford, Benjamin; D’Ascenzo, Mark; Liu, Xiaomin; Tellier, Laurent C. A. M.; Yang, Fang; Tong, Xin; Chen, Dan; Zheng, Jing; Li, Weiyang; Richmond, Todd; Xu, Xun; Wang, Jun; Li, Yingrui

    2013-01-01

    The major histocompatibility complex (MHC) is one of the most variable and gene-dense regions of the human genome. Most studies of the MHC, and associated regions, focus on minor variants and HLA typing, many of which have been demonstrated to be associated with human disease susceptibility and metabolic pathways. However, the detection of variants in the MHC region, and diagnostic HLA typing, still lacks a coherent, standardized, cost effective and high coverage protocol of clinical quality and reliability. In this paper, we presented such a method for the accurate detection of minor variants and HLA types in the human MHC region, using high-throughput, high-coverage sequencing of target regions. A probe set was designed to template upon the 8 annotated human MHC haplotypes, and to encompass the 5 megabases (Mb) of the extended MHC region. We deployed our probes upon three, genetically diverse human samples for probe set evaluation, and sequencing data show that ∼97% of the MHC region, and over 99% of the genes in MHC region, are covered with sufficient depth and good evenness. 98% of genotypes called by this capture sequencing prove consistent with established HapMap genotypes. We have concurrently developed a one-step pipeline for calling any HLA type referenced in the IMGT/HLA database from this target capture sequencing data, which shows over 96% typing accuracy when deployed at 4 digital resolution. This cost-effective and highly accurate approach for variant detection and HLA typing in the MHC region may lend further insight into immune-mediated diseases studies, and may find clinical utility in transplantation medicine research. This one-step pipeline is released for general evaluation and use by the scientific community. PMID:23894464

  18. SSMART: Sequence-structure motif identification for RNA-binding proteins.

    PubMed

    Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe

    2018-06-11

    RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.

  19. The accelerated build-up of the red sequence in high-redshift galaxy clusters

    NASA Astrophysics Data System (ADS)

    Cerulo, P.; Couch, W. J.; Lidman, C.; Demarco, R.; Huertas-Company, M.; Mei, S.; Sánchez-Janssen, R.; Barrientos, L. F.; Muñoz, R. P.

    2016-04-01

    We analyse the evolution of the red sequence in a sample of galaxy clusters at redshifts 0.8 < z < 1.5 taken from the HAWK-I Cluster Survey (HCS). The comparison with the low-redshift (0.04 < z < 0.08) sample of the WIde-field Nearby Galaxy-cluster Survey (WINGS) and other literature results shows that the slope and intrinsic scatter of the cluster red sequence have undergone little evolution since z = 1.5. We find that the luminous-to-faint ratio and the slope of the faint end of the luminosity distribution of the HCS red sequence are consistent with those measured in WINGS, implying that there is no deficit of red galaxies at magnitudes fainter than M_V^{ast } at high redshifts. We find that the most massive HCS clusters host a population of bright red sequence galaxies at MV < -22.0 mag, which are not observed in low-mass clusters. Interestingly, we also note the presence of a population of very bright (MV < -23.0 mag) and massive (log (M*/M⊙) > 11.5) red sequence galaxies in the WINGS clusters, which do not include only the brightest cluster galaxies and which are not present in the HCS clusters, suggesting that they formed at epochs later than z = 0.8. The comparison with the luminosity distribution of a sample of passive red sequence galaxies drawn from the COSMOS/UltraVISTA field in the photometric redshift range 0.8 < zphot < 1.5 shows that the red sequence in clusters is more developed at the faint end, suggesting that halo mass plays an important role in setting the time-scales for the build-up of the red sequence.

  20. High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.

    PubMed

    Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie

    2015-06-17

    High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This sequence structure can be harnessed to improve bioinformatics algorithms, in particular for CNV and structural variant detection. Descriptive measures for cell-free DNA features developed here could also be used in biomarker analysis to monitor the changes that occur during different pathological conditions.

  1. Sequencing the threat and recommendation components of persuasive messages differentially improves the effectiveness of high- and low-distressing imagery in an anti-alcohol message in students.

    PubMed

    Brown, Stephen L; West, Charlotte

    2015-05-01

    Distressing imagery is often used to improve the persuasiveness of mass-reach health promotion messages, but its effectiveness may be limited because audiences avoid attending to content. Prior self-affirmation or self-efficacy inductions have been shown to reduce avoidance and improve audience responsiveness to distressing messages, but these are difficult to introduce into a mass-reach context. Reasoning that a behavioural recommendation may have a similar effect, we reversed the traditional threat-behavioural recommendation health promotion message sequence. 2 × 2 experimental design: Factor 1, high- and low-distress images; Factor 2, threat-recommendation and recommendation-threat sequences. Ninety-one students were exposed to an identical text message accompanied by high- or low-distress imagery presented in threat-recommendation and recommendation-threat sequences. For the high-distress message, greater persuasion was observed for the recommendation-threat than the threat-recommendation sequence. This was partially mediated by participants' greater self-exposure to the threat component of the message, which we attribute to the effect of sequence in reducing attentional avoidance. For the low-distress message, greater persuasion was observed for the threat-recommendation sequence, which was not mediated by reading time allocated to the threat. Tailoring message sequence to suit the degree of distress that message developers wish to induce provides a tool that could improve persuasive messages. These findings provide a first step in this process and discuss further steps needed to consolidate and expand these findings. Statement of contribution What is already known on this subject? Health promotion messages accompanied by distressing imagery might, under some circumstances, persuade individuals to engage in healthier behaviour. Audiences can respond defensively to distressing imagery, but may be less inclined to do so when an easily followed behavioural recommendation is presented before imagery. Current literature is divided on whether presenting a behavioural recommendation before a threat component accompanied by distressing images will improve the persuasiveness of messages. What does this study add? We show that, when a behavioural recommendation precedes a threat containing distressing images, persuasiveness of a threatening message is stronger than a threat-recommendation sequence. We show that a recommendation-threat sequence improves persuasiveness of distressing imagery because it reduces attentional avoidance. © 2014 The British Psychological Society.

  2. Direct typing of Canine parvovirus (CPV) from infected dog faeces by rapid mini sequencing technique.

    PubMed

    V, Pavana Jyothi; S, Akila; Selvan, Malini K; Naidu, Hariprasad; Raghunathan, Shwethaa; Kota, Sathish; Sundaram, R C Raja; Rana, Samir Kumar; Raj, G Dhinakar; Srinivasan, V A; Mohana Subramanian, B

    2016-12-01

    Canine parvovirus (CPV) is a non-enveloped single stranded DNA virus with an icosahedral capsid. Mini-sequencing based CPV typing was developed earlier to detect and differentiate all the CPV types and FPV in a single reaction. This technique was further evaluated in the present study by performing the mini-sequencing directly from fecal samples which avoided tedious virus isolation steps by cell culture system. Fecal swab samples were collected from 84 dogs with enteritis symptoms, suggestive of parvoviral infection from different locations across India. Seventy six of these samples were positive by PCR; the subsequent mini-sequencing reaction typed 74 of them as type 2a virus, and 2 samples as type 2b. Additionally, 25 of the positive samples were typed by cycle sequencing of PCR products. Direct CPV typing from fecal samples using mini-sequencing showed 100% correlation with CPV typing by cycle sequencing. Moreover, CPV typing was achieved by mini-sequencing even with faintly positive PCR amplicons which was not possible by cycle sequencing. Therefore, the mini-sequencing technique is recommended for regular epidemiological follow up of CPV types, since the technique is rapid, highly sensitive and high capacity method for CPV typing. Copyright © 2016. Published by Elsevier B.V.

  3. Is sequencing better than phenotypic tests for the detection of pyrazinamide resistance?

    PubMed

    Bouzouita, I; Cabibbe, A M; Trovato, A; Draoui, H; Ghariani, A; Midouni, B; Essalah, L; Mehiri, E; Cirillo, D M; Slim-Saidi, L

    2018-06-01

    Phenotypic tests used to detect pyrazinamide (PZA) resistance are slow and have a high rate of false resistance. To evaluate the accuracy of pncA sequencing for the detection of PZA resistance in Mycobacterium tuberculosis strains isolated in Tunisia. A total of 82 isolates, 41 resistant and 41 susceptible to PZA on BACTEC™ MGIT™ 960, were sequenced for pncA. Whole genome sequencing was performed for strains that were phenotypically resistant and had wild-type pncA in addition to MGIT retesting with a modified protocol. Twenty-three strains resistant to PZA with negative pyrazinamidase (PZase) activity harboured a mutation in the promoter or coding region of pncA. However, 18 strains resistant to PZA did not present any mutation. Repeat MGIT 960 showed that 16 of 18 M. tuberculosis isolates were falsely resistant to PZA. Compared with MGIT, PZase activity assay and pncA sequencing both presented a sensitivity of 92.0% (95%CI 73.9-99.0) and a specificity of respectively 96.5% (positive predictive value [PPV] 92.0%, negative predictive value [NPV] 96.5%) and 100.0% (PPV 100.0%, NPV 96.6%). The standard MGIT assay showed a high rate of false resistance to PZA, and the PZase activity assay is slow. pncA sequencing could therefore represent a rapid, accurate, alternative test to detect PZA resistance.

  4. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    PubMed

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  5. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    PubMed Central

    Rehm, Charlotte; Wurmthaler, Lena A.; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S.

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1–5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6–9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria. PMID:26695179

  6. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  7. Image encryption using random sequence generated from generalized information domain

    NASA Astrophysics Data System (ADS)

    Xia-Yan, Zhang; Guo-Ji, Zhang; Xuan, Li; Ya-Zhou, Ren; Jie-Hua, Wu

    2016-05-01

    A novel image encryption method based on the random sequence generated from the generalized information domain and permutation-diffusion architecture is proposed. The random sequence is generated by reconstruction from the generalized information file and discrete trajectory extraction from the data stream. The trajectory address sequence is used to generate a P-box to shuffle the plain image while random sequences are treated as keystreams. A new factor called drift factor is employed to accelerate and enhance the performance of the random sequence generator. An initial value is introduced to make the encryption method an approximately one-time pad. Experimental results show that the random sequences pass the NIST statistical test with a high ratio and extensive analysis demonstrates that the new encryption scheme has superior security.

  8. Mitochondrial DNA variation of indigenous goats in Narok and Isiolo counties of Kenya.

    PubMed

    Kibegwa, F M; Githui, K E; Jung'a, J O; Badamana, M S; Nyamu, M N

    2016-06-01

    Phylogenetic relationships among and genetic variability within 60 goats from two different indigenous breeds in Narok and Isiolo counties in Kenya and 22 published goat samples were analysed using mitochondrial control region sequences. The results showed that there were 54 polymorphic sites in a 481-bp sequence and 29 haplotypes were determined. The mean haplotype diversity and nucleotide diversity were 0.981 ± 0.006 and 0.019 ± 0.001, respectively. The phylogenetic analysis in combination with goat haplogroup reference sequences from GenBank showed that all goat sequences were clustered into two haplogroups (A and G), of which haplogroup A was the commonest in the two populations. A very high percentage (99.90%) of the genetic variation was distributed within the regions, and a smaller percentage (0.10%) distributed among regions as revealed by the analysis of molecular variance (amova). This amova results showed that the divergence between regions was not statistically significant. We concluded that the high levels of intrapopulation diversity in Isiolo and Narok goats and the weak phylogeographic structuring suggested that there existed strong gene flow among goat populations probably caused by extensive transportation of goats in history. © 2015 Blackwell Verlag GmbH.

  9. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    NASA Astrophysics Data System (ADS)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  10. Evidence for a lineage of virulent bacteriophages that target Campylobacter.

    PubMed

    Timms, Andrew R; Cambray-Young, Joanna; Scott, Andrew E; Petty, Nicola K; Connerton, Phillippa L; Clarke, Louise; Seeger, Kathy; Quail, Mike; Cummings, Nicola; Maskell, Duncan J; Thomson, Nicholas R; Connerton, Ian F

    2010-03-30

    Our understanding of the dynamics of genome stability versus gene flux within bacteriophage lineages is limited. Recently, there has been a renewed interest in the use of bacteriophages as 'therapeutic' agents; a prerequisite for their use in such therapies is a thorough understanding of their genetic complement, genome stability and their ecology to avoid the dissemination or mobilisation of phage or bacterial virulence and toxin genes. Campylobacter, a food-borne pathogen, is one of the organisms for which the use of bacteriophage is being considered to reduce human exposure to this organism. Sequencing and genome analysis was performed for two Campylobacter bacteriophages. The genomes were extremely similar at the nucleotide level (> or = 96%) with most differences accounted for by novel insertion sequences, DNA methylases and an approximately 10 kb contiguous region of metabolic genes that were dissimilar at the sequence level but similar in gene function between the two phages. Both bacteriophages contained a large number of radical S-adenosylmethionine (SAM) genes, presumably involved in boosting host metabolism during infection, as well as evidence that many genes had been acquired from a wide range of bacterial species. Further bacteriophages, from the UK Campylobacter typing set, were screened for the presence of bacteriophage structural genes, DNA methylases, mobile genetic elements and regulatory genes identified from the genome sequences. The results indicate that many of these bacteriophages are related, with 10 out of 15 showing some relationship to the sequenced genomes. Two large virulent Campylobacter bacteriophages were found to show very high levels of sequence conservation despite separation in time and place of isolation. The bacteriophages show adaptations to their host and possess genes that may enhance Campylobacter metabolism, potentially advantaging both the bacteriophage and its host. Genetic conservation has been shown to extend to other Campylobacter bacteriophages, forming a highly conserved lineage of bacteriophages that predate upon campylobacters and indicating that highly adapted bacteriophage genomes can be stable over prolonged periods of time.

  11. Emergence and Evolution of Hominidae-Specific Coding and Noncoding Genomic Sequences

    PubMed Central

    Saber, Morteza Mahmoudi; Adeyemi Babarinde, Isaac; Hettiarachchi, Nilmini; Saitou, Naruya

    2016-01-01

    Family Hominidae, which includes humans and great apes, is recognized for unique complex social behavior and intellectual abilities. Despite the increasing genome data, however, the genomic origin of its phenotypic uniqueness has remained elusive. Clade-specific genes and highly conserved noncoding sequences (HCNSs) are among the high-potential evolutionary candidates involved in driving clade-specific characters and phenotypes. On this premise, we analyzed whole genome sequences along with gene orthology data retrieved from major DNA databases to find Hominidae-specific (HS) genes and HCNSs. We discovered that Down syndrome critical region 4 (DSCR4) is the only experimentally verified gene uniquely present in Hominidae. DSCR4 has no structural homology to any known protein and was inferred to have emerged in several steps through LTR/ERV1, LTR/ERVL retrotransposition, and transversion. Using the genomic distance as neutral evolution threshold, we identified 1,658 HS HCNSs. Polymorphism coverage and derived allele frequency analysis of HS HCNSs showed that these HCNSs are under purifying selection, indicating that they may harbor important functions. They are overrepresented in promoters/untranslated regions, in close proximity of genes involved in sensory perception of sound and developmental process, and also showed a significantly lower nucleosome occupancy probability. Interestingly, many ancestral sequences of the HS HCNSs showed very high evolutionary rates. This suggests that new functions emerged through some kind of positive selection, and then purifying selection started to operate to keep these functions. PMID:27289096

  12. The complete amino acid sequence of human skeletal-muscle fructose-bisphosphate aldolase.

    PubMed Central

    Freemont, P S; Dunbar, B; Fothergill-Gilmore, L A

    1988-01-01

    The complete amino acid sequence of human skeletal-muscle fructose-bisphosphate aldolase, comprising 363 residues, was determined. The sequence was deduced by automated sequencing of CNBr-cleavage, o-iodosobenzoic acid-cleavage, trypsin-digest and staphylococcal-proteinase-digest fragments. Comparison of the sequence with other class I aldolase sequences shows that the mammalian muscle isoenzyme is one of the most highly conserved enzymes known, with only about 2% of the residues changing per 100 million years. Non-mammalian aldolases appear to be evolving at the same rate as other glycolytic enzymes, with about 4% of the residues changing per 100 million years. Secondary-structure predictions are analysed in an accompanying paper [Sawyer, Fothergill-Gilmore & Freemont (1988) Biochem. J. 249, 789-793]. PMID:3355497

  13. Source characteristics of the Fairview, OK, earthquake sequence and its relationship to industrial activities

    NASA Astrophysics Data System (ADS)

    Yeck, W. L.; Weingarten, M.; Benz, H.; McNamara, D. E.; Herrmann, R. B.; Rubinstein, J. L.; Earle, P. S.; Bergman, E.

    2016-12-01

    We characterize the spatio-temporal patterns of seismicity surrounding the February 13, 2016, Mw 5.1 Fairview, Oklahoma earthquake. This earthquake sequence accounts for the largest moment release in the central and eastern US since the November 06, 2011 Mw 5.6 Prague, OK earthquake sequence. To improve the location accuracy of the sequence and measure near-source ground motions, the United States Geological Survey (USGS) deployed eight seismometers and accelerometers in the epicentral region. With the added depth control from these stations, we show that earthquakes primarily occur in the Precambrian basement, at depths of 6-10 km below sea level. The Mw 5.1 mainshock, the largest event in the cluster, locates near the base of the seismicity. Relocated aftershocks delineate a partially unmapped, 14-km-long fault segment that strikes approximately N40°E, partially bridging the gap between previously mapped basement faults to the southwest and northeast. Gas production and hydraulic fracking data from the region show no evidence that either of these activities correlates spatio-temporally with the Fairview sequence. Instead, we suggest that a series of high-rate, Arbuckle injection wells (> 300,000 bbls/month) 8-25 km northeast of this sequence pressurized the reservoir in the far field. Regional injection into the Arbuckle formation increased 7-fold in the 24 months before the initiation of the sequence with some wells operating at rates greater than 1 million barrels per month. Seismicity in the proximity of the high-rate wells is diffuse whilst the energetic Fairview sequence occurs more than 15 km from this region. Our observations point to the critical role pre-existing geologic structures play in the occurrence of large induced earthquakes. This study demonstrates the need for a better understanding of the role of far-field pressurization. High-quality data sets such as this facilitate the USGS mission to improve earthquake hazard identification, especially as related to induced earthquakes.

  14. Frequency-locked pulse sequencer for high-frame-rate monochromatic tissue motion imaging.

    PubMed

    Azar, Reza Zahiri; Baghani, Ali; Salcudean, Septimiu E; Rohling, Robert

    2011-04-01

    To overcome the inherent low frame rate of conventional ultrasound, we have previously presented a system that can be implemented on conventional ultrasound scanners for high-frame-rate imaging of monochromatic tissue motion. The system employs a sector subdivision technique in the sequencer to increase the acquisition rate. To eliminate the delays introduced during data acquisition, a motion phase correction algorithm has also been introduced to create in-phase displacement images. Previous experimental results from tissue- mimicking phantoms showed that the system can achieve effective frame rates of up to a few kilohertz on conventional ultrasound systems. In this short communication, we present a new pulse sequencing strategy that facilitates high-frame-rate imaging of monochromatic motion such that the acquired echo signals are inherently in-phase. The sequencer uses the knowledge of the excitation frequency to synchronize the acquisition of the entire imaging plane to that of an external exciter. This sequencing approach eliminates any need for synchronization or phase correction and has applications in tissue elastography, which we demonstrate with tissue-mimicking phantoms. © 2011 IEEE

  15. Nanowire-nanopore transistor sensor for DNA detection during translocation

    NASA Astrophysics Data System (ADS)

    Xie, Ping; Xiong, Qihua; Fang, Ying; Qing, Quan; Lieber, Charles

    2011-03-01

    Nanopore sequencing, as a promising low cost, high throughput sequencing technique, has been proposed more than a decade ago. Due to the incompatibility between small ionic current signal and fast translocation speed and the technical difficulties on large scale integration of nanopore for direct ionic current sequencing, alternative methods rely on integrated DNA sensors have been proposed, such as using capacitive coupling or tunnelling current etc. But none of them have been experimentally demonstrated yet. Here we show that for the first time an amplified sensor signal has been experimentally recorded from a nanowire-nanopore field effect transistor sensor during DNA translocation. Independent multi-channel recording was also demonstrated for the first time. Our results suggest that the signal is from highly localized potential change caused by DNA translocation in none-balanced buffer condition. Given this method may produce larger signal for smaller nanopores, we hope our experiment can be a starting point for a new generation of nanopore sequencing devices with larger signal, higher bandwidth and large-scale multiplexing capability and finally realize the ultimate goal of low cost high throughput sequencing.

  16. Comparisons of Highly Virulent H5N1 Influenza A Viruses Isolated from Humans and Chickens from Hong Kong

    PubMed Central

    Suarez, David L.; Perdue, Michael L.; Cox, Nancy; Rowe, Thomas; Bender, Catherine; Huang, Jing; Swayne, David E.

    1998-01-01

    Genes of an influenza A (H5N1) virus from a human in Hong Kong isolated in May 1997 were sequenced and found to be all avian-like (K. Subbarao et al., Science 279:393–395, 1998). Gene sequences of this human isolate were compared to those of a highly pathogenic chicken H5N1 influenza virus isolated from Hong Kong in April 1997. Sequence comparisons of all eight RNA segments from the two viruses show greater than 99% sequence identity between them. However, neither isolate’s gene sequence was closely (>95% sequence identity) related to any other gene sequences found in the GenBank database. Phylogenetic analysis demonstrated that the nucleotide sequences of at least four of the eight RNA segments clustered with Eurasian origin avian influenza viruses. The hemagglutinin gene phylogenetic analysis also included the sequences from an additional three human and two chicken H5N1 virus isolates from Hong Kong, and the isolates separated into two closely related groups. However, no single amino acid change separated the chicken origin and human origin isolates, but they all contained multiple basic amino acids at the hemagglutinin cleavage site, which is associated with a highly pathogenic phenotype in poultry. In experimental intravenous inoculation studies with chickens, all seven viruses were highly pathogenic, killing most birds within 24 h. All infected chickens had virtually identical pathologic lesions, including moderate to severe diffuse edema and interstitial pneumonitis. Viral nucleoprotein was most frequently demonstrated in vascular endothelium, macrophages, heterophils, and cardiac myocytes. Asphyxiation from pulmonary edema and generalized cardiovascular collapse were the most likely pathogenic mechanisms responsible for illness and death. In summary, a small number of changes in hemagglutinin gene sequences defined two closely related subgroups, with both subgroups having human and chicken members, among the seven viruses examined from Hong Kong, and all seven viruses were highly pathogenic in chickens and caused similar lesions in experimental inoculations. PMID:9658115

  17. An ultra-sparse code underliesthe generation of neural sequences in a songbird

    NASA Astrophysics Data System (ADS)

    Hahnloser, Richard H. R.; Kozhevnikov, Alexay A.; Fee, Michale S.

    2002-09-01

    Sequences of motor activity are encoded in many vertebrate brains by complex spatio-temporal patterns of neural activity; however, the neural circuit mechanisms underlying the generation of these pre-motor patterns are poorly understood. In songbirds, one prominent site of pre-motor activity is the forebrain robust nucleus of the archistriatum (RA), which generates stereotyped sequences of spike bursts during song and recapitulates these sequences during sleep. We show that the stereotyped sequences in RA are driven from nucleus HVC (high vocal centre), the principal pre-motor input to RA. Recordings of identified HVC neurons in sleeping and singing birds show that individual HVC neurons projecting onto RA neurons produce bursts sparsely, at a single, precise time during the RA sequence. These HVC neurons burst sequentially with respect to one another. We suggest that at each time in the RA sequence, the ensemble of active RA neurons is driven by a subpopulation of RA-projecting HVC neurons that is active only at that time. As a population, these HVC neurons may form an explicit representation of time in the sequence. Such a sparse representation, a temporal analogue of the `grandmother cell' concept for object recognition, eliminates the problem of temporal interference during sequence generation and learning attributed to more distributed representations.

  18. A Shellcode Detection Method Based on Full Native API Sequence and Support Vector Machine

    NASA Astrophysics Data System (ADS)

    Cheng, Yixuan; Fan, Wenqing; Huang, Wei; An, Jing

    2017-09-01

    Dynamic monitoring the behavior of a program is widely used to discriminate between benign program and malware. It is usually based on the dynamic characteristics of a program, such as API call sequence or API call frequency to judge. The key innovation of this paper is to consider the full Native API sequence and use the support vector machine to detect the shellcode. We also use the Markov chain to extract and digitize Native API sequence features. Our experimental results show that the method proposed in this paper has high accuracy and low detection rate.

  19. Reduced randomness in quantum cryptography with sequences of qubits encoded in the same basis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lamoureux, L.-P.; Cerf, N. J.; Bechmann-Pasquinucci, H.

    2006-03-15

    We consider the cloning of sequences of qubits prepared in the states used in the BB84 or six-state quantum cryptography protocol, and show that the single-qubit fidelity is unaffected even if entire sequences of qubits are prepared in the same basis. This result is only valid provided that the sequences are much shorter than the total key. It is of great importance for practical quantum cryptosystems because it reduces the need for high-speed random number generation without impairing on the security against finite-size cloning attacks.

  20. Minimizing the average distance to a closest leaf in a phylogenetic tree.

    PubMed

    Matsen, Frederick A; Gallagher, Aaron; McCoy, Connor O

    2013-11-01

    When performing an analysis on a collection of molecular sequences, it can be convenient to reduce the number of sequences under consideration while maintaining some characteristic of a larger collection of sequences. For example, one may wish to select a subset of high-quality sequences that represent the diversity of a larger collection of sequences. One may also wish to specialize a large database of characterized "reference sequences" to a smaller subset that is as close as possible on average to a collection of "query sequences" of interest. Such a representative subset can be useful whenever one wishes to find a set of reference sequences that is appropriate to use for comparative analysis of environmentally derived sequences, such as for selecting "reference tree" sequences for phylogenetic placement of metagenomic reads. In this article, we formalize these problems in terms of the minimization of the Average Distance to the Closest Leaf (ADCL) and investigate algorithms to perform the relevant minimization. We show that the greedy algorithm is not effective, show that a variant of the Partitioning Around Medoids (PAM) heuristic gets stuck in local minima, and develop an exact dynamic programming approach. Using this exact program we note that the performance of PAM appears to be good for simulated trees, and is faster than the exact algorithm for small trees. On the other hand, the exact program gives solutions for all numbers of leaves less than or equal to the given desired number of leaves, whereas PAM only gives a solution for the prespecified number of leaves. Via application to real data, we show that the ADCL criterion chooses chimeric sequences less often than random subsets, whereas the maximization of phylogenetic diversity chooses them more often than random. These algorithms have been implemented in publicly available software.

  1. CNV-seq, a new method to detect copy number variation using high-throughput sequencing.

    PubMed

    Xie, Chao; Tammi, Martti T

    2009-03-06

    DNA copy number variation (CNV) has been recognized as an important source of genetic variation. Array comparative genomic hybridization (aCGH) is commonly used for CNV detection, but the microarray platform has a number of inherent limitations. Here, we describe a method to detect copy number variation using shotgun sequencing, CNV-seq. The method is based on a robust statistical model that describes the complete analysis procedure and allows the computation of essential confidence values for detection of CNV. Our results show that the number of reads, not the length of the reads is the key factor determining the resolution of detection. This favors the next-generation sequencing methods that rapidly produce large amount of short reads. Simulation of various sequencing methods with coverage between 0.1x to 8x show overall specificity between 91.7 - 99.9%, and sensitivity between 72.2 - 96.5%. We also show the results for assessment of CNV between two individual human genomes.

  2. Uncovering the Ancestry of B Chromosomes in Moenkhausia sanctaefilomenae (Teleostei, Characidae)

    PubMed Central

    Utsunomia, Ricardo; Silva, Duílio Mazzoni Zerbinato de Andrade; Ruiz-Ruano, Francisco J.; Araya-Jaime, Cristian; Pansonato-Alves, José Carlos; Scacchetti, Priscilla Cardim; Hashimoto, Diogo Teruo; Oliveira, Claudio; Trifonov, Vladmir A.; Porto-Foresti, Fábio; Camacho, Juan Pedro M.; Foresti, Fausto

    2016-01-01

    B chromosomes constitute a heterogeneous mixture of genomic parasites that are sometimes derived intraspecifically from the standard genome of the host species, but result from interspecific hybridization in other cases. The mode of origin determines the DNA content, with the B chromosomes showing high similarity with the A genome in the first case, but presenting higher similarity with a different species in the second. The characid fish Moenkhausia sanctaefilomenae harbours highly invasive B chromosomes, which are present in all populations analyzed to date in the Parana and Tietê rivers. To investigate the origin of these B chromosomes, we analyzed two natural populations: one carrying B chromosomes and the other lacking them, using a combination of molecular cytogenetic techniques, nucleotide sequence analysis and high-throughput sequencing (Illumina HiSeq2000). Our results showed that i) B chromosomes have not yet reached the Paranapanema River basin; ii) B chromosomes are mitotically unstable; iii) there are two types of B chromosomes, the most frequent of which is lightly C-banded (similar to euchromatin in A chromosomes) (B1), while the other is darkly C-banded (heterochromatin-like) (B2); iv) the two B types contain the same tandem repeat DNA sequences (18S ribosomal DNA, H3 histone genes, MS3 and MS7 satellite DNA), with a higher content of 18S rDNA in the heterochromatic variant; v) all of these repetitive DNAs are present together only in the paracentromeric region of autosome pair no. 6, suggesting that the B chromosomes are derived from this A chromosome; vi) the two B chromosome variants show MS3 sequences that are highly divergent from each other and from the 0B genome, although the B2-derived sequences exhibit higher similarity with the 0B genome (this suggests an independent origin of the two B variants, with the less frequent, B2 type presumably being younger); and vii) the dN/dS ratio for the H3.2 histone gene is almost 4–6 times higher for B chromosomes than for A chromosome sequences, suggesting that purifying selection is relaxed for the DNA sequences located on the B chromosomes, presumably because they are mostly inactive. PMID:26934481

  3. Gene Discovery through Genomic Sequencing of Brucella abortus

    PubMed Central

    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

    2001-01-01

    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

  4. Advanced colorectal adenoma related gene expression signature may predict prognostic for colorectal cancer patients with adenoma-carcinoma sequence.

    PubMed

    Li, Bing; Shi, Xiao-Yu; Liao, Dai-Xiang; Cao, Bang-Rong; Luo, Cheng-Hua; Cheng, Shu-Jun

    2015-01-01

    There are still no absolute parameters predicting progression of adenoma into cancer. The present study aimed to characterize functional differences on the multistep carcinogenetic process from the adenoma-carcinoma sequence. All samples were collected and mRNA expression profiling was performed by using Agilent Microarray high-throughput gene-chip technology. Then, the characteristics of mRNA expression profiles of adenoma-carcinoma sequence were described with bioinformatics software, and we analyzed the relationship between gene expression profiles of adenoma-adenocarcinoma sequence and clinical prognosis of colorectal cancer. The mRNA expressions of adenoma-carcinoma sequence were significantly different between high-grade intraepithelial neoplasia group and adenocarcinoma group. The biological process of gene ontology function enrichment analysis on differentially expressed genes between high-grade intraepithelial neoplasia group and adenocarcinoma group showed that genes enriched in the extracellular structure organization, skeletal system development, biological adhesion and itself regulated growth regulation, with the P value after FDR correction of less than 0.05. In addition, IPR-related protein mainly focused on the insulin-like growth factor binding proteins. The variable trends of gene expression profiles for adenoma-carcinoma sequence were mainly concentrated in high-grade intraepithelial neoplasia and adenocarcinoma. The differentially expressed genes are significantly correlated between high-grade intraepithelial neoplasia group and adenocarcinoma group. Bioinformatics analysis is an effective way to study the gene expression profiles in the adenoma-carcinoma sequence, and may provide an effective tool to involve colorectal cancer research strategy into colorectal adenoma or advanced adenoma.

  5. Denoising DNA deep sequencing data—high-throughput sequencing errors and their correction

    PubMed Central

    Laehnemann, David; Borkhardt, Arndt

    2016-01-01

    Characterizing the errors generated by common high-throughput sequencing platforms and telling true genetic variation from technical artefacts are two interdependent steps, essential to many analyses such as single nucleotide variant calling, haplotype inference, sequence assembly and evolutionary studies. Both random and systematic errors can show a specific occurrence profile for each of the six prominent sequencing platforms surveyed here: 454 pyrosequencing, Complete Genomics DNA nanoball sequencing, Illumina sequencing by synthesis, Ion Torrent semiconductor sequencing, Pacific Biosciences single-molecule real-time sequencing and Oxford Nanopore sequencing. There is a large variety of programs available for error removal in sequencing read data, which differ in the error models and statistical techniques they use, the features of the data they analyse, the parameters they determine from them and the data structures and algorithms they use. We highlight the assumptions they make and for which data types these hold, providing guidance which tools to consider for benchmarking with regard to the data properties. While no benchmarking results are included here, such specific benchmarks would greatly inform tool choices and future software development. The development of stand-alone error correctors, as well as single nucleotide variant and haplotype callers, could also benefit from using more of the knowledge about error profiles and from (re)combining ideas from the existing approaches presented here. PMID:26026159

  6. Identification and correction of systematic error in high-throughput sequence data

    PubMed Central

    2011-01-01

    Background A feature common to all DNA sequencing technologies is the presence of base-call errors in the sequenced reads. The implications of such errors are application specific, ranging from minor informatics nuisances to major problems affecting biological inferences. Recently developed "next-gen" sequencing technologies have greatly reduced the cost of sequencing, but have been shown to be more error prone than previous technologies. Both position specific (depending on the location in the read) and sequence specific (depending on the sequence in the read) errors have been identified in Illumina and Life Technology sequencing platforms. We describe a new type of systematic error that manifests as statistically unlikely accumulations of errors at specific genome (or transcriptome) locations. Results We characterize and describe systematic errors using overlapping paired reads from high-coverage data. We show that such errors occur in approximately 1 in 1000 base pairs, and that they are highly replicable across experiments. We identify motifs that are frequent at systematic error sites, and describe a classifier that distinguishes heterozygous sites from systematic error. Our classifier is designed to accommodate data from experiments in which the allele frequencies at heterozygous sites are not necessarily 0.5 (such as in the case of RNA-Seq), and can be used with single-end datasets. Conclusions Systematic errors can easily be mistaken for heterozygous sites in individuals, or for SNPs in population analyses. Systematic errors are particularly problematic in low coverage experiments, or in estimates of allele-specific expression from RNA-Seq data. Our characterization of systematic error has allowed us to develop a program, called SysCall, for identifying and correcting such errors. We conclude that correction of systematic errors is important to consider in the design and interpretation of high-throughput sequencing experiments. PMID:22099972

  7. Two Distinct Origins of Long-Term Learning Effects in Verbal Short-Term Memory

    ERIC Educational Resources Information Center

    Majerus, Steve; Perez, Trecy Martinez; Oberauer, Klaus

    2012-01-01

    Verbal short-term memory (STM) is highly sensitive to learning effects: digit sequences or nonword sequences which have been rendered more familiar via repeated exposure are recalled more accurately. In this study we show that sublist-level, incidental learning of item co-occurrence regularities affects immediate serial recall of words and…

  8. Cucumis melo endornavirus: Genome organization, host range and codivergence with the host

    USDA-ARS?s Scientific Manuscript database

    A high molecular weight dsRNA was isolated from a Cucumis melo plant (referred to as“CL01”) of an unknown cultivar and completely sequenced. Sequence analyses showed similarities with members of the Endornaviridae. The name Cucumis melo endornavirus (CmEV) is proposed. The genome of CmEV-CL01 consis...

  9. Complete genome sequence of a potyvirus infecting yam beans (Pachyrhizus spp.) in Peru.

    PubMed

    Fuentes, Segundo; Heider, Bettina; Tasso, Ruby Carolina; Romero, Elisa; Zum Felde, Thomas; Kreuze, Jan Frederik

    2012-04-01

    In 2010, yam beans in a field trial in Peru showed viral disease symptoms. Graft-transmission and positive ELISA results using potyvirus-specific antibodies suggested that the symptoms could be the result of a potyviral infection. Small interfering RNA (siRNA) were extracted from one of the samples and sent for high-throughput sequencing. The full genome of a new potyvirus could be assembled from the resulting siRNA sequences, and it was sufficiently different from other sequences to be considered a member of a new species, which we have designated Yam bean mosaic virus (YBMV). Sequence similarity suggests that YBMV has also been detected in yam beans in Indonesia.

  10. Quantum sequencing: opportunities and challenges

    NASA Astrophysics Data System (ADS)

    di Ventra, Massimiliano

    Personalized or precision medicine refers to the ability of tailoring drugs to the specific genome and transcriptome of each individual. It is however not yet feasible due the high costs and slow speed of present DNA sequencing methods. I will discuss a sequencing protocol that requires the measurement of the distributions of transverse tunneling currents during the translocation of single-stranded DNA into nanochannels. I will show that such a quantum sequencing approach can reach unprecedented speeds, without requiring any chemical preparation, amplification or labeling. I will discuss recent experiments that support these theoretical predictions, the advantages of this approach over other sequencing methods, and stress the challenges that need to be overcome to render it commercially viable.

  11. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    PubMed Central

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

  12. Development and Evaluation of Novel Real-Time Reverse Transcription-PCR Assays with Locked Nucleic Acid Probes Targeting Leader Sequences of Human-Pathogenic Coronaviruses

    PubMed Central

    Chan, Jasper Fuk-Woo; Choi, Garnet Kwan-Yue; Tsang, Alan Ka-Lun; Tee, Kah-Meng; Lam, Ho-Yin; Yip, Cyril Chik-Yan; To, Kelvin Kai-Wang; Cheng, Vincent Chi-Chung; Yeung, Man-Lung; Lau, Susanna Kar-Pui; Woo, Patrick Chiu-Yat; Chan, Kwok-Hung; Tang, Bone Siu-Fai

    2015-01-01

    Based on findings in small RNA-sequencing (Seq) data analysis, we developed highly sensitive and specific real-time reverse transcription (RT)-PCR assays with locked nucleic acid probes targeting the abundantly expressed leader sequences of Middle East respiratory syndrome coronavirus (MERS-CoV) and other human coronaviruses. Analytical and clinical evaluations showed their noninferiority to a commercial multiplex PCR test for the detection of these coronaviruses. PMID:26019210

  13. High-Resolution Radar Waveforms Based on Randomized Latin Square Sequences

    DTIC Science & Technology

    2017-04-18

    familiar Costas sequence [17]. The ambiguity function first introduced by Woodward in [13] is used to evaluate the matched filter output of a Radar waveform...the zero-delay cut that the result takes the shape of a sinc function which shows, even for significant Doppler shifts, the matched filter output...bad feature as the high ridge of the LFM waveform will still result in a large matched filter response from the target, just not at the correct delay

  14. Transcriptome analysis of genes related to resistance against powdery mildew in wheat-Thinopyrum alien addition disomic line germplasm SN6306.

    PubMed

    Li, Quanquan; Niu, Zubiao; Bao, Yinguang; Tian, Qiuju; Wang, Honggang; Kong, Lingrang; Feng, Deshun

    2016-09-15

    Wheat powdery mildew, which is mainly caused by Blumeria graminis f. sp. tritici (Bgt), seriously damages wheat production. The wheat-Thinopyrum intermedium alien addition disomic line germplasm SN6306, being one of the important sources of genes for wheat resistance, is highly resistant to Bgt E09 and to many other powdery mildew physiological races. However, knowledge on the resistance mechanism of SN6306 remains limited. Our study employed high-throughput RNA sequencing based on next-generation sequencing technology (Illumina) to obtain an overview of the transcriptome characteristics of SN6306 and its parent wheat Yannong 15 (YN15) during Bgt infection. The sequencing generated 104,773 unigenes, 9909 of which showed varied expression levels. Among the 9909 unigenes, 1678 unigenes showed 0 reads in YN15. The expression levels in Bgt-inoculated SN6306 and YN15 of exactly 39 unigenes that showed 0 or considerably low reads in YN15 were validated to identify the genes involved in Bgt resistance. Among the 39 unigenes, 12 unigenes were upregulated in SN6306 by 3-45 times. These unigenes mainly encoded kinase, synthase, proteases, and signal transduction proteins, which may play an important role in the resistance against Bgt. To confirm whether the unigenes that showed 0 reads in YN15 are really unique to SN6306, 8 unigenes were cloned and sequenced. Results showed that the selected unigenes are more similar to SN6306 and Th. intermedium than to the wheat cultivar YN15. The sequencing results further confirmed that the unigenes showing 0 reads in YN15 are unique to SN6306 and are most likely derived from Th. intermedium (Host) Nevski. Thus, the genes from Th. intermedium most probably conferred the resistance of SN6306 to Bgt. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. PANGEA: pipeline for analysis of next generation amplicons

    PubMed Central

    Giongo, Adriana; Crabb, David B; Davis-Richardson, Austin G; Chauliac, Diane; Mobberley, Jennifer M; Gano, Kelsey A; Mukherjee, Nabanita; Casella, George; Roesch, Luiz FW; Walts, Brandon; Riva, Alberto; King, Gary; Triplett, Eric W

    2010-01-01

    High-throughput DNA sequencing can identify organisms and describe population structures in many environmental and clinical samples. Current technologies generate millions of reads in a single run, requiring extensive computational strategies to organize, analyze and interpret those sequences. A series of bioinformatics tools for high-throughput sequencing analysis, including preprocessing, clustering, database matching and classification, have been compiled into a pipeline called PANGEA. The PANGEA pipeline was written in Perl and can be run on Mac OSX, Windows or Linux. With PANGEA, sequences obtained directly from the sequencer can be processed quickly to provide the files needed for sequence identification by BLAST and for comparison of microbial communities. Two different sets of bacterial 16S rRNA sequences were used to show the efficiency of this workflow. The first set of 16S rRNA sequences is derived from various soils from Hawaii Volcanoes National Park. The second set is derived from stool samples collected from diabetes-resistant and diabetes-prone rats. The workflow described here allows the investigator to quickly assess libraries of sequences on personal computers with customized databases. PANGEA is provided for users as individual scripts for each step in the process or as a single script where all processes, except the χ2 step, are joined into one program called the ‘backbone’. PMID:20182525

  16. PANGEA: pipeline for analysis of next generation amplicons.

    PubMed

    Giongo, Adriana; Crabb, David B; Davis-Richardson, Austin G; Chauliac, Diane; Mobberley, Jennifer M; Gano, Kelsey A; Mukherjee, Nabanita; Casella, George; Roesch, Luiz F W; Walts, Brandon; Riva, Alberto; King, Gary; Triplett, Eric W

    2010-07-01

    High-throughput DNA sequencing can identify organisms and describe population structures in many environmental and clinical samples. Current technologies generate millions of reads in a single run, requiring extensive computational strategies to organize, analyze and interpret those sequences. A series of bioinformatics tools for high-throughput sequencing analysis, including pre-processing, clustering, database matching and classification, have been compiled into a pipeline called PANGEA. The PANGEA pipeline was written in Perl and can be run on Mac OSX, Windows or Linux. With PANGEA, sequences obtained directly from the sequencer can be processed quickly to provide the files needed for sequence identification by BLAST and for comparison of microbial communities. Two different sets of bacterial 16S rRNA sequences were used to show the efficiency of this workflow. The first set of 16S rRNA sequences is derived from various soils from Hawaii Volcanoes National Park. The second set is derived from stool samples collected from diabetes-resistant and diabetes-prone rats. The workflow described here allows the investigator to quickly assess libraries of sequences on personal computers with customized databases. PANGEA is provided for users as individual scripts for each step in the process or as a single script where all processes, except the chi(2) step, are joined into one program called the 'backbone'.

  17. In vitro selection of high temperature Zn(2+)-dependent DNAzymes.

    PubMed

    Nelson, Kevin E; Bruesehoff, Peter J; Lu, Yi

    2005-08-01

    In vitro selection of Zn(2+)-dependent RNA-cleaving DNAzymes with activity at 90 degrees C has yielded a diverse spool of selected sequences. The RNA cleavage efficiency was found in all cases to be specific for Zn(2+) over Pb(2+), Ca(2+), Cd(2+), Co(2+), Hg(2+), and Mg(2+). The Zn(2+)-dependent activity assay of the most active sequence showed that the DNAzyme possesses an apparent Zn(2+)-binding dissociation constant of 234 muM and that its activity increases with increasing temperatures from 50-90 degrees C. A fit of the Arrhenius plot data gave E(a) = 15.3 kcal mol(-1). Surprisingly, the selected Zn(2+)-dependent DNAzymes showed only a modest (approximately 3-fold) activity enhancement over the background rate of cleavage of random sequences containing a single embedded ribonucleotide within an otherwise DNA oligonucleotide. The result is attributable to the ability of DNA to sustain cleavage activity at high temperature with minimal secondary structure when Zn(2+) is present. Since this effect is highly specific for Zn(2+), this metal ion may play a special role in molecular evolution of nucleic acids at high temperature.

  18. The glycoprotein genes and gene junctions of the fish rhabdoviruses spring viremia of carp virus and hirame rhabdovirus: Analysis of relationships with other rhabdoviruses

    USGS Publications Warehouse

    Bjorklund, H.V.; Higman, K.H.; Kurath, G.

    1996-01-01

    The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2–33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.

  19. The glycoprotein genes and gene junctions of the fish rhabdoviruses spring viremia of carp virus and hirame rhabdovirus: Analysis of relationships with other rhabdoviruses

    USGS Publications Warehouse

    Bjorklund, H.V.; Higman, K.H.; Kurath, G.

    1996-01-01

    The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2-33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.

  20. Self-Exciting Point Process Modeling of Conversation Event Sequences

    NASA Astrophysics Data System (ADS)

    Masuda, Naoki; Takaguchi, Taro; Sato, Nobuo; Yano, Kazuo

    Self-exciting processes of Hawkes type have been used to model various phenomena including earthquakes, neural activities, and views of online videos. Studies of temporal networks have revealed that sequences of social interevent times for individuals are highly bursty. We examine some basic properties of event sequences generated by the Hawkes self-exciting process to show that it generates bursty interevent times for a wide parameter range. Then, we fit the model to the data of conversation sequences recorded in company offices in Japan. In this way, we can estimate relative magnitudes of the self excitement, its temporal decay, and the base event rate independent of the self excitation. These variables highly depend on individuals. We also point out that the Hawkes model has an important limitation that the correlation in the interevent times and the burstiness cannot be independently modulated.

  1. High density bit transition requirements versus the effects on BCH error correcting code. [bit synchronization

    NASA Technical Reports Server (NTRS)

    Ingels, F. M.; Schoggen, W. O.

    1982-01-01

    The design to achieve the required bit transition density for the Space Shuttle high rate multiplexes (HRM) data stream of the Space Laboratory Vehicle is reviewed. It contained a recommended circuit approach, specified the pseudo random (PN) sequence to be used and detailed the properties of the sequence. Calculations showing the probability of failing to meet the required transition density were included. A computer simulation of the data stream and PN cover sequence was provided. All worst case situations were simulated and the bit transition density exceeded that required. The Preliminary Design Review and the critical Design Review are documented. The Cover Sequence Generator (CSG) Encoder/Decoder design was constructed and demonstrated. The demonstrations were successful. All HRM and HRDM units incorporate the CSG encoder or CSG decoder as appropriate.

  2. Assembly and diploid architecture of an individual human genome via single-molecule technologies

    PubMed Central

    Pendleton, Matthew; Sebra, Robert; Pang, Andy Wing Chun; Ummat, Ajay; Franzen, Oscar; Rausch, Tobias; Stütz, Adrian M; Stedman, William; Anantharaman, Thomas; Hastie, Alex; Dai, Heng; Fritz, Markus Hsi-Yang; Cao, Han; Cohain, Ariella; Deikus, Gintaras; Durrett, Russell E; Blanchard, Scott C; Altman, Roger; Chin, Chen-Shan; Guo, Yan; Paxinos, Ellen E; Korbel, Jan O; Darnell, Robert B; McCombie, W Richard; Kwok, Pui-Yan; Mason, Christopher E; Schadt, Eric E; Bashir, Ali

    2015-01-01

    We present the first comprehensive analysis of a diploid human genome that combines single-molecule sequencing with single-molecule genome maps. Our hybrid assembly markedly improves upon the contiguity observed from traditional shotgun sequencing approaches, with scaffold N50 values approaching 30 Mb, and we identified complex structural variants (SVs) missed by other high-throughput approaches. Furthermore, by combining Illumina short-read data with long reads, we phased both single-nucleotide variants and SVs, generating haplotypes with over 99% consistency with previous trio-based studies. Our work shows that it is now possible to integrate single-molecule and high-throughput sequence data to generate de novo assembled genomes that approach reference quality. PMID:26121404

  3. Assembly and diploid architecture of an individual human genome via single-molecule technologies.

    PubMed

    Pendleton, Matthew; Sebra, Robert; Pang, Andy Wing Chun; Ummat, Ajay; Franzen, Oscar; Rausch, Tobias; Stütz, Adrian M; Stedman, William; Anantharaman, Thomas; Hastie, Alex; Dai, Heng; Fritz, Markus Hsi-Yang; Cao, Han; Cohain, Ariella; Deikus, Gintaras; Durrett, Russell E; Blanchard, Scott C; Altman, Roger; Chin, Chen-Shan; Guo, Yan; Paxinos, Ellen E; Korbel, Jan O; Darnell, Robert B; McCombie, W Richard; Kwok, Pui-Yan; Mason, Christopher E; Schadt, Eric E; Bashir, Ali

    2015-08-01

    We present the first comprehensive analysis of a diploid human genome that combines single-molecule sequencing with single-molecule genome maps. Our hybrid assembly markedly improves upon the contiguity observed from traditional shotgun sequencing approaches, with scaffold N50 values approaching 30 Mb, and we identified complex structural variants (SVs) missed by other high-throughput approaches. Furthermore, by combining Illumina short-read data with long reads, we phased both single-nucleotide variants and SVs, generating haplotypes with over 99% consistency with previous trio-based studies. Our work shows that it is now possible to integrate single-molecule and high-throughput sequence data to generate de novo assembled genomes that approach reference quality.

  4. Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification

    PubMed Central

    Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu

    2018-01-01

    Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844

  5. Evidence for Widespread Reticulate Evolution within Human Duplicons

    PubMed Central

    Jackson, Michael S. ; Oliver, Karen ; Loveland, Jane ; Humphray, Sean ; Dunham, Ian ; Rocchi, Mariano ; Viggiano, Luigi ; Park, Jonathan P. ; Hurles, Matthew E. ; Santibanez-Koref, Mauro 

    2005-01-01

    Approximately 5% of the human genome consists of segmental duplications that can cause genomic mutations and may play a role in gene innovation. Reticulate evolutionary processes, such as unequal crossing-over and gene conversion, are known to occur within specific duplicon families, but the broader contribution of these processes to the evolution of human duplications remains poorly characterized. Here, we use phylogenetic profiling to analyze multiple alignments of 24 human duplicon families that span >8 Mb of DNA. Our results indicate that none of them are evolving independently, with all alignments showing sharp discontinuities in phylogenetic signal consistent with reticulation. To analyze these results in more detail, we have developed a quartet method that estimates the relative contribution of nucleotide substitution and reticulate processes to sequence evolution. Our data indicate that most of the duplications show a highly significant excess of sites consistent with reticulate evolution, compared with the number expected by nucleotide substitution alone, with 15 of 30 alignments showing a >20-fold excess over that expected. Using permutation tests, we also show that at least 5% of the total sequence shares 100% sequence identity because of reticulation, a figure that includes 74 independent tracts of perfect identity >2 kb in length. Furthermore, analysis of a subset of alignments indicates that the density of reticulation events is as high as 1 every 4 kb. These results indicate that phylogenetic relationships within recently duplicated human DNA can be rapidly disrupted by reticulate evolution. This finding has important implications for efforts to finish the human genome sequence, complicates comparative sequence analysis of duplicon families, and could profoundly influence the tempo of gene-family evolution. PMID:16252241

  6. Single sea urchin phagocytes express messages of a single sequence from the diverse Sp185/333 gene family in response to bacterial challenge.

    PubMed

    Majeske, Audrey J; Oren, Matan; Sacchi, Sandro; Smith, L Courtney

    2014-12-01

    Immune systems in animals rely on fast and efficient responses to a wide variety of pathogens. The Sp185/333 gene family in the purple sea urchin, Strongylocentrotus purpuratus, consists of an estimated 50 (±10) members per genome that share a basic gene structure but show high sequence diversity, primarily due to the mosaic appearance of short blocks of sequence called elements. The genes show significantly elevated expression in three subpopulations of phagocytes responding to marine bacteria. The encoded Sp185/333 proteins are highly diverse and have central effector functions in the immune system. In this study we report the Sp185/333 gene expression in single sea urchin phagocytes. Sea urchins challenged with heat-killed marine bacteria resulted in a typical increase in coelomocyte concentration within 24 h, which included an increased proportion of phagocytes expressing Sp185/333 proteins. Phagocyte fractions enriched from coelomocytes were used in limiting dilutions to obtain samples of single cells that were evaluated for Sp185/333 gene expression by nested RT-PCR. Amplicon sequences showed identical or nearly identical Sp185/333 amplicon sequences in single phagocytes with matches to six known Sp185/333 element patterns, including both common and rare element patterns. This suggested that single phagocytes show restricted expression from the Sp185/333 gene family and infers a diverse, flexible, and efficient response to pathogens. This type of expression pattern from a family of immune response genes in single cells has not been identified previously in other invertebrates. Copyright © 2014 by The American Association of Immunologists, Inc.

  7. Molecular characterization of Taenia multiceps isolates from Gansu Province, China by sequencing of mitochondrial cytochrome C oxidase subunit 1.

    PubMed

    Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan

    2013-04-01

    A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.

  8. Molecular Characterization of Taenia multiceps Isolates from Gansu Province, China by Sequencing of Mitochondrial Cytochrome C Oxidase Subunit 1

    PubMed Central

    Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu

    2013-01-01

    A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species. PMID:23710087

  9. Digit-color synaesthesia only enhances memory for colors in a specific context: A new method of duration thresholds to measure serial recall.

    PubMed

    Teichmann, A Lina; Nieuwenstein, Mark R; Rich, Anina N

    2017-08-01

    For digit-color synaesthetes, digits elicit vivid experiences of color that are highly consistent for each individual. The conscious experience of synaesthesia is typically unidirectional: Digits evoke colors but not vice versa. There is an ongoing debate about whether synaesthetes have a memory advantage over non-synaesthetes. One key question in this debate is whether synaesthetes have a general superiority or whether any benefit is specific to a certain type of material. Here, we focus on immediate serial recall and ask digit-color synaesthetes and controls to memorize digit and color sequences. We developed a sensitive staircase method manipulating presentation duration to measure participants' serial recall of both overlearned and novel sequences. Our results show that synaesthetes can activate digit information to enhance serial memory for color sequences. When color sequences corresponded to ascending or descending digit sequences, synaesthetes encoded these sequences at a faster rate than their non-synaesthetes counterparts and faster than non-structured color sequences. However, encoding color sequences is approximately 200 ms slower than encoding digit sequences directly, independent of group and condition, which shows that the translation process is time consuming. These results suggest memory advantages in synaesthesia require a modified dual-coding account, in which secondary (synaesthetically linked) information is useful only if it is more memorable than the primary information to be recalled. Our study further shows that duration thresholds are a sensitive method to measure subtle differences in serial recall performance. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  10. Genome variability of foot-and-mouth disease virus during the short period of the 2010 epidemic in Japan.

    PubMed

    Nishi, Tatsuya; Yamada, Manabu; Fukai, Katsuhiko; Shimada, Nobuaki; Morioka, Kazuki; Yoshida, Kazuo; Sakamoto, Kenichi; Kanno, Toru; Yamakawa, Makoto

    2017-02-01

    Foot-and-mouth disease virus (FMDV) is highly contagious and has a high mutation rate, leading to extensive genetic variation. To investigate how FMDV genetically evolves over a short period of an epidemic after initial introduction into an FMD-free area, whole L-fragment sequences of 104 FMDVs isolated from the 2010 epidemic in Japan, which continued for less than three months were determined and phylogenetically and comparatively analyzed. Phylogenetic analysis of whole L-fragment sequences showed that these isolates were classified into a single group, indicating that FMDV was introduced into Japan in the epidemic via a single introduction. Nucleotide sequences of 104 virus isolates showed more than 99.56% pairwise identity rates without any genetic deletion or insertion, although no sequences were completely identical with each other. These results indicate that genetic substitutions of FMDV occurred gradually and constantly during the epidemic and generation of an extensive mutant virus could have been prevented by rapid eradication strategy. From comparative analysis of variability of each FMDV protein coding region, VP4 and 2C regions showed the highest average identity rates and invariant rates, and were confirmed as highly conserved. In contrast, the protein coding regions VP2 and VP1 were confirmed to be highly variable regions with the lowest average identity rates and invariant rates, respectively. Our data demonstrate the importance of rapid eradication strategy in an FMD epidemic and provide valuable information on the genome variability of FMDV during the short period of an epidemic. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Mitochondrial sequences of Seriatopora corals show little agreement with morphology and reveal the duplication of a tRNA gene near the control region

    NASA Astrophysics Data System (ADS)

    Flot, J.-F.; Licuanan, W. Y.; Nakano, Y.; Payri, C.; Cruaud, C.; Tillier, S.

    2008-12-01

    The taxonomy of corals of the genus Seriatopora has not previously been studied using molecular sequence markers. As a first step toward a re-evaluation of species boundaries in this genus, mitochondrial sequence variability was analyzed in 51 samples collected from Okinawa, New Caledonia, and the Philippines. Four clusters of sequences were detected that showed little concordance with species currently recognized on a morphological basis. The most likely explanation is that the skeletal characters used for species identification are highly variable (polymorphic or phenotypically plastic); alternative explanations include introgression/hybridization, or deep coalescence and the retention of ancestral mitochondrial polymorphisms. In all individuals sequenced, two copies of trnW were found on either side of the atp8 gene near the putative D-loop, a novel mitochondrial gene arrangement that may have arisen from a duplication of the trnW-atp8 region followed by a deletion of one atp8.

  12. Structural study of Bombyx mori silk fibroin during processing for regeneration

    NASA Astrophysics Data System (ADS)

    Ha, Sung-Won

    Bombyx mori silk fibroin has excellent mechanical properties combined with flexibility, tissue compatibility, and high oxygen permeability in the wet condition. This important material should be dissolved and regenerated to be utilized as useful forms such as gel, film, fiber, powder, or non-woven. However, it has long been a problem that the regenerated fibroin materials show poor mechanical properties and brittleness. These problems were technically solved by improving a fiber processing method reported here. The regenerated fibroin fibers showed much better mechanical properties compared to the original silk fibers. This improved technique for the fiber processing of Bombyx mori silk fibroin may be used as a model system for other semi-crystalline fiber forming proteins, becoming available through biotechnology. The physical and chemical properties of the regenerated fibers were characterized by SinTechRTM tensile testing, X-ray diffraction, solid state 13C NMR spectroscopy, and SEM. Unlike synthetic polymers, the molecular weight distribution of Bombyx mori silk fibroin is mono-disperse because silk fibroin is synthesized from DNA template. Genetic studies have revealed the entire amino acid sequence of Bombyx mori silk fibroin. It is known that the crystalline silk II structure is composed of hexa-amino acid sequences, GAGAGS. However, in the amino acid sequence of Bombyx mori silk fibroin heavy chain, there are present 11 chemically irregular but evolutionarily conserved sequences with about 31 amino acid residues (irregular GT˜GT sequences). The structure and role of these irregular sequences have remained unknown. One of the most frequently appearing irregular sequences was synthesized by a peptide synthesizer. The three-dimensional structure of this irregular silk peptide was studied by the high resolution two-dimensional NMR technique. The three-dimensional structure of this peptide shows that it makes a turn or loop structure (distorted O shape), which means the proceeding backbone direction is changed 180° by this sequence. This may facilitate the beta-sheet formation of the crystal forming building blocks, GAGAGS/GY˜GY sequences, in fibroin heavy chain. It may also facilitate the solubilization of the fibroin heavy chain within the silk gland.

  13. Comparative molecular cytogenetics of major repetitive sequence families of three Dendrobium species (Orchidaceae) from Bangladesh

    PubMed Central

    Begum, Rabeya; Alam, Sheikh Shamimul; Menzel, Gerhard; Schmidt, Thomas

    2009-01-01

    Background and Aims Dendrobium species show tremendous morphological diversity and have broad geographical distribution. As repetitive sequence analysis is a useful tool to investigate the evolution of chromosomes and genomes, the aim of the present study was the characterization of repetitive sequences from Dendrobium moschatum for comparative molecular and cytogenetic studies in the related species Dendrobium aphyllum, Dendrobium aggregatum and representatives from other orchid genera. Methods In order to isolate highly repetitive sequences, a c0t-1 DNA plasmid library was established. Repeats were sequenced and used as probes for Southern hybridization. Sequence divergence was analysed using bioinformatic tools. Repetitive sequences were localized along orchid chromosomes by fluorescence in situ hybridization (FISH). Key Results Characterization of the c0t-1 library resulted in the detection of repetitive sequences including the (GA)n dinucleotide DmoO11, numerous Arabidopsis-like telomeric repeats and the highly amplified dispersed repeat DmoF14. The DmoF14 repeat is conserved in six Dendrobium species but diversified in representative species of three other orchid genera. FISH analyses showed the genome-wide distribution of DmoF14 in D. moschatum, D. aphyllum and D. aggregatum. Hybridization with the telomeric repeats demonstrated Arabidopsis-like telomeres at the chromosome ends of Dendrobium species. However, FISH using the telomeric probe revealed two pairs of chromosomes with strong intercalary signals in D. aphyllum. FISH showed the terminal position of 5S and 18S–5·8S–25S rRNA genes and a characteristic number of rDNA sites in the three Dendrobium species. Conclusions The repeated sequences isolated from D. moschatum c0t-1 DNA constitute major DNA families of the D. moschatum, D. aphyllum and D. aggregatum genomes with DmoF14 representing an ancient component of orchid genomes. Large intercalary telomere-like arrays suggest chromosomal rearrangements in D. aphyllum while the number and localization of rRNA genes as well as the species-specific distribution pattern of an abundant microsatellite reflect the genomic diversity of the three Dendrobium species. PMID:19635741

  14. High-throughput sequencing of complete human mtDNA genomes from the Caucasus and West Asia: high diversity and demographic inferences.

    PubMed

    Schönberg, Anna; Theunert, Christoph; Li, Mingkun; Stoneking, Mark; Nasidze, Ivan

    2011-09-01

    To investigate the demographic history of human populations from the Caucasus and surrounding regions, we used high-throughput sequencing to generate 147 complete mtDNA genome sequences from random samples of individuals from three groups from the Caucasus (Armenians, Azeri and Georgians), and one group each from Iran and Turkey. Overall diversity is very high, with 144 different sequences that fall into 97 different haplogroups found among the 147 individuals. Bayesian skyline plots (BSPs) of population size change through time show a population expansion around 40-50 kya, followed by a constant population size, and then another expansion around 15-18 kya for the groups from the Caucasus and Iran. The BSP for Turkey differs the most from the others, with an increase from 35 to 50 kya followed by a prolonged period of constant population size, and no indication of a second period of growth. An approximate Bayesian computation approach was used to estimate divergence times between each pair of populations; the oldest divergence times were between Turkey and the other four groups from the South Caucasus and Iran (~400-600 generations), while the divergence time of the three Caucasus groups from each other was comparable to their divergence time from Iran (average of ~360 generations). These results illustrate the value of random sampling of complete mtDNA genome sequences that can be obtained with high-throughput sequencing platforms.

  15. Selectivity by host plants affects the distribution of arbuscular mycorrhizal fungi: evidence from ITS rDNA sequence metadata.

    PubMed

    Yang, Haishui; Zang, Yanyan; Yuan, Yongge; Tang, Jianjun; Chen, Xin

    2012-04-12

    Arbuscular mycorrhizal fungi (AMF) can form obligate symbioses with the vast majority of land plants, and AMF distribution patterns have received increasing attention from researchers. At the local scale, the distribution of AMF is well documented. Studies at large scales, however, are limited because intensive sampling is difficult. Here, we used ITS rDNA sequence metadata obtained from public databases to study the distribution of AMF at continental and global scales. We also used these sequence metadata to investigate whether host plant is the main factor that affects the distribution of AMF at large scales. We defined 305 ITS virtual taxa (ITS-VTs) among all sequences of the Glomeromycota by using a comprehensive maximum likelihood phylogenetic analysis. Each host taxonomic order averaged about 53% specific ITS-VTs, and approximately 60% of the ITS-VTs were host specific. Those ITS-VTs with wide host range showed wide geographic distribution. Most ITS-VTs occurred in only one type of host functional group. The distributions of most ITS-VTs were limited across ecosystem, across continent, across biogeographical realm, and across climatic zone. Non-metric multidimensional scaling analysis (NMDS) showed that AMF community composition differed among functional groups of hosts, and among ecosystem, continent, biogeographical realm, and climatic zone. The Mantel test showed that AMF community composition was significantly correlated with plant community composition among ecosystem, among continent, among biogeographical realm, and among climatic zone. The structural equation modeling (SEM) showed that the effects of ecosystem, continent, biogeographical realm, and climatic zone were mainly indirect on AMF distribution, but plant had strongly direct effects on AMF. The distribution of AMF as indicated by ITS rDNA sequences showed a pattern of high endemism at large scales. This pattern indicates high specificity of AMF for host at different scales (plant taxonomic order and functional group) and high selectivity from host plants for AMF. The effects of ecosystemic, biogeographical, continental and climatic factors on AMF distribution might be mediated by host plants.

  16. Relation between native ensembles and experimental structures of proteins

    PubMed Central

    Best, Robert B.; Lindorff-Larsen, Kresten; DePristo, Mark A.; Vendruscolo, Michele

    2006-01-01

    Different experimental structures of the same protein or of proteins with high sequence similarity contain many small variations. Here we construct ensembles of “high-sequence similarity Protein Data Bank” (HSP) structures and consider the extent to which such ensembles represent the structural heterogeneity of the native state in solution. We find that different NMR measurements probing structure and dynamics of given proteins in solution, including order parameters, scalar couplings, and residual dipolar couplings, are remarkably well reproduced by their respective high-sequence similarity Protein Data Bank ensembles; moreover, we show that the effects of uncertainties in structure determination are insufficient to explain the results. These results highlight the importance of accounting for native-state protein dynamics in making comparisons with ensemble-averaged experimental data and suggest that even a modest number of structures of a protein determined under different conditions, or with small variations in sequence, capture a representative subset of the true native-state ensemble. PMID:16829580

  17. Cloning and molecular characterization of the betaine aldehyde dehydrogenase involved in the biosynthesis of glycine betaine in white shrimp (Litopenaeus vannamei).

    PubMed

    Delgado-Gaytán, María F; Rosas-Rodríguez, Jesús A; Yepiz-Plascencia, Gloria; Figueroa-Soto, Ciria G; Valenzuela-Soto, Elisa M

    2017-10-01

    The enzyme betaine aldehyde dehydrogenase (BADH) catalyzes the irreversible oxidation of betaine aldehyde to glycine betaine (GB), a very efficient osmolyte accumulated during osmotic stress. In this study, we determined the nucleotide sequence of the cDNA for the BADH from the white shrimp Litopenaeus vannamei (LvBADH). The cDNA was 1882 bp long, with a complete open reading frame of 1524 bp, encoding 507 amino acids with a predicted molecular mass of 54.15 kDa and a pI of 5.4. The predicted LvBADH amino acid sequence shares a high degree of identity with marine invertebrate BADHs. Catalytic residues (C-298, E-264 and N-167) and the decapeptide VTLELGGKSP involved in nucleotide binding and highly conserved in BADHs were identified in the amino acid sequence. Phylogenetic analyses classified LvBADH in a clade that includes ALDH9 sequences from marine invertebrates. Molecular modeling of LvBADH revealed that the protein has amino acid residues and sequence motifs essential for the function of the ALDH9 family of enzymes. LvBADH modeling showed three potential monovalent cation binding sites, one site is located in an intra-subunit cavity; other in an inter-subunit cavity and a third in a central-cavity of the protein. The results show that LvBADH shares a high degree of identity with BADH sequences from marine invertebrates and enzymes that belong to the ALDH9 family. Our findings suggest that the LvBADH has molecular mechanisms of regulation similar to those of other BADHs belonging to the ALDH9 family, and that BADH might be playing a role in the osmoregulation capacity of L. vannamei. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Assembly of highly repetitive genomes using short reads: the genome of discrete typing unit III Trypanosoma cruzi strain 231.

    PubMed

    Baptista, Rodrigo P; Reis-Cunha, Joao Luis; DeBarry, Jeremy D; Chiari, Egler; Kissinger, Jessica C; Bartholomeu, Daniella C; Macedo, Andrea M

    2018-02-14

    Next-generation sequencing (NGS) methods are low-cost high-throughput technologies that produce thousands to millions of sequence reads. Despite the high number of raw sequence reads, their short length, relative to Sanger, PacBio or Nanopore reads, complicates the assembly of genomic repeats. Many genome tools are available, but the assembly of highly repetitive genome sequences using only NGS short reads remains challenging. Genome assembly of organisms responsible for important neglected diseases such as Trypanosoma cruzi, the aetiological agent of Chagas disease, is known to be challenging because of their repetitive nature. Only three of six recognized discrete typing units (DTUs) of the parasite have their draft genomes published and therefore genome evolution analyses in the taxon are limited. In this study, we developed a computational workflow to assemble highly repetitive genomes via a combination of de novo and reference-based assembly strategies to better overcome the intrinsic limitations of each, based on Illumina reads. The highly repetitive genome of the human-infecting parasite T. cruzi 231 strain was used as a test subject. The combined-assembly approach shown in this study benefits from the reference-based assembly ability to resolve highly repetitive sequences and from the de novo capacity to assemble genome-specific regions, improving the quality of the assembly. The acceptable confidence obtained by analyzing our results showed that our combined approach is an attractive option to assemble highly repetitive genomes with NGS short reads. Phylogenomic analysis including the 231 strain, the first representative of DTU III whose genome was sequenced, was also performed and provides new insights into T. cruzi genome evolution.

  19. Synchronized tapping facilitates learning sound sequences as indexed by the P300.

    PubMed

    Kamiyama, Keiko S; Okanoya, Kazuo

    2014-01-01

    The purpose of the present study was to determine whether and how single finger tapping in synchrony with sound sequences contributed to the auditory processing of them. The participants learned two unfamiliar sound sequences via different methods. In the tapping condition, they learned an auditory sequence while they tapped in synchrony with each sound onset. In the no tapping condition, they learned another sequence while they kept pressing a key until the sequence ended. After these learning sessions, we presented the two melodies again and recorded event-related potentials (ERPs). During the ERP recordings, 10% of the tones within each melody deviated from the original tones. An analysis of the grand average ERPs showed that deviant stimuli elicited a significant P300 in the tapping but not in the no-tapping condition. In addition, the significance of the P300 effect in the tapping condition increased as the participants showed highly synchronized tapping behavior during the learning sessions. These results indicated that single finger tapping promoted the conscious detection and evaluation of deviants within the learned sequences. The effect was related to individuals' musical ability to coordinate their finger movements along with external auditory events.

  20. Synchronized tapping facilitates learning sound sequences as indexed by the P300

    PubMed Central

    Kamiyama, Keiko S.; Okanoya, Kazuo

    2014-01-01

    The purpose of the present study was to determine whether and how single finger tapping in synchrony with sound sequences contributed to the auditory processing of them. The participants learned two unfamiliar sound sequences via different methods. In the tapping condition, they learned an auditory sequence while they tapped in synchrony with each sound onset. In the no tapping condition, they learned another sequence while they kept pressing a key until the sequence ended. After these learning sessions, we presented the two melodies again and recorded event-related potentials (ERPs). During the ERP recordings, 10% of the tones within each melody deviated from the original tones. An analysis of the grand average ERPs showed that deviant stimuli elicited a significant P300 in the tapping but not in the no-tapping condition. In addition, the significance of the P300 effect in the tapping condition increased as the participants showed highly synchronized tapping behavior during the learning sessions. These results indicated that single finger tapping promoted the conscious detection and evaluation of deviants within the learned sequences. The effect was related to individuals’ musical ability to coordinate their finger movements along with external auditory events. PMID:25400564

  1. Length-independent structural similarities enrich the antibody CDR canonical class model.

    PubMed

    Nowak, Jaroslaw; Baker, Terry; Georges, Guy; Kelm, Sebastian; Klostermann, Stefan; Shi, Jiye; Sridharan, Sudharsan; Deane, Charlotte M

    2016-01-01

    Complementarity-determining regions (CDRs) are antibody loops that make up the antigen binding site. Here, we show that all CDR types have structurally similar loops of different lengths. Based on these findings, we created length-independent canonical classes for the non-H3 CDRs. Our length variable structural clusters show strong sequence patterns suggesting either that they evolved from the same original structure or result from some form of convergence. We find that our length-independent method not only clusters a larger number of CDRs, but also predicts canonical class from sequence better than the standard length-dependent approach. To demonstrate the usefulness of our findings, we predicted cluster membership of CDR-L3 sequences from 3 next-generation sequencing datasets of the antibody repertoire (over 1,000,000 sequences). Using the length-independent clusters, we can structurally classify an additional 135,000 sequences, which represents a ∼20% improvement over the standard approach. This suggests that our length-independent canonical classes might be a highly prevalent feature of antibody space, and could substantially improve our ability to accurately predict the structure of novel CDRs identified by next-generation sequencing.

  2. Community-led comparative genomic and phenotypic analysis of the aquaculture pathogen Pseudomonas baetica a390T sequenced by Ion semiconductor and Nanopore technologies

    PubMed Central

    Beaton, Ainsley; Lood, Cédric; Cunningham-Oakes, Edward; MacFadyen, Alison; Mullins, Alex J; Bestawy, Walid El; Botelho, João; Chevalier, Sylvie; Dalzell, Chloe; Dolan, Stephen K; Faccenda, Alberto; Ghequire, Maarten G K; Higgins, Steven; Kutschera, Alexander; Murray, Jordan; Redway, Martha; Salih, Talal; Smith, Brian A; Smits, Nathan; Thomson, Ryan; Woodcock, Stuart; Cornelis, Pierre; Lavigne, Rob; van Noort, Vera

    2018-01-01

    Abstract Pseudomonas baetica strain a390T is the type strain of this recently described species and here we present its high-contiguity draft genome. To celebrate the 16th International Conference on Pseudomonas, the genome of P. baetica strain a390T was sequenced using a unique combination of Ion Torrent semiconductor and Oxford Nanopore methods as part of a collaborative community-led project. The use of high-quality Ion Torrent sequences with long Nanopore reads gave rapid, high-contiguity and -quality, 16-contig genome sequence. Whole genome phylogenetic analysis places P. baetica within the P. koreensis clade of the P. fluorescens group. Comparison of the main genomic features of P. baetica with a variety of other Pseudomonas spp. suggests that it is a highly adaptable organism, typical of the genus. This strain was originally isolated from the liver of a diseased wedge sole fish, and genotypic and phenotypic analyses show that it is tolerant to osmotic stress and to oxytetracycline. PMID:29579234

  3. Effect of Next-Generation Exome Sequencing Depth for Discovery of Diagnostic Variants.

    PubMed

    Kim, Kyung; Seong, Moon-Woo; Chung, Won-Hyong; Park, Sung Sup; Leem, Sangseob; Park, Won; Kim, Jihyun; Lee, KiYoung; Park, Rae Woong; Kim, Namshin

    2015-06-01

    Sequencing depth, which is directly related to the cost and time required for the generation, processing, and maintenance of next-generation sequencing data, is an important factor in the practical utilization of such data in clinical fields. Unfortunately, identifying an exome sequencing depth adequate for clinical use is a challenge that has not been addressed extensively. Here, we investigate the effect of exome sequencing depth on the discovery of sequence variants for clinical use. Toward this, we sequenced ten germ-line blood samples from breast cancer patients on the Illumina platform GAII(x) at a high depth of ~200×. We observed that most function-related diverse variants in the human exonic regions could be detected at a sequencing depth of 120×. Furthermore, investigation using a diagnostic gene set showed that the number of clinical variants identified using exome sequencing reached a plateau at an average sequencing depth of about 120×. Moreover, the phenomena were consistent across the breast cancer samples.

  4. Abamectin, pymetrozine and azadirachtin sequence as a unique solution to control the leafminer Liriomyza trifolii (Burgess) (Diptera: Agromyzidae) infesting garden beans (Phaseolus vulgaris L.) in Egypt.

    PubMed

    Saad, A S A; Massoud, M A; Abdel-Megeed, A A M; Hamid, N A; Mourad, A K K; Barakat, A S T

    2007-01-01

    Field trails were conducted to determine the performance of three different sequences as a unique solution for the control of the leaf miner Liriomyza trifolii (Burgess) (Diptera: Agromyzidae) infesting garden beans (Phaseolus vulgaris L.) during the two successive seasons of 2004 and 2005. Furthermore, during the evaluation period, the side effect against the ectoparasite Diglyphus isaea (Walker) (Hymenoptera: Eulophidae) was put into consideration. Meanwhile, the comparative evaluation of the pesticides alone showed that abamectin and azadirachtin were highly effective against Liriomyza trifolii, while carbosulfan, pymetrozine and thiamethoxam provided to be of a moderate effect. Moreover, carbosulfan showed harmful effect to the larvae of the ectoparasite Diglyphus isaea (Walker), while abamectin and azadirachtin gave a moderate effect. Thiamethoxam and the the detergent (Masrol 410) had slight effect in this respect. The highly effective sequence among the sequences was abamectin, pymetrozine and azadirachtin, against Liriomyza trifolii (Burgess), with slight harmful effect on Diglyphus isaea (Walker). However the sequence of azadirachtin, pymetrozine and abamectin had a moderate effect on Liriomyza trifolii (Burgess) and exhibited a slight toxic effect on Diglyphus isaea (Walker). In contrast, the sequence of carbosulfan, thiamethoxam and pymetrozine was the least effective and represented a slight effect on Diglyphus isaea (Walker). From this study, it was concluded that abamectin, pymetrozine and azadirachtin sequence has proved to be a unique solution for the control of the leaf miner Liriomyza trifolii (Burgess) infesting garden beans (Phaseolus vulgaris L.) in Egypt.

  5. Guiding plant virus particles to integrin-displaying cells

    NASA Astrophysics Data System (ADS)

    Hovlid, Marisa L.; Steinmetz, Nicole F.; Laufer, Burkhardt; Lau, Jolene L.; Kuzelka, Jane; Wang, Qian; Hyypiä, Timo; Nemerow, Glen R.; Kessler, Horst; Manchester, Marianne; Finn, M. G.

    2012-05-01

    Viral nanoparticles (VNPs) are structurally regular, highly stable, tunable nanomaterials that can be conveniently produced in high yields. Unmodified VNPs from plants and bacteria generally do not show tissue specificity or high selectivity in binding to or entry into mammalian cells. They are, however, malleable by both genetic and chemical means, making them useful scaffolds for the display of large numbers of cell- and tissue-targeting ligands, imaging moieties, and/or therapeutic agents in a well-defined manner. Capitalizing on this attribute, we modified the genetic sequence of the Cowpea mosaic virus (CPMV) coat protein to display an RGD oligopeptide sequence derived from human adenovirus type 2 (HAdV-2). Concurrently, wild-type CPMV was modified via NHS acylation and Cu(i)-catalyzed azide-alkyne cycloaddition (CuAAC) chemistry to attach an integrin-binding cyclic RGD peptide. Both types of particles showed strong and selective affinity for several different cancer cell lines that express RGD-binding integrin receptors.Viral nanoparticles (VNPs) are structurally regular, highly stable, tunable nanomaterials that can be conveniently produced in high yields. Unmodified VNPs from plants and bacteria generally do not show tissue specificity or high selectivity in binding to or entry into mammalian cells. They are, however, malleable by both genetic and chemical means, making them useful scaffolds for the display of large numbers of cell- and tissue-targeting ligands, imaging moieties, and/or therapeutic agents in a well-defined manner. Capitalizing on this attribute, we modified the genetic sequence of the Cowpea mosaic virus (CPMV) coat protein to display an RGD oligopeptide sequence derived from human adenovirus type 2 (HAdV-2). Concurrently, wild-type CPMV was modified via NHS acylation and Cu(i)-catalyzed azide-alkyne cycloaddition (CuAAC) chemistry to attach an integrin-binding cyclic RGD peptide. Both types of particles showed strong and selective affinity for several different cancer cell lines that express RGD-binding integrin receptors. Electronic supplementary information (ESI) available: Synthetic procedures and compound characterization data; assay procedures; additional confocal micrographs at different time points. See DOI: 10.1039/c2nr30571b

  6. Molecular cloning and characterization of a novel RING zinc-finger protein gene up-regulated under in vitro salt stress in cassava.

    PubMed

    dos Reis, Sávio Pinho; Tavares, Liliane de Souza Conceição; Costa, Carinne de Nazaré Monteiro; Brígida, Aílton Borges Santa; de Souza, Cláudia Regina Batista

    2012-06-01

    Cassava (Manihot esculenta Crantz) is one of the world's most important food crops. It is cultivated mainly in developing countries of tropics, since its root is a major source of calories for low-income people due to its high productivity and resistance to many abiotic and biotic factors. A previous study has identified a partial cDNA sequence coding for a putative RING zinc finger in cassava storage root. The RING zinc finger protein is a specialized type of zinc finger protein found in many organisms. Here, we isolated the full-length cDNA sequence coding for M. esculenta RZF (MeRZF) protein by a combination of 5' and 3' RACE assays. BLAST analysis showed that its deduced amino acid sequence has a high level of similarity to plant proteins of RZF family. MeRZF protein contains a signature sequence motif for a RING zinc finger at its C-terminal region. In addition, this protein showed a histidine residue at the fifth coordination site, likely belonging to the RING-H2 subgroup, as confirmed by our phylogenetic analysis. There is also a transmembrane domain in its N-terminal region. Finally, semi-quantitative RT-PCR assays showed that MeRZF expression is increased in detached leaves treated with sodium chloride. Here, we report the first evidence of a RING zinc finger gene of cassava showing potential role in response to salt stress.

  7. An effective approach for annotation of protein families with low sequence similarity and conserved motifs: identifying GDSL hydrolases across the plant kingdom.

    PubMed

    Vujaklija, Ivan; Bielen, Ana; Paradžik, Tina; Biđin, Siniša; Goldstein, Pavle; Vujaklija, Dušica

    2016-02-18

    The massive accumulation of protein sequences arising from the rapid development of high-throughput sequencing, coupled with automatic annotation, results in high levels of incorrect annotations. In this study, we describe an approach to decrease annotation errors of protein families characterized by low overall sequence similarity. The GDSL lipolytic family comprises proteins with multifunctional properties and high potential for pharmaceutical and industrial applications. The number of proteins assigned to this family has increased rapidly over the last few years. In particular, the natural abundance of GDSL enzymes reported recently in plants indicates that they could be a good source of novel GDSL enzymes. We noticed that a significant proportion of annotated sequences lack specific GDSL motif(s) or catalytic residue(s). Here, we applied motif-based sequence analyses to identify enzymes possessing conserved GDSL motifs in selected proteomes across the plant kingdom. Motif-based HMM scanning (Viterbi decoding-VD and posterior decoding-PD) and the here described PD/VD protocol were successfully applied on 12 selected plant proteomes to identify sequences with GDSL motifs. A significant number of identified GDSL sequences were novel. Moreover, our scanning approach successfully detected protein sequences lacking at least one of the essential motifs (171/820) annotated by Pfam profile search (PfamA) as GDSL. Based on these analyses we provide a curated list of GDSL enzymes from the selected plants. CLANS clustering and phylogenetic analysis helped us to gain a better insight into the evolutionary relationship of all identified GDSL sequences. Three novel GDSL subfamilies as well as unreported variations in GDSL motifs were discovered in this study. In addition, analyses of selected proteomes showed a remarkable expansion of GDSL enzymes in the lycophyte, Selaginella moellendorffii. Finally, we provide a general motif-HMM scanner which is easily accessible through the graphical user interface ( http://compbio.math.hr/ ). Our results show that scanning with a carefully parameterized motif-HMM is an effective approach for annotation of protein families with low sequence similarity and conserved motifs. The results of this study expand current knowledge and provide new insights into the evolution of the large GDSL-lipase family in land plants.

  8. Genetic diversity of Babesia bovis in virulent and attenuated strains.

    PubMed

    Mazuz, M L; Molad, T; Fish, L; Leibovitz, B; Wolkomirsky, R; Fleiderovitz, L; Shkap, V

    2012-03-01

    The aim of this study was to compare the genetic diversity of the single copy Bv80 gene sequences of Babesia bovis in populations of attenuated and virulent parasites. PCR/ RT-PCR followed by cloning and sequence analyses of 4 attenuated and 4 virulent strains were performed. Multiple fragments in the range of 420 to 744 bp were amplified by PCR or RT-PCR. Cloning of the PCR fragments and sequence analyses revealed the presence of mixed subpopulations in either virulent or attenuated parasites with a total of 19 variants with 12 different sequences that differed in number and type of tandem repeats. High levels of intra- and inter-strain diversity of the Bv80 gene, with the presence of mixed populations of parasites were found in both the virulent field isolates and the attenuated vaccine strains. In addition, during the attenuation process, sequence analyses showed changes in the pattern of the parasite subpopulations. Despite high polymorphism found by sequence analyses, the patterns observed and the number of repeats, order, or motifs found could not discriminate between virulent field isolates and attenuated vaccine strains of the parasite.

  9. Immunoglobulin from Antarctic fish species of Rajidae family.

    PubMed

    Coscia, Maria Rosaria; Cocca, Ennio; Giacomelli, Stefano; Cuccaro, Fausta; Oreste, Umberto

    2012-03-01

    Immunoglobulins (Ig) of Chondroichthyes have been extensively studied in sharks; in contrast, in skates investigations on Ig remain scarce and fragmentary despite the high occurrence of skates in all of the major oceans of the world. To focus on Rajidae Igμ, the most abundant heavy chain isotype, we have chosen the Antarctic species Bathyraja eatonii, Bathyraja albomaculata, Bathyraja brachyurops, and Amblyraja georgiana which live at high latitudes in the Southern Ocean, and at very low temperatures. We prepared mRNA from the spleen of individuals of each species and performed RT-PCR experiments using two oligonucleotides designed on the alignment of various elasmobranch Igμ heavy chain sequences available in GenBank. The PCR products, about 1400-nt long, were cloned and sequenced. Nucleotide sequence identities calculated for the constant region domains ranged from 88.5% to 97.5% between species, and from 91.1% to 99.7% within species. In a distance tree, including also Raja erinacea sequences, two major branches were obtained, one containing Arhynchobatinae sequences, the other one Rajinae sequences. Four presumptive D gene segments were identified in the region of the VH/D/JH recombination; two different D segments were often found in the same sequence. Moreover, 5-15 genomic fragments of different lengths, carrying the gene locus encoding Igμ chain were revealed by Southern blotting analysis. B. eatonii amino acid sequences were analyzed for the positional diversity by Shannon entropy analysis, showing CH4 as the most conserved domain, and CH3 as the most variable one. B. eatonii CDR3 region length varied between 11 and 15 amino acid residues; the mean length (13.4 aa) was greater than that of Leucoraja eglanteria sequences (7.7 aa). An alignment of representative sequences of Antarctic species and R. erinacea showed that more cysteine residues not involved in the intradomain disulfide bridges were present in Antarctic species. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Genome Sequencing and Analysis of Yersina pestis KIM D27, an Avirulent Strain Exempt from Select Agent Regulation

    PubMed Central

    Losada, Liliana; Varga, John J.; Hostetler, Jessica; Radune, Diana; Kim, Maria; Durkin, Scott; Schneewind, Olaf; Nierman, William C.

    2011-01-01

    Yersinia pestis is the causative agent of the plague. Y. pestis KIM 10+ strain was passaged and selected for loss of the 102 kb pgm locus, resulting in an attenuated strain, KIM D27. In this study, whole genome sequencing was performed on KIM D27 in order to identify any additional differences. Initial assemblies of 454 data were highly fragmented, and various bioinformatic tools detected between 15 and 465 SNPs and INDELs when comparing both strains, the vast majority associated with A or T homopolymer sequences. Consequently, Illumina sequencing was performed to improve the quality of the assembly. Hybrid sequence assemblies were performed and a total of 56 validated SNP/INDELs and 5 repeat differences were identified in the D27 strain relative to published KIM 10+ sequence. However, further analysis showed that 55 of these SNP/INDELs and 3 repeats were errors in the KIM 10+ reference sequence. We conclude that both 454 and Illumina sequencing were required to obtain the most accurate and rapid sequence results for Y. pestis KIMD27. SNP and INDELS calls were most accurate when both Newbler and CLC Genomics Workbench were employed. For purposes of obtaining high quality genome sequence differences between strains, any identified differences should be verified in both the new and reference genomes. PMID:21559501

  11. Genome sequencing and analysis of Yersina pestis KIM D27, an avirulent strain exempt from select agent regulation.

    PubMed

    Losada, Liliana; Varga, John J; Hostetler, Jessica; Radune, Diana; Kim, Maria; Durkin, Scott; Schneewind, Olaf; Nierman, William C

    2011-04-29

    Yersinia pestis is the causative agent of the plague. Y. pestis KIM 10+ strain was passaged and selected for loss of the 102 kb pgm locus, resulting in an attenuated strain, KIM D27. In this study, whole genome sequencing was performed on KIM D27 in order to identify any additional differences. Initial assemblies of 454 data were highly fragmented, and various bioinformatic tools detected between 15 and 465 SNPs and INDELs when comparing both strains, the vast majority associated with A or T homopolymer sequences. Consequently, Illumina sequencing was performed to improve the quality of the assembly. Hybrid sequence assemblies were performed and a total of 56 validated SNP/INDELs and 5 repeat differences were identified in the D27 strain relative to published KIM 10+ sequence. However, further analysis showed that 55 of these SNP/INDELs and 3 repeats were errors in the KIM 10+ reference sequence. We conclude that both 454 and Illumina sequencing were required to obtain the most accurate and rapid sequence results for Y. pestis KIMD27. SNP and INDELS calls were most accurate when both Newbler and CLC Genomics Workbench were employed. For purposes of obtaining high quality genome sequence differences between strains, any identified differences should be verified in both the new and reference genomes.

  12. Deep sequencing reveals double mutations in cis of MPL exon 10 in myeloproliferative neoplasms.

    PubMed

    Pietra, Daniela; Brisci, Angela; Rumi, Elisa; Boggi, Sabrina; Elena, Chiara; Pietrelli, Alessandro; Bordoni, Roberta; Ferrari, Maurizio; Passamonti, Francesco; De Bellis, Gianluca; Cremonesi, Laura; Cazzola, Mario

    2011-04-01

    Somatic mutations of MPL exon 10, mainly involving a W515 substitution, have been described in JAK2 (V617F)-negative patients with essential thrombocythemia and primary myelofibrosis. We used direct sequencing and high-resolution melt analysis to identify mutations of MPL exon 10 in 570 patients with myeloproliferative neoplasms, and allele specific PCR and deep sequencing to further characterize a subset of mutated patients. Somatic mutations were detected in 33 of 221 patients (15%) with JAK2 (V617F)-negative essential thrombocythemia or primary myelofibrosis. Only one patient with essential thrombocythemia carried both JAK2 (V617F) and MPL (W515L). High-resolution melt analysis identified abnormal patterns in all the MPL mutated cases, while direct sequencing did not detect the mutant MPL in one fifth of them. In 3 cases carrying double MPL mutations, deep sequencing analysis showed identical load and location in cis of the paired lesions, indicating their simultaneous occurrence on the same chromosome.

  13. Deep Sequencing in Infectious Diseases: Immune and Pathogen Repertoires for the Improvement of Patient Outcomes.

    PubMed

    Burkholder, William F; Newell, Evan W; Poidinger, Michael; Chen, Swaine; Fink, Katja

    2017-01-01

    The inaugural workshop "Deep Sequencing in Infectious Diseases: Immune and Pathogen Repertoires for the Improvement of Patient Outcomes" was held in Singapore on 13-14 October 2016. The aim of the workshop was to discuss the latest trends in using high-throughput sequencing, bioinformatics, and allied technologies to analyze immune and pathogen repertoires and their interplay within the host, bringing together key international players in the field and Singapore-based researchers and clinician-scientists. The focus was in particular on the application of these technologies for the improvement of patient diagnosis, prognosis and treatment, and for other broad public health outcomes. The presentations by scientists and clinicians showed the potential of deep sequencing technology to capture the coevolution of adaptive immunity and pathogens. For clinical applications, some key challenges remain, such as the long turnaround time and relatively high cost of deep sequencing for pathogen identification and characterization and the lack of international standardization in immune repertoire analysis.

  14. Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction

    NASA Astrophysics Data System (ADS)

    Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin

    2017-03-01

    Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment.

  15. Deep Sequencing in Infectious Diseases: Immune and Pathogen Repertoires for the Improvement of Patient Outcomes

    PubMed Central

    Burkholder, William F.; Newell, Evan W.; Poidinger, Michael; Chen, Swaine; Fink, Katja

    2017-01-01

    The inaugural workshop “Deep Sequencing in Infectious Diseases: Immune and Pathogen Repertoires for the Improvement of Patient Outcomes” was held in Singapore on 13–14 October 2016. The aim of the workshop was to discuss the latest trends in using high-throughput sequencing, bioinformatics, and allied technologies to analyze immune and pathogen repertoires and their interplay within the host, bringing together key international players in the field and Singapore-based researchers and clinician-scientists. The focus was in particular on the application of these technologies for the improvement of patient diagnosis, prognosis and treatment, and for other broad public health outcomes. The presentations by scientists and clinicians showed the potential of deep sequencing technology to capture the coevolution of adaptive immunity and pathogens. For clinical applications, some key challenges remain, such as the long turnaround time and relatively high cost of deep sequencing for pathogen identification and characterization and the lack of international standardization in immune repertoire analysis. PMID:28620372

  16. A new arenavirus in a cluster of fatal transplant-associated diseases.

    PubMed

    Palacios, Gustavo; Druce, Julian; Du, Lei; Tran, Thomas; Birch, Chris; Briese, Thomas; Conlan, Sean; Quan, Phenix-Lan; Hui, Jeffrey; Marshall, John; Simons, Jan Fredrik; Egholm, Michael; Paddock, Christopher D; Shieh, Wun-Ju; Goldsmith, Cynthia S; Zaki, Sherif R; Catton, Mike; Lipkin, W Ian

    2008-03-06

    Three patients who received visceral-organ transplants from a single donor on the same day died of a febrile illness 4 to 6 weeks after transplantation. Culture, polymerase-chain-reaction (PCR) and serologic assays, and oligonucleotide microarray analysis for a wide range of infectious agents were not informative. We evaluated RNA obtained from the liver and kidney transplant recipients. Unbiased high-throughput sequencing was used to identify microbial sequences not found by means of other methods. The specificity of sequences for a new candidate pathogen was confirmed by means of culture and by means of PCR, immunohistochemical, and serologic analyses. High-throughput sequencing yielded 103,632 sequences, of which 14 represented an Old World arenavirus. Additional sequence analysis showed that this new arenavirus was related to lymphocytic choriomeningitis viruses. Specific PCR assays based on a unique sequence confirmed the presence of the virus in the kidneys, liver, blood, and cerebrospinal fluid of the recipients. Immunohistochemical analysis revealed arenavirus antigen in the liver and kidney transplants in the recipients. IgM and IgG antiviral antibodies were detected in the serum of the donor. Seroconversion was evident in serum specimens obtained from one recipient at two time points. Unbiased high-throughput sequencing is a powerful tool for the discovery of pathogens. The use of this method during an outbreak of disease facilitated the identification of a new arenavirus transmitted through solid-organ transplantation. Copyright 2008 Massachusetts Medical Society.

  17. Development of a Rapid Identification Method for a Variety of Antibody Candidates Using High-throughput Sequencing.

    PubMed

    Ito, Yuji

    2017-01-01

    As an alternative to hybridoma technology, the antibody phage library system can also be used for antibody selection. This method enables the isolation of antigen-specific binders through an in vitro selection process known as biopanning. While it has several advantages, such as an avoidance of animal immunization, the phage cloning and screening steps of biopanning are time-consuming and problematic. Here, we introduce a novel biopanning method combined with high-throughput sequencing (HTS) using a next-generation sequencer (NGS) to save time and effort in antibody selection, and to increase the diversity of acquired antibody sequences. Biopannings against a target antigen were performed using a human single chain Fv (scFv) antibody phage library. VH genes in pooled phages at each round of biopanning were analyzed by HTS on a NGS. The obtained data were trimmed, merged, and translated into amino acid sequences. The frequencies (%) of the respective VH sequences at each biopanning step were calculated, and the amplification factor (change of frequency through biopanning) was obtained to estimate the potential for antigen binding. A phylogenetic tree was drawn using the top 50 VH sequences with high amplification factors. Representative VH sequences forming the cluster were then picked up and used to reconstruct scFv genes harboring these VHs. Their derived scFv-Fc fusion proteins showed clear antigen binding activity. These results indicate that a combination of biopanning and HTS enables the rapid and comprehensive identification of specific binders from antibody phage libraries.

  18. [Complete genome sequencing of polymalic acid-producing strain Aureobasidium pullulans CCTCC M2012223].

    PubMed

    Wang, Yongkang; Song, Xiaodan; Li, Xiaorong; Yang, Sang-tian; Zou, Xiang

    2017-01-04

    To explore the genome sequence of Aureobasidium pullulans CCTCC M2012223, analyze the key genes related to the biosynthesis of important metabolites, and provide genetic background for metabolic engineering. Complete genome of A. pullulans CCTCC M2012223 was sequenced by Illumina HiSeq high throughput sequencing platform. Then, fragment assembly, gene prediction, functional annotation, and GO/COG cluster were analyzed in comparison with those of other five A. pullulans varieties. The complete genome sequence of A. pullulans CCTCC M2012223 was 30756831 bp with an average GC content of 47.49%, and 9452 genes were successfully predicted. Genome-wide analysis showed that A. pullulans CCTCC M2012223 had the biggest genome assembly size. Protein sequences involved in the pullulan and polymalic acid pathway were highly conservative in all of six A. pullulans varieties. Although both A. pullulans CCTCC M2012223 and A. pullulans var. melanogenum have a close affinity, some point mutation and inserts were occurred in protein sequences involved in melanin biosynthesis. Genome information of A. pullulans CCTCC M2012223 was annotated and genes involved in melanin, pullulan and polymalic acid pathway were compared, which would provide a theoretical basis for genetic modification of metabolic pathway in A. pullulans.

  19. Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China.

    PubMed

    Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

    2017-02-23

    Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5-80.8% nucleotide identity and 95.4-97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China.

  20. Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China

    PubMed Central

    Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

    2017-01-01

    Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5–80.8% nucleotide identity and 95.4–97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China. PMID:28230168

  1. Diverging Narratives: Evaluating the Uses of the Ideal-Typical Sequence of Transport Network Development

    ERIC Educational Resources Information Center

    Weber, Joe

    2004-01-01

    The development of new transport systems has been an important and highly visible component of economic development and spatial reorganization in the past two centuries. The Ideal-Typical Sequence of network development has been a widely used model of transport development. This paper shows that this model has been used in several different ways,…

  2. The use of piezocone tests for high-resolution stratigraphy of Quaternary sediment sequences in the Brazilian coast.

    PubMed

    de Mio, Giuliano; Giacheti, Heraldo L

    2007-03-01

    Correlations between mapping units of costal sedimentary basin and interpretation of piezocone test results are presented and discussed based on examples from Caravelas strandplain, (State of Bahia), Paranaguá (State of Paraná) and Guarujá bays (State of São Paulo), Brazil. Recognizing that the sedimentary environment was mainly controlled by sea level fluctuations led to the interpretation of transgressive and regressive sedimentary sequences, which is in a good agreement with the sea level fluctuation curves currently accepted for these regions. The interpretation of piezocone test results shows that the sedimentary sequences of Caravelas and Guarujá sites are similar and they have a good correlation to the sea level fluctuation curve accepted for Salvador region, State of Bahia. On the other hand, the piezocone test results from Paranaguá site indicate a different sedimentary sequence from the previous ones, relating to the sea level fluctuation curve accepted for Paranaguá region. The results show the high applicability of piezocone testing for stratigraphical logging and suggest that it is possible to integrate it with other current techniques used for paleo-environmental studies in Brazil, in accordance with recent approaches used in international research on the subject.

  3. Discovery and molecular characterization of a new cryptovirus dsRNA genome from Japanese persimmon through conventional cloning and high-throughput sequencing.

    PubMed

    Morelli, M; Chiumenti, M; De Stradis, A; La Notte, P; Minafra, A

    2015-02-01

    Through the application of next generation sequencing, in synergy with conventional cloning of DOP-PCR fragments, two double-stranded RNA (dsRNA) molecules of about 1.5 kbp in size were isolated from leaf tissue of a Japanese persimmon (accession SSPI) from Apulia (southern Italy) showing veinlets necrosis. High-throughput sequencing allowed whole genome sequence assembly, yielding a 1,577 and a 1,491 bp contigs identified as dsRNA-1 and dsRNA-2 of a previously undescribed virus, provisionally named as Persimmon cryptic virus (PeCV). In silico analysis showed that both dsRNA fragments were monocistronic and comprised the RNA-dependent RNA polymerase (RdRp) and the capsid protein (CP) genes, respectively. Phylogenetic reconstruction revealed a close relationship of these dsRNAs with those of cryptoviruses described in woody and herbaceous hosts, recently gathered in genus Deltapartitivirus. Virus-specific primers for RT-PCR, designed in the CP cistron, detected viral RNAs also in symptomless persimmon trees sampled from the same geographical area of SSPI, thus proving that PeCV infection may be fairly common and presumably latent.

  4. Emergence and Evolution of Hominidae-Specific Coding and Noncoding Genomic Sequences.

    PubMed

    Saber, Morteza Mahmoudi; Adeyemi Babarinde, Isaac; Hettiarachchi, Nilmini; Saitou, Naruya

    2016-07-12

    Family Hominidae, which includes humans and great apes, is recognized for unique complex social behavior and intellectual abilities. Despite the increasing genome data, however, the genomic origin of its phenotypic uniqueness has remained elusive. Clade-specific genes and highly conserved noncoding sequences (HCNSs) are among the high-potential evolutionary candidates involved in driving clade-specific characters and phenotypes. On this premise, we analyzed whole genome sequences along with gene orthology data retrieved from major DNA databases to find Hominidae-specific (HS) genes and HCNSs. We discovered that Down syndrome critical region 4 (DSCR4) is the only experimentally verified gene uniquely present in Hominidae. DSCR4 has no structural homology to any known protein and was inferred to have emerged in several steps through LTR/ERV1, LTR/ERVL retrotransposition, and transversion. Using the genomic distance as neutral evolution threshold, we identified 1,658 HS HCNSs. Polymorphism coverage and derived allele frequency analysis of HS HCNSs showed that these HCNSs are under purifying selection, indicating that they may harbor important functions. They are overrepresented in promoters/untranslated regions, in close proximity of genes involved in sensory perception of sound and developmental process, and also showed a significantly lower nucleosome occupancy probability. Interestingly, many ancestral sequences of the HS HCNSs showed very high evolutionary rates. This suggests that new functions emerged through some kind of positive selection, and then purifying selection started to operate to keep these functions. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Long-term excretion of vaccine-derived poliovirus by a healthy child.

    PubMed

    Martín, Javier; Odoom, Kofi; Tuite, Gráinne; Dunn, Glynis; Hopewell, Nicola; Cooper, Gill; Fitzharris, Catherine; Butler, Karina; Hall, William W; Minor, Philip D

    2004-12-01

    A child was found to be excreting type 1 vaccine-derived poliovirus (VDPV) with a 1.1% sequence drift from Sabin type 1 vaccine strain in the VP1 coding region 6 months after he was immunized with oral live polio vaccine. Seventeen type 1 poliovirus isolates were recovered from stools taken from this child during the following 4 months. Contrary to expectation, the child was not deficient in humoral immunity and showed high levels of serum neutralization against poliovirus. Selected virus isolates were characterized in terms of their antigenic properties, virulence in transgenic mice, sensitivity for growth at high temperatures, and differences in nucleotide sequence from the Sabin type 1 strain. The VDPV isolates showed mutations at key nucleotide positions that correlated with the observed reversion to biological properties typical of wild polioviruses. A number of capsid mutations mapped at known antigenic sites leading to changes in the viral antigenic structure. Estimates of sequence evolution based on the accumulation of nucleotide changes in the VP1 coding region detected a "defective" molecular clock running at an apparent faster speed of 2.05% nucleotide changes per year versus 1% shown in previous studies. Remarkably, when compared to several type 1 VDPV strains of different origins, isolates from this child showed a much higher proportion of nonsynonymous versus synonymous nucleotide changes in the capsid coding region. This anomaly could explain the high VP1 sequence drift found and the ability of these virus strains to replicate in the gut for a longer period than expected.

  6. Sequence diagrams and the presentation of structural and evolutionary relationships among proteins.

    PubMed

    Thomas, B R

    1975-01-01

    Protein sequences mapped on two-dimensional diagrams show characteristic patterns that should be of value in visualising sequence information and in distinguishing simpler structures. A convenient map form for comparative purposes is the alpha-helix diagram with aminoacid distribution analogous to the surface of an alpha-helix oriented so that an alpha-helix structure corresponds on the diagram to a vertical band 3.6 residues wide. The sequence diagram for an alpha-keratin, high-sulphur protein suggests a new form of polypeptide helix based on a repeating unit of five which may be an important component of alpha-keratin fibres.

  7. OncoNEM: inferring tumor evolution from single-cell sequencing data.

    PubMed

    Ross, Edith M; Markowetz, Florian

    2016-04-15

    Single-cell sequencing promises a high-resolution view of genetic heterogeneity and clonal evolution in cancer. However, methods to infer tumor evolution from single-cell sequencing data lag behind methods developed for bulk-sequencing data. Here, we present OncoNEM, a probabilistic method for inferring intra-tumor evolutionary lineage trees from somatic single nucleotide variants of single cells. OncoNEM identifies homogeneous cellular subpopulations and infers their genotypes as well as a tree describing their evolutionary relationships. In simulation studies, we assess OncoNEM's robustness and benchmark its performance against competing methods. Finally, we show its applicability in case studies of muscle-invasive bladder cancer and essential thrombocythemia.

  8. The ergot alkaloid gene cluster in Claviceps purpurea: extension of the cluster sequence and intra species evolution.

    PubMed

    Haarmann, Thomas; Machado, Caroline; Lübbe, Yvonne; Correia, Telmo; Schardl, Christopher L; Panaccione, Daniel G; Tudzynski, Paul

    2005-06-01

    The genomic region of Claviceps purpurea strain P1 containing the ergot alkaloid gene cluster [Tudzynski, P., Hölter, K., Correia, T., Arntz, C., Grammel, N., Keller, U., 1999. Evidence for an ergot alkaloid gene cluster in Claviceps purpurea. Mol. Gen. Genet. 261, 133-141] was explored by chromosome walking, and additional genes probably involved in the ergot alkaloid biosynthesis have been identified. The putative cluster sequence (extending over 68.5kb) contains 4 different nonribosomal peptide synthetase (NRPS) genes and several putative oxidases. Northern analysis showed that most of the genes were co-regulated (repressed by high phosphate), and identified probable flanking genes by lack of co-regulation. Comparison of the cluster sequences of strain P1, an ergotamine producer, with that of strain ECC93, an ergocristine producer, showed high conservation of most of the cluster genes, but significant variation in the NRPS modules, strongly suggesting that evolution of these chemical races of C. purpurea is determined by evolution of NRPS module specificity.

  9. Complete genome sequence and architecture of crucian carp Carassius auratus herpesvirus (CaHV).

    PubMed

    Zeng, Xiao-Tao; Chen, Zhong-Yuan; Deng, Yuan-Sheng; Gui, Jian-Fang; Zhang, Qi-Ya

    2016-12-01

    Crucian carp Carassius auratus herpesvirus (CaHV) was isolated from diseased crucian carp with acute gill hemorrhages and high mortality. The CaHV genome was sequenced and analyzed. The data showed that it consists of 275,348 bp and contains 150 predicted ORFs. The architecture of the CaHV genome differs from those of four cyprinid herpesviruses (CyHV1, CyHV2, SY-C1, CyHV3), with insertions, deletions and the absence of a terminal direct repeat. Phylogenetic analysis of the DNA polymerase sequences of 17 strains of Herpesvirales members, and the concatenated 12 core ORFs from 10 strains of alloherpesviruses showed that CaHV clustered together with members of the genus Cyprinivirus, family Alloherpesviridae.

  10. Molecular Cloning, Bioinformatics Analysis and Expression of Insulin-Like Growth Factor 2 from Tianzhu White Yak, Bos grunniens

    PubMed Central

    Zhang, Quanwei; Gong, Jishang; Wang, Xueying; Wu, Xiaohu; Li, Yalan; Ma, Youji; Zhang, Yong; Zhao, Xingxu

    2014-01-01

    The IGF family is essential for normal embryonic and postnatal development and plays important roles in the immune system, myogenesis, bone metabolism and other physiological functions, which makes the study of its structure and biological characteristics important. Tianzhu white yak (Bos grunniens) domesticated under alpine hypoxia environments, is well adapted to survive and grow against severe hypoxia and cold temperatures for extended periods. In this study, a full coding sequence of the IGF2 gene of Tianzhu white yak was amplified by reverse transcription PCR and rapid-amplification of cDNA ends (RACE) for the first time. The cDNA sequence revealed an open reading frame of 450 nucleotides, encoding a protein with 179 amino acids. Its expression in different tissues was also studied by Real time PCR. Phylogenetic tree analysis indicated that yak IGF2 was similar to Bos taurus, and 3D structure showed high similarity with the human IGF2. The putative full CDS of yak IGF2 was amplified by PCR in five tissues, and cDNA sequence analysis showed high homology to bovine IGF2. Moreover the super secondary structure prediction showed a similar 3D structure with human IGF2. Its conservation in sequence and structure has facilitated research on IGF2 and its physiological function in yak. PMID:24394317

  11. Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE.

    PubMed

    Lacerra, Giuseppina; Fiorito, Mirella; Musollino, Gennaro; Di Noce, Francesca; Esposito, Maria; Nigro, Vincenzo; Gaudiano, Carlo; Carestia, Clementina

    2004-10-01

    The alpha-globin chains are encoded by two duplicated genes (HBA2 and HBA1, 5'-3') showing overall sequence homology >96% and average CG content >60%. alpha-Thalassemia, the most prevalent worldwide autosomal recessive disorder, is a hereditary anemia caused by sequence variations of these genes in about 25% of carriers. We evaluated the overall sensitivity and suitability of DHPLC and DG-DGGE in scanning both the alpha-globin genes by carrying out a retrospective analysis of 19 variant alleles in 29 genotypes. The HBA2 alleles c.1A>G, c.79G>A, and c.281T>G, and the HBA1 allele c.475C>A were new. Three pathogenic sequence variations were associated in cis with nonpathogenic variations in all families studied; they were the HBA2 variation c.2T>C associated with c.-24C>G, and the HBA2 variations c.391G>C and c.427T>C, both associated with c.565G>A. We set up original experimental conditions for DHPLC and DG-DGGE and analyzed 10 normal subjects, 46 heterozygotes, seven homozygotes, seven compound heterozygotes, and six compound heterozygotes for a hybrid gene. Both the methodologies gave reproducible results and no false-positive was detected. DHPLC showed 100% sensitivity and DG-DGGE nearly 90%. About 100% of the sequence from the cap site to the polyA addition site could be scanned by DHPLC, about 87% by DG-DGGE. It is noteworthy that the three most common pathogenic sequence variations (HBA2 alleles c.2T>C, c.95+2_95+6del, and c.523A>G) were unambiguously detected by both the methodologies. Genotype diagnosis must be confirmed with PCR sequencing of single amplicons or with an allele-specific method. This study can be helpful for scanning genes with high CG content and offers a model suitable for duplicated genes with high homology. Copyright 2004 Wiley-Liss, Inc.

  12. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    PubMed

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  13. A comparative molecular analysis of water-filled limestone sinkholes in north-eastern Mexico.

    PubMed

    Sahl, Jason W; Gary, Marcus O; Harris, J Kirk; Spear, John R

    2011-01-01

    Sistema Zacatón in north-eastern Mexico is host to several deep, water-filled, anoxic, karstic sinkholes (cenotes). These cenotes were explored, mapped, and geochemically and microbiologically sampled by the autonomous underwater vehicle deep phreatic thermal explorer (DEPTHX). The community structure of the filterable fraction of the water column and extensive microbial mats that coat the cenote walls was investigated by comparative analysis of small-subunit (SSU) 16S rRNA gene sequences. Full-length Sanger gene sequence analysis revealed novel microbial diversity that included three putative bacterial candidate phyla and three additional groups that showed high intra-clade distance with poorly characterized bacterial candidate phyla. Limited functional gene sequence analysis in these anoxic environments identified genes associated with methanogenesis, sulfate reduction and anaerobic ammonium oxidation. A directed, barcoded amplicon, multiplex pyrosequencing approach was employed to compare ∼100,000 bacterial SSU gene sequences from water column and wall microbial mat samples from five cenotes in Sistema Zacatón. A new, high-resolution sequence distribution profile (SDP) method identified changes in specific phylogenetic types (phylotypes) in microbial mats at varied depths; Mantel tests showed a correlation of the genetic distances between mat communities in two cenotes and the geographic location of each cenote. Community structure profiles from the water column of three neighbouring cenotes showed distinct variation; statistically significant differences in the concentration of geochemical constituents suggest that the variation observed in microbial communities between neighbouring cenotes are due to geochemical variation. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  14. Length variation and sequence divergence in mitochondrial control region of Schizothoracine (Teleostei: Cyperinidae) species.

    PubMed

    Syed, Mudasir Ahmad; Bhat, Farooz Ahmad; Balkhi, Masood-ul Hassan; Bhat, Bilal Ahmad

    2016-01-01

    Schizothoracine fish commonly called snow trouts inhibit the entire network of snow and spring fed cool waters of Kashmir, India. Over 10 species reported earlier, only five species have been found, these include Schizothorax niger, Schizothorax esocinus, Schizothorax plagiostomus, Schizothorax curvifrons and Schizothorax labiatus. The relationship between these species is contradicting. To understand the evolutionary relation of these species, we examined the sequence information of mitochondrial D-loop of 25 individuals representing five species. Sequence alignment showed D-loop region highly variable and length variation was observed in di-nucleotide (TA)n microsatellite between and within species. Interestingly, all these species have (TA)n microsatellite not associated with longer tandem repeats at the 3' end of the mitochondrial control region and do not show heteroplasmy. Our analysis also indicates the presence of four conserved sequence blocks (CSB), CSB-D, CSB-1, CSB-II and CSB-III, four (Termination Associated Sequence) TAS motifs and 15bp pyrimidine block within the mitochondrial control region, that are highly conserved within genus Schizothorax when compared with other species. The phylogenetic analysis carried by Maximum likelihood (ML), Neighbor Joining (NJ) and Bayesian inference (BI) generated almost identical results. The resultant BI tree showed a close genetic relationship of all the five species and supports two distinct grouping of S. esocinus species. Besides the species relation, the presence of length variation in tandem repeats is attributed to differences in predicting the stability of secondary structures. The role of CSBs and TASs, reported so far as main regulatory signals, would explain the conservation of these elements in evolution.

  15. Sequencing, bioinformatic characterization and expression pattern of a putative amino acid transporter from the parasitic cestode Echinococcus granulosus.

    PubMed

    Camicia, Federico; Paredes, Rodolfo; Chalar, Cora; Galanti, Norbel; Kamenetzky, Laura; Gutierrez, Ariana; Rosenzvit, Mara C

    2008-03-31

    We have sequenced and partially characterized an Echinococcus granulosus cDNA, termed egat1, from a protoscolex signal sequence trap (SST) cDNA library. The isolated 1627 bp long cDNA contains an ORF of 489 amino acids and shows an amino acid identity of 30% with neutral and excitatory amino acid transporters members of the Dicarboxylate/Amino Acid Na+ and/or H+ Cation Symporter family (DAACS) (TC 2.A.23). Additional bioinformatics analysis of EgAT1, confirmed the results obtained by similarity searches and showed the presence of 9 to 10 transmembrane domains, consensus sequences for N-glycosylation between the third and fourth transmembrane domain, a highly similar hydropathy profile with ASCT1 (a known member of DAACS family), high score with SDF (Sodium Dicarboxilate Family) and similar motifs with EDTRANSPORT, a fingerprint of excitatory amino acid transporters. The localization of the putative amino acid transporter was analyzed by in situ hybridization and immunofluorescence in protoscoleces and associated germinal layer. The in situ hybridization labelling indicates the distribution of egat1 mRNA throughout the tegument. EgAT1 protein, which showed in Western blots a molecular mass of approximately 60 kD, is localized in the subtegumental region of the metacestode, particularly around suckers and rostellum of protoscoleces and layers from brood capsules. The sequence and expression analyses of EgAT1 pave the way for functional analysis of amino acids transporters of E. granulosus and its evaluation as new drug targets against cystic echinococcosis.

  16. Maintenance of an Intact Human Immunodeficiency Virus Type 1 vpr Gene following Mother-to-Infant Transmission

    PubMed Central

    Yedavalli, Venkat R. K.; Chappey, Colombe; Ahmad, Nafees

    1998-01-01

    The vpr sequences from six human immunodeficiency virus type 1 (HIV-1)-infected mother-infant pairs following perinatal transmission were analyzed. We found that 153 of the 166 clones analyzed from uncultured peripheral blood mononuclear cell DNA samples showed a 92.17% frequency of intact vpr open reading frames. There was a low degree of heterogeneity of vpr genes within mothers, within infants, and between epidemiologically linked mother-infant pairs. The distances between vpr sequences were greater in epidemiologically unlinked individuals than in epidemiologically linked mother-infant pairs. Moreover, the infants’ sequences displayed patterns similar to those seen in their mothers. The functional domains essential for Vpr activity, including virion incorporation, nuclear import, and cell cycle arrest and differentiation were highly conserved in most of the sequences. Phylogenetic analyses of 166 mother-infant pairs and 195 other available vpr sequences from HIV databases formed distinct clusters for each mother-infant pair and for other vpr sequences and grouped the six mother-infant pairs’ sequences with subtype B sequences. A high degree of conservation of intact and functional vpr supports the notion that vpr plays an important role in HIV-1 infection and replication in mother-infant isolates that are involved in perinatal transmission. PMID:9658150

  17. Generation and analysis of expressed sequence tags from a cDNA library of the fruiting body of Ganoderma lucidum

    PubMed Central

    2010-01-01

    Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644

  18. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry)

    PubMed Central

    Villacreses, Javier; Rojas-Herrera, Marcelo; Sánchez, Carolina; Hewstone, Nicole; Undurraga, Soledad F.; Alzate, Juan F.; Manque, Patricio; Maracaja-Coutinho, Vinicius; Polanco, Victor

    2015-01-01

    Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1). High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs): ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV), Petuvirus genus. ORF1 encodes a movement protein (MP); ORF2 a Reverse Transcriptase (RT) and a Ribonuclease H (RNase H) domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs), AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq). Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant. PMID:25855242

  19. UVnovo: A De Novo Sequencing Algorithm Using Single Series of Fragment Ions via Chromophore Tagging and 351 nm Ultraviolet Photodissociation Mass Spectrometry

    PubMed Central

    Robotham, Scott A.; Horton, Andrew P.; Cannon, Joe R.; Cotham, Victoria C.; Marcotte, Edward M.; Brodbelt, Jennifer S.

    2016-01-01

    De novo peptide sequencing by mass spectrometry represents an important strategy for characterizing novel peptides and proteins, in which a peptide’s amino acid sequence is inferred directly from the precursor peptide mass and tandem mass spectrum (MS/MS or MS3) fragment ions, without comparison to a reference proteome. This method is ideal for organisms or samples lacking a complete or well-annotated reference sequence set. One of the major barriers to de novo spectral interpretation arises from confusion of N- and C-terminal ion series due to the symmetry between b and y ion pairs created by collisional activation methods (or c, z ions for electron-based activation methods). This is known as the ‘antisymmetric path problem’ and leads to inverted amino acid subsequences within a de novo reconstruction. Here, we combine several key strategies for de novo peptide sequencing into a single high-throughput pipeline: high efficiency carbamylation blocks lysine side chains, and subsequent tryptic digestion and N-terminal peptide derivatization with the ultraviolet chromophore AMCA yields peptides susceptible to 351 nm ultraviolet photodissociation (UVPD). UVPD-MS/MS of the AMCA-modified peptides then predominantly produces y ions in the MS/MS spectra, specifically addressing the antisymmetric path problem. Finally, the program UVnovo applies a random forest algorithm to automatically learn from and then interpret UVPD mass spectra, passing results to a hidden Markov model for de novo sequence prediction and scoring. We show this combined strategy provides high performance de novo peptide sequencing, enabling the de novo sequencing of thousands of peptides from an E. coli lysate at high confidence. PMID:26938041

  20. Multishot versus Single-Shot Pulse Sequences in Very High Field fMRI: A Comparison Using Retinotopic Mapping

    PubMed Central

    Gatenby, J. Christopher; Gore, John C.; Tong, Frank

    2012-01-01

    High-resolution functional MRI is a leading application for very high field (7 Tesla) human MR imaging. Though higher field strengths promise improvements in signal-to-noise ratios (SNR) and BOLD contrast relative to fMRI at 3 Tesla, these benefits may be partially offset by accompanying increases in geometric distortion and other off-resonance effects. Such effects may be especially pronounced with the single-shot EPI pulse sequences typically used for fMRI at standard field strengths. As an alternative, one might consider multishot pulse sequences, which may lead to somewhat lower temporal SNR than standard EPI, but which are also often substantially less susceptible to off-resonance effects. Here we consider retinotopic mapping of human visual cortex as a practical test case by which to compare examples of these sequence types for high-resolution fMRI at 7 Tesla. We performed polar angle retinotopic mapping at each of 3 isotropic resolutions (2.0, 1.7, and 1.1 mm) using both accelerated single-shot 2D EPI and accelerated multishot 3D gradient-echo pulse sequences. We found that single-shot EPI indeed led to greater temporal SNR and contrast-to-noise ratios (CNR) than the multishot sequences. However, additional distortion correction in postprocessing was required in order to fully realize these advantages, particularly at higher resolutions. The retinotopic maps produced by both sequence types were qualitatively comparable, and showed equivalent test/retest reliability. Thus, when surface-based analyses are planned, or in other circumstances where geometric distortion is of particular concern, multishot pulse sequences could provide a viable alternative to single-shot EPI. PMID:22514646

  1. Multishot versus single-shot pulse sequences in very high field fMRI: a comparison using retinotopic mapping.

    PubMed

    Swisher, Jascha D; Sexton, John A; Gatenby, J Christopher; Gore, John C; Tong, Frank

    2012-01-01

    High-resolution functional MRI is a leading application for very high field (7 Tesla) human MR imaging. Though higher field strengths promise improvements in signal-to-noise ratios (SNR) and BOLD contrast relative to fMRI at 3 Tesla, these benefits may be partially offset by accompanying increases in geometric distortion and other off-resonance effects. Such effects may be especially pronounced with the single-shot EPI pulse sequences typically used for fMRI at standard field strengths. As an alternative, one might consider multishot pulse sequences, which may lead to somewhat lower temporal SNR than standard EPI, but which are also often substantially less susceptible to off-resonance effects. Here we consider retinotopic mapping of human visual cortex as a practical test case by which to compare examples of these sequence types for high-resolution fMRI at 7 Tesla. We performed polar angle retinotopic mapping at each of 3 isotropic resolutions (2.0, 1.7, and 1.1 mm) using both accelerated single-shot 2D EPI and accelerated multishot 3D gradient-echo pulse sequences. We found that single-shot EPI indeed led to greater temporal SNR and contrast-to-noise ratios (CNR) than the multishot sequences. However, additional distortion correction in postprocessing was required in order to fully realize these advantages, particularly at higher resolutions. The retinotopic maps produced by both sequence types were qualitatively comparable, and showed equivalent test/retest reliability. Thus, when surface-based analyses are planned, or in other circumstances where geometric distortion is of particular concern, multishot pulse sequences could provide a viable alternative to single-shot EPI.

  2. Optimal digital dynamical decoupling for general decoherence via Walsh modulation

    NASA Astrophysics Data System (ADS)

    Qi, Haoyu; Dowling, Jonathan P.; Viola, Lorenza

    2017-11-01

    We provide a general framework for constructing digital dynamical decoupling sequences based on Walsh modulation—applicable to arbitrary qubit decoherence scenarios. By establishing equivalence between decoupling design based on Walsh functions and on concatenated projections, we identify a family of optimal Walsh sequences, which can be exponentially more efficient, in terms of the required total pulse number, for fixed cancellation order, than known digital sequences based on concatenated design. Optimal sequences for a given cancellation order are highly non-unique—their performance depending sensitively on the control path. We provide an analytic upper bound to the achievable decoupling error and show how sequences within the optimal Walsh family can substantially outperform concatenated decoupling in principle, while respecting realistic timing constraints.

  3. Logo2PWM: a tool to convert sequence logo to position weight matrix.

    PubMed

    Gao, Zhen; Liu, Lu; Ruan, Jianhua

    2017-10-03

    position weight matrix (PWM) and sequence logo are the most widely used representations of transcription factor binding site (TFBS) in biological sequences. Sequence logo - a graphical representation of PWM, has been widely used in scientific publications and reports, due to its easiness of human perception, rich information, and simple format. Different from sequence logo, PWM works great as a precise and compact digitalized form, which can be easily used by a variety of motif analysis software. There are a few available tools to generate sequence logos from PWM; however, no tool does the reverse. Such tool to convert sequence logo back to PWM is needed to scan a TFBS represented in logo format in a publication where the PWM is not provided or hard to be acquired. A major difficulty in developing such tool to convert sequence logo to PWM is to deal with the diversity of sequence logo images. We propose logo2PWM for reconstructing PWM from a large variety of sequence logo images. Evaluation results on over one thousand logos from three sources of different logo format show that the correlation between the reconstructed PWMs and the original PWMs are constantly high, where median correlation is greater than 0.97. Because of the high recognition accuracy, the easiness of usage, and, the availability of both web-based service and stand-alone application, we believe that logo2PWM can readily benefit the study of transcription by filling the gap between sequence logo and PWM.

  4. Genome sequence, comparative analysis and haplotype structure of the domestic dog.

    PubMed

    Lindblad-Toh, Kerstin; Wade, Claire M; Mikkelsen, Tarjei S; Karlsson, Elinor K; Jaffe, David B; Kamal, Michael; Clamp, Michele; Chang, Jean L; Kulbokas, Edward J; Zody, Michael C; Mauceli, Evan; Xie, Xiaohui; Breen, Matthew; Wayne, Robert K; Ostrander, Elaine A; Ponting, Chris P; Galibert, Francis; Smith, Douglas R; DeJong, Pieter J; Kirkness, Ewen; Alvarez, Pablo; Biagi, Tara; Brockman, William; Butler, Jonathan; Chin, Chee-Wye; Cook, April; Cuff, James; Daly, Mark J; DeCaprio, David; Gnerre, Sante; Grabherr, Manfred; Kellis, Manolis; Kleber, Michael; Bardeleben, Carolyne; Goodstadt, Leo; Heger, Andreas; Hitte, Christophe; Kim, Lisa; Koepfli, Klaus-Peter; Parker, Heidi G; Pollinger, John P; Searle, Stephen M J; Sutter, Nathan B; Thomas, Rachael; Webber, Caleb; Baldwin, Jennifer; Abebe, Adal; Abouelleil, Amr; Aftuck, Lynne; Ait-Zahra, Mostafa; Aldredge, Tyler; Allen, Nicole; An, Peter; Anderson, Scott; Antoine, Claudel; Arachchi, Harindra; Aslam, Ali; Ayotte, Laura; Bachantsang, Pasang; Barry, Andrew; Bayul, Tashi; Benamara, Mostafa; Berlin, Aaron; Bessette, Daniel; Blitshteyn, Berta; Bloom, Toby; Blye, Jason; Boguslavskiy, Leonid; Bonnet, Claude; Boukhgalter, Boris; Brown, Adam; Cahill, Patrick; Calixte, Nadia; Camarata, Jody; Cheshatsang, Yama; Chu, Jeffrey; Citroen, Mieke; Collymore, Alville; Cooke, Patrick; Dawoe, Tenzin; Daza, Riza; Decktor, Karin; DeGray, Stuart; Dhargay, Norbu; Dooley, Kimberly; Dooley, Kathleen; Dorje, Passang; Dorjee, Kunsang; Dorris, Lester; Duffey, Noah; Dupes, Alan; Egbiremolen, Osebhajajeme; Elong, Richard; Falk, Jill; Farina, Abderrahim; Faro, Susan; Ferguson, Diallo; Ferreira, Patricia; Fisher, Sheila; FitzGerald, Mike; Foley, Karen; Foley, Chelsea; Franke, Alicia; Friedrich, Dennis; Gage, Diane; Garber, Manuel; Gearin, Gary; Giannoukos, Georgia; Goode, Tina; Goyette, Audra; Graham, Joseph; Grandbois, Edward; Gyaltsen, Kunsang; Hafez, Nabil; Hagopian, Daniel; Hagos, Birhane; Hall, Jennifer; Healy, Claire; Hegarty, Ryan; Honan, Tracey; Horn, Andrea; Houde, Nathan; Hughes, Leanne; Hunnicutt, Leigh; Husby, M; Jester, Benjamin; Jones, Charlien; Kamat, Asha; Kanga, Ben; Kells, Cristyn; Khazanovich, Dmitry; Kieu, Alix Chinh; Kisner, Peter; Kumar, Mayank; Lance, Krista; Landers, Thomas; Lara, Marcia; Lee, William; Leger, Jean-Pierre; Lennon, Niall; Leuper, Lisa; LeVine, Sarah; Liu, Jinlei; Liu, Xiaohong; Lokyitsang, Yeshi; Lokyitsang, Tashi; Lui, Annie; Macdonald, Jan; Major, John; Marabella, Richard; Maru, Kebede; Matthews, Charles; McDonough, Susan; Mehta, Teena; Meldrim, James; Melnikov, Alexandre; Meneus, Louis; Mihalev, Atanas; Mihova, Tanya; Miller, Karen; Mittelman, Rachel; Mlenga, Valentine; Mulrain, Leonidas; Munson, Glen; Navidi, Adam; Naylor, Jerome; Nguyen, Tuyen; Nguyen, Nga; Nguyen, Cindy; Nguyen, Thu; Nicol, Robert; Norbu, Nyima; Norbu, Choe; Novod, Nathaniel; Nyima, Tenchoe; Olandt, Peter; O'Neill, Barry; O'Neill, Keith; Osman, Sahal; Oyono, Lucien; Patti, Christopher; Perrin, Danielle; Phunkhang, Pema; Pierre, Fritz; Priest, Margaret; Rachupka, Anthony; Raghuraman, Sujaa; Rameau, Rayale; Ray, Verneda; Raymond, Christina; Rege, Filip; Rise, Cecil; Rogers, Julie; Rogov, Peter; Sahalie, Julie; Settipalli, Sampath; Sharpe, Theodore; Shea, Terrance; Sheehan, Mechele; Sherpa, Ngawang; Shi, Jianying; Shih, Diana; Sloan, Jessie; Smith, Cherylyn; Sparrow, Todd; Stalker, John; Stange-Thomann, Nicole; Stavropoulos, Sharon; Stone, Catherine; Stone, Sabrina; Sykes, Sean; Tchuinga, Pierre; Tenzing, Pema; Tesfaye, Senait; Thoulutsang, Dawa; Thoulutsang, Yama; Topham, Kerri; Topping, Ira; Tsamla, Tsamla; Vassiliev, Helen; Venkataraman, Vijay; Vo, Andy; Wangchuk, Tsering; Wangdi, Tsering; Weiand, Michael; Wilkinson, Jane; Wilson, Adam; Yadav, Shailendra; Yang, Shuli; Yang, Xiaoping; Young, Geneva; Yu, Qing; Zainoun, Joanne; Zembek, Lisa; Zimmer, Andrew; Lander, Eric S

    2005-12-08

    Here we report a high-quality draft genome sequence of the domestic dog (Canis familiaris), together with a dense map of single nucleotide polymorphisms (SNPs) across breeds. The dog is of particular interest because it provides important evolutionary information and because existing breeds show great phenotypic diversity for morphological, physiological and behavioural traits. We use sequence comparison with the primate and rodent lineages to shed light on the structure and evolution of genomes and genes. Notably, the majority of the most highly conserved non-coding sequences in mammalian genomes are clustered near a small subset of genes with important roles in development. Analysis of SNPs reveals long-range haplotypes across the entire dog genome, and defines the nature of genetic diversity within and across breeds. The current SNP map now makes it possible for genome-wide association studies to identify genes responsible for diseases and traits, with important consequences for human and companion animal health.

  5. Genome sequence resources for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici) and the barley stripe rust pathogen (Puccinia striiformis f. sp. hordei).

    PubMed

    Xia, Chongjing; Wang, Meinan; Yin, Chuntao; Cornejo, Omar E; Hulbert, Scot; Chen, Xianming

    2018-05-24

    Puccinia striiformis f. sp. tritici (Pst) causes devastating stripe (yellow) rust on wheat and P. striiformis f. sp. hordei (Psh) causes stripe rust on barley. Several Pst genomes are available, but no Psh genome is available. More genomes of Pst and Psh are needed to understand the genome evolution and molecular mechanisms of their pathogenicity. We sequenced Pst isolate 93-210 and Psh isolate 93TX-2 using PacBio and Illumina technologies, and RNA sequencing. Their genomic sequences were assembled to contigs with high continuity and showed significant structural differences. The circular mitochondria genomes of both were complete. These genomes provide high-quality resources for deciphering the genomic basis of rapid evolution and host adaptation, identifying genes for avirulence and other important traits, and studying host-pathogen interaction.

  6. snpAD: An ancient DNA genotype caller.

    PubMed

    Prüfer, Kay

    2018-06-21

    The study of ancient genomes can elucidate the evolutionary past. However, analyses are complicated by base-modifications in ancient DNA molecules that result in errors in DNA sequences. These errors are particularly common near the ends of sequences and pose a challenge for genotype calling. I describe an iterative method that estimates genotype frequencies and errors along sequences to allow for accurate genotype calling from ancient sequences. The implementation of this method, called snpAD, performs well on high-coverage ancient data, as shown by simulations and by subsampling the data of a high-coverage Neandertal genome. Although estimates for low-coverage genomes are less accurate, I am able to derive approximate estimates of heterozygosity from several low-coverage Neandertals. These estimates show that low heterozygosity, compared to modern humans, was common among Neandertals. The C ++ code of snpAD is freely available at http://bioinf.eva.mpg.de/snpAD/. Supplementary data are available at Bioinformatics online.

  7. Droplet barcoding for single cell transcriptomics applied to embryonic stem cells

    PubMed Central

    Klein, Allon M; Mazutis, Linas; Akartuna, Ilke; Tallapragada, Naren; Veres, Adrian; Li, Victor; Peshkin, Leonid; Weitz, David A; Kirschner, Marc W

    2015-01-01

    Summary It has long been the dream of biologists to map gene expression at the single cell level. With such data one might track heterogeneous cell sub-populations, and infer regulatory relationships between genes and pathways. Recently, RNA sequencing has achieved single cell resolution. What is limiting is an effective way to routinely isolate and process large numbers of individual cells for quantitative in-depth sequencing. We have developed a high-throughput droplet-microfluidic approach for barcoding the RNA from thousands of individual cells for subsequent analysis by next-generation sequencing. The method shows a surprisingly low noise profile and is readily adaptable to other sequencing-based assays. We analyzed mouse embryonic stem cells, revealing in detail the population structure and the heterogeneous onset of differentiation after LIF withdrawal. The reproducibility of these high-throughput single cell data allowed us to deconstruct cell populations and infer gene expression relationships. PMID:26000487

  8. Limiting vibration in systems with constant amplitude actuators through command preshaping. M.S Thesis - MIT

    NASA Technical Reports Server (NTRS)

    Rogers, Keith Eric

    1994-01-01

    The basic concepts of command preshaping were taken and adapted to the framework of systems with constant amplitude (on-off) actuators. In this context, pulse sequences were developed which help to attenuate vibration in flexible systems with high robustness to errors in frequency identification. Sequences containing impulses of different magnitudes were approximated by sequences containing pulses of different durations. The effects of variation in pulse width on this approximation were examined. Sequences capable of minimizing loads induced in flexible systems during execution of commands were also investigated. The usefulness of these techniques in real-world situations was verified by application to a high fidelity simulation of the space shuttle. Results showed that constant amplitude preshaping techniques offer a substantial improvement in vibration reduction over both the standard and upgraded shuttle control methods and may be mission enabling for use of the shuttle with extremely massive payloads.

  9. Nucleotide sequences of the tet(M) genes from the American and Dutch type tetracycline resistance plasmids of Neisseria gonorrhoeae.

    PubMed

    Gascoyne-Binzi, D M; Heritage, J; Hawkey, P M

    1993-11-01

    High-level tetracycline-resistant Neisseria gonorrhoeae (TRNG) has been associated with the presence of a plasmid approximately 25.2 MDa in size which carries a Tet M tetracycline resistance determinant. Two different plasmid types, American and Dutch, have previously been described, based on the restriction endonuclease digestion pattern. In this study, the tet(M) genes from the two plasmid types have been amplified by the polymerase chain reaction (PCR) and then sequenced. The gene sequences from the two plasmids shared 96.8% identity, and showed similarities with different segments of the tet(M) gene sequences from Tn1545, Tn916 and Ureaplasma urealyticum. The data suggest that it is highly likely that the Tet M determinant found in the American type plasmid has a different origin from that present in the Dutch plasmid.

  10. A statistical approach to detection of copy number variations in PCR-enriched targeted sequencing data.

    PubMed

    Demidov, German; Simakova, Tamara; Vnuchkova, Julia; Bragin, Anton

    2016-10-22

    Multiplex polymerase chain reaction (PCR) is a common enrichment technique for targeted massive parallel sequencing (MPS) protocols. MPS is widely used in biomedical research and clinical diagnostics as the fast and accurate tool for the detection of short genetic variations. However, identification of larger variations such as structure variants and copy number variations (CNV) is still being a challenge for targeted MPS. Some approaches and tools for structural variants detection were proposed, but they have limitations and often require datasets of certain type, size and expected number of amplicons affected by CNVs. In the paper, we describe novel algorithm for high-resolution germinal CNV detection in the PCR-enriched targeted sequencing data and present accompanying tool. We have developed a machine learning algorithm for the detection of large duplications and deletions in the targeted sequencing data generated with PCR-based enrichment step. We have performed verification studies and established the algorithm's sensitivity and specificity. We have compared developed tool with other available methods applicable for the described data and revealed its higher performance. We showed that our method has high specificity and sensitivity for high-resolution copy number detection in targeted sequencing data using large cohort of samples.

  11. A DNA Barcode Library for North American Ephemeroptera: Progress and Prospects

    PubMed Central

    Webb, Jeffrey M.; Jacobus, Luke M.; Funk, David H.; Zhou, Xin; Kondratieff, Boris; Geraci, Christy J.; DeWalt, R. Edward; Baird, Donald J.; Richard, Barton; Phillips, Iain; Hebert, Paul D. N.

    2012-01-01

    DNA barcoding of aquatic macroinvertebrates holds much promise as a tool for taxonomic research and for providing the reliable identifications needed for water quality assessment programs. A prerequisite for identification using barcodes is a reliable reference library. We gathered 4165 sequences from the barcode region of the mitochondrial cytochrome c oxidase subunit I gene representing 264 nominal and 90 provisional species of mayflies (Insecta: Ephemeroptera) from Canada, Mexico, and the United States. No species shared barcode sequences and all can be identified with barcodes with the possible exception of some Caenis. Minimum interspecific distances ranged from 0.3–24.7% (mean: 12.5%), while the average intraspecific divergence was 1.97%. The latter value was inflated by the presence of very high divergences in some taxa. In fact, nearly 20% of the species included two or three haplotype clusters showing greater than 5.0% sequence divergence and some values are as high as 26.7%. Many of the species with high divergences are polyphyletic and likely represent species complexes. Indeed, many of these polyphyletic species have numerous synonyms and individuals in some barcode clusters show morphological attributes characteristic of the synonymized species. In light of our findings, it is imperative that type or topotype specimens be sequenced to correctly associate barcode clusters with morphological species concepts and to determine the status of currently synonymized species. PMID:22666447

  12. Right ventricular strain analysis from three-dimensional echocardiography by using temporally diffeomorphic motion estimation.

    PubMed

    Zhang, Zhijun; Zhu, Meihua; Ashraf, Muhammad; Broberg, Craig S; Sahn, David J; Song, Xubo

    2014-12-01

    Quantitative analysis of right ventricle (RV) motion is important for study of the mechanism of congenital and acquired diseases. Unlike left ventricle (LV), motion estimation of RV is more difficult because of its complex shape and thin myocardium. Although attempts of finite element models on MR images and speckle tracking on echocardiography have shown promising results on RV strain analysis, these methods can be improved since the temporal smoothness of the motion is not considered. The authors have proposed a temporally diffeomorphic motion estimation method in which a spatiotemporal transformation is estimated by optimization of a registration energy functional of the velocity field in their earlier work. The proposed motion estimation method is a fully automatic process for general image sequences. The authors apply the method by combining with a semiautomatic myocardium segmentation method to the RV strain analysis of three-dimensional (3D) echocardiographic sequences of five open-chest pigs under different steady states. The authors compare the peak two-point strains derived by their method with those estimated from the sonomicrometry, the results show that they have high correlation. The motion of the right ventricular free wall is studied by using segmental strains. The baseline sequence results show that the segmental strains in their methods are consistent with results obtained by other image modalities such as MRI. The image sequences of pacing steady states show that segments with the largest strain variation coincide with the pacing sites. The high correlation of the peak two-point strains of their method and sonomicrometry under different steady states demonstrates that their RV motion estimation has high accuracy. The closeness of the segmental strain of their method to those from MRI shows the feasibility of their method in the study of RV function by using 3D echocardiography. The strain analysis of the pacing steady states shows the potential utility of their method in study on RV diseases.

  13. Inferring coarse-grain histone-DNA interaction potentials from high-resolution structures of the nucleosome

    NASA Astrophysics Data System (ADS)

    Meyer, Sam; Everaers, Ralf

    2015-02-01

    The histone-DNA interaction in the nucleosome is a fundamental mechanism of genomic compaction and regulation, which remains largely unknown despite increasing structural knowledge of the complex. In this paper, we propose a framework for the extraction of a nanoscale histone-DNA force-field from a collection of high-resolution structures, which may be adapted to a larger class of protein-DNA complexes. We applied the procedure to a large crystallographic database extended by snapshots from molecular dynamics simulations. The comparison of the structural models first shows that, at histone-DNA contact sites, the DNA base-pairs are shifted outwards locally, consistent with locally repulsive forces exerted by the histones. The second step shows that the various force profiles of the structures under analysis derive locally from a unique, sequence-independent, quadratic repulsive force-field, while the sequence preferences are entirely due to internal DNA mechanics. We have thus obtained the first knowledge-derived nanoscale interaction potential for histone-DNA in the nucleosome. The conformations obtained by relaxation of nucleosomal DNA with high-affinity sequences in this potential accurately reproduce the experimental values of binding preferences. Finally we address the more generic binding mechanisms relevant to the 80% genomic sequences incorporated in nucleosomes, by computing the conformation of nucleosomal DNA with sequence-averaged properties. This conformation differs from those found in crystals, and the analysis suggests that repulsive histone forces are related to local stretch tension in nucleosomal DNA, mostly between adjacent contact points. This tension could play a role in the stability of the complex.

  14. Sedimentary dynamics and high-frequency sequence stratigraphy of the southwestern slope of Great Bahama Bank

    NASA Astrophysics Data System (ADS)

    Wunsch, Marco; Betzler, Christian; Eberli, Gregor P.; Lindhorst, Sebastian; Lüdmann, Thomas; Reijmer, John J. G.

    2018-01-01

    New geophysical data from the leeward slope of Great Bahama Bank show how contour currents shape the slope and induce re-sedimentation processes. Along slope segments with high current control, drift migration and current winnowing at the toe of slope form a deep moat. Here, the slope progradation is inhibited by large channel incisions and the accumulation of large mass transport complexes, triggered by current winnowing. In areas where the slope is bathed by weaker currents, the accumulation of mass transport complexes and channel incision is rather controlled by the position of the sea level. Large slope failures were triggered during the Mid-Pleistocene transition and Mid-Brunhes event, both periods characterized by changes in the cyclicity or the amplitude of sea-level fluctuations. Within the seismic stratigraphic framework of third order sequences, four sequences of higher order were identified in the succession of the upper Pleistocene. These higher order sequences also show clear differences in function of the slope exposure to contour currents. Two stochastic models emphasize the role of the contour currents and slope morphology in the facies distribution in the upper Pleistocene sequences. In areas of high current influence the interplay of erosional and depositional processes form a complex facies pattern with downslope and along strike facies alterations. In zones with lower current influence, major facies alternations occur predominately in downslope direction, and a layer-cake pattern characterizes the along strike direction. Therefore, this study highlights that contour currents are an underestimated driver for the sediment distribution and architecture of carbonate slopes.

  15. Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

    PubMed Central

    Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

    1981-01-01

    The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

  16. Specific minor groove solvation is a crucial determinant of DNA binding site recognition

    PubMed Central

    Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

    2014-01-01

    The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

  17. Genetic diversities of MT-ND1 and MT-ND2 genes are associated with high-altitude adaptation in yak.

    PubMed

    Shi, Yu; Hu, Yongsong; Wang, Jie; Elzo, Mauricio A; Yang, Xue; Lai, Songjia

    2018-04-01

    Tibetan yak (Bos grunniens) inhabiting the Qinghai-Tibet Plateau (QTP) where the average altitude is 4000 m, is specially adapted to live at these altitudes. Conversely, cattle (B. taurus) has been found to suffer from high-altitude hypertension or heart failure when exposed to these high altitudes. Two mitochondrial genes, MT-ND1 and MT-ND2, encode two subunits of NADH dehydrogenase play an essential role in the electron transport chain of oxidative phosphorylation (OXPHOS). We sequenced these two mitochondrial genes in two bovine groups (70 Tibetan yaks and 70 Xuanhan cattle) and downloaded 300 sequences of B. taurus (cattle), 93 sequences of B. grunniens (domestic yak), and 2 sequences of B. mutus (wild yak) from NCBI to increase our understanding of the mechanisms of adaptability to hypoxia at high altitudes in yaks compared to cattle. MT-ND1 SNP m.3907 C > T, present in all Tibetan yaks, was positively associated with high-altitude adaptation (p < .0006). Specially, mutation m.3638 A > G present in all cattle, resulting in the termination of transcription, was negatively associated with high-altitude adaptation (p < .0006). Additionally, MT-ND2 SNPs m.4351 G > A and m.5218 C > T also showed positive associations with high-altitude adaptation (p < .0004). MT-ND1 haplotypes H2, H3, H4, H6, and H7 showed positive associations but haplotype H20 had a negative association with high-altitude adaptation (p < .0008). Similarly, MT-ND2 haplotypes Ha1 Ha8, Ha10, and Ha11 were positively associated whereas haplotype Ha2 was negatively associated with adaptability to high-altitudes (p < .0008). Thus, MT-ND1 and MT-ND2 can be considered as candidate genes associated with adaptation to high-altitude environments.

  18. Improved imaging of cochlear nerve hypoplasia using a 3-Tesla variable flip-angle turbo spin-echo sequence and a 7-cm surface coil.

    PubMed

    Giesemann, Anja M; Raab, Peter; Lyutenski, Stefan; Dettmer, Sabine; Bültmann, Eva; Frömke, Cornelia; Lenarz, Thomas; Lanfermann, Heinrich; Goetz, Friedrich

    2014-03-01

    Magnetic resonance imaging of the temporal bone has an important role in decision making with regard to cochlea implantation, especially in children with cochlear nerve deficiency. The purpose of this study was to evaluate the usefulness of the combination of an advanced high-resolution T2-weighted sequence with a surface coil in a 3-Tesla magnetic resonance imaging scanner in cases of suspected cochlear nerve aplasia. Prospective study. Seven patients with cochlear nerve hypoplasia or aplasia were prospectively examined using a high-resolution three-dimensional variable flip-angle turbo spin-echo sequence using a surface coil, and the images were compared with the same sequence in standard resolution using a standard head coil. Three neuroradiologists evaluated the magnetic resonance images independently, rating the visibility of the nerves in diagnosing hypoplasia or aplasia. Eight ears in seven patients with hypoplasia or aplasia of the cochlear nerve were examined. The average age was 2.7 years (range, 9 months-5 years). Seven ears had accompanying malformations. The inter-rater reliability in diagnosing hypoplasia or aplasia was greater using the high-resolution three-dimensional variable flip-angle turbo spin-echo sequence (fixed-marginal kappa: 0.64) than with the same sequence in lower resolution (fixed-marginal kappa: 0.06). Examining cases of suspected cochlear nerve aplasia using the high-resolution three-dimensional variable flip-angle turbo spin-echo sequence in combination with a surface coil shows significant improvement over standard methods. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  19. Comparative genomics of citric-acid producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andersen, Mikael R.; Salazar, Margarita; Schaap, Peter

    2011-06-01

    The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compels additional exploration. We therefore undertook whole genome sequencing of the acidogenic A. niger wild type strain (ATCC 1015), and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence and half the telomeric regionsmore » have been elucidated. Moreover, sequence information from ATCC 1015 was utilized to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 megabase of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis revealed up-regulation of the electron transport chain, specifically the alternative oxidative pathway in ATCC 1015, while CBS 513.88 showed significant up regulation of genes associated with biosynthesis of amino acids that are abundant in glucoamylase A, tRNA-synthases and protein transporters.« less

  20. DNA-A of a highly pathogenic Indian cassava mosaic virus isolated from Jatropha curcas causes symptoms in Nicotiana benthamiana.

    PubMed

    Wang, Gang; Sun, Yanwei; Xu, Ruirui; Qu, Jing; Tee, Chuansia; Jiang, Xiyuan; Ye, Jian

    2014-04-01

    Jatropha curcas mosaic disease (JcMD) is a newly emerging disease that has been reported in Africa and India. Here, we report the complete nucleotide sequence of a new Indian cassava mosaic virus isolate (ICMV-SG) from Singapore. Infection of ICMV-SG showed more severe JcMD in Jatropha curcas and Nicotiana benthamiana than the other ICMV isolates reported previously, though ICMV-SG shares high sequence identity with the other ICMV isolates. Agroinfectious DNA-A alone sufficiently induced systemic symptoms in N. benthamiana, but not in J. curcas. Results from agroinfection assays showed that systemic infection of ICMV-SG in J. curcas required both DNA-A and DNA-B components.

  1. Efficient error correction for next-generation sequencing of viral amplicons

    PubMed Central

    2012-01-01

    Background Next-generation sequencing allows the analysis of an unprecedented number of viral sequence variants from infected patients, presenting a novel opportunity for understanding virus evolution, drug resistance and immune escape. However, sequencing in bulk is error prone. Thus, the generated data require error identification and correction. Most error-correction methods to date are not optimized for amplicon analysis and assume that the error rate is randomly distributed. Recent quality assessment of amplicon sequences obtained using 454-sequencing showed that the error rate is strongly linked to the presence and size of homopolymers, position in the sequence and length of the amplicon. All these parameters are strongly sequence specific and should be incorporated into the calibration of error-correction algorithms designed for amplicon sequencing. Results In this paper, we present two new efficient error correction algorithms optimized for viral amplicons: (i) k-mer-based error correction (KEC) and (ii) empirical frequency threshold (ET). Both were compared to a previously published clustering algorithm (SHORAH), in order to evaluate their relative performance on 24 experimental datasets obtained by 454-sequencing of amplicons with known sequences. All three algorithms show similar accuracy in finding true haplotypes. However, KEC and ET were significantly more efficient than SHORAH in removing false haplotypes and estimating the frequency of true ones. Conclusions Both algorithms, KEC and ET, are highly suitable for rapid recovery of error-free haplotypes obtained by 454-sequencing of amplicons from heterogeneous viruses. The implementations of the algorithms and data sets used for their testing are available at: http://alan.cs.gsu.edu/NGS/?q=content/pyrosequencing-error-correction-algorithm PMID:22759430

  2. Efficient error correction for next-generation sequencing of viral amplicons.

    PubMed

    Skums, Pavel; Dimitrova, Zoya; Campo, David S; Vaughan, Gilberto; Rossi, Livia; Forbi, Joseph C; Yokosawa, Jonny; Zelikovsky, Alex; Khudyakov, Yury

    2012-06-25

    Next-generation sequencing allows the analysis of an unprecedented number of viral sequence variants from infected patients, presenting a novel opportunity for understanding virus evolution, drug resistance and immune escape. However, sequencing in bulk is error prone. Thus, the generated data require error identification and correction. Most error-correction methods to date are not optimized for amplicon analysis and assume that the error rate is randomly distributed. Recent quality assessment of amplicon sequences obtained using 454-sequencing showed that the error rate is strongly linked to the presence and size of homopolymers, position in the sequence and length of the amplicon. All these parameters are strongly sequence specific and should be incorporated into the calibration of error-correction algorithms designed for amplicon sequencing. In this paper, we present two new efficient error correction algorithms optimized for viral amplicons: (i) k-mer-based error correction (KEC) and (ii) empirical frequency threshold (ET). Both were compared to a previously published clustering algorithm (SHORAH), in order to evaluate their relative performance on 24 experimental datasets obtained by 454-sequencing of amplicons with known sequences. All three algorithms show similar accuracy in finding true haplotypes. However, KEC and ET were significantly more efficient than SHORAH in removing false haplotypes and estimating the frequency of true ones. Both algorithms, KEC and ET, are highly suitable for rapid recovery of error-free haplotypes obtained by 454-sequencing of amplicons from heterogeneous viruses.The implementations of the algorithms and data sets used for their testing are available at: http://alan.cs.gsu.edu/NGS/?q=content/pyrosequencing-error-correction-algorithm.

  3. Recent amplification and impact of MITEs on the genome of grapevine (Vitis vinifera L.)

    PubMed Central

    Benjak, Andrej; Boué, Stéphanie; Forneck, Astrid

    2009-01-01

    Miniature inverted-repeat transposable elements (MITEs) are a particular type of defective class II transposons present in genomes as highly homogeneous populations of small elements. Their high copy number and close association to genes make their potential impact on gene evolution particularly relevant. Here, we present a detailed analysis of the MITE families directly related to grapevine “cut-and-paste” transposons. Our results show that grapevine MITEs have transduplicated and amplified genomic sequences, including gene sequences and fragments of other mobile elements. Our results also show that although some of the MITE families were already present in the ancestor of the European and American Vitis wild species, they have been amplified and have been actively transposing accompanying grapevine domestication and breeding. We show that MITEs are abundant in grapevine and some of them are frequently inserted within the untranslated regions of grapevine genes. MITE insertions are highly polymorphic among grapevine cultivars, which frequently generate transcript variability. The data presented here show that MITEs have greatly contributed to the grapevine genetic diversity which has been used for grapevine domestication and breeding. PMID:20333179

  4. Deep Sequencing Analysis of RNAs from Citrus Plants Grown in a Citrus Sudden Death-Affected Area Reveals Diverse Known and Putative Novel Viruses.

    PubMed

    Matsumura, Emilyn E; Coletta-Filho, Helvecio D; Nouri, Shahideh; Falk, Bryce W; Nerva, Luca; Oliveira, Tiago S; Dorta, Silvia O; Machado, Marcos A

    2017-04-24

    Citrus sudden death (CSD) has caused the death of approximately four million orange trees in a very important citrus region in Brazil. Although its etiology is still not completely clear, symptoms and distribution of affected plants indicate a viral disease. In a search for viruses associated with CSD, we have performed a comparative high-throughput sequencing analysis of the transcriptome and small RNAs from CSD-symptomatic and -asymptomatic plants using the Illumina platform. The data revealed mixed infections that included Citrus tristeza virus (CTV) as the most predominant virus, followed by the Citrus sudden death-associated virus (CSDaV), Citrus endogenous pararetrovirus (CitPRV) and two putative novel viruses tentatively named Citrus jingmen-like virus (CJLV), and Citrus virga-like virus (CVLV). The deep sequencing analyses were sensitive enough to differentiate two genotypes of both viruses previously associated with CSD-affected plants: CTV and CSDaV. Our data also showed a putative association of the CSD-symptomatic plants with a specific CSDaV genotype and a likely association with CitPRV as well, whereas the two putative novel viruses showed to be more associated with CSD-asymptomatic plants. This is the first high-throughput sequencing-based study of the viral sequences present in CSD-affected citrus plants, and generated valuable information for further CSD studies.

  5. Parallel algorithms for large-scale biological sequence alignment on Xeon-Phi based clusters.

    PubMed

    Lan, Haidong; Chan, Yuandong; Xu, Kai; Schmidt, Bertil; Peng, Shaoliang; Liu, Weiguo

    2016-07-19

    Computing alignments between two or more sequences are common operations frequently performed in computational molecular biology. The continuing growth of biological sequence databases establishes the need for their efficient parallel implementation on modern accelerators. This paper presents new approaches to high performance biological sequence database scanning with the Smith-Waterman algorithm and the first stage of progressive multiple sequence alignment based on the ClustalW heuristic on a Xeon Phi-based compute cluster. Our approach uses a three-level parallelization scheme to take full advantage of the compute power available on this type of architecture; i.e. cluster-level data parallelism, thread-level coarse-grained parallelism, and vector-level fine-grained parallelism. Furthermore, we re-organize the sequence datasets and use Xeon Phi shuffle operations to improve I/O efficiency. Evaluations show that our method achieves a peak overall performance up to 220 GCUPS for scanning real protein sequence databanks on a single node consisting of two Intel E5-2620 CPUs and two Intel Xeon Phi 7110P cards. It also exhibits good scalability in terms of sequence length and size, and number of compute nodes for both database scanning and multiple sequence alignment. Furthermore, the achieved performance is highly competitive in comparison to optimized Xeon Phi and GPU implementations. Our implementation is available at https://github.com/turbo0628/LSDBS-mpi .

  6. Impact of cultivation on characterisation of species composition of soil bacterial communities.

    PubMed

    McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.

    2001-03-01

    The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated during direct analysis of the same soil and from a wide range of other sample types studied elsewhere. The study demonstrates the value of fine-scale molecular analysis for identification of laboratory isolates and indicates the culturability of approximately 1% of the total population but under a restricted range of media and cultivation conditions.

  7. TU-H-CAMPUS-IeP2-01: Quantitative Evaluation of PROPELLER DWI Using QIBA Diffusion Phantom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yung, J; Ai, H; Liu, H

    Purpose: The purpose of this study is to determine the quantitative variability of apparent diffusion coefficient (ADC) values when varying imaging parameters in a diffusion-weighted (DW) fast spin echo (FSE) sequence with Periodically Rotated Overlapping ParallEL Lines with Enhanced Reconstruction (PROPELLER) k-space trajectory. Methods: Using a 3T MRI scanner, a NIST traceable, quantitative magnetic resonance imaging (MRI) diffusion phantom (High Precision Devices, Inc, Boulder, Colorado) consisting of 13 vials filled with various concentrations of polymer polyvinylpyrrolidone (PVP) in aqueous solution was imaged with a standard Quantitative Imaging Biomarkers Alliance (QIBA) DWI spin echo, echo planar imaging (SE EPI) acquisition. Themore » same phantom was then imaged with a DWI PROPELLER sequence at varying echo train lengths (ETL) of 8, 20, and 32, as well as b-values of 400, 900, and 2000. QIBA DWI phantom analysis software was used to generate ADC maps and create region of interests (ROIs) for quantitative measurements of each vial. Mean and standard deviations of the ROIs were compared. Results: The SE EPI sequence generated ADC values that showed very good agreement with the known ADC values of the phantom (r2 = 0.9995, slope = 1.0061). The ADC values measured from the PROPELLER sequences were inflated, but were highly correlated with an r2 range from 0.8754 to 0.9880. The PROPELLER sequence with an ETL=20 and b-value of 0 and 2000 showed the closest agreement (r2 = 0.9034, slope = 0.9880). Conclusion: The DW PROPELLER sequence is promising for quantitative evaluation of ADC values. A drawback of the PROPELLER sequence is the longer acquisition time. The 180° refocusing pulses may also cause the observed increase in ADC values compared to the standard SE EPI DW sequence. However, the FSE sequence offers an advantage with in-plane motion and geometric distortion which will be investigated in future studies.« less

  8. Porcine parvovirus: DNA sequence and genome organization.

    PubMed

    Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

    1989-10-01

    We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

  9. Searching for resistance genes to Bursaphelenchus xylophilus using high throughput screening.

    PubMed

    Santos, Carla S; Pinheiro, Miguel; Silva, Ana I; Egas, Conceição; Vasconcelos, Marta W

    2012-11-07

    Pine wilt disease (PWD), caused by the pinewood nematode (PWN; Bursaphelenchus xylophilus), damages and kills pine trees and is causing serious economic damage worldwide. Although the ecological mechanism of infestation is well described, the plant's molecular response to the pathogen is not well known. This is due mainly to the lack of genomic information and the complexity of the disease. High throughput sequencing is now an efficient approach for detecting the expression of genes in non-model organisms, thus providing valuable information in spite of the lack of the genome sequence. In an attempt to unravel genes potentially involved in the pine defense against the pathogen, we hereby report the high throughput comparative sequence analysis of infested and non-infested stems of Pinus pinaster (very susceptible to PWN) and Pinus pinea (less susceptible to PWN). Four cDNA libraries from infested and non-infested stems of P. pinaster and P. pinea were sequenced in a full 454 GS FLX run, producing a total of 2,083,698 reads. The putative amino acid sequences encoded by the assembled transcripts were annotated according to Gene Ontology, to assign Pinus contigs into Biological Processes, Cellular Components and Molecular Functions categories. Most of the annotated transcripts corresponded to Picea genes-25.4-39.7%, whereas a smaller percentage, matched Pinus genes, 1.8-12.8%, probably a consequence of more public genomic information available for Picea than for Pinus. The comparative transcriptome analysis showed that when P. pinaster was infested with PWN, the genes malate dehydrogenase, ABA, water deficit stress related genes and PAR1 were highly expressed, while in PWN-infested P. pinea, the highly expressed genes were ricin B-related lectin, and genes belonging to the SNARE and high mobility group families. Quantitative PCR experiments confirmed the differential gene expression between the two pine species. Defense-related genes triggered by nematode infestation were detected in both P. pinaster and P. pinea transcriptomes utilizing 454 pyrosequencing technology. P. pinaster showed higher abundance of genes related to transcriptional regulation, terpenoid secondary metabolism (including some with nematicidal activity) and pathogen attack. P. pinea showed higher abundance of genes related to oxidative stress and higher levels of expression in general of stress responsive genes. This study provides essential information about the molecular defense mechanisms utilized by P. pinaster and P. pinea against PWN infestation and contributes to a better understanding of PWD.

  10. Transcriptomics of the Bed Bug (Cimex lectularius)

    PubMed Central

    Rajarapu, Swapna P.; Jones, Susan C.; Mittapalli, Omprakash

    2011-01-01

    Background Bed bugs (Cimex lectularius) are blood-feeding insects poised to become one of the major pests in households throughout the United States. Resistance of C. lectularius to insecticides/pesticides is one factor thought to be involved in its sudden resurgence. Despite its high-impact status, scant knowledge exists at the genomic level for C. lectularius. Hence, we subjected the C. lectularius transcriptome to 454 pyrosequencing in order to identify potential genes involved in pesticide resistance. Methodology and Principal Findings Using 454 pyrosequencing, we obtained a total of 216,419 reads with 79,596,412 bp, which were assembled into 35,646 expressed sequence tags (3902 contigs and 31744 singletons). Nearly 85.9% of the C. lectularius sequences showed similarity to insect sequences, but 44.8% of the deduced proteins of C. lectularius did not show similarity with sequences in the GenBank non-redundant database. KEGG analysis revealed putative members of several detoxification pathways involved in pesticide resistance. Lamprin domains, Protein Kinase domains, Protein Tyrosine Kinase domains and cytochrome P450 domains were among the top Pfam domains predicted for the C. lectularius sequences. An initial assessment of putative defense genes, including a cytochrome P450 and a glutathione-S-transferase (GST), revealed high transcript levels for the cytochrome P450 (CYP9) in pesticide-exposed versus pesticide-susceptible C. lectularius populations. A significant number of single nucleotide polymorphisms (296) and microsatellite loci (370) were predicted in the C. lectularius sequences. Furthermore, 59 putative sequences of Wolbachia were retrieved from the database. Conclusions To our knowledge this is the first study to elucidate the genetic makeup of C. lectularius. This pyrosequencing effort provides clues to the identification of potential detoxification genes involved in pesticide resistance of C. lectularius and lays the foundation for future functional genomics studies. PMID:21283830

  11. Image correlation method for DNA sequence alignment.

    PubMed

    Curilem Saldías, Millaray; Villarroel Sassarini, Felipe; Muñoz Poblete, Carlos; Vargas Vásquez, Asticio; Maureira Butler, Iván

    2012-01-01

    The complexity of searches and the volume of genomic data make sequence alignment one of bioinformatics most active research areas. New alignment approaches have incorporated digital signal processing techniques. Among these, correlation methods are highly sensitive. This paper proposes a novel sequence alignment method based on 2-dimensional images, where each nucleic acid base is represented as a fixed gray intensity pixel. Query and known database sequences are coded to their pixel representation and sequence alignment is handled as object recognition in a scene problem. Query and database become object and scene, respectively. An image correlation process is carried out in order to search for the best match between them. Given that this procedure can be implemented in an optical correlator, the correlation could eventually be accomplished at light speed. This paper shows an initial research stage where results were "digitally" obtained by simulating an optical correlation of DNA sequences represented as images. A total of 303 queries (variable lengths from 50 to 4500 base pairs) and 100 scenes represented by 100 x 100 images each (in total, one million base pair database) were considered for the image correlation analysis. The results showed that correlations reached very high sensitivity (99.01%), specificity (98.99%) and outperformed BLAST when mutation numbers increased. However, digital correlation processes were hundred times slower than BLAST. We are currently starting an initiative to evaluate the correlation speed process of a real experimental optical correlator. By doing this, we expect to fully exploit optical correlation light properties. As the optical correlator works jointly with the computer, digital algorithms should also be optimized. The results presented in this paper are encouraging and support the study of image correlation methods on sequence alignment.

  12. Molecular variation and horizontal gene transfer of the homocysteine methyltransferase gene mmuM and its distribution in clinical pathogens.

    PubMed

    Ying, Jianchao; Wang, Huifeng; Bao, Bokan; Zhang, Ying; Zhang, Jinfang; Zhang, Cheng; Li, Aifang; Lu, Junwan; Li, Peizhen; Ying, Jun; Liu, Qi; Xu, Teng; Yi, Huiguang; Li, Jinsong; Zhou, Li; Zhou, Tieli; Xu, Zuyuan; Ni, Liyan; Bao, Qiyu

    2015-01-01

    The homocysteine methyltransferase encoded by mmuM is widely distributed among microbial organisms. It is the key enzyme that catalyzes the last step in methionine biosynthesis and plays an important role in the metabolism process. It also enables the microbial organisms to tolerate high concentrations of selenium in the environment. In this research, 533 mmuM gene sequences covering 70 genera of the bacteria were selected from GenBank database. The distribution frequency of mmuM is different in the investigated genera of bacteria. The mapping results of 160 mmuM reference sequences showed that the mmuM genes were found in 7 species of pathogen genomes sequenced in this work. The polymerase chain reaction products of one mmuM genotype (NC_013951 as the reference) were sequenced and the sequencing results confirmed the mapping results. Furthermore, 144 representative sequences were chosen for phylogenetic analysis and some mmuM genes from totally different genera (such as the genes between Escherichia and Klebsiella and between Enterobacter and Kosakonia) shared closer phylogenetic relationship than those from the same genus. Comparative genomic analysis of the mmuM encoding regions on plasmids and bacterial chromosomes showed that pKF3-140 and pIP1206 plasmids shared a 21 kb homology region and a 4.9 kb fragment in this region was in fact originated from the Escherichia coli chromosome. These results further suggested that mmuM gene did go through the gene horizontal transfer among different species or genera of bacteria. High-throughput sequencing combined with comparative genomics analysis would explore distribution and dissemination of the mmuM gene among bacteria and its evolution at a molecular level.

  13. The mitochondrial genome of the legume Vigna radiata and the analysis of recombination across short mitochondrial repeats.

    PubMed

    Alverson, Andrew J; Zhuo, Shi; Rice, Danny W; Sloan, Daniel B; Palmer, Jeffrey D

    2011-01-20

    The mitochondrial genomes of seed plants are exceptionally fluid in size, structure, and sequence content, with the accumulation and activity of repetitive sequences underlying much of this variation. We report the first fully sequenced mitochondrial genome of a legume, Vigna radiata (mung bean), and show that despite its unexceptional size (401,262 nt), the genome is unusually depauperate in repetitive DNA and "promiscuous" sequences from the chloroplast and nuclear genomes. Although Vigna lacks the large, recombinationally active repeats typical of most other seed plants, a PCR survey of its modest repertoire of short (38-297 nt) repeats nevertheless revealed evidence for recombination across all of them. A set of novel control assays showed, however, that these results could instead reflect, in part or entirely, artifacts of PCR-mediated recombination. Consequently, we recommend that other methods, especially high-depth genome sequencing, be used instead of PCR to infer patterns of plant mitochondrial recombination. The average-sized but repeat- and feature-poor mitochondrial genome of Vigna makes it ever more difficult to generalize about the factors shaping the size and sequence content of plant mitochondrial genomes.

  14. Continuous- and discrete-time stimulus sequences for high stimulus rate paradigm in evoked potential studies.

    PubMed

    Wang, Tao; Huang, Jiang-hua; Lin, Lin; Zhan, Chang'an A

    2013-01-01

    To obtain reliable transient auditory evoked potentials (AEPs) from EEGs recorded using high stimulus rate (HSR) paradigm, it is critical to design the stimulus sequences of appropriate frequency properties. Traditionally, the individual stimulus events in a stimulus sequence occur only at discrete time points dependent on the sampling frequency of the recording system and the duration of stimulus sequence. This dependency likely causes the implementation of suboptimal stimulus sequences, sacrificing the reliability of resulting AEPs. In this paper, we explicate the use of continuous-time stimulus sequence for HSR paradigm, which is independent of the discrete electroencephalogram (EEG) recording system. We employ simulation studies to examine the applicability of the continuous-time stimulus sequences and the impacts of sampling frequency on AEPs in traditional studies using discrete-time design. Results from these studies show that the continuous-time sequences can offer better frequency properties and improve the reliability of recovered AEPs. Furthermore, we find that the errors in the recovered AEPs depend critically on the sampling frequencies of experimental systems, and their relationship can be fitted using a reciprocal function. As such, our study contributes to the literature by demonstrating the applicability and advantages of continuous-time stimulus sequences for HSR paradigm and by revealing the relationship between the reliability of AEPs and sampling frequencies of the experimental systems when discrete-time stimulus sequences are used in traditional manner for the HSR paradigm.

  15. Combinatorial Pooling Enables Selective Sequencing of the Barley Gene Space

    PubMed Central

    Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R.; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J.

    2013-01-01

    For the vast majority of species – including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding. PMID:23592960

  16. Combinatorial pooling enables selective sequencing of the barley gene space.

    PubMed

    Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J

    2013-04-01

    For the vast majority of species - including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding.

  17. HMMER Cut-off Threshold Tool (HMMERCTTER): Supervised classification of superfamily protein sequences with a reliable cut-off threshold.

    PubMed

    Pagnuco, Inti Anabela; Revuelta, María Victoria; Bondino, Hernán Gabriel; Brun, Marcel; Ten Have, Arjen

    2018-01-01

    Protein superfamilies can be divided into subfamilies of proteins with different functional characteristics. Their sequences can be classified hierarchically, which is part of sequence function assignation. Typically, there are no clear subfamily hallmarks that would allow pattern-based function assignation by which this task is mostly achieved based on the similarity principle. This is hampered by the lack of a score cut-off that is both sensitive and specific. HMMER Cut-off Threshold Tool (HMMERCTTER) adds a reliable cut-off threshold to the popular HMMER. Using a high quality superfamily phylogeny, it clusters a set of training sequences such that the cluster-specific HMMER profiles show cluster or subfamily member detection with 100% precision and recall (P&R), thereby generating a specific threshold as inclusion cut-off. Profiles and thresholds are then used as classifiers to screen a target dataset. Iterative inclusion of novel sequences to groups and the corresponding HMMER profiles results in high sensitivity while specificity is maintained by imposing 100% P&R self detection. In three presented case studies of protein superfamilies, classification of large datasets with 100% precision was achieved with over 95% recall. Limits and caveats are presented and explained. HMMERCTTER is a promising protein superfamily sequence classifier provided high quality training datasets are used. It provides a decision support system that aids in the difficult task of sequence function assignation in the twilight zone of sequence similarity. All relevant data and source codes are available from the Github repository at the following URL: https://github.com/BBCMdP/HMMERCTTER.

  18. HMMER Cut-off Threshold Tool (HMMERCTTER): Supervised classification of superfamily protein sequences with a reliable cut-off threshold

    PubMed Central

    Pagnuco, Inti Anabela; Revuelta, María Victoria; Bondino, Hernán Gabriel; Brun, Marcel

    2018-01-01

    Background Protein superfamilies can be divided into subfamilies of proteins with different functional characteristics. Their sequences can be classified hierarchically, which is part of sequence function assignation. Typically, there are no clear subfamily hallmarks that would allow pattern-based function assignation by which this task is mostly achieved based on the similarity principle. This is hampered by the lack of a score cut-off that is both sensitive and specific. Results HMMER Cut-off Threshold Tool (HMMERCTTER) adds a reliable cut-off threshold to the popular HMMER. Using a high quality superfamily phylogeny, it clusters a set of training sequences such that the cluster-specific HMMER profiles show cluster or subfamily member detection with 100% precision and recall (P&R), thereby generating a specific threshold as inclusion cut-off. Profiles and thresholds are then used as classifiers to screen a target dataset. Iterative inclusion of novel sequences to groups and the corresponding HMMER profiles results in high sensitivity while specificity is maintained by imposing 100% P&R self detection. In three presented case studies of protein superfamilies, classification of large datasets with 100% precision was achieved with over 95% recall. Limits and caveats are presented and explained. Conclusions HMMERCTTER is a promising protein superfamily sequence classifier provided high quality training datasets are used. It provides a decision support system that aids in the difficult task of sequence function assignation in the twilight zone of sequence similarity. All relevant data and source codes are available from the Github repository at the following URL: https://github.com/BBCMdP/HMMERCTTER. PMID:29579071

  19. The (in)complete organelle genome: exploring the use and nonuse of available technologies for characterizing mitochondrial and plastid chromosomes.

    PubMed

    Sanitá Lima, Matheus; Woods, Laura C; Cartwright, Matthew W; Smith, David Roy

    2016-11-01

    Not long ago, scientists paid dearly in time, money and skill for every nucleotide that they sequenced. Today, DNA sequencing technologies epitomize the slogan 'faster, easier, cheaper and more', and in many ways, sequencing an entire genome has become routine, even for the smallest laboratory groups. This is especially true for mitochondrial and plastid genomes. Given their relatively small sizes and high copy numbers per cell, organelle DNAs are currently among the most highly sequenced kind of chromosome. But accurately characterizing an organelle genome and the information it encodes can require much more than DNA sequencing and bioinformatics analyses. Organelle genomes can be surprisingly complex and can exhibit convoluted and unconventional modes of gene expression. Unravelling this complexity can demand a wide assortment of experiments, from pulsed-field gel electrophoresis to Southern and Northern blots to RNA analyses. Here, we show that it is exactly these types of 'complementary' analyses that are often lacking from contemporary organelle genome papers, particularly short 'genome announcement' articles. Consequently, crucial and interesting features of organelle chromosomes are going undescribed, which could ultimately lead to a poor understanding and even a misrepresentation of these genomes and the genes they express. High-throughput sequencing and bioinformatics have made it easy to sequence and assemble entire chromosomes, but they should not be used as a substitute for or at the expense of other types of genomic characterization methods. © 2016 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  20. Magnetic flux density measurement with balanced steady state free precession pulse sequence for MREIT: a simulation study.

    PubMed

    Minhas, Atul S; Woo, Eung Je; Lee, Soo Yeol

    2009-01-01

    Magnetic Resonance Electrical Impedance Tomography (MREIT) utilizes the magnetic flux density B(z), generated due to current injection, to find conductivity distribution inside an object. This B(z) can be measured from MR phase images using spin echo pulse sequence. The SNR of B(z) and the sensitivity of phase produced by B(z) in MR phase image are critical in deciding the resolution of MREIT conductivity images. The conventional spin echo based data acquisition has poor phase sensitivity to current injection. Longer scan time is needed to acquire data with higher SNR. We propose a balanced steady state free precession (b-SSFP) based pulse sequence which is highly sensitive to small off-resonance phase changes. A procedure to reconstruct B(z) from MR signal obtained with b-SSFP sequence is described. Phases for b-SSFP signals for two conductivity phantoms of TX 151 and Gelatin are simulated from the mathematical models of b-SSFP signal. It was observed that the phase changes obtained from b-SSFP pulse sequence are highly sensitive to current injection and hence would produce higher magnetic flux density. However, the b-SSFP signal is dependent on magnetic field inhomogeneity and the signal deteriorated highly for small offset from resonance frequency. The simulation results show that the b-SSFP sequence can be utilized for conductivity imaging of a local region where magnetic field inhomogeneity is small. A proper shimming of magnet is recommended before using the b-SSFP sequence.

  1. Gradient-Induced Voltages on 12-Lead ECGs during High Duty-Cycle MRI Sequences and a Method for Their Removal considering Linear and Concomitant Gradient Terms

    PubMed Central

    Zhang, Shelley HuaLei; Ho Tse, Zion Tsz; Dumoulin, Charles L.; Kwong, Raymond Y.; Stevenson, William G.; Watkins, Ronald; Ward, Jay; Wang, Wei; Schmidt, Ehud J.

    2015-01-01

    Purpose To restore 12-lead ECG signal fidelity inside MRI by removing magnetic-field gradient induced-voltages during high gradient-duty-cycle sequences. Theory and Methods A theoretical equation was derived, providing first- and second-order electrical fields induced at individual ECG electrode as a function of gradient fields. Experiments were performed at 3T on healthy volunteers, using a customized acquisition system which captured full amplitude and frequency response of ECGs, or a commercial recording system. The 19 equation coefficients were derived by linear regression of data from accelerated sequences, and used to compute induced-voltages in real-time during full-resolution sequences to remove ECG artifacts. Restored traces were evaluated relative to ones acquired without imaging. Results Measured induced-voltages were 0.7V peak-to-peak during balanced Steady-State Free Precession (bSSFP) with heart at the isocenter. Applying the equation during gradient echo sequencing, three-dimensional fast spin echo and multi-slice bSSFP imaging restored nonsaturated traces and second-order concomitant terms showed larger contributions in electrodes farther from the magnet isocenter. Equation coefficients are evaluated with high repeatability (ρ = 0.996) and are subject, sequence, and slice-orientation dependent. Conclusion Close agreement between theoretical and measured gradient-induced voltages allowed for real-time removal. Prospective estimation of sequence-periods where large induced-voltages occur may allow hardware removal of these signals. PMID:26101951

  2. Development of a genus-specific next generation sequencing approach for sensitive and quantitative determination of the Legionella microbiome in freshwater systems.

    PubMed

    Pereira, Rui P A; Peplies, Jörg; Brettar, Ingrid; Höfle, Manfred G

    2017-03-31

    Next Generation Sequencing (NGS) has revolutionized the analysis of natural and man-made microbial communities by using universal primers for bacteria in a PCR based approach targeting the 16S rRNA gene. In our study we narrowed primer specificity to a single, monophyletic genus because for many questions in microbiology only a specific part of the whole microbiome is of interest. We have chosen the genus Legionella, comprising more than 20 pathogenic species, due to its high relevance for water-based respiratory infections. A new NGS-based approach was designed by sequencing 16S rRNA gene amplicons specific for the genus Legionella using the Illumina MiSeq technology. This approach was validated and applied to a set of representative freshwater samples. Our results revealed that the generated libraries presented a low average raw error rate per base (<0.5%); and substantiated the use of high-fidelity enzymes, such as KAPA HiFi, for increased sequence accuracy and quality. The approach also showed high in situ specificity (>95%) and very good repeatability. Only in samples in which the gammabacterial clade SAR86 was present more than 1% non-Legionella sequences were observed. Next-generation sequencing read counts did not reveal considerable amplification/sequencing biases and showed a sensitive as well as precise quantification of L. pneumophila along a dilution range using a spiked-in, certified genome standard. The genome standard and a mock community consisting of six different Legionella species demonstrated that the developed NGS approach was quantitative and specific at the level of individual species, including L. pneumophila. The sensitivity of our genus-specific approach was at least one order of magnitude higher compared to the universal NGS approach. Comparison of quantification by real-time PCR showed consistency with the NGS data. Overall, our NGS approach can determine the quantitative abundances of Legionella species, i. e. the complete Legionella microbiome, without the need for species-specific primers. The developed NGS approach provides a new molecular surveillance tool to monitor all Legionella species in qualitative and quantitative terms if a spiked-in genome standard is used to calibrate the method. Overall, the genus-specific NGS approach opens up a new avenue to massive parallel diagnostics in a quantitative, specific and sensitive way.

  3. Determination of the melon chloroplast and mitochondrial genome sequences reveals that the largest reported mitochondrial genome in plants contains a significant amount of DNA having a nuclear origin

    PubMed Central

    2011-01-01

    Background The melon belongs to the Cucurbitaceae family, whose economic importance among vegetable crops is second only to Solanaceae. The melon has a small genome size (454 Mb), which makes it suitable for molecular and genetic studies. Despite similar nuclear and chloroplast genome sizes, cucurbits show great variation when their mitochondrial genomes are compared. The melon possesses the largest plant mitochondrial genome, as much as eight times larger than that of other cucurbits. Results The nucleotide sequences of the melon chloroplast and mitochondrial genomes were determined. The chloroplast genome (156,017 bp) included 132 genes, with 98 single-copy genes dispersed between the small (SSC) and large (LSC) single-copy regions and 17 duplicated genes in the inverted repeat regions (IRa and IRb). A comparison of the cucumber and melon chloroplast genomes showed differences in only approximately 5% of nucleotides, mainly due to short indels and SNPs. Additionally, 2.74 Mb of mitochondrial sequence, accounting for 95% of the estimated mitochondrial genome size, were assembled into five scaffolds and four additional unscaffolded contigs. An 84% of the mitochondrial genome is contained in a single scaffold. The gene-coding region accounted for 1.7% (45,926 bp) of the total sequence, including 51 protein-coding genes, 4 conserved ORFs, 3 rRNA genes and 24 tRNA genes. Despite the differences observed in the mitochondrial genome sizes of cucurbit species, Citrullus lanatus (379 kb), Cucurbita pepo (983 kb) and Cucumis melo (2,740 kb) share 120 kb of sequence, including the predicted protein-coding regions. Nevertheless, melon contained a high number of repetitive sequences and a high content of DNA of nuclear origin, which represented 42% and 47% of the total sequence, respectively. Conclusions Whereas the size and gene organisation of chloroplast genomes are similar among the cucurbit species, mitochondrial genomes show a wide variety of sizes, with a non-conserved structure both in gene number and organisation, as well as in the features of the noncoding DNA. The transfer of nuclear DNA to the melon mitochondrial genome and the high proportion of repetitive DNA appear to explain the size of the largest mitochondrial genome reported so far. PMID:21854637

  4. Prediction of novel pre-microRNAs with high accuracy through boosting and SVM.

    PubMed

    Zhang, Yuanwei; Yang, Yifan; Zhang, Huan; Jiang, Xiaohua; Xu, Bo; Xue, Yu; Cao, Yunxia; Zhai, Qian; Zhai, Yong; Xu, Mingqing; Cooke, Howard J; Shi, Qinghua

    2011-05-15

    High-throughput deep-sequencing technology has generated an unprecedented number of expressed short sequence reads, presenting not only an opportunity but also a challenge for prediction of novel microRNAs. To verify the existence of candidate microRNAs, we have to show that these short sequences can be processed from candidate pre-microRNAs. However, it is laborious and time consuming to verify these using existing experimental techniques. Therefore, here, we describe a new method, miRD, which is constructed using two feature selection strategies based on support vector machines (SVMs) and boosting method. It is a high-efficiency tool for novel pre-microRNA prediction with accuracy up to 94.0% among different species. miRD is implemented in PHP/PERL+MySQL+R and can be freely accessed at http://mcg.ustc.edu.cn/rpg/mird/mird.php.

  5. Optimizing Illumina next-generation sequencing library preparation for extremely AT-biased genomes.

    PubMed

    Oyola, Samuel O; Otto, Thomas D; Gu, Yong; Maslen, Gareth; Manske, Magnus; Campino, Susana; Turner, Daniel J; Macinnis, Bronwyn; Kwiatkowski, Dominic P; Swerdlow, Harold P; Quail, Michael A

    2012-01-03

    Massively parallel sequencing technology is revolutionizing approaches to genomic and genetic research. Since its advent, the scale and efficiency of Next-Generation Sequencing (NGS) has rapidly improved. In spite of this success, sequencing genomes or genomic regions with extremely biased base composition is still a great challenge to the currently available NGS platforms. The genomes of some important pathogenic organisms like Plasmodium falciparum (high AT content) and Mycobacterium tuberculosis (high GC content) display extremes of base composition. The standard library preparation procedures that employ PCR amplification have been shown to cause uneven read coverage particularly across AT and GC rich regions, leading to problems in genome assembly and variation analyses. Alternative library-preparation approaches that omit PCR amplification require large quantities of starting material and hence are not suitable for small amounts of DNA/RNA such as those from clinical isolates. We have developed and optimized library-preparation procedures suitable for low quantity starting material and tolerant to extremely high AT content sequences. We have used our optimized conditions in parallel with standard methods to prepare Illumina sequencing libraries from a non-clinical and a clinical isolate (containing ~53% host contamination). By analyzing and comparing the quality of sequence data generated, we show that our optimized conditions that involve a PCR additive (TMAC), produces amplified libraries with improved coverage of extremely AT-rich regions and reduced bias toward GC neutral templates. We have developed a robust and optimized Next-Generation Sequencing library amplification method suitable for extremely AT-rich genomes. The new amplification conditions significantly reduce bias and retain the complexity of either extremes of base composition. This development will greatly benefit sequencing clinical samples that often require amplification due to low mass of DNA starting material.

  6. A genome-specific repetitive DNA sequence from Oryza eichingeri: characterization, localization, and introgression to O. sativa.

    PubMed

    Yan, H. H.; Liu, G. Q.; Cheng, Z. K.; Li, X. B.; Liu, G. Z.; Min, S. K.; Zhu, L.H.

    2002-02-01

    In the course of transferring the brown planthopper resistance from a diploid, CC-genome wild rice species, Oryza eichingeri (IRGC acc. 105159 and 105163), to the cultivated rice variety 02428, we have isolated many alien addition and introgression lines. The O. eichingeri chromatin in some of these lines has previously been identified using genomic in situ hybridization and molecular-marker analysis. Here we cloned a tandemly repetitive DNA sequence from O. eichingeri IRGC acc105163, and detected it in 25 introgression lines. This repetitive DNA sequence showed high specificity to the rice CC genome, but was absent from all the four tetraploid species with BBCC or CCDD genomes. The monomer in this repetitive DNA sequence is 325-366-bp long, with a copy number of about 5,000 per 1 C of the O. eichingerigenome, showing 88% homology to a repetitive DNA sequence isolated from Oryza officinalis(2n=2 x=24, CC). Fluorescent in situ hybridization revealed 11 signals distributed over eight O. eichingeri chromosomes, mostly in terminal or subterminal regions.

  7. Comparative Genomics of Interreplichore Translocations in Bacteria: A Measure of Chromosome Topology?

    PubMed

    Khedkar, Supriya; Seshasayee, Aswin Sai Narain

    2016-06-01

    Genomes evolve not only in base sequence but also in terms of their architecture, defined by gene organization and chromosome topology. Whereas genome sequence data inform us about the changes in base sequences for a large variety of organisms, the study of chromosome topology is restricted to a few model organisms studied using microscopy and chromosome conformation capture techniques. Here, we exploit whole genome sequence data to study the link between gene organization and chromosome topology in bacteria. Using comparative genomics across ∼250 pairs of closely related bacteria we show that: (a) many organisms show a high degree of interreplichore translocations throughout the chromosome and not limited to the inversion-prone terminus (ter) or the origin of replication (oriC); (b) translocation maps may reflect chromosome topologies; and (c) symmetric interreplichore translocations do not disrupt the distance of a gene from oriC or affect gene expression states or strand biases in gene densities. In summary, we suggest that translocation maps might be a first line in defining a gross chromosome topology given a pair of closely related genome sequences. Copyright © 2016 Khedkar and Seshasayee.

  8. Comparative Genomics of Interreplichore Translocations in Bacteria: A Measure of Chromosome Topology?

    PubMed Central

    Khedkar, Supriya; Seshasayee, Aswin Sai Narain

    2016-01-01

    Genomes evolve not only in base sequence but also in terms of their architecture, defined by gene organization and chromosome topology. Whereas genome sequence data inform us about the changes in base sequences for a large variety of organisms, the study of chromosome topology is restricted to a few model organisms studied using microscopy and chromosome conformation capture techniques. Here, we exploit whole genome sequence data to study the link between gene organization and chromosome topology in bacteria. Using comparative genomics across ∼250 pairs of closely related bacteria we show that: (a) many organisms show a high degree of interreplichore translocations throughout the chromosome and not limited to the inversion-prone terminus (ter) or the origin of replication (oriC); (b) translocation maps may reflect chromosome topologies; and (c) symmetric interreplichore translocations do not disrupt the distance of a gene from oriC or affect gene expression states or strand biases in gene densities. In summary, we suggest that translocation maps might be a first line in defining a gross chromosome topology given a pair of closely related genome sequences. PMID:27172194

  9. Genetic variation among wild lake trout populations: the 'wanted' and the 'unwanted'

    USGS Publications Warehouse

    Burnham-Curtis, Mary K.; Kallemeyn, Larry W.; Bronte, Charles R.; Greswell, Robert E.; Dwyer, Pat; Hamre, R.H.

    1997-01-01

    In this study we examine genetic variation within and among self-sustaining lake trout populations from the Great Lakes basin, the Rainy Lake basin, and Yellowstone Lake. We used RFLP analysis and direct sequencing to examine DNA sequence variation among several mitochondrial and nuclear genes, including highly conserved loci (e.g. cytochrome b, nuclear exon regions) and highly variable loci (e.g. mitochondrial d-loop and nuclear intron regions). Native Lake Superior lake trout populations show high levels of genetic diversity, while populations from the Rainy Lake basin show little or none. The lake trout population sampled from Yellowstone Lake shows moderate genetic diversity, possibly representative of a relatively large source population closely related to lake trout from Lewis Lake, Wyoming. There has been significant social and management controversy involving these lake trout populations, particularly those that are located in National Parks. In the Great Lakes and Rainy Lake basins, the controversy involves the degree to which hatchery supplementation can contribute to or negatively impact self-sustaining populations which are highly desired by recreational and commercial fisheries. In Yellowstone Lake, the lake trout are viewed as an undesirable intruder that may interfere with resident populations of highly prized native cutthroat trout.

  10. Genomic identification, phylogeny, and expression analysis of MLO genes involved in susceptibility to powdery mildew in Fragaria vesca.

    PubMed

    Miao, L X; Jiang, M; Zhang, Y C; Yang, X F; Zhang, H Q; Zhang, Z F; Wang, Y Z; Jiang, G H

    2016-08-05

    The MLO (powdery mildew locus O) gene family is important in resistance to powdery mildew (PM). In this study, all of the members of the MLO family were identified and analyzed in the strawberry (Fragaria vesca) genome. The strawberry contains at least 20 members of the MLO family, and the protein sequence contained between 171 and 1485 amino acids, with 0-34 introns. Chromosomal localization showed that the MLOs were unevenly distributed on each of the chromosomes, except for chromosome 4. The greatest number of MLOs (seven) was found on chromosome 3. A phylogenetic tree showed that the MLOs were divided into seven groups (I-VII), four of which consisted of MLOs from strawberry, Arabidopsis thaliana, rice, and maize, suggesting that these genes may have evolved after the divergence of monocots and dicots. Multiple sequence alignment showed that strawberry MLO candidates related to powdery mildew resistance possessed seven highly conserved transmembrane domains, a calmodulin-binding domain, and two conserved regions, all of which are important domains for powdery mildew resistance genes. Expressed sequence tag analysis revealed that the MLOs were induced by multiple abiotic stressors, including low and high temperature, drought, and high salinity. These findings will contribute to the functional characterization of MLOs related to PM susceptibility, and will assist in the development of disease resistance in strawberries.

  11. Multiplex amplification of large sets of human exons.

    PubMed

    Porreca, Gregory J; Zhang, Kun; Li, Jin Billy; Xie, Bin; Austin, Derek; Vassallo, Sara L; LeProust, Emily M; Peck, Bill J; Emig, Christopher J; Dahl, Fredrik; Gao, Yuan; Church, George M; Shendure, Jay

    2007-11-01

    A new generation of technologies is poised to reduce DNA sequencing costs by several orders of magnitude. But our ability to fully leverage the power of these technologies is crippled by the absence of suitable 'front-end' methods for isolating complex subsets of a mammalian genome at a scale that matches the throughput at which these platforms will routinely operate. We show that targeting oligonucleotides released from programmable microarrays can be used to capture and amplify approximately 10,000 human exons in a single multiplex reaction. Additionally, we show integration of this protocol with ultra-high-throughput sequencing for targeted variation discovery. Although the multiplex capture reaction is highly specific, we found that nonuniform capture is a key issue that will need to be resolved by additional optimization. We anticipate that highly multiplexed methods for targeted amplification will enable the comprehensive resequencing of human exons at a fraction of the cost of whole-genome resequencing.

  12. ACCELERATED EVOLUTION OF LAND SNAILS MANDARINA IN THE OCEANIC BONIN ISLANDS: EVIDENCE FROM MITOCHONDRIAL DNA SEQUENCES.

    PubMed

    Chiba, Satoshi

    1999-04-01

    An endemic land snail genus Mandarina of the oceanic Bonin (Ogasawara) Islands shows exceptionally rapid evolution not only of morphological and ecological traits, but of DNA sequence. A phylogenetic relationship based on mitochondrial DNA (mtDNA) sequences suggests that morphological differences equivalent to the differences between families were produced between Mandarina and its ancestor during the Pleistocene. The inferred phylogeny shows that species with similar morphologies and life habitats appeared repeatedly and independently in different lineages and islands at different times. Sequential adaptive radiations occurred in different islands of the Bonin Islands and species occupying arboreal, semiarboreal, and terrestrial habitat arose independently in each island. Because of a close relationship between shell morphology and life habitat, independent evolution of the same life habitat in different islands created species possesing the same shell morphology in different islands and lineages. This rapid evolution produced some incongruences between phylogenetic relationship and species taxonomy. Levels of sequence divergence of mtDNA among the species of Mandarina is extremely high. The maximum level of sequence divergence at 16S and 12S ribosomal RNA sequence within Mandarina are 18.7% and 17.7%, respectively, and this suggests that evolution of mtDNA of Mandarina is extremely rapid, more than 20 times faster than the standard rate in other animals. The present examination reveals that evolution of morphological and ecological traits occurs at extremely high rates in the time of adaptive radiation, especially in fragmented environments. © 1999 The Society for the Study of Evolution.

  13. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  14. Detection of Human Papillomavirus Type 2 Related Sequence in Oral Papilloma

    PubMed Central

    Yamaguchi, Taihei; Shindoh, Masanobu; Amemiya, Akira; Inoue, Nobuo; Kawamura, Masaaki; Sakaoka, Hiroshi; Inoue, Masakazu; Fujinaga, Kei

    1998-01-01

    Oral papilloma is a benign tumourous lesion. Part of this lesion is associated with human papillomavirus (HPV) infection. We analysed the genetical and histopathological evidence for HPV type 2 infection in three oral papillomas. Southern blot hybridization showed HPV 2a sequence in one lesion. Cells of the positive specimen appeared to contain high copy numbers of the viral DNA in an episomal state. In situ staining demonstrated virus capsid antigen in koilocytotic cells and surrounding cells in the hyperplastic epithelial layer. Two other specimens contained no HPV sequences by labeled probe of full length linear HPVs 2a, 6b, 11, 16, 18, 31 and 33 DNA under low stringency hybridization conditions. These results showed the possibility that HPV 2 plays a role in oral papilloma. PMID:9699941

  15. Oligo kernels for datamining on biological sequences: a case study on prokaryotic translation initiation sites

    PubMed Central

    Meinicke, Peter; Tech, Maike; Morgenstern, Burkhard; Merkl, Rainer

    2004-01-01

    Background Kernel-based learning algorithms are among the most advanced machine learning methods and have been successfully applied to a variety of sequence classification tasks within the field of bioinformatics. Conventional kernels utilized so far do not provide an easy interpretation of the learnt representations in terms of positional and compositional variability of the underlying biological signals. Results We propose a kernel-based approach to datamining on biological sequences. With our method it is possible to model and analyze positional variability of oligomers of any length in a natural way. On one hand this is achieved by mapping the sequences to an intuitive but high-dimensional feature space, well-suited for interpretation of the learnt models. On the other hand, by means of the kernel trick we can provide a general learning algorithm for that high-dimensional representation because all required statistics can be computed without performing an explicit feature space mapping of the sequences. By introducing a kernel parameter that controls the degree of position-dependency, our feature space representation can be tailored to the characteristics of the biological problem at hand. A regularized learning scheme enables application even to biological problems for which only small sets of example sequences are available. Our approach includes a visualization method for transparent representation of characteristic sequence features. Thereby importance of features can be measured in terms of discriminative strength with respect to classification of the underlying sequences. To demonstrate and validate our concept on a biochemically well-defined case, we analyze E. coli translation initiation sites in order to show that we can find biologically relevant signals. For that case, our results clearly show that the Shine-Dalgarno sequence is the most important signal upstream a start codon. The variability in position and composition we found for that signal is in accordance with previous biological knowledge. We also find evidence for signals downstream of the start codon, previously introduced as transcriptional enhancers. These signals are mainly characterized by occurrences of adenine in a region of about 4 nucleotides next to the start codon. Conclusions We showed that the oligo kernel can provide a valuable tool for the analysis of relevant signals in biological sequences. In the case of translation initiation sites we could clearly deduce the most discriminative motifs and their positional variation from example sequences. Attractive features of our approach are its flexibility with respect to oligomer length and position conservation. By means of these two parameters oligo kernels can easily be adapted to different biological problems. PMID:15511290

  16. CSTminer: a web tool for the identification of coding and noncoding conserved sequence tags through cross-species genome comparison

    PubMed Central

    Castrignanò, Tiziana; Canali, Alessandro; Grillo, Giorgio; Liuni, Sabino; Mignone, Flavio; Pesole, Graziano

    2004-01-01

    The identification and characterization of genome tracts that are highly conserved across species during evolution may contribute significantly to the functional annotation of whole-genome sequences. Indeed, such sequences are likely to correspond to known or unknown coding exons or regulatory motifs. Here, we present a web server implementing a previously developed algorithm that, by comparing user-submitted genome sequences, is able to identify statistically significant conserved blocks and assess their coding or noncoding nature through the measure of a coding potential score. The web tool, available at http://www.caspur.it/CSTminer/, is dynamically interconnected with the Ensembl genome resources and produces a graphical output showing a map of detected conserved sequences and annotated gene features. PMID:15215464

  17. Carrot Juice Fermentations as Man-Made Microbial Ecosystems Dominated by Lactic Acid Bacteria.

    PubMed

    Wuyts, Sander; Van Beeck, Wannes; Oerlemans, Eline F M; Wittouck, Stijn; Claes, Ingmar J J; De Boeck, Ilke; Weckx, Stefan; Lievens, Bart; De Vuyst, Luc; Lebeer, Sarah

    2018-06-15

    Spontaneous vegetable fermentations, with their rich flavors and postulated health benefits, are regaining popularity. However, their microbiology is still poorly understood, therefore raising concerns about food safety. In addition, such spontaneous fermentations form interesting cases of man-made microbial ecosystems. Here, samples from 38 carrot juice fermentations were collected through a citizen science initiative, in addition to three laboratory fermentations. Culturing showed that Enterobacteriaceae were outcompeted by lactic acid bacteria (LAB) between 3 and 13 days of fermentation. Metabolite-target analysis showed that lactic acid and mannitol were highly produced, as well as the biogenic amine cadaverine. High-throughput 16S rRNA gene sequencing revealed that mainly species of Leuconostoc and Lactobacillus (as identified by 8 and 20 amplicon sequence variants [ASVs], respectively) mediated the fermentations in subsequent order. The analyses at the DNA level still detected a high number of Enterobacteriaceae , but their relative abundance was low when RNA-based sequencing was performed to detect presumptive metabolically active bacterial cells. In addition, this method greatly reduced host read contamination. Phylogenetic placement indicated a high LAB diversity, with ASVs from nine different phylogenetic groups of the Lactobacillus genus complex. However, fermentation experiments with isolates showed that only strains belonging to the most prevalent phylogenetic groups preserved the fermentation dynamics. The carrot juice fermentation thus forms a robust man-made microbial ecosystem suitable for studies on LAB diversity and niche specificity. IMPORTANCE The usage of fermented food products by professional chefs is steadily growing worldwide. Meanwhile, this interest has also increased at the household level. However, many of these artisanal food products remain understudied. Here, an extensive microbial analysis was performed of spontaneous fermented carrot juices which are used as nonalcoholic alternatives for wine in a Belgian Michelin star restaurant. Samples were collected through an active citizen science approach with 38 participants, in addition to three laboratory fermentations. Identification of the main microbial players revealed that mainly species of Leuconostoc and Lactobacillus mediated the fermentations in subsequent order. In addition, a high diversity of lactic acid bacteria was found; however, fermentation experiments with isolates showed that only strains belonging to the most prevalent lactic acid bacteria preserved the fermentation dynamics. Finally, this study showed that the usage of RNA-based 16S rRNA amplicon sequencing greatly reduces host read contamination. Copyright © 2018 American Society for Microbiology.

  18. Developmental rearrangement of cyanobacterial nif genes: nucleotide sequence, open reading frames, and cytochrome P-450 homology of the Anabaena sp. strain PCC 7120 nifD element.

    PubMed Central

    Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J

    1990-01-01

    An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria. Images PMID:2123860

  19. High-resolution phylogenetic microbial community profiling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin

    Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

  20. High-resolution phylogenetic microbial community profiling

    DOE PAGES

    Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin; ...

    2016-02-09

    Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

  1. Tissue-specific transcriptomics of the exotic invasive insect pest emerald ash borer (Agrilus planipennis).

    PubMed

    Mittapalli, Omprakash; Bai, Xiaodong; Mamidala, Praveen; Rajarapu, Swapna Priya; Bonello, Pierluigi; Herms, Daniel A

    2010-10-28

    The insect midgut and fat body represent major tissue interfaces that deal with several important physiological functions including digestion, detoxification and immune response. The emerald ash borer (Agrilus planipennis), is an exotic invasive insect pest that has killed millions of ash trees (Fraxinus spp.) primarily in the Midwestern United States and Ontario, Canada. However, despite its high impact status little knowledge exists for A. planipennis at the molecular level. Newer-generation Roche-454 pyrosequencing was used to obtain 126,185 reads for the midgut and 240,848 reads for the fat body, which were assembled into 25,173 and 37,661 high quality expressed sequence tags (ESTs) for the midgut and the fat body of A. planipennis larvae, respectively. Among these ESTs, 36% of the midgut and 38% of the fat body sequences showed similarity to proteins in the GenBank nr database. A high number of the midgut sequences contained chitin-binding peritrophin (248)and trypsin (98) domains; while the fat body sequences showed high occurrence of cytochrome P450s (85) and protein kinase (123) domains. Further, the midgut transcriptome of A. planipennis revealed putative microbial transcripts encoding for cell-wall degrading enzymes such as polygalacturonases and endoglucanases. A significant number of SNPs (137 in midgut and 347 in fat body) and microsatellite loci (317 in midgut and 571 in fat body) were predicted in the A. planipennis transcripts. An initial assessment of cytochrome P450s belonging to various CYP clades revealed distinct expression patterns at the tissue level. To our knowledge this study is one of the first to illuminate tissue-specific gene expression in an invasive insect of high ecological and economic consequence. These findings will lay the foundation for future gene expression and functional studies in A. planipennis.

  2. Molecular Phylogenetics of Trichostrongylus Species (Nematoda: Trichostrongylidae) from Humans of Mazandaran Province, Iran.

    PubMed

    Sharifdini, Meysam; Heidari, Zahra; Hesari, Zahra; Vatandoost, Sajad; Kia, Eshrat Beigom

    2017-06-01

    The present study was performed to analyze molecularly the phylogenetic positions of human-infecting Trichostrongylus species in Mazandaran Province, Iran, which is an endemic area for trichostrongyliasis. DNA from 7 Trichostrongylus infected stool samples were extracted by using in-house (IH) method. PCR amplification of ITS2-rDNA region was performed, and products were sequenced. Phylogenetic analysis of the nucleotide sequence data was performed using MEGA 5.0 software. Six out of 7 isolates had high similarity with Trichostrongylus colubriformis , while the other one showed high homology with Trichostrongylus axei registered in GenBank reference sequences. Intra-specific variations within isolates of T. colubriformis and T. axei amounted to 0-1.8% and 0-0.6%, respectively. Trichostrongylus species obtained in the present study were in a cluster with the relevant reference sequences from previous studies. BLAST analysis indicated that there was 100% homology among all 6 ITS2 sequences of T. colubriformis in the present study and most previously registered sequences of T. colubriformis from human, sheep, and goat isolates from Iran and also human isolates from Laos, Thailand, and France. The ITS2 sequence of T. axei exhibited 99.4% homology with the human isolate of T. axei from Thailand, sheep isolates from New Zealand and Iran, and cattle isolate from USA.

  3. Bayesian Correlation Analysis for Sequence Count Data

    PubMed Central

    Lau, Nelson; Perkins, Theodore J.

    2016-01-01

    Evaluating the similarity of different measured variables is a fundamental task of statistics, and a key part of many bioinformatics algorithms. Here we propose a Bayesian scheme for estimating the correlation between different entities’ measurements based on high-throughput sequencing data. These entities could be different genes or miRNAs whose expression is measured by RNA-seq, different transcription factors or histone marks whose expression is measured by ChIP-seq, or even combinations of different types of entities. Our Bayesian formulation accounts for both measured signal levels and uncertainty in those levels, due to varying sequencing depth in different experiments and to varying absolute levels of individual entities, both of which affect the precision of the measurements. In comparison with a traditional Pearson correlation analysis, we show that our Bayesian correlation analysis retains high correlations when measurement confidence is high, but suppresses correlations when measurement confidence is low—especially for entities with low signal levels. In addition, we consider the influence of priors on the Bayesian correlation estimate. Perhaps surprisingly, we show that naive, uniform priors on entities’ signal levels can lead to highly biased correlation estimates, particularly when different experiments have widely varying sequencing depths. However, we propose two alternative priors that provably mitigate this problem. We also prove that, like traditional Pearson correlation, our Bayesian correlation calculation constitutes a kernel in the machine learning sense, and thus can be used as a similarity measure in any kernel-based machine learning algorithm. We demonstrate our approach on two RNA-seq datasets and one miRNA-seq dataset. PMID:27701449

  4. Is Mutation Random or Targeted?: No Evidence for Hypermutability in Snail Toxin Genes.

    PubMed

    Roy, Scott W

    2016-10-01

    Ever since Luria and Delbruck, the notion that mutation is random with respect to fitness has been foundational to modern biology. However, various studies have claimed striking exceptions to this rule. One influential case involves toxin-encoding genes in snails of the genus Conus, termed conotoxins, a large gene family that undergoes rapid diversification of their protein-coding sequences by positive selection. Previous reconstructions of the sequence evolution of conotoxin genes claimed striking patterns: (1) elevated synonymous change, interpreted as being due to targeted "hypermutation" in this region; (2) elevated transversion-to-transition ratios, interpreted as reflective of the particular mechanism of hypermutation; and (3) much lower rates of synonymous change in the codons encoding several highly conserved cysteine residues, interpreted as strong position-specific codon bias. This work has spawned a variety of studies on the potential mechanisms of hypermutation and on causes for cysteine codon bias, and has inspired hypermutation hypotheses for various other fast-evolving genes. Here, I show that all three findings are likely to be artifacts of statistical reconstruction. First, by simulating nonsynonymous change I show that high rates of dN can lead to overestimation of dS. Second, I show that there is no evidence for any of these three patterns in comparisons of closely related conotoxin sequences, suggesting that the reported findings are due to breakdown of statistical methods at high levels of sequence divergence. The current findings suggest that mutation and codon bias in conotoxin genes may not be atypical, and that random mutation and selection can explain the evolution of even these exceptional loci. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. RAD sequencing yields a high success rate for westslope cutthroat and rainbow trout species-diagnostic SNP assays

    USGS Publications Warehouse

    Stephen J. Amish,; Paul A. Hohenlohe,; Sally Painter,; Robb F. Leary,; Muhlfeld, Clint C.; Fred W. Allendorf,; Luikart, Gordon

    2012-01-01

    Hybridization with introduced rainbow trout threatens most native westslope cutthroat trout populations. Understanding the genetic effects of hybridization and introgression requires a large set of high-throughput, diagnostic genetic markers to inform conservation and management. Recently, we identified several thousand candidate single-nucleotide polymorphism (SNP) markers based on RAD sequencing of 11 westslope cutthroat trout and 13 rainbow trout individuals. Here, we used flanking sequence for 56 of these candidate SNP markers to design high-throughput genotyping assays. We validated the assays on a total of 92 individuals from 22 populations and seven hatchery strains. Forty-six assays (82%) amplified consistently and allowed easy identification of westslope cutthroat and rainbow trout alleles as well as heterozygote controls. The 46 SNPs will provide high power for early detection of population admixture and improved identification of hybrid and nonhybridized individuals. This technique shows promise as a very low-cost, reliable and relatively rapid method for developing and testing SNP markers for nonmodel organisms with limited genomic resources.

  6. On the relationship between residue structural environment and sequence conservation in proteins.

    PubMed

    Liu, Jen-Wei; Lin, Jau-Ji; Cheng, Chih-Wen; Lin, Yu-Feng; Hwang, Jenn-Kang; Huang, Tsun-Tsao

    2017-09-01

    Residues that are crucial to protein function or structure are usually evolutionarily conserved. To identify the important residues in protein, sequence conservation is estimated, and current methods rely upon the unbiased collection of homologous sequences. Surprisingly, our previous studies have shown that the sequence conservation is closely correlated with the weighted contact number (WCN), a measure of packing density for residue's structural environment, calculated only based on the C α positions of a protein structure. Moreover, studies have shown that sequence conservation is correlated with environment-related structural properties calculated based on different protein substructures, such as a protein's all atoms, backbone atoms, side-chain atoms, or side-chain centroid. To know whether the C α atomic positions are adequate to show the relationship between residue environment and sequence conservation or not, here we compared C α atoms with other substructures in their contributions to the sequence conservation. Our results show that C α positions are substantially equivalent to the other substructures in calculations of various measures of residue environment. As a result, the overlapping contributions between C α atoms and the other substructures are high, yielding similar structure-conservation relationship. Take the WCN as an example, the average overlapping contribution to sequence conservation is 87% between C α and all-atom substructures. These results indicate that only C α atoms of a protein structure could reflect sequence conservation at the residue level. © 2017 Wiley Periodicals, Inc.

  7. A comprehensive insight into bacterial virulence in drinking water using 454 pyrosequencing and Illumina high-throughput sequencing.

    PubMed

    Huang, Kailong; Zhang, Xu-Xiang; Shi, Peng; Wu, Bing; Ren, Hongqiang

    2014-11-01

    In order to comprehensively investigate bacterial virulence in drinking water, 454 pyrosequencing and Illumina high-throughput sequencing were used to detect potential pathogenic bacteria and virulence factors (VFs) in a full-scale drinking water treatment and distribution system. 16S rRNA gene pyrosequencing revealed high bacterial diversity in the drinking water (441-586 operational taxonomic units). Bacterial diversity decreased after chlorine disinfection, but increased after pipeline distribution. α-Proteobacteria was the most dominant taxonomic class. Alignment against the established pathogen database showed that several types of putative pathogens were present in the drinking water and Pseudomonas aeruginosa had the highest abundance (over 11‰ of total sequencing reads). Many pathogens disappeared after chlorine disinfection, but P. aeruginosa and Leptospira interrogans were still detected in the tap water. High-throughput sequencing revealed prevalence of various pathogenicity islands and virulence proteins in the drinking water, and translocases, transposons, Clp proteases and flagellar motor switch proteins were the predominant VFs. Both diversity and abundance of the detectable VFs increased after the chlorination, and decreased after the pipeline distribution. This study indicates that joint use of 454 pyrosequencing and Illumina sequencing can comprehensively characterize environmental pathogenesis, and several types of putative pathogens and various VFs are prevalent in drinking water. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Scanning the human genome at kilobase resolution.

    PubMed

    Chen, Jun; Kim, Yeong C; Jung, Yong-Chul; Xuan, Zhenyu; Dworkin, Geoff; Zhang, Yanming; Zhang, Michael Q; Wang, San Ming

    2008-05-01

    Normal genome variation and pathogenic genome alteration frequently affect small regions in the genome. Identifying those genomic changes remains a technical challenge. We report here the development of the DGS (Ditag Genome Scanning) technique for high-resolution analysis of genome structure. The basic features of DGS include (1) use of high-frequent restriction enzymes to fractionate the genome into small fragments; (2) collection of two tags from two ends of a given DNA fragment to form a ditag to represent the fragment; (3) application of the 454 sequencing system to reach a comprehensive ditag sequence collection; (4) determination of the genome origin of ditags by mapping to reference ditags from known genome sequences; (5) use of ditag sequences directly as the sense and antisense PCR primers to amplify the original DNA fragment. To study the relationship between ditags and genome structure, we performed a computational study by using the human genome reference sequences as a model, and analyzed the ditags experimentally collected from the well-characterized normal human DNA GM15510 and the leukemic human DNA of Kasumi-1 cells. Our studies show that DGS provides a kilobase resolution for studying genome structure with high specificity and high genome coverage. DGS can be applied to validate genome assembly, to compare genome similarity and variation in normal populations, and to identify genomic abnormality including insertion, inversion, deletion, translocation, and amplification in pathological genomes such as cancer genomes.

  9. Dose-Response Analysis of RNA-Seq Profiles in Archival ...

    EPA Pesticide Factsheets

    Use of archival resources has been limited to date by inconsistent methods for genomic profiling of degraded RNA from formalin-fixed paraffin-embedded (FFPE) samples. RNA-sequencing offers a promising way to address this problem. Here we evaluated transcriptomic dose responses using RNA-sequencing in paired FFPE and frozen (FROZ) samples from two archival studies in mice, one 20 years old. Experimental treatments included 3 different doses of di(2-ethylhexyl)phthalate or dichloroacetic acid for the recently archived and older studies, respectively. Total RNA was ribo-depleted and sequenced using the Illumina HiSeq platform. In the recently archived study, FFPE samples had 35% lower total counts compared to FROZ samples but high concordance in fold-change values of differentially expressed genes (DEGs) (r2 = 0.99), highly enriched pathways (90% overlap with FROZ), and benchmark dose estimates for preselected target genes (2% difference vs FROZ). In contrast, older FFPE samples had markedly lower total counts (3% of FROZ) and poor concordance in global DEGs and pathways. However, counts from FFPE and FROZ samples still positively correlated (r2 = 0.84 across all transcripts) and showed comparable dose responses for more highly expressed target genes. These findings highlight potential applications and issues in using RNA-sequencing data from FFPE samples. Recently archived FFPE samples were highly similar to FROZ samples in sequencing q

  10. Interactional convergence in conversational storytelling: when reported speech is a cue of alignment and/or affiliation.

    PubMed

    Guardiola, Mathilde; Bertrand, Roxane

    2013-01-01

    This paper investigates how and when interactional convergence is established by participants in conversation. We analyze sequences of storytelling using an original method that combines Conversation Analysis and a corpus-based approach. In storytelling, the participant in the position of "listener" is expected to produce either generic or specific responses adapted to the storyteller's narrative. The listener's behavior produced within the current activity is a cue of his/her interactional alignment. We show here that the listener can produce a specific type of (aligned) response, which we term a reported speech utterance in echo. The participant who is not telling the story is nonetheless able to animate the characters, while reversing the usual asymmetric roles of storyteller and listener. The use of this device is a way for the listener to display his/her stance toward the events told by the storyteller. If the listener's stance is congruent with that of the storyteller, this reveals a high degree of affiliation between the participants. We present seventeen excerpts from a collection of 94 instances of Echo Reported Speech (ERS) which we examined using the concepts of alignment and affiliation in order to show how different kinds of convergent sequences are constructed. We demonstrate that this phenomenon is mainly used by the listener to align and affiliate with the storyteller by means of reformulative, enumerative, or overbidding ERS. We also show that in affiliative sequences, reported speech can be used by the listener in a humorous way in order to temporarily disalign. This disalignment constitutes a potential starting point for an oblique sequence, which, if accepted and continued by the storyteller, gives rise to a highly convergent sequence.

  11. Interactional convergence in conversational storytelling: when reported speech is a cue of alignment and/or affiliation

    PubMed Central

    Guardiola, Mathilde; Bertrand, Roxane

    2013-01-01

    This paper investigates how and when interactional convergence is established by participants in conversation. We analyze sequences of storytelling using an original method that combines Conversation Analysis and a corpus-based approach. In storytelling, the participant in the position of “listener” is expected to produce either generic or specific responses adapted to the storyteller's narrative. The listener's behavior produced within the current activity is a cue of his/her interactional alignment. We show here that the listener can produce a specific type of (aligned) response, which we term a reported speech utterance in echo. The participant who is not telling the story is nonetheless able to animate the characters, while reversing the usual asymmetric roles of storyteller and listener. The use of this device is a way for the listener to display his/her stance toward the events told by the storyteller. If the listener's stance is congruent with that of the storyteller, this reveals a high degree of affiliation between the participants. We present seventeen excerpts from a collection of 94 instances of Echo Reported Speech (ERS) which we examined using the concepts of alignment and affiliation in order to show how different kinds of convergent sequences are constructed. We demonstrate that this phenomenon is mainly used by the listener to align and affiliate with the storyteller by means of reformulative, enumerative, or overbidding ERS. We also show that in affiliative sequences, reported speech can be used by the listener in a humorous way in order to temporarily disalign. This disalignment constitutes a potential starting point for an oblique sequence, which, if accepted and continued by the storyteller, gives rise to a highly convergent sequence. PMID:24115939

  12. Whole Wiskott‑Aldrich syndrome protein gene deletion identified by high throughput sequencing.

    PubMed

    He, Xiangling; Zou, Runying; Zhang, Bing; You, Yalan; Yang, Yang; Tian, Xin

    2017-11-01

    Wiskott‑Aldrich syndrome (WAS) is a rare X‑linked recessive immunodeficiency disorder, characterized by thrombocytopenia, small platelets, eczema and recurrent infections associated with increased risk of autoimmunity and malignancy disorders. Mutations in the WAS protein (WASP) gene are responsible for WAS. To date, WASP mutations, including missense/nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with WAS. In addition, WASP‑interacting proteins are suspected in patients with clinical features of WAS, in whom the WASP gene sequence and mRNA levels are normal. The present study aimed to investigate the application of next generation sequencing in definitive diagnosis and clinical therapy for WAS. A 5 month‑old child with WAS who displayed symptoms of thrombocytopenia was examined. Whole exome sequence analysis of genomic DNA showed that the coverage and depth of WASP were extremely low. Quantitative polymerase chain reaction indicated total WASP gene deletion in the proband. In conclusion, high throughput sequencing is useful for the verification of WAS on the genetic profile, and has implications for family planning guidance and establishment of clinical programs.

  13. Experience of targeted Usher exome sequencing as a clinical test

    PubMed Central

    Besnard, Thomas; García-García, Gema; Baux, David; Vaché, Christel; Faugère, Valérie; Larrieu, Lise; Léonard, Susana; Millan, Jose M; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise

    2014-01-01

    We show that massively parallel targeted sequencing of 19 genes provides a new and reliable strategy for molecular diagnosis of Usher syndrome (USH) and nonsyndromic deafness, particularly appropriate for these disorders characterized by a high clinical and genetic heterogeneity and a complex structure of several of the genes involved. A series of 71 patients including Usher patients previously screened by Sanger sequencing plus newly referred patients was studied. Ninety-eight percent of the variants previously identified by Sanger sequencing were found by next-generation sequencing (NGS). NGS proved to be efficient as it offers analysis of all relevant genes which is laborious to reach with Sanger sequencing. Among the 13 newly referred Usher patients, both mutations in the same gene were identified in 77% of cases (10 patients) and one candidate pathogenic variant in two additional patients. This work can be considered as pilot for implementing NGS for genetically heterogeneous diseases in clinical service. PMID:24498627

  14. Simple chained guide trees give high-quality protein multiple sequence alignments

    PubMed Central

    Boyce, Kieran; Sievers, Fabian; Higgins, Desmond G.

    2014-01-01

    Guide trees are used to decide the order of sequence alignment in the progressive multiple sequence alignment heuristic. These guide trees are often the limiting factor in making large alignments, and considerable effort has been expended over the years in making these quickly or accurately. In this article we show that, at least for protein families with large numbers of sequences that can be benchmarked with known structures, simple chained guide trees give the most accurate alignments. These also happen to be the fastest and simplest guide trees to construct, computationally. Such guide trees have a striking effect on the accuracy of alignments produced by some of the most widely used alignment packages. There is a marked increase in accuracy and a marked decrease in computational time, once the number of sequences goes much above a few hundred. This is true, even if the order of sequences in the guide tree is random. PMID:25002495

  15. Terminal region sequence variations in variola virus DNA.

    PubMed

    Massung, R F; Loparev, V N; Knight, J C; Totmenin, A V; Chizhikov, V E; Parsons, J M; Safronov, P F; Gutorov, V V; Shchelkunov, S N; Esposito, J J

    1996-07-15

    Genome DNA terminal region sequences were determined for a Brazilian alastrim variola minor virus strain Garcia-1966 that was associated with an 0.8% case-fatality rate and African smallpox strains Congo-1970 and Somalia-1977 associated with variola major (9.6%) and minor (0.4%) mortality rates, respectively. A base sequence identity of > or = 98.8% was determined after aligning 30 kb of the left- or right-end region sequences with cognate sequences previously determined for Asian variola major strains India-1967 (31% death rate) and Bangladesh-1975 (18.5% death rate). The deduced amino acid sequences of putative proteins of > or = 65 amino acids also showed relatively high identity, although the Asian and African viruses were clearly more related to each other than to alastrim virus. Alastrim virus contained only 10 of 70 proteins that were 100% identical to homologs in Asian strains, and 7 alastrim-specific proteins were noted.

  16. A physical map of Brassica oleracea shows complexity of chromosomal changes following recursive paleopolyploidizations

    PubMed Central

    2011-01-01

    Background Evolution of the Brassica species has been recursively affected by polyploidy events, and comparison to their relative, Arabidopsis thaliana, provides means to explore their genomic complexity. Results A genome-wide physical map of a rapid-cycling strain of B. oleracea was constructed by integrating high-information-content fingerprinting (HICF) of Bacterial Artificial Chromosome (BAC) clones with hybridization to sequence-tagged probes. Using 2907 contigs of two or more BACs, we performed several lines of comparative genomic analysis. Interspecific DNA synteny is much better preserved in euchromatin than heterochromatin, showing the qualitative difference in evolution of these respective genomic domains. About 67% of contigs can be aligned to the Arabidopsis genome, with 96.5% corresponding to euchromatic regions, and 3.5% (shown to contain repetitive sequences) to pericentromeric regions. Overgo probe hybridization data showed that contigs aligned to Arabidopsis euchromatin contain ~80% of low-copy-number genes, while genes with high copy number are much more frequently associated with pericentromeric regions. We identified 39 interchromosomal breakpoints during the diversification of B. oleracea and Arabidopsis thaliana, a relatively high level of genomic change since their divergence. Comparison of the B. oleracea physical map with Arabidopsis and other available eudicot genomes showed appreciable 'shadowing' produced by more ancient polyploidies, resulting in a web of relatedness among contigs which increased genomic complexity. Conclusions A high-resolution genetically-anchored physical map sheds light on Brassica genome organization and advances positional cloning of specific genes, and may help to validate genome sequence assembly and alignment to chromosomes. All the physical mapping data is freely shared at a WebFPC site (http://lulu.pgml.uga.edu/fpc/WebAGCoL/brassica/WebFPC/; Temporarily password-protected: account: pgml; password: 123qwe123. PMID:21955929

  17. A dimer of the lymphoid protein RAG1 recognizes the recombination signal sequence and the complex stably incorporates the high mobility group protein HMG2.

    PubMed

    Rodgers, K K; Villey, I J; Ptaszek, L; Corbett, E; Schatz, D G; Coleman, J E

    1999-07-15

    RAG1 and RAG2 are the two lymphoid-specific proteins required for the cleavage of DNA sequences known as the recombination signal sequences (RSSs) flanking V, D or J regions of the antigen-binding genes. Previous studies have shown that RAG1 alone is capable of binding to the RSS, whereas RAG2 only binds as a RAG1/RAG2 complex. We have expressed recombinant core RAG1 (amino acids 384-1008) in Escherichia coli and demonstrated catalytic activity when combined with RAG2. This protein was then used to determine its oligomeric forms and the dissociation constant of binding to the RSS. Electrophoretic mobility shift assays show that up to three oligomeric complexes of core RAG1 form with a single RSS. Core RAG1 was found to exist as a dimer both when free in solution and as the minimal species bound to the RSS. Competition assays show that RAG1 recognizes both the conserved nonamer and heptamer sequences of the RSS. Zinc analysis shows the core to contain two zinc ions. The purified RAG1 protein overexpressed in E.coli exhibited the expected cleavage activity when combined with RAG2 purified from transfected 293T cells. The high mobility group protein HMG2 is stably incorporated into the recombinant RAG1/RSS complex and can increase the affinity of RAG1 for the RSS in the absence of RAG2.

  18. Accelerated Evolution of the ASPM Gene Controlling Brain Size Begins Prior to Human Brain Expansion

    PubMed Central

    Solomon, Gregory; Gersch, William; Yoon, Young-Ho; Collura, Randall; Ruvolo, Maryellen; Barrett, J. Carl; Woods, C. Geoffrey; Walsh, Christopher A

    2004-01-01

    Primary microcephaly (MCPH) is a neurodevelopmental disorder characterized by global reduction in cerebral cortical volume. The microcephalic brain has a volume comparable to that of early hominids, raising the possibility that some MCPH genes may have been evolutionary targets in the expansion of the cerebral cortex in mammals and especially primates. Mutations in ASPM, which encodes the human homologue of a fly protein essential for spindle function, are the most common known cause of MCPH. Here we have isolated large genomic clones containing the complete ASPM gene, including promoter regions and introns, from chimpanzee, gorilla, orangutan, and rhesus macaque by transformation-associated recombination cloning in yeast. We have sequenced these clones and show that whereas much of the sequence of ASPM is substantially conserved among primates, specific segments are subject to high Ka/Ks ratios (nonsynonymous/synonymous DNA changes) consistent with strong positive selection for evolutionary change. The ASPM gene sequence shows accelerated evolution in the African hominoid clade, and this precedes hominid brain expansion by several million years. Gorilla and human lineages show particularly accelerated evolution in the IQ domain of ASPM. Moreover, ASPM regions under positive selection in primates are also the most highly diverged regions between primates and nonprimate mammals. We report the first direct application of TAR cloning technology to the study of human evolution. Our data suggest that evolutionary selection of specific segments of the ASPM sequence strongly relates to differences in cerebral cortical size. PMID:15045028

  19. Isolation and characterization of adrenoleukodystrophy protein (ALDP) related sequences in the human genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geraghty, M.T.; Stetten, G.; Kearns, W.

    1994-09-01

    X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less

  20. Chicken skin virome analyzed by high-throughput sequencing shows a composition highly different from human skin.

    PubMed

    Denesvre, Caroline; Dumarest, Marine; Rémy, Sylvie; Gourichon, David; Eloit, Marc

    2015-10-01

    Recent studies show that human skin at homeostasis is a complex ecosystem whose virome include circular DNA viruses, especially papillomaviruses and polyomaviruses. To determine the chicken skin virome in comparison with human skin virome, a chicken swabs pool sample from fifteen indoor healthy chickens of five genetic backgrounds was examined for the presence of DNA viruses by high-throughput sequencing (HTS). The results indicate a predominance of herpesviruses from the Mardivirus genus, coming from either vaccinal origin or presumably asymptomatic infection. Despite the high sensitivity of the HTS method used herein to detect small circular DNA viruses, we did not detect any papillomaviruses, polyomaviruses, or circoviruses, indicating that these viruses may not be resident of the chicken skin. The results suggest that the turkey herpesvirus is a resident of chicken skin in vaccinated chickens. This study indicates major differences between the skin viromes of chickens and humans. The origin of this difference remains to be further studied in relation with skin physiology, environment, or virus population dynamics.

  1. Identification, Characterization, and Recombinant Expression of Epidermicin NI01, a Novel Unmodified Bacteriocin Produced by Staphylococcus epidermidis That Displays Potent Activity against Staphylococci

    PubMed Central

    Sandiford, Stephanie

    2012-01-01

    We describe the discovery, purification, characterization, and expression of an antimicrobial peptide, epidermicin NI01, which is an unmodified bacteriocin produced by Staphylococcus epidermidis strain 224. It is a highly cationic, hydrophobic, plasmid-encoded peptide that exhibits potent antimicrobial activity toward a wide range of pathogenic Gram-positive bacteria including methicillin-resistant Staphylococcus aureus (MRSA), enterococci, and biofilm-forming S. epidermidis strains. Purification of the peptide was achieved using a combination of hydrophobic interaction, cation exchange, and high-performance liquid chromatography (HPLC). Matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) analysis yielded a molecular mass of 6,074 Da, and partial sequence data of the peptide were elucidated using a combination of tandem mass spectrometry (MS/MS) and de novo sequencing. The draft genome sequence of the producing strain was obtained using 454 pyrosequencing technology, thus enabling the identification of the structural gene using the de novo peptide sequence data previously obtained. Epidermicin NI01 contains 51 residues with four tryptophan and nine lysine residues, and the sequence showed approximately 50% identity to peptides lacticin Z, lacticin Q, and aureocin A53, all of which belong to a new family of unmodified type II-like bacteriocins. The peptide is active in the nanomolar range against S. epidermidis, MRSA isolates, and vancomycin-resistant enterococci. Other unique features displayed by epidermicin include a high degree of protease stability and the ability to retain antimicrobial activity over a pH range of 2 to 10, and exposure to the peptide does not result in development of resistance in susceptible isolates. In this study we also show the structural gene alone can be cloned into Escherichia coli strain BL21(DE3), and expression yields active peptide. PMID:22155816

  2. Whole genome sequencing discriminates hepatocellular carcinoma with intrahepatic metastasis from multi-centric tumors.

    PubMed

    Furuta, Mayuko; Ueno, Masaki; Fujimoto, Akihiro; Hayami, Shinya; Yasukawa, Satoru; Kojima, Fumiyoshi; Arihiro, Koji; Kawakami, Yoshiiku; Wardell, Christopher P; Shiraishi, Yuichi; Tanaka, Hiroko; Nakano, Kaoru; Maejima, Kazuhiro; Sasaki-Oku, Aya; Tokunaga, Naoki; Boroevich, Keith A; Abe, Tetsuo; Aikata, Hiroshi; Ohdan, Hideki; Gotoh, Kunihito; Kubo, Michiaki; Tsunoda, Tatsuhiko; Miyano, Satoru; Chayama, Kazuaki; Yamaue, Hiroki; Nakagawa, Hidewaki

    2017-02-01

    Patients with hepatocellular carcinoma (HCC) have a high-risk of multi-centric (MC) tumor occurrence due to a strong carcinogenic background in the liver. In addition, they have a high risk of intrahepatic metastasis (IM). Liver tumors withIM or MC are profoundly different in their development and clinical outcome. However, clinically or pathologically discriminating between IM and MC can be challenging. This study investigated whether IM or MC could be diagnosed at the molecular level. We performed whole genome and RNA sequencing analyses of 49 tumors including two extra-hepatic metastases, and one nodule-in-nodule tumor from 23 HCC patients. Sequencing-based molecular diagnosis using somatic single nucleotide variation information showed higher sensitivity compared to previous techniques due to the inclusion of a larger number of mutation events. This proved useful in cases, which showed inconsistent clinical diagnoses. In addition, whole genome sequencing offered advantages in profiling of other genetic alterations, such as structural variations, copy number alterations, and variant allele frequencies, and helped to confirm the IM/MCdiagnosis. Divergent alterations between IM tumors with sorafenib treatment, long time-intervals, or tumor-in-tumor nodules indicated high intra-tumor heterogeneity, evolution, and clonal switching of liver cancers. It is important to analyze the differences between IM tumors, in addition to IM/MC diagnosis, before selecting a therapeutic strategy for multiple tumors in the liver. Whole genome sequencing of multiple liver tumors enabled the accuratediagnosis ofmulti-centric occurrence and intrahepatic metastasis using somatic single nucleotide variation information. In addition, genetic discrepancies between tumors help us to understand the physical changes during recurrence and cancer spread. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  3. Detecting exact breakpoints of deletions with diversity in hepatitis B viral genomic DNA from next-generation sequencing data.

    PubMed

    Cheng, Ji-Hong; Liu, Wen-Chun; Chang, Ting-Tsung; Hsieh, Sun-Yuan; Tseng, Vincent S

    2017-10-01

    Many studies have suggested that deletions of Hepatitis B Viral (HBV) are associated with the development of progressive liver diseases, even ultimately resulting in hepatocellular carcinoma (HCC). Among the methods for detecting deletions from next-generation sequencing (NGS) data, few methods considered the characteristics of virus, such as high evolution rates and high divergence among the different HBV genomes. Sequencing high divergence HBV genome sequences using the NGS technology outputs millions of reads. Thus, detecting exact breakpoints of deletions from these big and complex data incurs very high computational cost. We proposed a novel analytical method named VirDelect (Virus Deletion Detect), which uses split read alignment base to detect exact breakpoint and diversity variable to consider high divergence in single-end reads data, such that the computational cost can be reduced without losing accuracy. We use four simulated reads datasets and two real pair-end reads datasets of HBV genome sequence to verify VirDelect accuracy by score functions. The experimental results show that VirDelect outperforms the state-of-the-art method Pindel in terms of accuracy score for all simulated datasets and VirDelect had only two base errors even in real datasets. VirDelect is also shown to deliver high accuracy in analyzing the single-end read data as well as pair-end data. VirDelect can serve as an effective and efficient bioinformatics tool for physiologists with high accuracy and efficient performance and applicable to further analysis with characteristics similar to HBV on genome length and high divergence. The software program of VirDelect can be downloaded at https://sourceforge.net/projects/virdelect/. Copyright © 2017. Published by Elsevier Inc.

  4. The crystal structure of Erwinia amylovora AmyR, a member of the YbjN protein family, shows similarity to type III secretion chaperones but suggests different cellular functions

    PubMed Central

    Bartho, Joseph D.; Bellini, Dom; Wuerges, Jochen; Demitri, Nicola; Toccafondi, Mirco; Schmitt, Armin O.; Zhao, Youfu; Walsh, Martin A.

    2017-01-01

    AmyR is a stress and virulence associated protein from the plant pathogenic Enterobacteriaceae species Erwinia amylovora, and is a functionally conserved ortholog of YbjN from Escherichia coli. The crystal structure of E. amylovora AmyR reveals a class I type III secretion chaperone-like fold, despite the lack of sequence similarity between these two classes of protein and lacking any evidence of a secretion-associated role. The results indicate that AmyR, and YbjN proteins in general, function through protein-protein interactions without any enzymatic action. The YbjN proteins of Enterobacteriaceae show remarkably low sequence similarity with other members of the YbjN protein family in Eubacteria, yet a high level of structural conservation is observed. Across the YbjN protein family sequence conservation is limited to residues stabilising the protein core and dimerization interface, while interacting regions are only conserved between closely related species. This study presents the first structure of a YbjN protein from Enterobacteriaceae, the most highly divergent and well-studied subgroup of YbjN proteins, and an in-depth sequence and structural analysis of this important but poorly understood protein family. PMID:28426806

  5. The crystal structure of Erwinia amylovora AmyR, a member of the YbjN protein family, shows similarity to type III secretion chaperones but suggests different cellular functions.

    PubMed

    Bartho, Joseph D; Bellini, Dom; Wuerges, Jochen; Demitri, Nicola; Toccafondi, Mirco; Schmitt, Armin O; Zhao, Youfu; Walsh, Martin A; Benini, Stefano

    2017-01-01

    AmyR is a stress and virulence associated protein from the plant pathogenic Enterobacteriaceae species Erwinia amylovora, and is a functionally conserved ortholog of YbjN from Escherichia coli. The crystal structure of E. amylovora AmyR reveals a class I type III secretion chaperone-like fold, despite the lack of sequence similarity between these two classes of protein and lacking any evidence of a secretion-associated role. The results indicate that AmyR, and YbjN proteins in general, function through protein-protein interactions without any enzymatic action. The YbjN proteins of Enterobacteriaceae show remarkably low sequence similarity with other members of the YbjN protein family in Eubacteria, yet a high level of structural conservation is observed. Across the YbjN protein family sequence conservation is limited to residues stabilising the protein core and dimerization interface, while interacting regions are only conserved between closely related species. This study presents the first structure of a YbjN protein from Enterobacteriaceae, the most highly divergent and well-studied subgroup of YbjN proteins, and an in-depth sequence and structural analysis of this important but poorly understood protein family.

  6. Genotyping of Salmonella enterica serovar Typhi strains isolated from 1959 to 2006 in China and analysis of genetic diversity by genomic microarray.

    PubMed

    Zhang, Haifang; Zhang, Xiaolei; Yan, Meiying; Pang, Bo; Kan, Biao; Xu, Huaxi; Huang, Xinxiang

    2011-12-15

    To determine the genotype of Salmonella enterica serovar Typhi (S. Typhi) strains in China and analyze their genetic diversity. We collected S. Typhi strains from 1959 to 2006 in five highly endemic Chinese provinces and chose 40 representative strains. Multilocus sequence typing was used to determine the genotypes or sequence types (ST) and microarray-based comparative genomic hybridization (M-CGH) to investigate the differences in gene content among these strains. Forty representative S. Typhi strains belonged to 4 sequence types (ST1, ST2, ST890, and ST892). The predominant S. Typhi genotype (31/40) was ST2 and it had a diverse geographic distribution. We discovered two novel STs - ST890 and ST892. M-CGH showed that 69 genes in these two novel STs were divergent from S. Typhi Ty2, which belongs to ST1. In addition, 5 representative Typhi strains of ST2 isolated from Guizhou province showed differences in divergent genes. We determined two novel sequence types, ST890 and ST892, and found that ST2 was the most prevalent genotype of S. Typhi in China. Genetic diversity was present even within a highly clonal bacterial population.

  7. A machine learning model to determine the accuracy of variant calls in capture-based next generation sequencing.

    PubMed

    van den Akker, Jeroen; Mishne, Gilad; Zimmer, Anjali D; Zhou, Alicia Y

    2018-04-17

    Next generation sequencing (NGS) has become a common technology for clinical genetic tests. The quality of NGS calls varies widely and is influenced by features like reference sequence characteristics, read depth, and mapping accuracy. With recent advances in NGS technology and software tools, the majority of variants called using NGS alone are in fact accurate and reliable. However, a small subset of difficult-to-call variants that still do require orthogonal confirmation exist. For this reason, many clinical laboratories confirm NGS results using orthogonal technologies such as Sanger sequencing. Here, we report the development of a deterministic machine-learning-based model to differentiate between these two types of variant calls: those that do not require confirmation using an orthogonal technology (high confidence), and those that require additional quality testing (low confidence). This approach allows reliable NGS-based calling in a clinical setting by identifying the few important variant calls that require orthogonal confirmation. We developed and tested the model using a set of 7179 variants identified by a targeted NGS panel and re-tested by Sanger sequencing. The model incorporated several signals of sequence characteristics and call quality to determine if a variant was identified at high or low confidence. The model was tuned to eliminate false positives, defined as variants that were called by NGS but not confirmed by Sanger sequencing. The model achieved very high accuracy: 99.4% (95% confidence interval: +/- 0.03%). It categorized 92.2% (6622/7179) of the variants as high confidence, and 100% of these were confirmed to be present by Sanger sequencing. Among the variants that were categorized as low confidence, defined as NGS calls of low quality that are likely to be artifacts, 92.1% (513/557) were found to be not present by Sanger sequencing. This work shows that NGS data contains sufficient characteristics for a machine-learning-based model to differentiate low from high confidence variants. Additionally, it reveals the importance of incorporating site-specific features as well as variant call features in such a model.

  8. Neurovascular Study of the Trigeminal Nerve at 3 T MRI

    PubMed Central

    Gonzalez, Nadia; Muñoz, Alexandra; Bravo, Fernando; Sarroca, Daniel; Morales, Carlos

    2015-01-01

    This study aimed to show a novel visualization method to investigate neurovascular compression of the trigeminal nerve (TN) using a volume-rendering fusion imaging technique of 3D fast imaging employing steady-state acquisition (3D FIESTA) and coregistered 3D time of flight MR angiography (3D TOF MRA) sequences, which we called “neurovascular study of the trigeminal nerve”. We prospectively studied 30 patients with unilateral trigeminal neuralgia (TN) and 50 subjects without symptoms of TN (control group), on a 3 Tesla scanner. All patients were assessed using 3D FIESTA and 3D TOF MRA sequences centered on the pons, as well as a standard brain protocol including axial T1, T2, FLAIR and GRE sequences to exclude other pathologies that could cause TN. Post-contrast T1-weighted sequences were also performed. All cases showing arterial imprinting on the trigeminal nerve (n = 11) were identified on the ipsilateral side of the pain. No significant relationship was found between the presence of an artery in contact with the trigeminal nerve and TN. Eight cases were found showing arterial contact on the ipsilateral side of the pain and five cases of arterial contact on the contralateral side. The fusion imaging technique of 3D FIESTA and 3D TOF MRA sequences, combining the high anatomical detail provided by the 3D FIESTA sequence with the 3D TOF MRA sequence and its capacity to depict arterial structures, results in a tool that enables quick and efficient visualization and assessment of the relationship between the trigeminal nerve and the neighboring vascular structures. PMID:25924169

  9. SSR_pipeline: a bioinformatic infrastructure for identifying microsatellites from paired-end Illumina high-throughput DNA sequencing data

    USGS Publications Warehouse

    Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.

    2013-01-01

    SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).

  10. SSR_pipeline: a bioinformatic infrastructure for identifying microsatellites from paired-end Illumina high-throughput DNA sequencing data.

    PubMed

    Miller, Mark P; Knaus, Brian J; Mullins, Thomas D; Haig, Susan M

    2013-01-01

    SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25 bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).

  11. Structural and Functional Insights from the Metagenome of an Acidic Hot Spring Microbial Planktonic Community in the Colombian Andes

    PubMed Central

    Jiménez, Diego Javier; Andreote, Fernando Dini; Chaves, Diego; Montaña, José Salvador; Osorio-Forero, Cesar; Junca, Howard; Zambrano, María Mercedes; Baena, Sandra

    2012-01-01

    A taxonomic and annotated functional description of microbial life was deduced from 53 Mb of metagenomic sequence retrieved from a planktonic fraction of the Neotropical high Andean (3,973 meters above sea level) acidic hot spring El Coquito (EC). A classification of unassembled metagenomic reads using different databases showed a high proportion of Gammaproteobacteria and Alphaproteobacteria (in total read affiliation), and through taxonomic affiliation of 16S rRNA gene fragments we observed the presence of Proteobacteria, micro-algae chloroplast and Firmicutes. Reads mapped against the genomes Acidiphilium cryptum JF-5, Legionella pneumophila str. Corby and Acidithiobacillus caldus revealed the presence of transposase-like sequences, potentially involved in horizontal gene transfer. Functional annotation and hierarchical comparison with different datasets obtained by pyrosequencing in different ecosystems showed that the microbial community also contained extensive DNA repair systems, possibly to cope with ultraviolet radiation at such high altitudes. Analysis of genes involved in the nitrogen cycle indicated the presence of dissimilatory nitrate reduction to N2 (narGHI, nirS, norBCDQ and nosZ), associated with Proteobacteria-like sequences. Genes involved in the sulfur cycle (cysDN, cysNC and aprA) indicated adenylsulfate and sulfite production that were affiliated to several bacterial species. In summary, metagenomic sequence data provided insight regarding the structure and possible functions of this hot spring microbial community, describing some groups potentially involved in the nitrogen and sulfur cycling in this environment. PMID:23251687

  12. Molecular cloning and expression of the CRISP family of proteins in the boar.

    PubMed

    Vadnais, Melissa L; Foster, Douglas N; Roberts, Kenneth P

    2008-12-01

    The family of mammalian cysteine-rich secretory proteins (CRISP) have been well characterized in the rat, mouse, and human. Here we report the molecular cloning and expression analysis of CRISP1, CRISP2, and CRISP3 in the boar. A partial sequence published in the National Center for Biotechnology Information (NCBI) database was used to derive the full-length sequences for CRISP1 and CRISP2 using rapid amplification of cDNA ends. RT-PCR confirmed the expression of these mRNAs in the boar reproductive tract, and real time RT-PCR showed CRISP1 to be highly expressed throughout the epididymis, with CRISP2 highly expressed in the testis. A search of the porcine genomic sequence in the NCBI database identified a BAC (CH242-199E6) encoding the CRISP1 gene. This BAC is derived from porcine Chromosome 7 and is syntenic with the regions of the mouse, rat, and human genomes encoding the CRISP gene family. This BAC was found to encode a third CRISP protein with a predicted amino acid sequence of high similarity to human CRISP3. Using RT-PCR we show that CRISP3 expression in the boar reproductive tract is confined to the prostate. Recombinant porcine (rp) CRISP2 protein was produced and purified. When incubated with capacitated boar sperm, rpCRISP2 induced an acrosome reaction, consistent with its demonstrated ability to alter the activity of calcium channels.

  13. MRI T2 Mapping of the Knee Articular Cartilage Using Different Acquisition Sequences and Calculation Methods at 1.5 Tesla.

    PubMed

    Mars, Mokhtar; Bouaziz, Mouna; Tbini, Zeineb; Ladeb, Fethi; Gharbi, Souha

    2018-06-12

    This study aims to determine how Magnetic Resonance Imaging (MRI) acquisition techniques and calculation methods affect T2 values of knee cartilage at 1.5 Tesla and to identify sequences that can be used for high-resolution T2 mapping in short scanning times. This study was performed on phantom and twenty-nine patients who underwent MRI of the knee joint at 1.5 Tesla. The protocol includes T2 mapping sequences based on Single Echo Spin Echo (SESE), Multi-Echo Spin Echo (MESE), Fast Spin Echo (FSE) and Turbo Gradient Spin Echo (TGSE). The T2 relaxation times were quantified and evaluated using three calculation methods (MapIt, Syngo Offline and monoexponential fit). Signal to Noise Ratios (SNR) were measured in all sequences. All statistical analyses were performed using the t-test. The average T2 values in phantom were 41.7 ± 13.8 ms for SESE, 43.2 ± 14.4 ms for MESE, 42.4 ± 14.1 ms for FSE and 44 ± 14.5 ms for TGSE. In the patient study, the mean differences were 6.5 ± 8.2 ms, 7.8 ± 7.6 ms and 8.4 ± 14.2 ms for MESE, FSE and TGSE compared to SESE respectively; these statistical results were not significantly different (p > 0.05). The comparison between the three calculation methods showed no significant difference (p > 0.05). t-Test showed no significant difference between SNR values for all sequences. T2 values depend not only on the sequence type but also on the calculation method. None of the sequences revealed significant differences compared to the SESE reference sequence. TGSE with its short scanning time can be used for high-resolution T2 mapping. ©2018The Author(s). Published by S. Karger AG, Basel.

  14. Microbial Diversity of Acidic Hot Spring (Kawah Hujan B) in Geothermal Field of Kamojang Area, West Java-Indonesia

    PubMed Central

    Aditiawati, Pingkan; Yohandini, Heni; Madayanti, Fida; Akhmaloka

    2009-01-01

    Microbial communities in an acidic hot spring, namely Kawah Hujan B, at Kamojang geothermal field, West Java-Indonesia was examined using culture dependent and culture independent strategies. Chemical analysis of the hot spring water showed a characteristic of acidic-sulfate geothermal activity that contained high sulfate concentrations and low pH values (pH 1.8 to 1.9). Microbial community present in the spring was characterized by 16S rRNA gene combined with denaturing gradient gel electrophoresis (DGGE) analysis. The majority of the sequences recovered from culture-independent method were closely related to Crenarchaeota and Proteobacteria phyla. However, detail comparison among the member of Crenarchaeota showing some sequences variation compared to that the published data especially on the hypervariable and variable regions. In addition, the sequences did not belong to certain genus. Meanwhile, the 16S Rdna sequences from culture-dependent samples revealed mostly close to Firmicute and gamma Proteobacteria. PMID:19440252

  15. Afterslip Enhanced Aftershock Activity During the 2017 Earthquake Sequence Near Sulphur Peak, Idaho

    DOE PAGES

    Koper, Keith D.; Pankow, Kristine L.; Pechmann, James C.; ...

    2018-05-29

    An energetic earthquake sequence occurred during September to October 2017 near Sulphur Peak, Idaho. The normal–faulting M w 5.3 mainshock of 2 September 2017 was widely felt in Idaho, Utah, and Wyoming. Over 1,000 aftershocks were located within the first 2 months, 29 of which had magnitudes ≥4.0 M L. High–accuracy locations derived with data from a temporary seismic array show that the sequence occurred in the upper (<10 km) crust of the Aspen Range, east of the northern section of the range–bounding, west–dipping East Bear Lake Fault. Moment tensors for 77 of the largest events show normal and strike–slipmore » faulting with a summed aftershock moment that is 1.8–2.4 times larger than the mainshock moment. Here, we propose that the unusually high productivity of the 2017 Sulphur Peak sequence can be explained by aseismic afterslip, which triggered a secondary swarm south of the coseismic rupture zone beginning ~1 day after the mainshock.« less

  16. Afterslip Enhanced Aftershock Activity During the 2017 Earthquake Sequence Near Sulphur Peak, Idaho

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koper, Keith D.; Pankow, Kristine L.; Pechmann, James C.

    An energetic earthquake sequence occurred during September to October 2017 near Sulphur Peak, Idaho. The normal–faulting M w 5.3 mainshock of 2 September 2017 was widely felt in Idaho, Utah, and Wyoming. Over 1,000 aftershocks were located within the first 2 months, 29 of which had magnitudes ≥4.0 M L. High–accuracy locations derived with data from a temporary seismic array show that the sequence occurred in the upper (<10 km) crust of the Aspen Range, east of the northern section of the range–bounding, west–dipping East Bear Lake Fault. Moment tensors for 77 of the largest events show normal and strike–slipmore » faulting with a summed aftershock moment that is 1.8–2.4 times larger than the mainshock moment. Here, we propose that the unusually high productivity of the 2017 Sulphur Peak sequence can be explained by aseismic afterslip, which triggered a secondary swarm south of the coseismic rupture zone beginning ~1 day after the mainshock.« less

  17. Microbial diversity of acidic hot spring (kawah hujan B) in geothermal field of kamojang area, west java-indonesia.

    PubMed

    Aditiawati, Pingkan; Yohandini, Heni; Madayanti, Fida; Akhmaloka

    2009-01-01

    Microbial communities in an acidic hot spring, namely Kawah Hujan B, at Kamojang geothermal field, West Java-Indonesia was examined using culture dependent and culture independent strategies. Chemical analysis of the hot spring water showed a characteristic of acidic-sulfate geothermal activity that contained high sulfate concentrations and low pH values (pH 1.8 to 1.9). Microbial community present in the spring was characterized by 16S rRNA gene combined with denaturing gradient gel electrophoresis (DGGE) analysis. The majority of the sequences recovered from culture-independent method were closely related to Crenarchaeota and Proteobacteria phyla. However, detail comparison among the member of Crenarchaeota showing some sequences variation compared to that the published data especially on the hypervariable and variable regions. In addition, the sequences did not belong to certain genus. Meanwhile, the 16S Rdna sequences from culture-dependent samples revealed mostly close to Firmicute and gamma Proteobacteria.

  18. Determining Clostridium difficile intra-taxa diversity by mining multilocus sequence typing databases.

    PubMed

    Muñoz, Marina; Ríos-Chaparro, Dora Inés; Patarroyo, Manuel Alfonso; Ramírez, Juan David

    2017-03-14

    Multilocus sequence typing (MLST) is a highly discriminatory typing strategy; it is reproducible and scalable. There is a MLST scheme for Clostridium difficile (CD), a gram positive bacillus causing different pathologies of the gastrointestinal tract. This work was aimed at describing the frequency of sequence types (STs) and Clades (C) reported and evalute the intra-taxa diversity in the CD MLST database (CD-MLST-db) using an MLSA approach. Analysis of 1778 available isolates showed that clade 1 (C1) was the most frequent worldwide (57.7%), followed by C2 (29.1%). Regarding sequence types (STs), it was found that ST-1, belonging to C2, was the most frequent. The isolates analysed came from 17 countries, mostly from the United Kingdom (UK) (1541 STs, 87.0%). The diversity of the seven housekeeping genes in the MLST scheme was evaluated, and alleles from the profiles (STs), for identifying CD population structure. It was found that adk and atpA are conserved genes allowing a limited amount of clusters to be discriminated; however, different genes such as drx, glyA and particularly sodA showed high diversity indexes and grouped CD populations in many clusters, suggesting that these genes' contribution to CD typing should be revised. It was identified that CD STs reported to date have a mostly clonal population structure with foreseen events of recombination; however, one group of STs was not assigned to a clade being highly different containing at least nine well-supported clusters, suggesting a greater amount of clades for CD. This study shows the usefulness of CD-MLST-db as a tool for studying CD distribution and population structure, identifying the need for reviewing the usefulness of sodA as housekeeping gene within the MLST scheme and suggesting the existence of a greater amount of CD clades. The study also shows the plausible exchange of genetic material between STs, contributing towards intra-taxa genetic diversity.

  19. Molecular characterization of two high-level ceftriaxone-resistant Neisseria gonorrhoeae isolates detected in Catalonia, Spain.

    PubMed

    Cámara, Jordi; Serra, Judit; Ayats, Josefina; Bastida, Teresa; Carnicer-Pont, Dolors; Andreu, Antònia; Ardanuy, Carmen

    2012-08-01

    The aim of this study was to characterize the first two extended-spectrum cephalosporin-resistant and multidrug-resistant (MDR) Neisseria gonorrhoeae isolates collected from two sexually related patients (men who have sex with men) in Spain. Antimicrobial susceptibility was studied by Etest. Genes involved in quinolone, ceftriaxone and multidrug resistance were amplified by PCR and sequenced in both directions. The isolates were typed by N. gonorrhoeae multi-antigen sequence typing (NG-MAST). The two isolates had the same MDR profile, showing resistance to penicillin (MIC 0.094 mg/L; β-lactamase negative), ceftriaxone (MIC 1.5 mg/L), cefixime (MIC 1.5 mg/L), cefotaxime (MIC 1 mg/L), ciprofloxacin (MIC >32 mg/L) and tetracycline (MIC 1.5 mg/L). NG-MAST showed that both isolates belonged to sequence type (ST) 1407 (porB-908 and tbpB-110). Ciprofloxacin resistance was due to amino acid substitutions in GyrA (S91F and D95G) and ParC (S87R). An A deletion in the promoter of the MtrCDE efflux pump (mtrR) was detected. No changes were detected in the pilQ gene. The outer membrane protein PorB showed two substitutions at G120K and A121N. An L421P substitution was observed in the PBP1A (ponA) sequence. The sequence of PBP2 (penA) showed a mosaic structure related to genotype XXXIV with a single additional amino acid substitution (A501P). This genotype was identical to a recently described French isolate (F89). This is the first reported case of high-level extended-spectrum cephalosporin-resistant N. gonorrhoeae transmission. The molecular typing and MDR genotype suggest possible European spread of this strain, highlighting the need for surveillance and the importance of testing the susceptibility of N. gonorrhoeae to extended-spectrum cephalosporins.

  20. Accurate Sample Assignment in a Multiplexed, Ultrasensitive, High-Throughput Sequencing Assay for Minimal Residual Disease.

    PubMed

    Bartram, Jack; Mountjoy, Edward; Brooks, Tony; Hancock, Jeremy; Williamson, Helen; Wright, Gary; Moppett, John; Goulden, Nick; Hubank, Mike

    2016-07-01

    High-throughput sequencing (HTS) (next-generation sequencing) of the rearranged Ig and T-cell receptor genes promises to be less expensive and more sensitive than current methods of monitoring minimal residual disease (MRD) in patients with acute lymphoblastic leukemia. However, the adoption of new approaches by clinical laboratories requires careful evaluation of all potential sources of error and the development of strategies to ensure the highest accuracy. Timely and efficient clinical use of HTS platforms will depend on combining multiple samples (multiplexing) in each sequencing run. Here we examine the Ig heavy-chain gene HTS on the Illumina MiSeq platform for MRD. We identify errors associated with multiplexing that could potentially impact the accuracy of MRD analysis. We optimize a strategy that combines high-purity, sequence-optimized oligonucleotides, dual indexing, and an error-aware demultiplexing approach to minimize errors and maximize sensitivity. We present a probability-based, demultiplexing pipeline Error-Aware Demultiplexer that is suitable for all MiSeq strategies and accurately assigns samples to the correct identifier without excessive loss of data. Finally, using controls quantified by digital PCR, we show that HTS-MRD can accurately detect as few as 1 in 10(6) copies of specific leukemic MRD. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

  1. High level of APOBEC3F/3G editing in HIV-2 DNA vif and pol sequences from antiretroviral-naive patients.

    PubMed

    Bertine, Mélanie; Charpentier, Charlotte; Visseaux, Benoit; Storto, Alexandre; Collin, Gilles; Larrouy, Lucile; Damond, Florence; Matheron, Sophie; Brun-Vézinet, Françoise; Descamps, Diane

    2015-04-24

    In HIV-1, hypermutation introduced by APOBEC3F/3G cytidine deaminase activity leads to defective viruses. In-vivo impact of APOBEC3F/3G editing on HIV-2 sequences remains unknown. The objective of this study was to assess the level of APOBEC3F/3G editing in HIV-2-infected antiretroviral-naive patients. Direct sequencing of vif and pol regions was performed on HIV-2 proviral DNA from antiretroviral-naive patients included in the French Agence Nationale de Recherches sur le SIDA et les hépatites virales CO5 HIV-2 cohort. Hypermutated sequences were identified using Hypermut2.0 program. HIV-1 proviral sequences from Genbank were also assessed. Among 82 antiretroviral-naive HIV-2-infected patients assessed, 15 (28.8%) and five (16.7%) displayed Vif proviral defective sequences in HIV-2 groups A and B, respectively. A lower proportion of defective sequences was observed in protease-reverse transcriptase region. A higher median number of G-to-A mutations was observed in HIV-2 group B than in group A, both in Vif and protease-reverse transcriptase regions (P = 0.02 and P = 0.006, respectively). Compared with HIV-1 Vif sequences, a higher number of Vif defective sequences was observed in HIV-2 group A (P = 0.00001) and group B sequences (P = 0.013). We showed for the first time a high level of APOBEC3F/3G editing in HIV-2 sequences from antiretroviral-naive patients. Our study reported a group effect with a significantly higher level of APOBEC3F/3G editing in HIV-2 group B than in group A sequences.

  2. Reproducibility of Illumina platform deep sequencing errors allows accurate determination of DNA barcodes in cells.

    PubMed

    Beltman, Joost B; Urbanus, Jos; Velds, Arno; van Rooij, Nienke; Rohr, Jan C; Naik, Shalin H; Schumacher, Ton N

    2016-04-02

    Next generation sequencing (NGS) of amplified DNA is a powerful tool to describe genetic heterogeneity within cell populations that can both be used to investigate the clonal structure of cell populations and to perform genetic lineage tracing. For applications in which both abundant and rare sequences are biologically relevant, the relatively high error rate of NGS techniques complicates data analysis, as it is difficult to distinguish rare true sequences from spurious sequences that are generated by PCR or sequencing errors. This issue, for instance, applies to cellular barcoding strategies that aim to follow the amount and type of offspring of single cells, by supplying these with unique heritable DNA tags. Here, we use genetic barcoding data from the Illumina HiSeq platform to show that straightforward read threshold-based filtering of data is typically insufficient to filter out spurious barcodes. Importantly, we demonstrate that specific sequencing errors occur at an approximately constant rate across different samples that are sequenced in parallel. We exploit this observation by developing a novel approach to filter out spurious sequences. Application of our new method demonstrates its value in the identification of true sequences amongst spurious sequences in biological data sets.

  3. DNA sequence transfer between two high-cysteine chorion gene families in the silkmoth Bombyx mori.

    PubMed Central

    Iatrou, K; Tsitilou, S G; Kafatos, F C

    1984-01-01

    We have previously shown that one type of high-cysteine silkmoth chorion protein (Hc-A) has evolved from the A family of chorion proteins by radical modifications of the NH2-terminal and COOH-terminal polypeptide arms: most of the arm sequences have been deleted, while short cysteine- and glycine-containing repeats have expanded into long arrays. Strikingly similar modifications of the arms have led to the evolution of a second type of high-cysteine protein (Hc-B) from the B family of chorion proteins. It appears that the parallel evolution of these high-cysteine-encoding gene families has not been entirely independent: examination of 3' untranslated regions shows evidence of information transfer between the two families. PMID:6589605

  4. Insights into rubber biosynthesis from transcriptome analysis of Hevea brasiliensis latex.

    PubMed

    Chow, Keng-See; Wan, Kiew-Lian; Isa, Mohd Noor Mat; Bahari, Azlina; Tan, Siang-Hee; Harikrishna, K; Yeang, Hoong-Yeet

    2007-01-01

    Hevea brasiliensis is the most widely cultivated species for commercial production of natural rubber (cis-polyisoprene). In this study, 10,040 expressed sequence tags (ESTs) were generated from the latex of the rubber tree, which represents the cytoplasmic content of a single cell type, in order to analyse the latex transcription profile with emphasis on rubber biosynthesis-related genes. A total of 3,441 unique transcripts (UTs) were obtained after quality editing and assembly of EST sequences. Functional classification of UTs according to the Gene Ontology convention showed that 73.8% were related to genes of unknown function. Among highly expressed ESTs, a significant proportion encoded proteins related to rubber biosynthesis and stress or defence responses. Sequences encoding rubber particle membrane proteins (RPMPs) belonging to three protein families accounted for 12% of the ESTs. Characterization of these ESTs revealed nine RPMP variants (7.9-27 kDa) including the 14 kDa REF (rubber elongation factor) and 22 kDa SRPP (small rubber particle protein). The expression of multiple RPMP isoforms in latex was shown using antibodies against REF and SRPP. Both EST and quantitative reverse transcription-PCR (QRT-PCR) analyses demonstrated REF and SRPP to be the most abundant transcripts in latex. Besides rubber biosynthesis, comparative sequence analysis showed that the RPMPs are highly similar to sequences in the plant kingdom having stress-related functions. Implications of the RPMP function in cis-polyisoprene biosynthesis in the context of transcript abundance and differential gene expression are discussed.

  5. Effective DNA Inhibitors of Cathepsin G by In Vitro Selection

    PubMed Central

    Gatto, Barbara; Vianini, Elena; Lucatello, Lorena; Sissi, Claudia; Moltrasio, Danilo; Pescador, Rodolfo; Porta, Roberto; Palumbo, Manlio

    2008-01-01

    Cathepsin G (CatG) is a chymotrypsin-like protease released upon degranulation of neutrophils. In several inflammatory and ischaemic diseases the impaired balance between CatG and its physiological inhibitors leads to tissue destruction and platelet aggregation. Inhibitors of CatG are suitable for the treatment of inflammatory diseases and procoagulant conditions. DNA released upon the death of neutrophils at injury sites binds CatG. Moreover, short DNA fragments are more inhibitory than genomic DNA. Defibrotide, a single stranded polydeoxyribonucleotide with antithrombotic effect is also a potent CatG inhibitor. Given the above experimental evidences we employed a selection protocol to assess whether DNA inhibition of CatG may be ascribed to specific sequences present in defibrotide DNA. A Selex protocol was applied to identify the single-stranded DNA sequences exhibiting the highest affinity for CatG, the diversity of a combinatorial pool of oligodeoxyribonucleotides being a good representation of the complexity found in defibrotide. Biophysical and biochemical studies confirmed that the selected sequences bind tightly to the target enzyme and also efficiently inhibit its catalytic activity. Sequence analysis carried out to unveil a motif responsible for CatG recognition showed a recurrence of alternating TG repeats in the selected CatG binders, adopting an extended conformation that grants maximal interaction with the highly charged protein surface. This unprecedented finding is validated by our results showing high affinity and inhibition of CatG by specific DNA sequences of variable length designed to maximally reduce pairing/folding interactions. PMID:19325843

  6. Characterization of durum wheat high molecular weight glutenin subunits Bx20 and By20 sequences by a molecular and proteomic approach.

    PubMed

    Santagati, Vito Davide; Sestili, Francesco; Lafiandra, Domenico; D'Ovidio, Renato; Rogniaux, Helene; Masci, Stefania

    2016-07-01

    Wheat high molecular weight glutenin subunit variation is important because of its great influence on glutenin polymer structure, that is related to dough technological properties. Among the different subunits, the pair Bx20 and By20 is known to have a negative effect on quality, but the reasons are not clear: Bx20 has two cysteines, which theoretically make this subunit a chain extender of the glutenin polymer, just like the other Bx subunits, showing four cysteines, two of which should be involved in intra-molecular disulfide bonds. By20 has never been characterized so far at molecular level. Here we report the nucleotide sequences of Bx20 and By20 genes isolated from the durum wheat cultivar 'Lira 45' and the validation of the corresponding deduced amino acid sequences by using MALDI-TOF and LC-MS/MS. Four nucleotide differences were identified in the Bx20 gene with respect to the deduced sequence present in NCBI, causing two amino acid substitutions. For the By20 subunit, nucleotide and amino acid sequences revealed a great similarity to By15, both at gene and protein levels, showing five nucleotide changes generating two amino acid differences. No evidence of post-translational modifications has been found. Hypotheses are formulated in regard to relationships with technological quality. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  7. The complete chloroplast genome sequence of Dodonaea viscosa: comparative and phylogenetic analyses.

    PubMed

    Saina, Josphat K; Gichira, Andrew W; Li, Zhi-Zhong; Hu, Guang-Wan; Wang, Qing-Feng; Liao, Kuo

    2018-02-01

    The plant chloroplast (cp) genome is a highly conserved structure which is beneficial for evolution and systematic research. Currently, numerous complete cp genome sequences have been reported due to high throughput sequencing technology. However, there is no complete chloroplast genome of genus Dodonaea that has been reported before. To better understand the molecular basis of Dodonaea viscosa chloroplast, we used Illumina sequencing technology to sequence its complete genome. The whole length of the cp genome is 159,375 base pairs (bp), with a pair of inverted repeats (IRs) of 27,099 bp separated by a large single copy (LSC) 87,204 bp, and small single copy (SSC) 17,972 bp. The annotation analysis revealed a total of 115 unique genes of which 81 were protein coding, 30 tRNA, and four ribosomal RNA genes. Comparative genome analysis with other closely related Sapindaceae members showed conserved gene order in the inverted and single copy regions. Phylogenetic analysis clustered D. viscosa with other species of Sapindaceae with strong bootstrap support. Finally, a total of 249 SSRs were detected. Moreover, a comparison of the synonymous (Ks) and nonsynonymous (Ka) substitution rates in D. viscosa showed very low values. The availability of cp genome reported here provides a valuable genetic resource for comprehensive further studies in genetic variation, taxonomy and phylogenetic evolution of Sapindaceae family. In addition, SSR markers detected will be used in further phylogeographic and population structure studies of the species in this genus.

  8. Whole-comparative genomic hybridization in domestic sheep (Ovis aries) breeds.

    PubMed

    Dávila-Rodríguez, M I; Cortés-Gutiérrez, E I; López-Fernández, C; Pita, M; Mezzanotte, R; Gosálvez, J

    2009-01-01

    Whole-comparative genomic hybridization (W-CGH) allows identification of chromosomal polymorphisms related to highly repetitive DNA sequences localized in constitutive heterochromatin. Such polymorphisms are detected establishing competition between genomic DNAs in an in situ hybridization environment without subtraction of highly repetitive DNA sequences, when comparing two species from closely related taxa (same species, sub-species, or breeds) or somewhat related taxa. This experimental approach was applied to investigating differences in highly repetitive sequences of three sheep breeds (Castellana, Ojalada, and Assaf). To this end, W-CGH was carried out using mouflon (sheep ancestor) chromosomes as a common target to co-hybridize equimolar quantities of two genomic DNAs obtained from either Castellana, Ojalada or Assaf sheep breeds. The results showed that the amount of constitutive heterochromatin is greater in all pericentromeric heterochromatin regions of acrocentric chromosomes than in metacentric or sex chromosomes. Additionally, when W-CGH was performed using DNAs from the Iberian breeds Castellana and Ojalada, chromosomal pericentromeric regions revealed quantitatively and qualitatively a presence of DNA families similar to that obtained from any of the above-cited breeds. On the contrary, when the DNA used in W-CGH experiments was obtained from Assaf, as compared to either Castellana or Ojalada, two different pericentromeric DNA families of highly repetitive sequences could be detected. Lastly, sex chromosomes were shown to be homogeneous among all breeds and thus revealed no detectable constitutive heterochromatin. W-CGH results were confirmed using DNA breakage detection-FISH experiments (DBD-FISH) carried out on lymphocytes. As a whole, the results showed that two different repetitive DNA families are present in the pericentromeric heterochromatin of the sheep breeds studied here. Additionally, they suggest a differential presence of these distinct repetitive DNA families in Castellana and Ojalada breeds as compared to the Assaf breed. Finally, the results of W-CGH after using mouflon as the targeted chromosomes also show that the two DNA families are present in the ancestor. Copyright 2009 S. Karger AG, Basel.

  9. Characterization of Developmental- and Stress-Mediated Expression of Cinnamoyl-CoA Reductase in Kenaf (Hibiscus cannabinus L.)

    PubMed Central

    Lim, Hyoun-Sub; Park, Sang-Un; Bae, Hyeun-Jong; Natarajan, Savithiry

    2014-01-01

    Cinnamoyl-CoA reductase (CCR) is an important enzyme for lignin biosynthesis as it catalyzes the first specific committed step in monolignol biosynthesis. We have cloned a full length coding sequence of CCR from kenaf (Hibiscus cannabinus L.), which contains a 1,020-bp open reading frame (ORF), encoding 339 amino acids of 37.37 kDa, with an isoelectric point (pI) of 6.27 (JX524276, HcCCR2). BLAST result found that it has high homology with other plant CCR orthologs. Multiple alignment with other plant CCR sequences showed that it contains two highly conserved motifs: NAD(P) binding domain (VTGAGGFIASWMVKLLLEKGY) at N-terminal and probable catalytic domain (NWYCYGK). According to phylogenetic analysis, it was closely related to CCR sequences of Gossypium hirsutum (ACQ59094) and Populus trichocarpa (CAC07424). HcCCR2 showed ubiquitous expression in various kenaf tissues and the highest expression was detected in mature flower. HcCCR2 was expressed differentially in response to various stresses, and the highest expression was observed by drought and NaCl treatments. PMID:24723816

  10. Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

    PubMed Central

    Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

    1999-01-01

    Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

  11. Proteomic Identification of Monoclonal Antibodies from Serum

    PubMed Central

    2015-01-01

    Characterizing the in vivo dynamics of the polyclonal antibody repertoire in serum, such as that which might arise in response to stimulation with an antigen, is difficult due to the presence of many highly similar immunoglobulin proteins, each specified by distinct B lymphocytes. These challenges have precluded the use of conventional mass spectrometry for antibody identification based on peptide mass spectral matches to a genomic reference database. Recently, progress has been made using bottom-up analysis of serum antibodies by nanoflow liquid chromatography/high-resolution tandem mass spectrometry combined with a sample-specific antibody sequence database generated by high-throughput sequencing of individual B cell immunoglobulin variable domains (V genes). Here, we describe how intrinsic features of antibody primary structure, most notably the interspersed segments of variable and conserved amino acid sequences, generate recurring patterns in the corresponding peptide mass spectra of V gene peptides, greatly complicating the assignment of correct sequences to mass spectral data. We show that the standard method of decoy-based error modeling fails to account for the error introduced by these highly similar sequences, leading to a significant underestimation of the false discovery rate. Because of these effects, antibody-derived peptide mass spectra require increased stringency in their interpretation. The use of filters based on the mean precursor ion mass accuracy of peptide-spectrum matches is shown to be particularly effective in distinguishing between “true” and “false” identifications. These findings highlight important caveats associated with the use of standard database search and error-modeling methods with nonstandard data sets and custom sequence databases. PMID:24684310

  12. SNP Discovery in the Transcriptome of White Pacific Shrimp Litopenaeus vannamei by Next Generation Sequencing

    PubMed Central

    Yu, Yang; Wei, Jiankai; Zhang, Xiaojun; Liu, Jingwen; Liu, Chengzhang; Li, Fuhua; Xiang, Jianhai

    2014-01-01

    The application of next generation sequencing technology has greatly facilitated high throughput single nucleotide polymorphism (SNP) discovery and genotyping in genetic research. In the present study, SNPs were discovered based on two transcriptomes of Litopenaeus vannamei (L. vannamei) generated from Illumina sequencing platform HiSeq 2000. One transcriptome of L. vannamei was obtained through sequencing on the RNA from larvae at mysis stage and its reference sequence was de novo assembled. The data from another transcriptome were downloaded from NCBI and the reads of the two transcriptomes were mapped separately to the assembled reference by BWA. SNP calling was performed using SAMtools. A total of 58,717 and 36,277 SNPs with high quality were predicted from the two transcriptomes, respectively. SNP calling was also performed using the reads of two transcriptomes together, and a total of 96,040 SNPs with high quality were predicted. Among these 96,040 SNPs, 5,242 and 29,129 were predicted as non-synonymous and synonymous SNPs respectively. Characterization analysis of the predicted SNPs in L. vannamei showed that the estimated SNP frequency was 0.21% (one SNP per 476 bp) and the estimated ratio for transition to transversion was 2.0. Fifty SNPs were randomly selected for validation by Sanger sequencing after PCR amplification and 76% of SNPs were confirmed, which indicated that the SNPs predicted in this study were reliable. These SNPs will be very useful for genetic study in L. vannamei, especially for the high density linkage map construction and genome-wide association studies. PMID:24498047

  13. A G-to-A mutation in IVS-3 of the human gamma fibrinogen gene causing afibrinogenemia due to abnormal RNA splicing.

    PubMed

    Margaglione, M; Santacroce, R; Colaizzo, D; Seripa, D; Vecchione, G; Lupone, M R; De Lucia, D; Fortina, P; Grandone, E; Perricone, C; Di Minno, G

    2000-10-01

    Congenital afibrinogenemia is a rare autosomal recessive disorder characterized by a hemorrhagic diathesis of variable severity. Although more than 100 families with this disorder have been described, genetic defects have been characterized in few cases. An investigation of a young propositus, offspring of a consanguineous marriage, with undetectable levels of functional and quantitative fibrinogen, was conducted. Sequence analysis of the fibrinogen genes showed a homozygous G-to-A mutation at the fifth nucleotide (nt 2395) of the third intervening sequence (IVS) of the gamma-chain gene. Her first-degree relatives, who had approximately half the normal fibrinogen values and showed concordance between functional and immunologic levels, were heterozygtes. The G-to-A change predicts the disappearance of a donor splice site. After transfection with a construct, containing either the wild-type or the mutated sequence, cells with the mutant construct showed an aberrant messenger RNA (mRNA), consistent with skipping of exon 3, but not the expected mRNA. Sequencing of the abnormal mRNA showed the complete absence of exon 3. Skipping of exon 3 predicts the deletion of amino acid sequence from residue 16 to residue 75 and shifting of reading frame at amino acid 76 with a premature stop codon within exon 4 at position 77. Thus, the truncated gamma-chain gene product would not interact with other chains to form the mature fibrinogen molecule. The current findings show that mutations within highly conserved IVS regions of fibrinogen genes could affect the efficiency of normal splicing, giving rise to congenital afibrinogenemia.

  14. Detection of a new bat gammaherpesvirus in the Philippines.

    PubMed

    Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

    2009-08-01

    A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

  15. An experimental phylogeny to benchmark ancestral sequence reconstruction

    PubMed Central

    Randall, Ryan N.; Radford, Caelan E.; Roof, Kelsey A.; Natarajan, Divya K.; Gaucher, Eric A.

    2016-01-01

    Ancestral sequence reconstruction (ASR) is a still-burgeoning method that has revealed many key mechanisms of molecular evolution. One criticism of the approach is an inability to validate its algorithms within a biological context as opposed to a computer simulation. Here we build an experimental phylogeny using the gene of a single red fluorescent protein to address this criticism. The evolved phylogeny consists of 19 operational taxonomic units (leaves) and 17 ancestral bifurcations (nodes) that display a wide variety of fluorescent phenotypes. The 19 leaves then serve as ‘modern' sequences that we subject to ASR analyses using various algorithms and to benchmark against the known ancestral genotypes and ancestral phenotypes. We confirm computer simulations that show all algorithms infer ancient sequences with high accuracy, yet we also reveal wide variation in the phenotypes encoded by incorrectly inferred sequences. Specifically, Bayesian methods incorporating rate variation significantly outperform the maximum parsimony criterion in phenotypic accuracy. Subsampling of extant sequences had minor effect on the inference of ancestral sequences. PMID:27628687

  16. Neutrality and evolvability of designed protein sequences

    NASA Astrophysics Data System (ADS)

    Bhattacherjee, Arnab; Biswas, Parbati

    2010-07-01

    The effect of foldability on protein’s evolvability is analyzed by a two-prong approach consisting of a self-consistent mean-field theory and Monte Carlo simulations. Theory and simulation models representing protein sequences with binary patterning of amino acid residues compatible with a particular foldability criteria are used. This generalized foldability criterion is derived using the high temperature cumulant expansion approximating the free energy of folding. The effect of cumulative point mutations on these designed proteins is studied under neutral condition. The robustness, protein’s ability to tolerate random point mutations is determined with a selective pressure of stability (ΔΔG) for the theory designed sequences, which are found to be more robust than that of Monte Carlo and mean-field-biased Monte Carlo generated sequences. The results show that this foldability criterion selects viable protein sequences more effectively compared to the Monte Carlo method, which has a marked effect on how the selective pressure shapes the evolutionary sequence space. These observations may impact de novo sequence design and its applications in protein engineering.

  17. Detecting cooperative sequences in the binding of RNA Polymerase-II

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

    2008-03-01

    Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

  18. Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses

    PubMed Central

    Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A.; Janke, Axel

    2015-01-01

    The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. PMID:26019166

  19. Influence of Flow Sequencing Attributed to Climate Change and Climate Variability on the Assessment of Water-dependent Ecosystem Outcomes

    NASA Astrophysics Data System (ADS)

    Wang, J.; Nathan, R.; Horne, A.

    2017-12-01

    Traditional approaches to characterize water-dependent ecosystem outcomes in response to flow have been based on time-averaged hydrological indicators, however there is increasing recognition for the need to characterize ecological processes that are highly dependent on the sequencing of flow conditions (i.e. floods and droughts). This study considers the representation of flow regimes when considering assessment of ecological outcomes, and in particular, the need to account for sequencing and variability of flow. We conducted two case studies - one in the largely unregulated Ovens River catchment and one in the highly regulated Murray River catchment (both located in south-eastern Australia) - to explore the importance of flow sequencing to the condition of a typical long-lived ecological asset in Australia, the River Red Gum forests. In the first, the Ovens River case study, the implications of representing climate change using different downscaling methods (annual scaling, monthly scaling, quantile mapping, and weather generator method) on the sequencing of flows and resulting ecological outcomes were considered. In the second, the Murray River catchment, sequencing within a historic drought period was considered by systematically making modest adjustments on an annual basis to the hydrological records. In both cases, the condition of River Red Gum forests was assessed using an ecological model that incorporates transitions between ecological conditions in response to sequences of required flow components. The results of both studies show the importance of considering how hydrological alterations are represented when assessing ecological outcomes. The Ovens case study showed that there is significant variation in the predicted ecological outcomes when different downscaling techniques are applied. Similarly, the analysis in the Murray case study showed that the drought as it historically occurred provided one of the best possible outcomes for River Red Gum forests when compared to other re-arrangements of flow within the same drought. These results have implications for the way we represent climate change impacts and drought risk assessments where ecological outcomes are a key management objective.

  20. The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

    PubMed

    Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

    2018-05-17

    Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    PubMed

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Image quality assessment of silent T2 PROPELLER sequence for brain imaging in infants.

    PubMed

    Kim, Hyun Gi; Choi, Jin Wook; Yoon, Soo Han; Lee, Sieun

    2018-02-01

    Infants are vulnerable to high acoustic noise. Acoustic noise generated by MR scanning can be reduced by a silent sequence. The purpose of this study is to compare the image quality of the conventional and silent T2 PROPELLER sequences for brain imaging in infants. A total of 36 scans were acquired from 24 infants using a 3 T MR scanner. Each patient underwent both conventional and silent T2 PROPELLER sequences. Acoustic noise level was measured. Quantitative and qualitative assessments were performed with the images taken with each sequence. The sound pressure level of the conventional T2 PROPELLER imaging sequence was 92.1 dB and that of the silent T2 PROPELLER imaging sequence was 73.3 dB (reduction of 20%). On quantitative assessment, the two sequences (conventional vs silent T2 PROPELLER) did not show significant difference in relative contrast (0.069 vs 0.068, p value = 0.536) and signal-to-noise ratio (75.4 vs 114.8, p value = 0.098). Qualitative assessment of overall image quality (p value = 0.572), grey-white differentiation (p value = 0.986), shunt-related artefact (p value > 0.999), motion artefact (p value = 0.801) and myelination degree in different brain regions (p values ≥ 0.092) did not show significant difference between the two sequences. The silent T2 PROPELLER sequence reduces acoustic noise and generated comparable image quality to that of the conventional sequence. Advances in knowledge: This is the first report to compare silent T2 PROPELLER images with that of conventional T2 PROPELLER images in children.

  3. Increasing Compliance of Children with Autism: Effects of Programmed Reinforcement for High-Probability Requests and Varied Inter-Instruction Intervals

    ERIC Educational Resources Information Center

    Pitts, Laura; Dymond, Simon

    2012-01-01

    Research on the high-probability (high-p) request sequence shows that compliance with low-probability (low-p) requests generally increases when preceded by a series of high-p requests. Few studies have conducted formal preference assessments to identify the consequences used for compliance, which may partly explain treatment failures, and still…

  4. ChAy/Bx, a novel chimeric high-molecular-weight glutenin subunit gene apparently created by homoeologous recombination in Triticum turgidum ssp. dicoccoides.

    PubMed

    Guo, Xiao-Hui; Bi, Zhe-Guang; Wu, Bi-Hua; Wang, Zhen-Zhen; Hu, Ji-Liang; Zheng, You-Liang; Liu, Deng-Cai

    2013-12-01

    High-molecular-weight glutenin subunits (HMW-GSs) are of considerable interest, because they play a crucial role in determining dough viscoelastic properties and end-use quality of wheat flour. In this paper, ChAy/Bx, a novel chimeric HMW-GS gene from Triticum turgidum ssp. dicoccoides (AABB, 2n=4x=28) accession D129, was isolated and characterized. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis revealed that the electrophoretic mobility of the glutenin subunit encoded by ChAy/Bx was slightly faster than that of 1Dy12. The complete ORF of ChAy/Bx contained 1,671 bp encoding a deduced polypeptide of 555 amino acid residues (or 534 amino acid residues for the mature protein), making it the smallest HMW-GS gene known from Triticum species. Sequence analysis showed that ChAy/Bx was neither a conventional x-type nor a conventional y-type subunit gene, but a novel chimeric gene. Its first 1305 nt sequence was highly homologous with the corresponding sequence of 1Ay type genes, while its final 366 nt sequence was highly homologous with the corresponding sequence of 1Bx type genes. The mature ChAy/Bx protein consisted of the N-terminus of 1Ay type subunit (the first 414 amino acid residues) and the C-terminus of 1Bx type subunit (the final 120 amino acid residues). Secondary structure prediction showed that ChAy/Bx contained some domains of 1Ay subunit and some domains of 1Bx subunit. The special structure of this HMW glutenin chimera ChAy/Bx subunit might have unique effects on the end-use quality of wheat flour. Here we propose that homoeologous recombination might be a novel pathway for allelic variation or molecular evolution of HMW-GSs. © 2013.

  5. Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells.

    PubMed

    Klein, Allon M; Mazutis, Linas; Akartuna, Ilke; Tallapragada, Naren; Veres, Adrian; Li, Victor; Peshkin, Leonid; Weitz, David A; Kirschner, Marc W

    2015-05-21

    It has long been the dream of biologists to map gene expression at the single-cell level. With such data one might track heterogeneous cell sub-populations, and infer regulatory relationships between genes and pathways. Recently, RNA sequencing has achieved single-cell resolution. What is limiting is an effective way to routinely isolate and process large numbers of individual cells for quantitative in-depth sequencing. We have developed a high-throughput droplet-microfluidic approach for barcoding the RNA from thousands of individual cells for subsequent analysis by next-generation sequencing. The method shows a surprisingly low noise profile and is readily adaptable to other sequencing-based assays. We analyzed mouse embryonic stem cells, revealing in detail the population structure and the heterogeneous onset of differentiation after leukemia inhibitory factor (LIF) withdrawal. The reproducibility of these high-throughput single-cell data allowed us to deconstruct cell populations and infer gene expression relationships. VIDEO ABSTRACT. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Investigation of the design of a metal-lined fully wrapped composite vessel under high internal pressure

    NASA Astrophysics Data System (ADS)

    Kalaycıoğlu, Barış; Husnu Dirikolu, M.

    2010-09-01

    In this study, a Type III composite pressure vessel (ISO 11439:2000) loaded with high internal pressure is investigated in terms of the effect of the orientation of the element coordinate system while simulating the continuous variation of the fibre angle, the effect of symmetric and non-symmetric composite wall stacking sequences, and lastly, a stacking sequence evaluation for reducing the cylindrical section-end cap transition region stress concentration. The research was performed using an Ansys® model with 2.9 l volume, 6061 T6 aluminium liner/Kevlar® 49-Epoxy vessel material, and a service internal pressure loading of 22 MPa. The results show that symmetric stacking sequences give higher burst pressures by up to 15%. Stacking sequence evaluations provided a further 7% pressure-carrying capacity as well as reduced stress concentration in the transition region. Finally, the Type III vessel under consideration provides a 45% lighter construction as compared with an all metal (Type I) vessel.

  7. Sequencing ebola and marburg viruses genomes using microarrays.

    PubMed

    Hardick, Justin; Woelfel, Roman; Gardner, Warren; Ibrahim, Sofi

    2016-08-01

    Periodic outbreaks of Ebola and Marburg hemorrhagic fevers have occurred in Africa over the past four decades with case fatality rates reaching as high as 90%. The latest Ebola outbreak in West Africa in 2014 raised concerns that these infections can spread across continents and pose serious health risks. Early and accurate identification of the causative agents is necessary to contain outbreaks. In this report, we describe sequencing-by-hybridization (SBH) technique using high density microarrays to identify Ebola and Marburg viruses. The microarrays were designed to interrogate the sequences of entire viral genomes, and were evaluated with three species of Ebolavirus (Reston, Sudan, and Zaire), and three strains of Marburgvirus (Angola, Musoke, and Ravn). The results showed that the consensus sequences generated with four or more hybridizations had 92.1-98.9% accuracy over 95-99% of the genomes. Additionally, with SBH microarrays it was possible to distinguish between different strains of the Lake Victoria Marburgvirus. J. Med. Virol. 88:1303-1308, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Viruses associated with Antarctic wildlife: From serology based detection to identification of genomes using high throughput sequencing.

    PubMed

    Smeele, Zoe E; Ainley, David G; Varsani, Arvind

    2018-01-02

    The Antarctic, sub-Antarctic islands and surrounding sea-ice provide a unique environment for the existence of organisms. Nonetheless, birds and seals of a variety of species inhabit them, particularly during their breeding seasons. Early research on Antarctic wildlife health, using serology-based assays, showed exposure to viruses in the families Birnaviridae, Flaviviridae, Herpesviridae, Orthomyxoviridae and Paramyxoviridae circulating in seals (Phocidae), penguins (Spheniscidae), petrels (Procellariidae) and skuas (Stercorariidae). It is only during the last decade or so that polymerase chain reaction-based assays have been used to characterize viruses associated with Antarctic animals. Furthermore, it is only during the last five years that full/whole genomes of viruses (adenoviruses, anelloviruses, orthomyxoviruses, a papillomavirus, paramyoviruses, polyomaviruses and a togavirus) have been sequenced using Sanger sequencing or high throughput sequencing (HTS) approaches. This review summaries the knowledge of animal Antarctic virology and discusses potential future directions with the advent of HTS in virus discovery and ecology. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. De novo assembly and next-generation sequencing to analyse full-length gene variants from codon-barcoded libraries.

    PubMed

    Cho, Namjin; Hwang, Byungjin; Yoon, Jung-ki; Park, Sangun; Lee, Joongoo; Seo, Han Na; Lee, Jeewon; Huh, Sunghoon; Chung, Jinsoo; Bang, Duhee

    2015-09-21

    Interpreting epistatic interactions is crucial for understanding evolutionary dynamics of complex genetic systems and unveiling structure and function of genetic pathways. Although high resolution mapping of en masse variant libraries renders molecular biologists to address genotype-phenotype relationships, long-read sequencing technology remains indispensable to assess functional relationship between mutations that lie far apart. Here, we introduce JigsawSeq for multiplexed sequence identification of pooled gene variant libraries by combining a codon-based molecular barcoding strategy and de novo assembly of short-read data. We first validate JigsawSeq on small sub-pools and observed high precision and recall at various experimental settings. With extensive simulations, we then apply JigsawSeq to large-scale gene variant libraries to show that our method can be reliably scaled using next-generation sequencing. JigsawSeq may serve as a rapid screening tool for functional genomics and offer the opportunity to explore evolutionary trajectories of protein variants.

  10. Targeted sequencing for high-resolution evolutionary analyses following genome duplication in salmonid fish: Proof of concept for key components of the insulin-like growth factor axis.

    PubMed

    Lappin, Fiona M; Shaw, Rebecca L; Macqueen, Daniel J

    2016-12-01

    High-throughput sequencing has revolutionised comparative and evolutionary genome biology. It has now become relatively commonplace to generate multiple genomes and/or transcriptomes to characterize the evolution of large taxonomic groups of interest. Nevertheless, such efforts may be unsuited to some research questions or remain beyond the scope of some research groups. Here we show that targeted high-throughput sequencing offers a viable alternative to study genome evolution across a vertebrate family of great scientific interest. Specifically, we exploited sequence capture and Illumina sequencing to characterize the evolution of key components from the insulin-like growth (IGF) signalling axis of salmonid fish at unprecedented phylogenetic resolution. The IGF axis represents a central governor of vertebrate growth and its core components were expanded by whole genome duplication in the salmonid ancestor ~95Ma. Using RNA baits synthesised to genes encoding the complete family of IGF binding proteins (IGFBP) and an IGF hormone (IGF2), we captured, sequenced and assembled orthologous and paralogous exons from species representing all ten salmonid genera. This approach generated 299 novel sequences, most as complete or near-complete protein-coding sequences. Phylogenetic analyses confirmed congruent evolutionary histories for all nineteen recognized salmonid IGFBP family members and identified novel salmonid-specific IGF2 paralogues. Moreover, we reconstructed the evolution of duplicated IGF axis paralogues across a replete salmonid phylogeny, revealing complex historic selection regimes - both ancestral to salmonids and lineage-restricted - that frequently involved asymmetric paralogue divergence under positive and/or relaxed purifying selection. Our findings add to an emerging literature highlighting diverse applications for targeted sequencing in comparative-evolutionary genomics. We also set out a viable approach to obtain large sets of nuclear genes for any member of the salmonid family, which should enable insights into the evolutionary role of whole genome duplication before additional nuclear genome sequences become available. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  11. BrEPS 2.0: Optimization of sequence pattern prediction for enzyme annotation.

    PubMed

    Dudek, Christian-Alexander; Dannheim, Henning; Schomburg, Dietmar

    2017-01-01

    The prediction of gene functions is crucial for a large number of different life science areas. Faster high throughput sequencing techniques generate more and larger datasets. The manual annotation by classical wet-lab experiments is not suitable for these large amounts of data. We showed earlier that the automatic sequence pattern-based BrEPS protocol, based on manually curated sequences, can be used for the prediction of enzymatic functions of genes. The growing sequence databases provide the opportunity for more reliable patterns, but are also a challenge for the implementation of automatic protocols. We reimplemented and optimized the BrEPS pattern generation to be applicable for larger datasets in an acceptable timescale. Primary improvement of the new BrEPS protocol is the enhanced data selection step. Manually curated annotations from Swiss-Prot are used as reliable source for function prediction of enzymes observed on protein level. The pool of sequences is extended by highly similar sequences from TrEMBL and SwissProt. This allows us to restrict the selection of Swiss-Prot entries, without losing the diversity of sequences needed to generate significant patterns. Additionally, a supporting pattern type was introduced by extending the patterns at semi-conserved positions with highly similar amino acids. Extended patterns have an increased complexity, increasing the chance to match more sequences, without losing the essential structural information of the pattern. To enhance the usability of the database, we introduced enzyme function prediction based on consensus EC numbers and IUBMB enzyme nomenclature. BrEPS is part of the Braunschweig Enzyme Database (BRENDA) and is available on a completely redesigned website and as download. The database can be downloaded and used with the BrEPScmd command line tool for large scale sequence analysis. The BrEPS website and downloads for the database creation tool, command line tool and database are freely accessible at http://breps.tu-bs.de.

  12. BrEPS 2.0: Optimization of sequence pattern prediction for enzyme annotation

    PubMed Central

    Schomburg, Dietmar

    2017-01-01

    The prediction of gene functions is crucial for a large number of different life science areas. Faster high throughput sequencing techniques generate more and larger datasets. The manual annotation by classical wet-lab experiments is not suitable for these large amounts of data. We showed earlier that the automatic sequence pattern-based BrEPS protocol, based on manually curated sequences, can be used for the prediction of enzymatic functions of genes. The growing sequence databases provide the opportunity for more reliable patterns, but are also a challenge for the implementation of automatic protocols. We reimplemented and optimized the BrEPS pattern generation to be applicable for larger datasets in an acceptable timescale. Primary improvement of the new BrEPS protocol is the enhanced data selection step. Manually curated annotations from Swiss-Prot are used as reliable source for function prediction of enzymes observed on protein level. The pool of sequences is extended by highly similar sequences from TrEMBL and SwissProt. This allows us to restrict the selection of Swiss-Prot entries, without losing the diversity of sequences needed to generate significant patterns. Additionally, a supporting pattern type was introduced by extending the patterns at semi-conserved positions with highly similar amino acids. Extended patterns have an increased complexity, increasing the chance to match more sequences, without losing the essential structural information of the pattern. To enhance the usability of the database, we introduced enzyme function prediction based on consensus EC numbers and IUBMB enzyme nomenclature. BrEPS is part of the Braunschweig Enzyme Database (BRENDA) and is available on a completely redesigned website and as download. The database can be downloaded and used with the BrEPScmd command line tool for large scale sequence analysis. The BrEPS website and downloads for the database creation tool, command line tool and database are freely accessible at http://breps.tu-bs.de. PMID:28750104

  13. The Influence of Phonotactic Probability on Nonword Repetition and Fast Mapping in 3-Year-Olds With a History of Expressive Language Delay.

    PubMed

    MacRoy-Higgins, Michelle; Dalton, Kevin Patrick

    2015-12-01

    The purpose of this study was to examine the influence of phonotactic probability on sublexical (phonological) and lexical representations in 3-year-olds who had a history of being late talkers in comparison with their peers with typical language development. Ten 3-year-olds who were late talkers and 10 age-matched typically developing controls completed nonword repetition and fast mapping tasks; stimuli for both experimental procedures differed in phonotactic probability. Both participant groups repeated nonwords containing high phonotactic probability sequences more accurately than nonwords containing low phonotactic probability sequences. Participants with typical language showed an early advantage for fast mapping high phonotactic probability words; children who were late talkers required more exposures to the novel words to show the same advantage for fast mapping high phonotactic probability words. Children who were late talkers showed similar sensitivities to phonotactic probability in nonword repetition and word learning when compared with their peers with no history of language delay. However, word learning in children who were late talkers appeared to be slower when compared with their peers.

  14. Parallel computation of genome-scale RNA secondary structure to detect structural constraints on human genome.

    PubMed

    Kawaguchi, Risa; Kiryu, Hisanori

    2016-05-06

    RNA secondary structure around splice sites is known to assist normal splicing by promoting spliceosome recognition. However, analyzing the structural properties of entire intronic regions or pre-mRNA sequences has been difficult hitherto, owing to serious experimental and computational limitations, such as low read coverage and numerical problems. Our novel software, "ParasoR", is designed to run on a computer cluster and enables the exact computation of various structural features of long RNA sequences under the constraint of maximal base-pairing distance. ParasoR divides dynamic programming (DP) matrices into smaller pieces, such that each piece can be computed by a separate computer node without losing the connectivity information between the pieces. ParasoR directly computes the ratios of DP variables to avoid the reduction of numerical precision caused by the cancellation of a large number of Boltzmann factors. The structural preferences of mRNAs computed by ParasoR shows a high concordance with those determined by high-throughput sequencing analyses. Using ParasoR, we investigated the global structural preferences of transcribed regions in the human genome. A genome-wide folding simulation indicated that transcribed regions are significantly more structural than intergenic regions after removing repeat sequences and k-mer frequency bias. In particular, we observed a highly significant preference for base pairing over entire intronic regions as compared to their antisense sequences, as well as to intergenic regions. A comparison between pre-mRNAs and mRNAs showed that coding regions become more accessible after splicing, indicating constraints for translational efficiency. Such changes are correlated with gene expression levels, as well as GC content, and are enriched among genes associated with cytoskeleton and kinase functions. We have shown that ParasoR is very useful for analyzing the structural properties of long RNA sequences such as mRNAs, pre-mRNAs, and long non-coding RNAs whose lengths can be more than a million bases in the human genome. In our analyses, transcribed regions including introns are indicated to be subject to various types of structural constraints that cannot be explained from simple sequence composition biases. ParasoR is freely available at https://github.com/carushi/ParasoR .

  15. Sensitive and Specific Target Sequences Selected from Retrotransposons of Schistosoma japonicum for the Diagnosis of Schistosomiasis

    PubMed Central

    Xu, Jing; Zhu, Xing-Quan; Wang, Sheng-Yue; Xia, Chao-Ming

    2012-01-01

    Background Schistosomiasis japonica is a serious debilitating and sometimes fatal disease. Accurate diagnostic tests play a key role in patient management and control of the disease. However, currently available diagnostic methods are not ideal, and the detection of the parasite DNA in blood samples has turned out to be one of the most promising tools for the diagnosis of schistosomiasis. In our previous investigations, a 230-bp sequence from the highly repetitive retrotransposon SjR2 was identified and it showed high sensitivity and specificity for detecting Schistosoma japonicum DNA in the sera of rabbit model and patients. Recently, 29 retrotransposons were found in S. japonicum genome by our group. The present study highlighted the key factors for selecting a new perspective sensitive target DNA sequence for the diagnosis of schistosomiasis, which can serve as example for other parasitic pathogens. Methodology/Principal Findings In this study, we demonstrated that the key factors based on the bioinformatic analysis for selecting target sequence are the higher genome proportion, repetitive complete copies and partial copies, and active ESTs than the others in the chromosome genome. New primers based on 25 novel retrotransposons and SjR2 were designed and their sensitivity and specificity for detecting S. japonicum DNA were compared. The results showed that a new 303-bp sequence from non-long terminal repeat (LTR) retrotransposon (SjCHGCS19) had high sensitivity and specificity. The 303-bp target sequence was amplified from the sera of rabbit model at 3 d post-infection by nested-PCR and it became negative at 17 weeks post-treatment. Furthermore, the percentage sensitivity of the nested-PCR was 97.67% in 43 serum samples of S. japonicum-infected patients. Conclusions/Significance Our findings highlighted the key factors based on the bioinformatic analysis for selecting target sequence from S. japonicum genome, which provide basis for establishing powerful molecular diagnostic techniques that can be used for monitoring early infection and therapy efficacy to support schistosomiasis control programs. PMID:22479661

  16. Stress Drop and Directivity Patterns Observed in Small-Magnitude (

    NASA Astrophysics Data System (ADS)

    Ruhl, C. J.; Hatch, R. L.; Abercrombie, R. E.; Smith, K.

    2017-12-01

    Recent improvements in seismic instrumentation and network coverage in the Reno, NV area have provided high-quality records of abundant microseismicity, including several swarms and clusters. Here, we discuss stress drop and directivity patterns of small-magnitude seismicity in the 2008 Mw4.9 Mogul earthquake swarm in Reno, NV and in the nearby region of an ML3.2 sequence near Virginia City, NV. In both sequences, double-difference relocated earthquakes cluster on multiple distinct structures consistent with focal mechanism and moment tensor fault plane solutions. Both sequences also show migration potentially related to fluid flow. We estimate corner frequency and stress drop using EGF-derived spectral ratios, convolving earthquake pairs (target*EGF) such that we preserve phase and recover source-time functions (STF) on a station-by-station basis. We then stack individual STFs per station for all EGF-target pairs per target earthquake, increasing the signal-to-noise of our results. By applying an azimuthal- and incidence-angle-dependent stretching factor to STFs in the time domain, we are able to invert for rupture directivity and velocity assuming both unilateral and bilateral rupture. Earthquakes in both sequences, some as low as ML2.1, show strong unilateral directivity consistent with independent fault plane solutions. We investigate and compare the relationship between rupture and migration directions on subfaults within each sequence. Average stress drops for both sequences are 4 MPa, but there is large variation in individual estimates for both sequences. Although this variation is not explained simply by any one parameter (e.g., depth), spatiotemporal variation in the Mogul swarm is distinct: coherent clusters of high and low stress drop earthquakes along the mainshock fault plane are seen, and high-stress-drop foreshocks correlate with an area of reduced aftershock productivity. These observations are best explained by a difference in rheology along the fault plane. The unprecedented detail achieved for these small magnitude earthquakes confirms that stress drop, when measured precisely, is a valuable observation of physically-meaningful fault zone properties and earthquake behavior.

  17. Genetic analysis of Trichuris suis and Trichuris trichiura recovered from humans and pigs in a sympatric setting in Uganda.

    PubMed

    Nissen, Sofie; Al-Jubury, Azmi; Hansen, Tina V A; Olsen, Annette; Christensen, Henrik; Thamsborg, Stig M; Nejsum, Peter

    2012-08-13

    The whipworms Trichuris trichiura and Trichuris suis in humans and pigs, respectively, are believed to be two different species yet closely related. Morphologically, adult worms, eggs and larvae of the two species are indistinguishable. The aim of this study was to examine the genetic variation of Trichuris sp. mainly recovered from natural infected pigs and humans. Worm material isolated from humans and pigs living in the same geographical region in Uganda were analyzed by PCR, cloning and sequencing. Measurements of morphometric characters were also performed. The analysis of the ITS-2 (internal transcribed spacer) region showed a high genetic variation in the human-derived worms with two sequence types, designated type 1 and type 2, differing with up to 45%, the type 2 being identical to the sequence found in pig-derived worms. A single human-derived worm showed exclusively the type 2-genotype (T. suis-type) and three cases of 'heterozygote' worms in humans were identified. However, the analysis showed that sympatric Trichuris primarily assorted with host origin. Sequence analysis of a part of the genetically conserved β-tubulin gene confirmed two separate populations/species but also showed that the 'heterozygote' worms had a T. suis-like β-tubulin gene. A PCR-RFLP on the ITS-2 region was developed, that could distinguish between worms of the pig, human and 'heterozygote' type. The data suggest that Trichuris in pigs and humans belong to two different populations (i.e. are two different species). However, the data presented also suggest that cross-infections of humans with T. suis takes place. Further studies on sympatric Trichuris populations are highly warranted in order to explore transmission dynamics and unravel the zoonotic potential of T. suis. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Beta-keratins of differentiating epidermis of snake comprise glycine-proline-serine-rich proteins with an avian-like gene organization.

    PubMed

    Dalla Valle, Luisa; Nardi, Alessia; Belvedere, Paola; Toni, Mattia; Alibardi, Lorenzo

    2007-07-01

    Beta-keratins of reptilian scales have been recently cloned and characterized in some lizards. Here we report for the first time the sequence of some beta-keratins from the snake Elaphe guttata. Five different cDNAs were obtained using 5'- and 3'-RACE analyses. Four sequences differ by only few nucleotides in the coding region, whereas the last cDNA shows, in this region, only 84% of identity. The gene corresponding to one of the cDNA sequences has a single intron present in the 5'-untranslated region. This genomic organization is similar to that of birds' beta-keratins. Cloning and Southern blotting analysis suggest that snake beta-keratins belong to a family of high-related genes as for geckos. PCR analysis suggests a head-to-tail orientation of genes in the same chromosome. In situ hybridization detected beta-keratin transcripts almost exclusively in differentiating oberhautchen and beta-cells of the snake epidermis in renewal phase. This is confirmed by Northern blotting that showed, in this phase, a high expression of two different transcripts whereas only the longer transcript is expressed at a much lower level in resting skin. The cDNA coding sequences encoded putative glycine-proline-serine rich proteins containing 137-139 amino acids, with apparent isoelectric point at 7.5 and 8.2. A central region, rich in proline, shows over 50% homology with avian scale, claw, and feather keratins. The prediction of secondary structure shows mainly a random coil conformation and few beta-strand regions in the central region, likely involved in the formation of a fibrous framework of beta-keratins. This region was possibly present in basic reptiles that originated reptiles and birds. Copyright 2007 Wiley-Liss, Inc.

  19. Isolation, genome sequencing and functional analysis of two T7-like coliphages of avian pathogenic Escherichia coli.

    PubMed

    Chen, Mianmian; Xu, Juntian; Yao, Huochun; Lu, Chengping; Zhang, Wei

    2016-05-10

    Avian pathogenic Escherichia coli (APEC) causes colibacillosis, which results in significant economic losses to the poultry industry worldwide. Due to the drug residues and increased antibiotic resistance caused by antibiotic use, bacteriophages and other alternative therapeutic agents are expected to control APEC infection in poultry. Two APEC phages, named P483 and P694, were isolated from the feces from the farmers market in China. We then studied their biological properties, and carried out high-throughput genome sequencing and homology analyses of these phages. Assembly results of high-throughput sequencing showed that the structures of both P483 and P694 genomes consist of linear and double-stranded DNA. Results of the electron microscopy and homology analysis revealed that both P483 and P694 belong to T7-like virus which is a member of the Podoviridae family of the Caudovirales order. Comparative genomic analysis showed that most of the predicted proteins of these two phages showed strongest sequence similarity to the Enterobacteria phages BA14 and 285P, Erwinia phage FE44, and Kluyvera phage Kvp1; however, some proteins such as gp0.6a, gp1.7 and gp17 showed lower similarity (<85%) with the homologs of other phages in the T7 subgroup. We also found some unique characteristics of P483 and P694, such as the two types of the genes of P694 and no lytic activity of P694 against its host bacteria in liquid medium. Our results serve to further our understanding of phage evolution of T7-like coliphages and provide the potential application of the phages as therapeutic agents for the treatment of diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Phylogenetic Placement of Exact Amplicon Sequences Improves Associations with Clinical Information

    PubMed Central

    McDonald, Daniel; Gonzalez, Antonio; Navas-Molina, Jose A.; Jiang, Lingjing; Xu, Zhenjiang Zech; Winker, Kevin; Kado, Deborah M.; Orwoll, Eric; Manary, Mark; Mirarab, Siavash

    2018-01-01

    ABSTRACT Recent algorithmic advances in amplicon-based microbiome studies enable the inference of exact amplicon sequence fragments. These new methods enable the investigation of sub-operational taxonomic units (sOTU) by removing erroneous sequences. However, short (e.g., 150-nucleotide [nt]) DNA sequence fragments do not contain sufficient phylogenetic signal to reproduce a reasonable tree, introducing a barrier in the utilization of critical phylogenetically aware metrics such as Faith’s PD or UniFrac. Although fragment insertion methods do exist, those methods have not been tested for sOTUs from high-throughput amplicon studies in insertions against a broad reference phylogeny. We benchmarked the SATé-enabled phylogenetic placement (SEPP) technique explicitly against 16S V4 sequence fragments and showed that it outperforms the conceptually problematic but often-used practice of reconstructing de novo phylogenies. In addition, we provide a BSD-licensed QIIME2 plugin (https://github.com/biocore/q2-fragment-insertion) for SEPP and integration into the microbial study management platform QIITA. IMPORTANCE The move from OTU-based to sOTU-based analysis, while providing additional resolution, also introduces computational challenges. We demonstrate that one popular method of dealing with sOTUs (building a de novo tree from the short sequences) can provide incorrect results in human gut metagenomic studies and show that phylogenetic placement of the new sequences with SEPP resolves this problem while also yielding other benefits over existing methods. PMID:29719869

  1. Within-genome evolution of REPINs: a new family of miniature mobile DNA in bacteria.

    PubMed

    Bertels, Frederic; Rainey, Paul B

    2011-06-01

    Repetitive sequences are a conserved feature of many bacterial genomes. While first reported almost thirty years ago, and frequently exploited for genotyping purposes, little is known about their origin, maintenance, or processes affecting the dynamics of within-genome evolution. Here, beginning with analysis of the diversity and abundance of short oligonucleotide sequences in the genome of Pseudomonas fluorescens SBW25, we show that over-represented short sequences define three distinct groups (GI, GII, and GIII) of repetitive extragenic palindromic (REP) sequences. Patterns of REP distribution suggest that closely linked REP sequences form a functional replicative unit: REP doublets are over-represented, randomly distributed in extragenic space, and more highly conserved than singlets. In addition, doublets are organized as inverted repeats, which together with intervening spacer sequences are predicted to form hairpin structures in ssDNA or mRNA. We refer to these newly defined entities as REPINs (REP doublets forming hairpins) and identify short reads from population sequencing that reveal putative transposition intermediates. The proximal relationship between GI, GII, and GIII REPINs and specific REP-associated tyrosine transposases (RAYTs), combined with features of the putative transposition intermediate, suggests a mechanism for within-genome dissemination. Analysis of the distribution of REPs in a range of RAYT-containing bacterial genomes, including Escherichia coli K-12 and Nostoc punctiforme, show that REPINs are a widely distributed, but hitherto unrecognized, family of miniature non-autonomous mobile DNA.

  2. Score distributions of gapped multiple sequence alignments down to the low-probability tail

    NASA Astrophysics Data System (ADS)

    Fieth, Pascal; Hartmann, Alexander K.

    2016-08-01

    Assessing the significance of alignment scores of optimally aligned DNA or amino acid sequences can be achieved via the knowledge of the score distribution of random sequences. But this requires obtaining the distribution in the biologically relevant high-scoring region, where the probabilities are exponentially small. For gapless local alignments of infinitely long sequences this distribution is known analytically to follow a Gumbel distribution. Distributions for gapped local alignments and global alignments of finite lengths can only be obtained numerically. To obtain result for the small-probability region, specific statistical mechanics-based rare-event algorithms can be applied. In previous studies, this was achieved for pairwise alignments. They showed that, contrary to results from previous simple sampling studies, strong deviations from the Gumbel distribution occur in case of finite sequence lengths. Here we extend the studies to multiple sequence alignments with gaps, which are much more relevant for practical applications in molecular biology. We study the distributions of scores over a large range of the support, reaching probabilities as small as 10-160, for global and local (sum-of-pair scores) multiple alignments. We find that even after suitable rescaling, eliminating the sequence-length dependence, the distributions for multiple alignment differ from the pairwise alignment case. Furthermore, we also show that the previously discussed Gaussian correction to the Gumbel distribution needs to be refined, also for the case of pairwise alignments.

  3. Constructing DNA Barcode Sets Based on Particle Swarm Optimization.

    PubMed

    Wang, Bin; Zheng, Xuedong; Zhou, Shihua; Zhou, Changjun; Wei, Xiaopeng; Zhang, Qiang; Wei, Ziqi

    2018-01-01

    Following the completion of the human genome project, a large amount of high-throughput bio-data was generated. To analyze these data, massively parallel sequencing, namely next-generation sequencing, was rapidly developed. DNA barcodes are used to identify the ownership between sequences and samples when they are attached at the beginning or end of sequencing reads. Constructing DNA barcode sets provides the candidate DNA barcodes for this application. To increase the accuracy of DNA barcode sets, a particle swarm optimization (PSO) algorithm has been modified and used to construct the DNA barcode sets in this paper. Compared with the extant results, some lower bounds of DNA barcode sets are improved. The results show that the proposed algorithm is effective in constructing DNA barcode sets.

  4. Study of infectious diseases in archaeological bone material - A dataset.

    PubMed

    Pucu, Elisa; Cascardo, Paula; Chame, Marcia; Felice, Gisele; Guidon, Niéde; Cleonice Vergne, Maria; Campos, Guadalupe; Roberto Machado-Silva, José; Leles, Daniela

    2017-08-01

    Bones of human and ground sloth remains were analyzed for presence of Trypanosoma cruzi by conventional PCR using primers TC, TC1 and TC2. Sequence results amplified a fragment with the same product size as the primers (300 and 350pb). Amplified PCR product was sequenced and analyzed on GenBank, using Blast. Although these sequences did not match with these parasites they showed high amplification with species of bacteria. This article presents the methodology used and the alignment of the sequences. The display of this dataset will allow further analysis of our results and discussion presented in the manuscript "Finding the unexpected: a critical view on molecular diagnosis of infectious diseases in archaeological samples" (Pucu et al. 2017) [1].

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wemmer, D.E.; Kumar, N.V.; Metrione, R.M.

    Toxin II from Radianthus paumotensis (Rp/sub II/) has been investigated by high-resolution NMR and chemical sequencing methods. Resonance assignments have been obtained for this protein by the sequential approach. NMR assignments could not be made consistent with the previously reported primary sequence for this protein, and chemical methods have been used to determine a sequence with which the NMR data are consistent. Analysis of the 2D NOE spectra shows that the protein secondary structure is comprised of two sequences of ..beta..-sheet, probably joined into a distorted continuous sheet, connected by turns and extended loops, without any regular ..cap alpha..-helical segments.more » The residues previously implicated in activity in this class of proteins, D8 and R13, occur in a loop region.« less

  6. Sequences with high propensity to form G-quartet structures in kinetoplast DNA from Phytomonas serpens.

    PubMed

    Sá-Carvalho, D; Traub-Cseko, Y M

    1995-06-01

    Naturally occurring sequences containing repetitive guanine motifs have the potential to form tetraplex DNA. Phytomonas serpens minicircle DNA shows some regions where one strand is composed mainly of G and T (GT regions). These regions contain several stretches of contiguous guanines. An oligonucleotide was constructed with the sequence corresponding to one of these regions (Phyto-GT). It was demonstrated by native gel electrophoresis and methylation protection that Phyto-GT forms tetramolecular (G4), bimolecular (G'2) and unimolecular (G4') structures stabilized through G-quartets. Tetraplex DNA formation by this sequence could have biological relevance as it can be formed in physiological conditions and GT regions comprise approximately one-third of P. serpens and Crithidia oncopelti minicircles.

  7. Effect of amino acid substitution on biological activity of cyanophlyctin-β and brevinin-2R

    NASA Astrophysics Data System (ADS)

    Ghorani-Azam, Adel; Balali-Mood, Mahdi; Aryan, Ehsan; Karimi, Gholamreza; Riahi-Zanjani, Bamdad

    2018-04-01

    Antimicrobial peptides (AMPs), as ancient immune components, are found in almost all types of living organisms. They are bioactive components with strong antibacterial, antiviral, and anti-tumor properties. In this study, we designed three sequences of antimicrobial peptides to study the effects of structural changes in biological activity compared with original peptides, cyanophlyctin β, and brevinin-2R. For antibacterial activity, two Gram-positive (Staphylococcus aureus and S. epidermidis) and two Gram-negative bacteria (Escherichia coli and Pseudomonas aeroginosa) were assayed. Unlike cyanophlyctin β and brevinin-2R, the synthesized peptide (brevinin-M1, brevinin-M2 and brevinin-M3) showed no considerable antibacterial properties. Hemolytic activity of these peptides was also ignorable even at very high concentrations of 2 mg/ml. However, after proteolytic digestion by trypsin, the peptides showed antibacterial activity comparable to their original template sequences. Structural prediction suggested that the motif sequence responsible for antibacterial activity may be re-exposed to bacterial cell membrane after proteolytic digestion. Also, findings showed that only a small change in primary sequence and therefore structure of peptides may result in a significant alteration in biological activity.

  8. PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

    PubMed Central

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the discovery of complex patterns in gene expression of soil fungal communities. PMID:25545363

  9. Sedimentology and High Resolution Sequence Stratigraphy of the Middle Jurassic Dhruma Formation Carbonates Outcrops in the Central Saudi Arabia

    NASA Astrophysics Data System (ADS)

    Yousif, Ibrahim; Abdullatif, Osman; Makkawi, Mohammed; Abdulghani, Waleed

    2017-04-01

    This study investigates the microfacies and sequence stratigraphic frame work of the Middle Jurassic Dhruma Formation in outcrops in central Saudi Arabia. The study contributes to the efforts to understand and enhance local and regional stratigraphic relationship and correlation of the Jurassic carbonate sequences and their significance to reservoir description and prediction in the subsurcae. The study describes and characterizes the sedimentology, microfacies and the stratigraphy of Dhruma Formation from outcrop sections having a total thickness of 70 m. Detailed microfacies and high-resolution stratigraphical analysis were carried out to determine microfacies, cyclicity, sequences and staking pattern. The study revealed ten lithofacies namely: oolitic grainstone,bioclastic oolitic grainstone, oolitic grapestone, bioclastic grainstone,foraminiferal packstone, echinoderm packstone, peloidal packstone to grainstone,skeletal wackestone to packstone, mudstone, and marlstone.These lithofacies were grouped into five lithofacies associations that deposited on a carbonate ramp setting. The depositional environment ranging from low energy lagoonal setting to high-energy shoals and banks to low energy outer ramp setting. Five high-resolution composite sequences have been defined and each sequence is composed at the bottom of intercalated mudstone/wackestone that passing up into grainstone lithofacies.The composite sequences range in thickness from 7 to 15 m, while the parasequences range from 0.5 to 1.5 m. The composite sequences extend laterally for a distance of more than 350 m. The overall composite section shows a shallowing upward succession of the 4th to the 5th order high-resolution sequences.The dominant lithofacies are the grainy ones, which constitute 30%, 50% and 80% of the studied sections. Furthermore, the parasequences thickness and their bio-components are increasing towards the top. The muddy lithofacies intensively affected the vertical continuity of the lower reservoir interval compared to the upper interval. Detailed examination of thin-sections reflects a clear and well-developed reservoir interval in the uppermost part of the section, which is dominated by peloidal packstone and grainstone.The findings of this high-resolution outcrop analog might help to understand and predict lithofacies, stratigraphic heirachies and correlations of Dhruma Formation within the interwell spacing. Moreover, this study might also contribute to better reservoir description and assessment of its quality and architecture in subsurface equivalent reservoirs.

  10. Bicycle: a bioinformatics pipeline to analyze bisulfite sequencing data.

    PubMed

    Graña, Osvaldo; López-Fernández, Hugo; Fdez-Riverola, Florentino; González Pisano, David; Glez-Peña, Daniel

    2018-04-15

    High-throughput sequencing of bisulfite-converted DNA is a technique used to measure DNA methylation levels. Although a considerable number of computational pipelines have been developed to analyze such data, none of them tackles all the peculiarities of the analysis together, revealing limitations that can force the user to manually perform additional steps needed for a complete processing of the data. This article presents bicycle, an integrated, flexible analysis pipeline for bisulfite sequencing data. Bicycle analyzes whole genome bisulfite sequencing data, targeted bisulfite sequencing data and hydroxymethylation data. To show how bicycle overtakes other available pipelines, we compared them on a defined number of features that are summarized in a table. We also tested bicycle with both simulated and real datasets, to show its level of performance, and compared it to different state-of-the-art methylation analysis pipelines. Bicycle is publicly available under GNU LGPL v3.0 license at http://www.sing-group.org/bicycle. Users can also download a customized Ubuntu LiveCD including bicycle and other bisulfite sequencing data pipelines compared here. In addition, a docker image with bicycle and its dependencies, which allows a straightforward use of bicycle in any platform (e.g. Linux, OS X or Windows), is also available. ograna@cnio.es or dgpena@uvigo.es. Supplementary data are available at Bioinformatics online.

  11. AntiClustal: Multiple Sequence Alignment by antipole clustering and linear approximate 1-median computation.

    PubMed

    Di Pietro, C; Di Pietro, V; Emmanuele, G; Ferro, A; Maugeri, T; Modica, E; Pigola, G; Pulvirenti, A; Purrello, M; Ragusa, M; Scalia, M; Shasha, D; Travali, S; Zimmitti, V

    2003-01-01

    In this paper we present a new Multiple Sequence Alignment (MSA) algorithm called AntiClusAl. The method makes use of the commonly use idea of aligning homologous sequences belonging to classes generated by some clustering algorithm, and then continue the alignment process ina bottom-up way along a suitable tree structure. The final result is then read at the root of the tree. Multiple sequence alignment in each cluster makes use of the progressive alignment with the 1-median (center) of the cluster. The 1-median of set S of sequences is the element of S which minimizes the average distance from any other sequence in S. Its exact computation requires quadratic time. The basic idea of our proposed algorithm is to make use of a simple and natural algorithmic technique based on randomized tournaments which has been successfully applied to large size search problems in general metric spaces. In particular a clustering algorithm called Antipole tree and an approximate linear 1-median computation are used. Our algorithm compared with Clustal W, a widely used tool to MSA, shows a better running time results with fully comparable alignment quality. A successful biological application showing high aminoacid conservation during evolution of Xenopus laevis SOD2 is also cited.

  12. De novo Assembly of a 40 Mb Eukaryotic Genome from Short Sequence Reads: Sordaria macrospora, a Model Organism for Fungal Morphogenesis

    PubMed Central

    Nowrousian, Minou; Stajich, Jason E.; Chu, Meiling; Engh, Ines; Espagne, Eric; Halliday, Karen; Kamerewerd, Jens; Kempken, Frank; Knab, Birgit; Kuo, Hsiao-Che; Osiewacz, Heinz D.; Pöggeler, Stefanie; Read, Nick D.; Seiler, Stephan; Smith, Kristina M.; Zickler, Denise; Kück, Ulrich; Freitag, Michael

    2010-01-01

    Filamentous fungi are of great importance in ecology, agriculture, medicine, and biotechnology. Thus, it is not surprising that genomes for more than 100 filamentous fungi have been sequenced, most of them by Sanger sequencing. While next-generation sequencing techniques have revolutionized genome resequencing, e.g. for strain comparisons, genetic mapping, or transcriptome and ChIP analyses, de novo assembly of eukaryotic genomes still presents significant hurdles, because of their large size and stretches of repetitive sequences. Filamentous fungi contain few repetitive regions in their 30–90 Mb genomes and thus are suitable candidates to test de novo genome assembly from short sequence reads. Here, we present a high-quality draft sequence of the Sordaria macrospora genome that was obtained by a combination of Illumina/Solexa and Roche/454 sequencing. Paired-end Solexa sequencing of genomic DNA to 85-fold coverage and an additional 10-fold coverage by single-end 454 sequencing resulted in ∼4 Gb of DNA sequence. Reads were assembled to a 40 Mb draft version (N50 of 117 kb) with the Velvet assembler. Comparative analysis with Neurospora genomes increased the N50 to 498 kb. The S. macrospora genome contains even fewer repeat regions than its closest sequenced relative, Neurospora crassa. Comparison with genomes of other fungi showed that S. macrospora, a model organism for morphogenesis and meiosis, harbors duplications of several genes involved in self/nonself-recognition. Furthermore, S. macrospora contains more polyketide biosynthesis genes than N. crassa. Phylogenetic analyses suggest that some of these genes may have been acquired by horizontal gene transfer from a distantly related ascomycete group. Our study shows that, for typical filamentous fungi, de novo assembly of genomes from short sequence reads alone is feasible, that a mixture of Solexa and 454 sequencing substantially improves the assembly, and that the resulting data can be used for comparative studies to address basic questions of fungal biology. PMID:20386741

  13. De novo assembly of a 40 Mb eukaryotic genome from short sequence reads: Sordaria macrospora, a model organism for fungal morphogenesis.

    PubMed

    Nowrousian, Minou; Stajich, Jason E; Chu, Meiling; Engh, Ines; Espagne, Eric; Halliday, Karen; Kamerewerd, Jens; Kempken, Frank; Knab, Birgit; Kuo, Hsiao-Che; Osiewacz, Heinz D; Pöggeler, Stefanie; Read, Nick D; Seiler, Stephan; Smith, Kristina M; Zickler, Denise; Kück, Ulrich; Freitag, Michael

    2010-04-08

    Filamentous fungi are of great importance in ecology, agriculture, medicine, and biotechnology. Thus, it is not surprising that genomes for more than 100 filamentous fungi have been sequenced, most of them by Sanger sequencing. While next-generation sequencing techniques have revolutionized genome resequencing, e.g. for strain comparisons, genetic mapping, or transcriptome and ChIP analyses, de novo assembly of eukaryotic genomes still presents significant hurdles, because of their large size and stretches of repetitive sequences. Filamentous fungi contain few repetitive regions in their 30-90 Mb genomes and thus are suitable candidates to test de novo genome assembly from short sequence reads. Here, we present a high-quality draft sequence of the Sordaria macrospora genome that was obtained by a combination of Illumina/Solexa and Roche/454 sequencing. Paired-end Solexa sequencing of genomic DNA to 85-fold coverage and an additional 10-fold coverage by single-end 454 sequencing resulted in approximately 4 Gb of DNA sequence. Reads were assembled to a 40 Mb draft version (N50 of 117 kb) with the Velvet assembler. Comparative analysis with Neurospora genomes increased the N50 to 498 kb. The S. macrospora genome contains even fewer repeat regions than its closest sequenced relative, Neurospora crassa. Comparison with genomes of other fungi showed that S. macrospora, a model organism for morphogenesis and meiosis, harbors duplications of several genes involved in self/nonself-recognition. Furthermore, S. macrospora contains more polyketide biosynthesis genes than N. crassa. Phylogenetic analyses suggest that some of these genes may have been acquired by horizontal gene transfer from a distantly related ascomycete group. Our study shows that, for typical filamentous fungi, de novo assembly of genomes from short sequence reads alone is feasible, that a mixture of Solexa and 454 sequencing substantially improves the assembly, and that the resulting data can be used for comparative studies to address basic questions of fungal biology.

  14. Retirement Sequences of Older Americans: Moderately Destandardized and Highly Stratified Across Gender, Class, and Race.

    PubMed

    Calvo, Esteban; Madero-Cabib, Ignacio; Staudinger, Ursula M

    2017-06-06

    A destandardization of labor-force patterns revolving around retirement has been observed in recent literature. It is unclear, however, to which degree and of which kind. This study looked at sequences rather than individual statuses or transitions and argued that differentiating older Americans' retirement sequences by type, order, and timing and considering gender, class, and race differences yields a less destandardized picture. Sequence analysis was employed to analyze panel data from the Health and Retirement Study (HRS) for 7,881 individuals observed 6 consecutive times between ages 60-61 and 70-71. As expected, types of retirement sequences were identified that cannot be subsumed under the conventional model of complete retirement from full-time employment around age 65. However, these retirement sequences were not entirely destandardized, as some irreversibility and age-grading persisted. Further, the degree of destandardization varied along gender, class, and race. Unconventional sequences were archetypal for middle-level educated individuals and Blacks. Also, sequences for women and individuals with lower education showed more unemployment and part-time jobs, and less age-grading. A sequence-analytic approach that models group differences uncovers misjudgments about the degree of destandardization of retirement sequences. When a continuous process is represented as individual transitions, the overall pattern of retirement sequences gets lost and appears destandardized. These patterns get further complicated by differences in social structures by gender, class, and race in ways that seem to reproduce advantages that men, more highly educated individuals, and Whites enjoy in numerous areas over the life course. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Comparative Genome Sequence Analysis of the Bpa/Str Region in Mouse and Man

    PubMed Central

    Mallon, A.-M.; Platzer, M.; Bate, R.; Gloeckner, G.; Botcherby, M.R.M.; Nordsiek, G.; Strivens, M.A.; Kioschis, P.; Dangel, A.; Cunningham, D.; Straw, R.N.A.; Weston, P.; Gilbert, M.; Fernando, S.; Goodall, K.; Hunter, G.; Greystrong, J.S.; Clarke, D.; Kimberley, C.; Goerdes, M.; Blechschmidt, K.; Rump, A.; Hinzmann, B.; Mundy, C.R.; Miller, W.; Poustka, A.; Herman, G.E.; Rhodes, M.; Denny, P.; Rosenthal, A.; Brown, S.D.M.

    2000-01-01

    The progress of human and mouse genome sequencing programs presages the possibility of systematic cross-species comparison of the two genomes as a powerful tool for gene and regulatory element identification. As the opportunities to perform comparative sequence analysis emerge, it is important to develop parameters for such analyses and to examine the outcomes of cross-species comparison. Our analysis used gene prediction and a database search of 430 kb of genomic sequence covering the Bpa/Str region of the mouse X chromosome, and 745 kb of genomic sequence from the homologous human X chromosome region. We identified 11 genes in mouse and 13 genes and two pseudogenes in human. In addition, we compared the mouse and human sequences using pairwise alignment and searches for evolutionary conserved regions (ECRs) exceeding a defined threshold of sequence identity. This approach aided the identification of at least four further putative conserved genes in the region. Comparative sequencing revealed that this region is a mosaic in evolutionary terms, with considerably more rearrangement between the two species than realized previously from comparative mapping studies. Surprisingly, this region showed an extremely high LINE and low SINE content, low G+C content, and yet a relatively high gene density, in contrast to the low gene density usually associated with such regions. [The sequence data described in this paper have been submitted to EMBL under the following accession nos.: Mouse Genomic Sequence: Mouse contig A (AL021127), Mouse contig B (AL049866), BAC41M10 (AL136328), PAC303O11(AL136329). Human Genomic Sequence: Human contig 1 (U82671, U82670), Human contig 2 (U82695).] PMID:10854409

  16. Purification and sequence characterization of chondroitin sulfate and dermatan sulfate from fishes.

    PubMed

    Lin, Na; Mo, Xiaoli; Yang, Yang; Zhang, Hong

    2017-04-01

    Chondroitin sulfate (CS) and dermatan sulfate (DS) were extracted and purified from skins or bones of salmon (Salmo salar), snakehead (Channa argus), monkfish (Lophius litulon) and skipjack tuna (Katsuwonus pelamis). Size, structural sequences and sulfate groups of oligosaccharides in the purified CS and DS could be characterized and identified using high performance liquid chromatography (HPLC) combined with Orbitrap mass spectrometry. CS and DS chain structure varies depending on origin, but motif structure appears consistent. Structures of CS and DS oligosaccharides with different size and sulfate groups were compared between fishes and other animals, and results showed that some minor differences of special structures could be identified by hydrophilic interaction chromatography-liquid chromatography-fourier transform-mass/mass spectrometry (HILIC-LC-FT-MS/MS). For example, data showed that salmon and skipjack CS had a higher percentage content of high-level sulfated oligosaccharides than that porcine CS. In addition, structural information of different origins of CS and DS was analyzed by principal component analysis (PCA) and results showed that CS and DS samples could be differentiated according to their molecular conformation and oligosaccharide fragments information. Understanding CS and DS structure derived from different origins may lead to the production of CS or DS with unique disaccharides or oligosaccharides sequence composition and biological functions.

  17. Environmental distribution, abundance and activity of the Miscellaneous Crenarchaeotal Group

    NASA Astrophysics Data System (ADS)

    Lloyd, K. G.; Biddle, J.; Teske, A.

    2011-12-01

    Many marine sedimentary microbes have only been identified by 16S rRNA sequences. Consequently, little is known about the types of metabolism, activity levels, or relative abundance of these groups in marine sediments. We found that one of these uncultured groups, called the Miscellaneous Crenarchaeotal Group (MCG), dominated clone libraries made from reverse transcribed 16S rRNA, and 454 pyrosequenced 16S rRNA genes, in the White Oak River estuary. Primers suitable for quantitative PCR were developed for MCG and used to show that 16S rRNA DNA copy numbers from MCG account for nearly all the archaeal 16S rRNA genes present. RT-qPCR shows much less MCG rRNA than total archaeal rRNA, but comparisons of different primers for each group suggest bias in the RNA-based work relative to the DNA-based work. There is no evidence of a population shift with depth below the sulfate-methane transition zone, suggesting that the metabolism of MCG may not be tied to sulfur or methane cycles. We classified 2,771 new sequences within the SSU Silva 106 database that, along with the classified sequences in the Silva database was used to make an MCG database of 4,646 sequences that allowed us to increase the named subgroups of MCG from 7 to 19. Percent terrestrial sequences in each subgroup is positively correlated with percent of the marine sequences that are nearshore, suggesting that membership in the different subgroups is not random, but dictated by environmental selective pressures. Given their high phylogenetic diversity, ubiquitous distribution in anoxic environments, and high DNA copy number relative to total archaea, members of MCG are most likely anaerobic heterotrophs who are integral to the post-depositional marine carbon cycle.

  18. Electron-Transfer Ion/Ion Reactions of Doubly Protonated Peptides: Effect of Elevated Bath Gas Temperature

    PubMed Central

    Pitteri, Sharon J.; Chrisman, Paul A.; McLuckey, Scott A.

    2005-01-01

    In this study, the electron-transfer dissociation (ETD) behavior of cations derived from 27 different peptides (22 of which are tryptic peptides) has been studied in a 3D quadrupole ion trap mass spectrometer. Ion/ion reactions between peptide cations and nitrobenzene anions have been examined at both room temperature and in an elevated temperature bath gas environment to form ETD product ions. From the peptides studied, the ETD sequence coverage tends to be inversely related to peptide size. At room temperature, very high sequence coverage (~100%) was observed for small peptides (≤7 amino acids). For medium-sized peptides composed of 8–11 amino acids, the average sequence coverage was 46%. Larger peptides with 14 or more amino acids yielded an average sequence coverage of 23%. Elevated-temperature ETD provided increased sequence coverage over room-temperature experiments for the peptides of greater than 7 residues, giving an average of 67% for medium-sized peptides and 63% for larger peptides. Percent ETD, a measure of the extent of electron transfer, has also been calculated for the peptides and also shows an inverse relation with peptide size. Bath gas temperature does not have a consistent effect on percent ETD, however. For the tryptic peptides, fragmentation is localized at the ends of the peptides suggesting that the distribution of charge within the peptide may play an important role in determining fragmentation sites. A triply protonated peptide has also been studied and shows behavior similar to the doubly charged peptides. These preliminary results suggest that for a given charge state there is a maximum size for which high sequence coverage is obtained and that increasing the bath gas temperature can increase this maximum. PMID:16131079

  19. The dark nemesis of galaxy formation: why hot haloes trigger black hole growth and bring star formation to an end

    NASA Astrophysics Data System (ADS)

    Bower, Richard G.; Schaye, Joop; Frenk, Carlos S.; Theuns, Tom; Schaller, Matthieu; Crain, Robert A.; McAlpine, Stuart

    2017-02-01

    Galaxies fall into two clearly distinct types: `blue-sequence' galaxies which are rapidly forming young stars, and `red-sequence' galaxies in which star formation has almost completely ceased. Most galaxies more massive than 3 × 1010 M⊙ follow the red sequence, while less massive central galaxies lie on the blue sequence. We show that these sequences are created by a competition between star formation-driven outflows and gas accretion on to the supermassive black hole at the galaxy's centre. We develop a simple analytic model for this interaction. In galaxies less massive than 3 × 1010 M⊙, young stars and supernovae drive a high-entropy outflow which is more buoyant than any tenuous corona. The outflow balances the rate of gas inflow, preventing high gas densities building up in the central regions. More massive galaxies, however, are surrounded by an increasingly hot corona. Above a halo mass of ˜1012 M⊙, the outflow ceases to be buoyant and star formation is unable to prevent the build-up of gas in the central regions. This triggers a strongly non-linear response from the black hole. Its accretion rate rises rapidly, heating the galaxy's corona, disrupting the incoming supply of cool gas and starving the galaxy of the fuel for star formation. The host galaxy makes a transition to the red sequence, and further growth predominantly occurs through galaxy mergers. We show that the analytic model provides a good description of galaxy evolution in the EAGLE hydrodynamic simulations. So long as star formation-driven outflows are present, the transition mass scale is almost independent of subgrid parameter choice.

  20. Genomic patterns of introgression in rainbow and westslope cutthroat trout illuminated by overlapping paired-end RAD sequencing

    USGS Publications Warehouse

    Hohenlohe, Paul A.; Day, Mitch D.; Amish, Stephen J.; Miller, Michael R.; Kamps-Hughes, Nick; Boyer, Matthew C.; Muhlfeld, Clint C.; Allendorf, Fred W.; Johnson, Eric A.; Luikart, Gordon

    2013-01-01

    Rapid and inexpensive methods for genomewide single nucleotide polymorphism (SNP) discovery and genotyping are urgently needed for population management and conservation. In hybridized populations, genomic techniques that can identify and genotype thousands of species-diagnostic markers would allow precise estimates of population- and individual-level admixture as well as identification of 'super invasive' alleles, which show elevated rates of introgression above the genomewide background (likely due to natural selection). Techniques like restriction-site-associated DNA (RAD) sequencing can discover and genotype large numbers of SNPs, but they have been limited by the length of continuous sequence data they produce with Illumina short-read sequencing. We present a novel approach, overlapping paired-end RAD sequencing, to generate RAD contigs of >300–400 bp. These contigs provide sufficient flanking sequence for design of high-throughput SNP genotyping arrays and strict filtering to identify duplicate paralogous loci. We applied this approach in five populations of native westslope cutthroat trout that previously showed varying (low) levels of admixture from introduced rainbow trout (RBT). We produced 77 141 RAD contigs and used these data to filter and genotype 3180 previously identified species-diagnostic SNP loci. Our population-level and individual-level estimates of admixture were generally consistent with previous microsatellite-based estimates from the same individuals. However, we observed slightly lower admixture estimates from genomewide markers, which might result from natural selection against certain genome regions, different genomic locations for microsatellites vs. RAD-derived SNPs and/or sampling error from the small number of microsatellite loci (n = 7). We also identified candidate adaptive super invasive alleles from RBT that had excessively high admixture proportions in hybridized cutthroat trout populations.

  1. The Origins of 168, W23, and Other Bacillus subtilis Legacy Strains▿ †

    PubMed Central

    Zeigler, Daniel R.; Prágai, Zoltán; Rodriguez, Sabrina; Chevreux, Bastien; Muffler, Andrea; Albert, Thomas; Bai, Renyuan; Wyss, Markus; Perkins, John B.

    2008-01-01

    Bacillus subtilis is both a model organism for basic research and an industrial workhorse, yet there are major gaps in our understanding of the genomic heritage and provenance of many widely used strains. We analyzed 17 legacy strains dating to the early years of B. subtilis genetics. For three—NCIB 3610T, PY79, and SMY—we performed comparative genome sequencing. For the remainder, we used conventional sequencing to sample genomic regions expected to show sequence heterogeneity. Sequence comparisons showed that 168, its siblings (122, 160, and 166), and the type strains NCIB 3610 and ATCC 6051 are highly similar and are likely descendants of the original Marburg strain, although the 168 lineage shows genetic evidence of early domestication. Strains 23, W23, and W23SR are identical in sequence to each other but only 94.6% identical to the Marburg group in the sequenced regions. Strain 23, the probable W23 parent, likely arose from a contaminant in the mutagenesis experiments that produced 168. The remaining strains are all genomic hybrids, showing one or more “W23 islands” in a 168 genomic backbone. Each traces its origin to transformations of 168 derivatives with DNA from 23 or W23. The common prototrophic lab strain PY79 possesses substantial W23 islands at its trp and sac loci, along with large deletions that have reduced its genome 4.3%. SMY, reputed to be the parent of 168, is actually a 168-W23 hybrid that likely shares a recent ancestor with PY79. These data provide greater insight into the genomic history of these B. subtilis legacy strains. PMID:18723616

  2. Evaluation and integration of functional annotation pipelines for newly sequenced organisms: the potato genome as a test case.

    PubMed

    Amar, David; Frades, Itziar; Danek, Agnieszka; Goldberg, Tatyana; Sharma, Sanjeev K; Hedley, Pete E; Proux-Wera, Estelle; Andreasson, Erik; Shamir, Ron; Tzfadia, Oren; Alexandersson, Erik

    2014-12-05

    For most organisms, even if their genome sequence is available, little functional information about individual genes or proteins exists. Several annotation pipelines have been developed for functional analysis based on sequence, 'omics', and literature data. However, researchers encounter little guidance on how well they perform. Here, we used the recently sequenced potato genome as a case study. The potato genome was selected since its genome is newly sequenced and it is a non-model plant even if there is relatively ample information on individual potato genes, and multiple gene expression profiles are available. We show that the automatic gene annotations of potato have low accuracy when compared to a "gold standard" based on experimentally validated potato genes. Furthermore, we evaluate six state-of-the-art annotation pipelines and show that their predictions are markedly dissimilar (Jaccard similarity coefficient of 0.27 between pipelines on average). To overcome this discrepancy, we introduce a simple GO structure-based algorithm that reconciles the predictions of the different pipelines. We show that the integrated annotation covers more genes, increases by over 50% the number of highly co-expressed GO processes, and obtains much higher agreement with the gold standard. We find that different annotation pipelines produce different results, and show how to integrate them into a unified annotation that is of higher quality than each single pipeline. We offer an improved functional annotation of both PGSC and ITAG potato gene models, as well as tools that can be applied to additional pipelines and improve annotation in other organisms. This will greatly aid future functional analysis of '-omics' datasets from potato and other organisms with newly sequenced genomes. The new potato annotations are available with this paper.

  3. Type III Bartter-like syndrome in an infant boy with Gitelman syndrome and autosomal dominant familial neurohypophyseal diabetes insipidus.

    PubMed

    Brugnara, Milena; Gaudino, Rossella; Tedeschi, Silvana; Syrèn, Marie-Louise; Perrotta, Silverio; Maines, Evelina; Zaffanello, Marco

    2014-09-01

    We report the case of an infant boy with polyuria and a familial history of central diabetes insipidus. Laboratory blood tests disclosed hypokalemia, metabolic alkalosis, hyperreninemia, and hyperaldosteronism. Plasma magnesium concentration was slightly low. Urine analysis showed hypercalciuria, hyposthenuria, and high excretion of potassium. Such findings oriented toward type III Bartter syndrome (BSIII). Direct sequencing of the CLCNKB gene revealed no disease-causing mutations. The water deprivation test was positive. Magnetic resonance imaging showed a lack of posterior pituitary hyperintensity. Finally, direct sequencing of the AVP-NPII gene showed a point mutation (c.1884G>A) in a heterozygous state, confirming an autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI). This condition did not explain the patient's phenotype; thus, we investigated for Gitelman syndrome (GS). A direct sequencing of the SLC12A3 gene showed c.269A>C and c.1205C>A new mutations. In conclusion, the patient had a genetic combination of GS and adFNDI with a BSIII-like phenotype.

  4. Dyadic Power Profiles: Power-Contingent Strategies for Value Creation in Negotiation

    ERIC Educational Resources Information Center

    Olekalns, Mara; Smith, Philip Leigh

    2013-01-01

    Using a simulated employment negotiation, we tested the conditional relationships among dyadic power profiles (symmetric high, symmetric low, and asymmetric), the choice and sequencing of strategies, and value creation. We showed that negotiators in symmetric high, symmetric low, and asymmetric power dyads took distinctly different paths to value…

  5. An improved genome assembly uncovers prolific tandem repeats in Atlantic cod.

    PubMed

    Tørresen, Ole K; Star, Bastiaan; Jentoft, Sissel; Reinar, William B; Grove, Harald; Miller, Jason R; Walenz, Brian P; Knight, James; Ekholm, Jenny M; Peluso, Paul; Edvardsen, Rolf B; Tooming-Klunderud, Ave; Skage, Morten; Lien, Sigbjørn; Jakobsen, Kjetill S; Nederbragt, Alexander J

    2017-01-18

    The first Atlantic cod (Gadus morhua) genome assembly published in 2011 was one of the early genome assemblies exclusively based on high-throughput 454 pyrosequencing. Since then, rapid advances in sequencing technologies have led to a multitude of assemblies generated for complex genomes, although many of these are of a fragmented nature with a significant fraction of bases in gaps. The development of long-read sequencing and improved software now enable the generation of more contiguous genome assemblies. By combining data from Illumina, 454 and the longer PacBio sequencing technologies, as well as integrating the results of multiple assembly programs, we have created a substantially improved version of the Atlantic cod genome assembly. The sequence contiguity of this assembly is increased fifty-fold and the proportion of gap-bases has been reduced fifteen-fold. Compared to other vertebrates, the assembly contains an unusual high density of tandem repeats (TRs). Indeed, retrospective analyses reveal that gaps in the first genome assembly were largely associated with these TRs. We show that 21% of the TRs across the assembly, 19% in the promoter regions and 12% in the coding sequences are heterozygous in the sequenced individual. The inclusion of PacBio reads combined with the use of multiple assembly programs drastically improved the Atlantic cod genome assembly by successfully resolving long TRs. The high frequency of heterozygous TRs within or in the vicinity of genes in the genome indicate a considerable standing genomic variation in Atlantic cod populations, which is likely of evolutionary importance.

  6. Complete genome sequence of bacteriocin-producing Lactobacillus plantarum KLDS1.0391, a probiotic strain with gastrointestinal tract resistance and adhesion to the intestinal epithelial cells.

    PubMed

    Jia, Fang-Fang; Zhang, Lu-Ji; Pang, Xue-Hui; Gu, Xin-Xi; Abdelazez, Amro; Liang, Yu; Sun, Si-Rui; Meng, Xiang-Chen

    2017-10-01

    Lactobacillus plantarum KLDS1.0391 is a probiotic strain isolated from the traditional fermented dairy products and identified to produce bacteriocin against Gram-positive and Gram-negative bacteria. Previous studies showed that the strain has a high resistance to gastrointestinal stress and has a high adhesion ability to the intestinal epithelial cells (Caco-2). We reported the entire genome sequence of this strain, which contains a circular 2,886,607-bp chromosome and three circular plasmids. Genes, which are related to the biosynthesis of bacteriocins, the stress resistance to gastrointestinal tract environment and adhesive performance, were identified. Whole genome sequence of Lactobacillus plantarum KLDS1.0391 will be helpful for its applications in food industry. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Draft genome sequence of the rubber tree Hevea brasiliensis.

    PubMed

    Rahman, Ahmad Yamin Abdul; Usharraj, Abhilash O; Misra, Biswapriya B; Thottathil, Gincy P; Jayasekaran, Kandakumar; Feng, Yun; Hou, Shaobin; Ong, Su Yean; Ng, Fui Ling; Lee, Ling Sze; Tan, Hock Siew; Sakaff, Muhd Khairul Luqman Muhd; Teh, Beng Soon; Khoo, Bee Feong; Badai, Siti Suriawati; Aziz, Nurohaida Ab; Yuryev, Anton; Knudsen, Bjarne; Dionne-Laporte, Alexandre; Mchunu, Nokuthula P; Yu, Qingyi; Langston, Brennick J; Freitas, Tracey Allen K; Young, Aaron G; Chen, Rui; Wang, Lei; Najimudin, Nazalan; Saito, Jennifer A; Alam, Maqsudul

    2013-02-02

    Hevea brasiliensis, a member of the Euphorbiaceae family, is the major commercial source of natural rubber (NR). NR is a latex polymer with high elasticity, flexibility, and resilience that has played a critical role in the world economy since 1876. Here, we report the draft genome sequence of H. brasiliensis. The assembly spans ~1.1 Gb of the estimated 2.15 Gb haploid genome. Overall, ~78% of the genome was identified as repetitive DNA. Gene prediction shows 68,955 gene models, of which 12.7% are unique to Hevea. Most of the key genes associated with rubber biosynthesis, rubberwood formation, disease resistance, and allergenicity have been identified. The knowledge gained from this genome sequence will aid in the future development of high-yielding clones to keep up with the ever increasing need for natural rubber.

  8. Draft genome sequence of the rubber tree Hevea brasiliensis

    PubMed Central

    2013-01-01

    Background Hevea brasiliensis, a member of the Euphorbiaceae family, is the major commercial source of natural rubber (NR). NR is a latex polymer with high elasticity, flexibility, and resilience that has played a critical role in the world economy since 1876. Results Here, we report the draft genome sequence of H. brasiliensis. The assembly spans ~1.1 Gb of the estimated 2.15 Gb haploid genome. Overall, ~78% of the genome was identified as repetitive DNA. Gene prediction shows 68,955 gene models, of which 12.7% are unique to Hevea. Most of the key genes associated with rubber biosynthesis, rubberwood formation, disease resistance, and allergenicity have been identified. Conclusions The knowledge gained from this genome sequence will aid in the future development of high-yielding clones to keep up with the ever increasing need for natural rubber. PMID:23375136

  9. Identification of antigen-specific human monoclonal antibodies using high-throughput sequencing of the antibody repertoire.

    PubMed

    Liu, Ju; Li, Ruihua; Liu, Kun; Li, Liangliang; Zai, Xiaodong; Chi, Xiangyang; Fu, Ling; Xu, Junjie; Chen, Wei

    2016-04-22

    High-throughput sequencing of the antibody repertoire provides a large number of antibody variable region sequences that can be used to generate human monoclonal antibodies. However, current screening methods for identifying antigen-specific antibodies are inefficient. In the present study, we developed an antibody clone screening strategy based on clone dynamics and relative frequency, and used it to identify antigen-specific human monoclonal antibodies. Enzyme-linked immunosorbent assay showed that at least 52% of putative positive immunoglobulin heavy chains composed antigen-specific antibodies. Combining information on dynamics and relative frequency improved identification of positive clones and elimination of negative clones. and increase the credibility of putative positive clones. Therefore the screening strategy could simplify the subsequent experimental screening and may facilitate the generation of antigen-specific antibodies. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Development of phylogenetic markers for Sebacina (Sebacinaceae) mycorrhizal fungi associated with Australian orchids.

    PubMed

    Ruibal, Monica P; Peakall, Rod; Foret, Sylvain; Linde, Celeste C

    2014-06-01

    To investigate fungal species identity and diversity in mycorrhizal fungi of order Sebacinales, we developed phylogenetic markers. These new markers will enable future studies investigating species delineation and phylogenetic relationships of the fungal symbionts and facilitate investigations into evolutionary interactions among Sebacina species and their orchid hosts. • We generated partial genome sequences for a Sebacina symbiont originating from Caladenia huegelii with 454 genome sequencing and from three symbionts from Eriochilus dilatatus and one from E. pulchellus using Illumina sequencing. Six nuclear and two mitochondrial loci showed high variability (10-31% parsimony informative sites) for Sebacinales mycorrhizal fungi across four genera of Australian orchids (Caladenia, Eriochilus, Elythranthera, and Glossodia). • We obtained highly informative DNA markers that will allow investigation of mycorrhizal diversity of Sebacinaceae fungi associated with terrestrial orchids in Australia and worldwide.

  11. ChIP-chip versus ChIP-seq: Lessons for experimental design and data analysis

    PubMed Central

    2011-01-01

    Background Chromatin immunoprecipitation (ChIP) followed by microarray hybridization (ChIP-chip) or high-throughput sequencing (ChIP-seq) allows genome-wide discovery of protein-DNA interactions such as transcription factor bindings and histone modifications. Previous reports only compared a small number of profiles, and little has been done to compare histone modification profiles generated by the two technologies or to assess the impact of input DNA libraries in ChIP-seq analysis. Here, we performed a systematic analysis of a modENCODE dataset consisting of 31 pairs of ChIP-chip/ChIP-seq profiles of the coactivator CBP, RNA polymerase II (RNA PolII), and six histone modifications across four developmental stages of Drosophila melanogaster. Results Both technologies produce highly reproducible profiles within each platform, ChIP-seq generally produces profiles with a better signal-to-noise ratio, and allows detection of more peaks and narrower peaks. The set of peaks identified by the two technologies can be significantly different, but the extent to which they differ varies depending on the factor and the analysis algorithm. Importantly, we found that there is a significant variation among multiple sequencing profiles of input DNA libraries and that this variation most likely arises from both differences in experimental condition and sequencing depth. We further show that using an inappropriate input DNA profile can impact the average signal profiles around genomic features and peak calling results, highlighting the importance of having high quality input DNA data for normalization in ChIP-seq analysis. Conclusions Our findings highlight the biases present in each of the platforms, show the variability that can arise from both technology and analysis methods, and emphasize the importance of obtaining high quality and deeply sequenced input DNA libraries for ChIP-seq analysis. PMID:21356108

  12. A network approach to analyzing highly recombinant malaria parasite genes.

    PubMed

    Larremore, Daniel B; Clauset, Aaron; Buckee, Caroline O

    2013-01-01

    The var genes of the human malaria parasite Plasmodium falciparum present a challenge to population geneticists due to their extreme diversity, which is generated by high rates of recombination. These genes encode a primary antigen protein called PfEMP1, which is expressed on the surface of infected red blood cells and elicits protective immune responses. Var gene sequences are characterized by pronounced mosaicism, precluding the use of traditional phylogenetic tools that require bifurcating tree-like evolutionary relationships. We present a new method that identifies highly variable regions (HVRs), and then maps each HVR to a complex network in which each sequence is a node and two nodes are linked if they share an exact match of significant length. Here, networks of var genes that recombine freely are expected to have a uniformly random structure, but constraints on recombination will produce network communities that we identify using a stochastic block model. We validate this method on synthetic data, showing that it correctly recovers populations of constrained recombination, before applying it to the Duffy Binding Like-α (DBLα) domain of var genes. We find nine HVRs whose network communities map in distinctive ways to known DBLα classifications and clinical phenotypes. We show that the recombinational constraints of some HVRs are correlated, while others are independent. These findings suggest that this micromodular structuring facilitates independent evolutionary trajectories of neighboring mosaic regions, allowing the parasite to retain protein function while generating enormous sequence diversity. Our approach therefore offers a rigorous method for analyzing evolutionary constraints in var genes, and is also flexible enough to be easily applied more generally to any highly recombinant sequences.

  13. A Network Approach to Analyzing Highly Recombinant Malaria Parasite Genes

    PubMed Central

    Larremore, Daniel B.; Clauset, Aaron; Buckee, Caroline O.

    2013-01-01

    The var genes of the human malaria parasite Plasmodium falciparum present a challenge to population geneticists due to their extreme diversity, which is generated by high rates of recombination. These genes encode a primary antigen protein called PfEMP1, which is expressed on the surface of infected red blood cells and elicits protective immune responses. Var gene sequences are characterized by pronounced mosaicism, precluding the use of traditional phylogenetic tools that require bifurcating tree-like evolutionary relationships. We present a new method that identifies highly variable regions (HVRs), and then maps each HVR to a complex network in which each sequence is a node and two nodes are linked if they share an exact match of significant length. Here, networks of var genes that recombine freely are expected to have a uniformly random structure, but constraints on recombination will produce network communities that we identify using a stochastic block model. We validate this method on synthetic data, showing that it correctly recovers populations of constrained recombination, before applying it to the Duffy Binding Like-α (DBLα) domain of var genes. We find nine HVRs whose network communities map in distinctive ways to known DBLα classifications and clinical phenotypes. We show that the recombinational constraints of some HVRs are correlated, while others are independent. These findings suggest that this micromodular structuring facilitates independent evolutionary trajectories of neighboring mosaic regions, allowing the parasite to retain protein function while generating enormous sequence diversity. Our approach therefore offers a rigorous method for analyzing evolutionary constraints in var genes, and is also flexible enough to be easily applied more generally to any highly recombinant sequences. PMID:24130474

  14. Comprehensive detection of genes causing a phenotype using phenotype sequencing and pathway analysis.

    PubMed

    Harper, Marc; Gronenberg, Luisa; Liao, James; Lee, Christopher

    2014-01-01

    Discovering all the genetic causes of a phenotype is an important goal in functional genomics. We combine an experimental design for detecting independent genetic causes of a phenotype with a high-throughput sequencing analysis that maximizes sensitivity for comprehensively identifying them. Testing this approach on a set of 24 mutant strains generated for a metabolic phenotype with many known genetic causes, we show that this pathway-based phenotype sequencing analysis greatly improves sensitivity of detection compared with previous methods, and reveals a wide range of pathways that can cause this phenotype. We demonstrate our approach on a metabolic re-engineering phenotype, the PEP/OAA metabolic node in E. coli, which is crucial to a substantial number of metabolic pathways and under renewed interest for biofuel research. Out of 2157 mutations in these strains, pathway-phenoseq discriminated just five gene groups (12 genes) as statistically significant causes of the phenotype. Experimentally, these five gene groups, and the next two high-scoring pathway-phenoseq groups, either have a clear connection to the PEP metabolite level or offer an alternative path of producing oxaloacetate (OAA), and thus clearly explain the phenotype. These high-scoring gene groups also show strong evidence of positive selection pressure, compared with strictly neutral selection in the rest of the genome.

  15. Conservation of coevolving protein interfaces bridges prokaryote–eukaryote homologies in the twilight zone

    PubMed Central

    Rodriguez-Rivas, Juan; Marsili, Simone; Juan, David; Valencia, Alfonso

    2016-01-01

    Protein–protein interactions are fundamental for the proper functioning of the cell. As a result, protein interaction surfaces are subject to strong evolutionary constraints. Recent developments have shown that residue coevolution provides accurate predictions of heterodimeric protein interfaces from sequence information. So far these approaches have been limited to the analysis of families of prokaryotic complexes for which large multiple sequence alignments of homologous sequences can be compiled. We explore the hypothesis that coevolution points to structurally conserved contacts at protein–protein interfaces, which can be reliably projected to homologous complexes with distantly related sequences. We introduce a domain-centered protocol to study the interplay between residue coevolution and structural conservation of protein–protein interfaces. We show that sequence-based coevolutionary analysis systematically identifies residue contacts at prokaryotic interfaces that are structurally conserved at the interface of their eukaryotic counterparts. In turn, this allows the prediction of conserved contacts at eukaryotic protein–protein interfaces with high confidence using solely mutational patterns extracted from prokaryotic genomes. Even in the context of high divergence in sequence (the twilight zone), where standard homology modeling of protein complexes is unreliable, our approach provides sequence-based accurate information about specific details of protein interactions at the residue level. Selected examples of the application of prokaryotic coevolutionary analysis to the prediction of eukaryotic interfaces further illustrate the potential of this approach. PMID:27965389

  16. Conservation of coevolving protein interfaces bridges prokaryote-eukaryote homologies in the twilight zone.

    PubMed

    Rodriguez-Rivas, Juan; Marsili, Simone; Juan, David; Valencia, Alfonso

    2016-12-27

    Protein-protein interactions are fundamental for the proper functioning of the cell. As a result, protein interaction surfaces are subject to strong evolutionary constraints. Recent developments have shown that residue coevolution provides accurate predictions of heterodimeric protein interfaces from sequence information. So far these approaches have been limited to the analysis of families of prokaryotic complexes for which large multiple sequence alignments of homologous sequences can be compiled. We explore the hypothesis that coevolution points to structurally conserved contacts at protein-protein interfaces, which can be reliably projected to homologous complexes with distantly related sequences. We introduce a domain-centered protocol to study the interplay between residue coevolution and structural conservation of protein-protein interfaces. We show that sequence-based coevolutionary analysis systematically identifies residue contacts at prokaryotic interfaces that are structurally conserved at the interface of their eukaryotic counterparts. In turn, this allows the prediction of conserved contacts at eukaryotic protein-protein interfaces with high confidence using solely mutational patterns extracted from prokaryotic genomes. Even in the context of high divergence in sequence (the twilight zone), where standard homology modeling of protein complexes is unreliable, our approach provides sequence-based accurate information about specific details of protein interactions at the residue level. Selected examples of the application of prokaryotic coevolutionary analysis to the prediction of eukaryotic interfaces further illustrate the potential of this approach.

  17. Variation in the genomic locations and sequence conservation of STAR elements among staphylococcal species provides insight into DNA repeat evolution

    PubMed Central

    2012-01-01

    Background Staphylococcus aureus Repeat (STAR) elements are a type of interspersed intergenic direct repeat. In this study the conservation and variation in these elements was explored by bioinformatic analyses of published staphylococcal genome sequences and through sequencing of specific STAR element loci from a large set of S. aureus isolates. Results Using bioinformatic analyses, we found that the STAR elements were located in different genomic loci within each staphylococcal species. There was no correlation between the number of STAR elements in each genome and the evolutionary relatedness of staphylococcal species, however higher levels of repeats were observed in both S. aureus and S. lugdunensis compared to other staphylococcal species. Unexpectedly, sequencing of the internal spacer sequences of individual repeat elements from multiple isolates showed conservation at the sequence level within deep evolutionary lineages of S. aureus. Whilst individual STAR element loci were demonstrated to expand and contract, the sequences associated with each locus were stable and distinct from one another. Conclusions The high degree of lineage and locus-specific conservation of these intergenic repeat regions suggests that STAR elements are maintained due to selective or molecular forces with some of these elements having an important role in cell physiology. The high prevalence in two of the more virulent staphylococcal species is indicative of a potential role for STAR elements in pathogenesis. PMID:23020678

  18. Searching for resistance genes to Bursaphelenchus xylophilus using high throughput screening

    PubMed Central

    2012-01-01

    Background Pine wilt disease (PWD), caused by the pinewood nematode (PWN; Bursaphelenchus xylophilus), damages and kills pine trees and is causing serious economic damage worldwide. Although the ecological mechanism of infestation is well described, the plant’s molecular response to the pathogen is not well known. This is due mainly to the lack of genomic information and the complexity of the disease. High throughput sequencing is now an efficient approach for detecting the expression of genes in non-model organisms, thus providing valuable information in spite of the lack of the genome sequence. In an attempt to unravel genes potentially involved in the pine defense against the pathogen, we hereby report the high throughput comparative sequence analysis of infested and non-infested stems of Pinus pinaster (very susceptible to PWN) and Pinus pinea (less susceptible to PWN). Results Four cDNA libraries from infested and non-infested stems of P. pinaster and P. pinea were sequenced in a full 454 GS FLX run, producing a total of 2,083,698 reads. The putative amino acid sequences encoded by the assembled transcripts were annotated according to Gene Ontology, to assign Pinus contigs into Biological Processes, Cellular Components and Molecular Functions categories. Most of the annotated transcripts corresponded to Picea genes-25.4-39.7%, whereas a smaller percentage, matched Pinus genes, 1.8-12.8%, probably a consequence of more public genomic information available for Picea than for Pinus. The comparative transcriptome analysis showed that when P. pinaster was infested with PWN, the genes malate dehydrogenase, ABA, water deficit stress related genes and PAR1 were highly expressed, while in PWN-infested P. pinea, the highly expressed genes were ricin B-related lectin, and genes belonging to the SNARE and high mobility group families. Quantitative PCR experiments confirmed the differential gene expression between the two pine species. Conclusions Defense-related genes triggered by nematode infestation were detected in both P. pinaster and P. pinea transcriptomes utilizing 454 pyrosequencing technology. P. pinaster showed higher abundance of genes related to transcriptional regulation, terpenoid secondary metabolism (including some with nematicidal activity) and pathogen attack. P. pinea showed higher abundance of genes related to oxidative stress and higher levels of expression in general of stress responsive genes. This study provides essential information about the molecular defense mechanisms utilized by P. pinaster and P. pinea against PWN infestation and contributes to a better understanding of PWD. PMID:23134679

  19. Diversity arrays technology (DArT) markers in apple for genetic linkage maps.

    PubMed

    Schouten, Henk J; van de Weg, W Eric; Carling, Jason; Khan, Sabaz Ali; McKay, Steven J; van Kaauwen, Martijn P W; Wittenberg, Alexander H J; Koehorst-van Putten, Herma J J; Noordijk, Yolanda; Gao, Zhongshan; Rees, D Jasper G; Van Dyk, Maria M; Jaccoud, Damian; Considine, Michael J; Kilian, Andrzej

    2012-03-01

    Diversity Arrays Technology (DArT) provides a high-throughput whole-genome genotyping platform for the detection and scoring of hundreds of polymorphic loci without any need for prior sequence information. The work presented here details the development and performance of a DArT genotyping array for apple. This is the first paper on DArT in horticultural trees. Genetic mapping of DArT markers in two mapping populations and their integration with other marker types showed that DArT is a powerful high-throughput method for obtaining accurate and reproducible marker data, despite the low cost per data point. This method appears to be suitable for aligning the genetic maps of different segregating populations. The standard complexity reduction method, based on the methylation-sensitive PstI restriction enzyme, resulted in a high frequency of markers, although there was 52-54% redundancy due to the repeated sampling of highly similar sequences. Sequencing of the marker clones showed that they are significantly enriched for low-copy, genic regions. The genome coverage using the standard method was 55-76%. For improved genome coverage, an alternative complexity reduction method was examined, which resulted in less redundancy and additional segregating markers. The DArT markers proved to be of high quality and were very suitable for genetic mapping at low cost for the apple, providing moderate genome coverage. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1007/s11032-011-9579-5) contains supplementary material, which is available to authorized users.

  20. High-Throughput rRNA Gene Sequencing Reveals High
and Complex Bacterial Diversity Associated with
Brazilian Coffee Bean Fermentation

    PubMed Central

    Vinícius de Melo, Gilberto

    2018-01-01

    Summary Coffee bean fermentation is a spontaneous, on-farm process involving the action of different microbial groups, including bacteria and fungi. In this study, high-throughput sequencing approach was employed to study the diversity and dynamics of bacteria associated with Brazilian coffee bean fermentation. The total DNA from fermenting coffee samples was extracted at different time points, and the 16S rRNA gene with segments around the V4 variable region was sequenced by Illumina high-throughput platform. Using this approach, the presence of over eighty bacterial genera was determined, many of which have been detected for the first time during coffee bean fermentation, including Fructobacillus, Pseudonocardia, Pedobacter, Sphingomonas and Hymenobacter. The presence of Fructobacillus suggests an influence of these bacteria on fructose metabolism during coffee fermentation. Temporal analysis showed a strong dominance of lactic acid bacteria with over 97% of read sequences at the end of fermentation, mainly represented by the Leuconostoc and Lactococcus. Metabolism of lactic acid bacteria was associated with the high formation of lactic acid during fermentation, as determined by HPLC analysis. The results reported in this study confirm the underestimation of bacterial diversity associated with coffee fermentation. New microbial groups reported in this study may be explored as functional starter cultures for on-farm coffee processing.

  1. A Hidden Markov Model Approach to the Problem of Heuristic Selection in Hyper-Heuristics with a Case Study in High School Timetabling Problems.

    PubMed

    Kheiri, Ahmed; Keedwell, Ed

    2017-01-01

    Operations research is a well-established field that uses computational systems to support decisions in business and public life. Good solutions to operations research problems can make a large difference to the efficient running of businesses and organisations and so the field often searches for new methods to improve these solutions. The high school timetabling problem is an example of an operations research problem and is a challenging task which requires assigning events and resources to time slots subject to a set of constraints. In this article, a new sequence-based selection hyper-heuristic is presented that produces excellent results on a suite of high school timetabling problems. In this study, we present an easy-to-implement, easy-to-maintain, and effective sequence-based selection hyper-heuristic to solve high school timetabling problems using a benchmark of unified real-world instances collected from different countries. We show that with sequence-based methods, it is possible to discover new best known solutions for a number of the problems in the timetabling domain. Through this investigation, the usefulness of sequence-based selection hyper-heuristics has been demonstrated and the capability of these methods has been shown to exceed the state of the art.

  2. The zebrafish reference genome sequence and its relationship to the human genome.

    PubMed

    Howe, Kerstin; Clark, Matthew D; Torroja, Carlos F; Torrance, James; Berthelot, Camille; Muffato, Matthieu; Collins, John E; Humphray, Sean; McLaren, Karen; Matthews, Lucy; McLaren, Stuart; Sealy, Ian; Caccamo, Mario; Churcher, Carol; Scott, Carol; Barrett, Jeffrey C; Koch, Romke; Rauch, Gerd-Jörg; White, Simon; Chow, William; Kilian, Britt; Quintais, Leonor T; Guerra-Assunção, José A; Zhou, Yi; Gu, Yong; Yen, Jennifer; Vogel, Jan-Hinnerk; Eyre, Tina; Redmond, Seth; Banerjee, Ruby; Chi, Jianxiang; Fu, Beiyuan; Langley, Elizabeth; Maguire, Sean F; Laird, Gavin K; Lloyd, David; Kenyon, Emma; Donaldson, Sarah; Sehra, Harminder; Almeida-King, Jeff; Loveland, Jane; Trevanion, Stephen; Jones, Matt; Quail, Mike; Willey, Dave; Hunt, Adrienne; Burton, John; Sims, Sarah; McLay, Kirsten; Plumb, Bob; Davis, Joy; Clee, Chris; Oliver, Karen; Clark, Richard; Riddle, Clare; Elliot, David; Eliott, David; Threadgold, Glen; Harden, Glenn; Ware, Darren; Begum, Sharmin; Mortimore, Beverley; Mortimer, Beverly; Kerry, Giselle; Heath, Paul; Phillimore, Benjamin; Tracey, Alan; Corby, Nicole; Dunn, Matthew; Johnson, Christopher; Wood, Jonathan; Clark, Susan; Pelan, Sarah; Griffiths, Guy; Smith, Michelle; Glithero, Rebecca; Howden, Philip; Barker, Nicholas; Lloyd, Christine; Stevens, Christopher; Harley, Joanna; Holt, Karen; Panagiotidis, Georgios; Lovell, Jamieson; Beasley, Helen; Henderson, Carl; Gordon, Daria; Auger, Katherine; Wright, Deborah; Collins, Joanna; Raisen, Claire; Dyer, Lauren; Leung, Kenric; Robertson, Lauren; Ambridge, Kirsty; Leongamornlert, Daniel; McGuire, Sarah; Gilderthorp, Ruth; Griffiths, Coline; Manthravadi, Deepa; Nichol, Sarah; Barker, Gary; Whitehead, Siobhan; Kay, Michael; Brown, Jacqueline; Murnane, Clare; Gray, Emma; Humphries, Matthew; Sycamore, Neil; Barker, Darren; Saunders, David; Wallis, Justene; Babbage, Anne; Hammond, Sian; Mashreghi-Mohammadi, Maryam; Barr, Lucy; Martin, Sancha; Wray, Paul; Ellington, Andrew; Matthews, Nicholas; Ellwood, Matthew; Woodmansey, Rebecca; Clark, Graham; Cooper, James D; Cooper, James; Tromans, Anthony; Grafham, Darren; Skuce, Carl; Pandian, Richard; Andrews, Robert; Harrison, Elliot; Kimberley, Andrew; Garnett, Jane; Fosker, Nigel; Hall, Rebekah; Garner, Patrick; Kelly, Daniel; Bird, Christine; Palmer, Sophie; Gehring, Ines; Berger, Andrea; Dooley, Christopher M; Ersan-Ürün, Zübeyde; Eser, Cigdem; Geiger, Horst; Geisler, Maria; Karotki, Lena; Kirn, Anette; Konantz, Judith; Konantz, Martina; Oberländer, Martina; Rudolph-Geiger, Silke; Teucke, Mathias; Lanz, Christa; Raddatz, Günter; Osoegawa, Kazutoyo; Zhu, Baoli; Rapp, Amanda; Widaa, Sara; Langford, Cordelia; Yang, Fengtang; Schuster, Stephan C; Carter, Nigel P; Harrow, Jennifer; Ning, Zemin; Herrero, Javier; Searle, Steve M J; Enright, Anton; Geisler, Robert; Plasterk, Ronald H A; Lee, Charles; Westerfield, Monte; de Jong, Pieter J; Zon, Leonard I; Postlethwait, John H; Nüsslein-Volhard, Christiane; Hubbard, Tim J P; Roest Crollius, Hugues; Rogers, Jane; Stemple, Derek L

    2013-04-25

    Zebrafish have become a popular organism for the study of vertebrate gene function. The virtually transparent embryos of this species, and the ability to accelerate genetic studies by gene knockdown or overexpression, have led to the widespread use of zebrafish in the detailed investigation of vertebrate gene function and increasingly, the study of human genetic disease. However, for effective modelling of human genetic disease it is important to understand the extent to which zebrafish genes and gene structures are related to orthologous human genes. To examine this, we generated a high-quality sequence assembly of the zebrafish genome, made up of an overlapping set of completely sequenced large-insert clones that were ordered and oriented using a high-resolution high-density meiotic map. Detailed automatic and manual annotation provides evidence of more than 26,000 protein-coding genes, the largest gene set of any vertebrate so far sequenced. Comparison to the human reference genome shows that approximately 70% of human genes have at least one obvious zebrafish orthologue. In addition, the high quality of this genome assembly provides a clearer understanding of key genomic features such as a unique repeat content, a scarcity of pseudogenes, an enrichment of zebrafish-specific genes on chromosome 4 and chromosomal regions that influence sex determination.

  3. The zebrafish reference genome sequence and its relationship to the human genome

    PubMed Central

    Howe, Kerstin; Clark, Matthew D.; Torroja, Carlos F.; Torrance, James; Berthelot, Camille; Muffato, Matthieu; Collins, John E.; Humphray, Sean; McLaren, Karen; Matthews, Lucy; McLaren, Stuart; Sealy, Ian; Caccamo, Mario; Churcher, Carol; Scott, Carol; Barrett, Jeffrey C.; Koch, Romke; Rauch, Gerd-Jörg; White, Simon; Chow, William; Kilian, Britt; Quintais, Leonor T.; Guerra-Assunção, José A.; Zhou, Yi; Gu, Yong; Yen, Jennifer; Vogel, Jan-Hinnerk; Eyre, Tina; Redmond, Seth; Banerjee, Ruby; Chi, Jianxiang; Fu, Beiyuan; Langley, Elizabeth; Maguire, Sean F.; Laird, Gavin K.; Lloyd, David; Kenyon, Emma; Donaldson, Sarah; Sehra, Harminder; Almeida-King, Jeff; Loveland, Jane; Trevanion, Stephen; Jones, Matt; Quail, Mike; Willey, Dave; Hunt, Adrienne; Burton, John; Sims, Sarah; McLay, Kirsten; Plumb, Bob; Davis, Joy; Clee, Chris; Oliver, Karen; Clark, Richard; Riddle, Clare; Eliott, David; Threadgold, Glen; Harden, Glenn; Ware, Darren; Mortimer, Beverly; Kerry, Giselle; Heath, Paul; Phillimore, Benjamin; Tracey, Alan; Corby, Nicole; Dunn, Matthew; Johnson, Christopher; Wood, Jonathan; Clark, Susan; Pelan, Sarah; Griffiths, Guy; Smith, Michelle; Glithero, Rebecca; Howden, Philip; Barker, Nicholas; Stevens, Christopher; Harley, Joanna; Holt, Karen; Panagiotidis, Georgios; Lovell, Jamieson; Beasley, Helen; Henderson, Carl; Gordon, Daria; Auger, Katherine; Wright, Deborah; Collins, Joanna; Raisen, Claire; Dyer, Lauren; Leung, Kenric; Robertson, Lauren; Ambridge, Kirsty; Leongamornlert, Daniel; McGuire, Sarah; Gilderthorp, Ruth; Griffiths, Coline; Manthravadi, Deepa; Nichol, Sarah; Barker, Gary; Whitehead, Siobhan; Kay, Michael; Brown, Jacqueline; Murnane, Clare; Gray, Emma; Humphries, Matthew; Sycamore, Neil; Barker, Darren; Saunders, David; Wallis, Justene; Babbage, Anne; Hammond, Sian; Mashreghi-Mohammadi, Maryam; Barr, Lucy; Martin, Sancha; Wray, Paul; Ellington, Andrew; Matthews, Nicholas; Ellwood, Matthew; Woodmansey, Rebecca; Clark, Graham; Cooper, James; Tromans, Anthony; Grafham, Darren; Skuce, Carl; Pandian, Richard; Andrews, Robert; Harrison, Elliot; Kimberley, Andrew; Garnett, Jane; Fosker, Nigel; Hall, Rebekah; Garner, Patrick; Kelly, Daniel; Bird, Christine; Palmer, Sophie; Gehring, Ines; Berger, Andrea; Dooley, Christopher M.; Ersan-Ürün, Zübeyde; Eser, Cigdem; Geiger, Horst; Geisler, Maria; Karotki, Lena; Kirn, Anette; Konantz, Judith; Konantz, Martina; Oberländer, Martina; Rudolph-Geiger, Silke; Teucke, Mathias; Osoegawa, Kazutoyo; Zhu, Baoli; Rapp, Amanda; Widaa, Sara; Langford, Cordelia; Yang, Fengtang; Carter, Nigel P.; Harrow, Jennifer; Ning, Zemin; Herrero, Javier; Searle, Steve M. J.; Enright, Anton; Geisler, Robert; Plasterk, Ronald H. A.; Lee, Charles; Westerfield, Monte; de Jong, Pieter J.; Zon, Leonard I.; Postlethwait, John H.; Nüsslein-Volhard, Christiane; Hubbard, Tim J. P.; Crollius, Hugues Roest; Rogers, Jane; Stemple, Derek L.

    2013-01-01

    Zebrafish have become a popular organism for the study of vertebrate gene function1,2. The virtually transparent embryos of this species, and the ability to accelerate genetic studies by gene knockdown or overexpression, have led to the widespread use of zebrafish in the detailed investigation of vertebrate gene function and increasingly, the study of human genetic disease3–5. However, for effective modelling of human genetic disease it is important to understand the extent to which zebrafish genes and gene structures are related to orthologous human genes. To examine this, we generated a high-quality sequence assembly of the zebrafish genome, made up of an overlapping set of completely sequenced large-insert clones that were ordered and oriented using a high-resolution high-density meiotic map. Detailed automatic and manual annotation provides evidence of more than 26,000 protein-coding genes6, the largest gene set of any vertebrate so far sequenced. Comparison to the human reference genome shows that approximately 70% of human genes have at least one obvious zebrafish orthologue. In addition, the high quality of this genome assembly provides a clearer understanding of key genomic features such as a unique repeat content, a scarcity of pseudogenes, an enrichment of zebrafish-specific genes on chromosome 4 and chromosomal regions that influence sex determination. PMID:23594743

  4. [Analysis of 4 clustered high risk acute flaccid paralysis cases in Shanxi Province in 2006].

    PubMed

    Yan, Dong-mei; Zhang, Yong; Wang, Dong-yan

    2010-04-01

    Analysis of epidemiology of 4 clustered high risk acute flaccid paralysis(AFP) cases reported by Shanxi province in 2006 and VP1 gene characteristic for type III poliovirus isolated from the four AFP cases. Virus isolation and identification were conducted according to the 4th edition of WHO polio laboratory manual. The sequence of VP1 region were amplified and sequenced. The phylogenetic trees based on VP1 region were constructed. Three of four high risk AFP cases were suspected as vaccine associated paralysis poliomyelitis (VAPP), the onset date of them were close. VP1 sequencing of the four type III isolates revealed that the identity were 99.7%, 99.9%, 99.4% and 99.9% respectively compared with vaccine reference strain-BJOPV3. According to WHO criteria, the four isolates were identified as type III vaccine-related poliovirus. Phylogenetic analysis based on VP1 coding sequence showed that the four type III poliovirus were not related significantly. The type III poliovirus isolated from 3 suspected VAPP cases shared one nucleotide mutation at 2637 (C-->U), which result in the amino acid mutation from Val into Ala. The improvement of laboratory surveillance for clustered high risk AFP cases should be strengthened so as to detect and prevent poliovirus circulation timely.

  5. Characterization of genomic sequence showing strong association with polyembryony among diverse Citrus species and cultivars, and its synteny with Vitis and Populus.

    PubMed

    Nakano, Michiharu; Shimada, Takehiko; Endo, Tomoko; Fujii, Hiroshi; Nesumi, Hirohisa; Kita, Masayuki; Ebina, Masumi; Shimizu, Tokurou; Omura, Mitsuo

    2012-02-01

    Polyembryony, in which multiple somatic nucellar cell-derived embryos develop in addition to the zygotic embryo in a seed, is common in the genus Citrus. Previous genetic studies indicated polyembryony is mainly determined by a single locus, but the underlying molecular mechanism is still unclear. As a step towards identification and characterization of the gene or genes responsible for nucellar embryogenesis in Citrus, haplotype-specific physical maps around the polyembryony locus were constructed. By sequencing three BAC clones aligned on the polyembryony haplotype, a single contiguous draft sequence consisting of 380 kb containing 70 predicted open reading frames (ORFs) was reconstructed. Single nucleotide polymorphism genotypes detected in the sequenced genomic region showed strong association with embryo type in Citrus, indicating a common polyembryony locus is shared among widely diverse Citrus cultivars and species. The arrangement of the predicted ORFs in the characterized genomic region showed high collinearity to the genomic sequence of chromosome 4 of Vitis vinifera and linkage group VI of Populus trichocarpa, suggesting that the syntenic relationship among these species is conserved even though V. vinifera and P. trichocarpa are non-apomictic species. This is the first study to characterize in detail the genomic structure of an apomixis locus determining adventitious embryony. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  6. Recognition of platinum-DNA adducts by HMGB1a.

    PubMed

    Ramachandran, Srinivas; Temple, Brenda; Alexandrova, Anastassia N; Chaney, Stephen G; Dokholyan, Nikolay V

    2012-09-25

    Cisplatin (CP) and oxaliplatin (OX), platinum-based drugs used widely in chemotherapy, form adducts on intrastrand guanines (5'GG) in genomic DNA. DNA damage recognition proteins, transcription factors, mismatch repair proteins, and DNA polymerases discriminate between CP- and OX-GG DNA adducts, which could partly account for differences in the efficacy, toxicity, and mutagenicity of CP and OX. In addition, differential recognition of CP- and OX-GG adducts is highly dependent on the sequence context of the Pt-GG adduct. In particular, DNA binding protein domain HMGB1a binds to CP-GG DNA adducts with up to 53-fold greater affinity than to OX-GG adducts in the TGGA sequence context but shows much smaller differences in binding in the AGGC or TGGT sequence contexts. Here, simulations of the HMGB1a-Pt-DNA complex in the three sequence contexts revealed a higher number of interface contacts for the CP-DNA complex in the TGGA sequence context than in the OX-DNA complex. However, the number of interface contacts was similar in the TGGT and AGGC sequence contexts. The higher number of interface contacts in the CP-TGGA sequence context corresponded to a larger roll of the Pt-GG base pair step. Furthermore, geometric analysis of stacking of phenylalanine 37 in HMGB1a (Phe37) with the platinated guanines revealed more favorable stacking modes correlated with a larger roll of the Pt-GG base pair step in the TGGA sequence context. These data are consistent with our previous molecular dynamics simulations showing that the CP-TGGA complex was able to sample larger roll angles than the OX-TGGA complex or either CP- or OX-DNA complexes in the AGGC or TGGT sequences. We infer that the high binding affinity of HMGB1a for CP-TGGA is due to the greater flexibility of CP-TGGA compared to OX-TGGA and other Pt-DNA adducts. This increased flexibility is reflected in the ability of CP-TGGA to sample larger roll angles, which allows for a higher number of interface contacts between the Pt-DNA adduct and HMGB1a.

  7. Characterization of a species-specific repetitive DNA from a highly endangered wild animal, Rhinoceros unicornis, and assessment of genetic polymorphism by microsatellite associated sequence amplification (MASA).

    PubMed

    Ali, S; Azfer, M A; Bashamboo, A; Mathur, P K; Malik, P K; Mathur, V B; Raha, A K; Ansari, S

    1999-03-04

    We have cloned and sequenced a 906bp EcoRI repeat DNA fraction from Rhinoceros unicornis genome. The contig pSS(R)2 is AT rich with 340 A (37.53%), 187 C (20.64%), 173 G (19.09%) and 206 T (22.74%). The sequence contains MALT box, NF-E1, Poly-A signal, lariat consensus sequences, TATA box, translational initiation sequences and several stop codons. Translation of the contig showed seven different types of protein motifs, among which, EGF-like domain cysteine pattern signatures and Bowman-Birk serine protease inhibitor family signatures were prominent. The presence of eukaryotic transcriptional elements, protein signatures and analysis of subset sequences in the 5' region from 1 to 165nt indicating coding potential (test code value=0.97) suggest possible regulatory and/or functional role(s) of these sequences in the rhino genome. Translation of the complementary strand from 906 to 706nt and 190 to 2nt showed proteins of more than 7kDa rich in non-polar residues. This suggests that pSS(R)2 is either a part of, or adjacent to, a functional gene. The contig contains mostly non-consecutive simple repeat units from 2 to 17nt with varying frequencies, of which four base motifs were found to be predominant. Zoo-blot hybridization revealed that pSS(R)2 sequences are unique to R. unicornis genome because they do not cross-hybridize, even with the genomic DNA of South African black rhino Diceros bicornis. Southern blot analysis of R. unicornis genomic DNA with pSS(R)2 and other synthetic oligo probes revealed a high level of genetic homogeneity, which was also substantiated by microsatellite associated sequence amplification (MASA). Owing to its uniqueness, the pSS(R)2 probe has a potential application in the area of conservation biology for unequivocal identification of horn or other body tissues of R. unicornis. The evolutionary aspect of this repeat fraction in the context of comparative genome analysis is discussed.

  8. BlackOPs: increasing confidence in variant detection through mappability filtering.

    PubMed

    Cabanski, Christopher R; Wilkerson, Matthew D; Soloway, Matthew; Parker, Joel S; Liu, Jinze; Prins, Jan F; Marron, J S; Perou, Charles M; Hayes, D Neil

    2013-10-01

    Identifying variants using high-throughput sequencing data is currently a challenge because true biological variants can be indistinguishable from technical artifacts. One source of technical artifact results from incorrectly aligning experimentally observed sequences to their true genomic origin ('mismapping') and inferring differences in mismapped sequences to be true variants. We developed BlackOPs, an open-source tool that simulates experimental RNA-seq and DNA whole exome sequences derived from the reference genome, aligns these sequences by custom parameters, detects variants and outputs a blacklist of positions and alleles caused by mismapping. Blacklists contain thousands of artifact variants that are indistinguishable from true variants and, for a given sample, are expected to be almost completely false positives. We show that these blacklist positions are specific to the alignment algorithm and read length used, and BlackOPs allows users to generate a blacklist specific to their experimental setup. We queried the dbSNP and COSMIC variant databases and found numerous variants indistinguishable from mapping errors. We demonstrate how filtering against blacklist positions reduces the number of potential false variants using an RNA-seq glioblastoma cell line data set. In summary, accounting for mapping-caused variants tuned to experimental setups reduces false positives and, therefore, improves genome characterization by high-throughput sequencing.

  9. Combined proteomic and molecular approaches for cloning and characterization of copper-zinc superoxide dismutase (Cu, Zn-SOD2) from garlic (Allium sativum).

    PubMed

    Hadji Sfaxi, Imen; Ezzine, Aymen; Coquet, Laurent; Cosette, Pascal; Jouenne, Thierry; Marzouki, M Nejib

    2012-09-01

    Superoxide dismutases (SODs; EC 1.15.1.1) are key enzymes in the cells protection against oxidant agents. Thus, SODs play a major role in the protection of aerobic organisms against oxygen-mediated damages. Three SOD isoforms were previously identified by zymogram staining from Allium sativum bulbs. The purified Cu, Zn-SOD2 shows an antagonist effect to an anticancer drug and alleviate cytotoxicity inside tumor cells lines B16F0 (mouse melanoma cells) and PAE (porcine aortic endothelial cells). To extend the characterization of Allium SODs and their corresponding genes, a proteomic approach was applied involving two-dimensional gel electrophoresis and LC-MS/MS analyses. From peptide sequence data obtained by mass spectrometry and sequences homologies, primers were defined and a cDNA fragment of 456 bp was amplified by RT-PCR. The cDNA nucleotide sequence analysis revealed an open reading frame coding for 152 residues. The deduced amino acid sequence showed high identity (82-87%) with sequences of Cu, Zn-SODs from other plant species. Molecular analysis was achieved by a protein 3D structural model.

  10. DNA hypomethylation of individual sequences in aborted cloned bovine fetuses.

    PubMed

    Chen, Tao; Jiang, Yan; Zhang, Yan-Ling; Liu, Jing-He; Hou, Yi; Schatten, Heide; Chen, Da-Yuan; Sun, Qing-Yuan

    2005-09-01

    Cloned bovines have a much higher abortion rate than those derived in vivo. Available evidence indicates that inappropriate epigenetic reprogramming of donor nuclei is the primary cause of cloning failure. To gain a better understanding of the DNA methylation changes associated with the high abortion rate of cloned bovines, we examined the DNA methylation status of a repeated sequence (satellite I) and the promoter regions of two single-copy genes (interleukin 3/cytokeratin) in aborted cloned fetuses, aborted fetuses derived from artificial insemination (AI), cloned adults and AI adults by bisulfite sequencing and restriction enzyme analysis. Two of four aborted cloned fetuses show very low methylation levels in the two single-copy gene promoter regions. One of the two fetuses also showed undermethylated status in the satellite I sequence. The other two aborted cloned fetuses have similar methylation levels to those of aborted AI fetuses. However, no difference in methylation was observed between cloned adults and AI adults. Our results demonstrate for the first time the undermethylated status of individual sequences in aborted cloned fetuses. These findings suggest that aberrant DNA methylation may contribute to the developmental failure of cloned bovine fetuses.

  11. Genetic diversity analysis of Leuconostoc mesenteroides from Korean vegetables and food products by multilocus sequence typing.

    PubMed

    Sharma, Anshul; Kaur, Jasmine; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    In the present study, 35 Leuconostoc mesenteroides strains isolated from vegetables and food products from South Korea were studied by multilocus sequence typing (MLST) of seven housekeeping genes (atpA, groEL, gyrB, pheS, pyrG, rpoA, and uvrC). The fragment sizes of the seven amplified housekeeping genes ranged in length from 366 to 1414 bp. Sequence analysis indicated 27 different sequence types (STs) with 25 of them being represented by a single strain indicating high genetic diversity, whereas the remaining 2 were characterized by five strains each. In total, 220 polymorphic nucleotide sites were detected among seven housekeeping genes. The phylogenetic analysis based on the STs of the seven loci indicated that the 35 strains belonged to two major groups, A (28 strains) and B (7 strains). Split decomposition analysis showed that intraspecies recombination played a role in generating diversity among strains. The minimum spanning tree showed that the evolution of the STs was not correlated with food source. This study signifies that the multilocus sequence typing is a valuable tool to access the genetic diversity among L. mesenteroides strains from South Korea and can be used further to monitor the evolutionary changes.

  12. Structure-Function Analysis of Chloroplast Proteins via Random Mutagenesis Using Error-Prone PCR.

    PubMed

    Dumas, Louis; Zito, Francesca; Auroy, Pascaline; Johnson, Xenie; Peltier, Gilles; Alric, Jean

    2018-06-01

    Site-directed mutagenesis of chloroplast genes was developed three decades ago and has greatly advanced the field of photosynthesis research. Here, we describe a new approach for generating random chloroplast gene mutants that combines error-prone polymerase chain reaction of a gene of interest with chloroplast complementation of the knockout Chlamydomonas reinhardtii mutant. As a proof of concept, we targeted a 300-bp sequence of the petD gene that encodes subunit IV of the thylakoid membrane-bound cytochrome b 6 f complex. By sequencing chloroplast transformants, we revealed 149 mutations in the 300-bp target petD sequence that resulted in 92 amino acid substitutions in the 100-residue target subunit IV sequence. Our results show that this method is suited to the study of highly hydrophobic, multisubunit, and chloroplast-encoded proteins containing cofactors such as hemes, iron-sulfur clusters, and chlorophyll pigments. Moreover, we show that mutant screening and sequencing can be used to study photosynthetic mechanisms or to probe the mutational robustness of chloroplast-encoded proteins, and we propose that this method is a valuable tool for the directed evolution of enzymes in the chloroplast. © 2018 American Society of Plant Biologists. All rights reserved.

  13. Genetic variability of Echinococcus granulosus from the Tibetan plateau inferred by mitochondrial DNA sequences.

    PubMed

    Yan, Ning; Nie, Hua-Ming; Jiang, Zhong-Rong; Yang, Ai-Guo; Deng, Shi-Jin; Guo, Li; Yu, Hua; Yan, Yu-Bao; Tsering, Dawa; Kong, Wei-Shu; Wang, Ning; Wang, Jia-Hai; Xie, Yue; Fu, Yan; Yang, De-Ying; Wang, Shu-Xian; Gu, Xiao-Bin; Peng, Xue-Rong; Yang, Guang-You

    2013-09-01

    To analyse genetic variability and population structure, 84 isolates of Echinococcus granulosus (Cestoda: Taeniidae) collected from various host species at different sites of the Tibetan plateau in China were sequenced for the whole mitochondrial nad1 (894 bp) and atp6 (513 bp) genes. The vast majority were classified as G1 genotype (n=82), and two samples from human patients in Sichuan province were identified as G3 genotype. Based on the concatenated sequences of nad1+atp6, 28 different haplotypes (NA1-NA28) were identified. A parsimonious network of the concatenated sequence haplotypes showed star-like features in the overall population, with NA1 as the major haplotype in the population networks. By AMOVA it was shown that variation of E. granulosus within the overall population was the main pattern of the total genetic variability. Neutrality indexes of the concatenated sequence (nad1+atp6) were computed by Tajima's D and Fu's Fs tests and showed high negative values for E. granulosus, indicating significant deviations from neutrality. FST and Nm values suggested that the populations were not genetically differentiated. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Infants learn better from left to right: a directional bias in infants' sequence learning.

    PubMed

    Bulf, Hermann; de Hevia, Maria Dolores; Gariboldi, Valeria; Macchi Cassia, Viola

    2017-05-26

    A wealth of studies show that human adults map ordered information onto a directional spatial continuum. We asked whether mapping ordinal information into a directional space constitutes an early predisposition, already functional prior to the acquisition of symbolic knowledge and language. While it is known that preverbal infants represent numerical order along a left-to-right spatial continuum, no studies have investigated yet whether infants, like adults, organize any kind of ordinal information onto a directional space. We investigated whether 7-month-olds' ability to learn high-order rule-like patterns from visual sequences of geometric shapes was affected by the spatial orientation of the sequences (left-to-right vs. right-to-left). Results showed that infants readily learn rule-like patterns when visual sequences were presented from left to right, but not when presented from right to left. This result provides evidence that spatial orientation critically determines preverbal infants' ability to perceive and learn ordered information in visual sequences, opening to the idea that a left-to-right spatially organized mental representation of ordered dimensions might be rooted in biologically-determined constraints on human brain development.

  15. Sequence of the structural gene for granule-bound starch synthase of potato (Solanum tuberosum L.) and evidence for a single point deletion in the amf allele.

    PubMed

    van der Leij, F R; Visser, R G; Ponstein, A S; Jacobsen, E; Feenstra, W J

    1991-08-01

    The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type sequence with a cDNA sequence from the literature and a newly isolated cDNA revealed the presence of 13 introns, the first of which is located in the untranslated leader. The promoter contains a G-box-like sequence. The deduced amino acid sequence of the precursor of GBSS shows a high degree of identity with monocot waxy protein sequences in the region corresponding to the mature form of the enzyme. The transit peptide of 77 amino acids, required for routing of the precursor to the plastids, shows much less identity with the transit peptides of the other waxy preproteins, but resembles the hydropathic distributions of these peptides. Alignment of the amino acid sequences of the four mature starch synthases with the Escherichia coli glgA gene product revealed the presence of at least three conserved boxes; there is no homology with previously proposed starch-binding domains of other enzymes involved in starch metabolism. We report the use of chimeric constructs with wild-type and amf sequences to localize, via complementation experiments, the region of the amf allele in which the mutation resides. Direct sequencing of polymerase chain reaction products confirmed that the amf mutation is a deletion of a single AT basepair in the region coding for the transit peptide.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Breaking barriers and halting rupture: the 2016 Amatrice-Visso-Castelluccio earthquake sequence, central Italy

    NASA Astrophysics Data System (ADS)

    Gregory, L. C.; Walters, R. J.; Wedmore, L. N. J.; Craig, T. J.; McCaffrey, K. J. W.; Wilkinson, M. W.; Livio, F.; Michetti, A.; Goodall, H.; Li, Z.; Chen, J.; De Martini, P. M.

    2017-12-01

    In 2016 the Central Italian Apennines was struck by a sequence of normal faulting earthquakes that ruptured in three separate events on the 24th August (Mw 6.2), the 26th Oct (Mw 6.1), and the 30th Oct (Mw 6.6). We reveal the complex nature of the individual events and the time-evolution of the sequence using multiple datasets. We will present an overview of the results from field geology, satellite geodesy, GNSS (including low-cost short baseline installations), and terrestrial laser scanning (TLS). Sequences of earthquakes of mid to high magnitude 6 are common in historical and seismological records in Italy and other similar tectonic settings globally. Multi-fault rupture during these sequences can occur in seconds, as in the M 6.9 1980 Irpinia earthquake, or can span days, months, or years (e.g. the 1703 Norcia-L'Aquila sequence). It is critical to determine why the causative faults in the 2016 sequence did not rupture simultaneously, and how this relates to fault segmentation and structural barriers. This is the first sequence of this kind to be observed using modern geodetic techniques, and only with all of the datasets combined can we begin to understand how and why the sequence evolved in time and space. We show that earthquake rupture both broke through structural barriers that were thought to exist, but was also inhibited by a previously unknown structure. We will also discuss the logistical challenges in generating datasets on the time-evolving sequence, and show how rapid response and international collaboration within the Open EMERGEO Working Group was critical for gaining a complete picture of the ongoing activity.

  17. Identification and characterization of Theileria ovis surface protein (ToSp) resembled TaSp in Theileria annulata.

    PubMed

    Shayan, P; Jafari, S; Fattahi, R; Ebrahimzade, E; Amininia, N; Changizi, E

    2016-05-01

    Ovine theileriosis is an important hemoprotozoal disease of sheep and goats in tropical and subtropical regions which caused high economic loses in the livestock industry. Theileria annulata surface protein (TaSp) was used previously as a tool for serological analysis in livestock. Since the amino acid sequences of TaSp is, at least, in part very conserved in T. annulata, Theileria lestoquardi and Theileria china I and II, it is very important to determine the amino acid sequence of this protein in Theileria ovis as well, to avoid false interpretation of serological data based on this protein in small animal. In the present study, the nucleotide sequence and amino acid sequence of T. ovis surface protein (ToSp) were determined. The comparison of the nucleotide sequence of ToSp showed 96, 96, 99, and 86 % homology to the corresponding nucleotide sequence of TaSp genes by T. annulata, T. China I, T. China II and T. lestoquardi, previously registered in GenBank under accession nos. AJ316260.1, AY274329.1, DQ120058.1, and EF092924.1 respectively. The amino acid sequence analysis showed 95, 81, 98 and 70 % homology to the corresponding amino acid sequence of T. annulata, T chinaI, T china II and T. lestoquardi, registered in GenBank under accession nos. CAC87478.1, AAP36993.1, AAZ30365.1 and AAP36999.11, respectively. Interestingly, in contrast to the C terminus, a significant difference in amino acid sequence in the N teminus of the ToSp protein could be determined compared to the other known corresponding TaSp sequences, which make this region attractive for designing of a suitable tool for serological diagnosis.

  18. Short-read, high-throughput sequencing technology for STR genotyping

    PubMed Central

    Bornman, Daniel M.; Hester, Mark E.; Schuetter, Jared M.; Kasoji, Manjula D.; Minard-Smith, Angela; Barden, Curt A.; Nelson, Scott C.; Godbold, Gene D.; Baker, Christine H.; Yang, Boyu; Walther, Jacquelyn E.; Tornes, Ivan E.; Yan, Pearlly S.; Rodriguez, Benjamin; Bundschuh, Ralf; Dickens, Michael L.; Young, Brian A.; Faith, Seth A.

    2013-01-01

    DNA-based methods for human identification principally rely upon genotyping of short tandem repeat (STR) loci. Electrophoretic-based techniques for variable-length classification of STRs are universally utilized, but are limited in that they have relatively low throughput and do not yield nucleotide sequence information. High-throughput sequencing technology may provide a more powerful instrument for human identification, but is not currently validated for forensic casework. Here, we present a systematic method to perform high-throughput genotyping analysis of the Combined DNA Index System (CODIS) STR loci using short-read (150 bp) massively parallel sequencing technology. Open source reference alignment tools were optimized to evaluate PCR-amplified STR loci using a custom designed STR genome reference. Evaluation of this approach demonstrated that the 13 CODIS STR loci and amelogenin (AMEL) locus could be accurately called from individual and mixture samples. Sensitivity analysis showed that as few as 18,500 reads, aligned to an in silico referenced genome, were required to genotype an individual (>99% confidence) for the CODIS loci. The power of this technology was further demonstrated by identification of variant alleles containing single nucleotide polymorphisms (SNPs) and the development of quantitative measurements (reads) for resolving mixed samples. PMID:25621315

  19. Bacteroides fragilis mobilizable transposon Tn5520 requires a 71 base pair origin of transfer sequence and a single mobilization protein for relaxosome formation during conjugation.

    PubMed

    Vedantam, Gayatri; Knopf, Sarah; Hecht, David W

    2006-01-01

    Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.

  20. Cloning, analysis and functional annotation of expressed sequence tags from the Earthworm Eisenia fetida

    PubMed Central

    Pirooznia, Mehdi; Gong, Ping; Guan, Xin; Inouye, Laura S; Yang, Kuan; Perkins, Edward J; Deng, Youping

    2007-01-01

    Background Eisenia fetida, commonly known as red wiggler or compost worm, belongs to the Lumbricidae family of the Annelida phylum. Little is known about its genome sequence although it has been extensively used as a test organism in terrestrial ecotoxicology. In order to understand its gene expression response to environmental contaminants, we cloned 4032 cDNAs or expressed sequence tags (ESTs) from two E. fetida libraries enriched with genes responsive to ten ordnance related compounds using suppressive subtractive hybridization-PCR. Results A total of 3144 good quality ESTs (GenBank dbEST accession number EH669363–EH672369 and EL515444–EL515580) were obtained from the raw clone sequences after cleaning. Clustering analysis yielded 2231 unique sequences including 448 contigs (from 1361 ESTs) and 1783 singletons. Comparative genomic analysis showed that 743 or 33% of the unique sequences shared high similarity with existing genes in the GenBank nr database. Provisional function annotation assigned 830 Gene Ontology terms to 517 unique sequences based on their homology with the annotated genomes of four model organisms Drosophila melanogaster, Mus musculus, Saccharomyces cerevisiae, and Caenorhabditis elegans. Seven percent of the unique sequences were further mapped to 99 Kyoto Encyclopedia of Genes and Genomes pathways based on their matching Enzyme Commission numbers. All the information is stored and retrievable at a highly performed, web-based and user-friendly relational database called EST model database or ESTMD version 2. Conclusion The ESTMD containing the sequence and annotation information of 4032 E. fetida ESTs is publicly accessible at . PMID:18047730

  1. In-silico and in-vivo analyses of EST databases unveil conserved miRNAs from Carthamus tinctorius and Cynara cardunculus

    PubMed Central

    2012-01-01

    Background MicroRNAs (miRNAs) are small RNAs (21-24 bp) providing an RNA-based system of gene regulation highly conserved in plants and animals. In plants, miRNAs control mRNA degradation or restrain translation, affecting development and responses to stresses. Plant miRNAs show imperfect but extensive complementarity to mRNA targets, making their computational prediction possible, useful when data mining is applied on different species. In this study we used a comparative approach to identify both miRNAs and their targets, in artichoke and safflower. Results Two complete expressed sequence tags (ESTs) datasets from artichoke (3.6·104 entries) and safflower (4.2·104), were analysed with a bioinformatic pipeline and in vitro experiments, identifying 17 potential miRNAs. For each EST, using RNAhybrid program and 953 non redundant miRNA mature sequences, available in mirBase as reference, we searched matching putative targets. 8730 out of 42011 ESTs from safflower and 7145 of 36323 ESTs from artichoke showed at least one predicted miRNA target. BLAST analysis showed that 75% of all ESTs shared at least a common homologous region (E-value < 10-4) and about 50% of these displayed 400 bp or longer aligned sequences as conserved homologous/orthologous (COS) regions. 960 and 890 ESTs of safflower and artichoke organized in COS shared 79 different miRNA targets, considered functionally conserved, and statistically significant when compared with random sequences (signal to noise ratio > 2 and specificity ≥ 0.85). Four highly significant miRNAs selected from in silico data were experimentally validated in globe artichoke leaves. Conclusions Mature miRNAs and targets were predicted within EST sequences of safflower and artichoke. Most of the miRNA targets appeared highly/moderately conserved, highlighting an important and conserved function. In this study we introduce a stringent parameter for the comparative sequence analysis, represented by the identification of the same target in the COS region. After statistical analysis 79 targets, found on the COS regions and belonging to 60 miRNA families, have a signal to noise ratio > 2, with ≥ 0.85 specificity. The putative miRNAs identified belong to 55 dicotyledon plants and to 24 families only in monocotyledon. PMID:22536958

  2. High-Molecular-Mass Multi-c-Heme Cytochromes from Methylococcus capsulatus Bath†

    PubMed Central

    Bergmann, David J.; Zahn, James A.; DiSpirito, Alan A.

    1999-01-01

    The polypeptide and structural gene for a high-molecular-mass c-type cytochrome, cytochrome c553O, was isolated from the methanotroph Methylococcus capsulatus Bath. Cytochrome c553O is a homodimer with a subunit molecular mass of 124,350 Da and an isoelectric point of 6.0. The heme c concentration was estimated to be 8.2 ± 0.4 mol of heme c per subunit. The electron paramagnetic resonance spectrum showed the presence of multiple low spin, S = 1/2, hemes. A degenerate oligonucleotide probe synthesized based on the N-terminal amino acid sequence of cytochrome c553O was used to identify a DNA fragment from M. capsulatus Bath that contains occ, the gene encoding cytochrome c553O. occ is part of a gene cluster which contains three other open reading frames (ORFs). ORF1 encodes a putative periplasmic c-type cytochrome with a molecular mass of 118,620 Da that shows approximately 40% amino acid sequence identity with occ and contains nine c-heme-binding motifs. ORF3 encodes a putative periplasmic c-type cytochrome with a molecular mass of 94,000 Da and contains seven c-heme-binding motifs but shows no sequence homology to occ or ORF1. ORF4 encodes a putative 11,100-Da protein. The four ORFs have no apparent similarity to any proteins in the GenBank database. The subunit molecular masses, arrangement and number of hemes, and amino acid sequences demonstrate that cytochrome c553O and the gene products of ORF1 and ORF3 constitute a new class of c-type cytochrome. PMID:9922265

  3. 'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

    PubMed

    Eichmann, Cordula; Parson, Walther

    2008-09-01

    The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

  4. [High resolution melting analysis for detecting of JAK2V617F mutation in patients with myeloproliferative neoplasms].

    PubMed

    Chen, Hai-Hua; Yang, Ji-Long; Lu, Hui-Fang; Zhou, Wei-Jun; Yao, Fei; Deng, Lan

    2014-02-01

    This study was purposed to investigate the feasibility of high resolution melting (HRM) in the detection of JAK2V617F mutation in patients with myeloproliferative neoplasm (MPN). The 29 marrow samples randomly selected from patients with clinically diagnosed MPN from January 2008 to January 2011 were detected by HRM method. The results of HRM analysis were compared with that detected by allele specific polymerase chain reaction (AS-PCR) and DNA direct sequencing. The results showed that the JAK2V617F mutations were detected in 11 (37.9%, 11/29) cases by HRM, and its comparability with the direct sequencing result was 100%. While the consistency of AS-PCR with the direct sequencing was moderate (Kappa = 0.179, P = 0.316). It is concluded that the HRM analysis may be an optimal method for clinical screening of JAK2V617F mutation due to its simplicity and promptness with a high specificity.

  5. [MRI monitoring of autologous hyaline cartilage grafts in the knee joint: a follow-up study over 12 months].

    PubMed

    Müller-Horvat, C; Schick, F; Claussen, C D; Grönewäller, E

    2004-12-01

    To evaluate the suitability of different MR sequences for monitoring the stage of maturation of hyaline cartilage grafts in the knee joint and the early detection of complications like hypertrophy. In addition, it was analyzed whether indirect MR arthrography can indicate debonding of the graft. MRI examinations were performed in 19 patients, aged 17 - 48 years, with autologous transplantation of a hyaline cartilage tissue graft after knee trauma. Examination dates were prior to transplantation to localize the defect, and 6 weeks, 3, 6 and 12 months after transplantation to control morphology and maturation of the autologous graft. Standard T2- and proton-density-weighted turbo spin echo (TSE) sequences and T1-weighted spin echo (SE) sequences were used, as well as gradient echo (GRE) sequences with and without magnetization transfer (MT) prepulses. In some cases, indirect MR arthrography was performed. Cartilage defect and the hyaline cartilage graft could be detected in all 19 patients. Hypertrophy of the graft could be found early in 3 patients and debonding in 1 patient. For depicting the graft a short time after surgery, T2-weighted TSE-sequences showed the best results. Six and 12 months after transplantation, spoiled 3D-GRE-sequences like FLASH3D (fast low angle shot) showed reduced artifacts due to magnetic residues from the surgery. Difference images from GRE-sequences with and without MT pulse provided high contrast between cartilage and surrounding tissue. The quantification of the MT effect showed an assimilation of the graft to the original cartilage within 12 months. Indirect MR arthrography showed subchondral contrast medium even 12 months after transplantation in 3 patients. MRI allows a reliable depiction of the hyaline graft and provides very early detection of complications like hypertrophy. The MT effect seems to be correlated with maturation of the graft and allows selective depiction of normal cartilage and engrafted cartilage.

  6. Canine distemper viral infection threatens the giant panda population in China.

    PubMed

    Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan

    2017-12-26

    We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas ( Ailuropoda melanoleuca ) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin ( H ) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population.

  7. Molecular mechanism for cadmium-induced anthocyanin accumulation in Azolla imbricata.

    PubMed

    Dai, Ling-Peng; Dong, Xin-Jiao; Ma, Hai-Hu

    2012-04-01

    Anthocyanins inducibly synthesized by Cd treatment showed high antioxidant activity and might be involved in internal detoxification mechanisms of Azolla imbricata against Cd toxicity. In order to understand anthocyanin biosynthesis mechanism during Cd stress, the cDNAs encoding chalcone synthase (CHS) and dihydroflavonol reductase (DFR), two key enzymes in the anthocyanin synthesis pathway, were isolated from A. imbricata. Deduced amino acid sequences of the cDNAs showed high homology to the sequences from other plants. Expression of AiDFR, and to a lesser extent AiCHS, was significantly induced in Cd treatment plant in comparison with the control. CHS and DFR enzymatic activities showed similar pattern changes with these genes expression during Cd stress. These results strongly indicate that Cd induced anthocyanin accumulation is probably mediated by up-regulation of structural genes including CHS and DFR, which might further increase the activities of enzymes encoded by these structural genes that control the anthocyanin biosynthetic steps. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Canine distemper viral infection threatens the giant panda population in China

    PubMed Central

    Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan

    2017-01-01

    We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas (Ailuropoda melanoleuca) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin (H) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population. PMID:29371956

  9. Sharing of photobionts in sympatric populations of Thamnolia and Cetraria lichens: evidence from high-throughput sequencing.

    PubMed

    Onuț-Brännström, Ioana; Benjamin, Mitchell; Scofield, Douglas G; Heiðmarsson, Starri; Andersson, Martin G I; Lindström, Eva S; Johannesson, Hanna

    2018-03-13

    In this study, we explored the diversity of green algal symbionts (photobionts) in sympatric populations of the cosmopolitan lichen-forming fungi Thamnolia and Cetraria. We sequenced with both Sanger and Ion Torrent High-Throughput Sequencing technologies the photobiont ITS-region of 30 lichen thalli from two islands: Iceland and Öland. While Sanger recovered just one photobiont genotype from each thallus, the Ion Torrent data recovered 10-18 OTUs for each pool of 5 lichen thalli, suggesting that individual lichens can contain heterogeneous photobiont populations. Both methods showed evidence for photobiont sharing between Thamnolia and Cetraria on Iceland. In contrast, our data suggest that on Öland the two mycobionts associate with distinct photobiont communities, with few shared OTUs revealed by Ion Torrent sequencing. Furthermore, by comparing our sequences with public data, we identified closely related photobionts from geographically distant localities. Taken together, we suggest that the photobiont composition in Thamnolia and Cetraria results from both photobiont-mycobiont codispersal and local acquisition during mycobiont establishment and/or lichen growth. We hypothesize that this is a successful strategy for lichens to be flexible in the use of the most adapted photobiont for the environment.

  10. Draft genome sequence of the silver pomfret fish, Pampus argenteus.

    PubMed

    AlMomin, Sabah; Kumar, Vinod; Al-Amad, Sami; Al-Hussaini, Mohsen; Dashti, Talal; Al-Enezi, Khaznah; Akbar, Abrar

    2016-01-01

    Silver pomfret, Pampus argenteus, is a fish species from coastal waters. Despite its high commercial value, this edible fish has not been sequenced. Hence, its genetic and genomic studies have been limited. We report the first draft genome sequence of the silver pomfret obtained using a Next Generation Sequencing (NGS) technology. We assembled 38.7 Gb of nucleotides into scaffolds of 350 Mb with N50 of about 1.5 kb, using high quality paired end reads. These scaffolds represent 63.7% of the estimated silver pomfret genome length. The newly sequenced and assembled genome has 11.06% repetitive DNA regions, and this percentage is comparable to that of the tilapia genome. The genome analysis predicted 16 322 genes. About 91% of these genes showed homology with known proteins. Many gene clusters were annotated to protein and fatty-acid metabolism pathways that may be important in the context of the meat texture and immune system developmental processes. The reference genome can pave the way for the identification of many other genomic features that could improve breeding and population-management strategies, and it can also help characterize the genetic diversity of P. argenteus.

  11. Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

    PubMed Central

    Yonetani, Yoshiteru; Kono, Hidetoshi

    2009-01-01

    Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

  12. BayesMotif: de novo protein sorting motif discovery from impure datasets.

    PubMed

    Hu, Jianjun; Zhang, Fan

    2010-01-18

    Protein sorting is the process that newly synthesized proteins are transported to their target locations within or outside of the cell. This process is precisely regulated by protein sorting signals in different forms. A major category of sorting signals are amino acid sub-sequences usually located at the N-terminals or C-terminals of protein sequences. Genome-wide experimental identification of protein sorting signals is extremely time-consuming and costly. Effective computational algorithms for de novo discovery of protein sorting signals is needed to improve the understanding of protein sorting mechanisms. We formulated the protein sorting motif discovery problem as a classification problem and proposed a Bayesian classifier based algorithm (BayesMotif) for de novo identification of a common type of protein sorting motifs in which a highly conserved anchor is present along with a less conserved motif regions. A false positive removal procedure is developed to iteratively remove sequences that are unlikely to contain true motifs so that the algorithm can identify motifs from impure input sequences. Experiments on both implanted motif datasets and real-world datasets showed that the enhanced BayesMotif algorithm can identify anchored sorting motifs from pure or impure protein sequence dataset. It also shows that the false positive removal procedure can help to identify true motifs even when there is only 20% of the input sequences containing true motif instances. We proposed BayesMotif, a novel Bayesian classification based algorithm for de novo discovery of a special category of anchored protein sorting motifs from impure datasets. Compared to conventional motif discovery algorithms such as MEME, our algorithm can find less-conserved motifs with short highly conserved anchors. Our algorithm also has the advantage of easy incorporation of additional meta-sequence features such as hydrophobicity or charge of the motifs which may help to overcome the limitations of PWM (position weight matrix) motif model.

  13. Leveraging genome-wide datasets to quantify the functional role of the anti-Shine-Dalgarno sequence in regulating translation efficiency.

    PubMed

    Hockenberry, Adam J; Pah, Adam R; Jewett, Michael C; Amaral, Luís A N

    2017-01-01

    Studies dating back to the 1970s established that sequence complementarity between the anti-Shine-Dalgarno (aSD) sequence on prokaryotic ribosomes and the 5' untranslated region of mRNAs helps to facilitate translation initiation. The optimal location of aSD sequence binding relative to the start codon, the full extents of the aSD sequence and the functional form of the relationship between aSD sequence complementarity and translation efficiency have not been fully resolved. Here, we investigate these relationships by leveraging the sequence diversity of endogenous genes and recently available genome-wide estimates of translation efficiency. We show that-after accounting for predicted mRNA structure-aSD sequence complementarity increases the translation of endogenous mRNAs by roughly 50%. Further, we observe that this relationship is nonlinear, with translation efficiency maximized for mRNAs with intermediate levels of aSD sequence complementarity. The mechanistic insights that we observe are highly robust: we find nearly identical results in multiple datasets spanning three distantly related bacteria. Further, we verify our main conclusions by re-analysing a controlled experimental dataset. © 2017 The Authors.

  14. Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †

    PubMed Central

    Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary

    2008-01-01

    Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877

  15. Comparative analysis of the prion protein gene sequences in African lion.

    PubMed

    Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming

    2006-10-01

    The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.

  16. Evaluation of the Bacterial Diversity in the Human Tongue Coating Based on Genus-Specific Primers for 16S rRNA Sequencing.

    PubMed

    Sun, Beili; Zhou, Dongrui; Tu, Jing; Lu, Zuhong

    2017-01-01

    The characteristics of tongue coating are very important symbols for disease diagnosis in traditional Chinese medicine (TCM) theory. As a habitat of oral microbiota, bacteria on the tongue dorsum have been proved to be the cause of many oral diseases. The high-throughput next-generation sequencing (NGS) platforms have been widely applied in the analysis of bacterial 16S rRNA gene. We developed a methodology based on genus-specific multiprimer amplification and ligation-based sequencing for microbiota analysis. In order to validate the efficiency of the approach, we thoroughly analyzed six tongue coating samples from lung cancer patients with different TCM types, and more than 600 genera of bacteria were detected by this platform. The results showed that ligation-based parallel sequencing combined with enzyme digestion and multiamplification could expand the effective length of sequencing reads and could be applied in the microbiota analysis.

  17. Comparative sequence analysis of B5R gene of zoonotic buffalo pox virus isolates with other orthopoxviruses.

    PubMed

    Chandranaik, B M; Singh, Raj Kumar; Hosamani, Mahusudan; Krishnappa, Giriappa; Harish, Balur R; Chethana, C S; Renukaprasad, C

    2011-02-01

    The present paper describes the isolation of buffalo pox virus from scab lesions and its molecular characterization through B5R gene sequencing. During our study, pustular pox lesions were observed on the teats and mammary parenchyma of cattle and buffaloes, and the disease was of significant zoonotic importance since similar lesions were produced on the hands, legs, and face of people in close contact with the affected animals. The collected scab materials were subjected for virus isolation in 9-11-day-old chicken embryos by the chorioallontoic membrane route and in the Vero cell line. The virus was confirmed by a sensitive and rapid diagnostic polymerase chain reaction using the primers that amplify "A type inclusion" gene, and further, B5R gene of the virus was sequenced and compared with the corresponding sequences of other orthopoxviruses. The results showed high sequence homology of our isolates with other orthopoxviruses.

  18. Molecular design of sequence specific DNA alkylating agents.

    PubMed

    Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi

    2009-01-01

    Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.

  19. Short Term Reproducibility of a High Contrast 3-D Isotropic Optic Nerve Imaging Sequence in Healthy Controls.

    PubMed

    Harrigan, Robert L; Smith, Alex K; Mawn, Louise A; Smith, Seth A; Landman, Bennett A

    2016-02-27

    The optic nerve (ON) plays a crucial role in human vision transporting all visual information from the retina to the brain for higher order processing. There are many diseases that affect the ON structure such as optic neuritis, anterior ischemic optic neuropathy and multiple sclerosis. Because the ON is the sole pathway for visual information from the retina to areas of higher level processing, measures of ON damage have been shown to correlate well with visual deficits. Increased intracranial pressure has been shown to correlate with the size of the cerebrospinal fluid (CSF) surrounding the ON. These measures are generally taken at an arbitrary point along the nerve and do not account for changes along the length of the ON. We propose a high contrast and high-resolution 3-D acquired isotropic imaging sequence optimized for ON imaging. We have acquired scan-rescan data using the optimized sequence and a current standard of care protocol for 10 subjects. We show that this sequence has superior contrast-to-noise ratio to the current standard of care while achieving a factor of 11 higher resolution. We apply a previously published automatic pipeline to segment the ON and CSF sheath and measure the size of each individually. We show that these measures of ON size have lower short-term reproducibility than the population variance and the variability along the length of the nerve. We find that the proposed imaging protocol is (1) useful in detecting population differences and local changes and (2) a promising tool for investigating biomarkers related to structural changes of the ON.

  20. Short term reproducibility of a high contrast 3-D isotropic optic nerve imaging sequence in healthy controls

    NASA Astrophysics Data System (ADS)

    Harrigan, Robert L.; Smith, Alex K.; Mawn, Louise A.; Smith, Seth A.; Landman, Bennett A.

    2016-03-01

    The optic nerve (ON) plays a crucial role in human vision transporting all visual information from the retina to the brain for higher order processing. There are many diseases that affect the ON structure such as optic neuritis, anterior ischemic optic neuropathy and multiple sclerosis. Because the ON is the sole pathway for visual information from the retina to areas of higher level processing, measures of ON damage have been shown to correlate well with visual deficits. Increased intracranial pressure has been shown to correlate with the size of the cerebrospinal fluid (CSF) surrounding the ON. These measures are generally taken at an arbitrary point along the nerve and do not account for changes along the length of the ON. We propose a high contrast and high-resolution 3-D acquired isotropic imaging sequence optimized for ON imaging. We have acquired scan-rescan data using the optimized sequence and a current standard of care protocol for 10 subjects. We show that this sequence has superior contrast-to-noise ratio to the current standard of care while achieving a factor of 11 higher resolution. We apply a previously published automatic pipeline to segment the ON and CSF sheath and measure the size of each individually. We show that these measures of ON size have lower short- term reproducibility than the population variance and the variability along the length of the nerve. We find that the proposed imaging protocol is (1) useful in detecting population differences and local changes and (2) a promising tool for investigating biomarkers related to structural changes of the ON.

  1. de novo assembly and population genomic survey of natural yeast isolates with the Oxford Nanopore MinION sequencer.

    PubMed

    Istace, Benjamin; Friedrich, Anne; d'Agata, Léo; Faye, Sébastien; Payen, Emilie; Beluche, Odette; Caradec, Claudia; Davidas, Sabrina; Cruaud, Corinne; Liti, Gianni; Lemainque, Arnaud; Engelen, Stefan; Wincker, Patrick; Schacherer, Joseph; Aury, Jean-Marc

    2017-02-01

    Oxford Nanopore Technologies Ltd (Oxford, UK) have recently commercialized MinION, a small single-molecule nanopore sequencer, that offers the possibility of sequencing long DNA fragments from small genomes in a matter of seconds. The Oxford Nanopore technology is truly disruptive; it has the potential to revolutionize genomic applications due to its portability, low cost, and ease of use compared with existing long reads sequencing technologies. The MinION sequencer enables the rapid sequencing of small eukaryotic genomes, such as the yeast genome. Combined with existing assembler algorithms, near complete genome assemblies can be generated and comprehensive population genomic analyses can be performed. Here, we resequenced the genome of the Saccharomyces cerevisiae S288C strain to evaluate the performance of nanopore-only assemblers. Then we de novo sequenced and assembled the genomes of 21 isolates representative of the S. cerevisiae genetic diversity using the MinION platform. The contiguity of our assemblies was 14 times higher than the Illumina-only assemblies and we obtained one or two long contigs for 65 % of the chromosomes. This high contiguity allowed us to accurately detect large structural variations across the 21 studied genomes. Because of the high completeness of the nanopore assemblies, we were able to produce a complete cartography of transposable elements insertions and inspect structural variants that are generally missed using a short-read sequencing strategy. Our analyses show that the Oxford Nanopore technology is already usable for de novo sequencing and assembly; however, non-random errors in homopolymers require polishing the consensus using an alternate sequencing technology. © The Author 2017. Published by Oxford University Press.

  2. Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses.

    PubMed

    Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A; Janke, Axel

    2015-05-27

    The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. de novo assembly and population genomic survey of natural yeast isolates with the Oxford Nanopore MinION sequencer

    PubMed Central

    Istace, Benjamin; Friedrich, Anne; d'Agata, Léo; Faye, Sébastien; Payen, Emilie; Beluche, Odette; Caradec, Claudia; Davidas, Sabrina; Cruaud, Corinne; Liti, Gianni; Lemainque, Arnaud; Engelen, Stefan; Wincker, Patrick; Schacherer, Joseph

    2017-01-01

    Abstract Background: Oxford Nanopore Technologies Ltd (Oxford, UK) have recently commercialized MinION, a small single-molecule nanopore sequencer, that offers the possibility of sequencing long DNA fragments from small genomes in a matter of seconds. The Oxford Nanopore technology is truly disruptive; it has the potential to revolutionize genomic applications due to its portability, low cost, and ease of use compared with existing long reads sequencing technologies. The MinION sequencer enables the rapid sequencing of small eukaryotic genomes, such as the yeast genome. Combined with existing assembler algorithms, near complete genome assemblies can be generated and comprehensive population genomic analyses can be performed. Results: Here, we resequenced the genome of the Saccharomyces cerevisiae S288C strain to evaluate the performance of nanopore-only assemblers. Then we de novo sequenced and assembled the genomes of 21 isolates representative of the S. cerevisiae genetic diversity using the MinION platform. The contiguity of our assemblies was 14 times higher than the Illumina-only assemblies and we obtained one or two long contigs for 65 % of the chromosomes. This high contiguity allowed us to accurately detect large structural variations across the 21 studied genomes. Conclusion: Because of the high completeness of the nanopore assemblies, we were able to produce a complete cartography of transposable elements insertions and inspect structural variants that are generally missed using a short-read sequencing strategy. Our analyses show that the Oxford Nanopore technology is already usable for de novo sequencing and assembly; however, non-random errors in homopolymers require polishing the consensus using an alternate sequencing technology. PMID:28369459

  4. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

    PubMed Central

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

  5. Complementary DNA cloning, sequence analysis, and tissue transcription profile of a novel U2AF2 gene from the Chinese Banna mini-pig inbred line.

    PubMed

    Wang, S Y; Huo, J L; Miao, Y W; Cheng, W M; Zeng, Y Z

    2013-04-02

    U2 small nuclear RNA auxiliary factor 2 (U2AF2) is an important gene for pre-messenger RNA splicing in higher eukaryotes. In this study, the Banna mini-pig inbred line (BMI) U2AF2 coding sequence (CDS) was cloned, sequenced, and characterized. The U2AF2 complete CDS was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) technique based on the conserved sequence information of cattle and known highly homologous swine expressed sequence tags. This novel gene was deposited into the National Center for Biotechnology Information database (Accession No. JQ839267). Sequence analysis revealed that the BMI U2AF2 coding sequence consisted of 1416 bp and encoded 471 amino acids with a molecular weight of 53.12 kDa. The protein sequence has high sequence homology with U2AF65 of 6 species - Homo sapiens (100%), Equus caballus (100%), Canis lupus (100%), Macaca mulatta (99.8%), Bos taurus (74.4%), and Mus musculus (74.4%). The phylogenetic tree analysis revealed that BMI U2AF65 has a closer genetic relationship with B. taurus U2AF65 than with U2AF65 of E. caballus, C. lupus, M. mulatta, H. sapiens, and M. musculus. RT-PCR analysis showed that BMI U2AF2 was most highly expressed in the brain; moderately expressed in the spleen, lung, muscle, and skin; and weakly expressed in the liver, kidney, and ovary. Its expression was nearly silent in the spinal cord, nerve fiber, heart, stomach, pancreas, and intestine. Three microRNA target sites were predicted in the CDS of BMI U2AF2 messenger RNA. Our results establish a foundation for further insight into this swine gene.

  6. High-Accuracy HLA Type Inference from Whole-Genome Sequencing Data Using Population Reference Graphs.

    PubMed

    Dilthey, Alexander T; Gourraud, Pierre-Antoine; Mentzer, Alexander J; Cereb, Nezih; Iqbal, Zamin; McVean, Gil

    2016-10-01

    Genetic variation at the Human Leucocyte Antigen (HLA) genes is associated with many autoimmune and infectious disease phenotypes, is an important element of the immunological distinction between self and non-self, and shapes immune epitope repertoires. Determining the allelic state of the HLA genes (HLA typing) as a by-product of standard whole-genome sequencing data would therefore be highly desirable and enable the immunogenetic characterization of samples in currently ongoing population sequencing projects. Extensive hyperpolymorphism and sequence similarity between the HLA genes, however, pose problems for accurate read mapping and make HLA type inference from whole-genome sequencing data a challenging problem. We describe how to address these challenges in a Population Reference Graph (PRG) framework. First, we construct a PRG for 46 (mostly HLA) genes and pseudogenes, their genomic context and their characterized sequence variants, integrating a database of over 10,000 known allele sequences. Second, we present a sequence-to-PRG paired-end read mapping algorithm that enables accurate read mapping for the HLA genes. Third, we infer the most likely pair of underlying alleles at G group resolution from the IMGT/HLA database at each locus, employing a simple likelihood framework. We show that HLA*PRG, our algorithm, outperforms existing methods by a wide margin. We evaluate HLA*PRG on six classical class I and class II HLA genes (HLA-A, -B, -C, -DQA1, -DQB1, -DRB1) and on a set of 14 samples (3 samples with 2 x 100bp, 11 samples with 2 x 250bp Illumina HiSeq data). Of 158 alleles tested, we correctly infer 157 alleles (99.4%). We also identify and re-type two erroneous alleles in the original validation data. We conclude that HLA*PRG for the first time achieves accuracies comparable to gold-standard reference methods from standard whole-genome sequencing data, though high computational demands (currently ~30-250 CPU hours per sample) remain a significant challenge to practical application.

  7. High-Accuracy HLA Type Inference from Whole-Genome Sequencing Data Using Population Reference Graphs

    PubMed Central

    Dilthey, Alexander T.; Gourraud, Pierre-Antoine; McVean, Gil

    2016-01-01

    Genetic variation at the Human Leucocyte Antigen (HLA) genes is associated with many autoimmune and infectious disease phenotypes, is an important element of the immunological distinction between self and non-self, and shapes immune epitope repertoires. Determining the allelic state of the HLA genes (HLA typing) as a by-product of standard whole-genome sequencing data would therefore be highly desirable and enable the immunogenetic characterization of samples in currently ongoing population sequencing projects. Extensive hyperpolymorphism and sequence similarity between the HLA genes, however, pose problems for accurate read mapping and make HLA type inference from whole-genome sequencing data a challenging problem. We describe how to address these challenges in a Population Reference Graph (PRG) framework. First, we construct a PRG for 46 (mostly HLA) genes and pseudogenes, their genomic context and their characterized sequence variants, integrating a database of over 10,000 known allele sequences. Second, we present a sequence-to-PRG paired-end read mapping algorithm that enables accurate read mapping for the HLA genes. Third, we infer the most likely pair of underlying alleles at G group resolution from the IMGT/HLA database at each locus, employing a simple likelihood framework. We show that HLA*PRG, our algorithm, outperforms existing methods by a wide margin. We evaluate HLA*PRG on six classical class I and class II HLA genes (HLA-A, -B, -C, -DQA1, -DQB1, -DRB1) and on a set of 14 samples (3 samples with 2 x 100bp, 11 samples with 2 x 250bp Illumina HiSeq data). Of 158 alleles tested, we correctly infer 157 alleles (99.4%). We also identify and re-type two erroneous alleles in the original validation data. We conclude that HLA*PRG for the first time achieves accuracies comparable to gold-standard reference methods from standard whole-genome sequencing data, though high computational demands (currently ~30–250 CPU hours per sample) remain a significant challenge to practical application. PMID:27792722

  8. A novel, highly divergent ssDNA virus identified in Brazil infecting apple, pear and grapevine.

    PubMed

    Basso, Marcos Fernando; da Silva, José Cleydson Ferreira; Fajardo, Thor Vinícius Martins; Fontes, Elizabeth Pacheco Batista; Zerbini, Francisco Murilo

    2015-12-02

    Fruit trees of temperate and tropical climates are of great economical importance worldwide and several viruses have been reported affecting their productivity and longevity. Fruit trees of different Brazilian regions displaying virus-like symptoms were evaluated for infection by circular DNA viruses. Seventy-four fruit trees were sampled and a novel, highly divergent, monopartite circular ssDNA virus was cloned from apple, pear and grapevine trees. Forty-five complete viral genomes were sequenced, with a size of approx. 3.4 kb and organized into five ORFs. Deduced amino acid sequences showed identities in the range of 38% with unclassified circular ssDNA viruses, nanoviruses and alphasatellites (putative Replication-associated protein, Rep), and begomo-, curto- and mastreviruses (putative coat protein, CP, and movement protein, MP). A large intergenic region contains a short palindromic sequence capable of forming a hairpin-like structure with the loop sequence TAGTATTAC, identical to the conserved nonanucleotide of circoviruses, nanoviruses and alphasatellites. Recombination events were not detected and phylogenetic analysis showed a relationship with circo-, nano- and geminiviruses. PCR confirmed the presence of this novel ssDNA virus in field plants. Infectivity tests using the cloned viral genome confirmed its ability to infect apple and pear tree seedlings, but not Nicotiana benthamiana. The name "Temperate fruit decay-associated virus" (TFDaV) is proposed for this novel virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Resolving the phylogenetic position of Darwin's extinct ground sloth (Mylodon darwinii) using mitogenomic and nuclear exon data.

    PubMed

    Delsuc, Frédéric; Kuch, Melanie; Gibb, Gillian C; Hughes, Jonathan; Szpak, Paul; Southon, John; Enk, Jacob; Duggan, Ana T; Poinar, Hendrik N

    2018-05-16

    Mylodon darwinii is the extinct giant ground sloth named after Charles Darwin, who first collected its remains in South America. We have successfully obtained a high-quality mitochondrial genome at 99-fold coverage using an Illumina shotgun sequencing of a 12 880-year-old bone fragment from Mylodon Cave in Chile. Low level of DNA damage showed that this sample was exceptionally well preserved for an ancient subfossil, probably the result of the dry and cold conditions prevailing within the cave. Accordingly, taxonomic assessment of our shotgun metagenomic data showed a very high percentage of endogenous DNA with 22% of the assembled metagenomic contigs assigned to Xenarthra. Additionally, we enriched over 15 kb of sequence data from seven nuclear exons, using target sequence capture designed against a wide xenarthran dataset. Phylogenetic and dating analyses of the mitogenomic dataset including all extant species of xenarthrans and the assembled nuclear supermatrix unambiguously place Mylodon darwinii as the sister-group of modern two-fingered sloths, from which it diverged around 22 million years ago. These congruent results from both the mitochondrial and nuclear data support the diphyly of the two modern sloth lineages, implying the convergent evolution of their unique suspensory behaviour as an adaption to arboreality. Our results offer promising perspectives for whole-genome sequencing of this emblematic extinct taxon. © 2018 The Authors.

  10. Molecular characterization and phylogenetic analysis of infectious bursal disease viruses isolated from chicken in South China in 2011.

    PubMed

    Liu, Di; Zhang, Xiang-Bin; Yan, Zhuan-Qiang; Chen, Feng; Ji, Jun; Qin, Jian-Ping; Li, Hai-Yan; Lu, Jun-Peng; Xue, Yu; Liu, Jia-Jia; Xie, Qing-Mei; Ma, Jing-Yun; Xue, Chun-Yi; Bee, Ying-Zuo

    2013-06-01

    Infectious bursal disease virus (IBDV) is a double-stranded RNA virus that causes immunosuppressive disease in young chickens. Thousands of cases of IBDV infection are reported each year in South China, and these infections can result in considerable economic losses to the poultry industry. To monitor variations of the virus during the outbreaks, 30 IBDVs were identified from vaccinated chicken flocks from nine provinces in South China in 2011. VP2 fragments from different virus strains were sequenced and analyzed by comparison with the published sequences of IBDV strains from China and around the world. Phylogenetic analysis of hypervariable regions of the VP2 (vVP2) gene showed that 29 of the isolates were very virulent (vv) IBDVs, and were closely related to vvIBDV strains from Europe and Asia. Alignment analysis of the deduced amino acid (aa) sequences of vVP2 showed the 29 vv isolates had high uniformity, indicated low variability and slow evolution of the virus. The non-vvIBDV isolate JX2-11 was associated with higher than expected mortality, and had high deduced aa sequence similarity (99.2 %) with the attenuated vaccine strain B87 (BJ). The present study has demonstrated the continued circulation of IBDV strains in South China, and emphasizes the importance of reinforcing IBDV surveillance.

  11. Conservation of a pH-sensitive structure in the C-terminal region of spider silk extends across the entire silk gene family.

    PubMed

    Strickland, Michelle; Tudorica, Victor; Řezáč, Milan; Thomas, Neil R; Goodacre, Sara L

    2018-06-01

    Spiders produce multiple silks with different physical properties that allow them to occupy a diverse range of ecological niches, including the underwater environment. Despite this functional diversity, past molecular analyses show a high degree of amino acid sequence similarity between C-terminal regions of silk genes that appear to be independent of the physical properties of the resulting silks; instead, this domain is crucial to the formation of silk fibers. Here, we present an analysis of the C-terminal domain of all known types of spider silk and include silk sequences from the spider Argyroneta aquatica, which spins the majority of its silk underwater. Our work indicates that spiders have retained a highly conserved mechanism of silk assembly, despite the extraordinary diversification of species, silk types and applications of silk over 350 million years. Sequence analysis of the silk C-terminal domain across the entire gene family shows the conservation of two uncommon amino acids that are implicated in the formation of a salt bridge, a functional bond essential to protein assembly. This conservation extends to the novel sequences isolated from A. aquatica. This finding is relevant to research regarding the artificial synthesis of spider silk, suggesting that synthesis of all silk types will be possible using a single process.

  12. Molecular Detection of Rickettsia felis in Different Flea Species from Caldas, Colombia

    PubMed Central

    Ramírez-Hernández, Alejandro; Montoya, Viviana; Martínez, Alejandra; Pérez, Jorge E.; Mercado, Marcela; de la Ossa, Alberto; Vélez, Carolina; Estrada, Gloria; Correa, Maria I.; Duque, Laura; Ariza, Juan S.; Henao, Cesar; Valbuena, Gustavo; Hidalgo, Marylin

    2013-01-01

    Rickettsioses caused by Rickettsia felis are an emergent global threat. Historically, the northern region of the province of Caldas in Colombia has reported murine typhus cases, and recently, serological studies confirmed high seroprevalence for both R. felis and R. typhi. In the present study, fleas from seven municipalities were collected from dogs, cats, and mice. DNA was extracted and amplified by polymerase chain reaction (PCR) to identify gltA, ompB, and 17kD genes. Positive samples were sequenced to identify the species of Rickettsia. Of 1,341 fleas, Ctenocephalides felis was the most prevalent (76.7%). Positive PCR results in the three genes were evidenced in C. felis (minimum infection rates; 5.3%), C. canis (9.2%), and Pulex irritans (10.0%). Basic Local Alignment Search Tool (BLAST) analyses of sequences showed high identity values (> 98%) with R. felis, and all were highly related by phylogenetic analyses. This work shows the first detection of R. felis in fleas collected from animals in Colombia. PMID:23878183

  13. A Method for Determining the Timing of Displaying the Speaker's Face and Captions for a Real-Time Speech-to-Caption System

    NASA Astrophysics Data System (ADS)

    Kuroki, Hayato; Ino, Shuichi; Nakano, Satoko; Hori, Kotaro; Ifukube, Tohru

    The authors of this paper have been studying a real-time speech-to-caption system using speech recognition technology with a “repeat-speaking” method. In this system, they used a “repeat-speaker” who listens to a lecturer's voice and then speaks back the lecturer's speech utterances into a speech recognition computer. The througoing system showed that the accuracy of the captions is about 97% in Japanese-Japanese conversion and the conversion time from voices to captions is about 4 seconds in English-English conversion in some international conferences. Of course it required a lot of costs to achieve these high performances. In human communications, speech understanding depends not only on verbal information but also on non-verbal information such as speaker's gestures, and face and mouth movements. So the authors found the idea to display information of captions and speaker's face movement images with a suitable way to achieve a higher comprehension after storing information once into a computer briefly. In this paper, we investigate the relationship of the display sequence and display timing between captions that have speech recognition errors and the speaker's face movement images. The results show that the sequence “to display the caption before the speaker's face image” improves the comprehension of the captions. The sequence “to display both simultaneously” shows an improvement only a few percent higher than the question sentence, and the sequence “to display the speaker's face image before the caption” shows almost no change. In addition, the sequence “to display the caption 1 second before the speaker's face shows the most significant improvement of all the conditions.

  14. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    NASA Astrophysics Data System (ADS)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  15. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    PubMed Central

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  16. Secondary structural analyses of ITS1 in Paramecium.

    PubMed

    Hoshina, Ryo

    2010-01-01

    The nuclear ribosomal RNA gene operon is interrupted by internal transcribed spacer (ITS) 1 and ITS2. Although the secondary structure of ITS2 has been widely investigated, less is known about ITS1 and its structure. In this study, the secondary structure of ITS1 sequences for Paramecium and other ciliates was predicted. Each Paramecium ITS1 forms an open loop with three helices, A through C. Helix B was highly conserved among Paramecium, and similar helices were found in other ciliates. A phylogenetic analysis using the ITS1 sequences showed high-resolution, implying that ITS1 is a good tool for species-level analyses.

  17. Concerted and nonconcerted evolution of the Hsp70 gene superfamily in two sibling species of nematodes.

    PubMed

    Nikolaidis, Nikolas; Nei, Masatoshi

    2004-03-01

    We have identified the Hsp70 gene superfamily of the nematode Caenorhabditis briggsae and investigated the evolution of these genes in comparison with Hsp70 genes from C. elegans, Drosophila, and yeast. The Hsp70 genes are classified into three monophyletic groups according to their subcellular localization, namely, cytoplasm (CYT), endoplasmic reticulum (ER), and mitochondria (MT). The Hsp110 genes can be classified into the polyphyletic CYT group and the monophyletic ER group. The different Hsp70 and Hsp110 groups appeared to evolve following the model of divergent evolution. This model can also explain the evolution of the ER and MT genes. On the other hand, the CYT genes are divided into heat-inducible and constitutively expressed genes. The constitutively expressed genes have evolved more or less following the birth-and-death process, and the rates of gene birth and gene death are different between the two nematode species. By contrast, some heat-inducible genes show an intraspecies phylogenetic clustering. This suggests that they are subject to sequence homogenization resulting from gene conversion-like events. In addition, the heat-inducible genes show high levels of sequence conservation in both intra-species and inter-species comparisons, and in most cases, amino acid sequence similarity is higher than nucleotide sequence similarity. This indicates that purifying selection also plays an important role in maintaining high sequence similarity among paralogous Hsp70 genes. Therefore, we suggest that the CYT heat-inducible genes have been subjected to a combination of purifying selection, birth-and-death process, and gene conversion-like events.

  18. Lelliottia aquatilis sp. nov., isolated from drinking water.

    PubMed

    Kämpfer, Peter; Glaeser, Stefanie P; Packroff, Gabriele; Behringer, Katja; Exner, Martin; Chakraborty, Trinad; Schmithausen, Ricarda M; Doijad, Swapnil

    2018-06-22

    Five beige-pigmented, oxidase-negative bacterial isolates, 6331-17 T , 6332-17, 6333-17, 6334-17 and 9827-07, isolated either from a drinking water storage reservoir or drinking water in 2006 and 2017 in Germany, were examined in detail applying by a polyphasic taxonomic approach. Cells of the isolates were rod-shaped and Gram-stain-negative. Comparison of the 16S rRNA gene sequences of these five isolates showed highest sequence similarities to Lelliottia amnigena (99.98 %) and Lelliottia nimipressuralis (99.99 %). Multilocus sequence analyses based on concatenated partial rpoB, gyrB, infB and atpD sequences confirmed the clustering of these isolates with Lelliottia species, but also revealed a clear distinction to the closest related type strains. Analysis of the genome sequences of these isolates indicated >70 % in silico DNA-DNA hybridization and high average nucleotide identities between strains. Nevertheless, they showed only <70 and <95 % similarity to the type strains of these two Lelliottia species. The fatty acid profiles of these isolates were very similar and consisted of the major fatty acids C16:0, C17 : 0cyclo, C15 : 0iso 2-OH/C16 : 1ω7c and C18 : 1ω7c. In addition, physiological/biochemical tests revealed high phenotypic similarity to each other. These cumulative data indicate that these isolates represent a novel Lelliottia species, for which the name Lelliottia aquatilis sp. nov. is proposed, with strain 6331-17 T (=CCM 8846 T =CIP 111609 T =LMG 30560 T ) as the type strain.

  19. Synchronous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment based on a zwitterionic copper (II) metal-organic framework.

    PubMed

    Qiu, Gui-Hua; Weng, Zi-Hua; Hu, Pei-Pei; Duan, Wen-Jun; Xie, Bao-Ping; Sun, Bin; Tang, Xiao-Yan; Chen, Jin-Xiang

    2018-04-01

    From a three-dimensional (3D) metal-organic framework (MOF) of {[Cu(Cmdcp)(phen)(H 2 O)] 2 ·9H 2 O} n (1, H 3 CmdcpBr = N-carboxymethyl-(3,5-dicarboxyl)pyridinium bromide, phen = phenanthroline), a sensitive and selective fluorescence sensor has been developed for the simultaneous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded microRNA-like (miRNA-like) fragment. The results from molecular dynamics simulation confirmed that MOF 1 absorbs carboxyfluorescein (FAM)-tagged and 5(6)-carboxyrhodamine, triethylammonium salt (ROX)-tagged probe ss-DNA (probe DNA, P-DNA) by π … π stacking and hydrogen bonding, as well as additional electrostatic interactions to form a sensing platform of P-DNAs@1 with quenched FAM and ROX fluorescence. In the presence of targeted ebolavirus conserved RNA sequences or ebolavirus-encoded miRNA-like fragment, the fluorophore-labeled P-DNA hybridizes with the analyte to give a P-DNA@RNA duplex and released from MOF 1, triggering a fluorescence recovery. Simultaneous detection of two target RNAs has also been realized by single and synchronous fluorescence analysis. The formed sensing platform shows high sensitivity for ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment with detection limits at the picomolar level and high selectivity without cross-reaction between the two probes. MOF 1 thus shows the potential as an effective fluorescent sensing platform for the synchronous detection of two ebolavirus-related sequences, and offer improved diagnostic accuracy of Ebola virus disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Primate amygdala neurons evaluate the progress of self-defined economic choice sequences

    PubMed Central

    Grabenhorst, Fabian; Hernadi, Istvan; Schultz, Wolfram

    2016-01-01

    The amygdala is a prime valuation structure yet its functions in advanced behaviors are poorly understood. We tested whether individual amygdala neurons encode a critical requirement for goal-directed behavior: the evaluation of progress during sequential choices. As monkeys progressed through choice sequences toward rewards, amygdala neurons showed phasic, gradually increasing responses over successive choice steps. These responses occurred in the absence of external progress cues or motor preplanning. They were often specific to self-defined sequences, typically disappearing during instructed control sequences with similar reward expectation. Their build-up rate reflected prospectively the forthcoming choice sequence, suggesting adaptation to an internal plan. Population decoding demonstrated a high-accuracy progress code. These findings indicate that amygdala neurons evaluate the progress of planned, self-defined behavioral sequences. Such progress signals seem essential for aligning stepwise choices with internal plans. Their presence in amygdala neurons may inform understanding of human conditions with amygdala dysfunction and deregulated reward pursuit. DOI: http://dx.doi.org/10.7554/eLife.18731.001 PMID:27731795

Top