Sample records for showed direct binding

  1. Direct Activation of Epac by Sulfonylurea is Isoform Selective

    PubMed Central

    Herbst, Katie J.; Coltharp, Carla; Amzel, L. Mario; Zhang, Jin

    2011-01-01

    Summary Commonly used as a treatment for Type II diabetes, sulfonylureas (SUs) stimulate insulin secretion from pancreatic β cells by binding to sulfonylurea receptors. Recently, SUs have been shown to also activate exchange protein directly activated by cAMP 2 (Epac2), however little is known about this molecular action. Using biosensor imaging and biochemical analysis, we show that SUs activate Epac2 and the downstream signaling via direct binding to Epac2. We further identify R447 of Epac2 to be critically involved in SU binding. This distinct binding site from cAMP points to a new mode of allosteric activation of Epac2. We also show that SUs selectively activate Epac2 isoform, but not the closely related Epac1, further establishing SUs as a new class of isoform-selective enzyme activators. PMID:21338921

  2. Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex*

    PubMed Central

    Douglas, Max E.

    2016-01-01

    Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly (“G1-like”) and high affinity recruitment when CMG assembly takes place (“S-phase-like”). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. PMID:26719337

  3. Single-molecule Imaging Analysis of Binding, Processive Movement, and Dissociation of Cellobiohydrolase Trichoderma reesei Cel6A and Its Domains on Crystalline Cellulose*

    PubMed Central

    Nakamura, Akihiko; Tasaki, Tomoyuki; Ishiwata, Daiki; Yamamoto, Mayuko; Okuni, Yasuko; Visootsat, Akasit; Maximilien, Morice; Noji, Hiroyuki; Uchiyama, Taku; Samejima, Masahiro; Igarashi, Kiyohiko; Iino, Ryota

    2016-01-01

    Trichoderma reesei Cel6A (TrCel6A) is a cellobiohydrolase that hydrolyzes crystalline cellulose into cellobiose. Here we directly observed the reaction cycle (binding, surface movement, and dissociation) of single-molecule intact TrCel6A, isolated catalytic domain (CD), cellulose-binding module (CBM), and CBM and linker (CBM-linker) on crystalline cellulose Iα. The CBM-linker showed a binding rate constant almost half that of intact TrCel6A, whereas those of the CD and CBM were only one-tenth of intact TrCel6A. These results indicate that the glycosylated linker region largely contributes to initial binding on crystalline cellulose. After binding, all samples showed slow and fast dissociations, likely caused by the two different bound states due to the heterogeneity of cellulose surface. The CBM showed much higher specificity to the high affinity site than to the low affinity site, whereas the CD did not, suggesting that the CBM leads the CD to the hydrophobic surface of crystalline cellulose. On the cellulose surface, intact molecules showed slow processive movements (8.8 ± 5.5 nm/s) and fast diffusional movements (30–40 nm/s), whereas the CBM-Linker, CD, and a catalytically inactive full-length mutant showed only fast diffusional movements. These results suggest that both direct binding and surface diffusion contribute to searching of the hydrolysable point of cellulose chains. The duration time constant for the processive movement was 7.7 s, and processivity was estimated as 68 ± 42. Our results reveal the role of each domain in the elementary steps of the reaction cycle and provide the first direct evidence of the processive movement of TrCel6A on crystalline cellulose. PMID:27609516

  4. Direct binding of F actin to the cytoplasmic domain of the alpha 2 integrin chain in vitro

    NASA Technical Reports Server (NTRS)

    Kieffer, J. D.; Plopper, G.; Ingber, D. E.; Hartwig, J. H.; Kupper, T. S.

    1995-01-01

    The transmembrane integrins have been shown to interact with the cytoskeleton via noncovalent binding between cytoplasmic domains (CDs) of integrin beta chains and various actin binding proteins within the focal adhesion complex. Direct or indirect integrin alpha chain CD binding to the actin cytoskeleton has not been reported. We show here that actin, as an abundant constituent of focal adhesion complex proteins isolated from fibroblasts, binds strongly and specifically to alpha 2 CD, but not to alpha 1 CD peptide. Similar specific binding to alpha 2 CD peptide was seen for highly purified F actin, free of putative actin-binding proteins. The bound complex of actin and peptide was visualized directly by coprecipitation, and actin binding was abrogated by removal of a five amino acid sequence from the alpha 2 CD peptide. Our findings may explain the earlier observation that, while integrins alpha 2 beta 1 and alpha 1 beta 1 both bind to collagen, only alpha 2 beta 1 can mediate contraction of extracellular collagen matrices.

  5. Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex.

    PubMed

    Douglas, Max E; Diffley, John F X

    2016-03-11

    Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly ("G1-like") and high affinity recruitment when CMG assembly takes place ("S-phase-like"). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. The Rice Resistance Protein Pair RGA4/RGA5 Recognizes the Magnaporthe oryzae Effectors AVR-Pia and AVR1-CO39 by Direct Binding[W][OA

    PubMed Central

    Cesari, Stella; Thilliez, Gaëtan; Ribot, Cécile; Chalvon, Véronique; Michel, Corinne; Jauneau, Alain; Rivas, Susana; Alaux, Ludovic; Kanzaki, Hiroyuki; Okuyama, Yudai; Morel, Jean-Benoit; Fournier, Elisabeth; Tharreau, Didier; Terauchi, Ryohei; Kroj, Thomas

    2013-01-01

    Resistance (R) proteins recognize pathogen avirulence (Avr) proteins by direct or indirect binding and are multidomain proteins generally carrying a nucleotide binding (NB) and a leucine-rich repeat (LRR) domain. Two NB-LRR protein-coding genes from rice (Oryza sativa), RGA4 and RGA5, were found to be required for the recognition of the Magnaporthe oryzae effector AVR1-CO39. RGA4 and RGA5 also mediate recognition of the unrelated M. oryzae effector AVR-Pia, indicating that the corresponding R proteins possess dual recognition specificity. For RGA5, two alternative transcripts, RGA5-A and RGA5-B, were identified. Genetic analysis showed that only RGA5-A confers resistance, while RGA5-B is inactive. Yeast two-hybrid, coimmunoprecipitation, and fluorescence resonance energy transfer–fluorescence lifetime imaging experiments revealed direct binding of AVR-Pia and AVR1-CO39 to RGA5-A, providing evidence for the recognition of multiple Avr proteins by direct binding to a single R protein. Direct binding seems to be required for resistance as an inactive AVR-Pia allele did not bind RGA5-A. A small Avr interaction domain with homology to the Avr recognition domain in the rice R protein Pik-1 was identified in the C terminus of RGA5-A. This reveals a mode of Avr protein recognition through direct binding to a novel, non-LRR interaction domain. PMID:23548743

  7. Controlled rotation of the F1-ATPase reveals differential and continuous binding changes for ATP synthesis

    PubMed Central

    Adachi, Kengo; Oiwa, Kazuhiro; Yoshida, Masasuke; Nishizaka, Takayuki; Kinosita, Kazuhiko

    2012-01-01

    F1-ATPase is an ATP-driven rotary molecular motor that synthesizes ATP when rotated in reverse. To elucidate the mechanism of ATP synthesis, we imaged binding and release of fluorescently labelled ADP and ATP while rotating the motor in either direction by magnets. Here we report the binding and release rates for each of the three catalytic sites for 360° of the rotary angle. We show that the rates do not significantly depend on the rotary direction, indicating ATP synthesis by direct reversal of the hydrolysis-driven rotation. ADP and ATP are discriminated in angle-dependent binding, but not in release. Phosphate blocks ATP binding at angles where ADP binding is essential for ATP synthesis. In synthesis rotation, the affinity for ADP increases by >104, followed by a shift to high ATP affinity, and finally the affinity for ATP decreases by >104. All these angular changes are gradual, implicating tight coupling between the rotor angle and site affinities. PMID:22929779

  8. Examining the neural correlates of active and passive forms of verbal-spatial binding in working memory.

    PubMed

    Grot, Stéphanie; Leclerc, Marie-Eve; Luck, David

    2018-05-23

    We designed an fMRI study to pinpoint the neural correlates of active and passive binding in working memory. Participants were instructed to memorize three words and three spatial locations. In the passive binding condition, words and spatial locations were directly presented as bound. Conversely, in the active binding condition, words and spatial locations were presented as separated, and participants were directed to intentionally create associations between them. Our results showed that participants performed better on passive binding relative to active binding. FMRI analysis revealed that both binding conditions induced greater activity within the hippocampus. Additionally, our analyses divulged regions specifically engaged in passive and active binding. Altogether, these data allow us to propose the hippocampus as a central candidate for working memory binding. When needed, a frontal-parietal network can contribute to the rearrangement of information. These findings may inform theories of working memory binding. Copyright © 2018. Published by Elsevier B.V.

  9. The PBX1 lupus susceptibility gene regulates CD44 expression

    PubMed Central

    Niu, Yuxin; Sengupta, Mayami; Titov, Anton A.; Choi, Seung-Chul; Morel, Laurence

    2017-01-01

    PBX1-d is novel splice isoform of pre-B-cell leukemia homeobox 1 (PBX1) that lacks its DNA-binding and Hox-binding domains, and functions as a dominant negative. We have shown that PBX1-d expression in CD4+ T cells is associated with systemic lupus erythematosus (SLE) in a mouse model as well as in human subjects. More specifically, PBX1-d expression leads to the production of autoreactive activated CD4+ T cells, a reduced frequency and function of Foxp3+ regulatory T (Treg) cells and an expansion of follicular helper T (Tfh) cells. Very little is known about the function of PBX1 in T cells, except that it directly regulates the expression of miRNAs associated with Treg and Tfh homeostasis. In the present study, we show that PBX1 directly regulated the expression of CD44, a marker of T cell activation. Two PBX1 binding sites in the promoter directly regulated CD44 expression, with PBX1-d driving a higher expression than the normal isoform PBX1-b. In addition, mutations in each of the two binding sites had different effects of PBX1-b and PBX1-d. Finally, we showed that an enhanced recruitment of co-factor MEIS by PBX1-d over PBX1-b, while there was no difference for co-factor PREP1 recruitment. Therefore, this study demonstrates that the lupus-associated PBX1-d isoform directly transactivates CD44, a marker of CD44 activation and memory, and that it has different DNA binding and co-factor recruitment relative to the normal isoform. Taken together, these results confirm that PBX1 directly regulates genes related to T cell activation and show that the lupus-associated isoform PBX1-d has unique molecular functions. PMID:28257976

  10. Direct membrane binding by bacterial actin MreB.

    PubMed

    Salje, Jeanne; van den Ent, Fusinita; de Boer, Piet; Löwe, Jan

    2011-08-05

    Bacterial actin MreB is one of the key components of the bacterial cytoskeleton. It assembles into short filaments that lie just underneath the membrane and organize the cell wall synthesis machinery. Here we show that MreB from both T. maritima and E. coli binds directly to cell membranes. This function is essential for cell shape determination in E. coli and is proposed to be a general property of many, if not all, MreBs. We demonstrate that membrane binding is mediated by a membrane insertion loop in TmMreB and by an N-terminal amphipathic helix in EcMreB and show that purified TmMreB assembles into double filaments on a membrane surface that can induce curvature. This, the first example of a membrane-binding actin filament, prompts a fundamental rethink of the structure and dynamics of MreB filaments within cells. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Color-motion feature-binding errors are mediated by a higher-order chromatic representation

    PubMed Central

    Shevell, Steven K.; Wang, Wei

    2017-01-01

    Peripheral and central moving objects of the same color may be perceived to move in the same direction even though peripheral objects have a different true direction of motion [Nature 429, 262 (2004)]. The perceived, illusory direction of peripheral motion is a color-motion feature-binding error. Recent work shows that such binding errors occur even without an exact color match between central and peripheral objects, and, moreover, the frequency of the binding errors in the periphery declines as the chromatic difference increases between the central and peripheral objects [J. Opt. Soc. Am. A 31, A60 (2014)]. This change in the frequency of binding errors with the chromatic difference raises the general question of the chromatic representation from which the difference is determined. Here, basic properties of the chromatic representation are tested to discover whether it depends on independent chromatic differences on the l and the s cardinal axes or, alternatively, on a more specific higher-order chromatic representation. Experimental tests compared the rate of feature-binding errors when the central and peripheral colors had the identical s chromaticity (so zero difference in s) and a fixed magnitude of l difference, while varying the identical s level in center and periphery (thus always keeping the s difference at zero). A chromatic representation based on independent l and s differences would result in the same frequency of color-motion binding errors at every s level. The results are contrary to this prediction, thus showing that the chromatic representation at the level of color-motion feature binding depends on a higherorder chromatic mechanism. PMID:26974945

  12. Andrographolide derivatives inhibit guanine nucleotide exchange and abrogate oncogenic Ras function

    PubMed Central

    Hocker, Harrison J.; Cho, Kwang-Jin; Chen, Chung-Ying K.; Rambahal, Nandini; Sagineedu, Sreenivasa Rao; Shaari, Khozirah; Stanslas, Johnson; Hancock, John F.; Gorfe, Alemayehu A.

    2013-01-01

    Aberrant signaling by oncogenic mutant rat sarcoma (Ras) proteins occurs in ∼15% of all human tumors, yet direct inhibition of Ras by small molecules has remained elusive. Recently, several small-molecule ligands have been discovered that directly bind Ras and inhibit its function by interfering with exchange factor binding. However, it is unclear whether, or how, these ligands could lead to drugs that act against constitutively active oncogenic mutant Ras. Using a dynamics-based pocket identification scheme, ensemble docking, and innovative cell-based assays, here we show that andrographolide (AGP)—a bicyclic diterpenoid lactone isolated from Andrographis paniculata—and its benzylidene derivatives bind to transient pockets on Kirsten-Ras (K-Ras) and inhibit GDP–GTP exchange. As expected for inhibitors of exchange factor binding, AGP derivatives reduced GTP loading of wild-type K-Ras in response to acute EGF stimulation with a concomitant reduction in MAPK activation. Remarkably, however, prolonged treatment with AGP derivatives also reduced GTP loading of, and signal transmission by, oncogenic mutant K-RasG12V. In sum, the combined analysis of our computational and cell biology results show that AGP derivatives directly bind Ras, block GDP–GTP exchange, and inhibit both wild-type and oncogenic K-Ras signaling. Importantly, our findings not only show that nucleotide exchange factors are required for oncogenic Ras signaling but also demonstrate that inhibiting nucleotide exchange is a valid approach to abrogating the function of oncogenic mutant Ras. PMID:23737504

  13. The basic leucine zipper domain of c-Jun functions in transcriptional activation through interaction with the N terminus of human TATA-binding protein-associated factor-1 (human TAF(II)250).

    PubMed

    Lively, Tricia N; Nguyen, Tuan N; Galasinski, Shelly K; Goodrich, James A

    2004-06-18

    We previously reported that c-Jun binds directly to the N-terminal 163 amino acids of Homo sapiens TATA-binding protein-associated factor-1 (hsTAF1), causing a derepression of transcription factor IID (TFIID)-driven transcription (Lively, T. N., Ferguson, H. A., Galasinski, S. K., Seto, A. G., and Goodrich, J. A. (2001) J. Biol. Chem. 276, 25582-25588). This region of hsTAF1 binds TATA-binding protein to repress TFIID DNA binding and transcription. Here we show that the basic leucine zipper domain of c-Jun, which allows for DNA binding and homodimerization, is necessary and sufficient for interaction with hsTAF1. Interestingly, the isolated basic leucine zipper domain of c-Jun was able to derepress TFIID-directed basal transcription in vitro. Moreover, when the N-terminal region of hsTAF1 was added to in vitro transcription reactions and overexpressed in cells, it blocked c-Jun activation. c-Fos, another basic leucine zipper protein, did not interact with hsTAF1, but c-Fos/c-Jun heterodimers did bind the N terminus of hsTAF1. Our studies show that, in addition to dimerization and DNA binding, the well characterized basic leucine zipper domain of c-Jun functions in transcriptional activation by binding to the N terminus of hsTAF1 to derepress transcription.

  14. Paced Reading in Semantic Dementia: Word Knowledge Contributes to Phoneme Binding in Rapid Speech Production

    ERIC Educational Resources Information Center

    Jefferies, Elizabeth; Grogan, John; Mapelli, Cristina; Isella, Valeria

    2012-01-01

    Patients with semantic dementia (SD) show deficits in phoneme binding in immediate serial recall: when attempting to reproduce a sequence of words that they no longer fully understand, they show frequent migrations of phonemes between items (e.g., cap, frog recalled as "frap, cog"). This suggests that verbal short-term memory emerges directly from…

  15. Color-motion feature-binding errors are mediated by a higher-order chromatic representation.

    PubMed

    Shevell, Steven K; Wang, Wei

    2016-03-01

    Peripheral and central moving objects of the same color may be perceived to move in the same direction even though peripheral objects have a different true direction of motion [Nature429, 262 (2004)10.1038/429262a]. The perceived, illusory direction of peripheral motion is a color-motion feature-binding error. Recent work shows that such binding errors occur even without an exact color match between central and peripheral objects, and, moreover, the frequency of the binding errors in the periphery declines as the chromatic difference increases between the central and peripheral objects [J. Opt. Soc. Am. A31, A60 (2014)JOAOD60740-323210.1364/JOSAA.31.000A60]. This change in the frequency of binding errors with the chromatic difference raises the general question of the chromatic representation from which the difference is determined. Here, basic properties of the chromatic representation are tested to discover whether it depends on independent chromatic differences on the l and the s cardinal axes or, alternatively, on a more specific higher-order chromatic representation. Experimental tests compared the rate of feature-binding errors when the central and peripheral colors had the identical s chromaticity (so zero difference in s) and a fixed magnitude of l difference, while varying the identical s level in center and periphery (thus always keeping the s difference at zero). A chromatic representation based on independent l and s differences would result in the same frequency of color-motion binding errors at everyslevel. The results are contrary to this prediction, thus showing that the chromatic representation at the level of color-motion feature binding depends on a higher-order chromatic mechanism.

  16. Plasmodium vivax Invasion of Human Erythrocytes Inhibited by Antibodies Directed against the Duffy Binding Protein

    PubMed Central

    Grimberg, Brian T; Udomsangpetch, Rachanee; Xainli, Jia; McHenry, Amy; Panichakul, Tasanee; Sattabongkot, Jetsumon; Cui, Liwang; Bockarie, Moses; Chitnis, Chetan; Adams, John; Zimmerman, Peter A; King, Christopher L

    2007-01-01

    Background Plasmodium vivax invasion requires interaction between the human Duffy antigen on the surface of erythrocytes and the P. vivax Duffy binding protein (PvDBP) expressed by the parasite. Given that Duffy-negative individuals are resistant and that Duffy-negative heterozygotes show reduced susceptibility to blood-stage infection, we hypothesized that antibodies directed against region two of P. vivax Duffy binding protein (PvDBPII) would inhibit P. vivax invasion of human erythrocytes. Methods and Findings Using a recombinant region two of the P. vivax Duffy binding protein (rPvDBPII), polyclonal antibodies were generated from immunized rabbits and affinity purified from the pooled sera of 14 P. vivax–exposed Papua New Guineans. It was determined by ELISA and by flow cytometry, respectively, that both rabbit and human antibodies inhibited binding of rPvDBPII to the Duffy antigen N-terminal region and to Duffy-positive human erythrocytes. Additionally, using immunofluorescent microscopy, the antibodies were shown to attach to native PvDBP on the apical end of the P. vivax merozoite. In vitro invasion assays, using blood isolates from individuals in the Mae Sot district of Thailand, showed that addition of rabbit anti-PvDBPII Ab or serum (antibodies against, or serum containing antibodies against, region two of the Plasmodium vivax Duffy binding protein) (1:100) reduced the number of parasite invasions by up to 64%, while pooled PvDBPII antisera from P. vivax–exposed people reduced P. vivax invasion by up to 54%. Conclusions These results show, for what we believe to be the first time, that both rabbit and human antibodies directed against PvDBPII reduce invasion efficiency of wild P. vivax isolated from infected patients, and suggest that a PvDBP-based vaccine may reduce human blood-stage P. vivax infection. PMID:18092885

  17. The PBX1 lupus susceptibility gene regulates CD44 expression.

    PubMed

    Niu, Yuxin; Sengupta, Mayami; Titov, Anton A; Choi, Seung-Chul; Morel, Laurence

    2017-05-01

    PBX1-d is novel splice isoform of pre-B-cell leukemia homeobox 1 (PBX1) that lacks its DNA-binding and Hox-binding domains, and functions as a dominant negative. We have shown that PBX1-d expression in CD4 + T cells is associated with systemic lupus erythematosus (SLE) in a mouse model as well as in human subjects. More specifically, PBX1-d expression leads to the production of autoreactive activated CD4+ T cells, a reduced frequency and function of Foxp3+ regulatory T (Treg) cells and an expansion of follicular helper T (Tfh) cells. Very little is known about the function of PBX1 in T cells, except that it directly regulates the expression of miRNAs associated with Treg and Tfh homeostasis. In the present study, we show that PBX1 directly regulated the expression of CD44, a marker of T cell activation. Two PBX1 binding sites in the promoter directly regulated CD44 expression, with PBX1-d driving a higher expression than the normal isoform PBX1-b. In addition, mutations in each of the two binding sites had different effects of PBX1-b and PBX1-d. Finally, we showed that an enhanced recruitment of co-factor MEIS by PBX1-d over PBX1-b, while there was no difference for co-factor PREP1 recruitment. Therefore, this study demonstrates that the lupus-associated PBX1-d isoform directly transactivates CD44, a marker of CD44 activation and memory, and that it has different DNA binding and co-factor recruitment relative to the normal isoform. Taken together, these results confirm that PBX1 directly regulates genes related to T cell activation and shows that the lupus-associated isoform PBX1-d has unique molecular functions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Common Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) Epitopes Mediate Multiple Routes for Internalization and Function

    PubMed Central

    DeVay, Rachel M.; Yamamoto, Lynn; Shelton, David L.; Liang, Hong

    2015-01-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a soluble protein that directs membrane-bound receptors to lysosomes for degradation. In the most studied example of this, PCSK9 binding leads to the degradation of low density lipoprotein receptor (LDLR), significantly affecting circulating LDL-C levels. The mechanism mediating this degradation, however, is not completely understood. We show here that LDLR facilitates PCSK9 interactions with amyloid precursor like protein 2 (APLP2) at neutral pH leading to PCSK9 internalization, although direct binding between PCSK9 and LDLR is not required. Moreover, binding to APLP2 or LDLR is independently sufficient for PCSK9 endocytosis in hepatocytes, while LDL can compete with APLP2 for PCSK9 binding to indirectly mediate PCSK9 endocytosis. Finally, we show that APLP2 and LDLR are also required for the degradation of another PCSK9 target, APOER2, necessitating a general role for LDLR and APLP2 in PCSK9 function. Together, these findings provide evidence that PCSK9 has at least two endocytic epitopes that are utilized by a variety of internalization mechanisms and clarifies how PCSK9 may direct proteins to lysosomes. PMID:25905719

  19. Viral receptor-binding site antibodies with diverse germline origins.

    PubMed

    Schmidt, Aaron G; Therkelsen, Matthew D; Stewart, Shaun; Kepler, Thomas B; Liao, Hua-Xin; Moody, M Anthony; Haynes, Barton F; Harrison, Stephen C

    2015-05-21

    Vaccines for rapidly evolving pathogens will confer lasting immunity if they elicit antibodies recognizing conserved epitopes, such as a receptor-binding site (RBS). From characteristics of an influenza-virus RBS-directed antibody, we devised a signature motif to search for similar antibodies. We identified, from three vaccinees, over 100 candidates encoded by 11 different VH genes. Crystal structures show that antibodies in this class engage the hemagglutinin RBS and mimic binding of the receptor, sialic acid, by supplying a critical dipeptide on their projecting, heavy-chain third complementarity determining region. They share contacts with conserved, receptor-binding residues but contact different residues on the RBS periphery, limiting the likelihood of viral escape when several such antibodies are present. These data show that related modes of RBS recognition can arise from different germline origins and mature through diverse affinity maturation pathways. Immunogens focused on an RBS-directed response will thus have a broad range of B cell targets. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Screening of a library of T7 phage-displayed peptides identifies alphaC helix in 14-3-3 protein as a CBP501-binding site.

    PubMed

    Matsumoto, Yuki; Shindo, Yosuke; Takakusagi, Yoichi; Takakusagi, Kaori; Tsukuda, Senko; Kusayanagi, Tomoe; Sato, Hitoshi; Kawabe, Takumi; Sugawara, Fumio; Sakaguchi, Kengo

    2011-12-01

    CBP501 is a chemically modified peptide composed of twelve unnatural d-amino acids, which inhibits Chk kinase and abrogates G2 arrest induced by DNA-damaging agents. Here we identified an alphaC helix in 14-3-3 protein as a CBP501-binding site using T7 phage display technology. An affinity selection of T7 phage-displayed peptide using biotinylated CBP501 identified a 14-mer peptide NSDCIISRKIEQKE. This peptide sequence showed similarity to a portion of the alphaC helix of human 14-3-3ε, suggesting that CBP501 may bind to this region. Surface plasmon resonance (SPR) and ELISA demonstrated that CBP501 interacts with 14-3-3ε specifically at the screen-guided region. An avidin-agarose bead pull-down assay showed that CBP501 also binds to other 14-3-3 isoforms in Jurkat cells. Among the other known Chk kinase inhibitors tested, CBP501 showed the strongest affinity for 14-3-3ε. Thus, we conclude that in addition to the direct inhibition of Chk kinase activity, CBP501 directly binds to cellular 14-3-3 proteins through alphaC helix. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. External electric field effect on the binding energy of a hydrogenic donor impurity in InGaAsP/InP concentric double quantum rings

    NASA Astrophysics Data System (ADS)

    Hu, Min; Wang, Hailong; Gong, Qian; Wang, Shumin

    2018-04-01

    Within the framework of effective-mass envelope-function theory, the ground state binding energy of a hydrogenic donor impurity is calculated in the InGaAsP/InP concentric double quantum rings (CDQRs) using the plane wave method. The effects of geometry, impurity position, external electric field and alloy composition on binding energy are considered. It is shown that the peak value of the binding energy appears in two rings with large gap as the donor impurity moves along the radial direction. The binding energy reaches the peak value at the center of ring height when the donor impurity moves along the axial direction. The binding energy shows nonlinear variation with the increase of ring height. With the external electric field applied along the z-axis, the binding energy of the donor impurity located at zi ≥ 0 decreases while that located at zi < 0 increases. In addition, the binding energy decreases with increasing Ga composition, but increases with the increasing As composition.

  2. Force fields for describing the solution-phase synthesis of shape-selective metal nanoparticles

    NASA Astrophysics Data System (ADS)

    Zhou, Ya; Al-Saidi, Wissam; Fichthorn, Kristen

    2013-03-01

    Polyvinylpyrrolidone (PVP) and polyethylene oxide (PEO) are structure-directing agents that exhibit different performance in the polyol synthesis of Ag nanostructures. The success of these structure-directing agents in selective nanostructure synthesis is often attributed to their selective binding to Ag(100) facets. We use first-principles, density-functional theory (DFT) calculations in a vacuum environment to show that PVP has a stronger preference to bind to Ag(100) than to Ag(111), whereas PEO exhibits much weaker selectivity. To understand the role of solvent in the surface-sensitive binding, we develop classical force fields to describe the interactions of the structure-directing (PVP and PEO) and solvent (ethylene glycol) molecules with various Ag substrates. We parameterize the force fields through force-and-energy matching to DFT results using simulated annealing. We validate the force fields by comparisons to DFT and experimental binding energies. Our force fields reproduce the surface-sensitive binding predicted by DFT calculations. Molecular dynamics simulations based on these force fields can be used to reveal the role of solvent, polymer chain length, and polymer concentration in the selective synthesis of Ag nanostructures.

  3. Interaction of Tl +3 with mononucleotides: metal ion binding and sugar conformation

    NASA Astrophysics Data System (ADS)

    Nafisi, Sh.; Mohajerani, N.; Hadjiakhoondi, A.; Monajemi, M.; Garib, F.

    2001-05-01

    The interaction of Tl 3+ with sodium salts of adenosine-5'-monophosphate (5'-AMP), guanosine-5'-monophosphate (5'-GMP), cytidine-5'-monophosphate (5'-CMP), thymidine 5'-monophosphate (5'-dTMP) in ratios 1 and 2 have been studied in neutral pH. The solid complexes were isolated and characterized by Fourier transform infrared (FTIR) and 1H NMR spectroscopy. In the Tl 2(AMP) 3, Tl 3+ binds directly to N-7 and indirectly to the N-1 position of the pyrimidine ring and phosphate group with sugar moiety in C2'-endoanti. The crystalline salt of Tl 2(GMP) 3 show direct Tl-N-7 and Tl-PO 3(inner-sphere) binding. The conformation of ribose moiety in Tl 2(GMP) 3 is C3'-endoanti. In the Tl 2(CMP) 3, Tl 3+ bind directly to N-3 and PO32- (inner-sphere). The conformation of ribose moiety in Tl 2(CMP) 3 is C2'-endoanti. In the Tl 2(dTMP) 3, Tl 3+ bind indirectly to carbonyl group. The sugar moiety in Tl 2(dTMP) 3 is C3'-endoanti.

  4. Direct detection of ligand binding to Sepharose-immobilised protein using saturation transfer double difference (STDD) NMR spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haselhorst, Thomas; Muenster-Kuehnel, Anja K.; Oschlies, Melanie

    2007-08-10

    We report an easy and direct application of 'Saturation Transfer Double Difference' (STDD) NMR spectroscopy to identify ligands that bind to a Sepharose-immobilised target protein. The model protein, cytidine 5'-monophosphate sialic acid (CMP-Sia) synthetase, was expressed as a Strep-Tag II fusion protein and immobilised on Strep-Tactin Sepharose. STD NMR experiments of the protein-enriched Sepharose matrix in the presence of a binding ligand (cytidine 5'-triphosphate, CTP) and a non-binding ligand ({alpha}/{beta}-glucose) clearly show that CTP binds to the immobilised enzyme, whereas glucose has no affinity. This approach has three major advantages: (a) only low quantities of protein are required, (b) nomore » specialised NMR technology or the application of additional data analysis by non-routine methods is required, and (c) easy multiple use of the immobilised protein is available.« less

  5. A Brownian motor mechanism of translocation and strand separation by hepatitis C virus helicase.

    PubMed

    Levin, Mikhail K; Gurjar, Madhura; Patel, Smita S

    2005-05-01

    Helicases translocate along their nucleic acid substrates using the energy of ATP hydrolysis and by changing conformations of their nucleic acid-binding sites. Our goal is to characterize the conformational changes of hepatitis C virus (HCV) helicase at different stages of ATPase cycle and to determine how they lead to translocation. We have reported that ATP binding reduces HCV helicase affinity for nucleic acid. Now we identify the stage of the ATPase cycle responsible for translocation and unwinding. We show that a rapid directional movement occurs upon helicase binding to DNA in the absence of ATP, resulting in opening of several base pairs. We propose that HCV helicase translocates as a Brownian motor with a simple two-stroke cycle. The directional movement step is fueled by single-stranded DNA binding energy while ATP binding allows for a brief period of random movement that prepares the helicase for the next cycle.

  6. Site-directed antibody immobilization using a protein A-gold binding domain fusion protein for enhanced SPR immunosensing.

    PubMed

    de Juan-Franco, Elena; Caruz, Antonio; Pedrajas, J R; Lechuga, Laura M

    2013-04-07

    We have implemented a novel strategy for the oriented immobilization of antibodies onto a gold surface based on the use of a fusion protein, the protein A-gold binding domain (PAG). PAG consists of a gold binding peptide (GBP) coupled to the immunoglobulin-binding domains of staphylococcal protein A. This fusion protein provides an easy and fast oriented immobilization of antibodies preserving its native structure, while leaving the antigen binding sites (Fab) freely exposed. Using this immobilization strategy, we have demonstrated the performance of the immunosensing of the human Growth Hormone by SPR. A limit of detection of 90 ng mL(-1) was obtained with an inter-chip variability lower than 7%. The comparison of this method with other strategies for the direct immobilization of antibodies over gold surfaces has showed the enhanced sensitivity provided by the PAG approach.

  7. Dimerization Domain of Retinal Membrane Guanylyl Cyclase 1 (RetGC1) Is an Essential Part of Guanylyl Cyclase-activating Protein (GCAP) Binding Interface.

    PubMed

    Peshenko, Igor V; Olshevskaya, Elena V; Dizhoor, Alexander M

    2015-08-07

    The photoreceptor-specific proteins guanylyl cyclase-activating proteins (GCAPs) bind and regulate retinal membrane guanylyl cyclase 1 (RetGC1) but not natriuretic peptide receptor A (NPRA). Study of RetGC1 regulation in vitro and its association with fluorescently tagged GCAP in transfected cells showed that R822P substitution in the cyclase dimerization domain causing congenital early onset blindness disrupted RetGC1 ability to bind GCAP but did not eliminate its affinity for another photoreceptor-specific protein, retinal degeneration 3 (RD3). Likewise, the presence of the NPRA dimerization domain in RetGC1/NPRA chimera specifically disabled binding of GCAPs but not of RD3. In subsequent mapping using hybrid dimerization domains in RetGC1/NPRA chimera, multiple RetGC1-specific residues contributed to GCAP binding by the cyclase, but the region around Met(823) was the most crucial. Either positively or negatively charged residues in that position completely blocked GCAP1 and GCAP2 but not RD3 binding similarly to the disease-causing mutation in the neighboring Arg(822). The specificity of GCAP binding imparted by RetGC1 dimerization domain was not directly related to promoting dimerization of the cyclase. The probability of coiled coil dimer formation computed for RetGC1/NPRA chimeras, even those incapable of binding GCAP, remained high, and functional complementation tests showed that the RetGC1 active site, which requires dimerization of the cyclase, was formed even when Met(823) or Arg(822) was mutated. These results directly demonstrate that the interface for GCAP binding on RetGC1 requires not only the kinase homology region but also directly involves the dimerization domain and especially its portion containing Arg(822) and Met(823). © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Interactions between Human Liver Fatty Acid Binding Protein and Peroxisome Proliferator Activated Receptor Selective Drugs

    PubMed Central

    Velkov, Tony

    2013-01-01

    Fatty acid binding proteins (FABPs) act as intracellular shuttles for fatty acids as well as lipophilic xenobiotics to the nucleus, where these ligands are released to a group of nuclear receptors called the peroxisome proliferator activated receptors (PPARs). PPAR mediated gene activation is ultimately involved in maintenance of cellular homeostasis through the transcriptional regulation of metabolic enzymes and transporters that target the activating ligand. Here we show that liver- (L-) FABP displays a high binding affinity for PPAR subtype selective drugs. NMR chemical shift perturbation mapping and proteolytic protection experiments show that the binding of the PPAR subtype selective drugs produces conformational changes that stabilize the portal region of L-FABP. NMR chemical shift perturbation studies also revealed that L-FABP can form a complex with the PPAR ligand binding domain (LBD) of PPARα. This protein-protein interaction may represent a mechanism for facilitating the activation of PPAR transcriptional activity via the direct channeling of ligands between the binding pocket of L-FABP and the PPARαLBD. The role of L-FABP in the delivery of ligands directly to PPARα via this channeling mechanism has important implications for regulatory pathways that mediate xenobiotic responses and host protection in tissues such as the small intestine and the liver where L-FABP is highly expressed. PMID:23476633

  9. Lipid binding activities of flax rust AvrM and AvrL567 effectors.

    PubMed

    Gan, Pamela H P; Rafiqi, Maryam; Ellis, Jeffrey G; Jones, David A; Hardham, Adrienne R; Dodds, Peter N

    2010-10-01

    Effectors are pathogen-encoded proteins that are thought to facilitate infection by manipulation of host cells. Evidence showing that the effectors of some eukaryotic plant pathogens are able to interact directly with cytoplasmic host proteins indicates that translocation of these proteins into host cells is an important part of infection. Recently, we showed that the flax rust effectors AvrM and AvrL567 are able to internalize into plant cells in the absence of the pathogen. Further, N-terminal sequences that were sufficient for uptake were identified for both these proteins. In light of the possibility that the internalization of fungal and oomycete effectors may require binding to specific phospholipids, the lipid binding activities of AvrM and AvrL567 mutants with different abilities to enter cells were tested. While AvrL567 was not found to bind to phospholipids, AvrM bound strongly to phosphatidyl inositol, phosphatidyl inositol monophosphates and phosphatidyl serine. However, a fragment of AvrM sufficient to direct uptake of a fusion protein into plant cells did not bind to these phospholipids. Thus, our results do not support the role of specific binding of AvrM and AvrL567 to phospholipids for uptake into the plant cytoplasm. © 2010 Landes Bioscience

  10. Structural and mutational analyses of the receptor binding domain of botulinum D/C mosaic neurotoxin: Insight into the ganglioside binding mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nuemket, Nipawan; Tanaka, Yoshikazu; Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810

    2011-07-29

    Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinummore » neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.« less

  11. Characterization of Novel Calmodulin Binding Domains within IQ Motifs of IQGAP1

    PubMed Central

    Jang, Deok-Jin; Ban, Byungkwan; Lee, Jin-A

    2011-01-01

    IQ motif-containing GTPase-activating protein 1 (IQGAP1), which is a well-known calmodulin (CaM) binding protein, is involved in a wide range of cellular processes including cell proliferation, tumorigenesis, adhesion, and migration. Interaction of IQGAP1 with CaM is important for its cellular functions. Although each IQ domain of IQGAP1 for CaM binding has been characterized in a Ca2+-dependent or -independent manner, it was not clear which IQ motifs are physiologically relevant for CaM binding in the cells. In this study, we performed immunoprecipitation using 3xFLAGhCaM in mammalian cell lines to characterize the domains of IQGAP1 that are key for CaM binding under physiological conditions. Interestingly, using this method, we identified two novel domains, IQ(2.7-3) and IQ(3.5-4.4), within IQGAP1 that were involved in Ca2+-independent or -dependent CaM binding, respectively. Mutant analysis clearly showed that the hydrophobic regions within IQ(2.7-3) were mainly involved in apoCaM binding, while the basic amino acids and hydrophobic region of IQ(3.5-4.4) were required for Ca2+/CaM binding. Finally, we showed that IQ(2.7-3) was the main apoCaM binding domain and both IQ(2.7-3) and IQ(3.5-4.4) were required for Ca2+/CaM binding within IQ(1- 2-3-4). Thus, we identified and characterized novel direct CaM binding motifs essential for IQGAP1. This finding indicates that IQGAP1 plays a dynamic role via direct interactions with CaM in a Ca2+-dependent or -independent manner. PMID:22080369

  12. Rif1 Binding and Control of Chromosome-Internal DNA Replication Origins Is Limited by Telomere Sequestration.

    PubMed

    Hafner, Lukas; Lezaja, Aleksandra; Zhang, Xu; Lemmens, Laure; Shyian, Maksym; Albert, Benjamin; Follonier, Cindy; Nunes, Jose Manuel; Lopes, Massimo; Shore, David; Mattarocci, Stefano

    2018-04-24

    The Saccharomyces cerevisiae telomere-binding protein Rif1 plays an evolutionarily conserved role in control of DNA replication timing by promoting PP1-dependent dephosphorylation of replication initiation factors. However, ScRif1 binding outside of telomeres has never been detected, and it has thus been unclear whether Rif1 acts directly on the replication origins that it controls. Here, we show that, in unperturbed yeast cells, Rif1 primarily regulates late-replicating origins within 100 kb of a telomere. Using the chromatin endogenous cleavage ChEC-seq technique, we robustly detect Rif1 at late-replicating origins that we show are targets of its inhibitory action. Interestingly, abrogation of Rif1 telomere association by mutation of its Rap1-binding module increases Rif1 binding and origin inhibition elsewhere in the genome. Our results indicate that Rif1 inhibits replication initiation by interacting directly with origins and suggest that Rap1-dependent sequestration of Rif1 increases its effective concentration near telomeres, while limiting its action at chromosome-internal sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  13. Electrostatically Biased Binding of Kinesin to Microtubules

    PubMed Central

    Zheng, Wenjun; Alonso, Maria; Huber, Gary; Dlugosz, Maciej; McCammon, J. Andrew; Cross, Robert A.

    2011-01-01

    The minimum motor domain of kinesin-1 is a single head. Recent evidence suggests that such minimal motor domains generate force by a biased binding mechanism, in which they preferentially select binding sites on the microtubule that lie ahead in the progress direction of the motor. A specific molecular mechanism for biased binding has, however, so far been lacking. Here we use atomistic Brownian dynamics simulations combined with experimental mutagenesis to show that incoming kinesin heads undergo electrostatically guided diffusion-to-capture by microtubules, and that this produces directionally biased binding. Kinesin-1 heads are initially rotated by the electrostatic field so that their tubulin-binding sites face inwards, and then steered towards a plus-endwards binding site. In tethered kinesin dimers, this bias is amplified. A 3-residue sequence (RAK) in kinesin helix alpha-6 is predicted to be important for electrostatic guidance. Real-world mutagenesis of this sequence powerfully influences kinesin-driven microtubule sliding, with one mutant producing a 5-fold acceleration over wild type. We conclude that electrostatic interactions play an important role in the kinesin stepping mechanism, by biasing the diffusional association of kinesin with microtubules. PMID:22140358

  14. Structure of Bacillus subtilis γ-glutamyltranspeptidase in complex with acivicin: diversity of the binding mode of a classical and electrophilic active-site-directed glutamate analogue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ida, Tomoyo; Suzuki, Hideyuki; Fukuyama, Keiichi

    2014-02-01

    The binding modes of acivicin, a classical and an electrophilic active-site-directed glutamate analogue, to bacterial γ-glutamyltranspeptidases were found to be diverse. γ-Glutamyltranspeptidase (GGT) is an enzyme that plays a central role in glutathione metabolism, and acivicin is a classical inhibitor of GGT. Here, the structure of acivicin bound to Bacillus subtilis GGT determined by X-ray crystallography to 1.8 Å resolution is presented, in which it binds to the active site in a similar manner to that in Helicobacter pylori GGT, but in a different binding mode to that in Escherichia coli GGT. In B. subtilis GGT, acivicin is bound covalentlymore » through its C3 atom with sp{sup 2} hybridization to Thr403 O{sup γ}, the catalytic nucleophile of the enzyme. The results show that acivicin-binding sites are common, but the binding manners and orientations of its five-membered dihydroisoxazole ring are diverse in the binding pockets of GGTs.« less

  15. Huntingtin interacting protein 1 (HIP1) regulates clathrin assembly through direct binding to the regulatory region of the clathrin light chain.

    PubMed

    Legendre-Guillemin, Valerie; Metzler, Martina; Lemaire, Jean-Francois; Philie, Jacynthe; Gan, Lu; Hayden, Michael R; McPherson, Peter S

    2005-02-18

    Huntingtin interacting protein 1 (HIP1) is a component of clathrin coats. We previously demonstrated that HIP1 promotes clathrin assembly through its central helical domain, which binds directly to clathrin light chains (CLCs). To better understand the relationship between CLC binding and clathrin assembly we sought to dissect this interaction. Using C-terminal deletion constructs of the HIP1 helical domain, we identified a region between residues 450 and 456 that is required for CLC binding. Within this region, point mutations showed the importance of residues Leu-451, Leu-452, and Arg-453. Mutants that fail to bind CLC are unable to promote clathrin assembly in vitro but still mediate HIP1 homodimerization and heterodimerization with the family member HIP12/HIP1R. Moreover, HIP1 binding to CLC is necessary for HIP1 targeting to clathrin-coated pits and clathrin-coated vesicles. Interestingly, HIP1 binds to a highly conserved region of CLC previously demonstrated to regulate clathrin assembly. These results suggest a role for HIP1/CLC interactions in the regulation of clathrin assembly.

  16. Cloning retinoid and peroxisome proliferator-activated nuclear receptors of the Pacific oyster and in silico binding to environmental chemicals

    PubMed Central

    Vogeler, Susanne; Galloway, Tamara S.; Isupov, Michail

    2017-01-01

    Disruption of nuclear receptors, a transcription factor superfamily regulating gene expression in animals, is one proposed mechanism through which pollution causes effects in aquatic invertebrates. Environmental pollutants have the ability to interfere with the receptor’s functions through direct binding and inducing incorrect signals. Limited knowledge of invertebrate endocrinology and molecular regulatory mechanisms, however, impede the understanding of endocrine disruptive effects in many aquatic invertebrate species. Here, we isolated three nuclear receptors of the Pacific oyster, Crassostrea gigas: two isoforms of the retinoid X receptor, CgRXR-1 and CgRXR-2, a retinoic acid receptor ortholog CgRAR, and a peroxisome proliferator-activated receptor ortholog CgPPAR. Computer modelling of the receptors based on 3D crystal structures of human proteins was used to predict each receptor’s ability to bind to different ligands in silico. CgRXR showed high potential to bind and be activated by 9-cis retinoic acid and the organotin tributyltin (TBT). Computer modelling of CgRAR revealed six residues in the ligand binding domain, which prevent the successful interaction with natural and synthetic retinoid ligands. This supports an existing theory of loss of retinoid binding in molluscan RARs. Modelling of CgPPAR was less reliable due to high discrepancies in sequence to its human ortholog. Yet, there are suggestions of binding to TBT, but not to rosiglitazone. The effect of potential receptor ligands on early oyster development was assessed after 24h of chemical exposure. TBT oxide (0.2μg/l), all-trans retinoic acid (ATRA) (0.06 mg/L) and perfluorooctanoic acid (20 mg/L) showed high effects on development (>74% abnormal developed D-shelled larvae), while rosiglitazone (40 mg/L) showed no effect. The results are discussed in relation to a putative direct (TBT) disruption effect on nuclear receptors. The inability of direct binding of ATRA to CgRAR suggests either a disruptive effect through a pathway excluding nuclear receptors or an indirect interaction. Our findings provide valuable information on potential mechanisms of molluscan nuclear receptors and the effects of environmental pollution on aquatic invertebrates. PMID:28426724

  17. Dielectric response of molecules in empirical tight-binding theory

    NASA Astrophysics Data System (ADS)

    Boykin, Timothy B.; Vogl, P.

    2002-01-01

    In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.

  18. Allergic reaction to latex: a risk factor for unsuspected anaphylaxis.

    PubMed

    Warpinski, J R; Folgert, J; Cohen, M; Bush, R K

    1991-01-01

    Allergic reactions to latex, including anaphylaxis may be a problem in certain individuals exposed to latex. Four atopic patients with symptoms of rhinitis, asthma, anaphylaxis, and/or urticaria upon contact with latex products were studied. The patients showed IgE binding to latex RAST disks ranging from 1.0 to 27.3 times the negative control. Latex products (gloves, balloons, and condoms) directly bound IgE from all four patients. Eluted proteins from the latex products inhibited IgE binding to commercial latex RAST disks. SDS-PAGE demonstrated multiple latex protein bands by Coomassie Blue staining between 14 and 66 kD. Immunoblotting showed specific IgE binding to latex proteins at 30 and 66 kD. These results indicate that latex-allergic patients have IgE directed against specific latex proteins. Allergy to latex can pose a substantial health risk to susceptible individuals.

  19. NKp44 receptor mediates interaction of the envelope glycoproteins from the West-Nile and dengue viruses with Natural Killer cells

    PubMed Central

    Hershkovitz, Oren; Rosental, Benyamin; Rosenberg, Lior Ann; Navarro-Sanchez, Martha Erika; Jivov, Sergey; Zilka, Alon; Gershoni-Yahalom, Orly; Brient-Litzler, Elodie; Bedouelle, Hugues; Ho, Joanna W.; Campbell, Kerry S.; Rager-Zisman, Bracha; Despres, Philippe; Porgador, Angel

    2009-01-01

    Dengue virus (DV) and West Nile virus (WNV) have become a global concern due to their widespread distribution and their ability to cause a variety of human diseases. Antiviral immune defenses involve natural killer (NK) cells. In the present study, we investigated the interaction between NK cells and these two flaviviruses. We show that the NK-activating receptor NKp44 is involved in virally-mediated NK activation through direct interaction with the flavivirus envelope protein. Recombinant NKp44 directly binds to purified DV and WNV envelope proteins and specifically to domain III of WNV envelope protein (EIII); it also binds to WNV virus-like particles (VLPs). These WNV-VLPs and WNV-EIII directly bind NK cells expressing high levels of NKp44. Functionally, interaction of NK cells with infective and inactivated WNV results in NKp44-mediated NK de-granulation. Finally, WNV infection of cells results in increased binding of recombinant NKp44 that is specifically inhibited by anti-WNV serum. WNV-infected target cells induce IFNγ secretion and augmented lysis by NKp44-expressing primary NK cells that are blocked by anti-NKp44 antibodies. Our findings show that triggering of NK cells by flavivirus is mediated by interaction of NKp44 with the flavivirus envelope protein. PMID:19635919

  20. Cobra venom factor immunoconjugates: effects of carbohydrate-directed versus amino group-directed conjugation.

    PubMed

    Zara, J; Pomato, N; McCabe, R P; Bredehorst, R; Vogel, C W

    1995-01-01

    Human IgM monoclonal antibody 16-88, derived from patients immunized with autologous colon carcinoma cells, was derivatized with two different cross-linkers, S-(2-thiopyridyl)-L-cysteine hydrazide (TPCH), which is carbohydrate-directed, and N-succinimidyl-3-(2- pyridyldithio)propionate (SPDP), which is amino group-directed. Two antibody functions, antigen binding and complement activation, were assayed upon derivatization with TPCH and SPDP. TPCH allowed for extensive modification (up to 17 TPCH molecules per antibody) without impairment of antigen binding activity, while this function was significantly compromised upon derivatization with SPDP. Antibody molecules derivatized with 16 SPDP residues showed almost complete loss of their antigen binding function. The complement activating ability of antibody 16-88 was significantly decreased after derivatization with TPCH or SPDP. In the case of SPDP derivatization, this decrease of the complement activating ability is predominantly a consequence of the impaired binding function. Upon conjugation of cobra venom factor (CVF), a nontoxic 137-kDa glycoprotein which is capable of activating the alternative pathway of complement, the antigen binding activity of SPDP-derivatized antibody was further compromised, whereas that of TPCH-derivatized antibody remained unaffected even after attachment of three or four CVF molecules per antibody. In both conjugates CVF retained good functional activity. CVF was slightly more active when attached to SPDP-derivatized antibody, suggesting a better accessibility of amino group-coupled CVF for its interaction with other complement proteins. These results indicate that carbohydrate-directed conjugation compromises the antibody function of complement activation, but allows for the generation of immunoconjugates with unimpaired antigen binding capability.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Analysis of the promoter of the cudA gene reveals novel mechanisms of Dictyostelium cell type differentiation.

    PubMed

    Fukuzawa, M; Williams, J G

    2000-06-01

    The cudA gene encodes a nuclear protein that is essential for normal multicellular development. At the slug stage cudA is expressed in the prespore cells and in a sub-region of the prestalk zone. We show that cap site distal promoter sequences direct cudA expression in prespore cells, while proximal sequences direct expression in the prestalk sub-region. The promoter domain that directs prespore-specific transcription consists of a positively acting region, that has the potential to direct expression in all cells within the slug, and a negatively acting region that prevents expression in the prestalk cells. Dd-STATa is the STAT protein that regulates commitment to stalk cell gene expression, where it is known to function as a transcriptional repressor. We show that Dd-STATa binds in vitro to the positively acting part of the prespore domain of the cudA promoter. However, Dd-STATa cannot be utilised for this purpose in vivo, because analysis of a Dd-STATa null mutant strain shows that Dd-STATa is not necessary for cudA transcription in prespore cells. In contrast, the part of the cudA promoter that directs prestalk-specific expression contains a binding site for Dd-STATa that is essential for its biological activity. Dd-STATa appears therefore to serve as a direct activator of cudA transcription in prestalk cells, while a protein with a DNA binding specificity highly related to that of Dd-STATa is utilised to activate cudA transcription in prespore cells.

  2. Symbiotic Bacteria Direct Expression of an Intestinal Bactericidal Lectin

    PubMed Central

    Cash, Heather L.; Whitham, Cecilia V.; Behrendt, Cassie L.; Hooper, Lora V.

    2009-01-01

    The mammalian intestine harbors complex societies of beneficial bacteria that are maintained in the lumen with minimal penetration of mucosal surfaces. Microbial colonization of germ-free mice triggers epithelial expression of RegIIIγ, a secreted C-type lectin. RegIIIγ binds intestinal bacteria but lacks the complement recruitment domains present in other microbe-binding mammalian C-type lectins. We show that RegIIIγ and its human counterpart, HIP/PAP, are directly antimicrobial proteins that bind their bacterial targets via interactions with peptidoglycan carbohydrate. We propose that these proteins represent an evolutionarily primitive form of lectin-mediated innate immunity, and that they reveal intestinal strategies for maintaining symbiotic host-microbial relationships. PMID:16931762

  3. Arsenic trioxide controls the fate of the PML-RARalpha oncoprotein by directly binding PML.

    PubMed

    Zhang, Xiao-Wei; Yan, Xiao-Jing; Zhou, Zi-Ren; Yang, Fei-Fei; Wu, Zi-Yu; Sun, Hong-Bin; Liang, Wen-Xue; Song, Ai-Xin; Lallemand-Breitenbach, Valérie; Jeanne, Marion; Zhang, Qun-Ye; Yang, Huai-Yu; Huang, Qiu-Hua; Zhou, Guang-Biao; Tong, Jian-Hua; Zhang, Yan; Wu, Ji-Hui; Hu, Hong-Yu; de Thé, Hugues; Chen, Sai-Juan; Chen, Zhu

    2010-04-09

    Arsenic, an ancient drug used in traditional Chinese medicine, has attracted worldwide interest because it shows substantial anticancer activity in patients with acute promyelocytic leukemia (APL). Arsenic trioxide (As2O3) exerts its therapeutic effect by promoting degradation of an oncogenic protein that drives the growth of APL cells, PML-RARalpha (a fusion protein containing sequences from the PML zinc finger protein and retinoic acid receptor alpha). PML and PML-RARalpha degradation is triggered by their SUMOylation, but the mechanism by which As2O3 induces this posttranslational modification is unclear. Here we show that arsenic binds directly to cysteine residues in zinc fingers located within the RBCC domain of PML-RARalpha and PML. Arsenic binding induces PML oligomerization, which increases its interaction with the small ubiquitin-like protein modifier (SUMO)-conjugating enzyme UBC9, resulting in enhanced SUMOylation and degradation. The identification of PML as a direct target of As2O3 provides new insights into the drug's mechanism of action and its specificity for APL.

  4. Conformational antibody binding to a native, cell-free expressed GPCR in block copolymer membranes.

    PubMed

    de Hoog, Hans-Peter M; Lin JieRong, Esther M; Banerjee, Sourabh; Décaillot, Fabien M; Nallani, Madhavan

    2014-01-01

    G-protein coupled receptors (GPCRs) play a key role in physiological processes and are attractive drug targets. Their biophysical characterization is, however, highly challenging because of their innate instability outside a stabilizing membrane and the difficulty of finding a suitable expression system. We here show the cell-free expression of a GPCR, CXCR4, and its direct embedding in diblock copolymer membranes. The polymer-stabilized CXCR4 is readily immobilized onto biosensor chips for label-free binding analysis. Kinetic characterization using a conformationally sensitive antibody shows the receptor to exist in the correctly folded conformation, showing binding behaviour that is commensurate with heterologously expressed CXCR4.

  5. Conformational Antibody Binding to a Native, Cell-Free Expressed GPCR in Block Copolymer Membranes

    PubMed Central

    de Hoog, Hans-Peter M.; Lin JieRong, Esther M.; Banerjee, Sourabh; Décaillot, Fabien M.; Nallani, Madhavan

    2014-01-01

    G-protein coupled receptors (GPCRs) play a key role in physiological processes and are attractive drug targets. Their biophysical characterization is, however, highly challenging because of their innate instability outside a stabilizing membrane and the difficulty of finding a suitable expression system. We here show the cell-free expression of a GPCR, CXCR4, and its direct embedding in diblock copolymer membranes. The polymer-stabilized CXCR4 is readily immobilized onto biosensor chips for label-free binding analysis. Kinetic characterization using a conformationally sensitive antibody shows the receptor to exist in the correctly folded conformation, showing binding behaviour that is commensurate with heterologously expressed CXCR4. PMID:25329156

  6. MMPP Attenuates Non-Small Cell Lung Cancer Growth by Inhibiting the STAT3 DNA-Binding Activity via Direct Binding to the STAT3 DNA-Binding Domain.

    PubMed

    Son, Dong Ju; Zheng, Jie; Jung, Yu Yeon; Hwang, Chul Ju; Lee, Hee Pom; Woo, Ju Rang; Baek, Song Yi; Ham, Young Wan; Kang, Min Woong; Shong, Minho; Kweon, Gi Ryang; Song, Min Jong; Jung, Jae Kyung; Han, Sang-Bae; Kim, Bo Yeon; Yoon, Do Young; Choi, Bu Young; Hong, Jin Tae

    2017-01-01

    Rationale: Signal transducer and activator of transcription-3 (STAT3) plays a pivotal role in cancer biology. Many small-molecule inhibitors that target STAT3 have been developed as potential anticancer drugs. While designing small-molecule inhibitors that target the SH2 domain of STAT3 remains the leading focus for drug discovery, there has been a growing interest in targeting the DNA-binding domain (DBD) of the protein. Methods: We demonstrated the potential antitumor activity of a novel, small-molecule (E)-2-methoxy-4-(3-(4-methoxyphenyl)prop-1-en-1-yl)phenol (MMPP) that directly binds to the DBD of STAT3, in patient-derived non-small cell lung cancer (NSCLC) xenograft model as well as in NCI-H460 cell xenograft model in nude mice. Results: MMPP effectively inhibited the phosphorylation of STAT3 and its DNA binding activity in vitro and in vivo . It induced G1-phase cell cycle arrest and apoptosis through the regulation of cell cycle- and apoptosis-regulating genes by directly binding to the hydroxyl residue of threonine 456 in the DBD of STAT3. Furthermore, MMPP showed a similar or better antitumor activity than that of docetaxel or cisplatin. Conclusion: MMPP is suggested to be a potential candidate for further development as an anticancer drug that targets the DBD of STAT3.

  7. Binding affinities of cationic dyes in the presence of activated charcoal and anionic surfactant in the premicellar region

    NASA Astrophysics Data System (ADS)

    Ali, Farman; Ibrahim, Muhammad; Khan, Fawad; Bibi, Iram; Shah, Syed W. H.

    2018-03-01

    Binding preferences of cationic dyes malachite green and methylene blue in a mixed charcoal-sodium dodecyl sulfate system have been investigated using UV-visible absorption spectroscopy. The dye adsorption shows surfactant-dependent patterns, indicating diverse modes of interactions. At low surfactant concentration, a direct binding to charcoal is preferred. Comparatively greater quantities of surfactant lead to attachment of dye-surfactant complex to charcoal through hydrophobic interactions. A simple model was employed for determination of equilibrium constant K eq and concentration of dye-surfactant ion pair N DS for both dyes. The values of binding parameters revealed that malachite green was directly adsorbed onto charcoal, whereas methylene blue was bound through surfactant monomers. The model is valid for low surfactant concentrations in the premicellar region. These findings have significance for material and environmental sciences.

  8. Occupancy of a C2-C2 type 'zinc-finger' protein domain by copper. Direct observation by electrospray ionization mass spectrometry.

    PubMed

    Hutchens, T W; Allen, M H; Li, C M; Yip, T T

    1992-09-07

    The metal ion specificity of most 'zinc-finger' metal binding domains is unknown. The human estrogen receptor protein contains two different C2-C2 type 'zinc-finger' sequences within its DNA-binding domain (ERDBD). Copper inhibits the function of this protein by mechanisms which remain unclear. We have used electrospray ionization mass spectrometry to evaluate directly the 71-residue ERDBD (K180-M250) in the absence and presence of Cu(II) ions. The ERDBD showed a high affinity for Cu and was completely occupied with 4 Cu bound; each Cu ion was evidently bound to only two ligand residues (net loss of only 2 Da per bound Cu). The Cu binding stoichiometry was confirmed by atomic absorption. These results (i) provide the first direct physical evidence for the ability of the estrogen receptor DNA-binding domain to bind Cu and (ii) document a twofold difference in the Zn- and Cu-binding capacity. Differences in the ERDBD domain structure with bound Zn and Cu are predicted. Given the relative intracellular contents of Zn and Cu, our findings demonstrate the need to investigate further the Cu occupancy of this and other zinc-finger domains both in vitro and in vivo.

  9. Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis.

    PubMed

    Koshino-Kimura, Yoshihiro; Wada, Takuji; Tachibana, Tatsuhiko; Tsugeki, Ryuji; Ishiguro, Sumie; Okada, Kiyotaka

    2005-06-01

    Epidermal cell differentiation in Arabidopsis root is studied as a model system for understanding cell fate specification. Two types of MYB-related transcription factors are involved in this cell differentiation. One of these, CAPRICE (CPC), encoding an R3-type MYB protein, is a positive regulator of hair cell differentiation and is preferentially transcribed in hairless cells. We analyzed the regulatory mechanism of CPC transcription. Deletion analyses of the CPC promoter revealed that hairless cell-specific transcription of the CPC gene required a 69 bp sequence, and a tandem repeat of this region was sufficient for its expression in epidermis. This region includes two MYB-binding sites, and the epidermis-specific transcription of CPC was abolished when base substitutions were introduced in these sites. We showed by gel mobility shift experiments and by yeast one-hybrid assay that WEREWOLF (WER), which is an R2R3-type MYB protein, directly binds to this region. We showed that WER also binds to the GL2 promoter region, indicating that WER directly regulates CPC and GL2 transcription by binding to their promoter regions.

  10. The binding of human and guinea-pig IgG subclasses to homologous macrophage and monocyte Fc receptors.

    PubMed Central

    Alexander, M D; Andrews, J A; Leslie, R G; Wood, N J

    1978-01-01

    Guinea-pig IgG2 and IgT1 bind to contiguous Fc receptors on homologous peritoneal macrophages. Equilibrium association constants determined for the binding of human IgG subclasses to homologous peripheral blood monocytes show that the order of binding is IgG1 greater than IgG3 greater than IgG4 greater than IgG2. Direct binding and rosette assay techniques independently established that both guinea-pig IgG2 and human IgG bind to homologous macrophage-monocyte Fc receptors through a site present in whole Fc (CH2. CH3)2, but absent in pFc' subfragments (CH3)2. PMID:680795

  11. A novel progesterone receptor membrane component (PGRMC) in the human and swine parasite Taenia solium: implications to the host-parasite relationship.

    PubMed

    Aguilar-Díaz, Hugo; Nava-Castro, Karen E; Escobedo, Galileo; Domínguez-Ramírez, Lenin; García-Varela, Martín; Del Río-Araiza, Víctor H; Palacios-Arreola, Margarita I; Morales-Montor, Jorge

    2018-03-09

    We have previously reported that progesterone (P 4 ) has a direct in vitro effect on the scolex evagination and growth of Taenia solium cysticerci. Here, we explored the hypothesis that the P 4 direct effect on T. solium might be mediated by a novel steroid-binding parasite protein. By way of using immunofluorescent confocal microscopy, flow cytometry analysis, double-dimension electrophoresis analysis, and sequencing the corresponding protein spot, we detected a novel PGRMC in T. solium. Molecular modeling studies accompanied by computer docking using the sequenced protein, together with phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is from parasite origin. Our results show that P 4 in vitro increases parasite evagination and scolex size. Using immunofluorescent confocal microscopy, we detected that parasite cells showed expression of a P 4 -binding like protein exclusively located at the cysticercus subtegumental tissue. Presence of the P 4 -binding protein in cyst cells was also confirmed by flow cytometry. Double-dimension electrophoresis analysis, followed by sequencing the corresponding protein spot, revealed a protein that was previously reported in the T. solium genome belonging to a membrane-associated progesterone receptor component (PGRMC). Molecular modeling studies accompanied by computer docking using the sequenced protein showed that PGRMC is potentially able to bind steroid hormones such as progesterone, estradiol, testosterone and dihydrodrotestosterone with different affinities. Phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is related to a steroid-binding protein of Echinoccocus granulosus, both of them being nested within a cluster including similar proteins present in platyhelminths such as Schistocephalus solidus and Schistosoma haematobium. Progesterone may directly act upon T. solium cysticerci probably by binding to PGRMC. This research has implications in the field of host-parasite co-evolution as well as the sex-associated susceptibility to this infection. In a more practical matter, present results may contribute to the molecular design of new drugs with anti-parasite actions.

  12. Structural Basis for the ABO Blood-Group Dependence of Plasmodium falciparum Rosetting

    PubMed Central

    Hessel, Audrey; Raynal, Bertrand; England, Patrick; Cohen, Jacques H.; Bertrand, Olivier; Peyrard, Thierry; Bentley, Graham A.; Lewit-Bentley, Anita; Mercereau-Puijalon, Odile

    2012-01-01

    The ABO blood group influences susceptibility to severe Plasmodium falciparum malaria. Recent evidence indicates that the protective effect of group O operates by virtue of reduced rosetting of infected red blood cells (iRBCs) with uninfected RBCs. Rosetting is mediated by a subgroup of PfEMP1 adhesins, with RBC binding being assigned to the N-terminal DBL1α1 domain. Here, we identify the ABO blood group as the main receptor for VarO rosetting, with a marked preference for group A over group B, which in turn is preferred to group O RBCs. We show that recombinant NTS-DBL1α1 and NTS-DBL1α1-CIDR1γ reproduce the VarO-iRBC blood group preference and document direct binding to blood group trisaccharides by surface plasmon resonance. More detailed RBC subgroup analysis showed preferred binding to group A1, weaker binding to groups A2 and B, and least binding to groups Ax and O. The 2.8 Å resolution crystal structure of the PfEMP1-VarO Head region, NTS-DBL1α1-CIDR1γ, reveals extensive contacts between the DBL1α1 and CIDR1γ and shows that the NTS-DBL1α1 hinge region is essential for RBC binding. Computer docking of the blood group trisaccharides and subsequent site-directed mutagenesis localized the RBC-binding site to the face opposite to the heparin-binding site of NTS-DBLα1. RBC binding involves residues that are conserved between rosette-forming PfEMP1 adhesins, opening novel opportunities for intervention against severe malaria. By deciphering the structural basis of blood group preferences in rosetting, we provide a link between ABO blood grouppolymorphisms and rosette-forming adhesins, consistent with the selective role of falciparum malaria on human genetic makeup. PMID:22807674

  13. PDK1-mediated activation of MRCKα regulates directional cell migration and lamellipodia retraction

    PubMed Central

    Gagliardi, Paolo Armando; di Blasio, Laura; Puliafito, Alberto; Seano, Giorgio; Sessa, Roberto; Chianale, Federica; Leung, Thomas; Bussolino, Federico

    2014-01-01

    Directional cell migration is of paramount importance in both physiological and pathological processes, such as development, wound healing, immune response, and cancer invasion. Here, we report that 3-phosphoinositide-dependent kinase 1 (PDK1) regulates epithelial directional migration and invasion by binding and activating myotonic dystrophy kinase–related CDC42-binding kinase α (MRCKα). We show that the effect of PDK1 on cell migration does not involve its kinase activity but instead relies on its ability to bind membrane phosphatidylinositol (3,4,5)-trisphosphate. Upon epidermal growth factor (EGF) stimulation, PDK1 and MRCKα colocalize at the cell membrane in lamellipodia. We demonstrate that PDK1 positively modulates MRCKα activity and drives its localization within lamellipodia. Likewise, the retraction phase of lamellipodia is controlled by PDK1 through an MRCKα-dependent mechanism. In summary, we discovered a functional pathway involving PDK1-mediated activation of MRCKα, which links EGF signaling to myosin contraction and directional migration. PMID:25092657

  14. Specific binding of a Pop6/Pop7 heterodimer to the P3 stem of the yeast RNase MRP and RNase P RNAs.

    PubMed

    Perederina, Anna; Esakova, Olga; Koc, Hasan; Schmitt, Mark E; Krasilnikov, Andrey S

    2007-10-01

    Pop6 and Pop7 are protein subunits of Saccharomyces cerevisiae RNase MRP and RNase P. Here we show that bacterially expressed Pop6 and Pop7 form a soluble heterodimer that binds the RNA components of both RNase MRP and RNase P. Footprint analysis of the interaction between the Pop6/7 heterodimer and the RNase MRP RNA, combined with gel mobility assays, demonstrates that the Pop6/7 complex binds to a conserved region of the P3 domain. Binding of these proteins to the MRP RNA leads to local rearrangement in the structure of the P3 loop and suggests that direct interaction of the Pop6/7 complex with the P3 domain of the RNA components of RNases MRP and P may mediate binding of other protein components. These results suggest a role for a key element in the RNase MRP and RNase P RNAs in protein binding, and demonstrate the feasibility of directly studying RNA-protein interactions in the eukaryotic RNases MRP and P complexes.

  15. Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

    PubMed Central

    Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

    1994-01-01

    To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

  16. Identification of distant drug off-targets by direct superposition of binding pocket surfaces.

    PubMed

    Schumann, Marcel; Armen, Roger S

    2013-01-01

    Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target ("distant off-targets"). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target ("distant off-target").

  17. Identification of Distant Drug Off-Targets by Direct Superposition of Binding Pocket Surfaces

    PubMed Central

    Schumann, Marcel; Armen, Roger S.

    2013-01-01

    Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target (“distant off-targets”). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target (“distant off-target”). PMID:24391782

  18. Chloroplast Hsp93 Directly Binds to Transit Peptides at an Early Stage of the Preprotein Import Process1[OPEN

    PubMed Central

    Huang, Po-Kai; Chan, Po-Ting; Chen, Lih-Jen

    2016-01-01

    Three stromal chaperone ATPases, cpHsc70, Hsp90C, and Hsp93, are present in the chloroplast translocon, but none has been shown to directly bind preproteins in vivo during import, so it remains unclear whether any function as a preprotein-translocating motor and whether they have different functions during the import process. Here, using protein crosslinking followed by ionic detergent solubilization, we show that Hsp93 directly binds to the transit peptides of various preproteins undergoing active import into chloroplasts. Hsp93 also binds to the mature region of a preprotein. A time course study of import, followed by coimmunoprecipitation experiments, confirmed that Hsp93 is present in the same complexes as preproteins at an early stage when preproteins are being processed to the mature size. In contrast, cpHsc70 is present in the same complexes as preproteins at both the early stage and a later stage after the transit peptide has been removed, suggesting that cpHsc70, but not Hsp93, is important in translocating processed mature proteins across the envelope. PMID:26676256

  19. Identification of TTAGGG-binding proteins in Neurospora crassa, a fungus with vertebrate-like telomere repeats.

    PubMed

    Casas-Vila, Núria; Scheibe, Marion; Freiwald, Anja; Kappei, Dennis; Butter, Falk

    2015-11-17

    To date, telomere research in fungi has mainly focused on Saccharomyces cerevisiae and Schizosaccharomyces pombe, despite the fact that both yeasts have degenerated telomeric repeats in contrast to the canonical TTAGGG motif found in vertebrates and also several other fungi. Using label-free quantitative proteomics, we here investigate the telosome of Neurospora crassa, a fungus with canonical telomeric repeats. We show that at least six of the candidates detected in our screen are direct TTAGGG-repeat binding proteins. While three of the direct interactors (NCU03416 [ncTbf1], NCU01991 [ncTbf2] and NCU02182 [ncTay1]) feature the known myb/homeobox DNA interaction domain also found in the vertebrate telomeric factors, we additionally show that a zinc-finger protein (NCU07846) and two proteins without any annotated DNA-binding domain (NCU02644 and NCU05718) are also direct double-strand TTAGGG binders. We further find two single-strand binders (NCU02404 [ncGbp2] and NCU07735 [ncTcg1]). By quantitative label-free interactomics we identify TTAGGG-binding proteins in Neurospora crassa, suggesting candidates for telomeric factors that are supported by phylogenomic comparison with yeast species. Intriguingly, homologs in yeast species with degenerated telomeric repeats are also TTAGGG-binding proteins, e.g. in S. cerevisiae Tbf1 recognizes the TTAGGG motif found in its subtelomeres. However, there is also a subset of proteins that is not conserved. While a rudimentary core TTAGGG-recognition machinery may be conserved across yeast species, our data suggests Neurospora as an emerging model organism with unique features.

  20. The MTA family proteins as novel histone H3 binding proteins.

    PubMed

    Wu, Meng; Wang, Lina; Li, Qian; Li, Jiwen; Qin, Jun; Wong, Jiemin

    2013-01-03

    The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail.

  1. The MTA family proteins as novel histone H3 binding proteins

    PubMed Central

    2013-01-01

    Background The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. Results In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Conclusions Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail. PMID:23286669

  2. Few residues within an extensive binding interface drive receptor interaction and determine the specificity of arrestin proteins.

    PubMed

    Vishnivetskiy, Sergey A; Gimenez, Luis E; Francis, Derek J; Hanson, Susan M; Hubbell, Wayne L; Klug, Candice S; Gurevich, Vsevolod V

    2011-07-08

    Arrestins bind active phosphorylated forms of G protein-coupled receptors, terminating G protein activation, orchestrating receptor trafficking, and redirecting signaling to alternative pathways. Visual arrestin-1 preferentially binds rhodopsin, whereas the two non-visual arrestins interact with hundreds of G protein-coupled receptor subtypes. Here we show that an extensive surface on the concave side of both arrestin-2 domains is involved in receptor binding. We also identified a small number of residues on the receptor binding surface of the N- and C-domains that largely determine the receptor specificity of arrestins. We show that alanine substitution of these residues blocks the binding of arrestin-1 to rhodopsin in vitro and of arrestin-2 and -3 to β2-adrenergic, M2 muscarinic cholinergic, and D2 dopamine receptors in intact cells, suggesting that these elements critically contribute to the energy of the interaction. Thus, in contrast to arrestin-1, where direct phosphate binding is crucial, the interaction of non-visual arrestins with their cognate receptors depends to a lesser extent on phosphate binding and more on the binding to non-phosphorylated receptor elements.

  3. Few Residues within an Extensive Binding Interface Drive Receptor Interaction and Determine the Specificity of Arrestin Proteins*

    PubMed Central

    Vishnivetskiy, Sergey A.; Gimenez, Luis E.; Francis, Derek J.; Hanson, Susan M.; Hubbell, Wayne L.; Klug, Candice S.; Gurevich, Vsevolod V.

    2011-01-01

    Arrestins bind active phosphorylated forms of G protein-coupled receptors, terminating G protein activation, orchestrating receptor trafficking, and redirecting signaling to alternative pathways. Visual arrestin-1 preferentially binds rhodopsin, whereas the two non-visual arrestins interact with hundreds of G protein-coupled receptor subtypes. Here we show that an extensive surface on the concave side of both arrestin-2 domains is involved in receptor binding. We also identified a small number of residues on the receptor binding surface of the N- and C-domains that largely determine the receptor specificity of arrestins. We show that alanine substitution of these residues blocks the binding of arrestin-1 to rhodopsin in vitro and of arrestin-2 and -3 to β2-adrenergic, M2 muscarinic cholinergic, and D2 dopamine receptors in intact cells, suggesting that these elements critically contribute to the energy of the interaction. Thus, in contrast to arrestin-1, where direct phosphate binding is crucial, the interaction of non-visual arrestins with their cognate receptors depends to a lesser extent on phosphate binding and more on the binding to non-phosphorylated receptor elements. PMID:21471193

  4. Demonstration of muscarinic and nicotinic receptor binding activities of distigmine to treat detrusor underactivity.

    PubMed

    Harada, Taketsugu; Fushimi, Kazumi; Kato, Aya; Ito, Yoshihiko; Nishijima, Saori; Sugaya, Kimio; Yamada, Shizuo

    2010-01-01

    The present study was undertaken to examine whether distigmine, a therapeutic agent used to treat detrusor underactivity, binds directly to muscarinic and nicotinic receptors. We used radioreceptor binding assays and compared the effects of distigmine with those of neostigmine and donepedil. The inhibitory effect of distigmine on the blood acetylcholinesterase (AChE) activity was significantly weaker than that of neostigmine. Distigmine, neostigmine, and donepezil competed for specific binding sites of [N-methyl-(3)H]scopolamine methyl chloride ([(3)H]NMS ) and [(3)H]oxotremorine-M in the bladder, submaxillary gland and cerebral cortex of rats in a concentration-dependent manner, indicating significant binding activity of muscarinic receptors. Distigmine displayed significantly higher affinity for binding sites of [(3)H]oxotremorine-M compared with those of [(3)H]NMS as revealed by large ratios of its K(i) value for [(3)H]NMS to that for [(3)H]oxotremorine-M, suggesting that it has preferential affinity for agonist sites of muscarinic receptors. Distigmine seemed to bind to the agonist sites of muscarinic receptors in a competitive manner. Repeated oral administration of distigmine caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]NMS in the bladder and submaxillary gland but not cerebral cortex. Distigmine also bound to nicotinic receptors in the rat cerebral cortex. In conclusion, distigmine shows direct binding to muscarinic receptors in the rat bladder, and repeated oral administration of distigmine causes downregulation of muscarinic receptors in the rat bladder. The observed direct interaction of distigmine with the bladder muscarinic receptors may partly contribute to the therapeutic and/or side effects seen in the treatment of detrusor underactivity.

  5. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  6. In vitro fluorescence studies of transcription factor IIB-DNA interaction.

    PubMed

    Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta

    2015-01-01

    General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.

  7. Apo-states of calmodulin and CaBP1 control CaV1 voltage-gated calcium channel function through direct competition for the IQ domain

    PubMed Central

    Findeisen, Felix; Rumpf, Christine; Minor, Daniel L.

    2013-01-01

    In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation (CDI) and limits calcium entry, whereas CaBP1 blocks CDI and allows sustained calcium influx. Here, we combine isothermal titration calorimetry (ITC) with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca2+/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium binding properties. The observation that the apo-forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. PMID:23811053

  8. Structural basis for collagen recognition by the immune receptor OSCAR.

    PubMed

    Zhou, Long; Hinerman, Jennifer M; Blaszczyk, Michal; Miller, Jeanette L C; Conrady, Deborah G; Barrow, Alexander D; Chirgadze, Dimitri Y; Bihan, Dominique; Farndale, Richard W; Herr, Andrew B

    2016-02-04

    The osteoclast-associated receptor (OSCAR) is a collagen-binding immune receptor with important roles in dendritic cell maturation and activation of inflammatory monocytes as well as in osteoclastogenesis. The crystal structure of the OSCAR ectodomain is presented, both free and in complex with a consensus triple-helical peptide (THP). The structures revealed a collagen-binding site in each immunoglobulin-like domain (D1 and D2). The THP binds near a predicted collagen-binding groove in D1, but a more extensive interaction with D2 is facilitated by the unusually wide D1-D2 interdomain angle in OSCAR. Direct binding assays, combined with site-directed mutagenesis, confirm that the primary collagen-binding site in OSCAR resides in D2, in marked contrast to the related collagen receptors, glycoprotein VI (GPVI) and leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1). Monomeric OSCAR D1D2 binds to the consensus THP with a KD of 28 µM measured in solution, but shows a higher affinity (KD 1.5 μM) when binding to a solid-phase THP, most likely due to an avidity effect. These data suggest a 2-stage model for the interaction of OSCAR with a collagen fibril, with transient, low-affinity interactions initiated by the membrane-distal D1, followed by firm adhesion to the primary binding site in D2. © 2016 by The American Society of Hematology.

  9. Loading direction regulates the affinity of ADP for kinesin.

    PubMed

    Uemura, Sotaro; Ishiwata, Shin'ichi

    2003-04-01

    Kinesin is an ATP-driven molecular motor that moves processively along a microtubule. Processivity has been explained as a mechanism that involves alternating single- and double-headed binding of kinesin to microtubules coupled to the ATPase cycle of the motor. The internal load imposed between the two bound heads has been proposed to be a key factor regulating the ATPase cycle in each head. Here we show that external load imposed along the direction of motility on a single kinesin molecule enhances the binding affinity of ADP for kinesin, whereas an external load imposed against the direction of motility decreases it. This coupling between loading direction and enzymatic activity is in accord with the idea that the internal load plays a key role in the unidirectional and cooperative movement of processive motors.

  10. Examining the critical roles of human CB2 receptor residues Valine 3.32 (113) and Leucine 5.41 (192) in ligand recognition and downstream signaling activities.

    PubMed

    Alqarni, Mohammed; Myint, Kyaw Zeyar; Tong, Qin; Yang, Peng; Bartlow, Patrick; Wang, Lirong; Feng, Rentian; Xie, Xiang-Qun

    2014-09-26

    We performed molecular modeling and docking to predict a putative binding pocket and associated ligand-receptor interactions for human cannabinoid receptor 2 (CB2). Our data showed that two hydrophobic residues came in close contact with three structurally distinct CB2 ligands: CP-55,940, SR144528 and XIE95-26. Site-directed mutagenesis experiments and subsequent functional assays implicated the roles of Valine residue at position 3.32 (V113) and Leucine residue at position 5.41 (L192) in the ligand binding function and downstream signaling activities of the CB2 receptor. Four different point mutations were introduced to the wild type CB2 receptor: V113E, V113L, L192S and L192A. Our results showed that mutation of Val113 with a Glutamic acid and Leu192 with a Serine led to the complete loss of CB2 ligand binding as well as downstream signaling activities. Substitution of these residues with those that have similar hydrophobic side chains such as Leucine (V113L) and Alanine (L192A), however, allowed CB2 to retain both its ligand binding and signaling functions. Our modeling results validated by competition binding and site-directed mutagenesis experiments suggest that residues V113 and L192 play important roles in ligand binding and downstream signaling transduction of the CB2 receptor. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks

    PubMed Central

    Dubois, Laurence; Bataillé, Laetitia; Painset, Anaïs; Le Gras, Stéphanie; Jost, Bernard; Crozatier, Michèle; Vincent, Alain

    2015-01-01

    Collier, the single Drosophila COE (Collier/EBF/Olf-1) transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col) targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya) is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles. PMID:26204530

  12. S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA

    PubMed Central

    Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

    2007-01-01

    The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376

  13. Structural and Functional Studies Indicate That the EPEC Effector, EspG, Directly Binds p21-Activated Kinase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Germane, Katherine L.; Spiller, Benjamin W.

    2011-09-20

    Bacterial pathogens secrete effectors into their hosts that subvert host defenses and redirect host processes. EspG is a type three secretion effector with a disputed function that is found in enteropathogenic Escherichia coli. Here we show that EspG is structurally similar to VirA, a Shigella virulence factor; EspG has a large, conserved pocket on its surface; EspG binds directly to the amino-terminal inhibitory domain of human p21-activated kinase (PAK); and mutations to conserved residues in the surface pocket disrupt the interaction with PAK.

  14. Differential Binding Models for Direct and Reverse Isothermal Titration Calorimetry.

    PubMed

    Herrera, Isaac; Winnik, Mitchell A

    2016-03-10

    Isothermal titration calorimetry (ITC) is a technique to measure the stoichiometry and thermodynamics from binding experiments. Identifying an appropriate mathematical model to evaluate titration curves of receptors with multiple sites is challenging, particularly when the stoichiometry or binding mechanism is not available. In a recent theoretical study, we presented a differential binding model (DBM) to study calorimetry titrations independently of the interaction among the binding sites (Herrera, I.; Winnik, M. A. J. Phys. Chem. B 2013, 117, 8659-8672). Here, we build upon our DBM and show its practical application to evaluate calorimetry titrations of receptors with multiple sites independently of the titration direction. Specifically, we present a set of ordinary differential equations (ODEs) with the general form d[S]/dV that can be integrated numerically to calculate the equilibrium concentrations of free and bound species S at every injection step and, subsequently, to evaluate the volume-normalized heat signal (δQ(V) = δq/dV) of direct and reverse calorimetry titrations. Additionally, we identify factors that influence the shape of the titration curve and can be used to optimize the initial concentrations of titrant and analyte. We demonstrate the flexibility of our updated DBM by applying these differentials and a global regression analysis to direct and reverse calorimetric titrations of gadolinium ions with multidentate ligands of increasing denticity, namely, diglycolic acid (DGA), citric acid (CIT), and nitrilotriacetic acid (NTA), and use statistical tests to validate the stoichiometries for the metal-ligand pairs studied.

  15. Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harada, Y.; Li, H.; Li, Hua

    2009-04-28

    Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of {approx}1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings,more » we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes.« less

  16. Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site

    PubMed Central

    Harada, Yoichiro; Li, Hua; Li, Huilin; Lennarz, William J.

    2009-01-01

    Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of ≈1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings, we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes. PMID:19365066

  17. Simian Immunodeficiency Virus and Human Immunodeficiency Virus Type 1 Nef Proteins Show Distinct Patterns and Mechanisms of Src Kinase Activation

    PubMed Central

    Greenway, Alison L.; Dutartre, Hélène; Allen, Kelly; McPhee, Dale A.; Olive, Daniel; Collette, Yves

    1999-01-01

    The nef gene from human and simian immunodeficiency viruses (HIV and SIV) regulates cell function and viral replication, possibly through binding of the nef product to cellular proteins, including Src family tyrosine kinases. We show here that the Nef protein encoded by SIVmac239 interacts with and also activates the human Src kinases Lck and Hck. This is in direct contrast to the inhibitory effect of HIV type 1 (HIV-1) Nef on Lck catalytic activity. Unexpectedly, however, the interaction of SIV Nef with human Lck or Hck is not mediated via its consensus proline motif, which is known to mediate HIV-1 Nef binding to Src homology 3 (SH3) domains, and various experimental analyses failed to show significant interaction of SIV Nef with the SH3 domain of either kinase. Instead, SIV Nef can bind Lck and Hck SH2 domains, and its N-terminal 50 amino acid residues are sufficient for Src kinase binding and activation. Our results provide evidence for multiple mechanisms by which Nef binds to and regulates Src kinases. PMID:10364375

  18. The Role of Interfacial Water in Protein-Ligand Binding: Insights from the Indirect Solvent Mediated Potential of Mean Force.

    PubMed

    Cui, Di; Zhang, Bin W; Matubayasi, Nobuyuki; Levy, Ronald M

    2018-02-13

    Classical density functional theory (DFT) can be used to relate the thermodynamic properties of solutions to the indirect solvent mediated part of the solute-solvent potential of mean force (PMF). Standard, but powerful numerical methods can be used to estimate the solute-solvent PMF from which the indirect part can be extracted. In this work we show how knowledge of the direct and indirect parts of the solute-solvent PMF for water at the interface of a protein receptor can be used to gain insights about how to design tighter binding ligands. As we show, the indirect part of the solute-solvent PMF is equal to the sum of the 1-body (energy + entropy) terms in the inhomogeneous solvation theory (IST) expansion of the solvation free energy. To illustrate the effect of displacing interfacial water molecules with particular direct/indirect PMF signatures on the binding of ligands, we carry out simulations of protein binding with several pairs of congeneric ligands. We show that interfacial water locations that contribute favorably or unfavorably at the 1-body level (energy + entropy) to the solvation free energy of the solute can be targeted as part of the ligand design process. Water locations where the indirect PMF is larger in magnitude provide better targets for displacement when adding a functional group to a ligand core.

  19. Cefradine blocks solar-ultraviolet induced skin inflammation through direct inhibition of T-LAK cell-originated protein kinase

    PubMed Central

    Ke, Changshu; Zhang, Guiping; Xiao, Juanjuan; Wu, Dan; Zeng, Xiaoyu; Chen, Jingwen; Guo, Jinguang; Zhou, Jie; Shi, Fei; Zhu, Feng

    2016-01-01

    Skin inflammation, and skin cancer induced by excessive solar ultraviolet (SUV) is a great threat to human health. SUV induced skin inflammation through activating p38 mitogen-activated protein kinase (p38) and c-Jun N-termeinal kinases (JNKs). T-LAK cell-originated protein kinase (TOPK) plays an important role in this process. Herein, the clinical data showed TOPK, phospho-p38, phospho-JNKs were highly expressed in human solar dermatitis. Ex vivo studies showed that SUV induced the phosphorylation of p38 and JNKs in HaCat and JB6 cells in a dose and time dependent manner. Molecule docking model indicated cefradine, an FDA-approved cephalosporin antibiotic, directly binds with TOPK. The result of in vitro binding assay verified cefradine can directly bind with TOPK. In vitro kinase results showed cefradine can inhibit TOPK activity. Ex vivo studies further showed cefradine inhibited SUV-induced the phosphorylation level of p38, JNKs and H2AX through inhibiting TOPK activity in a dose and time dependent manner, and cefradine inhibited the secretion of IL6 and TNF-α in HaCat and JB6 cells. In vivo studies showed that cefradine down-regulated SUV-induced the phosphorylation of p38, JNKs and H2AX and inhibited the secretion of IL6 and TNF-α in Babl/c mice. These results indicated that cefradine can inhibit SUV-induced skin inflammation by blocking TOPK signaling pathway, and TOPK is an effective target for suppressing inflammation induced by SUV irradiation. PMID:27016423

  20. Methyl pyropheophorbide-a analogues: potential fluorescent probes for the peripheral-type benzodiazepine receptor. Effect of central metal in photosensitizing efficacy.

    PubMed

    Chen, Yihui; Zheng, Xiang; Dobhal, Mahabeer P; Gryshuk, Amy; Morgan, Janet; Dougherty, Thomas J; Oseroff, Allan; Pandey, Ravindra K

    2005-06-02

    Pyropheophorbides and their metal complexes were synthesized to investigate their applications as nonradioactive peripheral benzodiazepine receptor (PBR) binding probes and photosensitizers for use in photodynamic therapy. They were found to be localized in mitochondria and showed significant binding to PBR. In some cases, the PBR binding values were similar to that for 17 (PK11195, 1-(2-chlorophenyl)-N-methyl-N-(1-methylpropyl)isoquinoline-3-carboxamide). However, no direct correlation between 17 displacement ability and photosensitizing efficacy of photosensitizers was observed.

  1. Re-engineering the zinc fingers of PRDM9 reverses hybrid sterility in mice.

    PubMed

    Davies, Benjamin; Hatton, Edouard; Altemose, Nicolas; Hussin, Julie G; Pratto, Florencia; Zhang, Gang; Hinch, Anjali Gupta; Moralli, Daniela; Biggs, Daniel; Diaz, Rebeca; Preece, Chris; Li, Ran; Bitoun, Emmanuelle; Brick, Kevin; Green, Catherine M; Camerini-Otero, R Daniel; Myers, Simon R; Donnelly, Peter

    2016-02-11

    The DNA-binding protein PRDM9 directs positioning of the double-strand breaks (DSBs) that initiate meiotic recombination in mice and humans. Prdm9 is the only mammalian speciation gene yet identified and is responsible for sterility phenotypes in male hybrids of certain mouse subspecies. To investigate PRDM9 binding and its role in fertility and meiotic recombination, we humanized the DNA-binding domain of PRDM9 in C57BL/6 mice. This change repositions DSB hotspots and completely restores fertility in male hybrids. Here we show that alteration of one Prdm9 allele impacts the behaviour of DSBs controlled by the other allele at chromosome-wide scales. These effects correlate strongly with the degree to which each PRDM9 variant binds both homologues at the DSB sites it controls. Furthermore, higher genome-wide levels of such 'symmetric' PRDM9 binding associate with increasing fertility measures, and comparisons of individual hotspots suggest binding symmetry plays a downstream role in the recombination process. These findings reveal that subspecies-specific degradation of PRDM9 binding sites by meiotic drive, which steadily increases asymmetric PRDM9 binding, has impacts beyond simply changing hotspot positions, and strongly support a direct involvement in hybrid infertility. Because such meiotic drive occurs across mammals, PRDM9 may play a wider, yet transient, role in the early stages of speciation.

  2. Landmark and route knowledge in children's spatial representation of a virtual environment.

    PubMed

    Nys, Marion; Gyselinck, Valérie; Orriols, Eric; Hickmann, Maya

    2014-01-01

    This study investigates the development of landmark and route knowledge in complex wayfinding situations. It focuses on how children (aged 6, 8, and 10 years) and young adults (n = 79) indicate, recognize, and bind landmarks and directions in both verbal and visuo-spatial tasks after learning a virtual route. Performance in these tasks is also related to general verbal and visuo-spatial abilities as assessed by independent standardized tests (attention, working memory, perception of direction, production and comprehension of spatial terms, sentences and stories). The results first show that the quantity and quality of landmarks and directions produced and recognized by participants in both verbal and visuo-spatial tasks increased with age. In addition, an increase with age was observed in participants' selection of decisional landmarks (i.e., landmarks associated with a change of direction), as well as in their capacity to bind landmarks and directions. Our results support the view that children first acquire landmark knowledge, then route knowledge, as shown by their late developing ability to bind knowledge of directions and landmarks. Overall, the quality of verbal and visuo-spatial information in participants' spatial representations was found to vary mostly with their visuo-spatial abilities (attention and perception of directions) and not with their verbal abilities. Interestingly, however, when asked to recognize landmarks encountered during the route, participants show an increasing bias with age toward choosing a related landmark of the same category, regardless of its visual characteristics, i.e., they incorrectly choose the picture of another fountain. The discussion highlights the need for further studies to determine more precisely the role of verbal and visuo-spatial knowledge and the nature of how children learn to represent and memorize routes.

  3. Legume receptors perceive the rhizobial lipochitin oligosaccharide signal molecules by direct binding

    PubMed Central

    Broghammer, Angelique; Krusell, Lene; Blaise, Mickaël; Sauer, Jørgen; Sullivan, John T.; Maolanon, Nicolai; Vinther, Maria; Lorentzen, Andrea; Madsen, Esben B.; Jensen, Knud J.; Roepstorff, Peter; Thirup, Søren; Ronson, Clive W.; Thygesen, Mikkel B.; Stougaard, Jens

    2012-01-01

    Lipochitin oligosaccharides called Nod factors function as primary rhizobial signal molecules triggering legumes to develop new plant organs: root nodules that host the bacteria as nitrogen-fixing bacteroids. Here, we show that the Lotus japonicus Nod factor receptor 5 (NFR5) and Nod factor receptor 1 (NFR1) bind Nod factor directly at high-affinity binding sites. Both receptor proteins were posttranslationally processed when expressed as fusion proteins and extracted from purified membrane fractions of Nicotiana benthamiana or Arabidopsis thaliana. The N-terminal signal peptides were cleaved, and NFR1 protein retained its in vitro kinase activity. Processing of NFR5 protein was characterized by determining the N-glycosylation patterns of the ectodomain. Two different glycan structures with identical composition, Man3XylFucGlcNAc4, were identified by mass spectrometry and located at amino acid positions N68 and N198. Receptor–ligand interaction was measured by using ligands that were labeled or immobilized by application of chemoselective chemistry at the anomeric center. High-affinity ligand binding was demonstrated with both solid-phase and free solution techniques. The Kd values obtained for Nod factor binding were in the nanomolar range and comparable to the concentration range sufficient for biological activity. Structure-dependent ligand specificity was shown by using chitin oligosaccharides. Taken together, our results suggest that ligand recognition through direct ligand binding is a key step in the receptor-mediated activation mechanism leading to root nodule development in legumes. PMID:22859506

  4. Lis1 acts as a "clutch" between the ATPase and microtubule-binding domains of the dynein motor.

    PubMed

    Huang, Julie; Roberts, Anthony J; Leschziner, Andres E; Reck-Peterson, Samara L

    2012-08-31

    The lissencephaly protein Lis1 has been reported to regulate the mechanical behavior of cytoplasmic dynein, the primary minus-end-directed microtubule motor. However, the regulatory mechanism remains poorly understood. Here, we address this issue using purified proteins from Saccharomyces cerevisiae and a combination of techniques, including single-molecule imaging and single-particle electron microscopy. We show that rather than binding to the main ATPase site within dynein's AAA+ ring or its microtubule-binding stalk directly, Lis1 engages the interface between these elements. Lis1 causes individual dynein motors to remain attached to microtubules for extended periods, even during cycles of ATP hydrolysis that would canonically induce detachment. Thus, Lis1 operates like a "clutch" that prevents dynein's ATPase domain from transmitting a detachment signal to its track-binding domain. We discuss how these findings provide a conserved mechanism for dynein functions in living cells that require prolonged microtubule attachments. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Lis1 Acts as a “Clutch” between the ATPase and Microtubule-Binding Domains of the Dynein Motor

    PubMed Central

    Huang, Julie; Roberts, Anthony J.; Leschziner, Andres E.; Reck-Peterson, Samara L.

    2012-01-01

    Summary The lissencephaly protein Lis1 has been reported to regulate the mechanical behavior of cytoplasmic dynein, the primary minus-end-directed microtubule motor. However, the regulatory mechanism remains poorly understood. Here, we address this issue using purified proteins from Saccharomyces cerevisiae and a combination of techniques, including single-molecule imaging and single-particle electron microscopy. We show that rather than binding to the main ATPase site within dynein's AAA+ ring or its microtubule-binding stalk directly, Lis1 engages the interface between these elements. Lis1 causes individual dynein motors to remain attached to microtubules for extended periods, even during cycles of ATP hydrolysis that would canonically induce detachment. Thus, Lis1 operates like a “clutch” that prevents dynein's ATPase domain from transmitting a detachment signal to its track-binding domain. We discuss how these findings provide a conserved mechanism for dynein functions in living cells that require prolonged microtubule attachments. PMID:22939623

  6. Structure of colicin I receptor bound to the R-domain of colicin Ia: implications for protein import

    PubMed Central

    Buchanan, Susan K; Lukacik, Petra; Grizot, Sylvestre; Ghirlando, Rodolfo; Ali, Maruf M U; Barnard, Travis J; Jakes, Karen S; Kienker, Paul K; Esser, Lothar

    2007-01-01

    Colicin Ia is a 69 kDa protein that kills susceptible Escherichia coli cells by binding to a specific receptor in the outer membrane, colicin I receptor (70 kDa), and subsequently translocating its channel forming domain across the periplasmic space, where it inserts into the inner membrane and forms a voltage-dependent ion channel. We determined crystal structures of colicin I receptor alone and in complex with the receptor binding domain of colicin Ia. The receptor undergoes large and unusual conformational changes upon colicin binding, opening at the cell surface and positioning the receptor binding domain of colicin Ia directly above it. We modelled the interaction with full-length colicin Ia to show that the channel forming domain is initially positioned 150 Å above the cell surface. Functional data using full-length colicin Ia show that colicin I receptor is necessary for cell surface binding, and suggest that the receptor participates in translocation of colicin Ia across the outer membrane. PMID:17464289

  7. The Iron-Dependent Regulation of the Candida albicans Oxidative Stress Response by the CCAAT-Binding Factor

    PubMed Central

    Chakravarti, Ananya; Camp, Kyle; McNabb, David S.

    2017-01-01

    Candida albicans is the most frequently encountered fungal pathogen in humans, capable of causing mucocutaneous and systemic infections in immunocompromised individuals. C. albicans virulence is influenced by multiple factors. Importantly, iron acquisition and avoidance of the immune oxidative burst are two critical barriers for survival in the host. Prior studies using whole genome microarray expression data indicated that the CCAAT-binding factor is involved in the regulation of iron uptake/utilization and the oxidative stress response. This study examines directly the role of the CCAAT-binding factor in regulating the expression of oxidative stress genes in response to iron availability. The CCAAT-binding factor is a heterooligomeric transcription factor previously shown to regulate genes involved in respiration and iron uptake/utilization in C. albicans. Since these pathways directly influence the level of free radicals, it seemed plausible the CCAAT-binding factor regulates genes necessary for the oxidative stress response. In this study, we show the CCAAT-binding factor is involved in regulating some oxidative stress genes in response to iron availability, including CAT1, SOD4, GRX5, and TRX1. We also show that CAT1 expression and catalase activity correlate with the survival of C. albicans to oxidative stress, providing a connection between iron obtainability and the oxidative stress response. We further explore the role of the various CCAAT-binding factor subunits in the formation of distinct protein complexes that modulate the transcription of CAT1 in response to iron. We find that Hap31 and Hap32 can compensate for each other in the formation of an active transcriptional complex; however, they play distinct roles in the oxidative stress response during iron limitation. Moreover, Hap43 was found to be solely responsible for the repression observed under iron deprivation. PMID:28122000

  8. Overexpression of Transcription Factor Sp1 Leads to Gene Expression Perturbations and Cell Cycle Inhibition

    PubMed Central

    Deniaud, Emmanuelle; Baguet, Joël; Chalard, Roxane; Blanquier, Bariza; Brinza, Lilia; Meunier, Julien; Michallet, Marie-Cécile; Laugraud, Aurélie; Ah-Soon, Claudette; Wierinckx, Anne; Castellazzi, Marc; Lachuer, Joël; Gautier, Christian

    2009-01-01

    Background The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. Methodology and Principal Findings We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. Conclusion This study shows that the binding to DNA of overexpressed Sp1 induces an inhibition of cell cycle progression that precedes apoptosis and a transcriptional response targeting genes containing Sp1 binding sites in their promoter or not suggesting both direct Sp1-driven transcription and indirect mechanisms. PMID:19753117

  9. RPA binds histone H3-H4 and functions in DNA replication-coupled nucleosome assembly.

    PubMed

    Liu, Shaofeng; Xu, Zhiyun; Leng, He; Zheng, Pu; Yang, Jiayi; Chen, Kaifu; Feng, Jianxun; Li, Qing

    2017-01-27

    DNA replication-coupled nucleosome assembly is essential to maintain genome integrity and retain epigenetic information. Multiple involved histone chaperones have been identified, but how nucleosome assembly is coupled to DNA replication remains elusive. Here we show that replication protein A (RPA), an essential replisome component that binds single-stranded DNA, has a role in replication-coupled nucleosome assembly. RPA directly binds free H3-H4. Assays using a synthetic sequence that mimics freshly unwound single-stranded DNA at replication fork showed that RPA promotes DNA-(H3-H4) complex formation immediately adjacent to double-stranded DNA. Further, an RPA mutant defective in H3-H4 binding exhibited attenuated nucleosome assembly on nascent chromatin. Thus, we propose that RPA functions as a platform for targeting histone deposition to replication fork, through which RPA couples nucleosome assembly with ongoing DNA replication. Copyright © 2017, American Association for the Advancement of Science.

  10. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

    PubMed

    Schneider, T D

    2001-12-01

    The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

  11. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    PubMed

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common feature which defines the capacity of these elements to confer T3 induction.

  12. Apo states of calmodulin and CaBP1 control CaV1 voltage-gated calcium channel function through direct competition for the IQ domain.

    PubMed

    Findeisen, Felix; Rumpf, Christine H; Minor, Daniel L

    2013-09-09

    In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation and limits calcium entry, whereas CaBP1 blocks calcium-dependent inactivation (CDI) and allows sustained calcium influx. Here, we combine isothermal titration calorimetry with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca(2+)/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium-binding properties. The observation that the apo forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Developmental roles of 21 Drosophila transcription factors are determined by quantitative differences in binding to an overlapping set of thousands of genomic regions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MacArthur, Stewart; Li, Xiao-Yong; Li, Jingyi

    2009-05-15

    BACKGROUND: We previously established that six sequence-specific transcription factors that initiate anterior/posterior patterning in Drosophila bind to overlapping sets of thousands of genomic regions in blastoderm embryos. While regions bound at high levels include known and probable functional targets, more poorly bound regions are preferentially associated with housekeeping genes and/or genes not transcribed in the blastoderm, and are frequently found in protein coding sequences or in less conserved non-coding DNA, suggesting that many are likely non-functional. RESULTS: Here we show that an additional 15 transcription factors that regulate other aspects of embryo patterning show a similar quantitative continuum of functionmore » and binding to thousands of genomic regions in vivo. Collectively, the 21 regulators show a surprisingly high overlap in the regions they bind given that they belong to 11 DNA binding domain families, specify distinct developmental fates, and can act via different cis-regulatory modules. We demonstrate, however, that quantitative differences in relative levels of binding to shared targets correlate with the known biological and transcriptional regulatory specificities of these factors. CONCLUSIONS: It is likely that the overlap in binding of biochemically and functionally unrelated transcription factors arises from the high concentrations of these proteins in nuclei, which, coupled with their broad DNA binding specificities, directs them to regions of open chromatin. We suggest that most animal transcription factors will be found to show a similar broad overlapping pattern of binding in vivo, with specificity achieved by modulating the amount, rather than the identity, of bound factor.« less

  14. States of direct and indirect excitons in strained zinc-blende GaN/InGaN asymmetric quantum wells

    NASA Astrophysics Data System (ADS)

    Rojas-Briseño, J. G.; Martínez-Orozco, J. C.; Mora-Ramos, M. E.

    2017-12-01

    The total and binding energies of excitons in step-like asymmetric quantum wells made of zincblende GaN/InxlGa(1-xl)N/InxrGa(1-xr)N/GaN are theoretically reported. It is discussed how the asymmetry in the carrier confinement leads to singular behaviors in the exciton binding energy, allowing to observe both direct and indirect exciton states in the heterostructure. The study is carried out with the use of the effective mass approximation. The effects of strain are taken into account and a comparison of the results obtained for both strained and unstrained situations is presented. Exciton energy shows a decreasing behavior when the size of the effective confinement region is augmented. The total exciton energy as well as the binding energy are reported as functions of the indium concentration and quantum well width. In addition, the results of the calculation of the photoluminescence peak are presented. For this latter quantity, our results for the limiting case of a single zinc-blende GaN/InGaN quantum well show very good agreement with published experimental ones.

  15. Direct induction of T lymphocyte-specific gene expression by the mammalian Notch signaling pathway

    PubMed Central

    Reizis, Boris; Leder, Philip

    2002-01-01

    The Notch signaling pathway regulates the commitment and early development of T lymphocytes. We studied Notch-mediated induction of the pre-T cell receptor α (pTa) gene, a T-cell-specific transcriptional target of Notch. The pTa enhancer was activated by Notch signaling and contained binding sites for its nuclear effector, CSL. Mutation of the CSL-binding sites abolished enhancer induction by Notch and delayed the up-regulation of pTa transgene expression during T cell lineage commitment. These results show a direct mechanism of stage- and tissue-specific gene induction by the mammalian Notch/CSL signaling pathway. PMID:11825871

  16. Ternary Complex Factors and Cofactors Are Essential for Human T-Cell Leukemia Virus Type 1 Tax Transactivation of the Serum Response Element

    PubMed Central

    Shuh, Maureen; Derse, David

    2000-01-01

    The human T-cell leukemia virus type 1 Tax protein activates the expression of cellular immediate early genes controlled by the serum response element (SRE), which contains both the serum response factor (SRF) binding element (CArG box) and the ternary complex factor (TCF) binding element (Ets box). We show that TCF binding is necessary for Tax activation of the SRE and that Tax directly interacts with TCFs in vitro. In addition, Tax interactions with CREB binding protein (CBP) and p300- and CBP-associated factor were found to be essential for Tax activation of SRF-mediated transcription. PMID:11070040

  17. Affinities of penicillins and cephalosporins for the penicillin-binding proteins of Escherichia coli K-12 and their antibacterial activity.

    PubMed Central

    Curtis, N A; Orr, D; Ross, G W; Boulton, M G

    1979-01-01

    The affinities of a range of penicillins and cephalosporins for ther penicillin-binding proteins of Escherichia coli K-12 have been studied, and the results were compared with the antibacterial activity of the compounds against E. coli K-12 and an isogenic permeability mutant. Different penicillins and cephalosporins exhibited different affinities for the "essential" penicillin-binding proteins of E. coli K-12, in a manner which directly correlated with their observed effects upon bacterial morphology. Furthermore, the affinities of the compounds for their "primary" lethal penicillin-binding protein targets showed close agreement with their antibacterial activities against the permeability mutant. Images PMID:393164

  18. Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

    PubMed

    Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

    2015-09-10

    The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

  19. How Does Mg2+ Modulate the RNA Folding Mechanism: A Case Study of the G:C W:W Trans Basepair.

    PubMed

    Halder, Antarip; Roy, Rohit; Bhattacharyya, Dhananjay; Mitra, Abhijit

    2017-07-25

    Reverse Watson-Crick G:C basepairs (G:C W:W Trans) occur frequently in different functional RNAs. This is one of the few basepairs whose gas-phase-optimized isolated geometry is inconsistent with the corresponding experimental geometry. Several earlier studies indicate that through post-transcriptional modification, direct protonation, or coordination with Mg 2+ , accumulation of positive charge near N7 of guanine can stabilize the experimental geometry. Interestingly, recent studies reveal significant variation in the position of putatively bound Mg 2+ . This, in conjunction with recently raised doubts regarding some of the Mg 2+ assignments near the imino nitrogen of guanine, is suggestive of the existence of multiple Mg 2+ binding modes for this basepair. Our detailed investigation of Mg 2+ -bound G:C W:W Trans pairs occurring in high-resolution RNA crystal structures shows that they are found in 14 different contexts, eight of which display Mg 2+ binding at the Hoogsteen edge of guanine. Further examination of occurrences in these eight contexts led to the characterization of three different Mg 2+ binding modes: 1) direct binding via N7 coordination, 2) direct binding via O6 coordination, and 3) binding via hydrogen-bonding interaction with the first-shell water molecules. In the crystal structures, the latter two modes are associated with a buckled and propeller-twisted geometry of the basepair. Interestingly, respective optimized geometries of these different Mg 2+ binding modes (optimized using six different DFT functionals) are consistent with their corresponding experimental geometries. Subsequent interaction energy calculations at the MP2 level, and decomposition of its components, suggest that for G:C W:W Trans , Mg 2+ binding can fine tune the basepair geometries without compromising with their stability. Our results, therefore, underline the importance of the mode of binding of Mg 2+ ions in shaping RNA structure, folding and function. Copyright © 2017. Published by Elsevier Inc.

  20. Addition of lysophospholipids with large head groups to cells inhibits Shiga toxin binding.

    PubMed

    Ailte, Ieva; Lingelem, Anne Berit Dyve; Kavaliauskiene, Simona; Bergan, Jonas; Kvalvaag, Audun Sverre; Myrann, Anne-Grethe; Skotland, Tore; Sandvig, Kirsten

    2016-07-26

    Shiga toxin (Stx), an AB5 toxin, binds specifically to the neutral glycosphingolipid Gb3 at the cell surface before being transported into cells. We here demonstrate that addition of conical lysophospholipids (LPLs) with large head groups inhibit Stx binding to cells whereas LPLs with small head groups do not. Lysophosphatidylinositol (LPI 18:0), the most efficient LPL with the largest head group, was selected for in-depth investigations to study how the binding of Stx is regulated. We show that the inhibition of Stx binding by LPI is reversible and possibly regulated by cholesterol since addition of methyl-β-cyclodextrin (mβCD) reversed the ability of LPI to inhibit binding. LPI-induced inhibition of Stx binding is independent of signalling and membrane turnover as it occurs in fixed cells as well as after depletion of cellular ATP. Furthermore, data obtained with fluorescent membrane dyes suggest that LPI treatment has a direct effect on plasma membrane lipid packing with shift towards a liquid disordered phase in the outer leaflet, while lysophosphoethanolamine (LPE), which has a small head group, does not. In conclusion, our data show that cellular treatment with conical LPLs with large head groups changes intrinsic properties of the plasma membrane and modulates Stx binding to Gb3.

  1. DIRECT BINDING OF GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE TO TELOMERIC DNA PROTECTS TELOMERES AGAINST CHEMOTHERAPY-INDUCED RAPID DEGRADATION

    PubMed Central

    Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher

    2009-01-01

    GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890

  2. SOS response in bacteria: Inhibitory activity of lichen secondary metabolites against Escherichia coli RecA protein.

    PubMed

    Bellio, Pierangelo; Di Pietro, Letizia; Mancini, Alisia; Piovano, Marisa; Nicoletti, Marcello; Brisdelli, Fabrizia; Tondi, Donatella; Cendron, Laura; Franceschini, Nicola; Amicosante, Gianfranco; Perilli, Mariagrazia; Celenza, Giuseppe

    2017-06-15

    RecA is a bacterial multifunctional protein essential to genetic recombination, error-prone replicative bypass of DNA damages and regulation of SOS response. The activation of bacterial SOS response is directly related to the development of intrinsic and/or acquired resistance to antimicrobials. Although recent studies directed towards RecA inactivation via ATP binding inhibition described a variety of micromolar affinity ligands, inhibitors of the DNA binding site are still unknown. Twenty-seven secondary metabolites classified as anthraquinones, depsides, depsidones, dibenzofurans, diphenyl-butenolides, paraconic acids, pseudo-depsidones, triterpenes and xanthones, were investigated for their ability to inhibit RecA from Escherichia coli. They were isolated in various Chilean regions from 14 families and 19 genera of lichens. The ATP hydrolytic activity of RecA was quantified detecting the generation of free phosphate in solution. The percentage of inhibition was calculated fixing at 100µM the concentration of the compounds. Deeper investigations were reserved to those compounds showing an inhibition higher than 80%. To clarify the mechanism of inhibition, the semi-log plot of the percentage of inhibition vs. ATP and vs. ssDNA, was evaluated. Only nine compounds showed a percentage of RecA inhibition higher than 80% (divaricatic, perlatolic, alpha-collatolic, lobaric, lichesterinic, protolichesterinic, epiphorellic acids, sphaerophorin and tumidulin). The half-inhibitory concentrations (IC 50 ) calculated for these compounds were ranging from 14.2µM for protolichesterinic acid to 42.6µM for sphaerophorin. Investigations on the mechanism of inhibition showed that all compounds behaved as uncompetitive inhibitors for ATP binding site, with the exception of epiphorellic acid which clearly acted as non-competitive inhibitor of the ATP site. Further investigations demonstrated that epiphorellic acid competitively binds the ssDNA binding site. Kinetic data were confirmed by molecular modelling binding predictions which shows that epiphorellic acid is expected to bind the ssDNA site into the L2 loop of RecA protein. In this paper the first RecA ssDNA binding site ligand is described. Our study sets epiphorellic acid as a promising hit for the development of more effective RecA inhibitors. In our drug discovery approach, natural products in general and lichen in particular, represent a successful source of active ligands and structural diversity. Copyright © 2017 Elsevier GmbH. All rights reserved.

  3. Selective Cooperation between Fatty Acid Binding Proteins and Peroxisome Proliferator-Activated Receptors in Regulating Transcription

    PubMed Central

    Tan, Nguan-Soon; Shaw, Natacha S.; Vinckenbosch, Nicolas; Liu, Peng; Yasmin, Rubina; Desvergne, Béatrice; Wahli, Walter; Noy, Noa

    2002-01-01

    Lipophilic compounds such as retinoic acid and long-chain fatty acids regulate gene transcription by activating nuclear receptors such as retinoic acid receptors (RARs) and peroxisome proliferator-activated receptors (PPARs). These compounds also bind in cells to members of the family of intracellular lipid binding proteins, which includes cellular retinoic acid-binding proteins (CRABPs) and fatty acid binding proteins (FABPs). We previously reported that CRABP-II enhances the transcriptional activity of RAR by directly targeting retinoic acid to the receptor. Here, potential functional cooperation between FABPs and PPARs in regulating the transcriptional activities of their common ligands was investigated. We show that adipocyte FABP and keratinocyte FABP (A-FABP and K-FABP, respectively) selectively enhance the activities of PPARγ and PPARβ, respectively, and that these FABPs massively relocate to the nucleus in response to selective ligands for the PPAR isotype which they activate. We show further that A-FABP and K-FABP interact directly with PPARγ and PPARβ and that they do so in a receptor- and ligand-selective manner. Finally, the data demonstrate that the presence of high levels of K-FABP in keratinocytes is essential for PPARβ-mediated induction of differentiation of these cells. Taken together, the data establish that A-FABP and K-FABP govern the transcriptional activities of their ligands by targeting them to cognate PPARs in the nucleus, thereby enabling PPARs to exert their biological functions. PMID:12077340

  4. Dual Role of DNA in Regulating ATP Hydrolysis by the SopA Partition Protein*

    PubMed Central

    Ah-Seng, Yoan; Lopez, Frederic; Pasta, Franck; Lane, David; Bouet, Jean-Yves

    2009-01-01

    In bacteria, mitotic stability of plasmids and many chromosomes depends on replicon-specific systems, which comprise a centromere, a centromere-binding protein and an ATPase. Dynamic self-assembly of the ATPase appears to enable active partition of replicon copies into cell-halves, but for Walker-box partition ATPases the molecular mechanism is unknown. ATPase activity appears to be essential for this process. DNA and centromere-binding proteins are known to stimulate the ATPase activity but molecular details of the stimulation mechanism have not been reported. We have investigated the interactions which stimulate ATP hydrolysis by the SopA partition ATPase of plasmid F. By using SopA and SopB proteins deficient in DNA binding, we have found that the intrinsic ability of SopA to hydrolyze ATP requires direct DNA binding by SopA but not by SopB. Our results show that two independent interactions of SopA act in synergy to stimulate its ATPase. SopA must interact with (i) DNA, through its ATP-dependent nonspecific DNA binding domain and (ii) SopB, which we show here to provide an arginine-finger motif. In addition, the latter interaction stimulates ATPase maximally when SopB is part of the partition complex. Hence, our data demonstrate that DNA acts on SopA in two ways, directly as nonspecific DNA and through SopB as centromeric DNA, to fully activate SopA ATP hydrolysis. PMID:19740757

  5. Structural evolution of luciferase activity in Zophobas mealworm AMP/CoA-ligase (protoluciferase) through site-directed mutagenesis of the luciferin binding site.

    PubMed

    Prado, R A; Barbosa, J A; Ohmiya, Y; Viviani, V R

    2011-07-01

    The structural origin and evolution of bioluminescent activity of beetle luciferases from AMP/CoA ligases remains a mystery. Previously we cloned the luciferase-like enzyme from Zophobas morio mealworm, a reasonable protoluciferase model that could shine light on this mystery. Kinetic characterization and studies with D- and L-luciferin and their adenylates showed that stereoselectivity constitutes a critical feature for the origin of luciferase activity in AMP/CoA ligases. Comparison of the primary structures and modeling studies of this protoluciferase and the three main families of beetle luciferases showed that the carboxylic acid substrate binding site of this enzyme is smaller and more hydrophobic than the luciferin binding site of beetle luciferases, showing several substitutions of otherwise conserved residues. Thus, here we performed a site-directed mutagenesis survey of the carboxylic binding site motifs of the protoluciferase by replacing their residues by the respective conserved ones found in beetle luciferases in order to identify the structural determinants of luciferase/oxygenase activity. Although most of the substitutions had negative impact on the luminescence activity of the protoluciferase, only the substitution I327T improved the luminescence activity, resulting in a broad and 15 nm blue-shifted luminescence spectrum. Such substitution indicates the importance of the loop motif 322YGMSEI327 (341YGLTETT347 in Photinus pyralis luciferase) for luciferase activity, and indicates a possible route for the evolution of bioluminescence function of beetle luciferases.

  6. Solid-binding peptides: smart tools for nanobiotechnology.

    PubMed

    Care, Andrew; Bergquist, Peter L; Sunna, Anwar

    2015-05-01

    Over the past decade, solid-binding peptides (SBPs) have been used increasingly as molecular building blocks in nanobiotechnology. These peptides show selectivity and bind with high affinity to the surfaces of a diverse range of solid materials including metals, metal oxides, metal compounds, magnetic materials, semiconductors, carbon materials, polymers, and minerals. They can direct the assembly and functionalisation of materials, and have the ability to mediate the synthesis and construction of nanoparticles and complex nanostructures. As the availability of newly synthesised nanomaterials expands rapidly, so too do the potential applications for SBPs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Direct Transmembrane Interaction between Actin and the Pore-Competent, Cholesterol-Dependent Cytolysin Pneumolysin

    PubMed Central

    Hupp, Sabrina; Förtsch, Christina; Wippel, Carolin; Ma, Jiangtao; Mitchell, Timothy J.; Iliev, Asparouh I.

    2013-01-01

    The eukaryotic actin cytoskeleton is an evolutionarily well-established pathogen target, as a large number of bacterial factors disturb its dynamics to alter the function of the host cells. These pathogenic factors modulate or mimic actin effector proteins or they modify actin directly, leading to an imbalance of the precisely regulated actin turnover. Here, we show that the pore-forming, cholesterol-dependent cytolysin pneumolysin (PLY), a major neurotoxin of Streptococcus pneumoniae, has the capacity to bind actin directly and to enhance actin polymerisation in vitro. In cells, the toxin co-localised with F-actin shortly after exposure, and this direct interaction was verified by Förster resonance energy transfer. PLY was capable of exerting its effect on actin through the lipid bilayer of giant unilamellar vesicles, but only when its pore competence was preserved. The dissociation constant of G-actin binding to PLY in a biochemical environment was 170–190 nM, which is indicative of a high-affinity interaction, comparable to the affinity of other intracellular actin-binding factors. Our results demonstrate the first example of a direct interaction of a pore-forming toxin with cytoskeletal components, suggesting that the cross talk between pore-forming cytolysins and cells is more complex than previously thought. PMID:23219469

  8. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    PubMed Central

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  9. Triiodothyronine enhances accumulation of intracellular lipids in adipocytes through thyroid hormone receptor α via direct and indirect mechanisms.

    PubMed

    Gambo, Yurina; Matsumura, Miki; Fujimori, Ko

    2016-08-15

    Triiodothyronine (T3) enhanced the expression of adipogenic and lipogenic genes with elevation of the intracellular lipids through thyroid hormone receptor (TR) α in mouse 3T3-L1 cells. However, the transcription of the SREBP-1c and HSL genes was decreased by T3. Such T3-mediated alterations were negated by TRα siRNA. Chromatin immunoprecipitation assay showed that the binding of TRα to the TR-responsive element (TRE) of the FAS promoter was elevated by T3. In contrast, the ability of TRα to bind to the TRE of the SREBP-1c promoter was decreased by T3. In addition, the binding of SREBP-1c to the SRE of the HSL promoter was lowered by T3. These results indicate that T3 increased the accumulation of intracellular lipids by enhancing the expression of the FAS gene through direct binding of TRα to the FAS promoter and simultaneously lowered the amount of lipolysis via reduced binding of T3-decreased SREBP-1c to the HSL promoter. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Structure of the transcriptional regulator LmrR and its mechanism of multidrug recognition.

    PubMed

    Madoori, Pramod Kumar; Agustiandari, Herfita; Driessen, Arnold J M; Thunnissen, Andy-Mark W H

    2009-01-21

    LmrR is a PadR-related transcriptional repressor that regulates the production of LmrCD, a major multidrug ABC transporter in Lactococcus lactis. Transcriptional regulation is presumed to follow a drug-sensitive induction mechanism involving the direct binding of transporter ligands to LmrR. Here, we present crystal structures of LmrR in an apo state and in two drug-bound states complexed with Hoechst 33342 and daunomycin. LmrR shows a common topology containing a typical beta-winged helix-turn-helix domain with an additional C-terminal helix involved in dimerization. Its dimeric organization is highly unusual with a flat-shaped hydrophobic pore at the dimer centre serving as a multidrug-binding site. The drugs bind in a similar manner with their aromatic rings sandwiched in between the indole groups of two dimer-related tryptophan residues. Multidrug recognition is facilitated by conformational plasticity and the absence of drug-specific hydrogen bonds. Combined analyses using site-directed mutagenesis, fluorescence-based drug binding and protein-DNA gel shift assays reveal an allosteric coupling between the multidrug- and DNA-binding sites of LmrR that most likely has a function in the induction mechanism.

  11. Site-directed Mutagenesis Shows the Significance of Interactions with Phospholipids and the G-protein OsYchF1 for the Physiological Functions of the Rice GTPase-activating Protein 1 (OsGAP1).

    PubMed

    Yung, Yuk-Lin; Cheung, Ming-Yan; Miao, Rui; Fong, Yu-Hang; Li, Kwan-Pok; Yu, Mei-Hui; Chye, Mee-Len; Wong, Kam-Bo; Lam, Hon-Ming

    2015-09-25

    The C2 domain is one of the most diverse phospholipid-binding domains mediating cellular signaling. One group of C2-domain proteins are plant-specific and are characterized by their small sizes and simple structures. We have previously reported that a member of this group, OsGAP1, is able to alleviate salt stress and stimulate defense responses, and bind to both phospholipids and an unconventional G-protein, OsYchF1. Here we solved the crystal structure of OsGAP1 to a resolution of 1.63 Å. Using site-directed mutagenesis, we successfully differentiated between the clusters of surface residues that are required for binding to phospholipids versus OsYchF1, which, in turn, is critical for its role in stimulating defense responses. On the other hand, the ability to alleviate salt stress by OsGAP1 is dependent only on its ability to bind OsYchF1 and is independent of its phospholipid-binding activity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Direct uptake and degradation of DNA by lysosomes

    PubMed Central

    Fujiwara, Yuuki; Kikuchi, Hisae; Aizawa, Shu; Furuta, Akiko; Hatanaka, Yusuke; Konya, Chiho; Uchida, Kenko; Wada, Keiji; Kabuta, Tomohiro

    2013-01-01

    Lysosomes contain various hydrolases that can degrade proteins, lipids, nucleic acids and carbohydrates. We recently discovered “RNautophagy,” an autophagic pathway in which RNA is directly taken up by lysosomes and degraded. A lysosomal membrane protein, LAMP2C, a splice variant of LAMP2, binds to RNA and acts as a receptor for this pathway. In the present study, we show that DNA is also directly taken up by lysosomes and degraded. Like RNautophagy, this autophagic pathway, which we term “DNautophagy,” is dependent on ATP. The cytosolic sequence of LAMP2C also directly interacts with DNA, and LAMP2C functions as a receptor for DNautophagy, in addition to RNautophagy. Similarly to RNA, DNA binds to the cytosolic sequences of fly and nematode LAMP orthologs. Together with the findings of our previous study, our present findings suggest that RNautophagy and DNautophagy are evolutionarily conserved systems in Metazoa. PMID:23839276

  13. Computational Investigation of Glycosylation Effects on a Family 1 Carbohydrate-binding Module*

    PubMed Central

    Taylor, Courtney B.; Talib, M. Faiz; McCabe, Clare; Bu, Lintao; Adney, William S.; Himmel, Michael E.; Crowley, Michael F.; Beckham, Gregg T.

    2012-01-01

    Carbohydrate-binding modules (CBMs) are ubiquitous components of glycoside hydrolases, which degrade polysaccharides in nature. CBMs target specific polysaccharides, and CBM binding affinity to cellulose is known to be proportional to cellulase activity, such that increasing binding affinity is an important component of performance improvement. To ascertain the impact of protein and glycan engineering on CBM binding, we use molecular simulation to quantify cellulose binding of a natively glycosylated Family 1 CBM. To validate our approach, we first examine aromatic-carbohydrate interactions on binding, and our predictions are consistent with previous experiments, showing that a tyrosine to tryptophan mutation yields a 2-fold improvement in binding affinity. We then demonstrate that enhanced binding of 3–6-fold over a nonglycosylated CBM is achieved by the addition of a single, native mannose or a mannose dimer, respectively, which has not been considered previously. Furthermore, we show that the addition of a single, artificial glycan on the anterior of the CBM, with the native, posterior glycans also present, can have a dramatic impact on binding affinity in our model, increasing it up to 140-fold relative to the nonglycosylated CBM. These results suggest new directions in protein engineering, in that modifying glycosylation patterns via heterologous expression, manipulation of culture conditions, or introduction of artificial glycosylation sites, can alter CBM binding affinity to carbohydrates and may thus be a general strategy to enhance cellulase performance. Our results also suggest that CBM binding studies should consider the effects of glycosylation on binding and function. PMID:22147693

  14. Sex- and Tissue-specific Functions of Drosophila Doublesex Transcription Factor Target Genes

    PubMed Central

    Clough, Emily; Jimenez, Erin; Kim, Yoo-Ah; Whitworth, Cale; Neville, Megan C.; Hempel, Leonie; Pavlou, Hania J.; Chen, Zhen-Xia; Sturgill, David; Dale, Ryan; Smith, Harold E.; Przytycka, Teresa M.; Goodwin, Stephen F.; Van Doren, Mark; Oliver, Brian

    2014-01-01

    Primary sex determination “switches” evolve rapidly, but Doublesex (DSX) related transcription factors (DMRTs) act downstream of these switches to control sexual development in most animal species. Drosophila dsx encodes female- and male-specific isoforms (DSXF and DSXM), but little is known about how dsx controls sexual development, whether DSXF and DSXM bind different targets, or how DSX proteins direct different outcomes in diverse tissues. We undertook genome-wide analyses to identify DSX targets using in vivo occupancy, binding site prediction, and evolutionary conservation. We find that DSXF and DSXM bind thousands of the same targets in multiple tissues in both sexes, yet these targets have sex- and tissue-specific functions. Interestingly, DSX targets show considerable overlap with targets identified for mouse DMRT1. DSX targets include transcription factors and signaling pathway components providing for direct and indirect regulation of sex-biased expression. PMID:25535918

  15. Structural basis of subunit selectivity for competitive NMDA receptor antagonists with preference for GluN2A over GluN2B subunits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia

    NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with boundmore » ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity.« less

  16. Structural basis of subunit selectivity for competitive NMDA receptor antagonists with preference for GluN2A over GluN2B subunits

    PubMed Central

    Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia; Pomper, Martin G.; De Micheli, Carlo; Conti, Paola; Pinto, Andrea

    2017-01-01

    NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with bound ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity. PMID:28760974

  17. Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

    PubMed

    Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

    2018-04-17

    In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.

  18. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange

    PubMed Central

    Qian, Yufeng; Johnson, Kenneth A.

    2017-01-01

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB–ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB)30 and (SSB)60, defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB)60 and (SSB)30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 109 m−1 s−1) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. PMID:28615444

  19. Survey of immune-related, mannose/fucose-binding C-type lectin receptors reveals widely divergent sugar-binding specificities

    PubMed Central

    Lee, Reiko T; Hsu, Tsui-Ling; Huang, Shau Ku; Hsieh, Shie-Liang; Wong, Chi-Huey; Lee, Yuan C

    2011-01-01

    C-type lectins (CTLs) are proteins that contain one or more carbohydrate-recognition domains (CRDs) that require calcium for sugar binding and share high degree of sequence homology and tertiary structure. CTLs whose CRD contain EPN (Glu-Pro-Asn) tripeptide motifs have potential to bind mannose (Man), N-acetylglucosamine (GlcNAc), glucose (Glc) and l-fucose (Fuc), whereas those with QPD (Glu-Pro-Asp) tripeptide motifs bind galactose (Gal) and N-acetylgalactosamine (GalNAc). We report here for the first time a direct comparison of monosaccharide (and some di- and trisaccharides)-binding characteristics of 11 EPX-containing (X = N, S or D) immune-related CTLs using a competition assay and an enzyme-linked immunosorbent assay, and neoglycoproteins as ligand. The EPX CTLs studied are DC-SIGN, L-SIGN, mSIGNR1, human and mouse mannose receptors, Langerin, BDCA-2, DCIR, dectin-2, MCL and MINCLE. We found that: (1) they all bound Man and Fuc; (2) binding of Glc and GlcNAc varied considerably among these lectins, but was always less than Man and Fuc; (3) in general, Gal and GalNAc were not bound. However, dectin-2, DCIR and MINCLE showed ability to bind Gal/GalNAc; (4) DC-SIGN, L-SIGN, mSIGNR1 and Langerin showed enhanced binding of Manα2Man over Man, whereas all others showed no enhancement; (5) DC-SIGN bound Lex trisaccharide structure, which has terminal Gal and Fuc residues, more avidly than Fuc, whereas L-SIGN, mSIGNR1, DCIR and MINCLE bound Lex less avidly than Fuc. BDCA-2, dectin-2, Langerin, MCL and mannose receptor did not bind Lex at all. PMID:21112966

  20. Survey of immune-related, mannose/fucose-binding C-type lectin receptors reveals widely divergent sugar-binding specificities.

    PubMed

    Lee, Reiko T; Hsu, Tsui-Ling; Huang, Shau Ku; Hsieh, Shie-Liang; Wong, Chi-Huey; Lee, Yuan C

    2011-04-01

    C-type lectins (CTLs) are proteins that contain one or more carbohydrate-recognition domains (CRDs) that require calcium for sugar binding and share high degree of sequence homology and tertiary structure. CTLs whose CRD contain EPN (Glu-Pro-Asn) tripeptide motifs have potential to bind mannose (Man), N-acetylglucosamine (GlcNAc), glucose (Glc) and l-fucose (Fuc), whereas those with QPD (Glu-Pro-Asp) tripeptide motifs bind galactose (Gal) and N-acetylgalactosamine (GalNAc). We report here for the first time a direct comparison of monosaccharide (and some di- and trisaccharides)-binding characteristics of 11 EPX-containing (X = N, S or D) immune-related CTLs using a competition assay and an enzyme-linked immunosorbent assay, and neoglycoproteins as ligand. The EPX CTLs studied are DC-SIGN, L-SIGN, mSIGNR1, human and mouse mannose receptors, Langerin, BDCA-2, DCIR, dectin-2, MCL and MINCLE. We found that: (1) they all bound Man and Fuc; (2) binding of Glc and GlcNAc varied considerably among these lectins, but was always less than Man and Fuc; (3) in general, Gal and GalNAc were not bound. However, dectin-2, DCIR and MINCLE showed ability to bind Gal/GalNAc; (4) DC-SIGN, L-SIGN, mSIGNR1 and Langerin showed enhanced binding of Manα2Man over Man, whereas all others showed no enhancement; (5) DC-SIGN bound Le(x) trisaccharide structure, which has terminal Gal and Fuc residues, more avidly than Fuc, whereas L-SIGN, mSIGNR1, DCIR and MINCLE bound Le(x) less avidly than Fuc. BDCA-2, dectin-2, Langerin, MCL and mannose receptor did not bind Le(x) at all.

  1. A cytoplasmic protein, bystin, interacts with trophinin, tastin, and cytokeratin and may be involved in trophinin-mediated cell adhesion between trophoblast and endometrial epithelial cells

    PubMed Central

    Suzuki, Nao; Zara, Jane; Sato, Takaaki; Ong, Edgar; Bakhiet, Nouna; Oshima, Robert G.; Watson, Kellie L.; Fukuda, Michiko N.

    1998-01-01

    Trophinin and tastin form a cell adhesion molecule complex that potentially mediates an initial attachment of the blastocyst to uterine epithelial cells at the time of implantation. Trophinin and tastin, however, do not directly bind to each other, suggesting the presence of an intermediary protein. The present study identifies a cytoplasmic protein, named bystin, that directly binds trophinin and tastin. Bystin consists of 306 amino acid residues and is predicted to contain tyrosine, serine, and threonine residues in contexts conforming to motifs for phosphorylation by protein kinases. Database searches revealed a 53% identity of the predicted peptide sequence with the Drosophila bys (mrr) gene. Direct protein–protein interactions of trophinin, tastin, and bystin analyzed by yeast two-hybrid assays and by in vitro protein binding assays indicated that binding between bystin and trophinin and between bystin and tastin is enhanced when cytokeratin 8 and 18 are present as the third molecule. Immunocytochemistry of bystin showed that bystin colocalizes with trophinin, tastin, and cytokeratins in a human trophoblastic teratocarcinoma cell, HT-H. It is therefore possible that these molecules form a complex and thus are involved in the process of embryo implantation. PMID:9560222

  2. A polybasic motif in ErbB3-binding protein 1 (EBP1) has key functions in nucleolar localization and polyphosphoinositide interaction

    PubMed Central

    Karlsson, Thomas; Altankhuyag, Altanchimeg; Dobrovolska, Olena; Turcu, Diana C.; Lewis, Aurélia E.

    2016-01-01

    Polyphosphoinositides (PPIns) are present in the nucleus where they participate in crucial nuclear processes, such as chromatin remodelling, transcription and mRNA processing. In a previous interactomics study, aimed to gain further insight into nuclear PPIns functions, we identified ErbB3 binding protein 1 (EBP1) as a potential nuclear PPIn-binding protein in a lipid pull-down screen. EBP1 is a ubiquitous and conserved protein, located in both the cytoplasm and nucleolus, and associated with cell proliferation and survival. In the present study, we show that EBP1 binds directly to several PPIns via two distinct PPIn-binding sites consisting of clusters of lysine residues and positioned at the N- and C-termini of the protein. Using interaction mutants, we show that the C-terminal PPIn-binding motif contributes the most to the localization of EBP1 in the nucleolus. Importantly, a K372N point mutation, located within the C-terminal motif and found in endometrial tumours, is sufficient to alter the nucleolar targeting of EBP1. Our study reveals also the presence of the class I phosphoinositide 3-kinase (PI3K) catalytic subunit p110β and its product PtdIns(3,4,5)P3 together with EBP1 in the nucleolus. Using NMR, we further demonstrate an association between EBP1 and PtdIns(3,4,5)P3 via both electrostatic and hydrophobic interactions. Taken together, these results show that EBP1 interacts directly with PPIns and associate with PtdIns(3,4,5)P3 in the nucleolus. The presence of p110β and PtdIns(3,4,5)P3 in the nucleolus indicates their potential role in regulating nucleolar processes, at least via EBP1. PMID:27118868

  3. Salt modulates the stability and lipid binding affinity of the adipocyte lipid-binding proteins

    NASA Technical Reports Server (NTRS)

    Schoeffler, Allyn J.; Ruiz, Carmen R.; Joubert, Allison M.; Yang, Xuemei; LiCata, Vince J.

    2003-01-01

    Adipocyte lipid-binding protein (ALBP or aP2) is an intracellular fatty acid-binding protein that is found in adipocytes and macrophages and binds a large variety of intracellular lipids with high affinity. Although intracellular lipids are frequently charged, biochemical studies of lipid-binding proteins and their interactions often focus most heavily on the hydrophobic aspects of these proteins and their interactions. In this study, we have characterized the effects of KCl on the stability and lipid binding properties of ALBP. We find that added salt dramatically stabilizes ALBP, increasing its Delta G of unfolding by 3-5 kcal/mol. At 37 degrees C salt can more than double the stability of the protein. At the same time, salt inhibits the binding of the fluorescent lipid 1-anilinonaphthalene-8-sulfonate (ANS) to the protein and induces direct displacement of the lipid from the protein. Thermodynamic linkage analysis of the salt inhibition of ANS binding shows a nearly 1:1 reciprocal linkage: i.e. one ion is released from ALBP when ANS binds, and vice versa. Kinetic experiments show that salt reduces the rate of association between ANS and ALBP while simultaneously increasing the dissociation rate of ANS from the protein. We depict and discuss the thermodynamic linkages among stability, lipid binding, and salt effects for ALBP, including the use of these linkages to calculate the affinity of ANS for the denatured state of ALBP and its dependence on salt concentration. We also discuss the potential molecular origins and potential intracellular consequences of the demonstrated salt linkages to stability and lipid binding in ALBP.

  4. Basic Residues of β-Sheet A Contribute to Heparin Binding and Activation of Vaspin (Serpin A12).

    PubMed

    Ulbricht, David; Oertwig, Kathrin; Arnsburg, Kristin; Saalbach, Anja; Pippel, Jan; Sträter, Norbert; Heiker, John T

    2017-01-20

    Many members of the serine protease inhibitor (serpin) family are activated by glycosaminoglycans (GAGs). Visceral adipose tissue-derived serpin (vaspin), serpin A12 of the serpin family, and its target protease kallikrein 7 (KLK7) are heparin-binding proteins, and inhibition of KLK7 by vaspin is accelerated by heparin. However, the nature of GAG binding to vaspin is not known. Here, we measured vaspin binding of various glycosaminoglycans and low molecular weight heparins by microscale thermophoresis and analyzed acceleration of protease inhibition by these molecules. In addition, basic residues contributing to heparin binding and heparin activation were identified by a selective labeling approach. Together, these data show that vaspin binds heparin with high affinity (K D = 21 ± 2 nm) and that binding takes place at a basic patch on top of β-sheet A and is different from other heparin-binding serpins. Mutation of basic residues decreased heparin binding and activation of vaspin. Similarly, reactive center loop insertion into sheet A decreased heparin binding because it disturbs the basic cluster. Finally, using vaspin-overexpressing keratinocyte cells, we show that a significant part of secreted vaspin is bound in the extracellular matrix on the cell surface. Together, basic residues of central β-sheet A contribute to heparin binding and activation of vaspin. Thus, binding to GAGs in the extracellular matrix can direct and regulate vaspin interaction with target proteases or other proteins and may play an important role in the various beneficial functions of vaspin in different tissues. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Editor's Highlight: Structure-Based Investigation on the Binding and Activation of Typical Pesticides With Thyroid Receptor.

    PubMed

    Xiang, Dandan; Han, Jian; Yao, Tingting; Wang, Qiangwei; Zhou, Bingsheng; Mohamed, Abou Donia; Zhu, Guonian

    2017-12-01

    A broad range of pesticides have been reported to interfere with the normal function of the thyroid endocrine system. However, the precise mechanism(s) of action has not yet been thoroughly elucidated. In this study, 21 pesticides were assessed for their binding interactions and the potential to disrupt thyroid homeostasis. In the GH3 luciferase reporter gene assays, 5 of the pesticides tested had agonistic effects in the order of procymidone > imidacloprid > mancozeb > fluroxypyr > atrazine. 11 pesticides inhibited luciferase activity of T3 to varying degrees, demonstrating their antagonistic activity. And there are 4 pesticides showed mixed effects when treated with different concentrations. Surface plasmon resonance (SPR) biosensor technique was used to directly measure the binding interactions of these pesticides to the human thyroid hormone receptor (hTR). 13 pesticides were observed to bind directly with TR, with a KD ranging from 4.80E-08 M to 9.44E-07 M. The association and disassociation of the hTR/pesticide complex revealed 2 distinctive binding modes between the agonists and antagonists. At the same time, a different binding mode was displayed by the pesticides showed mix agonist and antagonist activity. In addition, the molecular docking simulation analyses indicated that the interaction energy calculated by CDOCKER for the agonists and antagonists correlated well with the KD values measured by the surface plasmon resonance assay. These results help to explain the differences of the TR activities of these tested pesticides. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Combinatorial activation and concentration-dependent repression of the Drosophila even skipped stripe 3+7 enhancer

    PubMed Central

    Struffi, Paolo; Corado, Maria; Kaplan, Leah; Yu, Danyang; Rushlow, Christine; Small, Stephen

    2011-01-01

    Despite years of study, the precise mechanisms that control position-specific gene expression during development are not understood. Here, we analyze an enhancer element from the even skipped (eve) gene, which activates and positions two stripes of expression (stripes 3 and 7) in blastoderm stage Drosophila embryos. Previous genetic studies showed that the JAK-STAT pathway is required for full activation of the enhancer, whereas the gap genes hunchback (hb) and knirps (kni) are required for placement of the boundaries of both stripes. We show that the maternal zinc-finger protein Zelda (Zld) is absolutely required for activation, and present evidence that Zld binds to multiple non-canonical sites. We also use a combination of in vitro binding experiments and bioinformatics analysis to redefine the Kni-binding motif, and mutational analysis and in vivo tests to show that Kni and Hb are dedicated repressors that function by direct DNA binding. These experiments significantly extend our understanding of how the eve enhancer integrates positive and negative transcriptional activities to generate sharp boundaries in the early embryo. PMID:21865322

  7. HMGB1 Protein Binds to Influenza Virus Nucleoprotein and Promotes Viral Replication

    PubMed Central

    Moisy, Dorothée; Avilov, Sergiy V.; Jacob, Yves; Laoide, Brid M.; Ge, Xingyi; Baudin, Florence; Jestin, Jean-Luc

    2012-01-01

    Influenza virus has evolved replication strategies that hijack host cell pathways. To uncover interactions between viral macromolecules and host proteins, we applied a phage display strategy. A library of human cDNA expression products displayed on filamentous phages was submitted to affinity selection for influenza viral ribonucleoproteins (vRNPs). High-mobility-group box (HMGB) proteins were found to bind to the nucleoprotein (NP) component of vRNPs. HMGB1 and HMGB2 bind directly to the purified NP in the absence of viral RNA, and the HMG box A domain is sufficient to bind the NP. We show that HMGB1 associates with the viral NP in the nuclei of infected cells, promotes viral growth, and enhances the activity of the viral polymerase. The presence of a functional HMGB1 DNA-binding site is required to enhance influenza virus replication. Glycyrrhizin, which reduces HMGB1 binding to DNA, inhibits influenza virus polymerase activity. Our data show that the HMGB1 protein can play a significant role in intranuclear replication of influenza viruses, thus extending previous findings on the bornavirus and on a number of DNA viruses. PMID:22696656

  8. Activation of the edema factor of Bacillus anthracis by calmodulin: evidence of an interplay between the EF-calmodulin interaction and calcium binding.

    PubMed

    Laine, Elodie; Martínez, Leandro; Blondel, Arnaud; Malliavin, Thérèse E

    2010-10-06

    Calmodulin (CaM) is a remarkably flexible protein which can bind multiple targets in response to changes in intracellular calcium concentration. It contains four calcium-binding sites, arranged in two globular domains. The calcium affinity of CaM N-terminal domain (N-CaM) is dramatically reduced when the complex with the edema factor (EF) of Bacillus anthracis is formed. Here, an atomic explanation for this reduced affinity is proposed through molecular dynamics simulations and free energy perturbation calculations of the EF-CaM complex starting from different crystallographic models. The simulations show that electrostatic interactions between CaM and EF disfavor the opening of N-CaM domains usually induced by calcium binding. Relative calcium affinities of the N-CaM binding sites are probed by free energy perturbation, and dissociation probabilities are evaluated with locally enhanced sampling simulations. We show that EF impairs calcium binding on N-CaM through a direct conformational restraint on Site 1, by an indirect destabilization of Site 2, and by reducing the cooperativity between the two sites. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  9. Expanded RNA-binding activities of mammalian Argonaute 2

    PubMed Central

    Tan, Grace S.; Garchow, Barry G.; Liu, Xuhang; Yeung, Jennifer; Morris, John P.; Cuellar, Trinna L.; McManus, Michael T.; Kiriakidou, Marianthi

    2009-01-01

    Mammalian Argonaute 2 (Ago2) protein associates with microRNAs (miRNAs) or small interfering RNAs (siRNAs) forming RNA-induced silencing complexes (RISCs/miRNPs). In the present work, we characterize the RNA-binding and nucleolytic activity of recombinant mouse Ago2. Our studies show that recombinant mouse Ago2 binds efficiently to miRNAs forming active RISC. Surprisingly, we find that recombinant mouse Ago2 forms active RISC using pre-miRNAs or long unstructured single stranded RNAs as guides. Furthermore, we demonstrate that, in vivo, endogenous human Ago2 binds directly to pre-miRNAs independently of Dicer, and that Ago2:pre-miRNA complexes are found both in the cytoplasm and in the nucleus of human cells. PMID:19808937

  10. p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

    PubMed

    Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

    2004-06-01

    The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

  11. Functional Targets of the Monogenic Diabetes Transcription Factors HNF-1α and HNF-4α Are Highly Conserved Between Mice and Humans

    PubMed Central

    Boj, Sylvia F.; Servitja, Joan Marc; Martin, David; Rios, Martin; Talianidis, Iannis; Guigo, Roderic; Ferrer, Jorge

    2009-01-01

    OBJECTIVE The evolutionary conservation of transcriptional mechanisms has been widely exploited to understand human biology and disease. Recent findings, however, unexpectedly showed that the transcriptional regulators hepatocyte nuclear factor (HNF)-1α and -4α rarely bind to the same genes in mice and humans, leading to the proposal that tissue-specific transcriptional regulation has undergone extensive divergence in the two species. Such observations have major implications for the use of mouse models to understand HNF-1α– and HNF-4α–deficient diabetes. However, the significance of studies that assess binding without considering regulatory function is poorly understood. RESEARCH DESIGN AND METHODS We compared previously reported mouse and human HNF-1α and HNF-4α binding studies with independent binding experiments. We also integrated binding studies with mouse and human loss-of-function gene expression datasets. RESULTS First, we confirmed the existence of species-specific HNF-1α and -4α binding, yet observed incomplete detection of binding in the different datasets, causing an underestimation of binding conservation. Second, only a minor fraction of HNF-1α– and HNF-4α–bound genes were downregulated in the absence of these regulators. This subset of functional targets did not show evidence for evolutionary divergence of binding or binding sequence motifs. Finally, we observed differences between conserved and species-specific binding properties. For example, conserved binding was more frequently located near transcriptional start sites and was more likely to involve multiple binding events in the same gene. CONCLUSIONS Despite evolutionary changes in binding, essential direct transcriptional functions of HNF-1α and -4α are largely conserved between mice and humans. PMID:19188435

  12. Hydrogels with precisely controlled integrin activation dictate vascular patterning and permeability

    NASA Astrophysics Data System (ADS)

    Li, Shuoran; Nih, Lina R.; Bachman, Haylee; Fei, Peng; Li, Yilei; Nam, Eunwoo; Dimatteo, Robert; Carmichael, S. Thomas; Barker, Thomas H.; Segura, Tatiana

    2017-09-01

    Integrin binding to bioengineered hydrogel scaffolds is essential for tissue regrowth and regeneration, yet not all integrin binding can lead to tissue repair. Here, we show that through engineering hydrogel materials to promote α3/α5β1 integrin binding, we can promote the formation of a space-filling and mature vasculature compared with hydrogel materials that promote αvβ3 integrin binding. In vitro, α3/α5β1 scaffolds promoted endothelial cells to sprout and branch, forming organized extensive networks that eventually reached and anastomosed with neighbouring branches. In vivo, α3/α5β1 scaffolds delivering vascular endothelial growth factor (VEGF) promoted non-tortuous blood vessel formation and non-leaky blood vessels by 10 days post-stroke. In contrast, materials that promote αvβ3 integrin binding promoted endothelial sprout clumping in vitro and leaky vessels in vivo. This work shows that precisely controlled integrin activation from a biomaterial can be harnessed to direct therapeutic vessel regeneration and reduce VEGF-induced vascular permeability in vivo.

  13. Hydrogels with precisely controlled integrin activation dictate vascular patterning and permeability

    PubMed Central

    Li, Shuoran; Nih, Lina R.; Bachman, Haylee; Fei, Peng; Li, Yilei; Nam, Eunwoo; Dimatteo, Robert; Carmichael, S. Thomas; Barker, Thomas H.; Segura, Tatiana

    2017-01-01

    Integrin binding to bioengineered hydrogel scaffolds is essential for tissue regrowth and regeneration, yet not all integrin binding can lead to tissue repair. Here, we show that through engineering hydrogel materials to promote α3/α5β1 integrin binding, we can promote the formation of a space filling and mature vasculature compared to hydrogel materials that promote a αvβ3 integrin binding. In vitro, α3/α5β1 scaffolds promoted endothelial cells to sprout and branch, forming organized extensive networks that eventually reached and anastomosed with neighboring branches. In vivo, α3/α5β1 scaffolds delivering vascular endothelial growth factor (VEGF) promoted non-tortuous blood vessel formation and non-leaky blood vessels by 10-days post stroke. In contrast, materials that promote αvβ3 integrin binding promoted endothelial sprout clumping in vitro and leaky vessels in vivo. This work shows that precisely controlled integrin activation from a biomaterial can be harnessed to direct therapeutic vessel regeneration and reduce VEGF induced vascular permeability in vivo. PMID:28783156

  14. Mapping the ER Interactome: The P Domains of Calnexin and Calreticulin as Plurivalent Adapters for Foldases and Chaperones.

    PubMed

    Kozlov, Guennadi; Muñoz-Escobar, Juliana; Castro, Karla; Gehring, Kalle

    2017-09-05

    The lectin chaperones calreticulin (CRT) and calnexin (CNX) contribute to the folding of glycoproteins in the ER by recruiting foldases such as the protein disulfide isomerase ERp57 and the peptidyl prolyl cis-trans isomerase CypB. Recently, CRT was shown to interact with the chaperone ERp29. Here, we show that ERp29 directly binds to the P domain of CNX. Crystal structures of the D domain of ERp29 in complex with the P domains from CRT and calmegin, a tissue-specific CNX homolog, reveal a commonality in the mechanism of binding whereby the tip of the P domain functions as a plurivalent adapter to bind a variety of folding factors. We show that mutation of a single residue, D348 in CNX, abrogates binding to ERp29 as well as ERp57 and CypB. The structural diversity of the accessory factors suggests that these chaperones became specialized for glycoprotein folding through convergent evolution of their P-domain binding sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Polysaccharide of Dendrobium huoshanense activates macrophages via toll-like receptor 4-mediated signaling pathways.

    PubMed

    Xie, Song-Zi; Hao, Ran; Zha, Xue-Qiang; Pan, Li-Hua; Liu, Jian; Luo, Jian-Ping

    2016-08-01

    The present work aimed at investigating the pattern recognition receptor (PRR) and immunostimulatory mechanism of a purified Dendrobium huoshanense polysaccharide (DHP). We found that DHP could bind to the surface of macrophages and stimulate macrophages to secrete NO, TNF-α and IL-1β. To unravel the mechanism for the binding of DHP to macrophages, flow cytometry, confocal laser-scanning microscopy, affinity electrophoresis, SDS-PAGE and western blotting were employed to verify the type of PRR responsible for the recognition of DHP by RAW264.7 macrophages and peritoneal macrophages of C3H/HeN and C3H/HeJ macrophages. Results showed that toll-like receptor 4 (TLR4) was an essential receptor for macrophages to directly bind DHP. Further, the phosphorylation of ERK, JNK, Akt and p38 were observed to be time-dependently promoted by DHP, as well as the nuclear translocation of NF-κB p65. These results suggest that DHP activates macrophages via its direct binding to TLR4 to trigger TLR4 signaling pathways. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Calcium Regulates Molecular Interactions of Otoferlin with Soluble NSF Attachment Protein Receptor (SNARE) Proteins Required for Hair Cell Exocytosis*

    PubMed Central

    Ramakrishnan, Neeliyath A.; Drescher, Marian J.; Morley, Barbara J.; Kelley, Philip M.; Drescher, Dennis G.

    2014-01-01

    Mutations in otoferlin, a C2 domain-containing ferlin family protein, cause non-syndromic hearing loss in humans (DFNB9 deafness). Furthermore, transmitter secretion of cochlear inner hair cells is compromised in mice lacking otoferlin. In the present study, we show that the C2F domain of otoferlin directly binds calcium (KD = 267 μm) with diminished binding in a pachanga (D1767G) C2F mouse mutation. Calcium was found to differentially regulate binding of otoferlin C2 domains to target SNARE (t-SNARE) proteins and phospholipids. C2D–F domains interact with the syntaxin-1 t-SNARE motif with maximum binding within the range of 20–50 μm Ca2+. At 20 μm Ca2+, the dissociation rate was substantially lower, indicating increased binding (KD = ∼10−9) compared with 0 μm Ca2+ (KD = ∼10−8), suggesting a calcium-mediated stabilization of the C2 domain·t-SNARE complex. C2A and C2B interactions with t-SNAREs were insensitive to calcium. The C2F domain directly binds the t-SNARE SNAP-25 maximally at 100 μm and with reduction at 0 μm Ca2+, a pattern repeated for C2F domain interactions with phosphatidylinositol 4,5-bisphosphate. In contrast, C2F did not bind the vesicle SNARE protein synaptobrevin-1 (VAMP-1). Moreover, an antibody targeting otoferlin immunoprecipitated syntaxin-1 and SNAP-25 but not synaptobrevin-1. As opposed to an increase in binding with increased calcium, interactions between otoferlin C2F domain and intramolecular C2 domains occurred in the absence of calcium, consistent with intra-C2 domain interactions forming a “closed” tertiary structure at low calcium that “opens” as calcium increases. These results suggest a direct role for otoferlin in exocytosis and modulation of calcium-dependent membrane fusion. PMID:24478316

  17. Conformational selection in a protein-protein interaction revealed by dynamic pathway analysis

    DOE PAGES

    Chakrabarti, Kalyan S.; Agafonov, Roman V.; Pontiggia, Francesco; ...

    2015-12-24

    Molecular recognition plays a central role in biology, and protein dynamics has been acknowledged to be important in this process. However, it is highly debated whether conformational changes happen before ligand binding to produce a binding-competent state (conformational selection) or are caused in response to ligand binding (induced fit). Proposals for both mechanisms in protein/protein recognition have been primarily based on structural arguments. However, the distinction between them is a question of the probabilities of going via these two opposing pathways. Here we present a direct demonstration of exclusive conformational selection in protein/protein recognition by measuring the flux for rhodopsinmore » kinase binding to its regulator recoverin, an important molecular recognition in the vision system. Using NMR spectroscopy, stopped-flow kinetics and isothermal titration calorimetry we show that recoverin populates a minor conformation in solution that exposes a hydrophobic binding pocket responsible for binding rhodopsin kinase. Lastly, protein dynamics in free recoverin limits the overall rate of binding.« less

  18. Conformational selection in a protein-protein interaction revealed by dynamic pathway analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakrabarti, Kalyan S.; Agafonov, Roman V.; Pontiggia, Francesco

    Molecular recognition plays a central role in biology, and protein dynamics has been acknowledged to be important in this process. However, it is highly debated whether conformational changes happen before ligand binding to produce a binding-competent state (conformational selection) or are caused in response to ligand binding (induced fit). Proposals for both mechanisms in protein/protein recognition have been primarily based on structural arguments. However, the distinction between them is a question of the probabilities of going via these two opposing pathways. Here we present a direct demonstration of exclusive conformational selection in protein/protein recognition by measuring the flux for rhodopsinmore » kinase binding to its regulator recoverin, an important molecular recognition in the vision system. Using NMR spectroscopy, stopped-flow kinetics and isothermal titration calorimetry we show that recoverin populates a minor conformation in solution that exposes a hydrophobic binding pocket responsible for binding rhodopsin kinase. Lastly, protein dynamics in free recoverin limits the overall rate of binding.« less

  19. Mechanism and function of Vav1 localisation in TCR signalling

    PubMed Central

    Ksionda, Olga; Saveliev, Alexander; Köchl, Robert; Rapley, Jonathan; Faroudi, Mustapha; Smith-Garvin, Jennifer E.; Wülfing, Christoph; Rittinger, Katrin; Carter, Tom; Tybulewicz, Victor L. J.

    2012-01-01

    Summary The antigen-specific binding of T cells to antigen presenting cells results in recruitment of signalling proteins to microclusters at the cell-cell interface known as the immunological synapse (IS). The Vav1 guanine nucleotide exchange factor plays a critical role in T cell antigen receptor (TCR) signalling, leading to the activation of multiple pathways. We now show that it is recruited to microclusters and to the IS in primary CD4+ and CD8+ T cells. Furthermore, we show that this recruitment depends on the SH2 and C-terminal SH3 (SH3B) domains of Vav1, and on phosphotyrosines 112 and 128 of the SLP76 adaptor protein. Biophysical measurements show that Vav1 binds directly to these residues on SLP76 and that efficient binding depends on the SH2 and SH3B domains of Vav1. Finally, we show that the same two domains are critical for the phosphorylation of Vav1 and its signalling function in TCR-induced calcium flux. We propose that Vav1 is recruited to the IS by binding to SLP76 and that this interaction is critical for the transduction of signals leading to calcium flux. PMID:22956543

  20. Mechanism and function of Vav1 localisation in TCR signalling.

    PubMed

    Ksionda, Olga; Saveliev, Alexander; Köchl, Robert; Rapley, Jonathan; Faroudi, Mustapha; Smith-Garvin, Jennifer E; Wülfing, Christoph; Rittinger, Katrin; Carter, Tom; Tybulewicz, Victor L J

    2012-11-15

    The antigen-specific binding of T cells to antigen presenting cells results in recruitment of signalling proteins to microclusters at the cell-cell interface known as the immunological synapse (IS). The Vav1 guanine nucleotide exchange factor plays a critical role in T cell antigen receptor (TCR) signalling, leading to the activation of multiple pathways. We now show that it is recruited to microclusters and to the IS in primary CD4(+) and CD8(+) T cells. Furthermore, we show that this recruitment depends on the SH2 and C-terminal SH3 (SH3(B)) domains of Vav1, and on phosphotyrosines 112 and 128 of the SLP76 adaptor protein. Biophysical measurements show that Vav1 binds directly to these residues on SLP76 and that efficient binding depends on the SH2 and SH3(B) domains of Vav1. Finally, we show that the same two domains are critical for the phosphorylation of Vav1 and its signalling function in TCR-induced calcium flux. We propose that Vav1 is recruited to the IS by binding to SLP76 and that this interaction is critical for the transduction of signals leading to calcium flux.

  1. Mannan-Binding Lectin Inhibits Candida albicans-Induced Cellular Responses in PMA-Activated THP-1 Cells through Toll-Like Receptor 2 and Toll-Like Receptor 4

    PubMed Central

    Yang, Jianbin; Zhao, Dongfang; Wang, Hongpo; Shao, Feng; Wang, Wenjun; Sun, Ruili; Ling, Mingzhi; Zhai, Jingjing; Song, Shijun

    2013-01-01

    Background Candida albicans (C. albicans), the most common human fungal pathogen, can cause fatal systemic infections under certain circumstances. Mannan-binding lectin (MBL),a member of the collectin family in the C-type lectin superfamily, is an important serum component associated with innate immunity. Toll-like receptors (TLRs) are expressed extensively, and have been shown to be involved in C. albicans-induced cellular responses. We first examined whether MBL modulated heat-killed (HK) C. albicans-induced cellular responses in phorbol 12-myristate 13-acetate (PMA)-activated human THP-1 macrophages. We then investigated the possible mechanisms of its inhibitory effect. Methodology/Principal Finding Enzyme-linked immunosorbent assay (ELISA) and reverse transcriptasepolymerase chain reaction (RT-PCR) analysis showed that MBL at higher concentrations (10–20 µg/ml) significantly attenuated C. albicans-induced chemokine (e.g., IL-8) and proinflammatory cytokine (e.g., TNF-α) production from PMA-activated THP-1 cells at both protein and mRNA levels. Electrophoretic mobility shift assay (EMSA) and Western blot (WB) analysis showed that MBL could inhibit C. albicans-induced nuclear factor-κB (NF-κB) DNA binding and its translocation in PMA-activated THP-1 cells. MBL could directly bind to PMA-activated THP-1 cells in the presence of Ca2+, and this binding decreased TLR2 and TLR4 expressions in C. albicans-induced THP-1 macrophages. Furthermore, the binding could be partially inhibited by both anti-TLR2 monoclonal antibody (clone TL2.1) and anti-TLR4 monoclonal antibody (clone HTA125). In addition, co-immunoprecipitation experiments and microtiter wells assay showed that MBL could directly bind to the recombinant soluble form of extracellular TLR2 domain (sTLR2) and sTLR4. Conclusions/Significance Our study demonstrates that MBL can affect proinflammatory cytokine and chemokine expressions by modifying C. albicans-/TLR-signaling pathways. This study supports an important role for MBL on the regulation of C. albicans-induced cellular responses. PMID:24391778

  2. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  3. Fisetin inhibits human melanoma cell growth through direct binding to p70S6K and mTOR: findings from 3-D melanoma skin equivalents and computational modeling

    PubMed Central

    Syed, Deeba N.; Chamcheu, Jean-Christopher; Khan, Mohammad Imran; Sechi, Mario; Lall, Rahul K.; Adhami, Vaqar M.; Mukhtar, Hasan

    2014-01-01

    The incidence of melanoma continues to rise. Inspite of treatment advances, the prognosis remains grim once the disease has metastasized, emphasizing the need to explore additional therapeutic strategies. One such approach is through the use of mechanism-based dietary intervention. We previously showed that the flavonoid fisetin inhibits melanoma cell proliferation, in vitro and in vivo. Here, we studied fisetin-mediated regulation of kinases involved in melanoma growth and progression. Time-course analysis in 3-D melanoma constructs that transitioned from radial to vertical growth showed that fisetin treatment resulted in significant decrease in melanocytic lesions in contrast to untreated controls that showed large tumor nests and invading disseminated cells. Further studies in melanoma cultures and mouse xenografts showed that fisetin-mediated growth inhibition was associated with dephosphorylation of AKT, mTOR and p70S6K proteins. In silico modeling indicated direct interaction of fisetin with mTOR and p70S6K with favorable free energy values. These findings were validated by cell-free competition assays that established binding of fisetin to p70S6K and mTOR while little affinity was detected with AKT. Kinase activity studies reflected similar trend with % inhibition observed for p70S6K and mTOR at lower doses than AKT. Our studies characterized, for the first time, the differential interactions of any botanical agent with kinases involved in melanoma growth and demonstrate that fisetin inhibits mTOR and p70S6K through direct binding while the observed inhibitory effect of fisetin on AKT is mediated indirectly, through targeting interrelated pathways. PMID:24675012

  4. Fisetin inhibits human melanoma cell growth through direct binding to p70S6K and mTOR: findings from 3-D melanoma skin equivalents and computational modeling.

    PubMed

    Syed, Deeba N; Chamcheu, Jean-Christopher; Khan, Mohammad Imran; Sechi, Mario; Lall, Rahul K; Adhami, Vaqar M; Mukhtar, Hasan

    2014-06-01

    The incidence of melanoma continues to rise. Inspite of treatment advances, the prognosis remains grim once the disease has metastasized, emphasizing the need to explore additional therapeutic strategies. One such approach is through the use of mechanism-based dietary intervention. We previously showed that the flavonoid fisetin inhibits melanoma cell proliferation, in vitro and in vivo. Here, we studied fisetin-mediated regulation of kinases involved in melanoma growth and progression. Time-course analysis in 3-D melanoma constructs that transitioned from radial to vertical growth showed that fisetin treatment resulted in significant decrease in melanocytic lesions in contrast to untreated controls that showed large tumor nests and invading disseminated cells. Further studies in melanoma cultures and mouse xenografts showed that fisetin-mediated growth inhibition was associated with dephosphorylation of AKT, mTOR and p70S6K proteins. In silico modeling indicated direct interaction of fisetin with mTOR and p70S6K with favorable free energy values. These findings were validated by cell-free competition assays that established binding of fisetin to p70S6K and mTOR while little affinity was detected with AKT. Kinase activity studies reflected similar trend with % inhibition observed for p70S6K and mTOR at lower doses than AKT. Our studies characterized, for the first time, the differential interactions of any botanical agent with kinases involved in melanoma growth and demonstrate that fisetin inhibits mTOR and p70S6K through direct binding while the observed inhibitory effect of fisetin on AKT is mediated indirectly, through targeting interrelated pathways. Published by Elsevier Inc.

  5. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  6. Interactions of Plakoglobin and [beta]-Catenin with Desmosomal Cadherins BASIS OF SELECTIVE EXCLUSION OF [alpha]- AND [beta]-CATENIN FROM DESMOSOMES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choi, Hee-Jung; Gross, Julia C.; Pokutta, Sabine

    2009-11-18

    Plakoglobin and {beta}-catenin are homologous armadillo repeat proteins found in adherens junctions, where they interact with the cytoplasmic domain of classical cadherins and with {alpha}-catenin. Plakoglobin, but normally not {beta}-catenin, is also a structural constituent of desmosomes, where it binds to the cytoplasmic domains of the desmosomal cadherins, desmogleins and desmocollins. Here, we report structural, biophysical, and biochemical studies aimed at understanding the molecular basis of selective exclusion of {beta}-catenin and {alpha}-catenin from desmosomes. The crystal structure of the plakoglobin armadillo domain bound to phosphorylated E-cadherin shows virtually identical interactions to those observed between {beta}-catenin and E-cadherin. Trypsin sensitivity experimentsmore » indicate that the plakoglobin arm domain by itself is more flexible than that of {beta}-catenin. Binding of plakoglobin and {beta}-catenin to the intracellular regions of E-cadherin, desmoglein1, and desmocollin1 was measured by isothermal titration calorimetry. Plakoglobin and {beta}-catenin bind strongly and with similar thermodynamic parameters to E-cadherin. In contrast, {beta}-catenin binds to desmoglein-1 more weakly than does plakoglobin. {beta}-Catenin and plakoglobin bind with similar weak affinities to desmocollin-1. Full affinity binding of desmoglein-1 requires sequences C-terminal to the region homologous to the catenin-binding domain of classical cadherins. Although pulldown assays suggest that the presence of N- and C-terminal {beta}-catenin 'tails' that flank the armadillo repeat region reduces the affinity for desmosomal cadherins, calorimetric measurements show no significant effects of the tails on binding to the cadherins. Using purified proteins, we show that desmosomal cadherins and {alpha}-catenin compete directly for binding to plakoglobin, consistent with the absence of {alpha}-catenin in desmosomes.« less

  7. The origin of the cooperativity in the streptavidin-biotin system: A computational investigation through molecular dynamics simulations.

    PubMed

    Liu, Fengjiao; Zhang, John Z H; Mei, Ye

    2016-06-01

    Previous experimental study measuring the binding affinities of biotin to the wild type streptavidin (WT) and three mutants (S45A, D128A and S45A/D128A double mutant) has shown that the loss of binding affinity from the double mutation is larger than the direct sum of those from two single mutations. The origin of this cooperativity has been investigated in this work through molecular dynamics simulations and the end-state free energy method using the polarized protein-specific charge. The results show that this cooperativity comes from both the enthalpy and entropy contributions. The former contribution mainly comes from the alternations of solvation free energy. Decomposition analysis shows that the mutated residues nearly have no contributions to the cooperativity. Instead, N49 and S88, which are located at the entry of the binding pocket and interact with the carboxyl group of biotin, make the dominant contribution among all the residues in the first binding shell around biotin.

  8. The origin of the cooperativity in the streptavidin-biotin system: A computational investigation through molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Liu, Fengjiao; Zhang, John Z. H.; Mei, Ye

    2016-06-01

    Previous experimental study measuring the binding affinities of biotin to the wild type streptavidin (WT) and three mutants (S45A, D128A and S45A/D128A double mutant) has shown that the loss of binding affinity from the double mutation is larger than the direct sum of those from two single mutations. The origin of this cooperativity has been investigated in this work through molecular dynamics simulations and the end-state free energy method using the polarized protein-specific charge. The results show that this cooperativity comes from both the enthalpy and entropy contributions. The former contribution mainly comes from the alternations of solvation free energy. Decomposition analysis shows that the mutated residues nearly have no contributions to the cooperativity. Instead, N49 and S88, which are located at the entry of the binding pocket and interact with the carboxyl group of biotin, make the dominant contribution among all the residues in the first binding shell around biotin.

  9. RPA facilitates telomerase activity at chromosome ends in budding and fission yeasts

    PubMed Central

    Luciano, Pierre; Coulon, Stéphane; Faure, Virginie; Corda, Yves; Bos, Julia; Brill, Steven J; Gilson, Eric; Simon, Marie-Noelle; Géli, Vincent

    2012-01-01

    In Saccharomyces cerevisiae, the telomerase complex binds to chromosome ends and is activated in late S-phase through a process coupled to the progression of the replication fork. Here, we show that the single-stranded DNA-binding protein RPA (replication protein A) binds to the two daughter telomeres during telomere replication but only its binding to the leading-strand telomere depends on the Mre11/Rad50/Xrs2 (MRX) complex. We further demonstrate that RPA specifically co-precipitates with yKu, Cdc13 and telomerase. The interaction of RPA with telomerase appears to be mediated by both yKu and the telomerase subunit Est1. Moreover, a mutation in Rfa1 that affects both the interaction with yKu and telomerase reduces the dramatic increase in telomere length of a rif1Δ, rif2Δ double mutant. Finally, we show that the RPA/telomerase association and function are conserved in Schizosaccharomyces pombe. Our results indicate that in both yeasts, RPA directly facilitates telomerase activity at chromosome ends. PMID:22354040

  10. RPA facilitates telomerase activity at chromosome ends in budding and fission yeasts.

    PubMed

    Luciano, Pierre; Coulon, Stéphane; Faure, Virginie; Corda, Yves; Bos, Julia; Brill, Steven J; Gilson, Eric; Simon, Marie-Noelle; Géli, Vincent

    2012-04-18

    In Saccharomyces cerevisiae, the telomerase complex binds to chromosome ends and is activated in late S-phase through a process coupled to the progression of the replication fork. Here, we show that the single-stranded DNA-binding protein RPA (replication protein A) binds to the two daughter telomeres during telomere replication but only its binding to the leading-strand telomere depends on the Mre11/Rad50/Xrs2 (MRX) complex. We further demonstrate that RPA specifically co-precipitates with yKu, Cdc13 and telomerase. The interaction of RPA with telomerase appears to be mediated by both yKu and the telomerase subunit Est1. Moreover, a mutation in Rfa1 that affects both the interaction with yKu and telomerase reduces the dramatic increase in telomere length of a rif1Δ, rif2Δ double mutant. Finally, we show that the RPA/telomerase association and function are conserved in Schizosaccharomyces pombe. Our results indicate that in both yeasts, RPA directly facilitates telomerase activity at chromosome ends.

  11. Replication of damaged DNA in vitro is blocked by p53

    PubMed Central

    Zhou, Jianmin; Prives, Carol

    2003-01-01

    The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

  12. The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

    PubMed

    Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

    2003-08-29

    We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

  13. Structural analysis of the Sil1-Bip complex reveals the mechanism for Sil1 to function as a nucleotide-exchange factor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yan, Ming; Li, Jingzhi; Sha, Bingdong

    2013-01-16

    Sil1 functions as a NEF (nucleotide-exchange factor) for the ER (endoplasmic reticulum) Hsp70 (heat-shock protein of 70 kDa) Bip in eukaryotic cells. Sil1 may catalyse the ADP release from Bip by interacting directly with the ATPase domain of Bip. In the present study we show the complex crystal structure of the yeast Bip and the NEF Sil1 at the resolution of 2.3 {angstrom} (1 {angstrom} = 0.1 nm). In the Sil1-Bip complex structure, the Sil1 molecule acts as a 'clamp' which binds lobe IIb of the Bip ATPase domain. The binding of Sil1 causes the rotation of lobe IIb {approx}more » 13.5{sup o} away from the ADP-binding pocket. The complex formation also induces lobe Ib to swing in the opposite direction by {approx} 3.7{sup o}. These conformational changes open up the nucleotide-binding pocket in the Bip ATPase domain and disrupt the hydrogen bonds between Bip and bound ADP, which may catalyse ADP release. Mutation of the Sil1 residues involved in binding the Bip ATPase domain compromise the binding affinity of Sil1 to Bip, and these Sil1 mutants also abolish the ability to stimulate the ATPase activity of Bip.« less

  14. Alteration of the C-terminal ligand specificity of the erbin PDZ domain by allosteric mutational effects.

    PubMed

    Murciano-Calles, Javier; McLaughlin, Megan E; Erijman, Ariel; Hooda, Yogesh; Chakravorty, Nishant; Martinez, Jose C; Shifman, Julia M; Sidhu, Sachdev S

    2014-10-23

    Modulation of protein binding specificity is important for basic biology and for applied science. Here we explore how binding specificity is conveyed in PDZ (postsynaptic density protein-95/discs large/zonula occludens-1) domains, small interaction modules that recognize various proteins by binding to an extended C terminus. Our goal was to engineer variants of the Erbin PDZ domain with altered specificity for the most C-terminal position (position 0) where a Val is strongly preferred by the wild-type domain. We constructed a library of PDZ domains by randomizing residues in direct contact with position 0 and in a loop that is close to but does not contact position 0. We used phage display to select for PDZ variants that bind to 19 peptide ligands differing only at position 0. To verify that each obtained PDZ domain exhibited the correct binding specificity, we selected peptide ligands for each domain. Despite intensive efforts, we were only able to evolve Erbin PDZ domain variants with selectivity for the aliphatic C-terminal side chains Val, Ile and Leu. Interestingly, many PDZ domains with these three distinct specificities contained identical amino acids at positions that directly contact position 0 but differed in the loop that does not contact position 0. Computational modeling of the selected PDZ domains shows how slight conformational changes in the loop region propagate to the binding site and result in different binding specificities. Our results demonstrate that second-sphere residues could be crucial in determining protein binding specificity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Free-energy relationships in ion channels activated by voltage and ligand

    PubMed Central

    Chowdhury, Sandipan

    2013-01-01

    Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

  16. The Gab1 protein is a docking site for multiple proteins involved in signaling by the B cell antigen receptor.

    PubMed

    Ingham, R J; Holgado-Madruga, M; Siu, C; Wong, A J; Gold, M R

    1998-11-13

    Gab1 is a member of the docking/scaffolding protein family which includes IRS-1, IRS-2, c-Cbl, p130(cas), and p62(dok). These proteins contain a variety of protein-protein interaction motifs including multiple tyrosine residues that when phosphorylated can act as binding sites for Src homology 2 (SH2) domain-containing signaling proteins. We show in the RAMOS human B cell line that Gab1 is tyrosine-phosphorylated in response to B cell antigen receptor (BCR) engagement. Moreover, tyrosine phosphorylation of Gab1 correlated with the binding of several SH2-containing signaling proteins to Gab1 including Shc, Grb2, phosphatidylinositol 3-kinase, and the SHP-2 tyrosine phosphatase. Far Western analysis showed that the SH2 domains of Shc, SHP-2, and the p85 subunit of phosphatidylinositol 3-kinase could bind directly to tyrosine-phosphorylated Gab1 isolated from activated RAMOS cells. In contrast, the Grb2 SH2 domain did not bind directly to Gab1 but instead to the Shc and SHP-2 associated with Gab1. We also show that Gab1 is present in the membrane-enriched particulate fraction of RAMOS cells and that Gab1/signaling protein complexes are found in this fraction after BCR engagement. Thus, tyrosine-phosphorylated Gab1 may recruit cytosolic signaling proteins to cellular membranes where they can act on membrane-bound targets. This may be a critical step in the activation of multiple BCR signaling pathways.

  17. THE EFFECTS OF TYPE II BINDING ON METABOLIC STABILITY AND BINDING AFFINITY IN CYTOCHROME P450 CYP3A4

    PubMed Central

    Peng, Chi-Chi; Pearson, Josh T.; Rock, Dan A.; Joswig-Jones, Carolyn A.; Jones, Jeffrey P.

    2010-01-01

    One goal in drug design is to decrease clearance due to metabolism. It has been suggested that a compound’s metabolic stability can be increased by incorporation of a sp2 nitrogen into an aromatic ring. Nitrogen incorporation is hypothesized to increase metabolic stability by coordination of nitrogen to the heme iron (termed type II binding). However, questions regarding binding affinity, metabolic stability, and how metabolism of type II binders occurs remain unanswered. Herein, we use pyridinyl quinoline-4-carboxamide analogs to answer these questions. We show that type II binding can have a profound influence on binding affinity for CYP3A4, and the difference in binding affinity can be as high as 1,200 fold. We also find that type II binding compounds can be extensively metabolized, which is not consistent with the dead-end complex kinetic model assumed for type II binders. Two alternate kinetic mechanisms are presented to explain the results. The first involves a rapid equilibrium between the type II bound substrate and a metabolically oriented binding mode. The second involves direct reduction of the nitrogen-coordinated heme followed by oxygen binding. PMID:20346909

  18. Spectroscopic studies on the interaction of a water-soluble cationic porphyrin with proteins

    NASA Astrophysics Data System (ADS)

    Ma, Hong-Min; Chen, Xin; Zhang, Nuo; Han, Yan-Yan; Wu, Dan; Du, Bin; Wei, Qin

    2009-04-01

    The interaction of a water-soluble cationic porphyrin, meso-tetrakis (4- N, N, N-trimethylanilinium) porphyrin (TMAP), with two proteins, bovine serum albumin (BSA) and human serum albumin (HSA), was studied by UV-vis absorption spectroscopy, fluorescence spectroscopy, fluorescence anisotropy and synchronous fluorescence spectroscopy at neutral aqueous solutions. Free base TMAP bound to proteins as monomers and no aggregation was observed. The binding of TMAP quenched the fluorescence of the protein. On the contrary, the fluorescence of TMAP was enhanced and the fluorescence anisotropy increased due to the binding. The direct static binding mechanism could account for the quenching by TMAP and the binding constants were calculated. TMAP showed a higher quenching efficiency and binding constant of HSA than BSA. The binding of TMAP had no obvious effect on the molecular conformation of the protein. There was only one binding site for TMAP and it was located on the surface of the protein molecule. Electrostatic force played an important role in the binding due to the opposite charges on porphyrin and the proteins.

  19. Detection of angiotensin II binding to single adrenal zona glomerulosa cells by confocal Raman microspectroscopy

    NASA Astrophysics Data System (ADS)

    McCoy, Michael J.; Habermann, Timothy J.; Hanke, Craig J.; Adar, Fran; Campbell, William B.; Nithipatikom, Kasem

    1999-04-01

    We developed a confocal Raman microspectroscopic technique to study ligand-receptor bindings in single cells using Raman-labeled ligands and surface-enhanced Raman scattering (SERS). The adrenal zona glomerulosa (ZG) cells were used as a model in this study. ZG cells have a high density of angiotensin II (AII) receptors on the cellular membrane. There are two identified subtypes of AII receptors,namely AT1 and AT2 receptors. AII is a peptidic hormone, which upon binding to its receptors, stimulates the release of aldosterone from ZG cells. The cellular localization of these receptors subtypes was detected in single ZG cells by using immunocomplexation of receptors with specific antibodies and confocal Raman microspectroscopy. In the binding study, we used biotin-labeled AII to bind to its receptors in ZG cells. Then, avidin and Raman-labeled AII. The binding was measure directly on the single ZG cells. The results showed that the binding was displaced with unlabeled AII and specific AII antagonists. This is a rapid and sensitive technique for detection of cellular ligand bindings as well as antagonists screening in drug discovery.

  20. Spectroscopic studies on the interaction of a water-soluble cationic porphyrin with proteins.

    PubMed

    Ma, Hong-Min; Chen, Xin; Zhang, Nuo; Han, Yan-Yan; Wu, Dan; Du, Bin; Wei, Qin

    2009-04-01

    The interaction of a water-soluble cationic porphyrin, meso-tetrakis (4-N,N,N-trimethylanilinium) porphyrin (TMAP), with two proteins, bovine serum albumin (BSA) and human serum albumin (HSA), was studied by UV-vis absorption spectroscopy, fluorescence spectroscopy, fluorescence anisotropy and synchronous fluorescence spectroscopy at neutral aqueous solutions. Free base TMAP bound to proteins as monomers and no aggregation was observed. The binding of TMAP quenched the fluorescence of the protein. On the contrary, the fluorescence of TMAP was enhanced and the fluorescence anisotropy increased due to the binding. The direct static binding mechanism could account for the quenching by TMAP and the binding constants were calculated. TMAP showed a higher quenching efficiency and binding constant of HSA than BSA. The binding of TMAP had no obvious effect on the molecular conformation of the protein. There was only one binding site for TMAP and it was located on the surface of the protein molecule. Electrostatic force played an important role in the binding due to the opposite charges on porphyrin and the proteins.

  1. SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins.

    PubMed

    Park, Mi-Jeong; Sheng, Ren; Silkov, Antonina; Jung, Da-Jung; Wang, Zhi-Gang; Xin, Yao; Kim, Hyunjin; Thiagarajan-Rosenkranz, Pallavi; Song, Seohyeon; Yoon, Youngdae; Nam, Wonhee; Kim, Ilshin; Kim, Eui; Lee, Dong-Gyu; Chen, Yong; Singaram, Indira; Wang, Li; Jang, Myoung Ho; Hwang, Cheol-Sang; Honig, Barry; Ryu, Sungho; Lorieau, Justin; Kim, You-Me; Cho, Wonhwa

    2016-04-07

    The Src-homology 2 (SH2) domain is a protein interaction domain that directs myriad phosphotyrosine (pY)-signaling pathways. Genome-wide screening of human SH2 domains reveals that ∼90% of SH2 domains bind plasma membrane lipids and many have high phosphoinositide specificity. They bind lipids using surface cationic patches separate from pY-binding pockets, thus binding lipids and the pY motif independently. The patches form grooves for specific lipid headgroup recognition or flat surfaces for non-specific membrane binding and both types of interaction are important for cellular function and regulation of SH2 domain-containing proteins. Cellular studies with ZAP70 showed that multiple lipids bind its C-terminal SH2 domain in a spatiotemporally specific manner and thereby exert exquisite spatiotemporal control over its protein binding and signaling activities in T cells. Collectively, this study reveals how lipids control SH2 domain-mediated cellular protein-protein interaction networks and suggest a new strategy for therapeutic modulation of pY-signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Characterization of an RNA aptamer against HPV-16 L1 virus-like particles.

    PubMed

    Leija-Montoya, Ana Gabriela; Benítez-Hess, María Luisa; Toscano-Garibay, Julia Dolores; Alvarez-Salas, Luis Marat

    2014-10-01

    The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3'end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection.

  3. Characterization of an RNA Aptamer Against HPV-16 L1 Virus-Like Particles

    PubMed Central

    Leija-Montoya, Ana Gabriela; Benítez-Hess, María Luisa; Toscano-Garibay, Julia Dolores

    2014-01-01

    The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3′end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection. PMID:25111024

  4. A sensory complex consisting of an ATP-binding cassette transporter and a two-component regulatory system controls bacitracin resistance in Bacillus subtilis.

    PubMed

    Dintner, Sebastian; Heermann, Ralf; Fang, Chong; Jung, Kirsten; Gebhard, Susanne

    2014-10-03

    Resistance against antimicrobial peptides in many Firmicutes bacteria is mediated by detoxification systems that are composed of a two-component regulatory system (TCS) and an ATP-binding cassette (ABC) transporter. The histidine kinases of these systems depend entirely on the transporter for sensing of antimicrobial peptides, suggesting a novel mode of signal transduction where the transporter constitutes the actual sensor. The aim of this study was to investigate the molecular mechanisms of this unusual signaling pathway in more detail, using the bacitracin resistance system BceRS-BceAB of Bacillus subtilis as an example. To analyze the proposed communication between TCS and the ABC transporter, we characterized their interactions by bacterial two-hybrid analyses and could show that the permease BceB and the histidine kinase BceS interact directly. In vitro pulldown assays confirmed this interaction, which was found to be independent of bacitracin. Because it was unknown whether BceAB-type transporters could detect their substrate peptides directly or instead recognized the peptide-target complex in the cell envelope, we next analyzed substrate binding by the transport permease, BceB. Direct and specific binding of bacitracin by BceB was demonstrated by surface plasmon resonance spectroscopy. Finally, in vitro signal transduction assays indicated that complex formation with the transporter influenced the autophosphorylation activity of the histidine kinase. Taken together, our findings clearly show the existence of a sensory complex composed of TCS and ABC transporters and provide the first functional insights into the mechanisms of stimulus perception, signal transduction, and antimicrobial resistance employed by Bce-like detoxification systems. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. A Sensory Complex Consisting of an ATP-binding Cassette Transporter and a Two-component Regulatory System Controls Bacitracin Resistance in Bacillus subtilis*

    PubMed Central

    Dintner, Sebastian; Heermann, Ralf; Fang, Chong; Jung, Kirsten; Gebhard, Susanne

    2014-01-01

    Resistance against antimicrobial peptides in many Firmicutes bacteria is mediated by detoxification systems that are composed of a two-component regulatory system (TCS) and an ATP-binding cassette (ABC) transporter. The histidine kinases of these systems depend entirely on the transporter for sensing of antimicrobial peptides, suggesting a novel mode of signal transduction where the transporter constitutes the actual sensor. The aim of this study was to investigate the molecular mechanisms of this unusual signaling pathway in more detail, using the bacitracin resistance system BceRS-BceAB of Bacillus subtilis as an example. To analyze the proposed communication between TCS and the ABC transporter, we characterized their interactions by bacterial two-hybrid analyses and could show that the permease BceB and the histidine kinase BceS interact directly. In vitro pulldown assays confirmed this interaction, which was found to be independent of bacitracin. Because it was unknown whether BceAB-type transporters could detect their substrate peptides directly or instead recognized the peptide-target complex in the cell envelope, we next analyzed substrate binding by the transport permease, BceB. Direct and specific binding of bacitracin by BceB was demonstrated by surface plasmon resonance spectroscopy. Finally, in vitro signal transduction assays indicated that complex formation with the transporter influenced the autophosphorylation activity of the histidine kinase. Taken together, our findings clearly show the existence of a sensory complex composed of TCS and ABC transporters and provide the first functional insights into the mechanisms of stimulus perception, signal transduction, and antimicrobial resistance employed by Bce-like detoxification systems. PMID:25118291

  6. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding sitemore » are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.« less

  7. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    PubMed

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Bacteria-instructed synthesis of polymers for self-selective microbial binding and labelling

    PubMed Central

    Magennis, E. Peter; Fernandez-Trillo, Francisco; Sui, Cheng; Spain, Sebastian G.; Bradshaw, David; Churchley, David; Mantovani, Giuseppe; Winzer, Klaus; Alexander, Cameron

    2014-01-01

    The detection and inactivation of pathogenic strains of bacteria continues to be an important therapeutic goal. Hence, there is a need for materials that can bind selectively to specific microorganisms, for diagnostic or anti-infective applications, but which can be formed from simple and inexpensive building blocks. Here, we exploit bacterial redox systems to induce a copper-mediated radical polymerisation of synthetic monomers at cell surfaces, generating polymers in situ that bind strongly to the microorganisms which produced them. This ‘bacteria-instructed synthesis’ can be carried out with a variety of microbial strains, and we show that the polymers produced are self-selective binding agents for the ‘instructing’ cell types. We further expand on the bacterial redox chemistries to ‘click’ fluorescent reporters onto polymers directly at the surfaces of a range of clinical isolate strains, allowing rapid, facile and simultaneous binding and visualisation of pathogens. PMID:24813421

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Battles, Michael B.; Langedijk, Johannes P.; Furmanova-Hollenstein, Polina

    Respiratory syncytial virus (RSV) is a leading cause of pneumonia and bronchiolitis in young children and the elderly. Therapeutic small molecules have been developed that bind the RSV F glycoprotein and inhibit membrane fusion, yet their binding sites and molecular mechanisms of action remain largely unknown. In this paper, we show that these inhibitors bind to a three-fold-symmetric pocket within the central cavity of the metastable prefusion conformation of RSV F. Inhibitor binding stabilizes this conformation by tethering two regions that must undergo a structural rearrangement to facilitate membrane fusion. Inhibitor-escape mutations occur in residues that directly contact the inhibitorsmore » or are involved in the conformational rearrangements required to accommodate inhibitor binding. Resistant viruses do not propagate as well as wild-type RSV in vitro, indicating a fitness cost for inhibitor escape. Finally and collectively, these findings provide new insight into class I viral fusion proteins and should facilitate development of optimal RSV fusion inhibitors.« less

  10. Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

    PubMed

    Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

    2016-12-21

    Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

  11. Bacteria-instructed synthesis of polymers for self-selective microbial binding and labelling

    NASA Astrophysics Data System (ADS)

    Magennis, E. Peter; Fernandez-Trillo, Francisco; Sui, Cheng; Spain, Sebastian G.; Bradshaw, David J.; Churchley, David; Mantovani, Giuseppe; Winzer, Klaus; Alexander, Cameron

    2014-07-01

    The detection and inactivation of pathogenic strains of bacteria continues to be an important therapeutic goal. Hence, there is a need for materials that can bind selectively to specific microorganisms for diagnostic or anti-infective applications, but that can be formed from simple and inexpensive building blocks. Here, we exploit bacterial redox systems to induce a copper-mediated radical polymerization of synthetic monomers at cell surfaces, generating polymers in situ that bind strongly to the microorganisms that produced them. This ‘bacteria-instructed synthesis’ can be carried out with a variety of microbial strains, and we show that the polymers produced are self-selective binding agents for the ‘instructing’ cell types. We further expand on the bacterial redox chemistries to ‘click’ fluorescent reporters onto polymers directly at the surfaces of a range of clinical isolate strains, allowing rapid, facile and simultaneous binding and visualization of pathogens.

  12. Molecular mechanism of respiratory syncytial virus fusion inhibitors

    PubMed Central

    Battles, Michael B; Langedijk, Johannes P; Furmanova-Hollenstein, Polina; Chaiwatpongsakorn, Supranee; Costello, Heather M; Kwanten, Leen; Vranckx, Luc; Vink, Paul; Jaensch, Steffen; Jonckers, Tim H M; Koul, Anil; Arnoult, Eric; Peeples, Mark E; Roymans, Dirk; McLellan, Jason S

    2016-01-01

    Respiratory syncytial virus (RSV) is a leading cause of pneumonia and bronchiolitis in young children and the elderly. Therapeutic small molecules have been developed that bind the RSV F glycoprotein and inhibit membrane fusion, yet their binding sites and molecular mechanisms of action remain largely unknown. Here we show that these inhibitors bind to a three-fold-symmetric pocket within the central cavity of the metastable prefusion conformation of RSV F. Inhibitor binding stabilizes this conformation by tethering two regions that must undergo a structural rearrangement to facilitate membrane fusion. Inhibitor-escape mutations occur in residues that directly contact the inhibitors or are involved in the conformational rearrangements required to accommodate inhibitor binding. Resistant viruses do not propagate as well as wild-type RSV in vitro, indicating a fitness cost for inhibitor escape. Collectively, these findings provide new insight into class I viral fusion proteins and should facilitate development of optimal RSV fusion inhibitors. PMID:26641933

  13. The major birch allergen, Bet v 1, shows affinity for a broad spectrum of physiological ligands.

    PubMed

    Mogensen, Jesper E; Wimmer, Reinhard; Larsen, Jørgen N; Spangfort, Michael D; Otzen, Daniel E

    2002-06-28

    Bet v 1 is a 17-kDa protein abundantly present in the pollen of the White birch tree and is the primary cause of birch pollen allergy in humans. Its three-dimensional structure is remarkable in that a solvent-accessible cavity traverses the core of the molecule. The biological function of Bet v 1 is unknown, although it is homologous to a family of pathogenesis-related proteins in plants. In this study we first show that Bet v 1 in the native state is able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonic acid (ANS). ANS binds to Bet v 1 with 1:1 stoichiometry, and NMR data indicate that binding takes place in the cavity. Using an ANS displacement assay, we then identify a range of physiologically relevant ligands, including fatty acids, flavonoids, and cytokinins, which generally bind with low micromolar affinity. The ability of these ligands to displace ANS suggests that they also bind in the cavity, although the exact binding sites seem to vary among different ligands. The cytokinins, for example, seem to bind at a separate site close to ANS, because they increase the fluorescence of the ANS. Bet v 1 complex. Also, the fluorescent sterol dehydroergosterol binds to Bet v 1 as demonstrated by direct titrations. This study provides the first qualitative and quantitative data on the ligand binding properties of this important pollen allergen. Our findings indicate that ligand binding is important for the biological function of Bet v 1.

  14. The Antibiotic Novobiocin Binds and Activates the ATPase That Powers Lipopolysaccharide Transport.

    PubMed

    May, Janine M; Owens, Tristan W; Mandler, Michael D; Simpson, Brent W; Lazarus, Michael B; Sherman, David J; Davis, Rebecca M; Okuda, Suguru; Massefski, Walter; Ruiz, Natividad; Kahne, Daniel

    2017-12-06

    Novobiocin is an orally active antibiotic that inhibits DNA gyrase by binding the ATP-binding site in the ATPase subunit. Although effective against Gram-positive pathogens, novobiocin has limited activity against Gram-negative organisms due to the presence of the lipopolysaccharide-containing outer membrane, which acts as a permeability barrier. Using a novobiocin-sensitive Escherichia coli strain with a leaky outer membrane, we identified a mutant with increased resistance to novobiocin. Unexpectedly, the mutation that increases novobiocin resistance was not found to alter gyrase, but the ATPase that powers lipopolysaccharide (LPS) transport. Co-crystal structures, biochemical, and genetic evidence show novobiocin directly binds this ATPase. Novobiocin does not bind the ATP binding site but rather the interface between the ATPase subunits and the transmembrane subunits of the LPS transporter. This interaction increases the activity of the LPS transporter, which in turn alters the permeability of the outer membrane. We propose that novobiocin will be a useful tool for understanding how ATP hydrolysis is coupled to LPS transport.

  15. Rotenone Activates Phagocyte NADPH Oxidase through Binding to Its Membrane Subunit gp91phox

    PubMed Central

    Zhou, Hui; Zhang, Feng; Chen, Shih-heng; Zhang, Dan; Wilson, Belinda; Hong, Jau-shyong; Gao, Hui-Ming

    2011-01-01

    Rotenone, a widely used pesticide, reproduces Parkinsonism in rodents and associates with increased risk for Parkinson’s disease. We previously reported rotenone increased superoxide production through stimulating microglial phagocyte NADPH oxidase (PHOX). The present study identified a novel mechanism by which rotenone activates PHOX. Ligand-binding assay revealed that rotenone directly bound to membrane gp91phox, the catalytic subunit of PHOX; such binding was inhibited by diphenyleneiodonium, a PHOX inhibitor with a binding site on gp91phox. Functional studies showed both membrane and cytosolic subunits were required for rotenone-induced superoxide production in cell-free systems, intact phagocytes, and COS7 cells transfected with membrane subunits (gp91phox/p22phox) and cytosolic subunits (p67phox and p47phox). Rotenone-elicited extracellular superoxide release in p47phox-deficient macrophages suggested rotenone enabled to activate PHOX through a p47phox-independent mechanism. Increased membrane translocation of p67phox, elevated binding of p67phox to rotenone-treated membrane fractions, and co-immunoprecipitation of p67phox and gp91phox in rotenone-treated wild-type and p47phox-deficient macrophages indicated p67phox played a critical role in rotenone-induced PHOX activation via its direct interaction with gp91phox. Rac1, a Rho-like small GTPase, enhanced p67phox-gp91phox interaction; Rac1 inhibition decreased rotenone-elicited superoxide release. In conclusion, rotenone directly interacted with gp91phox; such an interaction triggered membrane translocation of p67phox, leading to PHOX activation and superoxide production. PMID:22094225

  16. Direct Binding of the Corrector VX-809 to Human CFTR NBD1: Evidence of an Allosteric Coupling between the Binding Site and the NBD1:CL4 Interface.

    PubMed

    Hudson, Rhea P; Dawson, Jennifer E; Chong, P Andrew; Yang, Zhengrong; Millen, Linda; Thomas, Philip J; Brouillette, Christie G; Forman-Kay, Julie D

    2017-08-01

    Understanding the mechanism of action of modulator compounds for the cystic fibrosis transmembrane conductance regulator (CFTR) is key for the optimization of therapeutics as well as obtaining insights into the molecular mechanisms of CFTR function. We demonstrate the direct binding of VX-809 to the first nucleotide-binding domain (NBD1) of human CFTR. Disruption of the interaction between C-terminal helices and the NBD1 core upon VX-809 binding is observed from chemical shift changes in the NMR spectra of residues in the helices and on the surface of β -strands S3, S9, and S10. Binding to VX-809 leads to a significant negative shift in NBD1 thermal melting temperature (T m ), pointing to direct VX-809 interaction shifting the NBD1 conformational equilibrium. An inter-residue correlation analysis of the chemical shift changes provides evidence of allosteric coupling between the direct binding site and the NBD1:CL4 interface, thus enabling effects on the interface in the absence of direct binding in that location. These NMR binding data and the negative T m shifts are very similar to those previously reported by us for binding of the dual corrector-potentiator CFFT-001 to NBD1 (Hudson et al., 2012), suggesting that the two compounds may share some aspects of their mechanisms of action. Although previous studies have shown an important role for VX-809 in modulating the conformation of the first membrane spanning domain (Aleksandrov et al., 2012; Ren et al., 2013), this additional mode of VX-809 binding provides insight into conformational dynamics and allostery within CFTR. Copyright © 2017 by The Author(s).

  17. Superlattices assembled through shape-induced directional binding

    NASA Astrophysics Data System (ADS)

    Lu, Fang; Yager, Kevin G.; Zhang, Yugang; Xin, Huolin; Gang, Oleg

    2015-04-01

    Organization of spherical particles into lattices is typically driven by packing considerations. Although the addition of directional binding can significantly broaden structural diversity, nanoscale implementation remains challenging. Here we investigate the assembly of clusters and lattices in which anisotropic polyhedral blocks coordinate isotropic spherical nanoparticles via shape-induced directional interactions facilitated by DNA recognition. We show that these polyhedral blocks--cubes and octahedrons--when mixed with spheres, promote the assembly of clusters with architecture determined by polyhedron symmetry. Moreover, three-dimensional binary superlattices are formed when DNA shells accommodate the shape disparity between nanoparticle interfaces. The crystallographic symmetry of assembled lattices is determined by the spatial symmetry of the block's facets, while structural order depends on DNA-tuned interactions and particle size ratio. The presented lattice assembly strategy, exploiting shape for defining the global structure and DNA-mediation locally, opens novel possibilities for by-design fabrication of binary lattices.

  18. Cytoplasmic Dynein Regulation by Subunit Heterogeneity and Its Role in Apical Transport

    PubMed Central

    Tai, Andrew W.; Chuang, Jen-Zen; Sung, Ching-Hwa

    2001-01-01

    Despite the existence of multiple subunit isoforms for the microtubule motor cytoplasmic dynein, it has not yet been directly shown that dynein complexes with different compositions exhibit different properties. The 14-kD dynein light chain Tctex-1, but not its homologue RP3, binds directly to rhodopsin's cytoplasmic COOH-terminal tail, which encodes an apical targeting determinant in polarized epithelial Madin-Darby canine kidney (MDCK) cells. We demonstrate that Tctex-1 and RP3 compete for binding to dynein intermediate chain and that overexpressed RP3 displaces endogenous Tctex-1 from dynein complexes in MDCK cells. Furthermore, replacement of Tctex-1 by RP3 selectively disrupts the translocation of rhodopsin to the MDCK apical surface. These results directly show that cytoplasmic dynein function can be regulated by its subunit composition and that cytoplasmic dynein is essential for at least one mode of apical transport in polarized epithelia. PMID:11425878

  19. Superlattices assembled through shape-induced directional binding

    DOE PAGES

    Lu, Fang; Yager, Kevin G.; Zhang, Yugang; ...

    2015-04-23

    Organization of spherical particles into lattices is typically driven by packing considerations. Although the addition of directional binding can significantly broaden structural diversity, nanoscale implementation remains challenging. Here we investigate the assembly of clusters and lattices in which anisotropic polyhedral blocks coordinate isotropic spherical nanoparticles via shape-induced directional interactions facilitated by DNA recognition. We show that these polyhedral blocks—cubes and octahedrons—when mixed with spheres, promote the assembly of clusters with architecture determined by polyhedron symmetry. Moreover, three-dimensional binary superlattices are formed when DNA shells accommodate the shape disparity between nanoparticle interfaces. The crystallographic symmetry of assembled lattices is determined bymore » the spatial symmetry of the block’s facets, while structural order depends on DNA-tuned interactions and particle size ratio. Lastly, the presented lattice assembly strategy, exploiting shape for defining the global structure and DNA-mediation locally, opens novel possibilities for by-design fabrication of binary lattices.« less

  20. Repeated losses of PRDM9-directed recombination despite the conservation of PRDM9 across vertebrates

    PubMed Central

    Baker, Zachary; Schumer, Molly; Haba, Yuki; Bashkirova, Lisa; Holland, Chris; Rosenthal, Gil G; Przeworski, Molly

    2017-01-01

    Studies of highly diverged species have revealed two mechanisms by which meiotic recombination is directed to the genome—through PRDM9 binding or by targeting promoter-like features—that lead to dramatically different evolutionary dynamics of hotspots. Here, we identify PRDM9 orthologs from genome and transcriptome data in 225 species. We find the complete PRDM9 ortholog across distantly related vertebrates but, despite this broad conservation, infer a minimum of six partial and three complete losses. Strikingly, taxa carrying the complete ortholog of PRDM9 are precisely those with rapid evolution of its predicted binding affinity, suggesting that all domains are necessary for directing recombination. Indeed, as we show, swordtail fish carrying only a partial but conserved ortholog share recombination properties with PRDM9 knock-outs. DOI: http://dx.doi.org/10.7554/eLife.24133.001 PMID:28590247

  1. Evidence that Poly(A) Binding Protein C1 Binds Nuclear Pre-mRNA Poly(A) Tails

    PubMed Central

    Hosoda, Nao; Lejeune, Fabrice; Maquat, Lynne E.

    2006-01-01

    In mammalian cells, poly(A) binding protein C1 (PABP C1) has well-known roles in mRNA translation and decay in the cytoplasm. However, PABPC1 also shuttles in and out of the nucleus, and its nuclear function is unknown. Here, we show that PABPC1, like the major nuclear poly(A) binding protein PABPN1, associates with nuclear pre-mRNAs that are polyadenylated and intron containing. PABPC1 does not bind nonpolyadenylated histone mRNA, indicating that the interaction of PABPC1 with pre-mRNA requires a poly(A) tail. Consistent with this conclusion, UV cross-linking results obtained using intact cells reveal that PABPC1 binds directly to pre-mRNA poly(A) tails in vivo. We also show that PABPC1 immunopurifies with poly(A) polymerase, suggesting that PABPC1 is acquired by polyadenylated transcripts during poly(A) tail synthesis. Our findings demonstrate that PABPC1 associates with polyadenylated transcripts earlier in mammalian mRNA biogenesis than previously thought and offer insights into the mechanism by which PABPC1 is recruited to newly synthesized poly(A). Our results are discussed in the context of pre-mRNA processing and stability and mRNA trafficking and the pioneer round of translation. PMID:16581783

  2. The IκBα/NF-κB complex has two hot spots, one at either end of the interface

    PubMed Central

    Bergqvist, Simon; Ghosh, Gourisankar; Komives, Elizabeth A.

    2008-01-01

    IκBα binds to and inhibits the transcriptional activity of NF-κB family members via its ankyrin repeat (AR) domain. The binding affinity of IκBα with NF-κB(p50/p65) heterodimers and NF-κB(p65/65) homodimers is in the picomolar range, and in the cell, this results in long half-lives of the complexes. Direct binding experiments have been performed using surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) on a series of truncations and mutations in order to understand what regions of the interface are most important for the tight binding affinity of this complex. We previously showed that interactions between residues 305 and 321 of NF-κB(p65) with the first AR of IκBα are critical for the binding energy. Interactions in this region are responsible for more than 7 kcal/mol of the binding energy. Here we show equally drastic consequences for the binding energy occur upon truncation of even a few residues at the C terminus of IκBα. Thus, the interface actually has two hot spots, one at either end of the elongated and large surface of interaction. These results suggest a “squeeze” mechanism that leads to the extremely high affinity of the IκBα•NF-κB complex through stabilization of the ankyrin repeat domain. PMID:18824506

  3. Electrical detection of single viruses

    NASA Astrophysics Data System (ADS)

    Patolsky, Fernando; Zheng, Gengfeng; Hayden, Oliver; Lakadamyali, Melike; Zhuang, Xiaowei; Lieber, Charles M.

    2004-09-01

    We report direct, real-time electrical detection of single virus particles with high selectivity by using nanowire field effect transistors. Measurements made with nanowire arrays modified with antibodies for influenza A showed discrete conductance changes characteristic of binding and unbinding in the presence of influenza A but not paramyxovirus or adenovirus. Simultaneous electrical and optical measurements using fluorescently labeled influenza A were used to demonstrate conclusively that the conductance changes correspond to binding/unbinding of single viruses at the surface of nanowire devices. pH-dependent studies further show that the detection mechanism is caused by a field effect, and that the nanowire devices can be used to determine rapidly isoelectric points and variations in receptor-virus binding kinetics for different conditions. Lastly, studies of nanowire devices modified with antibodies specific for either influenza or adenovirus show that multiple viruses can be selectively detected in parallel. The possibility of large-scale integration of these nanowire devices suggests potential for simultaneous detection of a large number of distinct viral threats at the single virus level.

  4. Binding Site Turnover Produces Pervasive Quantitative Changes in Transcription Factor Binding between Closely Related Drosophila Species

    PubMed Central

    Trapnell, Cole; Davidson, Stuart; Pachter, Lior; Chu, Hou Cheng; Tonkin, Leath A.; Biggin, Mark D.; Eisen, Michael B.

    2010-01-01

    Changes in gene expression play an important role in evolution, yet the molecular mechanisms underlying regulatory evolution are poorly understood. Here we compare genome-wide binding of the six transcription factors that initiate segmentation along the anterior-posterior axis in embryos of two closely related species: Drosophila melanogaster and Drosophila yakuba. Where we observe binding by a factor in one species, we almost always observe binding by that factor to the orthologous sequence in the other species. Levels of binding, however, vary considerably. The magnitude and direction of the interspecies differences in binding levels of all six factors are strongly correlated, suggesting a role for chromatin or other factor-independent forces in mediating the divergence of transcription factor binding. Nonetheless, factor-specific quantitative variation in binding is common, and we show that it is driven to a large extent by the gain and loss of cognate recognition sequences for the given factor. We find only a weak correlation between binding variation and regulatory function. These data provide the first genome-wide picture of how modest levels of sequence divergence between highly morphologically similar species affect a system of coordinately acting transcription factors during animal development, and highlight the dominant role of quantitative variation in transcription factor binding over short evolutionary distances. PMID:20351773

  5. ITCH directly K63-ubiquitinates the NOD2 binding protein, RIP2, to influence inflammatory signaling pathways

    PubMed Central

    Tao, MingFang; Scacheri, Peter C.; Marinis, Jill M.; Harhaj, Edward W.; Matesic, Lydia E.; Abbott, Derek W.

    2009-01-01

    Background: The inability to coordinate the signaling pathways that lead to proper cytokine responses characterizes the pathogenesis of inflammatory diseases such as Crohn's Disease. The Crohn's Disease susceptibility protein, NOD2, helps coordinate cytokine responses upon intracellular exposure to bacteria, and this signal coordination by NOD2 is accomplished, in part, through K63-linked polyubiquitin chains that create binding surfaces for the scaffolding of signaling complexes. Results: In this work, we show that the NOD2 signaling partner, RIP2, is directly K63 polyubiquitinated by ITCH, an E3 ubiquitin ligase which when lost genetically, causes widespread inflammatory disease at mucosal surfaces. We show that ITCH is responsible for RIP2 polyubiquitination in response to infection with listeria monocytogenes. We further show that NOD2 can bind polyubiquitinated RIP2, and while ITCH E3 ligase activity is required for optimal NOD2:RIP2-induced p38 and JNK activation, ITCH inhibits NOD2:RIP2-induced NFκB activation. This effect can be seen independently at the whole genome level by microarray analysis of MDP-treated Itch−/− primary macrophages. Conclusions: These findings suggest that ITCH helps regulate NOD2-dependent signal transduction pathways and as such, may be involved in the pathogenesis of NOD2-mediated inflammatory disease. PMID:19592251

  6. Direct Correlation of DNA Binding and Single Protein Domain Motion via Dual Illumination Fluorescence Microscopy

    PubMed Central

    2015-01-01

    We report a dual illumination, single-molecule imaging strategy to dissect directly and in real-time the correlation between nanometer-scale domain motion of a DNA repair protein and its interaction with individual DNA substrates. The strategy was applied to XPD, an FeS cluster-containing DNA repair helicase. Conformational dynamics was assessed via FeS-mediated quenching of a fluorophore site-specifically incorporated into XPD. Simultaneously, binding of DNA molecules labeled with a spectrally distinct fluorophore was detected by colocalization of the DNA- and protein-derived signals. We show that XPD undergoes thermally driven conformational transitions that manifest in spatial separation of its two auxiliary domains. DNA binding does not strictly enforce a specific conformation. Interaction with a cognate DNA damage, however, stabilizes the compact conformation of XPD by increasing the weighted average lifetime of this state by 140% relative to an undamaged DNA. Our imaging strategy will be a valuable tool to study other FeS-containing nucleic acid processing enzymes. PMID:25204359

  7. A Mutation Directs the Structural Switch of DNA Binding Proteins under Starvation to a Ferritin-like Protein Cage.

    PubMed

    Williams, Sunanda Margrett; Chandran, Anu Vijayakumari; Prakash, Sunita; Vijayan, Mamannamana; Chatterji, Dipankar

    2017-09-05

    Proteins of the ferritin family are ubiquitous in living organisms. With their spherical cage-like structures they are the iron storehouses in cells. Subfamilies of ferritins include 24-meric ferritins and bacterioferritins (maxiferritins), and 12-meric Dps (miniferritins). Dps safeguards DNA by direct binding, affording physical protection and safeguards from free radical-mediated damage by sequestering iron in its core. The maxiferritins can oxidize and store iron but cannot bind DNA. Here we show that a mutation at a critical interface in Dps alters its assembly from the canonical 12-mer to a ferritin-like 24-mer under crystallization. This structural switch was attributed to the conformational alteration of a highly conserved helical loop and rearrangement of the C-terminus. Our results demonstrate a novel concept of mutational switch between related protein subfamilies and corroborate the popular model for evolution by which subtle substitutions in an amino acid sequence lead to diversification among proteins. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Urusova, Darya V.; Shim, Jung-Hyun; Kim, Dong Joon

    The most active anticancer component in green tea is epigallocatechin-3-gallate (EGCG). The human peptidyl prolyl cis/trans isomerase (Pin1) plays a critical role in oncogenic signaling. Herein, we report the X-ray crystal structure of the Pin1/EGCG complex resolved at 1.9 Å resolution. Notably, the structure revealed the presence of EGCG in both the WW and PPIase domains of Pin1. The direct binding of EGCG with Pin1 was confirmed and the interaction inhibited Pin1 PPIase activity. In addition, proliferation of cells expressing Pin1 was inhibited and tumor growth in a xenograft mouse model was suppressed. The binding of EGCG with Arg17 inmore » the WW domain prevented the binding of c-Jun, a well-known Pin1 substrate. EGCG treatment corresponded with a decreased abundance of cyclin D1 and diminution of 12-O-tetradecanoylphorbol-l3-acetate–induced AP-1 or NF-κB promoter activity in cells expressing Pin1. Overall, these results showed that EGCG directly suppresses the tumor-promoting effect of Pin1.« less

  9. Combinatorial multispectral, thermodynamics, docking and site-directed mutagenesis reveal the cognitive characteristics of honey bee chemosensory protein to plant semiochemical.

    PubMed

    Tan, Jing; Song, Xinmi; Fu, Xiaobin; Wu, Fan; Hu, Fuliang; Li, Hongliang

    2018-08-05

    In the chemoreceptive system of insects, there are always some soluble binding proteins, such as some antennal-specific chemosensory proteins (CSPs), which are abundantly distributed in the chemosensory sensillar lymph. The antennal-specific CSPs usually have strong capability to bind diverse semiochemicals, while the detailed interaction between CSPs and the semiochemicals remain unclear. Here, by means of the combinatorial multispectral, thermodynamics, docking and site-directed mutagenesis, we detailedly interpreted a binding interaction between a plant semiochemical β-ionone and antennal-specific CSP1 from the worker honey bee. Thermodynamic parameters (ΔH < 0, ΔS > 0) indicate that the interaction is mainly driven by hydrophobic forces and electrostatic interactions. Docking prediction results showed that there are two key amino acids, Phe44 and Gln63, may be involved in the interacting process of CSP1 to β-ionone. In order to confirm the two key amino acids, site-directed mutagenesis were performed and the binding constant (K A ) for two CSP1 mutant proteins was reduced by 60.82% and 46.80% compared to wild-type CSP1. The thermodynamic analysis of mutant proteins furtherly verified that Phe44 maintained an electrostatic interaction and Gln63 contributes hydrophobic and electrostatic forces. Our investigation initially elucidates the physicochemical mechanism of the interaction between antennal-special CSPs in insects including bees to plant semiochemicals, as well as the development of twice thermodynamic analysis (wild type and mutant proteins) combined with multispectral and site-directed mutagenesis methods. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Cortactin scaffolds Arp2/3 and WAVE2 at the epithelial zonula adherens.

    PubMed

    Han, Siew Ping; Gambin, Yann; Gomez, Guillermo A; Verma, Suzie; Giles, Nichole; Michael, Magdalene; Wu, Selwin K; Guo, Zhong; Johnston, Wayne; Sierecki, Emma; Parton, Robert G; Alexandrov, Kirill; Yap, Alpha S

    2014-03-14

    Cadherin junctions arise from the integrated action of cell adhesion, signaling, and the cytoskeleton. At the zonula adherens (ZA), a WAVE2-Arp2/3 actin nucleation apparatus is necessary for junctional tension and integrity. But how this is coordinated with cadherin adhesion is not known. We now identify cortactin as a key scaffold for actin regulation at the ZA, which localizes to the ZA through influences from both E-cadherin and N-WASP. Using cell-free protein expression and fluorescent single molecule coincidence assays, we demonstrate that cortactin binds directly to the cadherin cytoplasmic tail. However, its concentration with cadherin at the apical ZA also requires N-WASP. Cortactin is known to bind Arp2/3 directly (Weed, S. A., Karginov, A. V., Schafer, D. A., Weaver, A. M., Kinley, A. W., Cooper, J. A., and Parsons, J. T. (2000) J. Cell Biol. 151, 29-40). We further show that cortactin can directly bind WAVE2, as well as Arp2/3, and both these interactions are necessary for actin assembly at the ZA. We propose that cortactin serves as a platform that integrates regulators of junctional actin assembly at the ZA.

  11. Cortactin Scaffolds Arp2/3 and WAVE2 at the Epithelial Zonula Adherens*♦

    PubMed Central

    Han, Siew Ping; Gambin, Yann; Gomez, Guillermo A.; Verma, Suzie; Giles, Nichole; Michael, Magdalene; Wu, Selwin K.; Guo, Zhong; Johnston, Wayne; Sierecki, Emma; Parton, Robert G.; Alexandrov, Kirill; Yap, Alpha S.

    2014-01-01

    Cadherin junctions arise from the integrated action of cell adhesion, signaling, and the cytoskeleton. At the zonula adherens (ZA), a WAVE2-Arp2/3 actin nucleation apparatus is necessary for junctional tension and integrity. But how this is coordinated with cadherin adhesion is not known. We now identify cortactin as a key scaffold for actin regulation at the ZA, which localizes to the ZA through influences from both E-cadherin and N-WASP. Using cell-free protein expression and fluorescent single molecule coincidence assays, we demonstrate that cortactin binds directly to the cadherin cytoplasmic tail. However, its concentration with cadherin at the apical ZA also requires N-WASP. Cortactin is known to bind Arp2/3 directly (Weed, S. A., Karginov, A. V., Schafer, D. A., Weaver, A. M., Kinley, A. W., Cooper, J. A., and Parsons, J. T. (2000) J. Cell Biol. 151, 29–40). We further show that cortactin can directly bind WAVE2, as well as Arp2/3, and both these interactions are necessary for actin assembly at the ZA. We propose that cortactin serves as a platform that integrates regulators of junctional actin assembly at the ZA. PMID:24469447

  12. A novel mechanism of RNase L inhibition: Theiler's virus L* protein prevents 2-5A from binding to RNase L

    PubMed Central

    Drappier, Melissa; Elliott, Ruth; Zhang, Rong; Weiss, Susan R.; Silverman, Robert H.

    2018-01-01

    The OAS/RNase L pathway is one of the best-characterized effector pathways of the IFN antiviral response. It inhibits the replication of many viruses and ultimately promotes apoptosis of infected cells, contributing to the control of virus spread. However, viruses have evolved a range of escape strategies that act against different steps in the pathway. Here we unraveled a novel escape strategy involving Theiler’s murine encephalomyelitis virus (TMEV) L* protein. Previously we found that L* was the first viral protein binding directly RNase L. Our current data show that L* binds the ankyrin repeats R1 and R2 of RNase L and inhibits 2’-5’ oligoadenylates (2-5A) binding to RNase L. Thereby, L* prevents dimerization and oligomerization of RNase L in response to 2-5A. Using chimeric mouse hepatitis virus (MHV) expressing TMEV L*, we showed that L* efficiently inhibits RNase L in vivo. Interestingly, those data show that L* can functionally substitute for the MHV-encoded phosphodiesterase ns2, which acts upstream of L* in the OAS/RNase L pathway, by degrading 2-5A. PMID:29652922

  13. Characterization of a unique motif in LIM mineralization protein-1 that interacts with jun activation-domain-binding protein 1.

    PubMed

    Sangadala, Sreedhara; Yoshioka, Katsuhito; Enyo, Yoshio; Liu, Yunshan; Titus, Louisa; Boden, Scott D

    2014-01-01

    Development and repair of the skeletal system and other organs are highly dependent on precise regulation of the bone morphogenetic protein (BMP) pathway. The use of BMPs clinically to induce bone formation has been limited in part by the requirement of much higher doses of recombinant proteins in primates than were needed in cell culture or rodents. Therefore, increasing cellular responsiveness to BMPs has become our focus. We determined that an osteogenic LIM mineralization protein, LMP-1 interacts with Smurf1 (Smad ubiquitin regulatory factor 1) and prevents ubiquitination of Smads resulting in potentiation of BMP activity. In the region of LMP-1 responsible for bone formation, there is a motif that directly interacts with the Smurf1 WW2 domain and thus effectively competes for binding with Smad1 and Smad5, key signaling proteins in the BMP pathway. Here we show that the same region also contains a motif that interacts with Jun activation-domain-binding protein 1 (Jab1) which targets a common Smad, Smad4, shared by both the BMP and transforming growth factor-β (TGF-β) pathways, for proteasomal degradation. Jab1 was first identified as a coactivator of the transcription factor c-Jun. Jab1 binds to Smad4, Smad5, and Smad7, key intracellular signaling molecules of the TGF-β superfamily, and causes ubiquitination and/or degradation of these Smads. We confirmed a direct interaction of Jab1 with LMP-1 using recombinantly expressed wild-type and mutant proteins in slot-blot-binding assays. We hypothesized that LMP-1 binding to Jab1 prevents the binding and subsequent degradation of these Smads causing increased accumulation of osteogenic Smads in cells. We identified a sequence motif in LMP-1 that was predicted to interact with Jab1 based on the MAME/MAST sequence analysis of several cellular signaling molecules that are known to interact with Jab-1. We further mutated the potential key interacting residues in LMP-1 and showed loss of binding to Jab1 in binding assays in vitro. The activities of various wild-type and mutant LMP-1 proteins were evaluated using a BMP-responsive luciferase reporter and alkaline phosphatase assay in mouse myoblastic cells that were differentiated toward the osteoblastic phenotype. Finally, to strengthen physiological relevance of LMP-1 and Jab1 interaction, we showed that overexpression of LMP-1 caused nuclear accumulation of Smad4 upon BMP treatment which is reflective of increased Smad signaling in cells.

  14. Dicyanovinylnaphthalenes for neuroimaging of amyloids and relationships of electronic structures and geometries to binding affinities

    PubMed Central

    Petrič, Andrej; Johnson, Scott A.; Pham, Hung V.; Li, Ying; Čeh, Simon; Golobič, Amalija; Agdeppa, Eric D.; Timbol, Gerald; Liu, Jie; Keum, Gyochang; Satyamurthy, Nagichettiar; Kepe, Vladimir; Houk, Kendall N.; Barrio, Jorge R.

    2012-01-01

    The positron-emission tomography (PET) probe 2-(1-[6-[(2-fluoroethyl)(methyl)amino]-2-naphthyl]ethylidene) (FDDNP) is used for the noninvasive brain imaging of amyloid-β (Aβ) and other amyloid aggregates present in Alzheimer’s disease and other neurodegenerative diseases. A series of FDDNP analogs has been synthesized and characterized using spectroscopic and computational methods. The binding affinities of these molecules have been measured experimentally and explained through the use of a computational model. The analogs were created by systematically modifying the donor and the acceptor sides of FDDNP to learn the structural requirements for optimal binding to Aβ aggregates. FDDNP and its analogs are neutral, environmentally sensitive, fluorescent molecules with high dipole moments, as evidenced by their spectroscopic properties and dipole moment calculations. The preferred solution-state conformation of these compounds is directly related to the binding affinities. The extreme cases were a nonplanar analog t-butyl-FDDNP, which shows low binding affinity for Aβ aggregates (520 nM Ki) in vitro and a nearly planar tricyclic analog cDDNP, which displayed the highest binding affinity (10 pM Ki). Using a previously published X-ray crystallographic model of 1,1-dicyano-2-[6-(dimethylamino)naphthalen-2-yl]propene (DDNP) bound to an amyloidogenic Aβ peptide model, we show that the binding affinity is inversely related to the distortion energy necessary to avoid steric clashes along the internal surface of the binding channel. PMID:23012452

  15. Functional characterization of chitin-binding lectin from Solanum integrifolium containing anti-fungal and insecticidal activities.

    PubMed

    Chen, Chang-Shan; Chen, Chun-Yi; Ravinath, Divya Malathy; Bungahot, Agustina; Cheng, Chi-Ping; You, Ren-In

    2018-01-03

    Along with the rapid development of glycomic tools, the study of lectin-carbohydrate interactions has expanded, opening the way for applications in the fields of analytic, diagnostic, and drug delivery. Chitin-binding lectins (CBLs) play roles in immune defense against chitin-containing pathogens. CBLs from species of the Solanaceae family, such as tomato, potato and jimsonweed, display different binding specificities to sugar chains containing poly-N-acetyllactosamine. In this report, CBLs from Solanum integrifolium were isolated by ion exchange chromatography. The fractions showed hemagglutination activity (HA). The recombinant CBL in the 293F cell culture supernatant was able to inhibit the growth of Rhizoctonia solani and Colletotrichum gloeosporioide. Furthermore, the carbohydrate-binding property of CBLs was confirmed with the inhibition of HA. Binding of CBL to Spodoptera frugiperda (sf21) insect cells can partly be inhibited by N-Acetylglucosamine (GlcNAc), which is related to decrease mitochondrial membrane potential of sf21 cells. The results showed that CBL exhibited antifungal properties and inhibited insect cell growth, which is directly correlated to the lectin-carbohydrate interaction. Further identification and characterization of CBLs will help to broaden their scope of application in plant defense and in biomedical applications.

  16. Actin-related proteins regulate the RSC chromatin remodeler by weakening intramolecular interactions of the Sth1 ATPase.

    PubMed

    Turegun, Bengi; Baker, Richard W; Leschziner, Andres E; Dominguez, Roberto

    2018-01-01

    The catalytic subunits of SWI/SNF-family and INO80-family chromatin remodelers bind actin and actin-related proteins (Arps) through an N-terminal helicase/SANT-associated (HSA) domain. Between the HSA and ATPase domains lies a conserved post-HSA (pHSA) domain. The HSA domain of Sth1, the catalytic subunit of the yeast SWI/SNF-family remodeler RSC, recruits the Rtt102-Arp7/9 heterotrimer. Rtt102-Arp7/9 regulates RSC function, but the mechanism is unclear. We show that the pHSA domain interacts directly with another conserved region of the catalytic subunit, protrusion-1. Rtt102-Arp7/9 binding to the HSA domain weakens this interaction and promotes the formation of stable, monodisperse complexes with DNA and nucleosomes. A crystal structure of Rtt102-Arp7/9 shows that ATP binds to Arp7 but not Arp9. However, Arp7 does not hydrolyze ATP. Together, the results suggest that Rtt102 and ATP stabilize a conformation of Arp7/9 that potentiates binding to the HSA domain, which releases intramolecular interactions within Sth1 and controls DNA and nucleosome binding.

  17. Interpretation of the Raji cell assay in sera containing anti-nuclear antibodies and immune complexes.

    PubMed Central

    Horsfall, A C; Venables, P J; Mumford, P A; Maini, R N

    1981-01-01

    The Raji cell assay is regarded as a test for the detection and quantitation of immune complexes. It is frequently positive in sera from patients with SLE. We have demonstrated a relationship between Raji cell binding and antibodies to DNA and soluble cellular antigens. In five sera containing high titres of antibodies of known single specificity, most of the Raji cell binding occurred in the 7S IgG fraction where the majority of anti-nuclear antibody was also found. When each of these sera was incubated with its specific antigen, Raji cell binding increased. Subsequent fractionation showed that this binding was in the high molecular weight fraction (greater than 200,000 daltons) and that Raji cell binding and antibody activity were abolished in the 7S fraction. These data confirm that Raji cell bind immune complexes but also indicate that 7S anti-nuclear antibodies may interact directly with Raji cells by an unknown mechanism. Therefore, in sera of patients with anti-nuclear antibodies, binding to Raji cells does not necessarily imply the presence of immune complexes alone. PMID:6975676

  18. Investigation of the Binding Interaction of Fatty Acids with Human G Protein-Coupled Receptor 40 Using a Site-Specific Fluorescence Probe by Flow Cytometry.

    PubMed

    Ren, Xiao-Min; Cao, Lin-Ying; Zhang, Jing; Qin, Wei-Ping; Yang, Yu; Wan, Bin; Guo, Liang-Hong

    2016-04-05

    Human G protein-coupled receptor 40 (hGPR40), with medium- and long-chain free fatty acids (FFAs) as its natural ligands, plays an important role in the enhancement of glucose-dependent insulin secretion. To date, information about the direct binding of FFAs to hGPR40 is very limited, and how carbon-chain length affects the activities of FFAs on hGPR40 is not yet understood. In this study, a fluorescein-fasiglifam analogue (F-TAK-875A) conjugate was designed and synthesized as a site-specific fluorescence probe to study the interaction of FFAs with hGPR40. hGPR40 was expressed in human embryonic kidney 293 cells and labeled with F-TAK-875A. By using flow cytometry, competitive binding of FFA and F-TAK-875A to hGPR40-expressed cells was measured. Binding affinities of 18 saturated FFAs, with carbon-chain lengths ranging from C6 to C23, were analyzed. The results showed that the binding potencies of FFAs to hGPR40 were dependent on carbon length. There was a positive correlation between length and binding potency for seven FFAs (C9-C15), with myristic acid (C15) showing the highest potency, 0.2% relative to TAK-875. For FFAs with a length of fewer than C9 or more than C15, they had very weak or no binding. Molecular docking results showed that the binding pocket of TAK-875 in hGPR40 could enclose FFAs with lengths of C15 or fewer. However, for FFAs with lengths longer than C15, part of the alkyl chain extended out of the binding pocket. This study provided insights into the structural dependence of FFAs binding to and activation of hGPR40.

  19. Kindlin-2 directly binds actin and regulates integrin outside-in signaling

    PubMed Central

    Bledzka, Kamila; Bialkowska, Katarzyna; Sossey-Alaoui, Khalid; Vaynberg, Julia; Pluskota, Elzbieta

    2016-01-01

    Reduced levels of kindlin-2 (K2) in endothelial cells derived from K2+/− mice or C2C12 myoblastoid cells treated with K2 siRNA showed disorganization of their actin cytoskeleton and decreased spreading. These marked changes led us to examine direct binding between K2 and actin. Purified K2 interacts with F-actin in cosedimentation and surface plasmon resonance analyses and induces actin aggregation. We further find that the F0 domain of K2 binds actin. A mutation, LK47/AA, within a predicted actin binding site (ABS) of F0 diminishes its interaction with actin by approximately fivefold. Wild-type K2 and K2 bearing the LK47/AA mutation were equivalent in their ability to coactivate integrin αIIbβ3 in a CHO cell system when coexpressed with talin. However, K2-LK47/AA exhibited a diminished ability to support cell spreading and actin organization compared with wild-type K2. The presence of an ABS in F0 of K2 that influences outside-in signaling across integrins establishes a new foundation for considering how kindlins might regulate cellular responses. PMID:27044892

  20. Substrate Binding and Catalytic Mechanism of Human Choline Acetyltransferase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim,A.; Rylett, J.; Shilton, B.

    2006-01-01

    Choline acetyltransferase (ChAT) catalyzes the synthesis of the neurotransmitter acetylcholine from choline and acetyl-CoA, and its presence is a defining feature of cholinergic neurons. We report the structure of human ChAT to a resolution of 2.2 {angstrom} along with structures for binary complexes of ChAT with choline, CoA, and a nonhydrolyzable acetyl-CoA analogue, S-(2-oxopropyl)-CoA. The ChAT-choline complex shows which features of choline are important for binding and explains how modifications of the choline trimethylammonium group can be tolerated by the enzyme. A detailed model of the ternary Michaelis complex fully supports the direct transfer of the acetyl group from acetyl-CoAmore » to choline through a mechanism similar to that seen in the serine hydrolases for the formation of an acyl-enzyme intermediate. Domain movements accompany CoA binding, and a surface loop, which is disordered in the unliganded enzyme, becomes localized and binds directly to the phosphates of CoA, stabilizing the complex. Interactions between this surface loop and CoA may function to lower the K{sub M} for CoA and could be important for phosphorylation-dependent regulation of ChAT activity.« less

  1. Dissecting the involvement of LC3B and GATE-16 in p62 recruitment into autophagosomes.

    PubMed

    Shvets, Elena; Abada, Adi; Weidberg, Hilla; Elazar, Zvulun

    2011-07-01

    Autophagy is a major intracellular trafficking pathway that delivers proteins and organelles from the cytoplasm into lysosomes for consequential degradation and recycling. Mammalian Atg8s are key autophagic factors that undergo a unique ubiquitin-like conjugation to the lipid phase of the autophagosomal membrane. In addition to their activity in autophagosome formation, several Atg8s directly bind p62/SQSTM1. Here we show that LC3 and GATE-16 differ in their mode of p62 binding. While the soluble form of both LC3 and GATE-16 bind p62, only the lipidated form of LC3 is directly involved in p62 recruitment into autophagosomes. Moreover, by utilizing chimeras of LC3 and GATE-16 where their N-terminus was swapped, we determined the regions responsible for this differential binding. Accordingly, we found that the chimera of GATE-16 containing the LC3 N-terminal region acts similarly to wild-type LC3 in recruiting p62 into autophagosomes. We therefore propose that LC3 is responsible for the final stages of p62 incorporation into autophagosomes, a process selectively mediated by its N-terminus.

  2. The WEREWOLF MYB protein directly regulates CAPRICE transcription during cell fate specification in the Arabidopsis root epidermis.

    PubMed

    Ryu, Kook Hui; Kang, Yeon Hee; Park, Young-hwan; Hwang, Ildoo; Schiefelbein, John; Lee, Myeong Min

    2005-11-01

    The Arabidopsis root epidermis is composed of two types of cells, hair cells and non-hair cells, and their fate is determined in a position-dependent manner. WEREWOLF (WER), a R2R3 MYB protein, has been shown genetically to function as a master regulator to control both of the epidermal cell fates. To directly test the proposed role of WER in this system, we examined its subcellular localization and defined its transcriptional activation properties. We show that a WER-GFP fusion protein is functional and accumulates in the nucleus of the N-position cells in the Arabidopsis root epidermis, as expected for a transcriptional regulator. We also find that a modified WER protein with a strong activation domain (WER-VP16) promotes the formation of both epidermal cell types, supporting the view that WER specifies both cell fates. In addition, we used the glucocorticoid receptor (GR) inducible system to show that CPC transcription is regulated directly by WER. Using EMSA, we found two WER-binding sites (WBSs; WBSI and WBSII) in the CPC promoter. WER-WBSI binding was confirmed in vivo using the yeast one-hybrid assay. Binding between the WER protein and both WBSs (WBSI and WBSII), and the importance of the two WBSs in CPC promoter activity were confirmed in Arabidopsis. These results provide experimental support for the proposed role of WER as an activator of gene transcription during the specification of both epidermal cell fates.

  3. Glucagon-Like Peptide-1 Receptor Ligand Interactions: Structural Cross Talk between Ligands and the Extracellular Domain

    PubMed Central

    West, Graham M.; Willard, Francis S.; Sloop, Kyle W.; Showalter, Aaron D.; Pascal, Bruce D.; Griffin, Patrick R.

    2014-01-01

    Activation of the glucagon-like peptide-1 receptor (GLP-1R) in pancreatic β-cells potentiates insulin production and is a current therapeutic target for the treatment of type 2 diabetes mellitus (T2DM). Like other class B G protein-coupled receptors (GPCRs), the GLP-1R contains an N-terminal extracellular ligand binding domain. N-terminal truncations on the peptide agonist generate antagonists capable of binding to the extracellular domain, but not capable of activating full length receptor. The main objective of this study was to use Hydrogen/deuterium exchange (HDX) to identify how the amide hydrogen bonding network of peptide ligands and the extracellular domain of GLP-1R (nGLP-1R) were altered by binding interactions and to then use this platform to validate direct binding events for putative GLP-1R small molecule ligands. The HDX studies presented here for two glucagon-like peptide-1 receptor (GLP-1R) peptide ligands indicates that the antagonist exendin-4[9-39] is significantly destabilized in the presence of nonionic detergents as compared to the agonist exendin-4. Furthermore, HDX can detect stabilization of exendin-4 and exendin-4[9-39] hydrogen bonding networks at the N-terminal helix [Val19 to Lys27] upon binding to the N-terminal extracellular domain of GLP-1R (nGLP-1R). In addition we show hydrogen bonding network stabilization on nGLP-1R in response to ligand binding, and validate direct binding events with the extracellular domain of the receptor for putative GLP-1R small molecule ligands. PMID:25180755

  4. Studies of the TLR4-associated protein MD-2 using yeast-display and mutational analyses

    PubMed Central

    Mattis, Daiva M.; Chervin, Adam; Ranoa, Diana; Kelley, Stacy; Tapping, Richard; Kranz, David M.

    2015-01-01

    Bacterial lipopolysaccharide (LPS) activates the innate immune system by forming a complex with myeloid differentiation factor 2 (MD-2) and Toll-like receptor 4 (TLR4), which is present on antigen presenting cells. MD-2 plays an essential role in this activation of the innate immune system as a member of the ternary complex, TLR4:MD-2:LPS. With the goal of further understanding the molecular details of the interaction of MD-2 with LPS and TLR4, and possibly toward engineering dominant negative regulators of the MD-2 protein, here we subjected MD-2 to a mutational analysis using yeast display. The approach included generation of site-directed alanine mutants, and ligand-driven selections of MD-2 mutant libraries. Our findings showed that: 1) proline mutations in the F119-K132 loop that binds LPS were strongly selected for enhanced yeast surface stability, 2) there was a preference for positive-charged side chains (R/K) at residue 120 for LPS binding, and negative-charged side chains (D/E) for TLR4 binding, 3) aromatic residues were strongly preferred at F119 and F121 for LPS binding, and 4) an MD-2 mutant (T84N/D101A/S118A/S120D/K122P) exhibited increased binding to TLR4 but decreased binding to LPS. These studies revealed the impact of specific residues and regions of MD-2 on the binding of LPS and TLR4, and they provide a framework for further directed evolution of the MD-2 protein. PMID:26320630

  5. Autoinhibition of ETV6 DNA Binding Is Established by the Stability of Its Inhibitory Helix

    PubMed Central

    De, Soumya; Okon, Mark; Graves, Barbara J.; McIntosh, Lawrence P.

    2017-01-01

    The ETS transcriptional repressor ETV6 (or TEL) is autoinhibited by an α-helix that sterically blocks its DNA-binding ETS domain. The inhibitory helix is marginally stable and unfolds when ETV6 binds to either specific or non-specific DNA. Using NMR spectroscopy, we show that folding of the inhibitory helix requires a buried charge–dipole interaction with helix H1 of the ETS domain. This interaction also contributes directly to autoinhibition by precluding a highly conserved dipole-enhanced hydrogen bond between the phosphodiester backbone of bound DNA and the N terminus of helix H1. To probe further the thermodynamic basis of autoinhibition, ETV6 variants were generated with amino acid substitutions introduced along the solvent exposed surface of the inhibitory helix. These changes were designed to increase the intrinsic helical propensity of the inhibitory helix without perturbing its packing interactions with the ETS domain. NMR-monitored amide hydrogen exchange measurements confirmed that the stability of the folded inhibitory helix increases progressively with added helix-promoting substitutions. This also results in progressively reinforced autoinhibition and decreased DNA-binding affinity. Surprisingly, locking the inhibitory helix onto the ETS domain by a disulfide bridge severely impairs, but does not abolish DNA binding. Weak interactions still occur via an interface displaced from the canonical ETS domain DNA-binding surface. Collectively, these studies establish a direct thermodynamic linkage between inhibitory helix stability and ETV6 autoinhibition, and demonstrate that helix unfolding does not strictly precede DNA binding. Modulating inhibitory helix stability provides a potential route for the in vivo regulation of ETV6 activity. PMID:26920109

  6. Poliovirus Mutants Resistant to Neutralization with Soluble Cell Receptors

    NASA Astrophysics Data System (ADS)

    Kaplan, Gerardo; Peters, David; Racaniello, Vincent R.

    1990-12-01

    Poliovirus mutants resistant to neutralization with soluble cellular receptor were isolated. Replication of soluble receptor-resistant (srr) mutants was blocked by a monoclonal antibody directed against the HeLa cell receptor for poliovirus, indicating that the mutants use this receptor to enter cells. The srr mutants showed reduced binding to HeLa cells and cell membranes. However, the reduced binding phenotype did not have a major impact on viral replication, as judged by plaque size and one-step growth curves. These results suggest that the use of soluble receptors as antiviral agents could lead to the selection of neutralization-resistant mutants that are able to bind cell surface receptors, replicate, and cause disease.

  7. Superposition-free comparison and clustering of antibody binding sites: implications for the prediction of the nature of their antigen

    PubMed Central

    Di Rienzo, Lorenzo; Milanetti, Edoardo; Lepore, Rosalba; Olimpieri, Pier Paolo; Tramontano, Anna

    2017-01-01

    We describe here a superposition free method for comparing the surfaces of antibody binding sites based on the Zernike moments and show that they can be used to quickly compare and cluster sets of antibodies. The clusters provide information about the nature of the bound antigen that, when combined with a method for predicting the number of direct antibody antigen contacts, allows the discrimination between protein and non-protein binding antibodies with an accuracy of 76%. This is of relevance in several aspects of antibody science, for example to select the framework to be used for a combinatorial antibody library. PMID:28338016

  8. Molecular and functional characterization of clathrin- and AP-2-binding determinants within a disordered domain of auxilin.

    PubMed

    Scheele, Urte; Alves, Jurgen; Frank, Ronald; Duwel, Michael; Kalthoff, Christoph; Ungewickell, Ernst

    2003-07-11

    Uncoating of clathrin-coated vesicles requires the J-domain protein auxilin for targeting hsc70 to the clathrin coats and for stimulating the hsc70 ATPase activity. This results in the release of hsc70-complexed clathrin triskelia and concomitant dissociation of the coat. To understand the complex role of auxilin in uncoating and clathrin assembly in more detail, we analyzed the molecular organization of its clathrin-binding domain (amino acids 547-813). CD spectroscopy of auxilin fragments revealed that the clathrin-binding domain is almost completely disordered in solution. By systematic mapping using synthetic peptides and by site-directed mutagenesis, we identified short peptide sequences involved in clathrin heavy chain and AP-2 binding and evaluated their significance for the function of auxilin. Some of the binding determinants, including those containing sequences 674DPF and 636WDW, showed dual specificity for both clathrin and AP-2. In contrast, the two DLL motifs within the clathrin-binding domain were exclusively involved in clathrin binding. Surprisingly, they interacted not only with the N-terminal domain of the heavy chain, but also with the distal domain. Moreover, both DLL peptides proved to be essential for clathrin assembly and uncoating. In addition, we found that the motif 726NWQ is required for efficient clathrin assembly activity. Auxilin shares a number of protein-protein interaction motifs with other endocytic proteins, including AP180. We demonstrate that AP180 and auxilin compete for binding to the alpha-ear domain of AP-2. Like AP180, auxilin also directly interacts with the ear domain of beta-adaptin. On the basis of our data, we propose a refined model for the uncoating mechanism of clathrin-coated vesicles.

  9. Hsp90 binds microtubules and is involved in the reorganization of the microtubular network in angiosperms.

    PubMed

    Krtková, Jana; Zimmermann, Aleksandra; Schwarzerová, Kateřina; Nick, Peter

    2012-09-15

    Microtubules (MTs) are essential for many processes in plant cells. MT-associated proteins (MAPs) influence MT polymerization dynamics and enable them to perform their functions. The molecular chaperone Hsp90 has been shown to associate with MTs in animal and plant cells. However, the role of Hsp90-MT binding in plants has not yet been investigated. Here, we show that Hsp90 associates with cortical MTs in tobacco cells and decorates MTs in the phragmoplast. Further, we show that tobacco Hsp90_MT binds directly to polymerized MTs in vitro. The inhibition of Hsp90 by geldanamycin (GDA) severely impairs MT re-assembly after cold-induced de-polymerization. Our results indicate that the plant Hsp90 interaction with MTs plays a key role in cellular events, where MT re-organization is needed. Copyright © 2012 Elsevier GmbH. All rights reserved.

  10. NO binding kinetics in myoglobin investigated by picosecond Fe K-edge absorption spectroscopy

    PubMed Central

    Silatani, Mahsa; Lima, Frederico A.; Penfold, Thomas J.; Rittmann, Jochen; Reinhard, Marco E.; Rittmann-Frank, Hannelore M.; Borca, Camelia; Grolimund, Daniel; Milne, Christopher J.; Chergui, Majed

    2015-01-01

    Diatomic ligands in hemoproteins and the way they bind to the active center are central to the protein’s function. Using picosecond Fe K-edge X-ray absorption spectroscopy, we probe the NO-heme recombination kinetics with direct sensitivity to the Fe-NO binding after 532-nm photoexcitation of nitrosylmyoglobin (MbNO) in physiological solutions. The transients at 70 and 300 ps are identical, but they deviate from the difference between the static spectra of deoxymyoglobin and MbNO, showing the formation of an intermediate species. We propose the latter to be a six-coordinated domed species that is populated on a timescale of ∼200 ps by recombination with NO ligands. This work shows the feasibility of ultrafast pump–probe X-ray spectroscopic studies of proteins in physiological media, delivering insight into the electronic and geometric structure of the active center. PMID:26438842

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less

  12. Systems Based Study of the Therapeutic Potential of Small Charged Molecules for the Inhibition of IL-1 Mediated Cartilage Degradation

    PubMed Central

    Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.

    2016-01-01

    Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and development of more pharmacologically effective osteoarthritis drugs, and to investigate possible therapeutic options. PMID:27977731

  13. Comparison of 99mTc-UBI 29-41, 99mTc-Ciprofloxacin, 99mTc-Ciprofloxacin dithiocarbamate and 111In-biotin for targeting experimental Staphylococcus aureus and Escherichia coli foreign-body infections: an ex-vivo study.

    PubMed

    Auletta, Sveva; Baldoni, Daniela; Varani, Michela; Galli, Filippo; Hajar, Iman A; Duatti, Adriano; Ferro-Flores, Guillermina; Trampuz, Andrej; Signore, Alberto

    2017-08-28

    Diagnosis of implant-associated infection is challenging. Several radiopharmaceuticals have been described but direct comparisons are limited. Here we compared in vitro and in an animal model 99mTc-UBI, 99mTc-Ciprofloxacin, 99mTcN-CiproCS2 and 111In-DTPA-biotin for targeting E. coli (ATCC 25922) and S. aureus (ATCC 43335). Stability controls were performed with the labelled radiopharmaceuticals during 6 h in saline and serum. The in vitro binding to viable or killed bacteria was evaluated at 37 °C and 4 °C. For in vivo studies, Teflon cages were subcutaneously implanted in mice, followed by percutaneous infection. Biodistribution of i.v. injected radiolabelled radiopharmaceuticals were evaluated during 24 h in cages and dissected tissues. Labelling efficiency of all radiopharmaceuticals ranged between 94% and 98%, with high stability both in saline and in human serum. In vitro binding assays displayed a rapid but poor bacterial binding for all tested agents. Similar binding kinetic occurred also with heat-killed and ethanol-killed bacteria. In the tissue cage model, infection was detected at different time points: 99mTc-UBI and 99mTcN-CiproCS2 showed higher infected cage/sterile cage ratio at 24 h for both E. coli and S. aureus; 99mTc-Ciprofloxacin at 24 h for both E. coli and at 4 h for S. aureus; 111In-DTPA-biotin accumulates faster in both E. coli and S. aureus infected cages. 99mTc-UBI, 99mTcN-CiproCS2 showed poor in vitro binding but good in vivo binding to E. coli only. 111In-DTPA-biotin showed poor in vitro binding but good in vivo binding to S. aureus and poor to E. coli. 99mTc-Ciprofloxacin showed poor in vitro binding but good in vivo binding to all tested bacteria. The mechanism of accumulation in infected sites remains to be elucidated.

  14. Binding preference of carbon nanotube over proline-rich motif ligand on SH3-domain: a comparison with different force fields.

    PubMed

    Shi, Biyun; Zuo, Guanghong; Xiu, Peng; Zhou, Ruhong

    2013-04-04

    With the widespread applications of nanomaterials such as carbon nanotubes, there is a growing concern on the biosafety of these engineered nanoparticles, in particular their interactions with proteins. In molecular simulations of nanoparticle-protein interactions, the choice of empirical parameters (force fields) plays a decisive role, and thus is of great importance and should be examined carefully before wider applications. Here we compare three commonly used force fields, CHARMM, OPLSAA, and AMBER in study of the competitive binding of a single wall carbon nanotube (SWCNT) with a native proline-rich motif (PRM) ligand on its target protein SH3 domain, a ubiquitous protein-protein interaction mediator involved in signaling and regulatory pathways. We find that the SWCNT displays a general preference over the PRM in binding with SH3 domain in all the three force fields examined, although the degree of preference can be somewhat different, with the AMBER force field showing the highest preference. The SWCNT prevents the ligand from reaching its native binding pocket by (i) occupying the binding pocket directly, and (ii) binding with the ligand itself and then being trapped together onto some off-sites. The π-π stacking interactions between the SWCNT and aromatic residues are found to play a significant role in its binding to the SH3 domain in all the three force fields. Further analyses show that even the SWCNT-ligand binding can also be relatively more stable than the native ligand-protein binding, indicating a serious potential disruption to the protein SH3 function.

  15. Frataxin Directly Stimulates Mitochondrial Cysteine Desulfurase by Exposing Substrate-binding Sites, and a Mutant Fe-S Cluster Scaffold Protein with Frataxin-bypassing Ability Acts Similarly*♦

    PubMed Central

    Pandey, Alok; Gordon, Donna M.; Pain, Jayashree; Stemmler, Timothy L.; Dancis, Andrew; Pain, Debkumar

    2013-01-01

    For iron-sulfur (Fe-S) cluster synthesis in mitochondria, the sulfur is derived from the amino acid cysteine by the cysteine desulfurase activity of Nfs1. The enzyme binds the substrate cysteine in the pyridoxal phosphate-containing site, and a persulfide is formed on the active site cysteine in a manner depending on the accessory protein Isd11. The persulfide is then transferred to the scaffold Isu, where it combines with iron to form the Fe-S cluster intermediate. Frataxin is implicated in the process, although it is unclear where and how, and deficiency causes Friedreich ataxia. Using purified proteins and isolated mitochondria, we show here that the yeast frataxin homolog (Yfh1) directly and specifically stimulates cysteine binding to Nfs1 by exposing substrate-binding sites. This novel function of frataxin does not require iron, Isu1, or Isd11. Once bound to Nfs1, the substrate cysteine is the source of the Nfs1 persulfide, but this step is independent of frataxin and strictly dependent on Isd11. Recently, a point mutation in Isu1 was found to bypass many frataxin functions. The data presented here show that the Isu1 suppressor mimics the frataxin effects on Nfs1, explaining the bypassing activity. We propose a regulatory mechanism for the Nfs1 persulfide-forming activity. Specifically, at least two separate conformational changes must occur in the enzyme for optimum activity as follows: one is mediated by frataxin interaction that exposes the “buried” substrate-binding sites, and the other is mediated by Isd11 interaction that brings the bound substrate cysteine and the active site cysteine in proximity for persulfide formation. PMID:24217246

  16. Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

    PubMed

    Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

    1994-12-20

    The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

  17. Antigenic role of the adaptive immune response to d-ribose glycated LDL in diabetes, atherosclerosis and diabetes atherosclerotic patients.

    PubMed

    Akhter, Firoz; Khan, M Salman; Alatar, Abdulrahman A; Faisal, Mohammad; Ahmad, Saheem

    2016-04-15

    Glycation of proteins leads to the formation of advanced glycation end products (AGEs, which have significant role in the pathophysiology of diabetes complications. d-ribose appears to be the most reactive among the naturally occurring sugars and contribute significantly to the generation of AGEs. Glycation also results in the generation of free radicals causing structural modification which leads to the generation of neoantigenic epitopes. The aim of the present study was to investigate whether LDL modification results in auto-antibodies formation against its glycated conformer in diabetes and atherosclerosis patients. The binding characteristics of circulating auto-antibodies in patients against native and modified LDL were assessed. T2D (n=105), ATH (n=106) and T2D-ATH patients (n=72) were examined by direct binding ELISA as well as inhibition ELISA, compared with healthy age-matched controls (n=50). Furthermore, ketoamine moieties, HMF and carbonyl content were also estimated in these patient's and healthy subjects. High degree of specific binding was observed by 41.91% of T2D, 54.72% of ATH and 70.83% T2D-ATH patient's sera towards d-ribose glycated LDL, in comparison to its native analog (P<0.05). Normal human sera showed negligible binding with either antigen. Competitive inhibition ELISA reiterates the direct binding results. The higher concentration of HMF, ketoamine and carbonyl content was observed in patient's sera than healthy subjects. LDL glycation results in structural perturbation causing generation of neoantigenic epitopes that are better antigens for antibodies in T2D, ATH and T2D-ATH patients where T2D-ATH subjects showed higher prevalence in auto-antibodies against ribosylated LDL. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Frataxin directly stimulates mitochondrial cysteine desulfurase by exposing substrate-binding sites, and a mutant Fe-S cluster scaffold protein with frataxin-bypassing ability acts similarly.

    PubMed

    Pandey, Alok; Gordon, Donna M; Pain, Jayashree; Stemmler, Timothy L; Dancis, Andrew; Pain, Debkumar

    2013-12-27

    For iron-sulfur (Fe-S) cluster synthesis in mitochondria, the sulfur is derived from the amino acid cysteine by the cysteine desulfurase activity of Nfs1. The enzyme binds the substrate cysteine in the pyridoxal phosphate-containing site, and a persulfide is formed on the active site cysteine in a manner depending on the accessory protein Isd11. The persulfide is then transferred to the scaffold Isu, where it combines with iron to form the Fe-S cluster intermediate. Frataxin is implicated in the process, although it is unclear where and how, and deficiency causes Friedreich ataxia. Using purified proteins and isolated mitochondria, we show here that the yeast frataxin homolog (Yfh1) directly and specifically stimulates cysteine binding to Nfs1 by exposing substrate-binding sites. This novel function of frataxin does not require iron, Isu1, or Isd11. Once bound to Nfs1, the substrate cysteine is the source of the Nfs1 persulfide, but this step is independent of frataxin and strictly dependent on Isd11. Recently, a point mutation in Isu1 was found to bypass many frataxin functions. The data presented here show that the Isu1 suppressor mimics the frataxin effects on Nfs1, explaining the bypassing activity. We propose a regulatory mechanism for the Nfs1 persulfide-forming activity. Specifically, at least two separate conformational changes must occur in the enzyme for optimum activity as follows: one is mediated by frataxin interaction that exposes the "buried" substrate-binding sites, and the other is mediated by Isd11 interaction that brings the bound substrate cysteine and the active site cysteine in proximity for persulfide formation.

  19. Bio-nanocapsule-based scaffold improves the sensitivity and ligand-binding capacity of mammalian receptors on the sensor chip.

    PubMed

    Iijima, Masumi; Yoshimoto, Nobuo; Niimi, Tomoaki; Maturana, Andrés D; Kuroda, Shun'ichi

    2016-06-01

    Mammalian receptors are recognized as target molecules for drug discovery, and chemical libraries have been screened for both potential antagonists and agonists mainly by ligand-binding assays using immobilized receptors. A bio-nanocapsule (BNC) of approximately 30 nm that displays a tandem form of the protein A-derived immunoglobulin G (IgG) Fc-binding Z domains (denoted as ZZ-BNC) has been developed for both clustering and oriented immobilization of IgGs on the solid phase of immunosensors. In this study, human IgG1 Fc-fused vascular endothelial growth factor (VEGF) receptor was immobilized through ZZ-BNC on the sensor chip of quartz crystal microbalance (ZZ-BNC-coating). When compared with direct adsorption and protein A-coating, the sensor chip showed higher sensitivity (∽46- and ∽165-fold, respectively) and larger ligand-binding capacity (∽4- and ∽18-fold, respectively). Furthermore, the number of VEGF molecules bound to its receptor increased from 0.20 (direct adsorption) to 2.06 by ZZ-BNC-coating, strongly suggesting that ZZ-BNC reduced the steric hindrance near ligand recognition sites through oriented immobilization. Similarly, the sensitivity and ligand-binding capacity of leptin and prolactin receptors were both enhanced at a level comparable to that observed for the VEGF receptor. Thus, the combination of ZZ-BNC and Fc-fused receptors could significantly improve the function of ligand-binding assays. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Akt1 binds focal adhesion kinase via the Akt1 kinase domain independently of the pleckstrin homology domain.

    PubMed

    Basson, M D; Zeng, B; Wang, S

    2015-10-01

    Akt1 and focal adhesion kinase (FAK) are protein kinases that play key roles in normal cell signaling. Individually, aberrant expression of these kinases has been linked to a variety of cancers. Together, Akt1/FAK interactions facilitate cancer metastasis by increasing cell adhesion under conditions of increased extracellular pressure. Pathological and iatrogenic sources of pressure arise from tumor growth against constraining stroma or direct perioperative manipulation. We previously reported that 15 mmHg increased extracellular pressure causes Akt1 to both directly interact with FAK and to phosphorylate and activate it. We investigated the nature of the Akt1/FAK binding by creating truncations of recombinant FAK, conjugated to glutathione S-transferase (GST), to pull down full-length Akt1. Western blots probing for Akt1 showed that FAK/Akt1 binding persisted in FAK truncations consisting of only amino acids 1-126, FAK(NT1), which contains the F1 subdomain of its band 4.1, ezrin, radixin, and moesin (FERM) domain. Using FAK(NT1) as bait, we then pulled down truncated versions of recombinant Akt1 conjugated to HA (human influenza hemagglutinin). Probes for GST-FAK(NT1) showed Akt1-FAK binding to occur in the absence of the both the Akt1 (N)-terminal pleckstrin homology (PH) domain and its adjacent hinge region. The Akt1 (C)-terminal regulatory domain was equally unnecessary for Akt1/FAK co-immunoprecipitation. Truncations involving the Akt1 catalytic domain showed that the domain by itself was enough to pull down FAK. Additionally, a fragment spanning from the PH domain to half way through the catalytic domain demonstrated increased FAK binding compared to full length Akt1. These results begin to delineate the Akt1/FAK interaction and can be used to manipulate their force-activated signal interactions. Furthermore, the finding that the N-terminal half of the Akt1 catalytic domain binds so strongly to FAK when cleaved from the rest of the protein may suggest a means for developing novel inhibitors that target this specific Akt1/FAK interaction.

  1. Drosophila COP9 signalosome subunit 7 interacts with multiple genomic loci to regulate development

    PubMed Central

    Singer, Ruth; Atar, Shimshi; Atias, Osnat; Oron, Efrat; Segal, Daniel; Hirsch, Joel A.; Tuller, Tamir; Orian, Amir; Chamovitz, Daniel A.

    2014-01-01

    The COP9 signalosome protein complex has a central role in the regulation of development of multicellular organisms. While the function of this complex in ubiquitin-mediated protein degradation is well established, results over the past few years have hinted that the COP9 signalosome may function more broadly in the regulation of gene expression. Here, using DamID technology, we show that COP9 signalosome subunit 7 functionally associates with a large number of genomic loci in the Drosophila genome, and show that the expression of many genes within these loci is COP9 signalosome-dependent. This association is likely direct as we show CSN7 binds DNA in vitro. The genes targeted by CSN7 are preferentially enriched for transcriptionally active regions of the genome, and are involved in the regulation of distinct gene ontology groupings including imaginal disc development and cell-cycle control. In accord, loss of CSN7 function leads to cell-cycle delay and altered wing development. These results indicate that CSN7, and by extension the entire COP9 signalosome, functions directly in transcriptional control. While the COP9 signalosome protein complex has long been known to regulate protein degradation, here we expand the role of this complex by showing that subunit 7 binds DNA in vitro and functions directly in vivo in transcriptional control of developmentally important pathways that are relevant for human health. PMID:25106867

  2. Characterization of the Catalytic and Nucleotide Binding Properties of the α-Kinase Domain of Dictyostelium Myosin-II Heavy Chain Kinase A*

    PubMed Central

    Yang, Yidai; Ye, Qilu; Jia, Zongchao; Côté, Graham P.

    2015-01-01

    The α-kinases are a widely expressed family of serine/threonine protein kinases that exhibit no sequence identity with conventional eukaryotic protein kinases. In this report, we provide new information on the catalytic properties of the α-kinase domain of Dictyostelium myosin-II heavy chain kinase-A (termed A-CAT). Crystallization of A-CAT in the presence of MgATP yielded structures with AMP or adenosine in the catalytic cleft together with a phosphorylated Asp-766 residue. The results show that the β- and α-phosphoryl groups are transferred either directly or indirectly to the catalytically essential Asp-766. Biochemical assays confirmed that A-CAT hydrolyzed ATP, ADP, and AMP with kcat values of 1.9, 0.6, and 0.32 min−1, respectively, and showed that A-CAT can use ADP to phosphorylate peptides and proteins. Binding assays using fluorescent 2′/3′-O-(N-methylanthraniloyl) analogs of ATP and ADP yielded Kd values for ATP, ADP, AMP, and adenosine of 20 ± 3, 60 ± 20, 160 ± 60, and 45 ± 15 μm, respectively. Site-directed mutagenesis showed that Glu-713, Leu-716, and Lys-645, all of which interact with the adenine base, were critical for nucleotide binding. Mutation of the highly conserved Gln-758, which chelates a nucleotide-associated Mg2+ ion, eliminated catalytic activity, whereas loss of the highly conserved Lys-722 and Arg-592 decreased kcat values for kinase and ATPase activities by 3–6-fold. Mutation of Asp-663 impaired kinase activity to a much greater extent than ATPase, indicating a specific role in peptide substrate binding, whereas mutation of Gln-768 doubled ATPase activity, suggesting that it may act to exclude water from the active site. PMID:26260792

  3. Amides Do Not Always Work: Observation of Guest Binding in an Amide-Functionalized Porous Metal-Organic Framework.

    PubMed

    Benson, Oguarabau; da Silva, Ivan; Argent, Stephen P; Cabot, Rafel; Savage, Mathew; Godfrey, Harry G W; Yan, Yong; Parker, Stewart F; Manuel, Pascal; Lennox, Matthew J; Mitra, Tamoghna; Easun, Timothy L; Lewis, William; Blake, Alexander J; Besley, Elena; Yang, Sihai; Schröder, Martin

    2016-11-16

    An amide-functionalized metal organic framework (MOF) material, MFM-136, shows a high CO 2 uptake of 12.6 mmol g -1 at 20 bar and 298 K. MFM-136 is the first example of an acylamide pyrimidyl isophthalate MOF without open metal sites and, thus, provides a unique platform to study guest binding, particularly the role of free amides. Neutron diffraction reveals that, surprisingly, there is no direct binding between the adsorbed CO 2 /CH 4 molecules and the pendant amide group in the pore. This observation has been confirmed unambiguously by inelastic neutron spectroscopy. This suggests that introduction of functional groups solely may not necessarily induce specific guest-host binding in porous materials, but it is a combination of pore size, geometry, and functional group that leads to enhanced gas adsorption properties.

  4. Structure of dual receptor binding to botulinum neurotoxin B.

    PubMed

    Berntsson, Ronnie P-A; Peng, Lisheng; Dong, Min; Stenmark, Pål

    2013-01-01

    Botulinum neurotoxins are highly toxic, and bind two receptors to achieve their high affinity and specificity for neurons. Here we present the first structure of a botulinum neurotoxin bound to both its receptors. We determine the 2.3-Å structure of a ternary complex of botulinum neurotoxin type B bound to both its protein receptor synaptotagmin II and its ganglioside receptor GD1a. We show that there is no direct contact between the two receptors, and that the binding affinity towards synaptotagmin II is not influenced by the presence of GD1a. The interactions of botulinum neurotoxin type B with the sialic acid 5 moiety of GD1a are important for the ganglioside selectivity. The structure demonstrates that the protein receptor and the ganglioside receptor occupy nearby but separate binding sites, thus providing two independent anchoring points.

  5. Physical and genetic interactions of yeast Cwc21p, an ortholog of human SRm300/SRRM2, suggest a role at the catalytic center of the spliceosome

    PubMed Central

    Grainger, Richard J.; Barrass, J. David; Jacquier, Alain; Rain, Jean-Christophe; Beggs, Jean D.

    2009-01-01

    In Saccharomyces cerevisiae, Cwc21p is a protein of unknown function that is associated with the NineTeen Complex (NTC), a group of proteins involved in activating the spliceosome to promote the pre-mRNA splicing reaction. Here, we show that Cwc21p binds directly to two key splicing factors—namely, Prp8p and Snu114p—and becomes the first NTC-related protein known to dock directly to U5 snRNP proteins. Using a combination of proteomic techniques we show that the N-terminus of Prp8p contains an intramolecular fold that is a Snu114p and Cwc21p interacting domain (SCwid). Cwc21p also binds directly to the C-terminus of Snu114p. Complementary chemical cross-linking experiments reveal reciprocal protein footprints between the interacting Prp8 and Cwc21 proteins, identifying the conserved cwf21 domain in Cwc21p as a Prp8p binding site. Genetic and functional interactions between Cwc21p and Isy1p indicate that they have related functions at or prior to the first catalytic step of splicing, and suggest that Cwc21p functions at the catalytic center of the spliceosome, possibly in response to environmental or metabolic changes. We demonstrate that SRm300, the only SR-related protein known to be at the core of human catalytic spliceosomes, is a functional ortholog of Cwc21p, also interacting directly with Prp8p and Snu114p. Thus, the function of Cwc21p is likely conserved from yeast to humans. PMID:19854871

  6. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  7. Structural and Histone Binding Ability Characterizations of Human PWWP Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Hong; Zeng, Hong; Lam, Robert

    2013-09-25

    The PWWP domain was first identified as a structural motif of 100-130 amino acids in the WHSC1 protein and predicted to be a protein-protein interaction domain. It belongs to the Tudor domain 'Royal Family', which consists of Tudor, chromodomain, MBT and PWWP domains. While Tudor, chromodomain and MBT domains have long been known to bind methylated histones, PWWP was shown to exhibit histone binding ability only until recently. The PWWP domain has been shown to be a DNA binding domain, but sequence analysis and previous structural studies show that the PWWP domain exhibits significant similarity to other 'Royal Family' members,more » implying that the PWWP domain has the potential to bind histones. In order to further explore the function of the PWWP domain, we used the protein family approach to determine the crystal structures of the PWWP domains from seven different human proteins. Our fluorescence polarization binding studies show that PWWP domains have weak histone binding ability, which is also confirmed by our NMR titration experiments. Furthermore, we determined the crystal structures of the BRPF1 PWWP domain in complex with H3K36me3, and HDGF2 PWWP domain in complex with H3K79me3 and H4K20me3. PWWP proteins constitute a new family of methyl lysine histone binders. The PWWP domain consists of three motifs: a canonical {beta}-barrel core, an insertion motif between the second and third {beta}-strands and a C-terminal {alpha}-helix bundle. Both the canonical {beta}-barrel core and the insertion motif are directly involved in histone binding. The PWWP domain has been previously shown to be a DNA binding domain. Therefore, the PWWP domain exhibits dual functions: binding both DNA and methyllysine histones.« less

  8. Multitargeting by curcumin as revealed by molecular interaction studies

    PubMed Central

    Gupta, Subash C.; Prasad, Sahdeo; Kim, Ji Hye; Patchva, Sridevi; Webb, Lauren J.; Priyadarsini, Indira K.

    2012-01-01

    Curcumin (diferuloylmethane), the active ingredient in turmeric (Curcuma longa), is a highly pleiotropic molecule with anti-inflammatory, anti-oxidant, chemopreventive, chemosensitization, and radiosensitization activities. The pleiotropic activities attributed to curcumin come from its complex molecular structure and chemistry, as well as its ability to influence multiple signaling molecules. Curcumin has been shown to bind by multiple forces directly to numerous signaling molecules, such as inflammatory molecules, cell survival proteins, protein kinases, protein reductases, histone acetyltransferase, histone deacetylase, glyoxalase I, xanthine oxidase, proteasome, HIV1 integrase, HIV1 protease, sarco (endo) plasmic reticulum Ca2+ ATPase, DNA methyltransferases 1, FtsZ protofilaments, carrier proteins, and metal ions. Curcumin can also bind directly to DNA and RNA. Owing to its β-diketone moiety, curcumin undergoes keto–enol tautomerism that has been reported as a favorable state for direct binding. The functional groups on curcumin found suitable for interaction with other macromolecules include the α, β-unsaturated β-diketone moiety, carbonyl and enolic groups of the β-diketone moiety, methoxy and phenolic hydroxyl groups, and the phenyl rings. Various biophysical tools have been used to monitor direct interaction of curcumin with other proteins, including absorption, fluorescence, Fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopy, surface plasmon resonance, competitive ligand binding, Forster type fluorescence resonance energy transfer (FRET), radiolabeling, site-directed mutagenesis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), immunoprecipitation, phage display biopanning, electron microscopy, 1-anilino-8-naphthalene-sulfonate (ANS) displacement, and co-localization. Molecular docking, the most commonly employed computational tool for calculating binding affinities and predicting binding sites, has also been used to further characterize curcumin’s binding sites. Furthermore, the ability of curcumin to bind directly to carrier proteins improves its solubility and bioavailability. In this review, we focus on how curcumin directly targets signaling molecules, as well as the different forces that bind the curcumin–protein complex and how this interaction affects the biological properties of proteins. We will also discuss various analogues of curcumin designed to bind selective targets with increased affinity. PMID:21979811

  9. A Broad-Spectrum Inhibitor of CRISPR-Cas9.

    PubMed

    Harrington, Lucas B; Doxzen, Kevin W; Ma, Enbo; Liu, Jun-Jie; Knott, Gavin J; Edraki, Alireza; Garcia, Bianca; Amrani, Nadia; Chen, Janice S; Cofsky, Joshua C; Kranzusch, Philip J; Sontheimer, Erik J; Davidson, Alan R; Maxwell, Karen L; Doudna, Jennifer A

    2017-09-07

    CRISPR-Cas9 proteins function within bacterial immune systems to target and destroy invasive DNA and have been harnessed as a robust technology for genome editing. Small bacteriophage-encoded anti-CRISPR proteins (Acrs) can inactivate Cas9, providing an efficient off switch for Cas9-based applications. Here, we show that two Acrs, AcrIIC1 and AcrIIC3, inhibit Cas9 by distinct strategies. AcrIIC1 is a broad-spectrum Cas9 inhibitor that prevents DNA cutting by multiple divergent Cas9 orthologs through direct binding to the conserved HNH catalytic domain of Cas9. A crystal structure of an AcrIIC1-Cas9 HNH domain complex shows how AcrIIC1 traps Cas9 in a DNA-bound but catalytically inactive state. By contrast, AcrIIC3 blocks activity of a single Cas9 ortholog and induces Cas9 dimerization while preventing binding to the target DNA. These two orthogonal mechanisms allow for separate control of Cas9 target binding and cleavage and suggest applications to allow DNA binding while preventing DNA cutting by Cas9. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Immobilization of Fab' fragments onto substrate surfaces: A survey of methods and applications.

    PubMed

    Crivianu-Gaita, Victor; Thompson, Michael

    2015-08-15

    Antibody immobilization onto surfaces has widespread applications in many different fields. It is desirable to bind antibodies such that their fragment-antigen-binding (Fab) units are oriented away from the surface in order to maximize analyte binding. The immobilization of only Fab' fragments yields benefits over the more traditional whole antibody immobilization technique. Bound Fab' fragments display higher surface densities, yielding a higher binding capacity for the analyte. The nucleophilic sulfide of the Fab' fragments allows for specific orientations to be achieved. For biosensors, this indicates a higher sensitivity and lower detection limit for a target analyte. The last thirty years have shown tremendous progress in the immobilization of Fab' fragments onto gold, Si-based, polysaccharide-based, plastic-based, magnetic, and inorganic surfaces. This review will show the current scope of Fab' immobilization techniques available and illustrate methods employed to minimize non-specific adsorption of undesirables. Furthermore, a variety of examples will be given to show the versatility of immobilized Fab' fragments in different applications and future directions of the field will be addressed, especially regarding biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. WAVE binds Ena/VASP for enhanced Arp2/3 complex–based actin assembly

    PubMed Central

    Havrylenko, Svitlana; Noguera, Philippe; Abou-Ghali, Majdouline; Manzi, John; Faqir, Fahima; Lamora, Audrey; Guérin, Christophe; Blanchoin, Laurent; Plastino, Julie

    2015-01-01

    The WAVE complex is the main activator of the Arp2/3 complex for actin filament nucleation and assembly in the lamellipodia of moving cells. Other important players in lamellipodial protrusion are Ena/VASP proteins, which enhance actin filament elongation. Here we examine the molecular coordination between the nucleating activity of the Arp2/3 complex and the elongating activity of Ena/VASP proteins for the formation of actin networks. Using an in vitro bead motility assay, we show that WAVE directly binds VASP, resulting in an increase in Arp2/3 complex–based actin assembly. We show that this interaction is important in vivo as well, for the formation of lamellipodia during the ventral enclosure event of Caenorhabditis elegans embryogenesis. Ena/VASP's ability to bind F-actin and profilin-complexed G-actin are important for its effect, whereas Ena/VASP tetramerization is not necessary. Our data are consistent with the idea that binding of Ena/VASP to WAVE potentiates Arp2/3 complex activity and lamellipodial actin assembly. PMID:25355952

  12. Pervasive Targeting of Nascent Transcripts by Hfq.

    PubMed

    Kambara, Tracy K; Ramsey, Kathryn M; Dove, Simon L

    2018-05-01

    Hfq is an RNA chaperone and an important post-transcriptional regulator in bacteria. Using chromatin immunoprecipitation coupled with high-throughput DNA sequencing (ChIP-seq), we show that Hfq associates with hundreds of different regions of the Pseudomonas aeruginosa chromosome. These associations are abolished when transcription is inhibited, indicating that they reflect Hfq binding to transcripts during their synthesis. Analogous ChIP-seq analyses with the post-transcriptional regulator Crc reveal that it associates with many of the same nascent transcripts as Hfq, an activity we show is Hfq dependent. Our findings indicate that Hfq binds many transcripts co-transcriptionally in P. aeruginosa, often in concert with Crc, and uncover direct regulatory targets of these proteins. They also highlight a general approach for studying the interactions of RNA-binding proteins with nascent transcripts in bacteria. The binding of post-transcriptional regulators to nascent mRNAs may represent a prevalent means of controlling translation in bacteria where transcription and translation are coupled. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Chloroplast Preproteins Bind to the Dimer Interface of the Toc159 Receptor during Import1[OPEN

    PubMed Central

    Chen, Lih-Jen; Yeh, Yi-Hung; Hsiao, Chwan-Deng

    2017-01-01

    Most chloroplast proteins are synthesized in the cytosol as higher molecular weight preproteins and imported via the translocons in the outer (TOC) and inner (TIC) envelope membranes of chloroplasts. Toc159 functions as a primary receptor and directly binds preproteins through its dimeric GTPase domain. As a first step toward a molecular understanding of how Toc159 mediates preprotein import, we mapped the preprotein-binding regions on the Toc159 GTPase domain (Toc159G) of pea (Pisum sativum) using cleavage by bound preproteins conjugated with the artificial protease FeBABE and cysteine-cysteine cross-linking. Our results show that residues at the dimer interface and the switch II region of Toc159G are in close proximity to preproteins. The mature portion of preproteins was observed preferentially at the dimer interface, whereas the transit peptide was found at both regions equally. Chloroplasts from transgenic plants expressing engineered Toc159 with a cysteine placed at the dimer interface showed increased cross-linking to bound preproteins. Our data suggest that, during preprotein import, the Toc159G dimer disengages and the dimer interface contacts translocating preproteins, which is consistent with a model in which conformational changes induced by dimer-monomer conversion in Toc159 play a direct role in facilitating preprotein import. PMID:28250068

  14. MamO Is a Repurposed Serine Protease that Promotes Magnetite Biomineralization through Direct Transition Metal Binding in Magnetotactic Bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hershey, David M.; Ren, Xuefeng; Melnyk, Ryan A.

    2016-03-16

    Many living organisms transform inorganic atoms into highly ordered crystalline materials. An elegant example of such biomineralization processes is the production of nano-scale magnetic crystals in magnetotactic bacteria. Previous studies have implicated the involvement of two putative serine proteases, MamE and MamO, during the early stages of magnetite formation in Magnetospirillum magneticum AMB-1. Here, using genetic analysis and X-ray crystallography, we show that MamO has a degenerate active site, rendering it incapable of protease activity. Instead, MamO promotes magnetosome formation through two genetically distinct, noncatalytic activities: activation of MamE-dependent proteolysis of biomineralization factors and direct binding to transition metal ions.more » By solving the structure of the protease domain bound to a metal ion, we identify a surface-exposed di-histidine motif in MamO that contributes to metal binding and show that it is required to initiate biomineralization in vivo. Finally, we find that pseudoproteases are widespread in magnetotactic bacteria and that they have evolved independently in three separate taxa. In conclusion, our results highlight the versatility of protein scaffolds in accommodating new biochemical activities and provide unprecedented insight into the earliest stages of biomineralization.« less

  15. SMAD3 augments FoxO3-induced MuRF-1 promoter activity in a DNA-binding-dependent manner

    PubMed Central

    Bollinger, Lance M.; Witczak, Carol A.; Houmard, Joseph A.

    2014-01-01

    Muscle-specific RING finger-1 (MuRF-1), a ubiquitin ligase and key regulator of proteasome-dependent protein degradation, is highly expressed during skeletal muscle atrophy. The transcription factor forkhead box O3 (FoxO3) induces MuRF-1 expression, but the direct role of other major atrophy-related transcription factors, such as SMAD3, is largely unknown. The goal of this study was to determine whether SMAD3 individually regulates, or with FoxO3 coordinately regulates, MuRF-1 expression. In cultured myotubes or human embryonic kidney cells, MuRF-1 mRNA content and promoter activity were increased by FoxO3 but not by SMAD3 overexpression. However, FoxO3 and SMAD3 coexpression synergistically increased MuRF-1 mRNA and promoter activity. Mutation of the SMAD-binding element (SBE) in the proximal MuRF-1 promoter or overexpression of a SMAD3 DNA-binding mutant attenuated FoxO3-dependent MuRF-1 promoter activation, showing that SMAD binding to DNA is required for optimal activation of FoxO3-induced transcription of MuRF-1. Using chromatin immunoprecipitation, SMAD3 DNA binding increased FoxO3 abundance and SBE mutation reduced FoxO3 abundance on the MuRF-1 promoter. Furthermore, SMAD3 overexpression dose-dependently increased FoxO3 protein content, and coexpression of FoxO3 and SMAD3 synergistically increased FoxO-dependent gene transcription [assessed with a FoxO response element (FRE)-driven reporter]. Collectively, these results show that SMAD3 regulates transcription of MuRF-1 by increasing FoxO3 binding at a conserved FRE-SBE motif within the proximal promoter region, and by increasing FoxO3 protein content and transcriptional activity. These data are the first to indicate that two major transcription factors regulating protein degradation, FoxO3 and SMAD3, converge to coordinately and directly regulate transcription of MuRF-1. PMID:24920680

  16. Toward a mechanistic understanding of patterns in biomineralization and new insights for old dogmas in geological settings (Invited)

    NASA Astrophysics Data System (ADS)

    Dove, P. M.; Hamm, L.; Giuffre, A. J.; Han, N.; De Yoreo, J. J.

    2013-12-01

    The ability of organisms to mineralize tissues into skeletons and other functional structures is a remarkable achievement of biology. Yet, the physical basis for how macromolecules regulate the placement and onset of mineral formation is not well established. Efforts to understand nucleation onto organic substrates have produced two, seemingly contradictory, lines of thought: The biomineralization community widely assumes the organic matrix promotes nucleation through stereochemical matching to guide the organization of solute ions, while materials synthesis groups use simple binding assays to correlate high binding strength with good promoters of nucleation. This study reconciles the two views and provides a mechanistic explanation for template-directed nucleation by correlating heterogeneous nucleation barriers with crystal-substrate binding free energies. Using surface assembled monolayers (SAM) as simple model systems, we first measure the kinetics of calcite nucleation onto model substrates that present different functional group chemistries (carboxyl, thiol, phosphate, hydroxyl) and conformations (C11, C16 chain lengths). We find rates are substrate-specific and obey predictions of classical nucleation theory at supersaturations that extend above the solubility of amorphous calcium carbonate (ACC). Analysis of the kinetic data shows the thermodynamic barrier to nucleation is reduced by minimizing the interfacial free energy of the system, γ. We then use dynamic force spectroscopy to independently measure calcite-substrate binding free energies, ΔGb. Moreover, we show that within the classical theory of nucleation, γ and ΔGb should be linearly related. The results bear out this prediction and demonstrate that low energy barriers to nucleation correlate with strong crystal-substrate binding. This relationship is general to all functional group chemistries and conformations. These findings reconcile the long-standing concept of templated nucleation through stereochemical matching with the conventional wisdom that ';good binders are good nucleators'. Alternative perspectives become internally consistent when viewed through the lens of crystal-substrate binding and provide a physical basis for how organic chemistry can direct temporal and spatial patterns of carbonate nucleation.

  17. Direct single-stranded DNA binding by Teb1 mediates the recruitment of Tetrahymena thermophila telomerase to telomeres.

    PubMed

    Upton, Heather E; Hong, Kyungah; Collins, Kathleen

    2014-11-15

    The eukaryotic reverse transcriptase telomerase copies its internal RNA template to synthesize telomeric DNA repeats at chromosome ends in balance with sequence loss during cell proliferation. Previous work has established several factors involved in telomerase recruitment to telomeres in yeast and mammalian cells; however, it remains unclear what determines the association of telomerase with telomeres in other organisms. Here we investigate the cell cycle dependence of telomere binding by each of the seven Tetrahymena thermophila telomerase holoenzyme proteins TERT, p65, Teb1, p50, p75, p45, and p19. We observed coordinate cell cycle-regulated recruitment and release of all of the subunits, including the telomeric-repeat DNA-binding subunit Teb1. Using domain truncation and mutagenesis approaches, we investigated which subunits govern the interaction of telomerase holoenzyme with telomeres. Our results show that Teb1 is critical for telomere interaction of other holoenzyme subunits and demonstrate that high-affinity Teb1 DNA-binding activity is necessary and sufficient for cell cycle-regulated telomere association. Overall, these and additional findings indicate that in the ciliate Tetrahymena, telomerase recruitment to telomeres requires direct binding to single-stranded DNA, unlike the indirect DNA recognition through telomere-bound proteins essential in yeast and mammalian cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. A small-molecule modulator interacts directly with deltaPhe508-CFTR to modify its ATPase activity and conformational stability.

    PubMed

    Wellhauser, Leigh; Kim Chiaw, Patrick; Pasyk, Stan; Li, Canhui; Ramjeesingh, Mohabir; Bear, Christine E

    2009-06-01

    The deletion of Phe-508 (DeltaPhe508) constitutes the most prevalent of a number of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) that cause cystic fibrosis (CF). This mutation leads to CFTR misfolding and retention in the endoplasmic reticulum, as well as impaired channel activity. The biosynthetic defect can be partially overcome by small-molecule "correctors"; once at the cell surface, small-molecule "potentiators" enhance the channel activity of DeltaPhe508-CFTR. Certain compounds, such as VRT-532, exhibit both corrector and potentiator functions. In the current studies, we confirmed that the inherent chloride channel activity of DeltaPhe508-CFTR (after biosynthetic rescue) is potentiated in studies of intact cells and membrane vesicles. It is noteworthy that we showed that the ATPase activity of the purified and reconstituted mutant protein is directly modulated by binding of VRT-532 [4-methyl-2-(5-phenyl-1H-pyrazol-3-yl)-phenol] ATP turnover by reconstituted DeltaPhe508-CFTR is decreased by VRT-532 treatment, an effect that may account for the increase in channel open time induced by this compound. To determine whether the modification of DeltaPhe508-CFTR function caused by direct VRT-532 binding is associated with structural changes, we evaluated the effect of VRT-532 binding on the protease susceptibility of the major mutant. We found that binding of VRT-532 to DeltaPhe508-CFTR led to a minor but significant decrease in the trypsin susceptibility of the full-length mutant protein and a fragment encompassing the second half of the protein. These findings suggest that direct binding of this small molecule induces and/or stabilizes a structure that promotes the channel open state and may underlie its efficacy as a corrector of DeltaPhe508-CFTR.

  19. The highly conserved MraZ protein is a transcriptional regulator in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eraso, Jesus M.; Markillie, Lye Meng; Mitchell, Hugh D.

    2014-05-05

    The mraZ and mraW genes are highly conserved in bacteria, both in sequence and location at the head of the division and cell wall (dcw) gene cluster. Although MraZ has structural similarity to the AbrB transition state regulator and the MazE antitoxin, and MraW is known to methylate ribosomal RNA, mraZ and mraW null mutants have no detectable growth phenotype in any species tested to date, hampering progress in understanding their physiological role. Here we show that overproduction of Escherichia coli MraZ perturbs cell division and the cell envelope, is more lethal at high levels or in minimal growth medium,more » and that MraW antagonizes these effects. MraZGFP localizes to the nucleoid, suggesting that it binds DNA. Indeed, purified MraZ directly binds a region upstream from its own promoter containing three direct repeats to regulate its own expression and that of downstream cell division and cell wall genes. MraZ-LacZ fusions are repressed by excess MraZ but not when DNA binding by MraZ is inhibited. RNAseq analysis indicates that MraZ is a global transcriptional regulator with numerous targets in addition to dcw genes. One of these targets, mioC, is directly bound by MraZ in a region with three direct repeats.« less

  20. Spatial Analysis and Quantification of the Thermodynamic Driving Forces in Protein-Ligand Binding: Binding Site Variability

    PubMed Central

    Raman, E. Prabhu; MacKerell, Alexander D.

    2015-01-01

    The thermodynamic driving forces behind small molecule-protein binding are still not well understood, including the variability of those forces associated with different types of ligands in different binding pockets. To better understand these phenomena we calculate spatially resolved thermodynamic contributions of the different molecular degrees of freedom for the binding of propane and methanol to multiple pockets on the proteins Factor Xa and p38 MAP kinase. Binding thermodynamics are computed using a statistical thermodynamics based end-point method applied on a canonical ensemble comprising the protein-ligand complexes and the corresponding free states in an explicit solvent environment. Energetic and entropic contributions of water and ligand degrees of freedom computed from the configurational ensemble provides an unprecedented level of detail into the mechanisms of binding. Direct protein-ligand interaction energies play a significant role in both non-polar and polar binding, which is comparable to water reorganization energy. Loss of interactions with water upon binding strongly compensates these contributions leading to relatively small binding enthalpies. For both solutes, the entropy of water reorganization is found to favor binding in agreement with the classical view of the “hydrophobic effect”. Depending on the specifics of the binding pocket, both energy-entropy compensation and reinforcement mechanisms are observed. Notable is the ability to visualize the spatial distribution of the thermodynamic contributions to binding at atomic resolution showing significant differences in the thermodynamic contributions of water to the binding of propane versus methanol. PMID:25625202

  1. Specific Binding of Adamantane Drugs and Direction of their Polar Amines in the Pore of the Influenza M2 Transmembrane Domain in Lipid Bilayers and Dodecylphosphocholine Micelles Determined by NMR Spectroscopy

    PubMed Central

    Cady, Sarah D.; Wang, Jun; Wu, Yibing; DeGrado, William F.; Hong, Mei

    2011-01-01

    The transmembrane domain of the influenza M2 protein (M2TM) forms a tetrameric proton channel important for the virus lifecycle. The proton-channel activity is inhibited by amine-containing adamantyl drugs amantadine and rimantadine, which have been shown to bind specifically to the pore of M2TM near Ser31. However, whether the polar amine points to the N- or C-terminus of the channel has not yet been determined. Elucidating the polar group direction will shed light on the mechanism by which drug binding inhibits this proton channel and will facilitate rational design of new inhibitors. In this study, we determine the polar amine direction using M2TM reconstituted in lipid bilayers as well as DPC micelles. 13C-2H rotational-echo double-resonance NMR experiments of 13C-labeled M2TM and methyl-deuterated rimantadine in lipid bilayers showed that the polar amine pointed to the C-terminus of the channel, with the methyl group close to Gly34. Solution NMR experiments of M2TM in dodecylphosphocholine (DPC) micelles indicate that drug binding causes significant chemical shift perturbations of the protein that are very similar to those seen for M2TM and M2(18–60) bound to lipid bilayers. Specific 2H-labeling of the drugs permitted the assignment of drug-protein cross peaks, which indicate that amantadine and rimantadine bind to the pore in the same fashion as for bilayer-bound M2TM. These results strongly suggest that adamantyl inhibition of M2TM is achieved not only by direct physical occlusion of the pore but also by perturbing the equilibrium constant of the proton-sensing residue His37. The reproduction of the pharmacologically relevant specific pore-binding site in DPC micelles, which was not observed with a different detergent, DHPC, underscores the significant influence of the detergent environment on the functional structure of membrane proteins. PMID:21381693

  2. Analysis of expression and chitin-binding activity of the wing disc cuticle protein BmWCP4 in the silkworm, Bombyx mori.

    PubMed

    Deng, Hui-Min; Li, Yong; Zhang, Jia-Ling; Liu, Lin; Feng, Qi-Li

    2016-12-01

    The insect exoskeleton is mainly composed of chitin filaments linked by cuticle proteins. When insects molt, the cuticle of the exoskeleton is renewed by degrading the old chitin and cuticle proteins and synthesizing new ones. In this study, chitin-binding activity of the wing disc cuticle protein BmWCP4 in Bombyx mori was studied. Sequence analysis showed that the protein had a conservative hydrophilic "R&R" chitin-binding domain (CBD). Western blotting showed that BmWCP4 was predominately expressed in the wing disc-containing epidermis during the late wandering and early pupal stages. The immunohistochemistry result showed that the BmWCP4 was mainly present in the wing disc tissues containing wing bud and trachea blast during day 2 of wandering stage. Recombinant full-length BmWCP4 protein, "R&R" CBD peptide (CBD), non-CBD peptide (BmWCP4-CBD - ), four single site-directed mutated peptides (M 1 , M 2 , M 3 and M 4 ) and four-sites-mutated peptide (M F ) were generated and purified, respectively, for in vitro chitin-binding assay. The results indicated that both the full-length protein and the "R&R" CBD peptide could bind with chitin, whereas the BmWCP4-CBD - could not bind with chitin. The single residue mutants M 1 , M 2 , M 3 and M 4 reduced but did not completely abolish the chitin-binding activity, while four-sites-mutated protein M F completely lost the chitin-binding activity. These data indicate that BmWCP4 protein plays a critical role by binding to the chitin filaments in the wing during larva-to-pupa transformation. The conserved aromatic amino acids are critical in the interaction between chitin and the cuticle protein. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  3. DNA mutagenic activity and capacity for HIV-1 restriction of the cytidine deaminase APOBEC3G depend on whether DNA or RNA binds to tyrosine 315

    PubMed Central

    Polevoda, Bogdan; Joseph, Rebecca; Friedman, Alan E.; Bennett, Ryan P.; Greiner, Rebecca; De Zoysa, Thareendra; Stewart, Ryan A.; Smith, Harold C.

    2017-01-01

    APOBEC3G (A3G) belongs to the AID/APOBEC protein family of cytidine deaminases (CDA) that bind to nucleic acids. A3G mutates the HIV genome by deamination of dC to dU, leading to accumulation of virus-inactivating mutations. Binding to cellular RNAs inhibits A3G binding to substrate single-stranded (ss) DNA and CDA activity. Bulk RNA and substrate ssDNA bind to the same three A3G tryptic peptides (amino acids 181–194, 314–320, and 345–374) that form parts of a continuously exposed protein surface extending from the catalytic domain in the C terminus of A3G to its N terminus. We show here that the A3G tyrosines 181 and 315 directly cross-linked ssDNA. Binding experiments showed that a Y315A mutation alone significantly reduced A3G binding to both ssDNA and RNA, whereas Y181A and Y182A mutations only moderately affected A3G nucleic acid binding. Consistent with these findings, the Y315A mutant exhibited little to no deaminase activity in an Escherichia coli DNA mutator reporter, whereas Y181A and Y182A mutants retained ∼50% of wild-type A3G activity. The Y315A mutant also showed a markedly reduced ability to assemble into viral particles and had reduced antiviral activity. In uninfected cells, the impaired RNA-binding capacity of Y315A was evident by a shift of A3G from high-molecular-mass ribonucleoprotein complexes to low-molecular-mass complexes. We conclude that Tyr-315 is essential for coordinating ssDNA interaction with or entry to the deaminase domain and hypothesize that RNA bound to Tyr-315 may be sufficient to competitively inhibit ssDNA deaminase-dependent antiviral activity. PMID:28381554

  4. Structural and functional characterization of a new recombinant histidine-tagged acyl coenzyme A binding protein (ACBP) from mouse

    PubMed Central

    Petrescu, Anca D.; Huang, Huan; Hostetler, Heather A.; Schroeder, Friedhelm; Kier, Ann B.

    2008-01-01

    Acyl-coenzyme A binding protein (ACBP) has been proposed to transport fatty acyl-CoAs intracellularly, facilitating their metabolism. In this study, a new mouse recombinant ACBP was produced by insertion of a histidine (his) tag at the C-terminus to allow efficient purification by Ni-affinity chromatography. The his-tag was inserted at the C-terminus since ACBP is a small molecular size (10 kDa) protein whose structure and activity are sensitive to amino acid substitutions in the N-terminus. The his tag had no or little effect on ACBP structure or ligand binding affinity and specificity. His-ACBP bound the naturally-occurring fluorescent cis-parinaroyl-CoA with very high affinity (Kd=2.15 nM), but exhibited no affinity for non-esterified cis-parinaric acid. To determine if the presence of the C-terminal his tag altered ACBP interactions with other proteins, direct binding to hepatocyte nuclear factor 4α (HNF-4α), a nuclear receptor regulating transcription of genes involved in lipid metabolism, was examined. His-ACBP and HNF-4α were labeled with Cy5 and Cy3, respectively, and direct interaction was determined by a novel fluorescence resonance energy transfer (FRET) binding assay. FRET analysis showed that his-ACBP directly interacted with HNF-4α (intermolecular distance of 73 Å) at high affinity (Kd=64-111 nM) similar to native ACBP. The his-tag also had no effect on ACBPs ability to interact with and stimulate microsomal enzymes utilizing or forming fatty acyl CoA. Thus, C-terminal his-tagged-ACBP maintained very similar structural and functional features of the untagged native protein and can be used in further in vitro experiments that require pure recombinant ACBP. PMID:18178100

  5. Electrostatic control of DNA intersegmental translocation by the ETS transcription factor ETV6.

    PubMed

    Vo, Tam; Wang, Shuo; Poon, Gregory M K; Wilson, W David

    2017-08-11

    To find their DNA target sites in complex solution environments containing excess heterogeneous DNA, sequence-specific DNA-binding proteins execute various translocation mechanisms known collectively as facilitated diffusion. For proteins harboring a single DNA contact surface, long-range translocation occurs by jumping between widely spaced DNA segments. We have configured biosensor-based surface plasmon resonance to directly measure the affinity and kinetics of this intersegmental jumping by the ETS-family transcription factor ETS variant 6 (ETV6). To isolate intersegmental target binding in a functionally defined manner, we pre-equilibrated ETV6 with excess salmon sperm DNA, a heterogeneous polymer, before exposing the nonspecifically bound protein to immobilized oligomeric DNA harboring a high-affinity ETV6 site. In this way, the mechanism of ETV6-target association could be toggled electrostatically through varying NaCl concentration in the bulk solution. Direct measurements of association and dissociation kinetics of the site-specific complex indicated that 1) freely diffusive binding by ETV6 proceeds through a nonspecific-like intermediate, 2) intersegmental jumping is rate-limited by dissociation from the nonspecific polymer, and 3) dissociation of the specific complex is independent of the history of complex formation. These results show that target searches by proteins with an ETS domain, such as ETV6, whose single DNA-binding domain cannot contact both source and destination sites simultaneously, are nonetheless strongly modulated by intersegmental jumping in heterogeneous site environments. Our findings establish biosensors as a general technique for directly and specifically measuring target site search by DNA-binding proteins via intersegmental translocation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Determinants of the Differential Antizyme-Binding Affinity of Ornithine Decarboxylase

    PubMed Central

    Liu, Yen-Chin; Hsu, Den-Hua; Huang, Chi-Liang; Liu, Yi-Liang; Liu, Guang-Yaw; Hung, Hui-Chih

    2011-01-01

    Ornithine decarboxylase (ODC) is a ubiquitous enzyme that is conserved in all species from bacteria to humans. Mammalian ODC is degraded by the proteasome in a ubiquitin-independent manner by direct binding to the antizyme (AZ). In contrast, Trypanosoma brucei ODC has a low binding affinity toward AZ. In this study, we identified key amino acid residues that govern the differential AZ binding affinity of human and Trypanosoma brucei ODC. Multiple sequence alignments of the ODC putative AZ-binding site highlights several key amino acid residues that are different between the human and Trypanosoma brucei ODC protein sequences, including residue 119, 124,125, 129, 136, 137 and 140 (the numbers is for human ODC). We generated a septuple human ODC mutant protein where these seven bases were mutated to match the Trypanosoma brucei ODC protein sequence. The septuple mutant protein was much less sensitive to AZ inhibition compared to the WT protein, suggesting that these amino acid residues play a role in human ODC-AZ binding. Additional experiments with sextuple mutants suggest that residue 137 plays a direct role in AZ binding, and residues 119 and 140 play secondary roles in AZ binding. The dissociation constants were also calculated to quantify the affinity of the ODC-AZ binding interaction. The K d value for the wild type ODC protein-AZ heterodimer ([ODC_WT]-AZ) is approximately 0.22 μM, while the K d value for the septuple mutant-AZ heterodimer ([ODC_7M]-AZ) is approximately 12.4 μM. The greater than 50-fold increase in [ODC_7M]-AZ binding affinity shows that the ODC-7M enzyme has a much lower binding affinity toward AZ. For the mutant proteins ODC_7M(-Q119H) and ODC_7M(-V137D), the K d was 1.4 and 1.2 μM, respectively. These affinities are 6-fold higher than the WT_ODC K d, which suggests that residues 119 and 137 play a role in AZ binding. PMID:22073206

  7. Transthyretin-binding activity of contaminants in blood from polar bear (Ursus maritimus) cubs.

    PubMed

    Bytingsvik, Jenny; Simon, Eszter; Leonards, Pim E G; Lamoree, Marja; Lie, Elisabeth; Aars, Jon; Derocher, Andrew E; Wiig, Oystein; Jenssen, Bjørn M; Hamers, Timo

    2013-05-07

    We determined the transthyretin (TTR)-binding activity of blood-accumulating contaminants in blood plasma samples of approximately 4-months-old polar bear (Ursus maritimus) cubs from Svalbard sampled in 1998 and 2008. The TTR-binding activity was measured as thyroxine (T4)-like equivalents (T4-EQMeas). Our findings show that the TTR-binding activity related to contaminant levels was significantly lower (45%) in 2008 than in 1998 (mean ± standard error of mean: 1998, 2265 ± 231 nM; 2008, 1258 ± 170 nM). Although we cannot exclude a potential influence of between-year differences in capture location and cub body mass, our findings most likely reflect reductions of TTR-binding contaminants or their precursors in the arctic environment (e.g., polychlorinated biphenyls [PCBs]). The measured TTR-binding activity correlated positively with the cubs' plasma levels of hydroxylated PCBs (OH-PCBs). No such association was found between TTR-binding activity and the plasma levels of perfluoroalkyl substances (PFASs). The OH-PCBs explained 60 ± 7% and 54 ± 4% of the TTR-binding activity in 1998 and 2008, respectively, and PFASs explained ≤1.2% both years. Still, almost half the TTR-binding activity could not be explained by the contaminants we examined. The considerable levels of TTR-binding contaminants warrant further effect directed analysis (EDA) to identify the contaminants responsible for the unexplained part of the observed TTR-binding activity.

  8. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  9. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  10. The Kinetic Mechanism for Cytochrome P450 Metabolism of Type II Binding Compounds: Evidence Supporting Direct Reduction

    PubMed Central

    Pearson, Joshua; Dahal, Upendra P.; Rock, Daniel; Peng, Chi-Chi; Schenk, James O.; Joswig-Jones, Carolyn; Jones, Jeffrey P.

    2011-01-01

    The metabolic stability of a drug is an important property that should be optimized during drug design and development. Nitrogen incorporation is hypothesized to increase the stability by coordination of nitrogen to the heme iron of cytochrome P450, a binding mode that is referred to as type II binding. However, we noticed that the type II binding compound 1 has less metabolic stability at subsaturating conditions than a closely related type I binding compound 3. Three kinetic models will be presented for type II binder metabolism; 1) Dead-end type II binding, 2) a rapid equilibrium between type I and II binding modes before reduction, and 3) a direct reduction of the type II coordinated heme. Data will be presented on reduction rates of iron, the off rates of substrate (using surface plasmon resonance) and the catalytic rate constants. These data argue against the dead-end, and rapid equilibrium models, leaving the direct reduction kinetic mechanism for metabolism of the type II binding compound 1. PMID:21530484

  11. Pestivirus Npro Directly Interacts with Interferon Regulatory Factor 3 Monomer and Dimer

    PubMed Central

    Holthauzen, Luis Marcelo F.; Ruggli, Nicolas

    2016-01-01

    ABSTRACT Interferon regulatory factor 3 (IRF3) is a transcription factor involved in the activation of type I alpha/beta interferon (IFN-α/β) in response to viral infection. Upon viral infection, the IRF3 monomer is activated into a phosphorylated dimer, which induces the transcription of interferon genes in the nucleus. Viruses have evolved several ways to target IRF3 in order to subvert the innate immune response. Pestiviruses, such as classical swine fever virus (CSFV), target IRF3 for ubiquitination and subsequent proteasomal degradation. This is mediated by the viral protein Npro that interacts with IRF3, but the molecular details for this interaction are largely unknown. We used recombinant Npro and IRF3 proteins and show that Npro interacts with IRF3 directly without additional proteins and forms a soluble 1:1 complex. The full-length IRF3 but not merely either of the individual domains is required for this interaction. The interaction between Npro and IRF3 is not dependent on the activation state of IRF3, since Npro binds to a constitutively active form of IRF3 in the presence of its transcriptional coactivator, CREB-binding protein (CBP). The results indicate that the Npro-binding site on IRF3 encompasses a region that is unperturbed by the phosphorylation and subsequent activation of IRF3 and thus excludes the dimer interface and CBP-binding site. IMPORTANCE The pestivirus N-terminal protease, Npro, is essential for evading the host's immune system by facilitating the degradation of interferon regulatory factor 3 (IRF3). However, the nature of the Npro interaction with IRF3, including the IRF3 species (inactive monomer versus activated dimer) that Npro targets for degradation, is largely unknown. We show that classical swine fever virus Npro and porcine IRF3 directly interact in solution and that full-length IRF3 is required for interaction with Npro. Additionally, Npro interacts with a constitutively active form of IRF3 bound to its transcriptional cofactor, the CREB-binding protein. This is the first study to demonstrate that Npro is able to bind both inactive IRF3 monomer and activated IRF3 dimer and thus likely targets both IRF3 species for ubiquitination and proteasomal degradation. PMID:27334592

  12. Ubiquitin Regulates Caspase Recruitment Domain-mediated Signaling by Nucleotide-binding Oligomerization Domain-containing Proteins NOD1 and NOD2*

    PubMed Central

    Ver Heul, Aaron M.; Fowler, C. Andrew; Ramaswamy, S.; Piper, Robert C.

    2013-01-01

    NOD1 and NOD2 (nucleotide-binding oligomerization domain-containing proteins) are intracellular pattern recognition receptors that activate inflammation and autophagy. These pathways rely on the caspase recruitment domains (CARDs) within the receptors, which serve as protein interaction platforms that coordinately regulate immune signaling. We show that NOD1 CARD binds ubiquitin (Ub), in addition to directly binding its downstream targets receptor-interacting protein kinase 2 (RIP2) and autophagy-related protein 16-1 (ATG16L1). NMR spectroscopy and structure-guided mutagenesis identified a small hydrophobic surface of NOD1 CARD that binds Ub. In vitro, Ub competes with RIP2 for association with NOD1 CARD. In vivo, we found that the ligand-stimulated activity of NOD1 with a mutant CARD lacking Ub binding but retaining ATG16L1 and RIP2 binding is increased relative to wild-type NOD1. Likewise, point mutations in the tandem NOD2 CARDs at positions analogous to the surface residues defining the Ub interface on NOD1 resulted in loss of Ub binding and increased ligand-stimulated NOD2 signaling. These data suggest that Ub binding provides a negative feedback loop upon NOD-dependent activation of RIP2. PMID:23300079

  13. Identification of T. gondii Myosin Light Chain-1 as a Direct Target of TachypleginA-2, a Small-Molecule Inhibitor of Parasite Motility and Invasion

    PubMed Central

    Leung, Jacqueline M.; Tran, Fanny; Pathak, Ravindra B.; Poupart, Séverine; Heaslip, Aoife T.; Ballif, Bryan A.; Westwood, Nicholas J.; Ward, Gary E.

    2014-01-01

    Motility of the protozoan parasite Toxoplasma gondii plays an important role in the parasite’s life cycle and virulence within animal and human hosts. Motility is driven by a myosin motor complex that is highly conserved across the Phylum Apicomplexa. Two key components of this complex are the class XIV unconventional myosin, TgMyoA, and its associated light chain, TgMLC1. We previously showed that treatment of parasites with a small-molecule inhibitor of T. gondii invasion and motility, tachypleginA, induces an electrophoretic mobility shift of TgMLC1 that is associated with decreased myosin motor activity. However, the direct target(s) of tachypleginA and the molecular basis of the compound-induced TgMLC1 modification were unknown. We show here by “click” chemistry labelling that TgMLC1 is a direct and covalent target of an alkyne-derivatized analogue of tachypleginA. We also show that this analogue can covalently bind to model thiol substrates. The electrophoretic mobility shift induced by another structural analogue, tachypleginA-2, was associated with the formation of a 225.118 Da adduct on S57 and/or C58, and treatment with deuterated tachypleginA-2 confirmed that the adduct was derived from the compound itself. Recombinant TgMLC1 containing a C58S mutation (but not S57A) was refractory to click labelling and no longer exhibited a mobility shift in response to compound treatment, identifying C58 as the site of compound binding on TgMLC1. Finally, a knock-in parasite line expressing the C58S mutation showed decreased sensitivity to compound treatment in a quantitative 3D motility assay. These data strongly support a model in which tachypleginA and its analogues inhibit the motility of T. gondii by binding directly and covalently to C58 of TgMLC1, thereby causing a decrease in the activity of the parasite’s myosin motor. PMID:24892871

  14. Binding Properties of General Odorant Binding Proteins from the Oriental Fruit Moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae)

    PubMed Central

    Li, Guangwei; Chen, Xiulin; Li, Boliao; Zhang, Guohui; Li, Yiping; Wu, Junxiang

    2016-01-01

    Background The oriental fruit moth Grapholita molesta is a host-switching pest species. The adults highly depend on olfactory cues in locating optimal host plants and oviposition sites. Odorant binding proteins (OBPs) are thought to be responsible for recognizing and transporting hydrophobic odorants across the aqueous sensillum lymph to stimulate the odorant receptors (ORs) within the antennal sensilla and activate the olfactory signal transduction pathway. Exploring the physiological function of these OBPs could facilitate understanding insect chemical communications. Methodology/Principal Finding Two antennae-specific general OBPs (GOBPs) of G. molesta were expressed and purified in vitro. The binding affinities of G. molesta GOBP1 and 2 (GmolGOBP1 and 2) for sex pheromone components and host plant volatiles were measured by fluorescence ligand-binding assays. The distribution of GmolGOBP1 and 2 in the antennal sensillum were defined by whole mount fluorescence immunohistochemistry (WM-FIHC) experiments. The binding sites of GmolGOBP2 were predicted using homology modeling, molecular docking and site-directed mutagenesis. Both GmolGOBP1 and 2 are housing in sensilla basiconica and with no differences in male and female antennae. Recombinant GmolGOBP1 (rGmolGOBP1) exhibited broad binding properties towards host plant volatiles and sex pheromone components; rGmolGOBP2 could not effectively bind host plant volatiles but showed specific binding affinity with a minor sex pheromone component dodecanol. We chose GmolGOBP2 and dodecanol for further homology modeling, molecular docking, and site-directed mutagenesis. Binding affinities of mutants demonstrated that Thr9 was the key binding site and confirmed dodecanol bonding to protein involves a hydrogen bond. Combined with the pH effect on binding affinities of rGmolGOBP2, ligand binding and release of GmolGOBP2 were related to a pH-dependent conformational transition. Conclusion Two rGmolGOBPs exhibit different binding characteristics for tested ligands. rGmolGOBP1 has dual functions in recognition of host plant volatiles and sex pheromone components, while rGmolGOBP2 is mainly involved in minor sex pheromone component dodecanol perception. This study also provides empirical evidence for the predicted functions of key amino acids in recombinant protein ligand-binding characteristics. PMID:27152703

  15. Transcription factor FBI-1 acts as a dual regulator in adipogenesis by coordinated regulation of cyclin-A and E2F-4.

    PubMed

    Laudes, Matthias; Bilkovski, Roman; Oberhauser, Frank; Droste, Andrea; Gomolka, Matthias; Leeser, Uschi; Udelhoven, Michael; Krone, Wilhelm

    2008-05-01

    Generation of new adipocytes plays a major role in the development of obesity. We previously have shown that transcriptional repressor factor that binds to IST (FBI)-1 exerts a dual effect in the process of adipogenesis by inhibiting proliferation and promoting differentiation of preadipocytes. The aim of the present study was to identify FBI-1 regulated molecular effectors that could account for these effects. Overexpressing FBI-1 in preadipocytes resulted in reduced expression of the cell cycle regulator cyclin A, which may explain FBI-1 induced inhibition of proliferation. Interestingly, FBI-1 repressed cyclin A promoter activity through an indirect mechanisms that did not involve direct binding of FBI-1 to the promoter sequence, but rather FBI-1 inhibition of transcriptional activator Sp1 binding to a regulatory element at -452 to -443. We also show that FBI-1 promotes terminal preadipocyte differentiation through a mechanism involving decreased levels of expression of the PPARgamma inhibitor E2F-4. FBI-1 significantly reduced E2F-4 promoter activity. Contrary to cyclin A, we found FBI-1-induced repression of E2F-4 is mediated by a direct mechanism via a FBI-1 regulatory element at -11 to -5. As function of transcriptional repressors normally depends on the presence of regulatory co-factors we also performed expression profiling of potential FBI-1 co-repressors throughout adipogenesis. In these experiments Sin3A and histon deacetylase (HDAC)-1 showed a similar expression pattern compared to FBI-1. Strikingly, co-immunoprecipitation studies revealed that FBI-1 binds Sin3A and HDAC-1 to form a repressor complex. Furthermore, by mutational analysis the amino terminal Poxvirus (POZ) domain of FBI-1 was found to be important for Sin3A and HDAC-1 binding. Taken together, FBI-1 is the first transcriptional repressor shown to act as a dual regulator in adipogenesis exerting repressor activities on target genes by both, direct and indirect mechanisms.

  16. Phosphorylation of an intrinsically disordered segment in Ets1 shifts conformational sampling toward binding-competent substates.

    PubMed

    Bui, Jennifer M; Gsponer, Jörg

    2014-08-05

    Functions of many proteins are affected by posttranslational modifications of intrinsically disordered (ID) regions, yet little is known about the underlying molecular mechanisms. By combining molecular dynamics simulations and protein docking, we demonstrate that the addition of phosphates to an ID segment adjacent to the PNT domain of Ets1 directs conformational sampling toward substates that are most compatible with high-affinity binding of the TAZ1 domain of its coactivator CBP. The phosphate charges disrupt salt bridges and thereby open a hydrophobic cleft and expose hydrophobic residues at the ID N terminus. The structure of the PNT-TAZ1 complex that we determined shows that PNT binds to TAZ1 via these hydrophobic regions in a similar manner to how it interacts with other partners. Our calculations reveal a dual effect of phosphorylation in that it changes the dynamics of PNT so that it becomes more compatible for TAZ1 binding and increases complementarity with this binding partner. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Molecular mechanism of respiratory syncytial virus fusion inhibitors

    DOE PAGES

    Battles, Michael B.; Langedijk, Johannes P.; Furmanova-Hollenstein, Polina; ...

    2015-12-07

    Respiratory syncytial virus (RSV) is a leading cause of pneumonia and bronchiolitis in young children and the elderly. Therapeutic small molecules have been developed that bind the RSV F glycoprotein and inhibit membrane fusion, yet their binding sites and molecular mechanisms of action remain largely unknown. In this paper, we show that these inhibitors bind to a three-fold-symmetric pocket within the central cavity of the metastable prefusion conformation of RSV F. Inhibitor binding stabilizes this conformation by tethering two regions that must undergo a structural rearrangement to facilitate membrane fusion. Inhibitor-escape mutations occur in residues that directly contact the inhibitorsmore » or are involved in the conformational rearrangements required to accommodate inhibitor binding. Resistant viruses do not propagate as well as wild-type RSV in vitro, indicating a fitness cost for inhibitor escape. Finally and collectively, these findings provide new insight into class I viral fusion proteins and should facilitate development of optimal RSV fusion inhibitors.« less

  18. CLASPs are required for proper microtubule localization of End-binding proteins

    PubMed Central

    Grimaldi, Ashley D.; Maki, Takahisa; Fitton, Benjamin P.; Roth, Daniel; Yampolsky, Dmitry; Davidson, Michael W.; Svitkina, Tatyana; Straube, Anne; Hayashi, Ikuko; Kaverina, Irina

    2014-01-01

    Summary Microtubule (MT) plus-end tracking proteins (+TIPs) preferentially localize to MT plus-ends. End-binding proteins (EBs) are master regulators of the +TIP complex; however, it is unknown whether EBs are regulated by other +TIPs. Here, we show that Cytoplasmic linker associated proteins (CLASPs) modulate EB localization at MTs. In CLASP-depleted cells, EBs localized along the MT lattice in addition to plus-ends. The MT-binding region of CLASP was sufficient for restoring normal EB localization, while neither EB-CLASP interactions nor EB tail-binding proteins are involved. In vitro assays revealed that CLASP directly functions to remove EB from MTs. Importantly, this effect occurs specifically during MT polymerization, but not at pre-formed MTs. Increased GTP-tubulin content within MTs in CLASP-depleted cells suggests that CLASPs facilitate GTP-hydrolysis to reduce EB lattice binding. Together, these findings suggest that CLASPs influence the MT lattice itself to regulate EB and determine exclusive plus-end localization of EBs in cells. PMID:25117684

  19. A Universal Base in a Specific Role: Tuning up a Thrombin Aptamer with 5-Nitroindole

    NASA Astrophysics Data System (ADS)

    Tsvetkov, Vladimir B.; Varizhuk, Anna M.; Pozmogova, Galina E.; Smirnov, Igor P.; Kolganova, Natalia A.; Timofeev, Edward N.

    2015-11-01

    In this study we describe new modified analogs of the thrombin binding aptamer (TBA) containing 5-nitroindole residues. It has been shown that all modified TBAs form an anti-parallel G-quadruplex structure and retain the ability to inhibit thrombin. The most advanced TBA variant (TBA-N8) has a substantially increased clotting time and two-fold lower IC50 value compared to the unmodified prototype. Molecular modelling studies suggest that the improved anticoagulant properties of TBA-N8 result from changes in the binding mode of the analog. A modified central loop in TBA-N8 is presumed to participate in the binding of the target protein. Studies of FAM labelled TBA and TBA-N8 showed an improved binding affinity of the modified aptamer and provided evidence of a direct interaction between the modified central loop and thrombin. Our findings have implications for the design of new aptamers with improved binding affinities.

  20. A Universal Base in a Specific Role: Tuning up a Thrombin Aptamer with 5-Nitroindole

    PubMed Central

    Tsvetkov, Vladimir B.; Varizhuk, Anna M.; Pozmogova, Galina E.; Smirnov, Igor P.; Kolganova, Natalia A.; Timofeev, Edward N.

    2015-01-01

    In this study we describe new modified analogs of the thrombin binding aptamer (TBA) containing 5-nitroindole residues. It has been shown that all modified TBAs form an anti-parallel G-quadruplex structure and retain the ability to inhibit thrombin. The most advanced TBA variant (TBA-N8) has a substantially increased clotting time and two-fold lower IC50 value compared to the unmodified prototype. Molecular modelling studies suggest that the improved anticoagulant properties of TBA-N8 result from changes in the binding mode of the analog. A modified central loop in TBA-N8 is presumed to participate in the binding of the target protein. Studies of FAM labelled TBA and TBA-N8 showed an improved binding affinity of the modified aptamer and provided evidence of a direct interaction between the modified central loop and thrombin. Our findings have implications for the design of new aptamers with improved binding affinities.

  1. Ubiquitin ligase parkin promotes Mdm2-arrestin interaction but inhibits arrestin ubiquitination.

    PubMed

    Ahmed, M Rafiuddin; Zhan, Xuanzhi; Song, Xiufeng; Kook, Seunghyi; Gurevich, Vsevolod V; Gurevich, Eugenia V

    2011-05-10

    Numerous mutations in E3 ubiquitin ligase parkin were shown to associate with familial Parkinson's disease. Here we show that parkin binds arrestins, versatile regulators of cell signaling. Arrestin-parkin interaction was demonstrated by coimmunoprecipitation of endogenous proteins from brain tissue and shown to be direct using purified proteins. Parkin binding enhances arrestin interactions with another E3 ubiquitin ligase, Mdm2, apparently by shifting arrestin conformational equilibrium to the basal state preferred by Mdm2. Although Mdm2 was reported to ubiquitinate arrestins, parkin-dependent increase in Mdm2 binding dramatically reduces the ubiquitination of both nonvisual arrestins, basal and stimulated by receptor activation, without affecting receptor internalization. Several disease-associated parkin mutations differentially affect the stimulation of Mdm2 binding. All parkin mutants tested effectively suppress arrestin ubiquitination, suggesting that bound parkin shields arrestin lysines targeted by Mdm2. Parkin binding to arrestins along with its effects on arrestin interaction with Mdm2 and ubiquitination is a novel function of this protein with implications for Parkinson's disease pathology.

  2. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

  3. The NS5A-binding heat shock proteins HSC70 and HSP70 play distinct roles in the hepatitis C viral life cycle.

    PubMed

    Khachatoorian, Ronik; Ganapathy, Ekambaram; Ahmadieh, Yasaman; Wheatley, Nicole; Sundberg, Christopher; Jung, Chun-Ling; Arumugaswami, Vaithilingaraja; Raychaudhuri, Santanu; Dasgupta, Asim; French, Samuel W

    2014-04-01

    We previously identified HSP70 and HSC70 in complex with NS5A in a proteomic screen. Here, coimmunoprecipitation studies confirmed NS5A/HSC70 complex formation during infection, and immunofluorescence studies showed NS5A and HSC70 to colocalize. Unlike HSP70, HSC70 knockdown did not decrease viral protein levels. Rather, intracellular infectious virion assembly was significantly impaired by HSC70 knockdown. We also discovered that both HSC70 nucleotide binding and substrate binding domains directly bind NS5A whereas only the HSP70 nucleotide binding domain does. Knockdown of both HSC70 and HSP70 demonstrated an additive reduction in virus production. This data suggests that HSC70 and HSP70 play discrete roles in the viral life cycle. Investigation of these different functions may facilitate developing of novel strategies that target host proteins to treat HCV infection. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Molecular principles underlying dual RNA specificity in the Drosophila SNF protein.

    PubMed

    Weber, Gert; DeKoster, Gregory T; Holton, Nicole; Hall, Kathleen B; Wahl, Markus C

    2018-06-07

    The first RNA recognition motif of the Drosophila SNF protein is an example of an RNA binding protein with multi-specificity. It binds different RNA hairpin loops in spliceosomal U1 or U2 small nuclear RNAs, and only in the latter case requires the auxiliary U2A' protein. Here we investigate its functions by crystal structures of SNF alone and bound to U1 stem-loop II, U2A' or U2 stem-loop IV and U2A', SNF dynamics from NMR spectroscopy, and structure-guided mutagenesis in binding studies. We find that different loop-closing base pairs and a nucleotide exchange at the tips of the loops contribute to differential SNF affinity for the RNAs. U2A' immobilizes SNF and RNA residues to restore U2 stem-loop IV binding affinity, while U1 stem-loop II binding does not require such adjustments. Our findings show how U2A' can modulate RNA specificity of SNF without changing SNF conformation or relying on direct RNA contacts.

  5. Phosphatidylglycerol directs binding and inhibitory action of EIIAGlc protein on the maltose transporter.

    PubMed

    Bao, Huan; Duong, Franck

    2013-08-16

    The signal-transducing protein EIIA(Glc) belongs to the phosphoenolpyruvate carbohydrate phosphotransferase system. In its dephosphorylated state, EIIA(Glc) is a negative regulator for several permeases, including the maltose transporter MalFGK2. How EIIA(Glc) is targeted to the membrane, how it interacts with the transporter, and how it inhibits sugar uptake remain obscure. We show here that acidic phospholipids together with the N-terminal tail of EIIA(Glc) are essential for the high affinity binding of the protein to the transporter. Using protein docking prediction and chemical cross-linking, we demonstrate that EIIA(Glc) binds to the MalK dimer, interacting with both the nucleotide-binding and the C-terminal regulatory domains. Dissection of the ATPase cycle reveals that EIIA(Glc) does not affect the binding of ATP but rather inhibits the capacity of MalK to cleave ATP. We propose a mechanism of maltose transport inhibition by this central amphitropic regulatory protein.

  6. The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

    PubMed Central

    Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

    2006-01-01

    As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

  7. Curcumin Binding to Beta Amyloid: A Computational Study.

    PubMed

    Rao, Praveen P N; Mohamed, Tarek; Teckwani, Karan; Tin, Gary

    2015-10-01

    Curcumin, a chemical constituent present in the spice turmeric, is known to prevent the aggregation of amyloid peptide implicated in the pathophysiology of Alzheimer's disease. While curcumin is known to bind directly to various amyloid aggregates, no systematic investigations have been carried out to understand its ability to bind to the amyloid aggregates including oligomers and fibrils. In this study, we constructed computational models of (i) Aβ hexapeptide (16) KLVFFA(21) octamer steric-zipper β-sheet assembly and (ii) full-length Aβ fibril β-sheet assembly. Curcumin binding in these models was evaluated by molecular docking and molecular dynamics (MD) simulation studies. In both the models, curcumin was oriented in a linear extended conformation parallel to fiber axis and exhibited better stability in the Aβ hexapeptide (16) KLVFFA(21) octamer steric-zipper model (Ebinding  = -10.05 kcal/mol) compared to full-length Aβ fibril model (Ebinding  = -3.47 kcal/mol). Analysis of MD trajectories of curcumin bound to full-length Aβ fibril shows good stability with minimum Cα-atom RMSD shifts. Interestingly, curcumin binding led to marked fluctuations in the (14) HQKLVFFA(21) region that constitute the fibril spine with RMSF values ranging from 1.4 to 3.6 Å. These results show that curcumin binding to Aβ shifts the equilibrium in the aggregation pathway by promoting the formation of non-toxic aggregates. © 2015 John Wiley & Sons A/S.

  8. Interaction of Nevirapine with the Peptide Binding Groove of HLA-DRB1*01:01 and Its Effect on the Conformation of HLA-Peptide Complex.

    PubMed

    Hirasawa, Makoto; Hagihara, Katsunobu; Abe, Koji; Ando, Osamu; Hirayama, Noriaki

    2018-06-04

    Human leukocyte antigen (HLA)-DRB1*01:01 has been shown to be involved in nevirapine-induced hepatic hypersensitivity reactions. In the present study, in silico docking simulations and molecular dynamics simulations were performed to predict the interaction mode of nevirapine with the peptide binding groove of HLA-DRB1*01:01 and its possible effect on the position and orientation of the ligand peptide derived from hemagglutinin (HA). In silico analyses suggested that nevirapine interacts with HLA-DRB1*01:01 around the P4 pocket within the peptide binding groove and the HA peptide stably binds on top of nevirapine at the groove. The analyses also showed that binding of nevirapine at the groove will significantly change the inter-helical distances of the groove. An in vitro competitive assay showed that nevirapine (1000 μM) increases the binding of the HA peptide to HLA-DRB1*01:01 in an allele-specific manner. These results indicate that nevirapine might interact directly with the P4 pocket and modifies its structure, which could change the orientation of loaded peptides and the conformation of HLA-DRB1*01:01; these changes could be distinctively recognized by T-cell receptors. Through this molecular mechanism, nevirapine might stimulate the immune system, resulting in hepatic hypersensitivity reactions.

  9. Specific electrostatic interactions between charged amino acid residues regulate binding of von Willebrand factor to blood platelets.

    PubMed

    Interlandi, Gianluca; Yakovenko, Olga; Tu, An-Yue; Harris, Jeff; Le, Jennie; Chen, Junmei; López, José A; Thomas, Wendy E

    2017-11-10

    The plasma protein von Willebrand factor (VWF) is essential for hemostasis initiation at sites of vascular injury. The platelet-binding A1 domain of VWF is connected to the VWF N-terminally located D'D3 domain through a relatively unstructured amino acid sequence, called here the N-terminal linker. This region has previously been shown to inhibit the binding of VWF to the platelet surface receptor glycoprotein Ibα (GpIbα). However, the molecular mechanism underlying the inhibitory function of the N-terminal linker has not been elucidated. Here, we show that an aspartate at position 1261 is the most critical residue of the N-terminal linker for inhibiting binding of the VWF A1 domain to GpIbα on platelets in blood flow. Through a combination of molecular dynamics simulations, mutagenesis, and A1-GpIbα binding experiments, we identified a network of salt bridges between Asp 1261 and the rest of A1 that lock the N-terminal linker in place such that it reduces binding to GpIbα. Mutations aimed at disrupting any of these salt bridges activated binding unless the mutated residue also formed a salt bridge with GpIbα, in which case the mutations inhibited the binding. These results show that interactions between charged amino acid residues are important both to directly stabilize the A1-GpIbα complex and to indirectly destabilize the complex through the N-terminal linker. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  11. Binding constants of phenylalanine for the four mononucleotides

    NASA Technical Reports Server (NTRS)

    Khaled, M. A.; Mullins, D. W., Jr.; Lacey, J. C., Jr.

    1984-01-01

    Earlier work has shown that several properties of amino acids correlate directly with properties of their anticodonic nucleotides. Furthermore, in precipitation studies with thermal proteinoids and homopolyribonucleotides, an anticodonic preference was displayed between Lys-rich, Pro-rich and Gly-rich thermal proteinoids and their anticodonic polyribonucleotides. However, Phe-rich thermal proteinoid displayed a preference for its codonic nucleotide, poly U. This inconsistency seemed to be explained by a folding in of the hydrophobic residues of Phe causing the proteinoid to appear more hydrophilic. The present work used nuclear magnetic resonance techniques to resolve a limited question: to which of the four nucleotides does Phe bind most strongly? The results show quite clearly that Phe binds most strongly to its anticodonic nucleotide, AMP.

  12. Porcine aminopeptidase N binds to F4+ enterotoxigenic Escherichia coli fimbriae.

    PubMed

    Xia, Pengpeng; Wang, Yiting; Zhu, Congrui; Zou, Yajie; Yang, Ying; Liu, Wei; Hardwidge, Philip R; Zhu, Guoqiang

    2016-02-09

    F4(+) enterotoxigenic Escherichia coli (ETEC) strains cause diarrheal disease in neonatal and post-weaned piglets. Several different host receptors for F4 fimbriae have been described, with porcine aminopeptidase N (APN) reported most recently. The FaeG subunit is essential for the binding of the three F4 variants to host cells. Here we show in both yeast two-hybrid and pulldown assays that APN binds directly to FaeG, the major subunit of F4 fimbriae, from three serotypes of F4(+) ETEC. Modulating APN gene expression in IPEC-J2 cells affected ETEC adherence. Antibodies raised against APN or F4 fimbriae both reduced ETEC adherence. Thus, APN mediates the attachment of F4(+) E. coli to intestinal epithelial cells.

  13. Mapping of ligand-binding cavities in proteins.

    PubMed

    Andersson, C David; Chen, Brian Y; Linusson, Anna

    2010-05-01

    The complex interactions between proteins and small organic molecules (ligands) are intensively studied because they play key roles in biological processes and drug activities. Here, we present a novel approach to characterize and map the ligand-binding cavities of proteins without direct geometric comparison of structures, based on Principal Component Analysis of cavity properties (related mainly to size, polarity, and charge). This approach can provide valuable information on the similarities and dissimilarities, of binding cavities due to mutations, between-species differences and flexibility upon ligand-binding. The presented results show that information on ligand-binding cavity variations can complement information on protein similarity obtained from sequence comparisons. The predictive aspect of the method is exemplified by successful predictions of serine proteases that were not included in the model construction. The presented strategy to compare ligand-binding cavities of related and unrelated proteins has many potential applications within protein and medicinal chemistry, for example in the characterization and mapping of "orphan structures", selection of protein structures for docking studies in structure-based design, and identification of proteins for selectivity screens in drug design programs. 2009 Wiley-Liss, Inc.

  14. Mapping of Ligand-Binding Cavities in Proteins

    PubMed Central

    Andersson, C. David; Chen, Brian Y.; Linusson, Anna

    2010-01-01

    The complex interactions between proteins and small organic molecules (ligands) are intensively studied because they play key roles in biological processes and drug activities. Here, we present a novel approach to characterise and map the ligand-binding cavities of proteins without direct geometric comparison of structures, based on Principal Component Analysis of cavity properties (related mainly to size, polarity and charge). This approach can provide valuable information on the similarities, and dissimilarities, of binding cavities due to mutations, between-species differences and flexibility upon ligand-binding. The presented results show that information on ligand-binding cavity variations can complement information on protein similarity obtained from sequence comparisons. The predictive aspect of the method is exemplified by successful predictions of serine proteases that were not included in the model construction. The presented strategy to compare ligand-binding cavities of related and unrelated proteins has many potential applications within protein and medicinal chemistry, for example in the characterisation and mapping of “orphan structures”, selection of protein structures for docking studies in structure-based design and identification of proteins for selectivity screens in drug design programs. PMID:20034113

  15. Functional Dynamics of PDZ Binding Domains: A Normal-Mode Analysis

    PubMed Central

    De Los Rios, Paolo; Cecconi, Fabio; Pretre, Anna; Dietler, Giovanni; Michielin, Olivier; Piazza, Francesco; Juanico, Brice

    2005-01-01

    Postsynaptic density-95/disks large/zonula occludens-1 (PDZ) domains are relatively small (80–120 residues) protein binding modules central in the organization of receptor clusters and in the association of cellular proteins. Their main function is to bind C-terminals of selected proteins that are recognized through specific amino acids in their carboxyl end. Binding is associated with a deformation of the PDZ native structure and is responsible for dynamical changes in regions not in direct contact with the target. We investigate how this deformation is related to the harmonic dynamics of the PDZ structure and show that one low-frequency collective normal mode, characterized by the concerted movements of different secondary structures, is involved in the binding process. Our results suggest that even minimal structural changes are responsible for communication between distant regions of the protein, in agreement with recent NMR experiments. Thus, PDZ domains are a very clear example of how collective normal modes are able to characterize the relation between function and dynamics of proteins, and to provide indications on the precursors of binding/unbinding events. PMID:15821164

  16. Unravelling the specificity and mechanism of sialic acid recognition by the gut symbiont Ruminococcus gnavus.

    PubMed

    Owen, C David; Tailford, Louise E; Monaco, Serena; Šuligoj, Tanja; Vaux, Laura; Lallement, Romane; Khedri, Zahra; Yu, Hai; Lecointe, Karine; Walshaw, John; Tribolo, Sandra; Horrex, Marc; Bell, Andrew; Chen, Xi; Taylor, Gary L; Varki, Ajit; Angulo, Jesus; Juge, Nathalie

    2017-12-19

    Ruminococcus gnavus is a human gut symbiont wherein the ability to degrade mucins is mediated by an intramolecular trans-sialidase (RgNanH). RgNanH comprises a GH33 catalytic domain and a sialic acid-binding carbohydrate-binding module (CBM40). Here we used glycan arrays, STD NMR, X-ray crystallography, mutagenesis and binding assays to determine the structure and function of RgNanH_CBM40 (RgCBM40). RgCBM40 displays the canonical CBM40 β-sandwich fold and broad specificity towards sialoglycans with millimolar binding affinity towards α2,3- or α2,6-sialyllactose. RgCBM40 binds to mucus produced by goblet cells and to purified mucins, providing direct evidence for a CBM40 as a novel bacterial mucus adhesin. Bioinformatics data show that RgCBM40 canonical type domains are widespread among Firmicutes. Furthermore, binding of R. gnavus ATCC 29149 to intestinal mucus is sialic acid mediated. Together, this study reveals novel features of CBMs which may contribute to the biogeography of symbiotic bacteria in the gut.

  17. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  18. A simple electrostatic switch important in the activation of type I protein kinase A by cyclic AMP.

    PubMed

    Vigil, Dominico; Lin, Jung-Hsin; Sotriffer, Christoph A; Pennypacker, Juniper K; McCammon, J Andrew; Taylor, Susan S

    2006-01-01

    Cyclic AMP activates protein kinase A by binding to an inhibitory regulatory (R) subunit and releasing inhibition of the catalytic (C) subunit. Even though crystal structures of regulatory and catalytic subunits have been solved, the precise molecular mechanism by which cyclic AMP activates the kinase remains unknown. The dynamic properties of the cAMP binding domain in the absence of cAMP or C-subunit are also unknown. Here we report molecular-dynamics simulations and mutational studies of the RIalpha R-subunit that identify the C-helix as a highly dynamic switch which relays cAMP binding to the helical C-subunit binding regions. Furthermore, we identify an important salt bridge which links cAMP binding directly to the C-helix that is necessary for normal activation. Additional mutations show that a hydrophobic "hinge" region is not as critical for the cross-talk in PKA as it is in the homologous EPAC protein, illustrating how cAMP can control diverse functions using the evolutionarily conserved cAMP-binding domains.

  19. Passive transport and binding of lead by human red blood cells.

    PubMed

    Simons, T J

    1986-09-01

    The uptake of Pb into human red blood cells has been studied using Pb buffers. Passive Pb movements can be studied conveniently when the cells are depleted of adenosine 5'-triphosphate (ATP), to eliminate active transport, and of inorganic phosphate, to prevent precipitation of lead phosphate. Pb can cross the membrane passively in either direction. Influx and efflux show similar properties. Passive Pb transport is strongly stimulated by HCO3-, and is reduced by replacing Cl- with ClO4-. It is inhibited by low concentrations of 4-acetamido-4'-isothiocyanostilbene-2,2'-disulphonic acid (SITS) and 4,4'-diisothiocyanostilbene-2.2'-disulphonic acid (DIDS), characteristic inhibitors of anion transport. Pb uptake is unaffected by varying the external concentrations of Na+, K+ and Ca2+. When Pb enters the cell, it binds mainly to haemoglobin. The ratio of bound Pb:free Pb2+ in the cytosol is estimated to be 6000:1. Pb binding to haemoglobin is unaffected by oxygenation. Binding to albumin is quantitatively similar to binding to haemoglobin. The implications of these results for the transport and binding of Pb in the blood are discussed.

  20. Ubiquitin Interacts with the Tollip C2 and CUE Domains and Inhibits Binding of Tollip to Phosphoinositides*

    PubMed Central

    Mitra, Sharmistha; Traughber, C. Alicia; Brannon, Mary K.; Gomez, Stephanie; Capelluto, Daniel G. S.

    2013-01-01

    A large number of cellular signaling processes are directed through internalization, via endocytosis, of polyubiquitinated cargo proteins. Tollip is an adaptor protein that facilitates endosomal cargo sorting for lysosomal degradation. Tollip preferentially binds phosphatidylinositol 3-phosphate (PtdIns(3)P) via its C2 domain, an association that may be required for endosomal membrane targeting. Here, we show that Tollip binds ubiquitin through its C2 and CUE domains and that its association with the C2 domain inhibits PtdIns(3)P binding. NMR analysis demonstrates that the C2 and CUE domains bind to overlapping sites on ubiquitin, suggesting that two ubiquitin molecules associate with Tollip simultaneously. Hydrodynamic studies reveal that ubiquitin forms heterodimers with the CUE domain, indicating that the association disrupts the dimeric state of the CUE domain. We propose that, in the absence of polyubiquitinated cargo, the dual binding of ubiquitin partitions Tollip into membrane-bound and membrane-free states, a function that contributes to the engagement of Tollip in both membrane trafficking and cytosolic pathways. PMID:23880770

  1. Characterization of the Interactions between Calmodulin and Death Receptor 5 in Triple-negative and Estrogen Receptor-positive Breast Cancer Cells

    PubMed Central

    Fancy, Romone M.; Wang, Lingyun; Zeng, Qinghua; Wang, Hong; Zhou, Tong; Buchsbaum, Donald J.; Song, Yuhua

    2016-01-01

    Activation of death receptor-5 (DR5) leads to the formation of death inducing signaling complex (DISC) for apoptotic signaling. Targeting DR5 to induce breast cancer apoptosis is a promising strategy to circumvent drug resistance and present a target for breast cancer treatment. Calmodulin (CaM) has been shown to regulate DR5-mediated apoptotic signaling, however, its mechanism remains unknown. In this study, we characterized CaM and DR5 interactions in breast cancer cells with integrated experimental and computational approaches. Results show that CaM directly binds to DR5 in a calcium dependent manner in breast cancer cells. The direct interaction of CaM with DR5 is localized at DR5 death domain. We have predicted and verified the CaM-binding site in DR5 being 354WEPLMRKLGL363 that is located at the α2 helix and the loop between α2 helix and α3 helix of DR5 DD. The residues of Trp-354, Arg-359, Glu-355, Leu-363, and Glu-367 in DR5 death domain that are important for DR5 recruitment of FADD and caspase-8 for DISC formation to signal apoptosis also play an important role for CaM-DR5 binding. The changed electrostatic potential distribution in the CaM-binding site in DR5 DD by the point mutations of W354A, E355K, R359A, L363N, or E367K in DR5 DD could directly contribute to the experimentally observed decreased CaM-DR5 binding by the point mutations of the key residues in DR5 DD. Results from this study provide a key step for the further investigation of the role of CaM-DR5 binding in DR5-mediated DISC formation for apoptosis in breast cancer cells. PMID:27129269

  2. Synthesis of biotinylated glycoconjugates and their use in a novel ELISA for direct comparison of HIV-1 Gp120 recognition of GalCer and related carbohydrate analogues.

    PubMed

    McReynolds, K D; Hadd, M J; Gervay-Hague, J

    1999-01-01

    As part of our program directed toward the design and synthesis of high-affinity ligands for the GalCer-binding site on the HIV cell surface glycoprotein, gp120, we required a reliable method for qualitatively assessing relative binding affinities for related analogues. Due to the hydrophilic nature of these synthetic conjugates, difficulties were encountered with typical ELISA methods, which rely upon hydrophobic interactions to anchor the ligand to a microtiter plate. Other types of assays were also problematic due to nonspecific binding of gp120. Therefore, we developed a general method for plating water-soluble ligands on microtiter plates using biotin/NeutrAvidin recognition for adhesion. A water-soluble GalCer analogue was prepared by conjugating psychosine to biotin using a novel tetraethylene glycol linker. In a similar manner, LacCer and GlcCer analogues were prepared and these conjugates were plated into microtiter wells containing NeutrAvidin. Unoccupied sites were blocked using biotin functionalized as a primary amide. Gp120 binding to galactosyl sphingosine, GalSph (19), GlcSph (22), and LacSph (23) conjugates was assessed through incubation with recombinant HRP-gp120. It was determined that LacSph has the strongest interaction with gp120. The binding affinities of GalSph and GlcSph were similar to each other and less strong than LacSph. These data contradict earlier studies where HPTLC showed that LacCer and GlcCer do not significantly bind gp120. They also contradict liposome-based assays that reported psychosine is not recognized by gp120. The extent of plating for each biotinylated molecule was quantified using HRP-biotin, allowing direct comparison of ligand plating efficiencies for the first time. Several other synthetic biotin conjugates were prepared and tested, demonstrating the feasibility of performing ELISA on water-soluble ligands.

  3. Evidence for in vivo phosphorylation of the Grb2 SH2-domain binding site on focal adhesion kinase by Src-family protein-tyrosine kinases.

    PubMed

    Schlaepfer, D D; Hunter, T

    1996-10-01

    Focal adhesion kinase (FAK) is a nonreceptor protein-tyrosine kinase (PTK) that associates with integrin receptors and participates in extracellular matrix-mediated signal transduction events. We showed previously that the c-Src nonreceptor PTK and the Grb2 SH2/SH3 adaptor protein bound directly to FAK after fibronectin stimulation (D. D. Schlaepfer, S.K. Hanks, T. Hunter, and P. van der Geer, Nature [London] 372:786-791, 1994). Here, we present evidence that c-Src association with FAK is required for Grb2 binding to FAK. Using a tryptic phosphopeptide mapping approach, the in vivo phosphorylation of the Grb2 binding site on FAK (Tyr-925) was detected after fibronectin stimulation of NIH 3T3 cells and was constitutively phosphorylated in v-Src-transformed NIH 3T3 cells. In vitro, c-Src phosphorylated FAK Tyr-925 in a glutathione S-transferase-FAK C-terminal domain fusion protein, whereas FAK did not. Using epitope-tagged FAK constructs, transiently expressed in human 293 cells, we determined the effect of site-directed mutations on c-Src and Grb2 binding to FAK. Mutation of FAK Tyr-925 disrupted Grb2 binding, whereas mutation of the c-Src binding site on FAK (Tyr-397) disrupted both c-Src and Grb2 binding to FAK in vivo. These results support a model whereby Src-family PTKs are recruited to FAK and focal adhesions following integrin-induced autophosphorylation and exposure of FAK Tyr-397. Src-family binding and phosphorylation of FAK at Tyr-925 creates a Grb2 SH2-domain binding site and provides a link to the activation of the Ras signal transduction pathway. In Src-transformed cells, this pathway may be constitutively activated as a result of FAK Tyr-925 phosphorylation in the absence of integrin stimulation.

  4. How does huperzine A enter and leave the binding gorge of acetylcholinesterase? Steered molecular dynamics simulations.

    PubMed

    Xu, Yechun; Shen, Jianhua; Luo, Xiaomin; Silman, Israel; Sussman, Joel L; Chen, Kaixian; Jiang, Hualiang

    2003-09-17

    The entering and leaving processes of Huperzine A (HupA) binding with the long active-site gorge of Torpedo californica acetylcholinesterase (TcAChE) have been investigated by using steered molecular dynamics simulations. The analysis of the force required along the pathway shows that it is easier for HupA to bind to the active site of AChE than to disassociate from it, which for the first time interprets at the atomic level the previous experimental result that unbinding process of HupA is much slower than its binding process to AChE. The direct hydrogen bonds, water bridges, and hydrophobic interactions were analyzed during two steered molecular dynamics (SMD) simulations. Break of the direct hydrogen bond needs a great pulling force. The steric hindrance of bottleneck might be the most important factor to produce the maximal rupture force for HupA to leave the binding site but it has a little effect on the binding process of HupA with AChE. Residue Asp72 forms a lot of water bridges with HupA leaving and entering the AChE binding gorge, acting as a clamp to take out HupA from or put HupA into the active site. The flip of the peptide bond between Gly117 and Gly118 has been detected during both the conventional MD and SMD simulations. The simulation results indicate that this flip phenomenon could be an intrinsic property of AChE and the Gly117-Gly118 peptide bond in both HupA bound and unbound AChE structures tends to adopt the native enzyme structure. At last, in a vacuum the rupture force is increased up to 1500 pN while in water solution the greatest rupture force is about 800 pN, which means water molecules in the binding gorge act as lubricant to facilitate HupA entering or leaving the binding gorge.

  5. Step-By-Step In Vitro Mutagenesis: Lessons From Fucose-Binding Lectin PA-IIL.

    PubMed

    Mrázková, Jana; Malinovská, Lenka; Wimmerová, Michaela

    2017-01-01

    Site-directed mutagenesis is a powerful technique which is used to understand the basis of interactions between proteins and their binding partners, as well as to modify these interactions. Methods of rational design that are based on detailed knowledge of the structure of a protein of interest are often used for preliminary investigations of the possible outcomes which can result from the practical application of site-directed mutagenesis. Also, random mutagenesis can be used in tandem with site-directed mutagenesis for an examination of amino acid "hotspots."Lectins are sugar-binding proteins which, among other functions, mediate the recognition of host cells by a pathogen and its adhesion to the host cell surface. Hence, lectins and their binding properties are studied and engineered using site-directed mutagenesis.In this chapter, we describe a site-directed mutagenesis method used for investigating the sugar binding pattern of the PA-IIL lectin from the pathogenic bacterium Pseudomonas aeruginosa. Moreover, procedures for the production and purification of PA-IIL mutants are described, and several basic methods for characterizing the mutants are discussed.

  6. Competition between Ski and CREB-binding protein for binding to Smad proteins in transforming growth factor-beta signaling.

    PubMed

    Chen, Weijun; Lam, Suvana S; Srinath, Hema; Schiffer, Celia A; Royer, William E; Lin, Kai

    2007-04-13

    The family of Smad proteins mediates transforming growth factor-beta (TGF-beta) signaling in cell growth and differentiation. Smads repress or activate TGF-beta signaling by interacting with corepressors (e.g. Ski) or coactivators (e.g. CREB-binding protein (CBP)), respectively. Specifically, Ski has been shown to interfere with the interaction between Smad3 and CBP. However, it is unclear whether Ski competes with CBP for binding to Smads and whether they can interact with Smad3 at the same binding surface on Smad3. We investigated the interactions among purified constructs of Smad, Ski, and CBP in vitro by size-exclusion chromatography, isothermal titration calorimetry, and mutational studies. Here, we show that Ski-(16-192) interacted directly with a homotrimer of receptor-regulated Smad protein (R-Smad), e.g. Smad2 or Smad3, to form a hexamer; Ski-(16-192) interacted with an R-Smad.Smad4 heterotrimer to form a pentamer. CBP-(1941-1992) was also found to interact directly with an R-Smad homotrimer to form a hexamer and with an R-Smad.Smad4 heterotrimer to form a pentamer. Moreover, these domains of Ski and CBP competed with each other for binding to Smad3. Our mutational studies revealed that domains of Ski and CBP interacted with Smad3 at a portion of the binding surface of the Smad anchor for receptor activation. Our results suggest that Ski negatively regulates TGF-beta signaling by replacing CBP in R-Smad complexes. Our working model suggests that Smad protein activity is delicately balanced by Ski and CBP in the TGF-beta pathway.

  7. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  8. Label-Free, LC-MS-Based Assays to Quantitate Small-Molecule Antagonist Binding to the Mammalian BLT1 Receptor.

    PubMed

    Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W

    2017-08-01

    We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.

  9. Zinc(II) binds to the neuroprotective peptide humanin.

    PubMed

    Armas, Ambar; Sonois, Vanessa; Mothes, Emmanuelle; Mazarguil, Honoré; Faller, Peter

    2006-10-01

    The abnormal accumulation of the peptide amyloid-beta in the form of senile (or amyloid) plaques is one of the hallmarks of Alzheimer's disease (AD). Zinc ions have been implicated in AD and plaques formation. Recently, the peptide humanin has been discovered. Humanin showed neuroprotective activity against amyloid-beta insults. Here the question investigated is if humanin could interact directly with Zn(II). It is shown that Zn(II) and its substitutes Cd(II)/Co(II) bind to humanin via a thiolate bond from the side chain of the single cysteine at position 8. The low intensity of the d-d bands of Co(II)-humanin indicated an octahedral coordination geometry. Titration experiments suggest that Zn(II) binds to humanin with an apparent affinity in the low muM range. This apparent Zn-binding affinity is in the same order as for amyloid-beta and glutathione and could thus be of physiological relevance.

  10. Direct detection of formate ligation in cytochrome c oxidase by ATR-FTIR spectroscopy.

    PubMed

    Iwaki, Masayo; Rich, Peter R

    2004-03-03

    The IR signature of binding of formate to the heme a(3-)Cu(B) binuclear site of bovine cytochrome c oxidase has been obtained by perfusion ATR-FTIR spectroscopy. The data show unequivocally that formate binds in its anionic form despite its binding being electroneutral overall. The bound formate can be distinguished from free ligand by the binding-induced sharpening and downshifting of vibrational bands. Formate ligation also causes shifts of vibrational modes of heme a(3) and its substituents and perturbation of histidine residues. The association of the accompanying protonation change with a carboxylate or tyrosine can be ruled out and may involve a histidine metal ligand or, more likely, a simple displacement into the bulk phase of a hydroxide ligand to heme a(3) or CU(B), a reaction which would account for stoichiometric proton uptake and maintenance of net charge within the binuclear center domain.

  11. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation.

    PubMed

    Das, Theerthankar; Kutty, Samuel K; Tavallaie, Roya; Ibugo, Amaye I; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W S; Thomas, Shane R; Kumar, Naresh; Gooding, J Justin; Manefield, Mike

    2015-02-11

    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation.

  12. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation

    PubMed Central

    Das, Theerthankar; Kutty, Samuel K.; Tavallaie, Roya; Ibugo, Amaye I.; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W. S.; Thomas, Shane R.; Kumar, Naresh; Gooding, J. Justin; Manefield, Mike

    2015-01-01

    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation. PMID:25669133

  13. Specific minor groove solvation is a crucial determinant of DNA binding site recognition

    PubMed Central

    Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

    2014-01-01

    The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

  14. Mannobiose Binding Induces Changes in Hydrogen Bonding and Protonation States of Acidic Residues in Concanavalin A As Revealed by Neutron Crystallography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gerlits, Oksana O.; Coates, Leighton; Woods, Robert J.

    Plant lectins are carbohydrate-binding proteins with various biomedical applications. Concanavalin A (Con A) holds promise in treating cancerous tumors. To better understand the Con A carbohydrate binding specificity, we obtained a room-temperature neutron structure of this legume lectin in complex with a disaccharide Manα1–2Man, mannobiose. The neutron structure afforded direct visualization of the hydrogen bonding between the protein and ligand, showing that the ligand is able to alter both protonation states and interactions for residues located close to and distant from the binding site. An unprecedented low-barrier hydrogen bond was observed forming between the carboxylic side chains of Asp28 andmore » Glu8, with the D atom positioned equidistant from the oxygen atoms having an O···D···O angle of 101.5°.« less

  15. The yeast transcription elongation factor Spt4/5 is a sequence‐specific RNA binding protein

    PubMed Central

    Blythe, Amanda J.; Yazar‐Klosinski, Berra; Webster, Michael W.; Chen, Eefei; Vandevenne, Marylène; Bendak, Katerina; Mackay, Joel P.; Hartzog, Grant A.

    2016-01-01

    Abstract The heterodimeric transcription elongation factor Spt4/Spt5 (Spt4/5) tightly associates with RNAPII to regulate both transcriptional elongation and co‐transcriptional pre‐mRNA processing; however, the mechanisms by which Spt4/5 acts are poorly understood. Recent studies of the human and Drosophila Spt4/5 complexes indicate that they can bind nucleic acids in vitro. We demonstrate here that yeast Spt4/5 can bind in a sequence‐specific manner to single stranded RNA containing AAN repeats. Furthermore, we show that the major protein determinants for RNA‐binding are Spt4 together with the NGN domain of Spt5 and that the KOW domains are not required for RNA recognition. These findings attribute a new function to a domain of Spt4/5 that associates directly with RNAPII, making significant steps towards elucidating the mechanism behind transcriptional control by Spt4/5. PMID:27376968

  16. Quantitation of Membrane-Ligand Interactions Using Backscattering Interferometry

    PubMed Central

    Baksh, Michael M.; Kussrow, Amanda K.; Mileni, Mauro; Finn, M.G.; Bornhop, Darryl J.

    2011-01-01

    Though membrane-associated proteins are ubiquitous within all living organisms and represent the majority of drug targets, a general method for direct, label-free measurement of ligand binding to native membranes has not been reported. Here we show backscattering interferometry (BSI) to be a viable technique for quantifying ligand-receptor binding affinities in a variety of membrane environments. By detecting minute changes in the refractive index of a solution, BSI allows binding interactions of proteins with their ligands to be measured at picomolar concentrations. Equilibrium binding constants in the micromolar to picomolar range were obtained for small- and large-molecule interactions in both synthetic- and cell-derived membranes without the use of labels or supporting substrates. The simple and low-cost hardware, high sensitivity, and label-free nature of BSI should make it readily applicable to the study of many membrane-associated proteins of biochemical and pharmacological interest. PMID:21399645

  17. Amides Do Not Always Work: Observation of Guest Binding in an Amide-Functionalized Porous Metal–Organic Framework

    PubMed Central

    2016-01-01

    An amide-functionalized metal organic framework (MOF) material, MFM-136, shows a high CO2 uptake of 12.6 mmol g–1 at 20 bar and 298 K. MFM-136 is the first example of an acylamide pyrimidyl isophthalate MOF without open metal sites and, thus, provides a unique platform to study guest binding, particularly the role of free amides. Neutron diffraction reveals that, surprisingly, there is no direct binding between the adsorbed CO2/CH4 molecules and the pendant amide group in the pore. This observation has been confirmed unambiguously by inelastic neutron spectroscopy. This suggests that introduction of functional groups solely may not necessarily induce specific guest–host binding in porous materials, but it is a combination of pore size, geometry, and functional group that leads to enhanced gas adsorption properties. PMID:27665845

  18. Akt phosphorylation regulates the tumour-suppressor merlin through ubiquitination and degradation.

    PubMed

    Tang, Xiaoling; Jang, Sung-Wuk; Wang, Xuerong; Liu, Zhixue; Bahr, Scott M; Sun, Shi-Yong; Brat, Daniel; Gutmann, David H; Ye, Keqiang

    2007-10-01

    The neurofibromatosis-2 (NF2) tumour-suppressor gene encodes an intracellular membrane-associated protein, called merlin, whose growth-suppressive function is dependent on its ability to form interactions through its intramolecular amino-terminal domain (NTD) and carboxy-terminal domain (CTD). Merlin phosphorylation plays a critical part in dictating merlin NTD/CTD interactions as well as in controlling binding to its effector proteins. Merlin is partially regulated by phosphorylation of Ser 518, such that hyperphosphorylated merlin is inactive and fails to form productive intramolecular and intermolecular interactions. Here, we show that the protein kinase Akt directly binds to and phosphorylates merlin on residues Thr 230 and Ser 315, which abolishes merlin NTD/CTD interactions and binding to merlin's effector protein PIKE-L and other binding partners. Furthermore, Akt-mediated phosphorylation leads to merlin degradation by ubiquitination. These studies demonstrate that Akt-mediated merlin phosphorylation regulates the function of merlin in the absence of an inactivating mutation.

  19. Phosphorylation-regulated Binding of RNA Polymerase II to Fibrous Polymers of Low Complexity Domains

    PubMed Central

    Xiang, Siheng; Wu, Leeju; Theodoropoulos, Pano; Mirzaei, Hamid; Han, Tina; Xie, Shanhai; Corden, Jeffry L.; McKnight, Steven L.

    2014-01-01

    SUMMARY The low complexity (LC) domains of the products of the fused in sarcoma (FUS), Ewings sarcoma (EWS) and TAF15 genes are translocated onto a variety of different DNA-binding domains and thereby assist in driving the formation of cancerous cells. In the context of the translocated fusion proteins, these LC sequences function as transcriptional activation domains. Here we show that polymeric fibers formed from these LC domains directly bind the C-terminal domain (CTD) of RNA polymerase II in a manner reversible by phosphorylation of the iterated, heptad repeats of the CTD. Mutational analysis indicates that the degree of binding between the CTD and the LC domain polymers correlates with the strength of transcriptional activation. These studies offer a simple means of conceptualizing how RNA polymerase II is recruited to active genes in its unphosphorylated state, and released for elongation following phosphorylation of the CTD. PMID:24267890

  20. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  1. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE PAGES

    Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

    2016-02-04

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  2. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paugh, Steven W.; Coss, David R.; Bao, Ju

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  3. Competitive folding of anti-terminator/terminator hairpins monitored by single molecule FRET.

    PubMed

    Clerte, Caroline; Declerck, Nathalie; Margeat, Emmanuel

    2013-02-01

    The control of transcription termination by RNA-binding proteins that modulate RNA-structures is an important regulatory mechanism in bacteria. LicT and SacY from Bacillus subtilis prevent the premature arrest of transcription by binding to an anti-terminator RNA hairpin that overlaps an intrinsic terminator located in the 5'-mRNA leader region of the gene to be regulated. In order to investigate the molecular determinants of this anti-termination/termination balance, we have developed a fluorescence-based nucleic acids system that mimics the competition between the LicT or SacY anti-terminator targets and the overlapping terminators. Using Förster Resonance Energy Transfer on single diffusing RNA hairpins, we could monitor directly their opening or closing state, and thus investigate the effects on this equilibrium of the binding of anti-termination proteins or terminator-mimicking oligonucleotides. We show that the anti-terminator hairpins adopt spontaneously a closed structure and that their structural dynamics is mainly governed by the length of their basal stem. The induced stability of the anti-terminator hairpins determines both the affinity and specificity of the anti-termination protein binding. Finally, we show that stabilization of the anti-terminator hairpin, by an extended basal stem or anti-termination protein binding can efficiently counteract the competing effect of the terminator-mimic.

  4. Integrin-mediated signal transduction linked to Ras pathway by GRB2 binding to focal adhesion kinase.

    PubMed

    Schlaepfer, D D; Hanks, S K; Hunter, T; van der Geer, P

    The cytoplasmic focal adhesion protein-tyrosine kinase (FAK) localizes with surface integrin receptors at sites where cells attach to the extracellular matrix. Increased FAK tyrosine phosphorylation occurs upon integrin engagement with fibronectin. Here we show that adhesion of murine NIH3T3 fibroblasts to fibronectin promotes SH2-domain-mediated association of the GRB2 adaptor protein and the c-Src protein-tyrosine kinase (PTK) with FAK in vivo, and also results in activation of mitogen-activated protein kinase (MAPK). In v-Src-transformed NIH3T3, the association of v-Src, GRB2 and Sos with FAK is independent of cell adhesion to fibronectin. The GRB2 SH2 domain binds directly to tyrosine-phosphorylated FAK. Mutation of tyrosine residue 925 of FAK (YENV motif) to phenylalanine blocks GRB2 SH2-domain binding to FAK in vitro. Our results show that fibronectin binding to integrins on NIH3T3 fibroblasts promotes c-Src and FAK association and formation of an integrin-activated signalling complex. Phosphorylation of FAK at Tyr 925 upon fibronectin stimulation creates an SH2-binding site for GRB2 which may link integrin engagement to the activation of the Ras/MAPK signal transduction pathway.

  5. The DNLZ/HEP zinc-binding subdomain is critical for regulation of the mitochondrial chaperone HSPA9

    PubMed Central

    Vu, Michael T; Zhai, Peng; Lee, Juhye; Guerra, Cecilia; Liu, Shirley; Gustin, Michael C; Silberg, Jonathan J

    2012-01-01

    Human mitochondrial DNLZ/HEP regulates the catalytic activity and solubility of the mitochondrial hsp70 chaperone HSPA9. Here, we investigate the role that the DNLZ zinc-binding and C-terminal subdomains play in regulating HSPA9. We show that truncations lacking portions of the zinc-binding subdomain (ZBS) do not affect the solubility of HSPA9 or its ATPase domain, whereas those containing the ZBS and at least 10 residues following this subdomain enhance chaperone solubility. Binding measurements further show that DNLZ requires its ZBS to form a stable complex with the HSPA9 ATPase domain, and ATP hydrolysis measurements reveal that the ZBS is critical for full stimulation of HSPA9 catalytic activity. We also examined if DNLZ is active in vivo. We found that DNLZ partially complements the growth of Δzim17Saccharomyces cerevisiae, and we discovered that a Zim17 truncation lacking a majority of the C-terminal subdomain strongly complements growth like full-length Zim17. These findings provide direct evidence that human DNLZ is a functional ortholog of Zim17. In addition, they implicate the pair of antiparallel β-strands that coordinate zinc in Zim17/DNLZ-type proteins as critical for binding and regulating hsp70 chaperones. PMID:22162012

  6. The DNLZ/HEP zinc-binding subdomain is critical for regulation of the mitochondrial chaperone HSPA9.

    PubMed

    Vu, Michael T; Zhai, Peng; Lee, Juhye; Guerra, Cecilia; Liu, Shirley; Gustin, Michael C; Silberg, Jonathan J

    2012-02-01

    Human mitochondrial DNLZ/HEP regulates the catalytic activity and solubility of the mitochondrial hsp70 chaperone HSPA9. Here, we investigate the role that the DNLZ zinc-binding and C-terminal subdomains play in regulating HSPA9. We show that truncations lacking portions of the zinc-binding subdomain (ZBS) do not affect the solubility of HSPA9 or its ATPase domain, whereas those containing the ZBS and at least 10 residues following this subdomain enhance chaperone solubility. Binding measurements further show that DNLZ requires its ZBS to form a stable complex with the HSPA9 ATPase domain, and ATP hydrolysis measurements reveal that the ZBS is critical for full stimulation of HSPA9 catalytic activity. We also examined if DNLZ is active in vivo. We found that DNLZ partially complements the growth of Δzim17 Saccharomyces cerevisiae, and we discovered that a Zim17 truncation lacking a majority of the C-terminal subdomain strongly complements growth like full-length Zim17. These findings provide direct evidence that human DNLZ is a functional ortholog of Zim17. In addition, they implicate the pair of antiparallel β-strands that coordinate zinc in Zim17/DNLZ-type proteins as critical for binding and regulating hsp70 chaperones. Copyright © 2011 The Protein Society.

  7. Mitotic centromeric targeting of HP1 and its binding to Sgo1 are dispensable for sister-chromatid cohesion in human cells

    PubMed Central

    Kang, Jungseog; Chaudhary, Jaideep; Dong, Hui; Kim, Soonjoung; Brautigam, Chad A.; Yu, Hongtao

    2011-01-01

    Human Shugoshin 1 (Sgo1) protects centromeric sister-chromatid cohesion during prophase and prevents premature sister-chromatid separation. Heterochromatin protein 1 (HP1) has been proposed to protect centromeric sister-chromatid cohesion by directly targeting Sgo1 to centromeres in mitosis. Here we show that HP1α is targeted to mitotic centromeres by INCENP, a subunit of the chromosome passenger complex (CPC). Biochemical and structural studies show that both HP1–INCENP and HP1–Sgo1 interactions require the binding of the HP1 chromo shadow domain to PXVXL/I motifs in INCENP or Sgo1, suggesting that the INCENP-bound, centromeric HP1α is incapable of recruiting Sgo1. Consistently, a Sgo1 mutant deficient in HP1 binding is functional in centromeric cohesion protection and localizes normally to centromeres in mitosis. By contrast, INCENP or Sgo1 mutants deficient in HP1 binding fail to localize to centromeres in interphase. Therefore, our results suggest that HP1 binding by INCENP or Sgo1 is dispensable for centromeric cohesion protection during mitosis of human cells, but might regulate yet uncharacterized interphase functions of CPC or Sgo1 at the centromeres. PMID:21346195

  8. POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

    PubMed

    Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

    2002-07-26

    The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

  9. Lentiavidins: Novel avidin-like proteins with low isoelectric points from shiitake mushroom (Lentinula edodes).

    PubMed

    Takakura, Yoshimitsu; Sofuku, Kozue; Tsunashima, Masako; Kuwata, Shigeru

    2016-04-01

    A biotin-binding protein with a low isoelectric point (pI), which minimizes electrostatic non-specific binding to substances other than biotin, is potentially valuable. To obtain such a protein, we screened hundreds of mushrooms, and detected strong biotin-binding activity in the fruit bodies of Lentinula edodes, shiitake mushroom. Two cDNAs, each encoding a protein of 152 amino acids, termed lentiavidin 1 and lentiavidin 2 were cloned from L. edodes. The proteins shared sequence identities of 27%-49% with other biotin-binding proteins, and many residues that directly associate with biotin in streptavidin were conserved in lentiavidins. The pI values of lentiavidin 1 and lentiavidin 2 were 3.9 and 4.4, respectively; the former is the lowest pI of the known biotin-binding proteins. Lentiavidin 1 was expressed as a tetrameric protein with a molecular mass of 60 kDa in an insect cell-free expression system and showed biotin-binding activity. Lentiavidin 1, with its pI of 3.9, has a potential for broad applications as a novel biotin-binding protein. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Human EAG channels are directly modulated by PIP2 as revealed by electrophysiological and optical interference investigations

    PubMed Central

    Han, Bo; He, Kunyan; Cai, Chunlin; Tang, Yin; Yang, Linli; Heinemann, Stefan H.; Hoshi, Toshinori; Hou, Shangwei

    2016-01-01

    Voltage-gated ether à go-go (EAG) K+ channels are expressed in various types of cancer cells and also in the central nervous system. Aberrant overactivation of human EAG1 (hEAG1) channels is associated with cancer and neuronal disorders such as Zimmermann-Laband and Temple-Baraitser syndromes. Although hEAG1 channels are recognized as potential therapeutic targets, regulation of their functional properties is only poorly understood. Here, we show that the membrane lipid phosphatidylinositol 4,5-bisphosphate (PIP2) is a potent inhibitory gating modifier of hEAG1 channels. PIP2 inhibits the channel activity by directly binding to a short N-terminal segment of the channel important for Ca2+/calmodulin (CaM) binding as evidenced by bio-layer interferometry measurements. Conversely, depletion of endogenous PIP2 either by serotonin-induced phospholipase C (PLC) activation or by a rapamycin-induced translocation system enhances the channel activity at physiological membrane potentials, suggesting that PIP2 exerts a tonic inhibitory influence. Our study, combining electrophysiological and direct binding assays, demonstrates that hEAG1 channels are subject to potent inhibitory modulation by multiple phospholipids and suggests that manipulations of the PIP2 signaling pathway may represent a strategy to treat hEAG1 channel-associated diseases. PMID:27005320

  11. Interactions of the GM2 activator protein with phosphatidylcholine bilayers: a site-directed spin-labeling power saturation study.

    PubMed

    Mathias, Jordan D; Ran, Yong; Carter, Jeffery D; Fanucci, Gail E

    2009-09-02

    The GM2 activator protein (GM2AP) is an accessory protein that is an essential component in the catabolism of the ganglioside GM2. A function of GM2AP is to bind and extract GM2 from intralysosomal vesicles, forming a soluble protein-lipid complex, which interacts with the hydrolase Hexosaminidase A, the enzyme that cleaves the terminal sugar group of GM2. Here, we used site-directed spin labeling with power saturation electron paramagnetic resonance to determine the surface-bound orientation of GM2AP upon phosphatidylcholine vesicles. Because GM2AP extracts lipid ligands from the vesicle and is undergoing exchange on and off the vesicle surface, we utilized a nickel-chelating lipid to localize the paramagnetic metal collider to the lipid bilayer-aqueous interface. Spin-labeled sites that collide with the lipid-bound metal relaxing agent provide a means for mapping sites of the protein that interact with the lipid bilayer interface. Results show that GM2AP binds to lipid bilayers such that the residues lining the lipid-binding cavity lie on the vesicle surface. This orientation creates a favorable microenvironment that can allow for the lipid tails to flip out of the bilayer directly into the hydrophobic pocket of GM2AP.

  12. Coactivator-associated arginine methyltransferase 1 enhances transcriptional activity of the human T-cell lymphotropic virus type 1 long terminal repeat through direct interaction with Tax.

    PubMed

    Jeong, Soo-Jin; Lu, Hanxin; Cho, Won-Kyung; Park, Hyeon Ung; Pise-Masison, Cynthia; Brady, John N

    2006-10-01

    In this study, we demonstrate that the coactivator-associated arginine methyltransferase 1 (CARM1), which methylates histone H3 and other proteins such as p300/CBP, is positively involved in the regulation of Tax transactivation. First, transfection studies demonstrated that overexpression of CARM1 wild-type protein resulted in increased Tax transactivation of the human T-cell lymphotropic virus type 1 (HTLV-1) long terminal repeat (LTR). In contrast, transfection of a catalytically inactive CARM1 methyltransferase mutant did not enhance Tax transactivation. CARM1 facilitated Tax transactivation of the CREB-dependent cellular GEM promoter. A direct physical interaction between HTLV-1 Tax and CARM1 was demonstrated using in vitro glutathione S-transferase-Tax binding assays, in vivo coimmunoprecipitation, and confocal microscopy experiments. Finally, chromatin immunoprecipitation analysis of the activated HTLV-1 LTR promoter showed the association of CARM1 and methylated histone H3 with the template DNA. In vitro, Tax facilitates the binding of CARM1 to the transcription complex. Together, our data provide evidence that CARM1 enhances Tax transactivation of the HTLV-1 LTR through a direct interaction between CARM1 and Tax and this binding promotes methylation of histone H3 (R2, R17, and R26).

  13. miR-200/375 control epithelial plasticity-associated alternative splicing by repressing the RNA-binding protein Quaking.

    PubMed

    Pillman, Katherine A; Phillips, Caroline A; Roslan, Suraya; Toubia, John; Dredge, B Kate; Bert, Andrew G; Lumb, Rachael; Neumann, Daniel P; Li, Xiaochun; Conn, Simon J; Liu, Dawei; Bracken, Cameron P; Lawrence, David M; Stylianou, Nataly; Schreiber, Andreas W; Tilley, Wayne D; Hollier, Brett G; Khew-Goodall, Yeesim; Selth, Luke A; Goodall, Gregory J; Gregory, Philip A

    2018-06-05

    Members of the miR-200 family are critical gatekeepers of the epithelial state, restraining expression of pro-mesenchymal genes that drive epithelial-mesenchymal transition (EMT) and contribute to metastatic cancer progression. Here, we show that miR-200c and another epithelial-enriched miRNA, miR-375, exert widespread control of alternative splicing in cancer cells by suppressing the RNA-binding protein Quaking (QKI). During EMT, QKI-5 directly binds to and regulates hundreds of alternative splicing targets and exerts pleiotropic effects, such as increasing cell migration and invasion and restraining tumour growth, without appreciably affecting mRNA levels. QKI-5 is both necessary and sufficient to direct EMT-associated alternative splicing changes, and this splicing signature is broadly conserved across many epithelial-derived cancer types. Importantly, several actin cytoskeleton-associated genes are directly targeted by both QKI and miR-200c, revealing coordinated control of alternative splicing and mRNA abundance during EMT These findings demonstrate the existence of a miR-200/miR-375/QKI axis that impacts cancer-associated epithelial cell plasticity through widespread control of alternative splicing. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  14. A22 disrupts the bacterial actin cytoskeleton by directly binding and inducing a low-affinity state in MreB.

    PubMed

    Bean, G J; Flickinger, S T; Westler, W M; McCully, M E; Sept, D; Weibel, D B; Amann, K J

    2009-06-09

    S-(3,4-Dichlorobenzyl)isothiourea (A22) disrupts the actin cytoskeleton of bacteria, causing defects of morphology and chromosome segregation. Previous studies have suggested that the actin homologue MreB itself is the target of A22, but there has been no direct observation of A22 binding to MreB and no mechanistic explanation of its mode of action. We show that A22 binds MreB with at least micromolar affinity in its nucleotide-binding pocket in a manner that is sterically incompatible with simultaneous ATP binding. A22 negatively affects both the time course and extent of MreB polymerization in vitro in the presence of ATP. A22 prevents assembly of MreB into long, rigid polymers, as determined by both fluorescence microscopy and sedimentation assays. A22 increases the critical concentration of ATP-bound MreB assembly from 500 nM to approximately 2000 nM. We therefore conclude that A22 is a competitive inhibitor of ATP binding to MreB. A22-bound MreB is capable of polymerization, but with assembly properties that more closely resemble those of the ADP-bound state. Because the cellular concentration of MreB is in the low micromolar range, this mechanism explains the ability of A22 to largely disassemble the actin cytoskeleton in bacterial cells. It also represents a novel mode of action for a cytoskeletal drug and the first biochemical characterization of the interaction between a small molecule inhibitor of the bacterial cytoskeleton and its target.

  15. Structural characterization of acyl-CoA oxidases reveals a direct link between pheromone biosynthesis and metabolic state in Caenorhabditis elegans

    PubMed Central

    Zhang, Xinxing; Jones, Rachel A.; Bruner, Steven D.; Butcher, Rebecca A.

    2016-01-01

    Caenorhabditis elegans secretes ascarosides as pheromones to communicate with other worms and to coordinate the development and behavior of the population. Peroxisomal β-oxidation cycles shorten the side chains of ascaroside precursors to produce the short-chain ascaroside pheromones. Acyl-CoA oxidases, which catalyze the first step in these β-oxidation cycles, have different side chain-length specificities and enable C. elegans to regulate the production of specific ascaroside pheromones. Here, we determine the crystal structure of the acyl-CoA oxidase 1 (ACOX-1) homodimer and the ACOX-2 homodimer bound to its substrate. Our results provide a molecular basis for the substrate specificities of the acyl-CoA oxidases and reveal why some of these enzymes have a very broad substrate range, whereas others are quite specific. Our results also enable predictions to be made for the roles of uncharacterized acyl-CoA oxidases in C. elegans and in other nematode species. Remarkably, we show that most of the C. elegans acyl-CoA oxidases that participate in ascaroside biosynthesis contain a conserved ATP-binding pocket that lies at the dimer interface, and we identify key residues in this binding pocket. ATP binding induces a structural change that is associated with tighter binding of the FAD cofactor. Mutations that disrupt ATP binding reduce FAD binding and reduce enzyme activity. Thus, ATP may serve as a regulator of acyl-CoA oxidase activity, thereby directly linking ascaroside biosynthesis to ATP concentration and metabolic state. PMID:27551084

  16. Structures of D14 and D14L in the strigolactone and karrikin signaling pathways.

    PubMed

    Kagiyama, Megumi; Hirano, Yoshinori; Mori, Tomoyuki; Kim, Sun-Yong; Kyozuka, Junko; Seto, Yoshiya; Yamaguchi, Shinjiro; Hakoshima, Toshio

    2013-02-01

    Strigolactones (SLs) are plant hormones that inhibit shoot branching. DWARF14 (D14) inhibits rice tillering and is an SL receptor candidate in the branching inhibition pathway, whereas the close homologue DWARF14-LIKE (D14L) participates in the signaling pathway of karrikins (KARs), which are derived from burnt vegetation as smoke stimulants of seed germination. We provide the first evidence for direct binding of the bioactive SL analogue GR24 to D14. Isothermal titration calorimetry measurements show a D14-GR24 binding affinity in the sub-micromolar range. Similarly, bioactive KAR1 directly binds D14L in the micromolar range. The crystal structure of rice D14 shows a compact α-/β-fold hydrolase domain forming a deep ligand-binding pocket capable of accommodating GR24. Insertion of four α-helices between β6 strand and αD helix forms the helical cap of the pocket, although the pocket is open to the solvent. The pocket contains the conserved catalytic triad Ser-His-Asp aligned with the oxyanion hole, suggesting hydrolase activity. Although these structural characteristics are conserved in D14L, the D14L pocket is smaller than that of D14. The KAR-insensitive mutation kai2-1 is located at the prominent long β6-αD1 loop, which is characteristic in D14 and D14L, but not in related α-/β-fold hydrolases. © 2013 The Authors Genes to Cells © 2013 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

  17. Molecular Mechanism of Action for Allosteric Modulators and Agonists in CC-chemokine Receptor 5 (CCR5).

    PubMed

    Karlshøj, Stefanie; Amarandi, Roxana Maria; Larsen, Olav; Daugvilaite, Viktorija; Steen, Anne; Brvar, Matjaž; Pui, Aurel; Frimurer, Thomas Michael; Ulven, Trond; Rosenkilde, Mette Marie

    2016-12-23

    The small molecule metal ion chelators bipyridine and terpyridine complexed with Zn 2+ (ZnBip and ZnTerp) act as CCR5 agonists and strong positive allosteric modulators of CCL3 binding to CCR5, weak modulators of CCL4 binding, and competitors for CCL5 binding. Here we describe their binding site using computational modeling, binding, and functional studies on WT and mutated CCR5. The metal ion Zn 2+ is anchored to the chemokine receptor-conserved Glu-283 VII:06/7.39 Both chelators interact with aromatic residues in the transmembrane receptor domain. The additional pyridine ring of ZnTerp binds deeply in the major binding pocket and, in contrast to ZnBip, interacts directly with the Trp-248 VI:13/6.48 microswitch, contributing to its 8-fold higher potency. The impact of Trp-248 was further confirmed by ZnClTerp, a chloro-substituted version of ZnTerp that showed no inherent agonism but maintained positive allosteric modulation of CCL3 binding. Despite a similar overall binding mode of all three metal ion chelator complexes, the pyridine ring of ZnClTerp blocks the conformational switch of Trp-248 required for receptor activation, thereby explaining its lack of activity. Importantly, ZnClTerp becomes agonist to the same extent as ZnTerp upon Ala mutation of Ile-116 III:16/3.40 , a residue that constrains the Trp-248 microswitch in its inactive conformation. Binding studies with 125 I-CCL3 revealed an allosteric interface between the chemokine and the small molecule binding site, including residues Tyr-37 I:07/1.39 , Trp-86 II:20/2.60 , and Phe-109 III:09/3.33 The small molecules and CCL3 approach this interface from opposite directions, with some residues being mutually exploited. This study provides new insight into the molecular mechanism of CCR5 activation and paves the way for future allosteric drugs for chemokine receptors. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Energetics of dendrimer binding to HIV-1 gp120-CD4 complex and mechanismic aspects of its role as an entry-inhibitor

    NASA Astrophysics Data System (ADS)

    Saurabh, Suman; Sahoo, Anil Kumar; Maiti, Prabal K.

    2016-10-01

    Experiments and computational studies have established that de-protonated dendrimers (SPL7013 and PAMAM) act as entry-inhibitors of HIV. SPL7013 based Vivagel is currently under clinical development. The dendrimer binds to gp120 in the gp120-CD4 complex, destabilizes it by breaking key contacts between gp120 and CD4 and prevents viral entry into target cells. In this work, we provide molecular details and energetics of the formation of the SPL7013-gp120-CD4 ternary complex and decipher modes of action of the dendrimer in preventing viral entry. It is also known from experiments that the dendrimer binds weakly to gp120 that is not bound to CD4. It binds even more weakly to the CD4-binding region of gp120 and thus cannot directly block gp120-CD4 complexation. In this work, we examine the feasibility of dendrimer binding to the gp120-binding region of CD4 and directly blocking gp120-CD4 complex formation. We find that the process of the dendrimer binding to CD4 can compete with gp120-CD4 binding due to comparable free energy change for the two processes, thus creating a possibility for the dendrimer to directly block gp120-CD4 complexation by binding to the gp120-binding region of CD4.

  19. Structural basis of arrestin-3 activation and signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Qiuyan; Perry, Nicole A.; Vishnivetskiy, Sergey A.

    A unique aspect of arrestin-3 is its ability to support both receptor-dependent and receptor-independent signaling. Here, we show that inositol hexakisphosphate (IP6) is a non-receptor activator of arrestin-3 and report the structure of IP6-activated arrestin-3 at 2.4-Å resolution. IP6-activated arrestin-3 exhibits an inter-domain twist and a displaced C-tail, hallmarks of active arrestin. IP6 binds to the arrestin phosphate sensor, and is stabilized by trimerization. Analysis of the trimerization surface, which is also the receptor-binding surface, suggests a feature called the finger loop as a key region of the activation sensor. We show that finger loop helicity and flexibility may underliemore » coupling to hundreds of diverse receptors and also promote arrestin-3 activation by IP6. Importantly, we show that effector-binding sites on arrestins have distinct conformations in the basal and activated states, acting as switch regions. These switch regions may work with the inter-domain twist to initiate and direct arrestin-mediated signaling.« less

  20. MuSK IgG4 autoantibodies cause myasthenia gravis by inhibiting binding between MuSK and Lrp4

    PubMed Central

    Huijbers, Maartje G.; Zhang, Wei; Klooster, Rinse; Niks, Erik H.; Friese, Matthew B.; Straasheijm, Kirsten R.; Thijssen, Peter E.; Vrolijk, Hans; Plomp, Jaap J.; Vogels, Pauline; Losen, Mario; Van der Maarel, Silvère M.; Burden, Steven J.; Verschuuren, Jan J.

    2013-01-01

    Myasthenia gravis (MG) is a severely debilitating autoimmune disease that is due to a decrease in the efficiency of synaptic transmission at neuromuscular synapses. MG is caused by antibodies against postsynaptic proteins, including (i) acetylcholine receptors, the neurotransmitter receptor, (ii) muscle-specific kinase (MuSK), a receptor tyrosine kinase essential for the formation and maintenance of neuromuscular synapses, and (iii) low-density lipoprotein receptor-related protein 4 (Lrp4), which responds to neural Agrin by binding and stimulating MuSK. Passive transfer studies in mice have shown that IgG4 antibodies from MuSK MG patients cause disease without requiring complement or other immune components, suggesting that these MuSK antibodies cause disease by directly interfering with MuSK function. Here we show that pathogenic IgG4 antibodies to MuSK bind to a structural epitope in the first Ig-like domain of MuSK, prevent binding between MuSK and Lrp4, and inhibit Agrin-stimulated MuSK phosphorylation. In contrast, these IgG4 antibodies have no direct effect on MuSK dimerization or MuSK internalization. These results provide insight into the unique pathogenesis of MuSK MG and provide clues toward development of specific treatment options. PMID:24297891

  1. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  2. Distinct Involvement of the Gab1 and Grb2 Adaptor Proteins in Signal Transduction by the Related Receptor Tyrosine Kinases RON and MET

    PubMed Central

    Chaudhuri, Amitabha; Xie, Ming-Hong; Yang, Becky; Mahapatra, Kaushiki; Liu, Jinfeng; Marsters, Scot; Bodepudi, Sweta; Ashkenazi, Avi

    2011-01-01

    Although the signal transduction mechanisms of the receptor tyrosine kinase MET are well defined, less is known about its close relative RON. MET initiates intracellular signaling by autophosphorylation on specific cytoplasmic tyrosines that form docking sites for the adaptor proteins Grb2 and Gab1. Grb2 binds directly and is essential for all of the biological activities of MET. Gab1 docks either directly or indirectly via Grb2 and controls only a subset of MET functions. Because MET and RON possess similar adaptor binding sites, it was anticipated that their adaptor interactions would be conserved. Here we show that in contrast to MET, RON relies primarily on Gab1 for signal transmission. Surprisingly, disruption of the Grb2 docking site of RON or Grb2 depletion augments activity, whereas enhancement of Grb2 binding attenuates Gab1 recruitment and signaling. Hence, RON and MET differ in their adaptor interactions; furthermore, Grb2 performs a novel antagonistic role in the context of RON signaling. PMID:21784853

  3. Single-molecule conductance through multiple π-π-stacked benzene rings determined with direct electrode-to-benzene ring connections.

    PubMed

    Schneebeli, Severin T; Kamenetska, Maria; Cheng, Zhanling; Skouta, Rachid; Friesner, Richard A; Venkataraman, Latha; Breslow, Ronald

    2011-02-23

    Understanding electron transport across π-π-stacked systems will help to answer fundamental questions about biochemical redox processes and benefit the design of new materials and molecular devices. Herein we employed the STM break-junction technique to measure the single-molecule conductance of multiple π-π-stacked aromatic rings. We studied electron transport through up to four stacked benzene rings held together in an eclipsed fashion via a paracyclophane scaffold. We found that the strained hydrocarbons studied herein couple directly to gold electrodes during the measurements; hence, we did not require any heteroatom binding groups as electrical contacts. Density functional theory-based calculations suggest that the gold atoms of the electrodes bind to two neighboring carbon atoms of the outermost cyclophane benzene rings in η(2) fashion. Our measurements show an exponential decay of the conductance with an increasing number of stacked benzene rings, indicating a nonresonant tunneling mechanism. Furthermore, STM tip-substrate displacement data provide additional evidence that the electrodes bind to the outermost benzene rings of the π-π-stacked molecular wires.

  4. Homocysteine directly interacts and activates the angiotensin II type I receptor to aggravate vascular injury.

    PubMed

    Li, Tuoyi; Yu, Bing; Liu, Zhixin; Li, Jingyuan; Ma, Mingliang; Wang, Yingbao; Zhu, Mingjiang; Yin, Huiyong; Wang, Xiaofeng; Fu, Yi; Yu, Fang; Wang, Xian; Fang, Xiaohong; Sun, Jinpeng; Kong, Wei

    2018-01-02

    Hyperhomocysteinemia (HHcy) is a risk factor for various cardiovascular diseases. However, the mechanism underlying HHcy-aggravated vascular injury remains unclear. Here we show that the aggravation of abdominal aortic aneurysm by HHcy is abolished in mice with genetic deletion of the angiotensin II type 1 (AT1) receptor and in mice treated with an AT1 blocker. We find that homocysteine directly activates AT1 receptor signalling. Homocysteine displaces angiotensin II and limits its binding to AT1 receptor. Bioluminescence resonance energy transfer analysis reveals distinct conformational changes of AT1 receptor upon binding to angiotensin II and homocysteine. Molecular dynamics and site-directed mutagenesis experiments suggest that homocysteine regulates the conformation of the AT1 receptor both orthosterically and allosterically by forming a salt bridge and a disulfide bond with its Arg 167 and Cys 289 residues, respectively. Together, these findings suggest that strategies aimed at blocking the AT1 receptor may mitigate HHcy-associated aneurysmal vascular injuries.

  5. PHD domain-mediated E3 ligase activity directs intramolecular sumoylation of an adjacent bromodomain required for gene silencing.

    PubMed

    Ivanov, Alexey V; Peng, Hongzhuang; Yurchenko, Vyacheslav; Yap, Kyoko L; Negorev, Dmitri G; Schultz, David C; Psulkowski, Elyse; Fredericks, William J; White, David E; Maul, Gerd G; Sadofsky, Moshe J; Zhou, Ming-Ming; Rauscher, Frank J

    2007-12-14

    Tandem PHD and bromodomains are often found in chromatin-associated proteins and have been shown to cooperate in gene silencing. Each domain can bind specifically modified histones: the mechanisms of cooperation between these domains are unknown. We show that the PHD domain of the KAP1 corepressor functions as an intramolecular E3 ligase for sumoylation of the adjacent bromodomain. The RING finger-like structure of the PHD domain is required for both Ubc9 binding and sumoylation and directs modification to specific lysine residues in the bromodomain. Sumoylation is required for KAP1-mediated gene silencing and functions by directly recruiting the SETDB1 histone methyltransferase and the CHD3/Mi2 component of the NuRD complex via SUMO-interacting motifs. Sumoylated KAP1 stimulates the histone methyltransferase activity of SETDB1. These data provide a mechanistic explanation for the cooperation of PHD and bromodomains in gene regulation and describe a function of the PHD domain as an intramolecular E3 SUMO ligase.

  6. Drosophila COP9 signalosome subunit 7 interacts with multiple genomic loci to regulate development.

    PubMed

    Singer, Ruth; Atar, Shimshi; Atias, Osnat; Oron, Efrat; Segal, Daniel; Hirsch, Joel A; Tuller, Tamir; Orian, Amir; Chamovitz, Daniel A

    2014-09-01

    The COP9 signalosome protein complex has a central role in the regulation of development of multicellular organisms. While the function of this complex in ubiquitin-mediated protein degradation is well established, results over the past few years have hinted that the COP9 signalosome may function more broadly in the regulation of gene expression. Here, using DamID technology, we show that COP9 signalosome subunit 7 functionally associates with a large number of genomic loci in the Drosophila genome, and show that the expression of many genes within these loci is COP9 signalosome-dependent. This association is likely direct as we show CSN7 binds DNA in vitro. The genes targeted by CSN7 are preferentially enriched for transcriptionally active regions of the genome, and are involved in the regulation of distinct gene ontology groupings including imaginal disc development and cell-cycle control. In accord, loss of CSN7 function leads to cell-cycle delay and altered wing development. These results indicate that CSN7, and by extension the entire COP9 signalosome, functions directly in transcriptional control. While the COP9 signalosome protein complex has long been known to regulate protein degradation, here we expand the role of this complex by showing that subunit 7 binds DNA in vitro and functions directly in vivo in transcriptional control of developmentally important pathways that are relevant for human health. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Novel Molecular Interactions and Biological Functions of the Neurofibromatosis 2 Tumor Suppressor Protein, Merlin

    DTIC Science & Technology

    2008-08-01

    their microtu- bules re-grown. In addition, the add-back cells had regained their spindle-like shape (Fig. 6C, D; 240 min). This implies that the normal...We show that merlin directly binds tubulin and regulates microtu- bule dynamics in vitro and in vivo. Our results show that merlin contains two...also APC and VHL show only limited colocalization with microtu- bules , but yet affect their dynamics in vivo (35,36). Here, we show that also merlin

  8. Distinct functional domains in nesprin-1{alpha} and nesprin-2{beta} bind directly to emerin and both interactions are disrupted in X-linked Emery-Dreifuss muscular dystrophy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wheeler, Matthew A.; Davies, John D.; Zhang Qiuping

    2007-08-01

    Emerin and specific isoforms of nesprin-1 and -2 are nuclear membrane proteins which are binding partners in multi-protein complexes spanning the nuclear envelope. We report here the characterisation of the residues both in emerin and in nesprin-1{alpha} and -2{beta} which are involved in their interaction and show that emerin requires nesprin-1 or -2 to retain it at the nuclear membrane. Using several protein-protein interaction methods, we show that residues 368 to 627 of nesprin-1{alpha} and residues 126 to 219 of nesprin-2{beta}, which show high homology to one another, both mediate binding to emerin residues 140-176. This region has previously beenmore » implicated in binding to F-actin, {beta}-catenin and lamin A/C suggesting that it is critical for emerin function. Confirmation that these protein domains interact in vivo was shown using GFP-dominant negative assays. Exogenous expression of either of these nesprin fragments in mouse myoblast C2C12 cells displaced endogenous emerin from the nuclear envelope and reduced the targeting of newly synthesised emerin. Furthermore, we are the first to report that emerin mutations which give rise to X-linked Emery-Dreifuss muscular dystrophy, disrupt binding to both nesprin-1{alpha} and -2{beta} isoforms, further indicating a role of nesprins in the pathology of Emery-Dreifuss muscular dystrophy.« less

  9. c-Fos downregulation positively regulates EphA5 expression in a congenital hypothyroidism rat model.

    PubMed

    Song, Honghua; Zheng, Yuqin; Cai, Fuying; Ma, Yanyan; Yang, Jingyue; Wu, Youjia

    2018-04-01

    The EphA5 receptor is well established as an axon guidance molecule during neural system development and plays an important role in dendritic spine formation and synaptogenesis. Our previous study has showed that EphA5 is decreased in the developing brain of congenital hypothyroidism (CH) and the EphA5 promoter methylation modification participates in its decrease. c-Fos, a well-kown transcription factor, has been considered in association with brain development. Bioinformatics analysis showed that the EphA5 promoter region contained five putative c-fos binding sites. The chromatin immunoprecipitation (ChIP) assays were used to assess the direct binding of c-fos to the EphA5 promoter. Furthermore, dual-luciferase assays showed that these three c-fos protein binding sites were positive regulatory elements for EphA5 expression in PC12 cells. Moreover, We verified c-fos positively regulation for EphA5 expression in CH model. Q-PCR and Western blot showed that c-fos overexpression could upregulate EphA5 expression in hippocampal neurons of rats with CH. Our results suggest that c-fos positively regulates EphA5 expression in CH rat model.

  10. A Small Molecule Inhibits Virion Attachment to Heparan Sulfate- or Sialic Acid-Containing Glycans

    PubMed Central

    Colpitts, Che C.

    2014-01-01

    ABSTRACT Primary attachment to cellular glycans is a critical entry step for most human viruses. Some viruses, such as herpes simplex virus type 1 (HSV-1) and hepatitis C virus (HCV), bind to heparan sulfate, whereas others, such as influenza A virus (IAV), bind to sialic acid. Receptor mimetics that interfere with these interactions are active against viruses that bind to either heparan sulfate or to sialic acid. However, no molecule that inhibits the attachment of viruses in both groups has yet been identified. Epigallocatechin gallate (EGCG), a green tea catechin, is active against many unrelated viruses, including several that bind to heparan sulfate or to sialic acid. We sought to identify the basis for the broad-spectrum activity of EGCG. Here, we show that EGCG inhibits the infectivity of a diverse group of enveloped and nonenveloped human viruses. EGCG acts directly on the virions, without affecting the fluidity or integrity of the virion envelopes. Instead, EGCG interacts with virion surface proteins to inhibit the attachment of HSV-1, HCV, IAV, vaccinia virus, adenovirus, reovirus, and vesicular stomatitis virus (VSV) virions. We further show that EGCG competes with heparan sulfate for binding of HSV-1 and HCV virions and with sialic acid for binding of IAV virions. Therefore, EGCG inhibits unrelated viruses by a common mechanism. Most importantly, we have identified EGCG as the first broad-spectrum attachment inhibitor. Our results open the possibility for the development of small molecule broad-spectrum antivirals targeting virion attachment. IMPORTANCE This study shows that it is possible to develop a small molecule antiviral or microbicide active against the two largest groups of human viruses: those that bind to glycosaminoglycans and those that bind to sialoglycans. This group includes the vast majority of human viruses, including herpes simplex viruses, cytomegalovirus, influenza virus, poxvirus, hepatitis C virus, HIV, and many others. PMID:24789779

  11. Differing susceptibility to autophagic degradation of two LC3-binding proteins: SQSTM1/p62 and TBC1D25/OATL1.

    PubMed

    Hirano, Satoshi; Uemura, Takefumi; Annoh, Hiromichi; Fujita, Naonobu; Waguri, Satoshi; Itoh, Takashi; Fukuda, Mitsunori

    2016-01-01

    MAP1LC3/LC3 (a mammalian ortholog family of yeast Atg8) is a ubiquitin-like protein that is essential for autophagosome formation. LC3 is conjugated to phosphatidylethanolamine on phagophores and ends up distributed both inside and outside the autophagosome membrane. One of the well-known functions of LC3 is as a binding partner for receptor proteins, which target polyubiquitinated organelles and proteins to the phagophore through direct interaction with LC3 in selective autophagy, and their LC3-binding ability is essential for degradation of the polyubiquitinated substances. Although a number of LC3-binding proteins have been identified, it is unknown whether they are substrates of autophagy or how their interaction with LC3 is regulated. We previously showed that one LC3-binding protein, TBC1D25/OATL1, plays an inhibitory role in the maturation step of autophagosomes and that this function depends on its binding to LC3. Interestingly, TBC1D25 seems not to be a substrate of autophagy, despite being present on the phagophore. In this study we investigated the molecular basis for the escape of TBC1D25 from autophagic degradation by performing a chimeric analysis between TBC1D25 and SQSTM1/p62 (sequestosome 1), and the results showed that mutant TBC1D25 with an intact LC3-binding site can become an autophagic substrate when TBC1D25 is forcibly oligomerized. In addition, an ultrastructural analysis showed that TBC1D25 is mainly localized outside autophagosomes, whereas an oligomerized TBC1D25 mutant rather uniformly resides both inside and outside the autophagosomes. Our findings indicate that oligomerization is a key factor in the degradation of LC3-binding proteins and suggest that lack of oligomerization ability of TBC1D25 results in its asymmetric localization at the outer autophagosome membrane.

  12. Binding Isotherms and Time Courses Readily from Magnetic Resonance.

    PubMed

    Xu, Jia; Van Doren, Steven R

    2016-08-16

    Evidence is presented that binding isotherms, simple or biphasic, can be extracted directly from noninterpreted, complex 2D NMR spectra using principal component analysis (PCA) to reveal the largest trend(s) across the series. This approach renders peak picking unnecessary for tracking population changes. In 1:1 binding, the first principal component captures the binding isotherm from NMR-detected titrations in fast, slow, and even intermediate and mixed exchange regimes, as illustrated for phospholigand associations with proteins. Although the sigmoidal shifts and line broadening of intermediate exchange distorts binding isotherms constructed conventionally, applying PCA directly to these spectra along with Pareto scaling overcomes the distortion. Applying PCA to time-domain NMR data also yields binding isotherms from titrations in fast or slow exchange. The algorithm readily extracts from magnetic resonance imaging movie time courses such as breathing and heart rate in chest imaging. Similarly, two-step binding processes detected by NMR are easily captured by principal components 1 and 2. PCA obviates the customary focus on specific peaks or regions of images. Applying it directly to a series of complex data will easily delineate binding isotherms, equilibrium shifts, and time courses of reactions or fluctuations.

  13. Structural Insights into the Role of the Cyclic Backbone in a Squash Trypsin Inhibitor*

    PubMed Central

    Daly, Norelle L.; Thorstholm, Louise; Greenwood, Kathryn P.; King, Gordon J.; Rosengren, K. Johan; Heras, Begoña; Martin, Jennifer L.; Craik, David J.

    2013-01-01

    MCoTI-II is a head-to-tail cyclic peptide with potent trypsin inhibitory activity and, on the basis of its exceptional proteolytic stability, is a valuable template for the design of novel drug leads. Insights into inhibitor dynamics and interactions with biological targets are critical for drug design studies, particularly for protease targets. Here, we show that the cyclization and active site loops of MCoTI-II are flexible in solution, but when bound to trypsin, the active site loop converges to a single well defined conformation. This finding of reduced flexibility on binding is in contrast to a recent study on the homologous peptide MCoTI-I, which suggested that regions of the peptide are more flexible upon binding to trypsin. We provide a possible explanation for this discrepancy based on degradation of the complex over time. Our study also unexpectedly shows that the cyclization loop, not present in acyclic homologues, facilitates potent trypsin inhibitory activity by engaging in direct binding interactions with trypsin. PMID:24169696

  14. A highly Conserved Aspartic Acid Residue of the Chitosanase from Bacillus Sp. TS Is Involved in the Substrate Binding.

    PubMed

    Zhou, Zhanping; Zhao, Shuangzhi; Liu, Yang; Chang, Zhengying; Ma, Yanhe; Li, Jian; Song, Jiangning

    2016-11-01

    The chitosanase from Bacillus sp. TS (CsnTS) is an enzyme belonging to the glycoside hydrolase family 8. The sequence of CsnTS shares 98 % identity with the chitosanase from Bacillus sp. K17. Crystallography analysis and site-direct mutagenesis of the chitosanase from Bacillus sp. K17 identified the important residues involved in the catalytic interaction and substrate binding. However, despite progress in understanding the catalytic mechanism of the chitosanase from the family GH8, the functional roles of some residues that are highly conserved throughout this family have not been fully elucidated. This study focused on one of these residues, i.e., the aspartic acid residue at position 318. We found that apart from asparagine, mutation of Asp318 resulted in significant loss of enzyme activity. In-depth investigations showed that mutation of this residue not only impaired enzymatic activity but also affected substrate binding. Taken together, our results showed that Asp318 plays an important role in CsnTS activity.

  15. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  16. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  17. Photoinduced Bandgap Renormalization and Exciton Binding Energy Reduction in WS2.

    PubMed

    Cunningham, Paul D; Hanbicki, Aubrey T; McCreary, Kathleen M; Jonker, Berend T

    2017-12-26

    Strong Coulomb attraction in monolayer transition metal dichalcogenides gives rise to tightly bound excitons and many-body interactions that dominate their optoelectronic properties. However, this Coulomb interaction can be screened through control of the surrounding dielectric environment as well as through applied voltage, which provides a potential means of tuning the bandgap, exciton binding energy, and emission wavelength. Here, we directly show that the bandgap and exciton binding energy can be optically tuned by means of the intensity of the incident light. Using transient absorption spectroscopy, we identify a sub-picosecond decay component in the excited-state dynamics of WS 2 that emerges for incident photon energies above the A-exciton resonance, which originates from a nonequilibrium population of charge carriers that form excitons as they cool. The generation of this charge-carrier population exhibits two distinct energy thresholds. The higher threshold is coincident with the onset of continuum states and therefore provides a direct optical means of determining both the bandgap and exciton binding energy. Using this technique, we observe a reduction in the exciton binding energy from 310 ± 30 to 220 ± 20 meV as the excitation density is increased from 3 × 10 11 to 1.2 × 10 12 photons/cm 2 . This reduction is due to dynamic dipolar screening of Coulomb interactions by excitons, which is the underlying physical process that initiates bandgap renormalization and leads to the insulator-metal transition in monolayer transition metal dichalcogenides.

  18. Vitamin D binding protein-macrophage activating factor directly inhibits proliferation, migration, and uPAR expression of prostate cancer cells.

    PubMed

    Gregory, Kalvin J; Zhao, Bing; Bielenberg, Diane R; Dridi, Sami; Wu, Jason; Jiang, Weihua; Huang, Bin; Pirie-Shepherd, Steven; Fannon, Michael

    2010-10-18

    Vitamin D binding protein-macrophage activating factor (DBP-maf) is a potent inhibitor of tumor growth. Its activity, however, has been attributed to indirect mechanisms such as boosting the immune response by activating macrophages and inhibiting the blood vessel growth necessary for the growth of tumors. In this study we show for the first time that DBP-maf exhibits a direct and potent effect on prostate tumor cells in the absence of macrophages. DBP-maf demonstrated inhibitory activity in proliferation studies of both LNCaP and PC3 prostate cancer cell lines as well as metastatic clones of these cells. Flow cytometry studies with annexin V and propidium iodide showed that this inhibitory activity is not due to apoptosis or cell death. DBP-maf also had the ability to inhibit migration of prostate cancer cells in vitro. Finally, DBP-maf was shown to cause a reduction in urokinase plasminogen activator receptor (uPAR) expression in prostate tumor cells. There is evidence that activation of this receptor correlates with tumor metastasis. These studies show strong inhibitory activity of DBP-maf on prostate tumor cells independent of its macrophage activation.

  19. Vitamin D Binding Protein-Macrophage Activating Factor Directly Inhibits Proliferation, Migration, and uPAR Expression of Prostate Cancer Cells

    PubMed Central

    Bielenberg, Diane R.; Dridi, Sami; Wu, Jason; Jiang, Weihua; Huang, Bin; Pirie-Shepherd, Steven; Fannon, Michael

    2010-01-01

    Background Vitamin D binding protein-macrophage activating factor (DBP-maf) is a potent inhibitor of tumor growth. Its activity, however, has been attributed to indirect mechanisms such as boosting the immune response by activating macrophages and inhibiting the blood vessel growth necessary for the growth of tumors. Methods and Findings In this study we show for the first time that DBP-maf exhibits a direct and potent effect on prostate tumor cells in the absence of macrophages. DBP-maf demonstrated inhibitory activity in proliferation studies of both LNCaP and PC3 prostate cancer cell lines as well as metastatic clones of these cells. Flow cytometry studies with annexin V and propidium iodide showed that this inhibitory activity is not due to apoptosis or cell death. DBP-maf also had the ability to inhibit migration of prostate cancer cells in vitro. Finally, DBP-maf was shown to cause a reduction in urokinase plasminogen activator receptor (uPAR) expression in prostate tumor cells. There is evidence that activation of this receptor correlates with tumor metastasis. Conclusions These studies show strong inhibitory activity of DBP-maf on prostate tumor cells independent of its macrophage activation. PMID:20976141

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lyn, Rodney K.; Department of Chemistry, University of Ottawa, Ottawa; Kennedy, David C.

    Research highlights: {yields} Hepatitis C virus uses lipid droplets (LD) onto which HCV core proteins bind. {yields} HCV core proteins on LDs facilitate viral particle assembly. {yields} We used a novel combination of CARS, two-photon fluorescence, and DIC microscopies. {yields} Particle tracking experiments show that core slowly affects LD localization. {yields} Particle tracking measured the change in speed and directionality of LD movement. -- Abstract: The hepatitis C virus (HCV) is a global health problem, with limited treatment options and no vaccine available. HCV uses components of the host cell to proliferate, including lipid droplets (LD) onto which HCV coremore » proteins bind and facilitate viral particle assembly. We have measured the dynamics of HCV core protein-mediated changes in LDs and rates of LD movement on microtubules using a combination of coherent anti-Stokes Raman scattering (CARS), two-photon fluorescence (TPF), and differential interference contrast (DIC) microscopies. Results show that the HCV core protein induces rapid increases in LD size. Particle tracking experiments show that HCV core protein slowly affects LD localization by controlling the directionality of LD movement on microtubules. These dynamic processes ultimately aid HCV in propagating and the molecules and interactions involved represent novel targets for potential therapeutic intervention.« less

  1. Paxillin associates with poly(A)-binding protein 1 at the dense endoplasmic reticulum and the leading edge of migrating cells.

    PubMed

    Woods, Alison J; Roberts, Marnie S; Choudhary, Jyoti; Barry, Simon T; Mazaki, Yuichi; Sabe, Hisataka; Morley, Simon J; Critchley, David R; Norman, Jim C

    2002-02-22

    Using mass spectrometry we have identified proteins which co-immunoprecipitate with paxillin, an adaptor protein implicated in the integrin-mediated signaling pathways of cell motility. A major component of paxillin immunoprecipitates was poly(A)-binding protein 1, a 70-kDa mRNA-binding protein. Poly(A)-binding protein 1 associated with both the alpha and beta isoforms of paxillin, and this was unaffected by RNase treatment consistent with a protein-protein interaction. The NH(2)-terminal region of paxillin (residues 54-313) associated directly with poly(A)-binding protein 1 in cell lysates, and with His-poly(A)-binding protein 1 immobilized in microtiter wells. Binding was specific, saturable and of high affinity (K(d) of approximately 10 nm). Cell fractionation studies showed that at steady state, the bulk of paxillin and poly(A)-binding protein 1 was present in the "dense" polyribosome-associated endoplasmic reticulum. However, inhibition of nuclear export with leptomycin B caused paxillin and poly(A)-binding protein 1 to accumulate in the nucleus, indicating that they shuttle between the nuclear and cytoplasmic compartments. When cells migrate, poly(A)-binding protein 1 colocalized with paxillin-beta at the tips of lamellipodia. Our results suggest a new mechanism whereby a paxillin x poly(A)-binding protein 1 complex facilitates transport of mRNA from the nucleus to sites of protein synthesis at the endoplasmic reticulum and the leading lamella during cell migration.

  2. Interaction of ligands with the opiate receptors of brain membranes: Regulation by ions and nucleotides

    PubMed Central

    Blume, Arthur J.

    1978-01-01

    This study shows that nucleotides, as well as ions, regulate the opiate receptors of brain. GMP-P(NH)P and Na+ reduce the amount of steady-state specific [3H]dihydromorphine binding and increase the rate of dissociation of the ligand from the opiate receptor. In contrast, Mn2+ decreases the rate of ligand dissociation and antagonizes the ability of Na+ to increase dissociation. The effects of GMP-P(NH)P on steady-state binding and dissociation are not reversed by washing. Only GTP, GDP, ITP, and IMP-P(NH)P, in addition to GMP-P(NH)P, increase the rate of dihydromorphine dissociation. The site of nucleotide action appears to have high affinity: <1 μM GMP-P(NH)P produces half-maximal increases in ligand dissociation. GMP-P(NH)P- and Na+-directed increases in dissociation have also been found for the opiate agonists [3H]etorphine, [3H]Leu-enkephalin, and [3H]Met-enkephalin and the opiate antagonist [3H]naltrexone. Mn2+-directed decreases in dissociation have been found for the agonist [3H]-etorphine and the antagonist [3H]naltrexone. Although the plasma membrane receptors for a number of other neuro-transmitters and hormones are also regulated by guanine nucleotides, the opiate receptors appear unique because only they show nucleotide regulation of both agonist and antagonist binding. PMID:205867

  3. Peroxynitrite modified DNA presents better epitopes for anti-DNA autoantibodies in diabetes type 1 patients.

    PubMed

    Tripathi, Prashant; Moinuddin; Dixit, Kiran; Mir, Abdul Rouf; Habib, Safia; Alam, Khursheed; Ali, Asif

    2014-07-01

    Peroxynitrite (ONOO(-)), formed by the reaction between nitric oxide (NO) and superoxide (O2(-)), has been implicated in the etiology of numerous disease processes. Peroxynitrite interacts with DNA via direct oxidative reactions or via indirect radical-mediated mechanism. It can inflict both oxidative and nitrosative damages on DNA bases, generating abasic sites, resulting in the single strand breaks. Plasmid pUC 18 isolated from Escherichiacoli was modified with peroxynitrite, generated by quenched flow process. Modifications incurred in plasmid DNA were characterized by ultraviolet and fluorescence spectroscopy, circular dichroism, HPLC and melting temperature studies. Binding characteristics and specificity of antibodies from diabetes patients were analyzed by direct binding and inhibition ELISA. Peroxynitrite modification of pUC 18 plasmid resulted in the formation of strand breaks and base modification. The major compound formed when peroxynitrite reacted with DNA was 8-nitroguanine, a specific marker for peroxynitrite induced DNA damage in inflamed tissues. The concentration of 8-nitroguanine was found to be 3.8 μM. Sera from diabetes type 1 patients from different age groups were studied for their binding to native and peroxynitrite modified plasmid. Direct binding and competitive-inhibition ELISA results showed higher recognition of peroxynitrite modified plasmid, as compared to the native form, by auto-antibodies present in diabetes patients. The preferential recognition of modified plasmid by diabetes autoantibodies was further reiterated by gel shift assay. Experimentally induced anti-peroxynitrite-modified plasmid IgG was used as a probe to detect nitrosative lesions in the DNA isolated from diabetes patients. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Methionine-141 directly influences the binding of 4-methylpyrazole in human sigma sigma alcohol dehydrogenase.

    PubMed Central

    Xie, P. T.; Hurley, T. D.

    1999-01-01

    Pyrazole and its 4-alkyl substituted derivatives are potent inhibitors for many alcohol dehydrogenases. However, the human sigma sigma isoenzyme exhibits a 580-fold lower affinity for 4-methylpyrazole than does the human beta1beta1 isoenzyme, with which it shares 69% sequence identity. In this study, structural and kinetic studies were utilized in an effort to identify key structural features that affect the binding of 4-methylpyrazole in human alcohol dehydrogenase isoenzymes. We have extended the resolution of the human sigma sigma alcohol dehydrogenase (ADH) isoenzyme to 2.5 A resolution. Comparison of this structure to the human beta1beta1 isoenzyme structure indicated that the side-chain position for Met141 in sigma sigma ADH might interfere with 4-methylpyrazole binding. Mutation of Met141 in sigma sigma ADH to Leu (sigma141L) lowers the Ki for 4-methylpyrazole from 350 to 10 microM, while having a much smaller effect on the Ki for pyrazole. Thus, the mutagenesis results show that the residue at position 141, which lines the substrate-binding pocket at a position close to the methyl group of 4-methylpyrazole, directly affects the binding of the inhibitor. To rule out nonspecific structural changes due to the mutation, the X-ray structure of the sigma141L mutant enzyme was determined to 2.4 A resolution. The three-dimensional structure of the mutant enzyme is identical to the wild-type enzyme, with the exception of the residue at position 141. Thus, the differences in 4-methylpyrazole binding between the mutant and wild-type sigma sigma ADH isoenzymes can be completely ascribed to the local changes in the topology of the substrate binding site, and provides an explanation for the class-specific differences in 4-methylpyrazole binding to the human ADH isoenzymes. PMID:10631979

  5. Subfamily-specific adaptations in the structures of two penicillin-binding proteins from Mycobacterium tuberculosis

    DOE PAGES

    Prigozhin, Daniil M.; Krieger, Inna V.; Huizar, John P.; ...

    2014-12-31

    Beta-lactam antibiotics target penicillin-binding proteins including several enzyme classes essential for bacterial cell-wall homeostasis. To better understand the functional and inhibitor-binding specificities of penicillin-binding proteins from the pathogen, Mycobacterium tuberculosis, we carried out structural and phylogenetic analysis of two predicted D,D-carboxypeptidases, Rv2911 and Rv3330. Optimization of Rv2911 for crystallization using directed evolution and the GFP folding reporter method yielded a soluble quadruple mutant. Structures of optimized Rv2911 bound to phenylmethylsulfonyl fluoride and Rv3330 bound to meropenem show that, in contrast to the nonspecific inhibitor, meropenem forms an extended interaction with the enzyme along a conserved surface. Phylogenetic analysis shows thatmore » Rv2911 and Rv3330 belong to different clades that emerged in Actinobacteria and are not represented in model organisms such as Escherichia coli and Bacillus subtilis. Clade-specific adaptations allow these enzymes to fulfill distinct physiological roles despite strict conservation of core catalytic residues. The characteristic differences include potential protein-protein interaction surfaces and specificity-determining residues surrounding the catalytic site. Overall, these structural insights lay the groundwork to develop improved beta-lactam therapeutics for tuberculosis.« less

  6. Subfamily-specific adaptations in the structures of two penicillin-binding proteins from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prigozhin, Daniil M.; Krieger, Inna V.; Huizar, John P.

    Beta-lactam antibiotics target penicillin-binding proteins including several enzyme classes essential for bacterial cell-wall homeostasis. To better understand the functional and inhibitor-binding specificities of penicillin-binding proteins from the pathogen, Mycobacterium tuberculosis, we carried out structural and phylogenetic analysis of two predicted D,D-carboxypeptidases, Rv2911 and Rv3330. Optimization of Rv2911 for crystallization using directed evolution and the GFP folding reporter method yielded a soluble quadruple mutant. Structures of optimized Rv2911 bound to phenylmethylsulfonyl fluoride and Rv3330 bound to meropenem show that, in contrast to the nonspecific inhibitor, meropenem forms an extended interaction with the enzyme along a conserved surface. Phylogenetic analysis shows thatmore » Rv2911 and Rv3330 belong to different clades that emerged in Actinobacteria and are not represented in model organisms such as Escherichia coli and Bacillus subtilis. Clade-specific adaptations allow these enzymes to fulfill distinct physiological roles despite strict conservation of core catalytic residues. The characteristic differences include potential protein-protein interaction surfaces and specificity-determining residues surrounding the catalytic site. Overall, these structural insights lay the groundwork to develop improved beta-lactam therapeutics for tuberculosis.« less

  7. Biophysical Characterization of Nucleophosmin Interactions with Human Immunodeficiency Virus Rev and Herpes Simplex Virus US11

    PubMed Central

    Nouri, Kazem; Moll, Jens M.; Milroy, Lech-Gustav; Hain, Anika; Dvorsky, Radovan; Amin, Ehsan; Lenders, Michael; Nagel-Steger, Luitgard; Howe, Sebastian; Smits, Sander H. J.; Hengel, Hartmut; Schmitt, Lutz; Münk, Carsten; Brunsveld, Luc; Ahmadian, Mohammad R.

    2015-01-01

    Nucleophosmin (NPM1, also known as B23, numatrin or NO38) is a pentameric RNA-binding protein with RNA and protein chaperon functions. NPM1 has increasingly emerged as a potential cellular factor that directly associates with viral proteins; however, the significance of these interactions in each case is still not clear. In this study, we have investigated the physical interaction of NPM1 with both human immunodeficiency virus type 1 (HIV-1) Rev and Herpes Simplex virus type 1 (HSV-1) US11, two functionally homologous proteins. Both viral proteins show, in mechanistically different modes, high affinity for a binding site on the N-terminal oligomerization domain of NPM1. Rev, additionally, exhibits low-affinity for the central histone-binding domain of NPM1. We also showed that the proapoptotic cyclic peptide CIGB-300 specifically binds to NPM1 oligomerization domain and blocks its association with Rev and US11. Moreover, HIV-1 virus production was significantly reduced in the cells treated with CIGB-300. Results of this study suggest that targeting NPM1 may represent a useful approach for antiviral intervention. PMID:26624888

  8. Modulating supramolecular binding of carbon dioxide in a redox-active porous metal-organic framework

    PubMed Central

    Lu, Zhenzhong; Godfrey, Harry G. W.; da Silva, Ivan; Cheng, Yongqiang; Savage, Mathew; Tuna, Floriana; McInnes, Eric J. L.; Teat, Simon J.; Gagnon, Kevin J.; Frogley, Mark D.; Manuel, Pascal; Rudić, Svemir; Ramirez-Cuesta, Anibal J.; Easun, Timothy L.; Yang, Sihai; Schröder, Martin

    2017-01-01

    Hydrogen bonds dominate many chemical and biological processes, and chemical modification enables control and modulation of host–guest systems. Here we report a targeted modification of hydrogen bonding and its effect on guest binding in redox-active materials. MFM-300(VIII) {[VIII2(OH)2(L)], LH4=biphenyl-3,3′,5,5′-tetracarboxylic acid} can be oxidized to isostructural MFM-300(VIV), [VIV2O2(L)], in which deprotonation of the bridging hydroxyl groups occurs. MFM-300(VIII) shows the second highest CO2 uptake capacity in metal-organic framework materials at 298 K and 1 bar (6.0 mmol g−1) and involves hydrogen bonding between the OH group of the host and the O-donor of CO2, which binds in an end-on manner, =1.863(1) Å. In contrast, CO2-loaded MFM-300(VIV) shows CO2 bound side-on to the oxy group and sandwiched between two phenyl groups involving a unique ···c.g.phenyl interaction [3.069(2), 3.146(3) Å]. The macroscopic packing of CO2 in the pores is directly influenced by these primary binding sites. PMID:28194014

  9. The actinobacterial transcription factor RbpA binds to the principal sigma subunit of RNA polymerase

    PubMed Central

    Tabib-Salazar, Aline; Liu, Bing; Doughty, Philip; Lewis, Richard A.; Ghosh, Somadri; Parsy, Marie-Laure; Simpson, Peter J.; O’Dwyer, Kathleen; Matthews, Steve J.; Paget, Mark S.

    2013-01-01

    RbpA is a small non–DNA-binding transcription factor that associates with RNA polymerase holoenzyme and stimulates transcription in actinobacteria, including Streptomyces coelicolor and Mycobacterium tuberculosis. RbpA seems to show specificity for the vegetative form of RNA polymerase as opposed to alternative forms of the enzyme. Here, we explain the basis of this specificity by showing that RbpA binds directly to the principal σ subunit in these organisms, but not to more diverged alternative σ factors. Nuclear magnetic resonance spectroscopy revealed that, although differing in their requirement for structural zinc, the RbpA orthologues from S. coelicolor and M. tuberculosis share a common structural core domain, with extensive, apparently disordered, N- and C-terminal regions. The RbpA–σ interaction is mediated by the C-terminal region of RbpA and σ domain 2, and S. coelicolor RbpA mutants that are defective in binding σ are unable to stimulate transcription in vitro and are inactive in vivo. Given that RbpA is essential in M. tuberculosis and critical for growth in S. coelicolor, these data support a model in which RbpA plays a key role in the σ cycle in actinobacteria. PMID:23605043

  10. Rapid Bedside Inactivation of Ebola Virus for Safe Nucleic Acid Tests.

    PubMed

    Rosenstierne, Maiken Worsøe; Karlberg, Helen; Bragstad, Karoline; Lindegren, Gunnel; Stoltz, Malin Lundahl; Salata, Cristiano; Kran, Anne-Marte Bakken; Dudman, Susanne Gjeruldsen; Mirazimi, Ali; Fomsgaard, Anders

    2016-10-01

    Rapid bedside inactivation of Ebola virus would be a solution for the safety of medical and technical staff, risk containment, sample transport, and high-throughput or rapid diagnostic testing during an outbreak. We show that the commercially available Magna Pure lysis/binding buffer used for nucleic acid extraction inactivates Ebola virus. A rapid bedside inactivation method for nucleic acid tests is obtained by simply adding Magna Pure lysis/binding buffer directly into vacuum blood collection EDTA tubes using a thin needle and syringe prior to sampling. The ready-to-use inactivation vacuum tubes are stable for more than 4 months, and Ebola virus RNA is preserved in the Magna Pure lysis/binding buffer for at least 5 weeks independent of the storage temperature. We also show that Ebola virus RNA can be manually extracted from Magna Pure lysis/binding buffer-inactivated samples using the QIAamp viral RNA minikit. We present an easy and convenient method for bedside inactivation using available blood collection vacuum tubes and reagents. We propose to use this simple method for fast, safe, and easy bedside inactivation of Ebola virus for safe transport and routine nucleic acid detection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. Amino Groups of Chitosan Are Crucial for Binding to a Family 32 Carbohydrate Binding Module of a Chitosanase from Paenibacillus elgii*

    PubMed Central

    Das, Subha Narayan; Wagenknecht, Martin; Nareddy, Pavan Kumar; Bhuvanachandra, Bhoopal; Niddana, Ramana; Balamurugan, Rengarajan; Swamy, Musti J.; Moerschbacher, Bruno M.; Podile, Appa Rao

    2016-01-01

    We report here the role and mechanism of specificity of a family 32 carbohydrate binding module (CBM32) of a glycoside hydrolase family 8 chitosanase from Paenibacillus elgii (PeCsn). Both the activity and mode of action of PeCsn toward soluble chitosan polymers were not different with/without the CBM32 domain of P. elgii (PeCBM32). The decreased activity of PeCsn without PeCBM32 on chitosan powder suggested that PeCBM32 increases the relative concentration of enzyme on the substrate and thereby enhanced enzymatic activity. PeCBM32 specifically bound to polymeric and oligomeric chitosan and showed very weak binding to chitin and cellulose. In isothermal titration calorimetry, the binding stoichiometry of 2 and 1 for glucosamine monosaccharide (GlcN) and disaccharide (GlcN)2, respectively, was indicative of two binding sites in PeCBM32. A three-dimensional model-guided site-directed mutagenesis and the use of defined disaccharides varying in the pattern of acetylation suggested that the amino groups of chitosan and the polar residues Glu-16 and Glu-38 of PeCBM32 play a crucial role for the observed binding. The specificity of CBM32 has been further elucidated by a generated fusion protein PeCBM32-eGFP that binds to the chitosan exposing endophytic infection structures of Puccinia graminis f. sp. tritici. Phylogenetic analysis showed that CBM32s appended to chitosanases are highly conserved across different chitosanase families suggesting their role in chitosan recognition and degradation. We have identified and characterized a chitosan-specific CBM32 useful for in situ staining of chitosans in the fungal cell wall during plant-fungus interaction. PMID:27405759

  12. Electrostatic Interactions Mediate Binding of Obscurin to Small Ankyrin 1: Biochemical and Molecular Modeling Studies

    PubMed Central

    Busby, Ben; Oashi, Taiji; Willis, Chris D.; Ackermann, Maegen A.; Kontrogianni-Konstantopoulos, Aikaterini; MacKerell, Alexander D.; Bloch, Robert J.

    2012-01-01

    Small ankyrin 1 (sAnk1; also Ank1.5) is an integral protein of the sarcoplasmic reticulum in skeletal and cardiac muscle cells, where it is thought to bind to the C-terminal region of obscurin, a large modular protein that surrounds the contractile apparatus. Using fusion proteins in vitro, in combination with site directed mutagenesis and surface plasmon resonance measurements, we previously showed that the binding site on sAnk1 for obscurin consists in part of six lysine and arginine residues. Here we show that four charged residues in the high affinity binding site on obscurin for sAnk1, between residues 6316-6345, consisting of three glutamates and a lysine, are necessary, but not sufficient, for this site on obscurin to bind with high affinity to sAnk1. We also identify specific complementary mutations in sAnk1 that can partially or completely compensate for the changes in binding caused by charge-switching mutations in obscurin. We used molecular modeling to develop structural models of residues 6322-6339 of obscurin bound to sAnk1. The models, based on a combination of Brownian and molecular dynamics simulations, predict that the binding site on sAnk1 for obscurin is organized as two ankyrin-like repeats, with the last α-helical segment oriented at an angle to the nearby helices, allowing lysine-6338 of obscurin to form an ionic interaction with aspartate-111 of sAnk1. This prediction was validated by double mutant cycle experiments. Our results are consistent with a model in which electrostatic interactions between specific pairs of side chains on obscurin and sAnk1 promote binding and complex formation. PMID:21333652

  13. Comparative studies on the human serum albumin binding of the clinically approved EGFR inhibitors gefitinib, erlotinib, afatinib, osimertinib and the investigational inhibitor KP2187.

    PubMed

    Dömötör, Orsolya; Pelivan, Karla; Borics, Attila; Keppler, Bernhard K; Kowol, Christian R; Enyedy, Éva A

    2018-05-30

    Binding interactions between human serum albumin (HSA) and four approved epidermal growth factor receptor (EGFR) inhibitors gefitinib (GEF), erlotinib (ERL), afatinib (AFA), osimertinib (OSI), as well as the experimental drug KP2187, were investigated by means of spectrofluorometric and molecular modelling methods. Steady-state and time resolved spectrofluorometric techniques were carried out, including direct quenching of protein fluorescence and site marker displacement measurements. Proton dissociation processes and solvent dependent fluorescence properties were investigated as well. The EGFR inhibitors were predominantly presented in their single protonated form (HL + ) at physiological pH except ERL, which is charge-neutral. Significant solvent dependent fluorescence properties were found for GEF, ERL and KP2187, namely their emission spectra show strong dependence on the polarity and the hydrogen bonding ability of the solvents. The inhibitors proved to be bound at site I of HSA (in subdomain IIA) in a weak-to-moderate fashion (logK' 3.9-4.9) using spectrofluorometry. OSI (logK' 4.3) and KP2187 can additionally bind in site II (in subdomain IIIA), while GEF, ERL and AFA clearly show no interaction here. Docking methods qualitatively confirmed binding site preferences of compounds GEF and KP2187, and indicated that they probably bind to HSA in their neutral forms. Binding constants calculated on the basis of the various experimental data indicate a weak-to-moderate binding on HSA, only OSI exhibits somewhat higher affinity towards this protein. However, model calculations performed at physiological blood concentrations of HSA resulted in high (ca. 90%) bound fractions for the inhibitors, highlighting the importance of plasma protein binding. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Charge effects in the selection of NPF motifs by the EH domain of EHD1.

    PubMed

    Henry, Gillian D; Corrigan, Daniel J; Dineen, Joseph V; Baleja, James D

    2010-04-27

    The Eps15 homology (EH) domain is found in proteins associated with endocytosis and vesicle trafficking. EH domains bind to their target proteins through an asparagine-proline-phenylalanine (NPF) motif. We have measured the interaction energetics of the EH domain from EHD1 with peptides derived from two of its binding partners: Rabenosyn-5 (Ac-GPSLNPFDEED-NH(2)) and Rab11-Fip2 (Ac-YESTNPFTAK-NH(2)). Heteronuclear single quantum coherence (HSQC) spectroscopy shows that both peptides bind in the canonical binding pocket of EHD1 EH and induce identical structural changes, yet the affinity of the negatively charged Ac-GPSLNPFDEED-NH(2) (K(a) = 8 x 10(5) M(-1)) is tighter by 2 orders of magnitude. The thermodynamic profiles (DeltaG, DeltaH, DeltaS) were measured for both peptides as a function of temperature. The enthalpies of binding are essentially identical, and the difference in affinity is a consequence of the difference in entropic cost. Ac-GPSLNPFDEED-NH(2) binding is salt-dependent, demonstrating an electrostatic component to the interaction, whereas Ac-YESTNPFTAK-NH(2) binding is independent of salt. Successive replacement of acidic residues in Ac-GPSLNPFDEED-NH(2) with neutral residues showed that all are important. Lysine side chains in EHD1 EH create a region of strong positive surface potential near the NPF binding pocket. Contributions by lysine epsilon-amino groups to complex formation with Ac-GPSLNPFDEED-NH(2) was shown using direct-observe (15)N NMR spectroscopy. These experiments have enabled us to define a new extended interaction motif for EHD proteins, N-P-F-[DE]-[DE]-[DE], which we have used to predict new interaction partners and hence broaden the range of cellular activities involving the EHD proteins.

  15. Detoxification of cancerogenic compounds by lactic acid bacteria strains.

    PubMed

    Lili, Zhao; Junyan, Wei; Hongfei, Zhao; Baoqing, Zhu; Bolin, Zhang

    2017-10-20

    Carcinogens in food are an important issue that threat people's health right now. Lactic acid bacteria (LAB) strains as well-known probiotics have shown numerous perspectives in being used as a good food additive to confront cancerogenic compounds in recent years. Some LAB strains can remove cancerogenic compounds from medium environment via direct physical binding and avoid re-pollution of poisonous secondary metabolites which are generated from degradation of cancerogenic compounds. This article presents a whole overview of the physical-binding of LAB strains to such common cancerogenic compounds existed in food and feed environments as mycotoxins, polycyclic aromatic hydrocarbons (PAHs), heterocyclic amines (HAs) and pthalic acid esters (PAEs).In most cases, summaries of these published researches show that the binding of LAB strains to cancerogenic compounds is a physical process. Binding sites generally take place in cell wall, and peptidoglycan from LAB cells is the chief binding site. The adsorption of lactic acid bacteria to cancerogenic compounds is strain-specific. Specially, the strains from the two genera Lactobacillus and Bifidobacterium show a better potential in binding cancerogenic compounds. Moreover, we firstly used molecular dynamic computer model as a highly potential tool to simulate the binding behavior of peptidoglycan from Lactobacillus acidophilus to DBP, one of pthalic acid esters with genetic toxicity. It was seen that the theoretical data were quite consistent with the experimental results in terms of the ability of this bacterium to bind DBP. Also, the toxicity reduction of cancerogenic compounds by LAB strains could be achieved either in gastrointestinal model or animal tests and clinical researches as well. In conclusion, carefully selected LAB strains should be a good solution as one of safety strategies to reduce potential risk of cancerogenic compounds from food-based products.

  16. Iron Uptake Mechanisms in the Fish Pathogen Tenacibaculum maritimum

    PubMed Central

    Avendaño-Herrera, Ruben; Toranzo, Alicia E.; Romalde, Jesús L.; Lemos, Manuel L.; Magariños, Beatriz

    2005-01-01

    We present here the first evidence of the presence of iron uptake mechanisms in the bacterial fish pathogen Tenacibaculum maritimum. Representative strains of this species, with different serotypes and origins, were examined. All of them were able to grow in the presence of the chelating agent ethylenediamine-di- (o-hydroxyphenyl acetic acid) (EDDHA) and also produced siderophores. Cross-feeding assays suggest that the siderophores produced are closely related. In addition, all T. maritimum strains utilized transferrin, hemin, hemoglobin, and ferric ammonic citrate as iron sources when added to iron-deficient media. Whole cells of all T. maritimum strains, grown under iron-supplemented or iron-restricted conditions, were able to bind hemin, indicating the existence of constitutive binding components located at the T. maritimum cell surface. This was confirmed by the observation that isolated total and outer membrane proteins from all of the strains, regardless of the iron levels of the media, were able to bind hemin, with the outer membranes showing the strongest binding. proteinase K treatment of whole cells did not affect the hemin binding, indicating that, in addition to proteins, some protease-resistant components could also bind hemin. At least three outer membrane proteins were induced in iron-limiting conditions, and all strains, regardless of their serotype, showed a similar pattern of induced proteins. The results of the present study suggest that T. maritimum possesses at least two different systems of iron acquisition: one involving the synthesis of siderophores and another that allows the utilization of heme groups as iron sources by direct binding. PMID:16269729

  17. Iron uptake mechanisms in the fish pathogen Tenacibaculum maritimum.

    PubMed

    Avendaño-Herrera, Ruben; Toranzo, Alicia E; Romalde, Jesús L; Lemos, Manuel L; Magariños, Beatriz

    2005-11-01

    We present here the first evidence of the presence of iron uptake mechanisms in the bacterial fish pathogen Tenacibaculum maritimum. Representative strains of this species, with different serotypes and origins, were examined. All of them were able to grow in the presence of the chelating agent ethylenediamine-di-(o-hydroxyphenyl acetic acid) (EDDHA) and also produced siderophores. Cross-feeding assays suggest that the siderophores produced are closely related. In addition, all T. maritimum strains utilized transferrin, hemin, hemoglobin, and ferric ammonic citrate as iron sources when added to iron-deficient media. Whole cells of all T. maritimum strains, grown under iron-supplemented or iron-restricted conditions, were able to bind hemin, indicating the existence of constitutive binding components located at the T. maritimum cell surface. This was confirmed by the observation that isolated total and outer membrane proteins from all of the strains, regardless of the iron levels of the media, were able to bind hemin, with the outer membranes showing the strongest binding. Proteinase K treatment of whole cells did not affect the hemin binding, indicating that, in addition to proteins, some protease-resistant components could also bind hemin. At least three outer membrane proteins were induced in iron-limiting conditions, and all strains, regardless of their serotype, showed a similar pattern of induced proteins. The results of the present study suggest that T. maritimum possesses at least two different systems of iron acquisition: one involving the synthesis of siderophores and another that allows the utilization of heme groups as iron sources by direct binding.

  18. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  19. An exclusive α/β code directs allostery in TetR-peptide complexes.

    PubMed

    Sevvana, Madhumati; Goetz, Christoph; Goeke, Dagmar; Wimmer, Cornelius; Berens, Christian; Hillen, Wolfgang; Muller, Yves A

    2012-02-10

    The allosteric mechanism of one of the best characterized bacterial transcription regulators, tetracycline repressor (TetR), has recently been questioned. Tetracycline binding induces cooperative folding of TetR, as suggested by recent unfolding studies, rather than switching between two defined conformational states, namely a DNA-binding-competent conformation and a non-DNA-binding conformation. Upon ligand binding, a host of near-native multiconformational structures collapse into a single, highly stabilized protein conformation that is no longer able to bind DNA. Here, structure-function studies performed with four synthetic peptides that bind to TetR and mimic the function of low-molecular-weight effectors, such as tetracyclines, provide new means to discriminate between different allosteric models. Whereas two inducing peptides bind in an extended β-like conformation, two anti-inducing peptides form an α-helix in the effector binding site of TetR. This exclusive bimodal interaction mode coincides with two distinct overall conformations of TetR, namely one that is identical with induced TetR and one that mirrors the DNA-bound state of TetR. Urea-induced unfolding studies show no increase in thermodynamic stability for any of the peptide complexes, although fluorescence measurements demonstrate peptide binding to TetR. This strongly suggests that, at least for these peptide effectors, a classical two-state allosteric model best describes TetR function. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Binding determinants in the interplay between porcine aminopeptidase N and enterotoxigenic Escherichia coli F4 fimbriae.

    PubMed

    Xia, Pengpeng; Quan, Guomei; Yang, Yi; Zhao, Jing; Wang, Yiting; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Jianzhong; Liu, Siguo; Zhu, Guoqiang

    2018-02-26

    The binding of F4 + enterotoxigenic Escherichia coli (ETEC) and the specific receptor on porcine intestinal epithelial cells is the initial step in F4 + ETEC infection. Porcine aminopeptidase N (APN) is a newly discovered receptor for F4 fimbriae that binds directly to FaeG adhesin, which is the major subunit of the F4 fimbriae variants F4ab, F4ac, and F4ad. We used overlapping peptide assays to map the APN-FaeG binding sites, which has facilitated in the identifying the APN-binding amino acids that are located in the same region of FaeG variants, thereby limiting the major binding regions of APN to 13 peptides. To determine the core sequence motif, a panel of FaeG peptides with point mutations and FaeG mutants were constructed. Pull-down and binding reactivity assays using piglet intestines determined that the amino acids G159 of F4ab, N209 and L212 of F4ac, and A200 of F4ad were the critical residues for APN binding of FaeG. We further show using ELISA and confocal microscopy assay that amino acids 553-568, and 652-670 of the APN comprise the linear epitope for FaeG binding in all three F4 fimbriae variants.

  1. A conserved NAD+ binding pocket that regulates protein-protein interactions during aging

    PubMed Central

    Li, Jun; Bonkowski, Michael S.; Moniot, Sébastien; Zhang, Dapeng; Hubbard, Basil P.; Ling, Alvin J. Y.; Rajman, Luis A.; Qin, Bo; Lou, Zhenkun; Gorbunova, Vera; Aravind, L.; Steegborn, Clemens; Sinclair, David A.

    2017-01-01

    DNA repair is essential for life, yet its efficiency declines with age for reasons that are unclear. Numerous proteins possess Nudix homology domains (NHDs) that have no known function. We show that NHDs are NAD+ (oxidized form of nicotinamide adenine dinucleotide) binding domains that regulate protein-protein interactions. The binding of NAD+ to the NHD domain of DBC1 (deleted in breast cancer 1) prevents it from inhibiting PARP1 [poly(adenosine diphosphate–ribose) polymerase], a critical DNA repair protein. As mice age and NAD+ concentrations decline, DBC1 is increasingly bound to PARP1, causing DNA damage to accumulate, a process rapidly reversed by restoring the abundance of NAD+. Thus, NAD+ directly regulates protein-protein interactions, the modulation of which may protect against cancer, radiation, and aging. PMID:28336669

  2. Binding of transcriptional activators to sigma 54 in the presence of the transition state analog ADP–aluminum fluoride: insights into activator mechanochemical action

    PubMed Central

    Chaney, Matthew; Grande, Ricardo; Wigneshweraraj, Siva R.; Cannon, Wendy; Casaz, Paul; Gallegos, Maria-Trinidad; Schumacher, Jorg; Jones, Susan; Elderkin, Sarah; Dago, Angel Ernesto; Morett, Enrique; Buck, Martin

    2001-01-01

    Conformational changes in sigma 54 (ς54) and ς54-holoenzyme depend on nucleotide hydrolysis by an activator. We now show that ς54 and its holoenzyme bind to the central ATP-hydrolyzing domains of the transcriptional activators PspF and NifA in the presence of ADP–aluminum fluoride, an analog of ATP in the transition state for hydrolysis. Direct binding of ς54 Region I to activator in the presence of ADP–aluminum fluoride was shown and inferred from in vivo suppression genetics. Energy transduction appears to occur through activator contacts to ς54 Region I. ADP–aluminum fluoride-dependent interactions and consideration of other AAA+ proteins provide insight into activator mechanochemical action. PMID:11544185

  3. Positively charged mini-protein Zbasic2 as a highly efficient silica binding module: opportunities for enzyme immobilization on unmodified silica supports.

    PubMed

    Bolivar, Juan M; Nidetzky, Bernd

    2012-07-03

    Silica is a highly attractive support material for protein immobilization in a wide range of biotechnological and biomedical-analytical applications. Without suitable derivatization, however, the silica surface is not generally usable for attachment of proteins. We show here that Z(basic2) (a three α-helix bundle mini-protein of 7 kDa size that exposes clustered positive charges from multiple arginine residues on one side) functions as highly efficient silica binding module (SBM), allowing chimeras of target protein with SBM to become very tightly attached to underivatized glass at physiological pH conditions. We used two enzymes, d-amino acid oxidase and sucrose phosphorylase, to demonstrate direct immobilization of Z(basic2) protein from complex biological samples with extremely high selectivity. Immobilized enzymes displayed full biological activity, suggesting that their binding to the glass surface had occurred in a preferred orientation via the SBM. We also show that charge complementarity was the main principle of affinity between SBM and glass surface, and Z(basic2) proteins were bound in a very strong, yet fully reversible manner, presumably through multipoint noncovalent interactions. Z(basic2) proteins were immobilized on porous glass in a loading of 30 mg protein/g support or higher, showing that attachment via the SBM combines excellent binding selectivity with a technically useful binding capacity. Therefore, Z(basic2) and silica constitute a fully orthogonal pair of binding module and insoluble support for oriented protein immobilization, and this opens up new opportunities for the application of silica-based materials in the development of supported heterogeneous biocatalysts.

  4. Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

    PubMed

    Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

    2016-03-14

    Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

  5. Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

    PubMed

    Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

    2012-09-01

    Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

  6. C-Terminal β9-Strand of the Cyclic Nucleotide-Binding Homology Domain Stabilizes Activated States of Kv11.1 Channels

    PubMed Central

    Ng, Chai Ann; Ke, Ying; Perry, Matthew D.; Tan, Peter S.; Hill, Adam P.; Vandenberg, Jamie I.

    2013-01-01

    Kv11.1 potassium channels are important for regulation of the normal rhythm of the heartbeat. Reduced activity of Kv11.1 channels causes long QT syndrome type 2, a disorder that increases the risk of cardiac arrhythmias and sudden cardiac arrest. Kv11.1 channels are members of the KCNH subfamily of voltage-gated K+ channels. However, they also share many similarities with the cyclic nucleotide gated ion channel family, including having a cyclic nucleotide-binding homology (cNBH) domain. Kv11.1 channels, however, are not directly regulated by cyclic nucleotides. Recently, crystal structures of the cNBH domain from mEAG and zELK channels, both members of the KCNH family of voltage-gated potassium channels, revealed that a C-terminal β9-strand in the cNBH domain occupied the putative cyclic nucleotide-binding site thereby precluding binding of cyclic nucleotides. Here we show that mutations to residues in the β9-strand affect the stability of the open state relative to the closed state of Kv11.1 channels. We also show that disrupting the structure of the β9-strand reduces the stability of the inactivated state relative to the open state. Clinical mutations located in this β9-strand result in reduced trafficking efficiency, which suggests that binding of the C-terminal β9-strand to the putative cyclic nucleotide-binding pocket is also important for assembly and trafficking of Kv11.1 channels. PMID:24204727

  7. PCBP2 enables the cadicivirus IRES to exploit the function of a conserved GRNA tetraloop to enhance ribosomal initiation complex formation

    PubMed Central

    Asnani, Mukta; Pestova, Tatyana V.; Hellen, Christopher U.T.

    2016-01-01

    The cadicivirus IRES diverges structurally from canonical Type 1 IRESs (e.g. poliovirus) but nevertheless also contains an essential GNRA tetraloop in a subdomain (d10c) that is homologous to poliovirus dIVc. In addition to canonical initiation factors, the canonical Type 1 and divergent cadicivirus IRESs require the same IRES trans-acting factor, poly(C)-binding protein 2 (PCBP2). PCBP2 has three KH domains and binds poliovirus IRES domain dIV in the vicinity of the tetraloop. How PCBP2 binds the cadicivirus IRES, and the roles of PCBP2 and the tetraloop in Type 1 IRES function are unknown. Here, directed hydroxyl radical probing showed that KH1 also binds near the cadicivirus tetraloop. KH2 and KH3 bind adjacently to an IRES subdomain (d10b) that is unrelated to dIV, with KH3 in an inverted orientation. KH3 is critical for PCBP2's binding to this IRES whereas KH1 is essential for PCBP2's function in promoting initiation. PCBP2 enforced the wild-type structure of d10c when it contained minor destabilizing substitutions, exposing the tetraloop. Strikingly, PCBP2 enhanced initiation on mutant IRESs that retained consensus GNRA tetraloops, whereas mutants with divergent sequences did not respond to PCBP2. These studies show that PCBP2 enables the IRES to exploit the GNRA tetraloop to enhance initiation. PMID:27387282

  8. The Conformational Changes Induced by Ubiquinone Binding in the Na+-pumping NADH:Ubiquinone Oxidoreductase (Na+-NQR) Are Kinetically Controlled by Conserved Glycines 140 and 141 of the NqrB Subunit*

    PubMed Central

    Strickland, Madeleine; Juárez, Oscar; Neehaul, Yashvin; Cook, Darcie A.; Barquera, Blanca; Hellwig, Petra

    2014-01-01

    Na+-pumping NADH:ubiquinone oxidoreductase (Na+-NQR) is responsible for maintaining a sodium gradient across the inner bacterial membrane. This respiratory enzyme, which couples sodium pumping to the electron transfer between NADH and ubiquinone, is not present in eukaryotes and as such could be a target for antibiotics. In this paper it is shown that the site of ubiquinone reduction is conformationally coupled to the NqrB subunit, which also hosts the final cofactor in the electron transport chain, riboflavin. Previous work showed that mutations in conserved NqrB glycine residues 140 and 141 affect ubiquinone reduction and the proper functioning of the sodium pump. Surprisingly, these mutants did not affect the dissociation constant of ubiquinone or its analog HQNO (2-n-heptyl-4-hydroxyquinoline N-oxide) from Na+-NQR, which indicates that these residues do not participate directly in the ubiquinone binding site but probably control its accessibility. Indeed, redox-induced difference spectroscopy showed that these mutations prevented the conformational change involved in ubiquinone binding but did not modify the signals corresponding to bound ubiquinone. Moreover, data are presented that demonstrate the NqrA subunit is able to bind ubiquinone but with a low non-catalytically relevant affinity. It is also suggested that Na+-NQR contains a single catalytic ubiquinone binding site and a second site that can bind ubiquinone but is not active. PMID:25006248

  9. Direct Determination of Vibrational Density of States Change on Ligand Binding to a Protein

    NASA Astrophysics Data System (ADS)

    Balog, Erika; Becker, Torsten; Oettl, Martin; Lechner, Ruep; Daniel, Roy; Finney, John; Smith, Jeremy C.

    2004-07-01

    The change in the vibrational density of states of a protein (dihydrofolate reductase) on binding a ligand (methotrexate) is determined using inelastic neutron scattering. The vibrations of the complex soften significantly relative to the unbound protein. The resulting free-energy change, which is directly determined by the density of states change, is found to contribute significantly to the binding equilibrium.

  10. Nucleic acid is a novel ligand for innate, immune pattern recognition collectins surfactant proteins A and D and mannose-binding lectin.

    PubMed

    Palaniyar, Nades; Nadesalingam, Jeya; Clark, Howard; Shih, Michael J; Dodds, Alister W; Reid, Kenneth B M

    2004-07-30

    Collectins are a family of innate immune proteins that contain fibrillar collagen-like regions and globular carbohydrate recognition domains (CRDs). The CRDs of these proteins recognize various microbial surface-specific carbohydrate patterns, particularly hexoses. We hypothesized that collectins, such as pulmonary surfactant proteins (SPs) SP-A and SP-D and serum protein mannose-binding lectin, could recognize nucleic acids, pentose-based anionic phosphate polymers. Here we show that collectins bind DNA from a variety of origins, including bacteria, mice, and synthetic oligonucleotides. Pentoses, such as arabinose, ribose, and deoxyribose, inhibit the interaction between SP-D and mannan, one of the well-studied hexose ligands for SP-D, and biologically relevant d-forms of the pentoses are better competitors than the l-forms. In addition, DNA and RNA polymer-related compounds, such as nucleotide diphosphates and triphosphates, also inhibit the carbohydrate binding ability of SP-D, or approximately 60 kDa trimeric recombinant fragments of SP-D that are composed of the alpha-helical coiled-coil neck region and three CRDs (SP-D(n/CRD)) or SP-D(n/CRD) with eight GXY repeats (SPD(GXY)(8)(n/CRD)). Direct binding and competition studies suggest that collectins bind nucleic acid via their CRDs as well as by their collagen-like regions, and that SP-D binds DNA more effectively than do SP-A and mannose-binding lectin at physiological salt conditions. Furthermore, the SP-D(GXY)(8)(n/CRD) fragments co-localize with DNA, and the protein competes the interaction between propidium iodide, a DNA-binding dye, and apoptotic cells. In conclusion, we show that collectins are a new class of proteins that bind free DNA and the DNA present on apoptotic cells by both their globular CRDs and collagen-like regions. Collectins may therefore play an important role in decreasing the inflammation caused by DNA in lungs and other tissues.

  11. Intrinsic optical confinement for ultrathin InAsN quantum well superlattices

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sakri, A.; Robert, C.; Pedesseau, L.

    We study energy-band engineering with InAsN monolayer in GaAs/GaP quantum well structure. A tight-binding calculation indicates that both type I alignment along with direct band-gap behavior can be obtained. We show that the optical transitions are less sensitive to the position of the probe.

  12. The Ability to Associate with Activation Domains in vitro is not Required for the TATA Box-Binding Protein to Support Activated Transcription in vivo

    NASA Astrophysics Data System (ADS)

    Tansey, William P.; Herr, Winship

    1995-11-01

    The TATA box-binding protein (TBP) interacts in vitro with the activation domains of many viral and cellular transcription factors and has been proposed to be a direct target for transcriptional activators. We have examined the functional relevance of activator-TBP association in vitro to transcriptional activation in vivo. We show that alanine substitution mutations in a single loop of TBP can disrupt its association in vitro with the activation domains of the herpes simplex virus activator VP16 and of the human tumor suppressor protein p53; these mutations do not, however, disrupt the transcriptional response of TBP to either activation domain in vivo. Moreover, we show that a region of VP16 distinct from its activation domain can also tightly associate with TBP in vitro, but fails to activate transcription in vivo. These data suggest that the ability of TBP to interact with activation domains in vitro is not directly relevant to its ability to support activated transcription in vivo.

  13. Regulation of Global Transcription in Escherichia coli by Rsd and 6S RNA

    PubMed Central

    Lal, Avantika; Krishna, Sandeep; Seshasayee, Aswin Sai Narain

    2018-01-01

    In Escherichia coli, the sigma factor σ70 directs RNA polymerase to transcribe growth-related genes, while σ38 directs transcription of stress response genes during stationary phase. Two molecules hypothesized to regulate RNA polymerase are the protein Rsd, which binds to σ70, and the non-coding 6S RNA which binds to the RNA polymerase-σ70 holoenzyme. Despite multiple studies, the functions of Rsd and 6S RNA remain controversial. Here we use RNA-Seq in five phases of growth to elucidate their function on a genome-wide scale. We show that Rsd and 6S RNA facilitate σ38 activity throughout bacterial growth, while 6S RNA also regulates widely different genes depending upon growth phase. We discover novel interactions between 6S RNA and Rsd and show widespread expression changes in a strain lacking both regulators. Finally, we present a mathematical model of transcription which highlights the crosstalk between Rsd and 6S RNA as a crucial factor in controlling sigma factor competition and global gene expression. PMID:29686109

  14. Direct Binding to Replication Protein A (RPA)-coated Single-stranded DNA Allows Recruitment of the ATR Activator TopBP1 to Sites of DNA Damage*

    PubMed Central

    Acevedo, Julyana; Yan, Shan; Michael, W. Matthew

    2016-01-01

    A critical event for the ability of cells to tolerate DNA damage and replication stress is activation of the ATR kinase. ATR activation is dependent on the BRCT (BRCA1 C terminus) repeat-containing protein TopBP1. Previous work has shown that recruitment of TopBP1 to sites of DNA damage and stalled replication forks is necessary for downstream events in ATR activation; however, the mechanism for this recruitment was not known. Here, we use protein binding assays and functional studies in Xenopus egg extracts to show that TopBP1 makes a direct interaction, via its BRCT2 domain, with RPA-coated single-stranded DNA. We identify a point mutant that abrogates this interaction and show that this mutant fails to accumulate at sites of DNA damage and that the mutant cannot activate ATR. These data thus supply a mechanism for how the critical ATR activator, TopBP1, senses DNA damage and stalled replication forks to initiate assembly of checkpoint signaling complexes. PMID:27129245

  15. Regulation of Global Transcription in Escherichia coli by Rsd and 6S RNA.

    PubMed

    Lal, Avantika; Krishna, Sandeep; Seshasayee, Aswin Sai Narain

    2018-05-31

    In Escherichia coli , the sigma factor σ 70 directs RNA polymerase to transcribe growth-related genes, while σ 38 directs transcription of stress response genes during stationary phase. Two molecules hypothesized to regulate RNA polymerase are the protein Rsd, which binds to σ 70 , and the non-coding 6S RNA which binds to the RNA polymerase-σ 70 holoenzyme. Despite multiple studies, the functions of Rsd and 6S RNA remain controversial. Here we use RNA-Seq in five phases of growth to elucidate their function on a genome-wide scale. We show that Rsd and 6S RNA facilitate σ 38 activity throughout bacterial growth, while 6S RNA also regulates widely different genes depending upon growth phase. We discover novel interactions between 6S RNA and Rsd and show widespread expression changes in a strain lacking both regulators. Finally, we present a mathematical model of transcription which highlights the crosstalk between Rsd and 6S RNA as a crucial factor in controlling sigma factor competition and global gene expression. Copyright © 2018 Lal et al.

  16. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure

    PubMed Central

    Shen, Manli; Bellaousov, Stanislav; Hiller, Michael; de La Grange, Pierre; Creamer, Trevor P.; Malina, Orit; Sperling, Ruth; Mathews, David H.; Stoilov, Peter; Stamm, Stefan

    2013-01-01

    The serotonin receptor 2C plays a central role in mood and appetite control. It undergoes pre-mRNA editing as well as alternative splicing. The RNA editing suggests that the pre-mRNA forms a stable secondary structure in vivo. To identify substances that promote alternative exons inclusion, we set up a high-throughput screen and identified pyrvinium pamoate as a drug-promoting exon inclusion without editing. Circular dichroism spectroscopy indicates that pyrvinium pamoate binds directly to the pre-mRNA and changes its structure. SHAPE (selective 2′-hydroxyl acylation analysed by primer extension) assays show that part of the regulated 5′-splice site forms intramolecular base pairs that are removed by this structural change, which likely allows splice site recognition and exon inclusion. Genome-wide analyses show that pyrvinium pamoate regulates >300 alternative exons that form secondary structures enriched in A–U base pairs. Our data demonstrate that alternative splicing of structured pre-mRNAs can be regulated by small molecules that directly bind to the RNA, which is reminiscent to an RNA riboswitch. PMID:23393189

  17. The Immune Adaptor SLP-76 Binds to SUMO-RANGAP1 at Nuclear Pore Complex Filaments to Regulate Nuclear Import of Transcription Factors in T Cells

    PubMed Central

    Liu, Hebin; Schneider, Helga; Recino, Asha; Richardson, Christine; Goldberg, Martin W.; Rudd, Christopher E.

    2015-01-01

    Summary While immune cell adaptors regulate proximal T cell signaling, direct regulation of the nuclear pore complex (NPC) has not been reported. NPC has cytoplasmic filaments composed of RanGAP1 and RanBP2 with the potential to interact with cytoplasmic mediators. Here, we show that the immune cell adaptor SLP-76 binds directly to SUMO-RanGAP1 of cytoplasmic fibrils of the NPC, and that this interaction is needed for optimal NFATc1 and NF-κB p65 nuclear entry in T cells. Transmission electron microscopy showed anti-SLP-76 cytoplasmic labeling of the majority of NPCs in anti-CD3 activated T cells. Further, SUMO-RanGAP1 bound to the N-terminal lysine 56 of SLP-76 where the interaction was needed for optimal RanGAP1-NPC localization and GAP exchange activity. While the SLP-76-RanGAP1 (K56E) mutant had no effect on proximal signaling, it impaired NF-ATc1 and p65/RelA nuclear entry and in vivo responses to OVA peptide. Overall, we have identified SLP-76 as a direct regulator of nuclear pore function in T cells. PMID:26321253

  18. The Immune Adaptor SLP-76 Binds to SUMO-RANGAP1 at Nuclear Pore Complex Filaments to Regulate Nuclear Import of Transcription Factors in T Cells.

    PubMed

    Liu, Hebin; Schneider, Helga; Recino, Asha; Richardson, Christine; Goldberg, Martin W; Rudd, Christopher E

    2015-09-03

    While immune cell adaptors regulate proximal T cell signaling, direct regulation of the nuclear pore complex (NPC) has not been reported. NPC has cytoplasmic filaments composed of RanGAP1 and RanBP2 with the potential to interact with cytoplasmic mediators. Here, we show that the immune cell adaptor SLP-76 binds directly to SUMO-RanGAP1 of cytoplasmic fibrils of the NPC, and that this interaction is needed for optimal NFATc1 and NF-κB p65 nuclear entry in T cells. Transmission electron microscopy showed anti-SLP-76 cytoplasmic labeling of the majority of NPCs in anti-CD3 activated T cells. Further, SUMO-RanGAP1 bound to the N-terminal lysine 56 of SLP-76 where the interaction was needed for optimal RanGAP1-NPC localization and GAP exchange activity. While the SLP-76-RanGAP1 (K56E) mutant had no effect on proximal signaling, it impaired NF-ATc1 and p65/RelA nuclear entry and in vivo responses to OVA peptide. Overall, we have identified SLP-76 as a direct regulator of nuclear pore function in T cells. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  19. ASS234, As a New Multi-Target Directed Propargylamine for Alzheimer's Disease Therapy.

    PubMed

    Marco-Contelles, José; Unzeta, Mercedes; Bolea, Irene; Esteban, Gerard; Ramsay, Rona R; Romero, Alejandro; Martínez-Murillo, Ricard; Carreiras, M Carmo; Ismaili, Lhassane

    2016-01-01

    ASS2324 is a hybrid compound resulting from the juxtaposition of donepezil and the propargylamine PF9601N ASS2324 is a multi-target directed propargylamine able to bind to all the AChE/BuChE and MAO A/B enzymesASS2324 shows antioxidant, neuroprotective and suitable permeability propertiesASS2324 restores the scopolamine-induced cognitive impairment to the same extent as donepezil, and is less toxicASS2324 prevents β-amyloid induced aggregation in the cortex of double transgenic miceASS2324 is the most advanced anti-Alzheimer agent for pre-clinical studies that we have identified in our laboratories The complex nature of Alzheimer's disease (AD) has prompted the design of Multi-Target-Directed Ligands (MTDL) able to bind to diverse biochemical targets involved in the progress and development of the disease. In this context, we have designed a number of MTD propargylamines (MTDP) showing antioxidant, anti-beta-amyloid, anti-inflammatory, as well as cholinesterase and monoamine oxidase (MAO) inhibition capacities. Here, we describe these properties in the MTDL ASS234, our lead-compound ready to enter in pre-clinical studies for AD, as a new multipotent, permeable cholinesterase/monoamine oxidase inhibitor, able to inhibit Aβ-aggregation, and possessing antioxidant and neuroprotective properties.

  20. Brown spider dermonecrotic toxin directly induces nephrotoxicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chaim, Olga Meiri; Sade, Youssef Bacila; Bertoni da Silveira, Rafael

    2006-02-15

    Brown spider (Loxosceles genus) venom can induce dermonecrotic lesions at the bite site and systemic manifestations including fever, vomiting, convulsions, disseminated intravascular coagulation, hemolytic anemia and acute renal failure. The venom is composed of a mixture of proteins with several molecules biochemically and biologically well characterized. The mechanism by which the venom induces renal damage is unknown. By using mice exposed to Loxosceles intermedia recombinant dermonecrotic toxin (LiRecDT), we showed direct induction of renal injuries. Microscopic analysis of renal biopsies from dermonecrotic toxin-treated mice showed histological alterations including glomerular edema and tubular necrosis. Hyalinization of tubules with deposition of proteinaceousmore » material in the tubule lumen, tubule epithelial cell vacuoles, tubular edema and epithelial cell lysis was also observed. Leukocytic infiltration was neither observed in the glomerulus nor the tubules. Renal vessels showed no sign of inflammatory response. Additionally, biochemical analyses showed such toxin-induced changes in renal function as urine alkalinization, hematuria and azotemia with elevation of blood urea nitrogen levels. Immunofluorescence with dermonecrotic toxin antibodies and confocal microscopy analysis showed deposition and direct binding of this toxin to renal intrinsic structures. By immunoblotting with a hyperimmune dermonecrotic toxin antiserum on renal lysates from toxin-treated mice, we detected a positive signal at the region of 33-35 kDa, which strengthens the idea that renal failure is directly induced by dermonecrotic toxin. Immunofluorescence reaction with dermonecrotic toxin antibodies revealed deposition and binding of this toxin directly in MDCK epithelial cells in culture. Similarly, dermonecrotic toxin treatment caused morphological alterations of MDCK cells including cytoplasmic vacuoles, blebs, evoked impaired spreading and detached cells from each other and from culture substratum. In addition, dermonecrotic toxin treatment of MDCK cells changed their viability evaluated by XTT and Neutral-Red Uptake methodologies. The present results point to brown spider dermonecrotic toxin cytotoxicity upon renal structures in vivo and renal cells in vitro and provide experimental evidence that this brown spider toxin is directly involved in nephrotoxicity evoked during Loxosceles spider venom accidents.« less

  1. Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR

    PubMed Central

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen

    2014-01-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  2. Emotional Impairment and Persistent Upregulation of mGlu5 Receptor following Morphine Abstinence: Implications of an mGlu5-MOPr Interaction

    PubMed Central

    Zanos, Panos; Georgiou, Polymnia; Gonzalez, Loreto Rojo; Hourani, Susanna; Chen, Ying; Kitchen, Ian; Kieffer, Brigitte L; Winsky-Sommerer, Raphaelle

    2016-01-01

    Background: A difficult problem in treating opioid addicts is the maintenance of a drug-free state because of the negative emotional symptoms associated with withdrawal, which may trigger relapse. Several lines of evidence suggest a role for the metabotropic glutamate receptor 5 in opioid addiction; however, its involvement during opioid withdrawal is not clear. Methods: Mice were treated with a 7-day escalating-dose morphine administration paradigm. Following withdrawal, the development of affective behaviors was assessed using the 3-chambered box, open-field, elevated plus-maze and forced-swim tests. Metabotropic glutamate receptor 5 autoradiographic binding was performed in mouse brains undergoing chronic morphine treatment and 7 days withdrawal. Moreover, since there is evidence showing direct effects of opioid drugs on the metabotropic glutamate receptor 5 system, the presence of an metabotropic glutamate receptor 5/μ-opioid receptor interaction was assessed by performing metabotropic glutamate receptor 5 autoradiographic binding in brains of mice lacking the μ-opioid receptor gene. Results: Withdrawal from chronic morphine administration induced anxiety-like, depressive-like, and impaired sociability behaviors concomitant with a marked upregulation of metabotropic glutamate receptor 5 binding. Administration of the metabotropic glutamate receptor 5 antagonist, 3-((2-Methyl-4-thiazolyl)ethynyl)pyridine, reversed morphine abstinence-induced depressive-like behaviors. A brain region-specific increase in metabotropic glutamate receptor 5 binding was observed in the nucleus accumbens shell, thalamus, hypothalamus, and amygdala of μ-opioid receptor knockout mice compared with controls. Conclusions: These results suggest an association between metabotropic glutamate receptor 5 alterations and the emergence of opioid withdrawal-related affective behaviors. This study supports metabotropic glutamate receptor 5 system as a target for the development of pharmacotherapies for the treatment of opioid addiction. Moreover, our data show direct effects of μ-opioid receptor system manipulation on metabotropic glutamate receptor 5 binding in the brain. PMID:26861145

  3. Active subsite properties, subsite residues and targeting to lysosomes or midgut lumen of cathepsins L from the beetle Tenebrio molitor.

    PubMed

    Damasceno, Ticiane F; Dias, Renata O; de Oliveira, Juliana R; Salinas, Roberto K; Juliano, Maria A; Ferreira, Clelia; Terra, Walter R

    2017-10-01

    Cathepsins L are the major digestive peptidases in the beetle Tenebrio molitor. Two digestive cathepsins L (TmCAL2 and TmCAL3) from it had their 3D structures solved. The aim of this paper was to study in details TmCAL3 specificity and properties and relate them to its 3D structure. Recombinant TmCAL3 was assayed with 64 oligopeptides with different amino acid replacements in positions P2, P1, P1' and P2'. Results showed that TmCAL3 S2 specificity differs from the human enzyme and that its specificities also explain why on autoactivation two propeptide residues remain in the enzyme. Data on free energy of binding and of activation showed that S1 and S2' are mainly involved in substrate binding, S1' acts in substrate binding and catalysis, whereas S2 is implied mainly in catalysis. Enzyme subsite residues were identified by docking with the same oligopeptide used for kinetics. The subsite hydrophobicities were calculated from the efficiency of hydrolysis of different amino acid replacements in the peptide and from docking data. The results were closer for S1 and S2' than for S1' and S2, indicating that the residue subsites that were more involved in transition state binding are different from those binding the substrate seen in docking. Besides TmCAL1-3, there are nine other cathepsins L, most of them more expressed at midgut. They are supposed to be directed to lysosomes by a Drosophila-like Lerp receptor and/or motifs in their prodomains. The mannose 6-phosphate lysosomal sorting machinery is absent from T. molitor transcriptome. Cathepsin L direction to midgut contents seems to depend on overexpression. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Regulation of Egr1 Target Genes by the NuRD Chromatin Remodeling Complex

    DTIC Science & Technology

    2006-12-01

    the M12 metastatic subline of P69SV40T prostate epithelial cells (Bae et al. 1998), Western analysis using an antibody directed against CHD4 revealed...Chromatin was then sonicated and immunoprecipitated with antibodies directed against EGR1, MTA2 or IgG control. The specificity of the assay is tested...subtle. Control ChIP assays employing an EGR1 antibody show correlated increased binding of EGR1 upon EGR1 overexpression, but this level of EGR1

  5. The arrestin-1 finger loop interacts with two distinct conformations of active rhodopsin.

    PubMed

    Elgeti, Matthias; Kazmin, Roman; Rose, Alexander S; Szczepek, Michal; Hildebrand, Peter W; Bartl, Franz J; Scheerer, Patrick; Hofmann, Klaus Peter

    2018-03-23

    Signaling of the prototypical G protein-coupled receptor (GPCR) rhodopsin through its cognate G protein transducin (G t ) is quenched when arrestin binds to the activated receptor. Although the overall architecture of the rhodopsin/arrestin complex is known, many questions regarding its specificity remain unresolved. Here, using FTIR difference spectroscopy and a dual pH/peptide titration assay, we show that rhodopsin maintains certain flexibility upon binding the "finger loop" of visual arrestin (prepared as synthetic peptide ArrFL-1). We found that two distinct complexes can be stabilized depending on the protonation state of E3.49 in the conserved (D)ERY motif. Both complexes exhibit different interaction modes and affinities of ArrFL-1 binding. The plasticity of the receptor within the rhodopsin/ArrFL-1 complex stands in contrast to the complex with the C terminus of the G t α-subunit (GαCT), which stabilizes only one specific substate out of the conformational ensemble. However, G t α-subunit binding and both ArrFL-1-binding modes involve a direct interaction to conserved R3.50, as determined by site-directed mutagenesis. Our findings highlight the importance of receptor conformational flexibility and cytoplasmic proton uptake for modulation of rhodopsin signaling and thereby extend the picture provided by crystal structures of the rhodopsin/arrestin and rhodopsin/ArrFL-1 complexes. Furthermore, the two binding modes of ArrFL-1 identified here involve motifs of conserved amino acids, which indicates that our results may have elucidated a common modulation mechanism of class A GPCR-G protein/-arrestin signaling. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Identification of the residues involved in stabilization of the semiquinone radical in the high-affinity ubiquinone binding site in cytochrome bo(3) from Escherichia coli by site-directed mutagenesis and EPR spectroscopy.

    PubMed

    Hellwig, Petra; Yano, Takahiro; Ohnishi, Tomoko; Gennis, Robert B

    2002-08-27

    During turnover of cytochrome bo(3) from Escherichia coli, a semiquinone radical is stabilized in a high-affinity binding site. To identify binding partners of this radical, site-directed mutants have been designed on the basis of a recently modeled quinone binding site (Abramson et al., 2000). The R71H, H98F, D75H, and I102W mutant enzymes were found to show very little or no quinol oxidase activity. The thermodynamic and EPR spectroscopic properties of semiquinone radicals in these mutants were characterized. For the H98F and the R71H mutants, no EPR signal of the semiquinone radical was observed in the redox potential range from -100 to 250 mV. During potentiometric titration of the D75H mutant enzyme, a semiquinone signal was detected in the same potential range as that of the wild-type enzyme. However, the EPR spectrum of the D75H mutant lacks the characteristic hyperfine structure of the semiquinone radical signal observed in the wild-type oxidase, indicating that D75 or the introduced His, interacts with the semiquinone radical. For the I102W mutant, a free radical signal was observed with a redox midpoint potential downshifted by about 200 mV. On the basis of these observations, it is suggested that R71, D75, and H98 residues are involved in the stabilization of the semiquinone state in the high-affinity binding site. Details of the possible binding motif and mechanistic implications are discussed.

  7. Specific phospholipid binding to Na,K-ATPase at two distinct sites.

    PubMed

    Habeck, Michael; Kapri-Pardes, Einat; Sharon, Michal; Karlish, Steven J D

    2017-03-14

    Membrane protein function can be affected by the physical state of the lipid bilayer and specific lipid-protein interactions. For Na,K-ATPase, bilayer properties can modulate pump activity, and, as observed in crystal structures, several lipids are bound within the transmembrane domain. Furthermore, Na,K-ATPase activity depends on phosphatidylserine (PS) and cholesterol, which stabilize the protein, and polyunsaturated phosphatidylcholine (PC) or phosphatidylethanolamine (PE), known to stimulate Na,K-ATPase activity. Based on lipid structural specificity and kinetic mechanisms, specific interactions of both PS and PC/PE have been inferred. Nevertheless, specific binding sites have not been identified definitively. We address this question with native mass spectrometry (MS) and site-directed mutagenesis. Native MS shows directly that one molecule each of 18:0/18:1 PS and 18:0/20:4 PC can bind specifically to purified human Na,K-ATPase (α 1 β 1 ). By replacing lysine residues at proposed phospholipid-binding sites with glutamines, the two sites have been identified. Mutations in the cytoplasmic αL8-9 loop destabilize the protein but do not affect Na,K-ATPase activity, whereas mutations in transmembrane helices (TM), αTM2 and αTM4, abolish the stimulation of activity by 18:0/20:4 PC but do not affect stability. When these data are linked to crystal structures, the underlying mechanism of PS and PC/PE effects emerges. PS (and cholesterol) bind between αTM 8, 9, 10, near the FXYD subunit, and maintain topological integrity of the labile C terminus of the α subunit (site A). PC/PE binds between αTM2, 4, 6, and 9 and accelerates the rate-limiting E 1 P-E 2 P conformational transition (site B). We discuss the potential physiological implications.

  8. A region rich in aspartic acid, arginine, tyrosine, and glycine (DRYG) mediates eukaryotic initiation factor 4B (eIF4B) self-association and interaction with eIF3.

    PubMed Central

    Méthot, N; Song, M S; Sonenberg, N

    1996-01-01

    The binding of mRNA to the ribosome is mediated by eukaryotic initiation factors eukaryotic initiation factor 4F (eIF4F), eIF4B, eIF4A, and eIF3, eIF4F binds to the mRNA cap structure and, in combination with eIF4B, is believed to unwind the secondary structure in the 5' untranslated region to facilitate ribosome binding. eIF3 associates with the 40S ribosomal subunit prior to mRNA binding. eIF4B copurifies with eIF3 and eIF4F through several purification steps, suggesting the involvement of a multisubunit complex during translation initiation. To understand the mechanism by which eIF4B promotes 40S ribosome binding to the mRNA, we studied its interactions with partner proteins by using a filter overlay (protein-protein [far Western]) assay and the two-hybrid system. In this report, we show that eIF4B self-associates and also interacts directly with the p170 subunit of eIF3. A region rich in aspartic acid, arginine, tyrosine, and glycine, termed the DRYG domain, is sufficient for self-association of eIF4B, both in vitro and in vivo, and for interaction with the p170 subunit of eIF3. These experiments suggest that eIF4B participates in mRNA-ribosome binding by acting as an intermediary between the mRNA and eIF3, via a direct interaction with the p170 subunit of eIF3. PMID:8816444

  9. La-related protein 1 (LARP1) binds the mRNA cap, blocking eIF4F assembly on TOP mRNAs.

    PubMed

    Lahr, Roni M; Fonseca, Bruno D; Ciotti, Gabrielle E; Al-Ashtal, Hiba A; Jia, Jian-Jun; Niklaus, Marius R; Blagden, Sarah P; Alain, Tommy; Berman, Andrea J

    2017-04-07

    The 5'terminal oligopyrimidine (5'TOP) motif is a cis -regulatory RNA element located immediately downstream of the 7-methylguanosine [m 7 G] cap of TOP mRNAs, which encode ribosomal proteins and translation factors. In eukaryotes, this motif coordinates the synchronous and stoichiometric expression of the protein components of the translation machinery. La-related protein 1 (LARP1) binds TOP mRNAs, regulating their stability and translation. We present crystal structures of the human LARP1 DM15 region in complex with a 5'TOP motif, a cap analog (m 7 GTP), and a capped cytidine (m 7 GpppC), resolved to 2.6, 1.8 and 1.7 Å, respectively. Our binding, competition, and immunoprecipitation data corroborate and elaborate on the mechanism of 5'TOP motif binding by LARP1. We show that LARP1 directly binds the cap and adjacent 5'TOP motif of TOP mRNAs, effectively impeding access of eIF4E to the cap and preventing eIF4F assembly. Thus, LARP1 is a specialized TOP mRNA cap-binding protein that controls ribosome biogenesis.

  10. Lectin-binding histochemistry of non-decalcified growth plate cartilage: a postembedment method for light microscopy of epon-embedded tissue.

    PubMed

    Farnum, C E; Wilsman, N J

    1984-06-01

    A postembedment method for the localization of lectin-binding glycoconjugates was developed using Epon-embedded growth plate cartilage from Yucatan miniature swine. By testing a variety of etching, blocking, and incubation procedures, a standard protocol was developed for 1 micron thick sections that allowed visualization of both intracellular and extracellular glycoconjugates with affinity for wheat germ agglutinin and concanavalin A. Both fluorescent and peroxidase techniques were used, and comparisons were made between direct methods and indirect methods using the biotin-avidin bridging system. Differential extracellular lectin binding allowed visualization of interterritorial , territorial, and pericellular matrices. Double labeling experiments showed the precision with which intracellular binding could be localized to specific cytoplasmic compartments, with resolution of binding to the Golgi apparatus, endoplasmic reticulum, and nuclear membrane at the light microscopic level. This method allows the localization of both intracellular and extracellular lectin-binding glycoconjugates using fixation and embedment procedures that are compatible with simultaneous ultrastructural analysis. As such it should have applicability both to the morphological analysis of growth plate organization during normal endochondral ossification, as well as to the diagnostic pathology of matrix abnormalities in disease states of growing cartilage.

  11. Competition effects in cation binding to humic acid: Conditional affinity spectra for fixed total metal concentration conditions

    NASA Astrophysics Data System (ADS)

    David, Calin; Mongin, Sandrine; Rey-Castro, Carlos; Galceran, Josep; Companys, Encarnació; Garcés, José Luis; Salvador, José; Puy, Jaume; Cecilia, Joan; Lodeiro, Pablo; Mas, Francesc

    2010-09-01

    Information on the Pb and Cd binding to a purified Aldrich humic acid (HA) is obtained from the influence of different fixed total metal concentrations on the acid-base titrations of this ligand. NICA (Non-Ideal Competitive Adsorption) isotherm has been used for a global quantitative description of the binding, which has then been interpreted by plotting the Conditional Affinity Spectra of the H + binding at fixed total metal concentrations (CAScTM). This new physicochemical tool, here introduced, allows the interpretation of binding results in terms of distributions of proton binding energies. A large increase in the acidity of the phenolic sites as the total metal concentration increases, especially in presence of Pb, is revealed from the shift of the CAScTM towards lower affinities. The variance of the CAScTM distribution, which can be used as a direct measure of the heterogeneity, also shows a significant dependence on the total metal concentration. A discussion of the factors that influence the heterogeneity of the HA under the conditions of each experiment is provided, so that the smoothed pattern exhibited by the titration curves can be justified.

  12. The E7 oncoprotein associates with Mi2 and histone deacetylase activity to promote cell growth.

    PubMed

    Brehm, A; Nielsen, S J; Miska, E A; McCance, D J; Reid, J L; Bannister, A J; Kouzarides, T

    1999-05-04

    E7 is the main transforming protein of human papilloma virus type 16 (HPV16) which is implicated in the formation of cervical cancer. The transforming activity of E7 has been attributed to its interaction with the retinoblastoma (Rb) tumour suppressor. However, Rb binding is not sufficient for transformation by E7. Mutations within a zinc finger domain, which is dispensable for Rb binding, also abolish E7 transformation functions. Here we show that HPV16 E7 associates with histone deacetylase in vitro and in vivo, via its zinc finger domain. Using a genetic screen, we identify Mi2beta, a component of the recently identified NURD histone deacetylase complex, as a protein that binds directly to the E7 zinc finger. A zinc finger point mutant which is unable to bind Mi2beta and histone deacetylase but is still able to bind Rb fails to overcome cell cycle arrest in osteosarcoma cells. Our results suggest that the binding to a histone deacetylase complex is an important parameter for the growthpromoting activity of the human papilloma virus E7 protein. This provides the first indication that viral oncoproteins control cell proliferation by targeting deacetylation pathways.

  13. Passive transport and binding of lead by human red blood cells.

    PubMed Central

    Simons, T J

    1986-01-01

    The uptake of Pb into human red blood cells has been studied using Pb buffers. Passive Pb movements can be studied conveniently when the cells are depleted of adenosine 5'-triphosphate (ATP), to eliminate active transport, and of inorganic phosphate, to prevent precipitation of lead phosphate. Pb can cross the membrane passively in either direction. Influx and efflux show similar properties. Passive Pb transport is strongly stimulated by HCO3-, and is reduced by replacing Cl- with ClO4-. It is inhibited by low concentrations of 4-acetamido-4'-isothiocyanostilbene-2,2'-disulphonic acid (SITS) and 4,4'-diisothiocyanostilbene-2.2'-disulphonic acid (DIDS), characteristic inhibitors of anion transport. Pb uptake is unaffected by varying the external concentrations of Na+, K+ and Ca2+. When Pb enters the cell, it binds mainly to haemoglobin. The ratio of bound Pb:free Pb2+ in the cytosol is estimated to be 6000:1. Pb binding to haemoglobin is unaffected by oxygenation. Binding to albumin is quantitatively similar to binding to haemoglobin. The implications of these results for the transport and binding of Pb in the blood are discussed. PMID:3795106

  14. Tris-amidoximate uranyl complexes via η2 binding mode coordinated in aqueous solution shown by X-ray absorption spectroscopy and density functional theory methods.

    PubMed

    Zhang, Linjuan; Qie, Meiying; Su, Jing; Zhang, Shuo; Zhou, Jing; Li, Jiong; Wang, Yu; Yang, Shitong; Wang, Shuao; Li, Jingye; Wu, Guozhong; Wang, Jian Qiang

    2018-03-01

    The present study sheds some light on the long-standing debate concerning the coordination properties between uranyl ions and the amidoxime ligand, which is a key ingredient for achieving efficient extraction of uranium. Using X-ray absorption fine structure combined with theoretical simulation methods, the binding mode and bonding nature of a uranyl-amidoxime complex in aqueous solution were determined for the first time. The results show that in a highly concentrated amidoxime solution the preferred binding mode between UO 2 2+ and the amidoxime ligand is η 2 coordination with tris-amidoximate species. In such a uranyl-amidoximate complex with η 2 binding motif, strong covalent interaction and orbital hybridization between U 5f/6d and (N, O) 2p should be responsible for the excellent binding ability of the amidoximate ligand to uranyl. The study was performed directly in aqueous solution to avoid the possible binding mode differences caused by crystallization of a single-crystal sample. This work also is an example of the simultaneous study of local structure and electronic structure in solution systems using combined diagnostic tools.

  15. RNA Modulates the Interaction between Influenza A Virus NS1 and Human PABP1.

    PubMed

    Arias-Mireles, Bryan H; de Rozieres, Cyrus M; Ly, Kevin; Joseph, Simpson

    2018-05-25

    Nonstructural protein 1 (NS1) is a multifunctional protein involved in preventing host-interferon response in influenza A virus (IAV). Previous studies have indicated that NS1 also stimulates the translation of viral mRNA by binding to conserved sequences in the viral 5'-UTR. Additionally, NS1 binds to poly(A) binding protein 1 (PABP1) and eukaryotic initiation factor 4G (eIF4G). The interaction of NS1 with the viral 5'-UTR, PABP1, and eIF4G has been suggested to specifically enhance the translation of viral mRNAs. In contrast, we report that NS1 does not directly bind to sequences in the viral 5'-UTR, indicating that NS1 is not responsible for providing the specificity to stimulate viral mRNA translation. We also monitored the interaction of NS1 with PABP1 using a new, quantitative FRET assay. Our data show that NS1 binds to PABP1 with high affinity; however, the binding of double-stranded RNA (dsRNA) to NS1 weakens the binding of NS1 to PABP1. Correspondingly, the binding of PABP1 to NS1 weakens the binding of NS1 to double-stranded RNA (dsRNA). In contrast, the affinity of PABP1 for binding to poly(A) RNA is not significantly changed by NS1. We propose that the modulation of NS1·PABP1 interaction by dsRNA may be important for the viral cycle.

  16. Arctigenin Inhibits Liver Cancer Tumorigenesis by Inhibiting Gankyrin Expression via C/EBPα and PPARα

    PubMed Central

    Sun, Ying; Tan, Yu-jun; Lu, Zhan-zhao; Li, Bing-bing; Sun, Cheng-hong; Li, Tao; Zhao, Li-li; Liu, Zhong; Zhang, Gui-min; Yao, Jing-chun; Li, Jie

    2018-01-01

    Burdock (Arctium lappa) is a popular vegetable in China and Japan that is consumed for its general health benefits. The principal active component of burdock is arctigenin, which shows a range of bioactivities in vivo and in vitro. Here, we investigated the potential anti-tumor effects of arctigenin using two human hepatocellular carcinoma (HCC) cell lines, HepG2 and Hep3B, and sought to elucidate its potential mechanisms of action. Our results showed that arctigenin treatment inhibited cell growth in both HepG2 and Hep3B cell lines (IC50 of 4.74 nM for HepG2 cells, and of 59.27 nM for Hep3B cells). In addition, migration, invasion, and colony formation by HepG2 cells were significantly inhibited by arctigenin. By contrast, treatment of Hep3B cells with arctigenin did not alter these parameters. Arctigenin also significantly reduced the levels of gankyrin mRNA and protein in HepG2 cells, but not in Hep3B cells. A luciferase assay indicated that arctigenin targeted the -450 to -400 region of the gankyrin promoter. This region is also the potential binding site for both C/EBPα and PPARα, as predicted and confirmed by an online software analysis and ChIP assay. Additionally, a co-immunoprecipitation (Co-IP) assay showed that binding between C/EBPα and PPARα was increased in the presence of arctigenin. However, arctigenin did not increase the expression of C/EBPα or PPARα protein. A binding screening assay and liquid chromatography–mass spectrometry (LC–MS) were performed to identify the mechanisms by which arctigenin regulates gankyrin expression. The results suggested that arctigenin could directly increase C/EBPα binding to the gankyrin promoter (-432 to -422 region), but did not affect PPARα binding. Expression of gankyrin, C/EBPα, and PPARα were analyzed in tumor tissues of patients using real-time PCR. Both C/EBPα and PPARα showed negative correlations with gankyrin. In tumor-bearing mice, arctigenin had a significant inhibitory effect on HCC growth. In conclusion, our results suggested that arctigenin could inhibit liver cancer growth by directly recruiting C/EBPα to the gankyrin promoter. PPARα subsequently bound to C/EBPα, and both had a negative regulatory effect on gankyrin expression. This study has identified a new mechanism of action of arctigenin against liver cancer growth. PMID:29636686

  17. Arctigenin Inhibits Liver Cancer Tumorigenesis by Inhibiting Gankyrin Expression via C/EBPα and PPARα.

    PubMed

    Sun, Ying; Tan, Yu-Jun; Lu, Zhan-Zhao; Li, Bing-Bing; Sun, Cheng-Hong; Li, Tao; Zhao, Li-Li; Liu, Zhong; Zhang, Gui-Min; Yao, Jing-Chun; Li, Jie

    2018-01-01

    Burdock ( Arctium lappa ) is a popular vegetable in China and Japan that is consumed for its general health benefits. The principal active component of burdock is arctigenin, which shows a range of bioactivities in vivo and in vitro . Here, we investigated the potential anti-tumor effects of arctigenin using two human hepatocellular carcinoma (HCC) cell lines, HepG2 and Hep3B, and sought to elucidate its potential mechanisms of action. Our results showed that arctigenin treatment inhibited cell growth in both HepG2 and Hep3B cell lines (IC 50 of 4.74 nM for HepG2 cells, and of 59.27 nM for Hep3B cells). In addition, migration, invasion, and colony formation by HepG2 cells were significantly inhibited by arctigenin. By contrast, treatment of Hep3B cells with arctigenin did not alter these parameters. Arctigenin also significantly reduced the levels of gankyrin mRNA and protein in HepG2 cells, but not in Hep3B cells. A luciferase assay indicated that arctigenin targeted the -450 to -400 region of the gankyrin promoter. This region is also the potential binding site for both C/EBPα and PPARα, as predicted and confirmed by an online software analysis and ChIP assay. Additionally, a co-immunoprecipitation (Co-IP) assay showed that binding between C/EBPα and PPARα was increased in the presence of arctigenin. However, arctigenin did not increase the expression of C/EBPα or PPARα protein. A binding screening assay and liquid chromatography-mass spectrometry (LC-MS) were performed to identify the mechanisms by which arctigenin regulates gankyrin expression. The results suggested that arctigenin could directly increase C/EBPα binding to the gankyrin promoter (-432 to -422 region), but did not affect PPARα binding. Expression of gankyrin, C/EBPα , and PPARα were analyzed in tumor tissues of patients using real-time PCR. Both C/EBPα and PPARα showed negative correlations with gankyrin. In tumor-bearing mice, arctigenin had a significant inhibitory effect on HCC growth. In conclusion, our results suggested that arctigenin could inhibit liver cancer growth by directly recruiting C/EBPα to the gankyrin promoter. PPARα subsequently bound to C/EBPα, and both had a negative regulatory effect on gankyrin expression. This study has identified a new mechanism of action of arctigenin against liver cancer growth.

  18. Studies on the contributions of steric and polarity effects to the H2S-binding properties of Vitreoscilla hemoglobin

    NASA Astrophysics Data System (ADS)

    Wang, Dandan; Wang, Hui; Li, Haichao; Liu, Li; Li, Zhengqiang

    2017-01-01

    We have reported recently that Vitreoscilla hemoglobin (VHb) is a potential H2S receptor and storage molecule in bacterial metabolism. In this study, molecular cloning and site-directed mutagenesis were employed to investigate the structural basis for H2S binding. Association and dissociation rate constants (kon and koff) were determined using stopped-flow rapid-scanning spectrophotometry and compared with those for wild type VHb. Several unanticipated factors were found to govern H2S binding properties, due to the distinct structure of VHb. The results presented in this paper show that: i) bulkier residues at positions E7 and E11 decrease H2S binding accessibility, while the residue located at position B10 blocks bound H2S from escaping. ii) hydroxyl sidechains within the distal heme pocket reduce H2S reactivity to VHb; iii) Pro(E8) is involved in moving the E7-E10 loop region to trigger opening of the distal heme pocket to facilitate H2S binding.

  19. A single mutation in Taiwanese H6N1 influenza hemagglutinin switches binding to human-type receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    de Vries, Robert P.; Tzarum, Netanel; Peng, Wenjie

    In June 2013, the first case of human infection with an avian H6N1 virus was reported in a Taiwanese woman. Although this was a single non-fatal case, the virus continues to circulate in Taiwanese poultry. As with any emerging avian virus that infects humans, there is concern that acquisition of human-type receptor specificity could enable transmission in the human population. Despite mutations in the receptor-binding pocket of the human H6N1 isolate, it has retained avian-type (NeuAcα2-3Gal) receptor specificity. However, we show here that a single nucleotide substitution, resulting in a change from Gly to Asp at position 225 (G225D), completelymore » switches specificity to human-type (NeuAcα2-6Gal) receptors. Significantly, G225D H6 loses binding to chicken trachea epithelium and is now able to bind to human tracheal tissue. Structural analysis reveals that Asp225 directly interacts with the penultimate Gal of the human-type receptor, stabilizing human receptor binding.« less

  20. The monomeric form of Neisseria DNA mimic protein DMP19 prevents DNA from binding to the histone-like HU protein

    PubMed Central

    Ko, Tzu-Ping; Liao, Yi-Ting; Hsu, Kai-Cheng

    2017-01-01

    DNA mimicry is a direct and effective strategy by which the mimic competes with DNA for the DNA binding sites on other proteins. Until now, only about a dozen proteins have been shown to function via this strategy, including the DNA mimic protein DMP19 from Neisseria meningitides. We have shown previously that DMP19 dimer prevents the operator DNA from binding to the transcription factor NHTF. Here, we provide new evidence that DMP19 monomer can also interact with the Neisseria nucleoid-associated protein HU. Using BS3 crosslinking, gel filtration and isothermal titration calorimetry assays, we found that DMP19 uses its monomeric form to interact with the Neisseria HU dimer. Crosslinking conjugated mass spectrometry was used to investigate the binding mode of DMP19 monomer and HU dimer. Finally, an electrophoretic mobility shift assay (EMSA) confirmed that the DNA binding affinity of HU is affected by DMP19. These results showed that DMP19 is bifunctional in the gene regulation of Neisseria through its variable oligomeric forms. PMID:29220372

  1. Ubiquitin ligase parkin promotes Mdm2-arrestin interaction but inhibits arrestin ubiquitination

    PubMed Central

    Ahmed, M. Rafiuddin; Zhan, Xuanzhi; Song, Xiufeng; Kook, Seunghyi; Gurevich, Vsevolod V.; Gurevich, Eugenia V.

    2011-01-01

    Numerous mutations in E3 ubiquitin ligase parkin were shown to associate with familial Parkinson's disease. Here we show that parkin binds arrestins, versatile regulators of cell signaling. Arrestin-parkin interaction was demonstrated by coimmuno-precipitation of endogenous proteins from brain tissue, and shown to be direct using purified proteins. Parkin binding enhances arrestin interactions with another E3 ubiquitin ligase, Mdm2, apparently by shifting arrestin conformational equilibrium to the basal state preferred by Mdm2. Although Mdm2 was reported to ubiquitinate arrestins, parkin-dependent increase in Mdm2 binding dramatically reduces the ubiquitination of both non-visual arrestins, basal and stimulated by receptor activation, without affecting receptor internalization. Several disease-associated parkin mutations differentially affect the stimulation of Mdm2 binding. All parkin mutants tested effectively suppress arrestin ubiquitination, suggesting that bound parkin shields arrestin lysines targeted by Mdm2. Parkin binding to arrestins along with its effects on arrestin interaction with Mdm2 and ubiquitination is a novel function of this protein with implications for Parkinson's disease pathology. PMID:21466165

  2. Phosphorylated nitrate reductase and 14-3-3 proteins. Site of interaction, effects of ions, and evidence for an amp-binding site on 14-3-3 proteins.

    PubMed

    Athwal, G S; Huber, J L; Huber, S C

    1998-11-01

    The inactivation of phosphorylated nitrate reductase (NR) by the binding of 14-3-3 proteins is one of a very few unambiguous biological functions for 14-3-3 proteins. We report here that serine and threonine residues at the +6 to +8 positions, relative to the known regulatory binding site involving serine-543, are important in the interaction with GF14omega, a recombinant plant 14-3-3. Also shown is that an increase in ionic strength with KCl or inorganic phosphate, known physical effectors of NR activity, directly disrupts the binding of protein and peptide ligands to 14-3-3 proteins. Increased ionic strength attributable to KCl caused a change in conformation of GF14omega, resulting in reduced surface hydrophobicity, as visualized with a fluorescent probe. Similarly, it is shown that the 5' isomer of AMP was specifically able to disrupt the inactive phosphorylated NR:14-3-3 complex. Using the 5'-AMP fluorescent analog trinitrophenyl-AMP, we show that there is a probable AMP-binding site on GF14omega.

  3. Cdc13 N-Terminal Dimerization DNA Binding and Telomere Length Regulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    M Mitchell; J Smith; M Mason

    The essential yeast protein Cdc13 facilitates chromosome end replication by recruiting telomerase to telomeres, and together with its interacting partners Stn1 and Ten1, it protects chromosome ends from nucleolytic attack, thus contributing to genome integrity. Although Cdc13 has been studied extensively, the precise role of its N-terminal domain (Cdc13N) in telomere length regulation remains unclear. Here we present a structural, biochemical, and functional characterization of Cdc13N. The structure reveals that this domain comprises an oligonucleotide/oligosaccharide binding (OB) fold and is involved in Cdc13 dimerization. Biochemical data show that Cdc13N weakly binds long, single-stranded, telomeric DNA in a fashion that ismore » directly dependent on domain oligomerization. When introduced into full-length Cdc13 in vivo, point mutations that prevented Cdc13N dimerization or DNA binding caused telomere shortening or lengthening, respectively. The multiple DNA binding domains and dimeric nature of Cdc13 offer unique insights into how it coordinates the recruitment and regulation of telomerase access to the telomeres.« less

  4. Analysis of RNA binding by the dengue virus NS5 RNA capping enzyme.

    PubMed

    Henderson, Brittney R; Saeedi, Bejan J; Campagnola, Grace; Geiss, Brian J

    2011-01-01

    Flaviviruses are small, capped positive sense RNA viruses that replicate in the cytoplasm of infected cells. Dengue virus and other related flaviviruses have evolved RNA capping enzymes to form the viral RNA cap structure that protects the viral genome and directs efficient viral polyprotein translation. The N-terminal domain of NS5 possesses the methyltransferase and guanylyltransferase activities necessary for forming mature RNA cap structures. The mechanism for flavivirus guanylyltransferase activity is currently unknown, and how the capping enzyme binds its diphosphorylated RNA substrate is important for deciphering how the flavivirus guanylyltransferase functions. In this report we examine how flavivirus NS5 N-terminal capping enzymes bind to the 5' end of the viral RNA using a fluorescence polarization-based RNA binding assay. We observed that the K(D) for RNA binding is approximately 200 nM Dengue, Yellow Fever, and West Nile virus capping enzymes. Removal of one or both of the 5' phosphates reduces binding affinity, indicating that the terminal phosphates contribute significantly to binding. RNA binding affinity is negatively affected by the presence of GTP or ATP and positively affected by S-adensyl methoninine (SAM). Structural superpositioning of the dengue virus capping enzyme with the Vaccinia virus VP39 protein bound to RNA suggests how the flavivirus capping enzyme may bind RNA, and mutagenesis analysis of residues in the putative RNA binding site demonstrate that several basic residues are critical for RNA binding. Several mutants show differential binding to 5' di-, mono-, and un-phosphorylated RNAs. The mode of RNA binding appears similar to that found with other methyltransferase enzymes, and a discussion of diphosphorylated RNA binding is presented.

  5. Mutations in the substrate binding site of human heat-shock protein 70 indicate specific interaction with HLA-DR outside the peptide binding groove

    PubMed Central

    Rohrer, Karin M; Haug, Markus; Schwörer, Daniela; Kalbacher, Hubert; Holzer, Ursula

    2014-01-01

    Heat-shock protein 70 (Hsp70)–peptide complexes are involved in MHC class I-and II-restricted antigen presentation, enabling enhanced activation of T cells. As shown previously, mammalian cytosolic Hsp70 (Hsc70) molecules interact specifically with HLA-DR molecules. This interaction might be of significance as Hsp70 molecules could transfer bound antigenic peptides in a ternary complex into the binding groove of HLA-DR molecules. The present study provides new insights into the distinct interaction of Hsp70 with HLA-DR molecules. Using a quantitative binding assay, it could be demonstrated that a point mutation of amino acids alanine 406 and valine 438 in the substrate binding pocket led to reduced peptide binding compared with the wild-type Hsp70 whereas HLA-DR binding remains unaffected. The removal of the C-terminal lid neither altered the substrate binding capacity nor the Hsp70 binding characteristics to HLA-DR. A truncated variant lacking the nucleotide binding domain showed no binding interactions with HLA-DR. Furthermore, the truncated ATPase subunit of constitutively expressed Hsc70 revealed similar binding affinities to HLA-DR compared with the complete Hsc70. Hence, it can be assumed that the Hsp70–HLA-DR interaction takes place outside the peptide binding groove and is attributed to the ATPase domain of HSP70 molecules. The Hsp70-chaperoned peptides might thereby be directly transferred into the binding groove of HLA-DR, so enabling enhanced presentation of the peptide on antigen-presenting cells and leading to an improved proliferation of responding T cells as shown previously. PMID:24428437

  6. Direct Ca2+-dependent Heterophilic Interaction between Desmosomal Cadherins, Desmoglein and Desmocollin, Contributes to Cell–Cell Adhesion

    PubMed Central

    Chitaev, Nikolai A.; Troyanovsky, Sergey M.

    1997-01-01

    Human fibrosarcoma cells, HT-1080, feature extensive adherens junctions, lack mature desmosomes, and express a single known desmosomal protein, Desmoglein 2 (Dsg2). Transfection of these cells with bovine Desmocollin 1a (Dsc1a) caused dramatic changes in the subcellular distribution of endogenous Dsg2. Both cadherins clustered in the areas of the adherens junctions, whereas only a minor portion of Dsg2 was seen in these areas in the parental cells. Deletion mapping showed that intact extracellular cadherin-like repeats of Dsc1a (Arg1-Thr170) are required for the translocation of Dsg2. Deletion of the intracellular C-domain that mediates the interaction of Dsc1a with plakoglobin, or the CSI region that is involved in the binding to desmoplakin, had no effect. Coimmunoprecipitation experiments of cell lysates stably expressing Dsc1a with anti-Dsc or -Dsg antibodies demonstrate that the desmosomal cadherins, Dsg2 and Dsc1a, are involved in a direct Ca2+-dependent interaction. This conclusion was further supported by the results of solid phase binding experiments. These showed that the Dsc1a fragment containing cadherin-like repeats 1 and 2 binds directly to the extracellular portion of Dsg in a Ca2+-dependent manner. The contribution of the Dsg/ Dsc interaction to cell–cell adhesion was tested by coculturing HT-1080 cells expressing Dsc1a with HT-1080 cells lacking Dsc but expressing myc-tagged plakoglobin (MPg). In the latter cells, MPg and the endogenous Dsg form stable complexes. The observed specific coimmunoprecipitation of MPg by anti-Dsc antibodies in coculture indicates that an intercellular interaction between Dsc1 and Dsg is involved in cell–cell adhesion. PMID:9214392

  7. Hsp90 Binds Directly to Fibronectin (FN) and Inhibition Reduces the Extracellular Fibronectin Matrix in Breast Cancer Cells

    PubMed Central

    Kenyon, Amy; Dhanani, Karim C. H.; Prinsloo, Earl; Edkins, Adrienne L.

    2014-01-01

    Heat shock protein 90 (Hsp90) has been identified in the extracellular space and has been shown to chaperone a finite number of extracellular proteins involved in cell migration and invasion. We used chemical cross-linking and immunoprecipitation followed by tandem mass spectrometry (MS/MS) to isolate a complex containing Hsp90 and the matrix protein fibronectin (FN) from breast cancer cells. Further analysis showed direct binding of Hsp90 to FN using an in vitro co-immunoprecipitation assay, a solid phase binding assay and surface plasmon resonance (SPR) spectroscopy. Confocal microscopy showed regions of co-localisation of Hsp90 and FN in breast cancer cell lines. Exogenous Hsp90β was shown to increase the formation of extracellular FN matrix in the Hs578T cell line, whilst knockdown or inhibition of Hsp90 led to a reduction in the levels of both soluble and insoluble FN and could be partially rescued by addition of exogenous Hsp90β. Treatment of cells with novobiocin led to internalization of FN into vesicles that were positive for the presence of the lysosomal marker, LAMP-1. Taken together, the direct interaction between FN and Hsp90, as well as the decreased levels of both soluble and insoluble FN upon Hsp90 inhibition or knockdown, suggested that FN may be a new client protein for Hsp90 and that Hsp90 was involved in FN matrix assembly and/or stability. The identification of FN as a putative client protein of Hsp90 suggests a role for Hsp90 in FN matrix stability, which is important for a number of fundamental cellular processes including embryogenesis, wound healing, cell migration and metastasis. PMID:24466266

  8. Hsp90 binds directly to fibronectin (FN) and inhibition reduces the extracellular fibronectin matrix in breast cancer cells.

    PubMed

    Hunter, Morgan C; O'Hagan, Kyle L; Kenyon, Amy; Dhanani, Karim C H; Prinsloo, Earl; Edkins, Adrienne L

    2014-01-01

    Heat shock protein 90 (Hsp90) has been identified in the extracellular space and has been shown to chaperone a finite number of extracellular proteins involved in cell migration and invasion. We used chemical cross-linking and immunoprecipitation followed by tandem mass spectrometry (MS/MS) to isolate a complex containing Hsp90 and the matrix protein fibronectin (FN) from breast cancer cells. Further analysis showed direct binding of Hsp90 to FN using an in vitro co-immunoprecipitation assay, a solid phase binding assay and surface plasmon resonance (SPR) spectroscopy. Confocal microscopy showed regions of co-localisation of Hsp90 and FN in breast cancer cell lines. Exogenous Hsp90β was shown to increase the formation of extracellular FN matrix in the Hs578T cell line, whilst knockdown or inhibition of Hsp90 led to a reduction in the levels of both soluble and insoluble FN and could be partially rescued by addition of exogenous Hsp90β. Treatment of cells with novobiocin led to internalization of FN into vesicles that were positive for the presence of the lysosomal marker, LAMP-1. Taken together, the direct interaction between FN and Hsp90, as well as the decreased levels of both soluble and insoluble FN upon Hsp90 inhibition or knockdown, suggested that FN may be a new client protein for Hsp90 and that Hsp90 was involved in FN matrix assembly and/or stability. The identification of FN as a putative client protein of Hsp90 suggests a role for Hsp90 in FN matrix stability, which is important for a number of fundamental cellular processes including embryogenesis, wound healing, cell migration and metastasis.

  9. An N-terminal nuclear localization sequence but not the calmodulin-binding domain mediates nuclear localization of nucleomorphin, a protein that regulates nuclear number in Dictyostelium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Myre, Michael A.; O'Day, Danton H.

    2005-06-24

    Nucleomorphin is a novel nuclear calmodulin (CaM)-binding protein (CaMBP) containing an extensive DEED (glu/asp repeat) domain that regulates nuclear number. GFP-constructs of the 38 kDa NumA1 isoform localize as intranuclear patches adjacent to the inner nuclear membrane. The translocation of CaMBPs into nuclei has previously been shown by others to be mediated by both classic nuclear localization sequences (NLSs) and CaM-binding domains (CaMBDs). Here we show that NumA1 possesses a CaMBD ({sup 171}EDVSRFIKGKLLQKQQKIYKDLERF{sup 195}) containing both calcium-dependent-binding motifs and an IQ-like motif for calcium-independent binding. GFP-constructs containing only NumA1 residues 1-129, lacking the DEED and CaMBDs, still localized as patchesmore » at the internal periphery of nuclei thus ruling out a direct role for the CaMBD in nuclear import. These constructs contained the amino acid residues {sup 48}KKSYQDPEIIAHSRPRK{sup 64} that include both a putative bipartite and classical NLS. GFP-bipartite NLS constructs localized uniformly within nuclei but not as patches. As with previous work, removal of the DEED domain resulted in highly multinucleate cells. However as shown here, multinuclearity only occurred when the NLS was present allowing the protein to enter nuclei. Site-directed mutation analysis in which the NLS was changed to {sup 48}EF{sup 49} abolished the stability of the GFP fusion at the protein but not RNA level preventing subcellular analyses. Cells transfected with the {sup 48}EF{sup 49} construct exhibited slowed growth when compared to parental AX3 cells and other GFP-NumA1 deletion mutants. In addition to identifying an NLS that is sufficient for nuclear translocation of nucleomorphin and ruling out CaM-binding in this event, this work shows that the nuclear localization of NumA1 is crucial to its ability to regulate nuclear number in Dictyostelium.« less

  10. Low pathogenic avian influenza isolates from wild birds replicate and transmit via contact in ferrets without prior adaptation.

    PubMed

    Driskell, Elizabeth A; Pickens, Jennifer A; Humberd-Smith, Jennifer; Gordy, James T; Bradley, Konrad C; Steinhauer, David A; Berghaus, Roy D; Stallknecht, David E; Howerth, Elizabeth W; Tompkins, Stephen Mark

    2012-01-01

    Direct transmission of avian influenza viruses to mammals has become an increasingly investigated topic during the past decade; however, isolates that have been primarily investigated are typically ones originating from human or poultry outbreaks. Currently there is minimal comparative information on the behavior of the innumerable viruses that exist in the natural wild bird host. We have previously demonstrated the capacity of numerous North American avian influenza viruses isolated from wild birds to infect and induce lesions in the respiratory tract of mice. In this study, two isolates from shorebirds that were previously examined in mice (H1N9 and H6N1 subtypes) are further examined through experimental inoculations in the ferret with analysis of viral shedding, histopathology, and antigen localization via immunohistochemistry to elucidate pathogenicity and transmission of these viruses. Using sequence analysis and glycan binding analysis, we show that these avian viruses have the typical avian influenza binding pattern, with affinity for cell glycoproteins/glycolipids having terminal sialic acid (SA) residues with α 2,3 linkage [Neu5Ac(α2,3)Gal]. Despite the lack of α2,6 linked SA binding, these AIVs productively infected both the upper and lower respiratory tract of ferrets, resulting in nasal viral shedding and pulmonary lesions with minimal morbidity. Moreover, we show that one of the viruses is able to transmit to ferrets via direct contact, despite its binding affinity for α 2,3 linked SA residues. These results demonstrate that avian influenza viruses, which are endemic in aquatic birds, can potentially infect humans and other mammals without adaptation. Finally this work highlights the need for additional study of the wild bird subset of influenza viruses in regard to surveillance, transmission, and potential for reassortment, as they have zoonotic potential.

  11. The Chromodomain of Tf1 Integrase Promotes Binding to cDNA and Mediates Target Site Selection▿ †

    PubMed Central

    Chatterjee, Atreyi Ghatak; Leem, Young Eun; Kelly, Felice D.; Levin, Henry L.

    2009-01-01

    The long terminal repeat (LTR) retrotransposon Tf1 of Schizosaccharomyces pombe integrates specifically into the promoters of pol II-transcribed genes. Its integrase (IN) contains a C-terminal chromodomain related to the chromodomains that bind to the N-terminal tail of histone H3. Although we have been unable to detect an interaction between histone tails and the chromodomain of Tf1 IN, it is possible that the chromodomain plays a role in directing IN to its target sites. To test this idea, we generated transposons with single amino acid substitutions in highly conserved residues of the chromodomain and created a chromodomain-deleted mutant. The mutations, V1290A, Y1292A, W1305A, and CHDΔ, substantially reduced transposition activity in vivo. Blotting assays showed that there was little or no reduction in the levels of IN or cDNA. By measuring the homologous recombination between cDNA and the plasmid copy of Tf1, we found that two of the mutations did not reduce the import of cDNA into the nucleus, while another caused a 33% reduction. Chromatin immunoprecipitation assays revealed that CHDΔ caused an approximately threefold reduction in the binding of IN to the downstream LTR of the cDNA. These data indicate that the chromodomain contributed directly to integration. We therefore tested whether the chromodomain contributed to selecting insertion sites. Results of a target plasmid assay showed that the deletion of the chromodomain resulted in a drastic reduction in the preference for pol II promoters. Collectively, these data indicate that the chromodomain promotes binding of cDNA and plays a key role in efficient targeting. PMID:19109383

  12. The chromodomain of Tf1 integrase promotes binding to cDNA and mediates target site selection.

    PubMed

    Chatterjee, Atreyi Ghatak; Leem, Young Eun; Kelly, Felice D; Levin, Henry L

    2009-03-01

    The long terminal repeat (LTR) retrotransposon Tf1 of Schizosaccharomyces pombe integrates specifically into the promoters of pol II-transcribed genes. Its integrase (IN) contains a C-terminal chromodomain related to the chromodomains that bind to the N-terminal tail of histone H3. Although we have been unable to detect an interaction between histone tails and the chromodomain of Tf1 IN, it is possible that the chromodomain plays a role in directing IN to its target sites. To test this idea, we generated transposons with single amino acid substitutions in highly conserved residues of the chromodomain and created a chromodomain-deleted mutant. The mutations, V1290A, Y1292A, W1305A, and CHDDelta, substantially reduced transposition activity in vivo. Blotting assays showed that there was little or no reduction in the levels of IN or cDNA. By measuring the homologous recombination between cDNA and the plasmid copy of Tf1, we found that two of the mutations did not reduce the import of cDNA into the nucleus, while another caused a 33% reduction. Chromatin immunoprecipitation assays revealed that CHDDelta caused an approximately threefold reduction in the binding of IN to the downstream LTR of the cDNA. These data indicate that the chromodomain contributed directly to integration. We therefore tested whether the chromodomain contributed to selecting insertion sites. Results of a target plasmid assay showed that the deletion of the chromodomain resulted in a drastic reduction in the preference for pol II promoters. Collectively, these data indicate that the chromodomain promotes binding of cDNA and plays a key role in efficient targeting.

  13. Genome-Wide Binding Analysis of the Transcription Activator IDEAL PLANT ARCHITECTURE1 Reveals a Complex Network Regulating Rice Plant Architecture[W

    PubMed Central

    Lu, Zefu; Yu, Hong; Xiong, Guosheng; Wang, Jing; Jiao, Yongqing; Liu, Guifu; Jing, Yanhui; Meng, Xiangbing; Hu, Xingming; Qian, Qian; Fu, Xiangdong; Wang, Yonghong; Li, Jiayang

    2013-01-01

    IDEAL PLANT ARCHITECTURE1 (IPA1) is critical in regulating rice (Oryza sativa) plant architecture and substantially enhances grain yield. To elucidate its molecular basis, we first confirmed IPA1 as a functional transcription activator and then identified 1067 and 2185 genes associated with IPA1 binding sites in shoot apices and young panicles, respectively, through chromatin immunoprecipitation sequencing assays. The SQUAMOSA PROMOTER BINDING PROTEIN-box direct binding core motif GTAC was highly enriched in IPA1 binding peaks; interestingly, a previously uncharacterized indirect binding motif TGGGCC/T was found to be significantly enriched through the interaction of IPA1 with proliferating cell nuclear antigen PROMOTER BINDING FACTOR1 or PROMOTER BINDING FACTOR2. Genome-wide expression profiling by RNA sequencing revealed IPA1 roles in diverse pathways. Moreover, our results demonstrated that IPA1 could directly bind to the promoter of rice TEOSINTE BRANCHED1, a negative regulator of tiller bud outgrowth, to suppress rice tillering, and directly and positively regulate DENSE AND ERECT PANICLE1, an important gene regulating panicle architecture, to influence plant height and panicle length. The elucidation of target genes of IPA1 genome-wide will contribute to understanding the molecular mechanisms underlying plant architecture and to facilitating the breeding of elite varieties with ideal plant architecture. PMID:24170127

  14. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Pathogenic Leptospira Species Acquire Factor H and Vitronectin via the Surface Protein LcpA

    PubMed Central

    da Silva, Ludmila Bezerra; Miragaia, Lidia dos Santos; Breda, Leandro Carvalho Dantas; Abe, Cecilia Mari; Schmidt, Mariana Costa Braga; Moro, Ana Maria; Monaris, Denize; Conde, Jonas Nascimento; Józsi, Mihály; Isaac, Lourdes; Abreu, Patrícia Antônia Estima

    2014-01-01

    Upon infection, pathogenic Leptospira species bind several complement regulators in order to overcome host innate immunity. We previously characterized a 20-kDa leptospiral surface protein which interacts with C4b binding protein (C4BP): leptospiral complement regulator-acquiring protein A (LcpA). Here we show that LcpA also interacts with human factor H (FH), which remains functionally active once bound to the protein. Antibodies directed against short consensus repeat 20 (SCR20) inhibited binding of FH to LcpA by approximately 90%, thus confirming that this particular domain is involved in the interaction. We have also shown for the first time that leptospires bind human vitronectin and that the interaction is mediated by LcpA. Coincubation with heparin blocked LcpA-vitronectin interaction in a dose-dependent manner, strongly suggesting that binding may occur through the heparin binding domains of vitronectin. LcpA also bound to the terminal pathway component C9 and inhibited Zn2+-induced polymerization and membrane attack complex (MAC) formation. Competitive binding assays indicated that LcpA interacts with C4BP, FH, and vitronectin through distinct sites. Taken together, our findings indicate that LcpA may play a role in leptospiral immune evasion. PMID:25534939

  16. Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles

    PubMed Central

    Sytnikova, Yuliya A.; Kubarenko, Andriy V.; Schäfer, Andrea; Weber, Alexander N. R.; Niehrs, Christof

    2011-01-01

    Background The Gadd45 proteins play important roles in growth control, maintenance of genomic stability, DNA repair, and apoptosis. Recently, Gadd45 proteins have also been implicated in epigenetic gene regulation by promoting active DNA demethylation. Gadd45 proteins have sequence homology with the L7Ae/L30e/S12e RNA binding superfamily of ribosomal proteins, which raises the question if they may interact directly with nucleic acids. Principal Findings Here we show that Gadd45a binds RNA but not single- or double stranded DNA or methylated DNA in vitro. Sucrose density gradient centrifugation experiments demonstrate that Gadd45a is present in high molecular weight particles, which are RNase sensitive. Gadd45a displays RNase-sensitive colocalization in nuclear speckles with the RNA helicase p68 and the RNA binding protein SC35. A K45A point mutation defective in RNA binding was still active in DNA demethylation. This suggests that RNA binding is not absolutely essential for demethylation of an artificial substrate. A point mutation at G39 impared RNA binding, nuclear speckle localization and DNA demethylation, emphasizing its relevance for Gadd45a function. Significance The results implicate RNA in Gadd45a function and suggest that Gadd45a is associated with a ribonucleoprotein particle. PMID:21249130

  17. Amino-terminal domains of c-myc and N-myc proteins mediate binding to the retinoblastoma gene product

    NASA Astrophysics Data System (ADS)

    Rustgi, Anil K.; Dyson, Nicholas; Bernards, Rene

    1991-08-01

    THE proteins encoded by the myc gene family are involved in the control of cell proliferation and differentiation, and aberrant expression of myc proteins has been implicated in the genesis of a variety of neoplasms1. In the carboxyl terminus, myc proteins have two domains that encode a basic domain/helix-loop-helix and a leucine zipper motif, respectively. These motifs are involved both in DNA binding and in protein dimerization2-5. In addition, myc protein family members share several regions of highly conserved amino acids in their amino termini that are essential for transformation6,7. We report here that an N-terminal domain present in both the c-myc and N-myc proteins mediates binding to the retinoblastoma gene product, pRb. We show that the human papilloma virus E7 protein competes with c-myc for binding to pRb, indicating that these proteins share overlapping binding sites on pRb. Furthermore, a mutant Rb protein from a human tumour cell line that carried a 35-amino-acid deletion in its C terminus failed to bind to c-myc. Our results suggest that c-myc and pRb cooperate through direct binding to control cell proliferation.

  18. A Prediction Method of Binding Free Energy of Protein and Ligand

    NASA Astrophysics Data System (ADS)

    Yang, Kun; Wang, Xicheng

    2010-05-01

    Predicting the binding free energy is an important problem in bimolecular simulation. Such prediction would be great benefit in understanding protein functions, and may be useful for computational prediction of ligand binding strengths, e.g., in discovering pharmaceutical drugs. Free energy perturbation (FEP)/thermodynamics integration (TI) is a classical method to explicitly predict free energy. However, this method need plenty of time to collect datum, and that attempts to deal with some simple systems and small changes of molecular structures. Another one for estimating ligand binding affinities is linear interaction energy (LIE) method. This method employs averages of interaction potential energy terms from molecular dynamics simulations or other thermal conformational sampling techniques. Incorporation of systematic deviations from electrostatic linear response, derived from free energy perturbation studies, into the absolute binding free energy expression significantly enhances the accuracy of the approach. However, it also is time-consuming work. In this paper, a new prediction method based on steered molecular dynamics (SMD) with direction optimization is developed to compute binding free energy. Jarzynski's equality is used to derive the PMF or free-energy. The results for two numerical examples are presented, showing that the method has good accuracy and efficiency. The novel method can also simulate whole binding proceeding and give some important structural information about development of new drugs.

  19. Differential manipulation of arrestin-3 binding to basal and agonist-activated G protein-coupled receptors.

    PubMed

    Prokop, Susanne; Perry, Nicole A; Vishnivetskiy, Sergey A; Toth, Andras D; Inoue, Asuka; Milligan, Graeme; Iverson, Tina M; Hunyady, Laszlo; Gurevich, Vsevolod V

    2017-08-01

    Non-visual arrestins interact with hundreds of different G protein-coupled receptors (GPCRs). Here we show that by introducing mutations into elements that directly bind receptors, the specificity of arrestin-3 can be altered. Several mutations in the two parts of the central "crest" of the arrestin molecule, middle-loop and C-loop, enhanced or reduced arrestin-3 interactions with several GPCRs in receptor subtype and functional state-specific manner. For example, the Lys139Ile substitution in the middle-loop dramatically enhanced the binding to inactive M 2 muscarinic receptor, so that agonist activation of the M 2 did not further increase arrestin-3 binding. Thus, the Lys139Ile mutation made arrestin-3 essentially an activation-independent binding partner of M 2 , whereas its interactions with other receptors, including the β 2 -adrenergic receptor and the D 1 and D 2 dopamine receptors, retained normal activation dependence. In contrast, the Ala248Val mutation enhanced agonist-induced arrestin-3 binding to the β 2 -adrenergic and D 2 dopamine receptors, while reducing its interaction with the D 1 dopamine receptor. These mutations represent the first example of altering arrestin specificity via enhancement of the arrestin-receptor interactions rather than selective reduction of the binding to certain subtypes. Copyright © 2017. Published by Elsevier Inc.

  20. Pathogenic Leptospira species acquire factor H and vitronectin via the surface protein LcpA.

    PubMed

    da Silva, Ludmila Bezerra; Miragaia, Lidia Dos Santos; Breda, Leandro Carvalho Dantas; Abe, Cecilia Mari; Schmidt, Mariana Costa Braga; Moro, Ana Maria; Monaris, Denize; Conde, Jonas Nascimento; Józsi, Mihály; Isaac, Lourdes; Abreu, Patrícia Antônia Estima; Barbosa, Angela Silva

    2015-03-01

    Upon infection, pathogenic Leptospira species bind several complement regulators in order to overcome host innate immunity. We previously characterized a 20-kDa leptospiral surface protein which interacts with C4b binding protein (C4BP): leptospiral complement regulator-acquiring protein A (LcpA). Here we show that LcpA also interacts with human factor H (FH), which remains functionally active once bound to the protein. Antibodies directed against short consensus repeat 20 (SCR20) inhibited binding of FH to LcpA by approximately 90%, thus confirming that this particular domain is involved in the interaction. We have also shown for the first time that leptospires bind human vitronectin and that the interaction is mediated by LcpA. Coincubation with heparin blocked LcpA-vitronectin interaction in a dose-dependent manner, strongly suggesting that binding may occur through the heparin binding domains of vitronectin. LcpA also bound to the terminal pathway component C9 and inhibited Zn(2+)-induced polymerization and membrane attack complex (MAC) formation. Competitive binding assays indicated that LcpA interacts with C4BP, FH, and vitronectin through distinct sites. Taken together, our findings indicate that LcpA may play a role in leptospiral immune evasion. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Competitive folding of anti-terminator/terminator hairpins monitored by single molecule FRET

    PubMed Central

    Clerte, Caroline; Declerck, Nathalie; Margeat, Emmanuel

    2013-01-01

    The control of transcription termination by RNA-binding proteins that modulate RNA-structures is an important regulatory mechanism in bacteria. LicT and SacY from Bacillus subtilis prevent the premature arrest of transcription by binding to an anti-terminator RNA hairpin that overlaps an intrinsic terminator located in the 5′-mRNA leader region of the gene to be regulated. In order to investigate the molecular determinants of this anti-termination/termination balance, we have developed a fluorescence-based nucleic acids system that mimics the competition between the LicT or SacY anti-terminator targets and the overlapping terminators. Using Förster Resonance Energy Transfer on single diffusing RNA hairpins, we could monitor directly their opening or closing state, and thus investigate the effects on this equilibrium of the binding of anti-termination proteins or terminator-mimicking oligonucleotides. We show that the anti-terminator hairpins adopt spontaneously a closed structure and that their structural dynamics is mainly governed by the length of their basal stem. The induced stability of the anti-terminator hairpins determines both the affinity and specificity of the anti-termination protein binding. Finally, we show that stabilization of the anti-terminator hairpin, by an extended basal stem or anti-termination protein binding can efficiently counteract the competing effect of the terminator-mimic. PMID:23303779

  2. DNA wrapping and distortion by an oligomeric homeodomain protein.

    PubMed

    Williams, Hannah; Jayaraman, Padma-Sheela; Gaston, Kevin

    2008-10-31

    Many transcription factors alter DNA or chromatin structure. Changes in chromatin structure are often brought about by the recruitment of chromatin-binding proteins, chromatin-modifying proteins, or other transcription co-activator or co-repressor proteins. However, some transcription factors form oligomeric assemblies that may themselves induce changes in DNA conformation and chromatin structure. The proline-rich homeodomain (PRH/Hex) protein is a transcription factor that regulates cell differentiation and cell proliferation, and has multiple roles in embryonic development. Earlier, we showed that PRH can repress transcription by multiple mechanisms, including the recruitment of co-repressor proteins belonging to the TLE family of chromatin-binding proteins. Our in vivo crosslinking studies have shown that PRH forms oligomeric complexes in cells and a variety of biophysical techniques suggest that the protein forms octamers. However, as yet we have little knowledge of the role played by PRH oligomerisation in the regulation of promoter activity or of the architecture of promoters that are regulated directly by PRH in cells. Here, we compare the binding of PRH and the isolated PRH homeodomain to DNA fragments with single and multiple PRH sites, using gel retardation assays and DNase I and chemical footprinting. We show that the PRH oligomer binds to multiple sites within the human Goosecoid promoter with high affinity and that the binding of PRH brings about DNA distortion. We suggest that PRH octamers wrap DNA in order to bring about transcriptional repression.

  3. Interaction of the Retinoblastoma Protein with Orc1 and Its Recruitment to Human Origins of DNA Replication

    PubMed Central

    Mendoza-Maldonado, Ramiro; Paolinelli, Roberta; Galbiati, Laura; Giadrossi, Sara; Giacca, Mauro

    2010-01-01

    Background The retinoblastoma protein (Rb) is a crucial regulator of cell cycle progression by binding with E2F transcription factor and repressing the expression of a variety of genes required for the G1-S phase transition. Methodology/Principal Findings Here we show that Rb and E2F1 directly participate in the control of initiation of DNA replication in human HeLa, U2OS and T98G cells by specifically binding to origins of DNA replication in a cell cycle regulated manner. We show that, both in vitro and inside the cells, the largest subunit of the origin recognition complex (Orc1) specifically binds hypo-phosphorylated Rb and that this interaction is competitive with the binding of Rb to E2F1. The displacement of Rb-bound Orc1 by E2F1 at origins of DNA replication marks the progression of the G1 phase of the cell cycle toward the G1-S border. Conclusions/Significance The participation of Rb and E2F1 in the formation of the multiprotein complex that binds origins of DNA replication in mammalian cells appears to represent an effective mechanism to couple the expression of genes required for cell cycle progression to the activation of DNA replication. PMID:21085491

  4. The effect of arrestin conformation on the recruitment of c-Raf1, MEK1, and ERK1/2 activation.

    PubMed

    Coffa, Sergio; Breitman, Maya; Hanson, Susan M; Callaway, Kari; Kook, Seunghyi; Dalby, Kevin N; Gurevich, Vsevolod V

    2011-01-01

    Arrestins are multifunctional signaling adaptors originally discovered as proteins that "arrest" G protein activation by G protein-coupled receptors (GPCRs). Recently GPCR complexes with arrestins have been proposed to activate G protein-independent signaling pathways. In particular, arrestin-dependent activation of extracellular signal-regulated kinase 1/2 (ERK1/2) has been demonstrated. Here we have performed in vitro binding assays with pure proteins to demonstrate for the first time that ERK2 directly binds free arrestin-2 and -3, as well as receptor-associated arrestins-1, -2, and -3. In addition, we showed that in COS-7 cells arrestin-2 and -3 association with β(2)-adrenergic receptor (β2AR) significantly enhanced ERK2 binding, but showed little effect on arrestin interactions with the upstream kinases c-Raf1 and MEK1. Arrestins exist in three conformational states: free, receptor-bound, and microtubule-associated. Using conformationally biased arrestin mutants we found that ERK2 preferentially binds two of these: the "constitutively inactive" arrestin-Δ7 mimicking microtubule-bound state and arrestin-3A, a mimic of the receptor-bound conformation. Both rescue arrestin-mediated ERK1/2/activation in arrestin-2/3 double knockout fibroblasts. We also found that arrestin-2-c-Raf1 interaction is enhanced by receptor binding, whereas arrestin-3-c-Raf1 interaction is not.

  5. The Effect of Arrestin Conformation on the Recruitment of c-Raf1, MEK1, and ERK1/2 Activation

    PubMed Central

    Coffa, Sergio; Breitman, Maya; Hanson, Susan M.; Callaway, Kari; Kook, Seunghyi; Dalby, Kevin N.; Gurevich, Vsevolod V.

    2011-01-01

    Arrestins are multifunctional signaling adaptors originally discovered as proteins that “arrest” G protein activation by G protein-coupled receptors (GPCRs). Recently GPCR complexes with arrestins have been proposed to activate G protein-independent signaling pathways. In particular, arrestin-dependent activation of extracellular signal-regulated kinase 1/2 (ERK1/2) has been demonstrated. Here we have performed in vitro binding assays with pure proteins to demonstrate for the first time that ERK2 directly binds free arrestin-2 and -3, as well as receptor-associated arrestins-1, -2, and -3. In addition, we showed that in COS-7 cells arrestin-2 and -3 association with β2-adrenergic receptor (β2AR) significantly enhanced ERK2 binding, but showed little effect on arrestin interactions with the upstream kinases c-Raf1 and MEK1. Arrestins exist in three conformational states: free, receptor-bound, and microtubule-associated. Using conformationally biased arrestin mutants we found that ERK2 preferentially binds two of these: the “constitutively inactive” arrestin-Δ7 mimicking microtubule-bound state and arrestin-3A, a mimic of the receptor-bound conformation. Both rescue arrestin-mediated ERK1/2/activation in arrestin-2/3 double knockout fibroblasts. We also found that arrestin-2-c-Raf1 interaction is enhanced by receptor binding, whereas arrestin-3-c-Raf1 interaction is not. PMID:22174878

  6. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

    PubMed Central

    Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

    2016-01-01

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

  7. Targeted DNA demethylation in human cells by fusion of a plant 5-methylcytosine DNA glycosylase to a sequence-specific DNA binding domain

    PubMed Central

    Parrilla-Doblas, Jara Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa

    2017-01-01

    ABSTRACT DNA methylation is a crucial epigenetic mark associated to gene silencing, and its targeted removal is a major goal of epigenetic editing. In animal cells, DNA demethylation involves iterative 5mC oxidation by TET enzymes followed by replication-dependent dilution and/or replication-independent DNA repair of its oxidized derivatives. In contrast, plants use specific DNA glycosylases that directly excise 5mC and initiate its substitution for unmethylated C in a base excision repair process. In this work, we have fused the catalytic domain of Arabidopsis ROS1 5mC DNA glycosylase (ROS1_CD) to the DNA binding domain of yeast GAL4 (GBD). We show that the resultant GBD-ROS1_CD fusion protein binds specifically a GBD-targeted DNA sequence in vitro. We also found that transient in vivo expression of GBD-ROS1_CD in human cells specifically reactivates transcription of a methylation-silenced reporter gene, and that such reactivation requires both ROS1_CD catalytic activity and GBD binding capacity. Finally, we show that reactivation induced by GBD-ROS1_CD is accompanied by decreased methylation levels at several CpG sites of the targeted promoter. All together, these results show that plant 5mC DNA glycosylases can be used for targeted active DNA demethylation in human cells. PMID:28277978

  8. Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

    2010-02-19

    Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

  9. Ab-initio study of structural, electronic, and transport properties of zigzag GaP nanotubes.

    PubMed

    Srivastava, Anurag; Jain, Sumit Kumar; Khare, Purnima Swarup

    2014-03-01

    Stability and electronic properties of zigzag (3 ≤ n ≤ 16) gallium phosphide nanotubes (GaP NTs) have been analyzed by employing a systematic ab-intio approach based on density functional theory using generalized gradient approximation with revised Perdew Burke Ernzerhoff type parameterization. Diameter dependence of bond length, buckling, binding energy, and band gap has been investigated and the analysis shows that the bond length and buckling decreases with increasing diameter of the tube, highest binding energy of (16, 0) confirms this as the most stable amongst all the NTs taken into consideration. The present GaP NTs shows direct band gap and it increases with diameter of the tubes. Using a two probe model for (4, 0) NT the I-V relationship shows an exponential increase in current on applying bias voltage beyond 1.73 volt.

  10. Casp8p41 generated by HIV protease kills CD4 T cells through direct Bak activation

    PubMed Central

    Sainski, Amy M.; Dai, Haiming; Natesampillai, Sekar; Pang, Yuan-Ping; Bren, Gary D.; Cummins, Nathan W.; Correia, Cristina; Meng, X. Wei; Tarara, James E.; Ramirez-Alvarado, Marina; Katzmann, David J.; Ochsenbauer, Christina; Kappes, John C.

    2014-01-01

    Previous studies have shown that human immunodeficiency virus (HIV) protease cleaves procaspase 8 to a fragment, termed Casp8p41, that lacks caspase activity but nonetheless contributes to T cell apoptosis. Herein, we show that Casp8p41 contains a domain that interacts with the BH3-binding groove of pro-apoptotic Bak to cause Bak oligomerization, Bak-mediated membrane permeabilization, and cell death. Levels of active Bak are higher in HIV-infected T cells that express Casp8p41. Conversely, targeted mutations in the Bak-interacting domain diminish Bak binding and Casp8p41-mediated cell death. Similar mutations in procaspase 8 impair the ability of HIV to kill infected T cells. These observations support a novel paradigm in which HIV converts a normal cellular constituent into a direct activator that functions like a BH3-only protein. PMID:25246614

  11. Inducible model for β-six-mediated site-specific recombination in mammalian cells

    PubMed Central

    Servert, Pilar; Garcia-Castro, Javier; Díaz, Vicente; Lucas, Daniel; Gonzalez, Manuel A.; Martínez-A, Carlos; Bernad, Antonio

    2006-01-01

    The prokaryotic β recombinase catalyzes site-specific recombination between two directly oriented minimal six sites in chromatin-integrated substrates. Here, we demonstrate that an enhanced green fluorescent protein (EGFP)-fused version of β recombinase (β-EGFP) is fully active, retaining most specific activity. It is used to develop a recombination-dependent activatable gene expression (RAGE) system based on the androgen receptor (AR) ligand-binding domain (LBD). Two hybrid molecules, a direct fusion of the LBD-AR to the C-terminus of β recombinase (β-AR) and a triple fusion of β-EGFP to the same ligand-binding domain (β-EGFP-AR), were engineered and their subcellular behavior, stability and catalytic activity were evaluated. Both chimeric β recombinase proteins showed in vivo inducible recombinogenic activity dependent on addition of an androgen receptor agonist, although the β-AR fusion protein demonstrated more accurate ligand-dependent translocation from cytoplasm to nucleus. PMID:16394020

  12. Characterization of high affinity (/sup 3/H)triazolam binding in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Earle, M.; Concas, A.; Yamamura, H.I.

    1986-03-01

    The hypnotic Triazolam (TZ), a triazolo (1,4)-benzodiazepine, displays a short physiological half life and has been used for the treatment of insomnia related to anxiety states. Specific binding properties of this recently tritiated TZ were characterized. The authors major objectives were the direct measurement of the temperature dependence and the GABA effect on (/sup 3/H)TZ binding. Saturation studies showed a shift to lower affinity at 37/sup 0/C (K/sub d/ = 0.25 +/- 0.01 nM at O/sup 0/C; K/sub d/ = 1.46 +/- 0.03 nM at 37/sup 0/C) while the B/sub max/ values remained unchanged (1003 +/- 37 fmoles/mg prot. atmore » 0/sup 0/C and 1001 +/- 43 fmoles/mg prot. at 37/sup 0/C). Inhibition studies showed that (/sup 3/H)TZ binding displayed no GABA shift at 0/sup 0/C(K/sub i/ 0.37 +/- 0.03 nM/- GABA and K/sub i/ = 0.55 +/- 0.13 nM/+GABA) but a nearly two-fold shift was apparent at 37/sup 0/C (K/sub i/ = 2.92 +/- 0.2 nM/-GABA; K/sub i/ = 1.37 +/- 0.11 mM/+GABA). These results were also confirmed by saturation studies in the presence or absence of GABA showing a shift to higher affinity in the presence of GABA only at 37/sup 0/C. In Ro 15-1788/(/sup 3/H)TZ competition experiments the presence of GABA did not affect the inhibitory potency of Ro 15-1788 on (/sup 3/H)TZ binding at both temperatures. In conclusion (/sup 3/H)TZ binding showed an extremely high affinity for benzodiazepine receptors. In contrast to reported literature, the findings suggest that TZ interacts with benzodiazepine receptors similar to other benzodiazepine agonists.« less

  13. Theta Phase Synchronization Is the Glue that Binds Human Associative Memory.

    PubMed

    Clouter, Andrew; Shapiro, Kimron L; Hanslmayr, Simon

    2017-10-23

    Episodic memories are information-rich, often multisensory events that rely on binding different elements [1]. The elements that will constitute a memory episode are processed in specialized but distinct brain modules. The binding of these elements is most likely mediated by fast-acting long-term potentiation (LTP), which relies on the precise timing of neural activity [2]. Theta oscillations in the hippocampus orchestrate such timing as demonstrated by animal studies in vitro [3, 4] and in vivo [5, 6], suggesting a causal role of theta activity for the formation of complex memory episodes, but direct evidence from humans is missing. Here, we show that human episodic memory formation depends on phase synchrony between different sensory cortices at the theta frequency. By modulating the luminance of visual stimuli and the amplitude of auditory stimuli, we directly manipulated the degree of phase synchrony between visual and auditory cortices. Memory for sound-movie associations was significantly better when the stimuli were presented in phase compared to out of phase. This effect was specific to theta (4 Hz) and did not occur in slower (1.7 Hz) or faster (10.5 Hz) frequencies. These findings provide the first direct evidence that episodic memory formation in humans relies on a theta-specific synchronization mechanism. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Direct observation of the influence of cardiolipin and antibiotics on lipid II binding to MurJ

    NASA Astrophysics Data System (ADS)

    Bolla, Jani Reddy; Sauer, Joshua B.; Wu, Di; Mehmood, Shahid; Allison, Timothy M.; Robinson, Carol V.

    2018-03-01

    Translocation of lipid II across the cytoplasmic membrane is essential in peptidoglycan biogenesis. Although most steps are understood, identifying the lipid II flippase has yielded conflicting results, and the lipid II binding properties of two candidate flippases—MurJ and FtsW—remain largely unknown. Here we apply native mass spectrometry to both proteins and characterize lipid II binding. We observed lower levels of lipid II binding to FtsW compared to MurJ, consistent with MurJ having a higher affinity. Site-directed mutagenesis of MurJ suggests that mutations at A29 and D269 attenuate lipid II binding to MurJ, whereas chemical modification of A29 eliminates binding. The antibiotic ramoplanin dissociates lipid II from MurJ, whereas vancomycin binds to form a stable complex with MurJ:lipid II. Furthermore, we reveal cardiolipins associate with MurJ but not FtsW, and exogenous cardiolipins reduce lipid II binding to MurJ. These observations provide insights into determinants of lipid II binding to MurJ and suggest roles for endogenous lipids in regulating substrate binding.

  15. A 44 bp intestine-specific hermaphrodite-specific enhancer from the C. elegans vit-2 vitellogenin gene is directly regulated by ELT-2, MAB-3, FKH-9 and DAF-16 and indirectly regulated by the germline, by daf-2/insulin signaling and by the TGF-β/Sma/Mab pathway.

    PubMed

    Goszczynski, Barbara; Captan, Vasile V; Danielson, Alicia M; Lancaster, Brett R; McGhee, James D

    2016-05-01

    The Caenorhabditis elegans vitellogenin genes are transcribed in the intestine of adult hermaphrodites but not of males. A 44-bp region from the vit-2 gene promoter is able largely to reconstitute this tissue-, stage- and sex-specific-expression. This "enhancer" contains a binding site for the DM-domain factor MAB-3, the male-specific repressor of vitellogenesis, as well as an activator site that we show is the direct target of the intestinal GATA factor ELT-2. We further show that the enhancer is directly activated by the winged-helix/forkhead-factor FKH-9, (whose gene has been shown by others to be a direct target of DAF-16), by an unknown activator binding to the MAB-3 site, and by the full C. elegans TGF-β/Sma/Mab pathway acting within the intestine. The vit-2 gene has been shown by others to be repressed by the daf-2/daf-16 insulin signaling pathway, which so strongly influences aging and longevity in C. elegans. We show that the activity of the 44 bp vit-2 enhancer is abolished by loss of daf-2 but is restored by simultaneous loss of daf-16. DAF-2 acts from outside of the intestine but DAF-16 acts both from outside of the intestine and from within the intestine where it binds directly to the same non-canonical target site that interacts with FKH-9. Activity of the 44 bp vit-2 enhancer is also inhibited by loss of the germline, in a manner that is only weakly influenced by DAF-16 but that is strongly influenced by KRI-1, a key downstream effector in the pathway by which germline loss increases C. elegans lifespan. The complex behavior of this enhancer presumably allows vitellogenin gene transcription to adjust to demands of body size, germline proliferation and nutritional state but we suggest that the apparent involvement of this enhancer in aging and longevity "pathways" could be incidental. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Nanopore Device for Reversible Ion and Molecule Sensing or Migration

    NASA Technical Reports Server (NTRS)

    Seger, R. Adam (Inventor); Pourmand, Nader (Inventor); Actis, Paolo (Inventor); Singaram, Bakthan (Inventor); Vilozny, Boaz (Inventor)

    2015-01-01

    Disclosed are methods and devices for detection of ion migration and binding, utilizing a nanopipette adapted for use in an electrochemical sensing circuit. The nanopipette may be functionalized on its interior bore with metal chelators for binding and sensing metal ions or other specific binding molecules such as boronic acid for binding and sensing glucose. Such a functionalized nanopipette is comprised in an electrical sensor that detects when the nanopipette selectively and reversibly binds ions or small molecules. Also disclosed is a nanoreactor, comprising a nanopipette, for controlling precipitation in aqueous solutions by voltage-directed ion migration, wherein ions may be directed out of the interior bore by a repulsing charge in the bore.

  17. Acetaldehyde dissociates the PTP1B–E-cadherin–β-catenin complex in Caco-2 cell monolayers by a phosphorylation-dependent mechanism

    PubMed Central

    Sheth, Parimal; Seth, Ankur; Atkinson, Katherine J.; Gheyi, Tarun; Kale, Gautam; Giorgianni, Francesco; Desiderio, Dominic M.; Li, Chunying; Naren, Anjaparavanda; Rao, Radhakrishna

    2006-01-01

    Interactions between E-cadherin, β-catenin and PTP1B (protein tyrosine phosphatase 1B) are crucial for the organization of AJs (adherens junctions) and epithelial cell–cell adhesion. In the present study, the effect of acetaldehyde on the AJs and on the interactions between E-cadherin, β-catenin and PTP1B was determined in Caco-2 cell monolayers. Treatment of cell monolayers with acetaldehyde induced redistribution of E-cadherin and β-catenin from the intercellular junctions by a tyrosine phosphorylation-dependent mechanism. The PTPase activity associated with E-cadherin and β-catenin was significantly reduced and the interaction of PTP1B with E-cadherin and β-catenin was attenuated by acetaldehyde. Acetaldehyde treatment resulted in phosphorylation of β-catenin on tyrosine residues, and abolished the interaction of β-catenin with E-cadherin by a tyrosine kinase-dependent mechanism. Protein binding studies showed that the treatment of cells with acetaldehyde reduced the binding of β-catenin to the C-terminal region of E-cadherin. Pairwise binding studies using purified proteins indicated that the direct interaction between E-cadherin and β-catenin was reduced by tyrosine phosphorylation of β-catenin, but was unaffected by tyrosine phosphorylation of E-cadherin-C. Treatment of cells with acetaldehyde also reduced the binding of E-cadherin to GST (glutathione S-transferase)–PTP1B. The pairwise binding study showed that GST–E-cadherin-C binds to recombinant PTP1B, but this binding was significantly reduced by tyrosine phosphorylation of E-cadherin. Acetaldehyde increased the phosphorylation of β-catenin on Tyr-331, Tyr-333, Tyr-654 and Tyr-670. These results show that acetaldehyde induces disruption of interactions between E-cadherin, β-catenin and PTP1B by a phosphorylation-dependent mechanism. PMID:17087658

  18. Effect-directed analysis to explore the polar bear exposome: identification of thyroid hormone disrupting compounds in plasma.

    PubMed

    Simon, Eszter; van Velzen, Martin; Brandsma, Sicco H; Lie, Elisabeth; Løken, Katharina; de Boer, Jacob; Bytingsvik, Jenny; Jenssen, Bjørn M; Aars, Jon; Hamers, Timo; Lamoree, Marja H

    2013-08-06

    Compounds with transthyretin (TTR)-binding potency in the blood plasma of polar bear cubs were identified with effect-directed analysis (EDA). This approach contributes to the understanding of the thyroid disrupting exposome of polar bears. The selection of these samples for in-depth EDA was based on the difference between the observed TTR-binding potency on the one hand and the calculated potency (based on known concentrations of TTR-binding compounds and their relative potencies) on the other. A library-based identification was applied to the liquid chromatography-time-of-flight-mass spectrometry (LC-ToF-MS) data by screening for matches between compound lists and the LC-ToF-MS data regarding accurate mass and isotope pattern. Then, isotope cluster analysis (ICA) was applied to the LC-ToF-MS data allowing specific screening for halogen isotope patterns. The presence of linear and branched nonylphenol (NP) was observed for the first time in polar bears. Furthermore, the presence of one di- and two monohydroxylated octachlorinated biphenyls (octaCBs) was revealed in the extracts. Linear and branched NP, 4'-OH-CB201 and 4,4'-OH-CB202 could be successfully confirmed with respect to their retention time in the analytical system. In addition, branched NP, mono- and dihydroxylated-octaCBs showed TTR-binding potencies and could explain another 32 ± 2% of the total measured activities in the extracts.

  19. Identification of berberine as a direct thrombin inhibitor from traditional Chinese medicine through structural, functional and binding studies

    NASA Astrophysics Data System (ADS)

    Wang, Xing; Zhang, Yuxin; Yang, Ying; Wu, Xia; Fan, Hantian; Qiao, Yanjiang

    2017-03-01

    Thrombin acts as a key enzyme in the blood coagulation cascade and represents a potential drug target for the treatment of several cardiovascular diseases. The aim of this study was to identify small-molecule direct thrombin inhibitors from herbs used in traditional Chinese medicine (TCM). A pharmacophore model and molecular docking were utilized to virtually screen a library of chemicals contained in compositions of traditional Chinese herbs, and these analyses were followed by in vitro bioassay validation and binding studies. Berberine (BBR) was first confirmed as a thrombin inhibitor using an enzymatic assay. The BBR IC50 value for thrombin inhibition was 2.92 μM. Direct binding studies using surface plasmon resonance demonstrated that BBR directly interacted with thrombin with a KD value of 16.39 μM. Competitive binding assay indicated that BBR could bind to the same argartroban/thrombin interaction site. A platelet aggregation assay demonstrated that BBR had the ability to inhibit thrombin-induced platelet aggregation in washed platelets samples. This study proved that BBR is a direct thrombin inhibitor that has activity in inhibiting thrombin-induced platelet aggregation. BBR may be a potential candidate for the development of safe and effective thrombin-inhibiting drugs.

  20. Na+/substrate Coupling in the Multidrug Antiporter NorM Probed with a Spin-labeled Substrate

    PubMed Central

    Steed, P. Ryan; Stein, Richard A.; Mishra, Smriti; Goodman, Michael C.; Mchaourab, Hassane S.

    2013-01-01

    NorM of the multidrug and toxic compound extrusion (MATE) family of transporters couples the efflux of a broad range of hydrophobic molecules to an inward Na+ gradient across the cell membrane. Several crystal structures of MATE transporters revealed distinct substrate binding sites leading to differing models of the mechanism of ion-coupled substrate extrusion. In the experiments reported here, we observed that a spin-labeled derivative of daunorubicin, Ruboxyl, is transported by NorM from Vibrio cholerae. It is therefore ideal to characterize mechanistically relevant binding interactions with NorM and to directly address the coupling of ion and drug binding. Fluorescence and EPR experiments revealed that Ruboxyl binds to NorM with micromolar affinity and becomes immobilized upon binding, even in the presence of Na+. Using double electron-electron resonance (DEER) spectroscopy, we determined that Ruboxyl binds to a single site on the periplasmic side of the protein. The presence of Na+ did not translocate the substrate to a second site as previously proposed. These experiments surprisingly show that Na+ does not affect the affinity or location of the substrate binding site on detergent-solubilized NorM, thus suggesting that additional factors beyond simple mutual exclusivity of binding, such as the presence of a Na+ gradient across the native membrane, govern Na+/drug coupling during antiport. PMID:23902581

  1. Enhanced detection of infectious prions by direct ELISA from the brains of asymptomatic animals using DRM2-118 monoclonal antibody and Gdn-HCl.

    PubMed

    Hnasko, Robert; Lin, Alice; McGarvey, Jeffery; Stanker, Larry

    2018-05-01

    In this report we describe the use of a novel anti-prion monoclonal antibody (DRM2-118) for the direct detection of infectious prions by ELISA. Epitope mapping using overlapping hamster (SHa) prion peptides indicates DRM2-118 binding occurs between residues 93-100 and at the 3 10 -helix (residues 163-170) between alpha helix-A and -B. This antibody shows broad species binding to endogenous prions from brain homogenates and corresponding recombinant prion proteins. To evaluate the performance of this MAb for the detection of prion proteins we performed an animal time course and evaluated prion detection from both crude brain homogenates and lipid raft fractions (DRM) by direct ELISA. Prion detection was significantly enhanced by the addition of the chaotropic guanidine-HCl (Gdn-HCl) during protein immobilization with detection of PK-resistant prion from asymptomatic animal brains at (45-DPI) and from lipid rafts at (24-DPI). Our data demonstrates enhanced prion detection from brain lipid rafts of asymptomatic animals by a simple direct ELISA using the DRM2-118 MAb combined with Gdn-HCl. Published by Elsevier B.V.

  2. Neisseria meningitidis Opc invasin binds to the sulphated tyrosines of activated vitronectin to attach to and invade human brain endothelial cells.

    PubMed

    Sa E Cunha, Claudia; Griffiths, Natalie J; Virji, Mumtaz

    2010-05-20

    The host vasculature is believed to constitute the principal route of dissemination of Neisseria meningitidis (Nm) throughout the body, resulting in septicaemia and meningitis in susceptible humans. In vitro, the Nm outer membrane protein Opc can enhance cellular entry and exit, utilising serum factors to anchor to endothelial integrins; but the mechanisms of binding to serum factors are poorly characterised. This study demonstrates that Nm Opc expressed in acapsulate as well as capsulate bacteria can increase human brain endothelial cell line (HBMEC) adhesion and entry by first binding to serum vitronectin and, to a lesser extent, fibronectin. This study also demonstrates that Opc binds preferentially to the activated form of human vitronectin, but not to native vitronectin unless the latter is treated to relax its closed conformation. The direct binding of vitronectin occurs at its Connecting Region (CR) requiring sulphated tyrosines Y(56) and Y(59). Accordingly, Opc/vitronectin interaction could be inhibited with a conformation-dependent monoclonal antibody 8E6 that targets the sulphotyrosines, and with synthetic sulphated (but not phosphorylated or unmodified) peptides spanning the vitronectin residues 43-68. Most importantly, the 26-mer sulphated peptide bearing the cell-binding domain (45)RGD(47) was sufficient for efficient meningococcal invasion of HBMECs. To our knowledge, this is the first study describing the binding of a bacterial adhesin to sulphated tyrosines of the host receptor. Our data also show that a single region of Opc is likely to interact with the sulphated regions of both vitronectin and of heparin. As such, in the absence of heparin, Opc-expressing Nm interact directly at the CR but when precoated with heparin, they bind via heparin to the heparin-binding domain of the activated vitronectin, although with a lower affinity than at the CR. Such redundancy suggests the importance of Opc/vitronectin interaction in meningococcal pathogenesis and may enable the bacterium to harness the benefits of the physiological processes in which the host effector molecule participates.

  3. A chemical biology approach demonstrates G protein βγ subunits are sufficient to mediate directional neutrophil chemotaxis.

    PubMed

    Surve, Chinmay R; Lehmann, David; Smrcka, Alan V

    2014-06-20

    Our laboratory has identified a number of small molecules that bind to G protein βγ subunits (Gβγ) by competing for peptide binding to the Gβγ "hot spot." M119/Gallein were identified as inhibitors of Gβγ subunit signaling. Here we examine the activity of another molecule identified in this screen, 12155, which we show that in contrast to M119/Gallein had no effect on Gβγ-mediated phospholipase C or phosphoinositide 3-kinase (PI3K) γ activation in vitro. Also in direct contrast to M119/Gallein, 12155 caused receptor-independent Ca(2+) release, and activated other downstream targets of Gβγ including extracellular signal regulated kinase (ERK), protein kinase B (Akt) in HL60 cells differentiated to neutrophils. We show that 12155 releases Gβγ in vitro from Gαi1β1γ2 heterotrimers by causing its dissociation from GαGDP without inducing nucleotide exchange in the Gα subunit. We used this novel probe to examine the hypothesis that Gβγ release is sufficient to direct chemotaxis of neutrophils in the absence of receptor or G protein α subunit activation. 12155 directed chemotaxis of HL60 cells and primary neutrophils in a transwell migration assay with responses similar to those seen for the natural chemotactic peptide n-formyl-Met-Leu-Phe. These data indicate that release of free Gβγ is sufficient to drive directional chemotaxis in a G protein-coupled receptor signaling-independent manner. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Disabled is a putative adaptor protein that functions during signaling by the sevenless receptor tyrosine kinase.

    PubMed

    Le, N; Simon, M A

    1998-08-01

    DRK, the Drosophila homolog of the SH2-SH3 domain adaptor protein Grb2, is required during signaling by the sevenless receptor tyrosine kinase (SEV). One role of DRK is to provide a link between activated SEV and the Ras1 activator SOS. We have investigated the possibility that DRK performs other functions by identifying additional DRK-binding proteins. We show that the phosphotyrosine-binding (PTB) domain-containing protein Disabled (DAB) binds to the DRK SH3 domains. DAB is expressed in the ommatidial clusters, and loss of DAB function disrupts ommatidial development. Moreover, reduction of DAB function attenuates signaling by a constitutively activated SEV. Our biochemical analysis suggests that DAB binds SEV directly via its PTB domain, becomes tyrosine phosphorylated upon SEV activation, and then serves as an adaptor protein for SH2 domain-containing proteins. Taken together, these results indicate that DAB is a novel component of the SEV signaling pathway.

  5. A high affinity RIM-binding protein/Aplip1 interaction prevents the formation of ectopic axonal active zones.

    PubMed

    Siebert, Matthias; Böhme, Mathias A; Driller, Jan H; Babikir, Husam; Mampell, Malou M; Rey, Ulises; Ramesh, Niraja; Matkovic, Tanja; Holton, Nicole; Reddy-Alla, Suneel; Göttfert, Fabian; Kamin, Dirk; Quentin, Christine; Klinedinst, Susan; Andlauer, Till Fm; Hell, Stefan W; Collins, Catherine A; Wahl, Markus C; Loll, Bernhard; Sigrist, Stephan J

    2015-08-14

    Synaptic vesicles (SVs) fuse at active zones (AZs) covered by a protein scaffold, at Drosophila synapses comprised of ELKS family member Bruchpilot (BRP) and RIM-binding protein (RBP). We here demonstrate axonal co-transport of BRP and RBP using intravital live imaging, with both proteins co-accumulating in axonal aggregates of several transport mutants. RBP, via its C-terminal Src-homology 3 (SH3) domains, binds Aplip1/JIP1, a transport adaptor involved in kinesin-dependent SV transport. We show in atomic detail that RBP C-terminal SH3 domains bind a proline-rich (PxxP) motif of Aplip1/JIP1 with submicromolar affinity. Pointmutating this PxxP motif provoked formation of ectopic AZ-like structures at axonal membranes. Direct interactions between AZ proteins and transport adaptors seem to provide complex avidity and shield synaptic interaction surfaces of pre-assembled scaffold protein transport complexes, thus, favouring physiological synaptic AZ assembly over premature assembly at axonal membranes.

  6. NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Dalei; Su, Xiaoyu; Potluri, Nalini

    Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less

  7. Structural Basis of Ligand Binding by a C-di-GMP Riboswitch

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, K.; Lipchock, S; Ames, T

    2009-01-01

    The second messenger signaling molecule bis-(3{prime}-5{prime})-cyclic dimeric guanosine monophosphate (c-di-GMP) regulates many processes in bacteria, including motility, pathogenesis and biofilm formation. c-di-GMP-binding riboswitches are important downstream targets in this signaling pathway. Here we report the crystal structure, at 2.7 {angstrom} resolution, of a c-di-GMP riboswitch aptamer from Vibrio cholerae bound to c-di-GMP, showing that the ligand binds within a three-helix junction that involves base-pairing and extensive base-stacking. The symmetric c-di-GMP is recognized asymmetrically with respect to both the bases and the backbone. A mutant aptamer was engineered that preferentially binds the candidate signaling molecule c-di-AMP over c-di-GMP. Kinetic and structuralmore » data suggest that genetic regulation by the c-di-GMP riboswitch is kinetically controlled and that gene expression is modulated through the stabilization of a previously unidentified P1 helix, illustrating a direct mechanism for c-di-GMP signaling.« less

  8. NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

    DOE PAGES

    Wu, Dalei; Su, Xiaoyu; Potluri, Nalini; ...

    2016-10-26

    Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less

  9. Mechanosensing Potentials Gate Fuel Consumption in a Bipedal DNA Nanowalker

    NASA Astrophysics Data System (ADS)

    Tee, Shern Ren; Hu, Xinpeng; Loh, Iong Ying; Wang, Zhisong

    2018-03-01

    A bipedal DNA nanowalker was recently reported to convert chemical energy into directional motion autonomously and efficiently. To elucidate its chemomechanical coupling mechanisms, three-dimensional molecular modeling is used to obtain coarse-grained foot-track binding potentials of the DNA nanowalker via unbiased and biased sampling techniques (for the potentials' basin and high-energy edges, respectively). The binding state that is protected against fuel-induced dissociation responds asymmetrically to forward versus backward forces, unlike the unprotected state, demonstrating a mechanosensing capability to gate fuel binding. Despite complex DNA mechanics, the foot-track potential exhibits a surprisingly neat three-part profile, offering some general guidelines to rationally design efficient nanowalkers. Subsequent modeling of the bipedal walker attached to the track gives estimates of the free energy for each bipedal state, showing how the mechanosensing foot-track binding breaks the symmetry between the rear and front feet, enabling the rear foot to be selectively dissociated by fuel and generating efficient chemomechanical coupling.

  10. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  11. Ritonavir binds to and downregulates estrogen receptors: Molecular mechanism of promoting early atherosclerosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiang, Jin; Wang, Ying; Su, Ke

    Estrogenic actions are closely related to cardiovascular disease. Ritonavir (RTV), a human immunodeficiency virus (HIV) protease inhibitor, induces atherosclerosis in an estrogen-related manner. However, how RTV induce pathological phenotypes through estrogen pathway remains unclear. In this study, we found that RTV increases thickness of coronary artery walls of Sprague Dawley rats and plasma free fatty acids (FFA) levels. In addition, RTV could induce foam cell formation, downregulate both estrogen receptor α (ERα) and ERβ expression, upregulate G protein-coupled estrogen receptor (GPER) expression, and all of them could be partially blocked by 17β-estradiol (E2), suggesting RTV acts as an antagonist formore » E2. Computational modeling shows a similar interaction with ERα between RTV and 2-aryl indoles, which are highly subtype-selective ligands for ERα. We also found that RTV directly bound to ERα and selectively inhibited the nuclear localization of ERα, and residue Leu536 in the hydrophobic core of ligand binding domain (LBD) was essential for the interaction with RTV. In addition, RTV did not change the secondary structure of ERα-LBD like E2, which explained how ERα lost the capacity of nuclear translocation under the treatment of RTV. All of the evidences suggest that ritonavir acts as an antagonist for 17β-estradiol in regulating α subtype estrogen receptor function and early events of atherosclerosis. - Graphical abstract: RTV directly binds to ERα and Leu536 in the hydrophobic core of ligand binding domain is essential for the interaction. - Highlights: • RTV increases the thickness of rat coronary artery wall and foam cell formation. • RTV downregulates the expression of ERα and ERβ. • RTV inhibits ERα promoter activity. • RTV directly binds to ERα and the key amino acid is Leu536. • RTV inhibits the nuclear translocation of ERα and GPER.« less

  12. Non-Natural Linker Configuration in 2,6-Dipeptidyl-Anthraquinones Enhances the Inhibition of TAR RNA Binding/Annealing Activities by HIV-1 NC and Tat Proteins.

    PubMed

    Sosic, Alice; Saccone, Irene; Carraro, Caterina; Kenderdine, Thomas; Gamba, Elia; Caliendo, Giuseppe; Corvino, Angela; Di Vaio, Paola; Fiorino, Ferdinando; Magli, Elisa; Perissutti, Elisa; Santagada, Vincenzo; Severino, Beatrice; Spada, Valentina; Fabris, Dan; Frecentese, Francesco; Gatto, Barbara

    2018-06-12

    The HIV-1 nucleocapsid (NC) protein represents an excellent molecular target for the development of anti-retrovirals by virtue of its well-characterized chaperone activities, which play pivotal roles in essential steps of the viral life cycle. Our ongoing search for candidates able to impair NC binding/annealing activities led to the identification of peptidyl-anthraquinones as a promising class of nucleic acid ligands. Seeking to elucidate the inhibition determinants and increase the potency of this class of compounds, we have now explored the effects of chirality in the linker connecting the planar nucleus to the basic side chains. We show here that the non-natural linker configuration imparted unexpected TAR RNA targeting properties to the 2,6-peptidyl-anthraquinones and significantly enhanced their potency. Even if the new compounds were able to interact directly with the NC protein, they manifested a consistently higher affinity for the TAR RNA substrate and their TAR-binding properties mirrored their ability to interfere with NC-TAR interactions. Based on these findings, we propose that the viral Tat protein, sharing the same RNA substrate but acting in distinct phases of the viral life cycle, constitutes an additional druggable target for this class of peptidyl-anthraquinones. The inhibition of Tat-TAR interaction for the test compounds correlated again with their TAR-binding properties, while simultaneously failing to demonstrate any direct Tat-binding capabilities. These considerations highlighted the importance of TAR RNA in the elucidation of their inhibition mechanism, rather than direct protein inhibition. We have therefore identified anti-TAR compounds with dual in vitro inhibitory activity on different viral proteins, demonstrating that it is possible to develop multitarget compounds capable of interfering with processes mediated by the interactions of this essential RNA domain of HIV-1 genome with NC and Tat proteins.

  13. Direct contact with perivascular tumor cells enhances integrin αvβ3 signaling and migration of endothelial cells

    PubMed Central

    Burgett, Monica E.; Lathia, Justin D.; Roth, Patrick; Nowacki, Amy S.; Galileo, Deni S.; Pugacheva, Elena; Huang, Ping; Vasanji, Amit; Li, Meizhang; Byzova, Tatiana; Mikkelsen, Tom; Bao, Shideng; Rich, Jeremy N.; Weller, Michael; Gladson, Candece L.

    2016-01-01

    The secretion of soluble pro-angiogenic factors by tumor cells and stromal cells in the perivascular niche promotes the aggressive angiogenesis that is typical of glioblastoma (GBM). Here, we show that angiogenesis also can be promoted by a direct interaction between brain tumor cells, including tumor cells with cancer stem-like properties (CSCs), and endothelial cells (ECs). As shown in vitro, this direct interaction is mediated by binding of integrin αvβ3 expressed on ECs to the RGD-peptide in L1CAM expressed on CSCs. It promotes both EC network formation and enhances directed migration toward basic fibroblast growth factor. Activation of αvβ3 and bone marrow tyrosine kinase on chromosome X (BMX) is required for migration stimulated by direct binding but not for migration stimulated by soluble factors. RGD-peptide treatment of mice with established intracerebral GBM xenografts significantly reduced the percentage of Sox2-positive tumor cells and CSCs in close proximity to ECs, decreased integrin αvβ3 and BMX activation and p130CAS phosphorylation in the ECs, and reduced the vessel surface area. These results reveal a previously unrecognized aspect of the regulation of angiogenesis in GBM that can impact therapeutic anti-angiogenic targeting. PMID:27270311

  14. Activation of the innate immune receptor Dectin-1 upon formation of a “phagocytic synapse”

    PubMed Central

    Goodridge, Helen S.; Reyes, Christopher N.; Becker, Courtney A.; Katsumoto, Tamiko R.; Ma, Jun; Wolf, Andrea J.; Bose, Nandita; Chan, Anissa S. H.; Magee, Andrew S.; Danielson, Michael E.; Weiss, Arthur; Vasilakos, John P.; Underhill, David M.

    2011-01-01

    Innate immune cells must be able to distinguish between direct binding to microbes and detection of components shed from the surface of microbes located at a distance. Dectin-1 is a pattern recognition receptor expressed by myeloid phagocytes (macrophages, dendritic cells and neutrophils) that detects β-glucans in fungal cell walls and triggers direct cellular anti-microbial activity, including phagocytosis and production of reactive oxygen species1, 2. In contrast to inflammatory responses stimulated upon detection of soluble ligands by other pattern recognition receptors, such as Toll-like receptors (TLRs), these responses are only useful when a cell comes into direct contact with a microbe and must not be spuriously activated by soluble stimuli. In this study we show that despite its ability to bind both soluble and particulate β-glucan polymers, Dectin-1 signalling is only activated by particulate β-glucans, which cluster the receptor in synapse-like structures from which regulatory tyrosine phosphatases CD45 and CD148 are excluded (Supplementary Figure 1). The “phagocytic synapse” now provides a model mechanism by which innate immune receptors can distinguish direct microbial contact from detection of microbes at a distance, thereby initiating direct cellular anti-microbial responses only when they are required. PMID:21525931

  15. Uncoupling PIP2-calmodulin regulation of Kv7.2 channels by an assembly destabilizing epileptogenic mutation.

    PubMed

    Alberdi, Araitz; Gomis-Perez, Carolina; Bernardo-Seisdedos, Ganeko; Alaimo, Alessandro; Malo, Covadonga; Aldaregia, Juncal; Lopez-Robles, Carlos; Areso, Pilar; Butz, Elisabeth; Wahl-Schott, Christian; Villarroel, Alvaro

    2015-11-01

    We show that the combination of an intracellular bi-partite calmodulin (CaM)-binding site and a distant assembly region affect how an ion channel is regulated by a membrane lipid. Our data reveal that regulation by phosphatidylinositol(4,5)bisphosphate (PIP2) and stabilization of assembled Kv7.2 subunits by intracellular coiled-coil regions far from the membrane are coupled molecular processes. Live-cell fluorescence energy transfer measurements and direct binding studies indicate that remote coiled-coil formation creates conditions for different CaM interaction modes, each conferring different PIP2 dependency to Kv7.2 channels. Disruption of coiled-coil formation by epilepsy-causing mutation decreases apparent CaM-binding affinity and interrupts CaM influence on PIP2 sensitivity. © 2015. Published by The Company of Biologists Ltd.

  16. A conserved NAD+ binding pocket that regulates protein-protein interactions during aging.

    PubMed

    Li, Jun; Bonkowski, Michael S; Moniot, Sébastien; Zhang, Dapeng; Hubbard, Basil P; Ling, Alvin J Y; Rajman, Luis A; Qin, Bo; Lou, Zhenkun; Gorbunova, Vera; Aravind, L; Steegborn, Clemens; Sinclair, David A

    2017-03-24

    DNA repair is essential for life, yet its efficiency declines with age for reasons that are unclear. Numerous proteins possess Nudix homology domains (NHDs) that have no known function. We show that NHDs are NAD + (oxidized form of nicotinamide adenine dinucleotide) binding domains that regulate protein-protein interactions. The binding of NAD + to the NHD domain of DBC1 (deleted in breast cancer 1) prevents it from inhibiting PARP1 [poly(adenosine diphosphate-ribose) polymerase], a critical DNA repair protein. As mice age and NAD + concentrations decline, DBC1 is increasingly bound to PARP1, causing DNA damage to accumulate, a process rapidly reversed by restoring the abundance of NAD + Thus, NAD + directly regulates protein-protein interactions, the modulation of which may protect against cancer, radiation, and aging. Copyright © 2017, American Association for the Advancement of Science.

  17. A key agonist-induced conformational change in the cannabinoid receptor CB1 is blocked by the allosteric ligand Org 27569.

    PubMed

    Fay, Jonathan F; Farrens, David L

    2012-09-28

    Allosteric ligands that modulate how G protein-coupled receptors respond to traditional orthosteric drugs are an exciting and rapidly expanding field of pharmacology. An allosteric ligand for the cannabinoid receptor CB1, Org 27569, exhibits an intriguing effect; it increases agonist binding, yet blocks agonist-induced CB1 signaling. Here we explored the mechanism behind this behavior, using a site-directed fluorescence labeling approach. Our results show that Org 27569 blocks conformational changes in CB1 that accompany G protein binding and/or activation, and thus inhibit formation of a fully active CB1 structure. The underlying mechanism behind this behavior is that simultaneous binding of Org 27569 produces a unique agonist-bound conformation, one that may resemble an intermediate structure formed on the pathway to full receptor activation.

  18. DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.

    PubMed

    Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L

    2017-09-01

    Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Water channel in the binding site of a high affinity anti-methotrexate antibody.

    PubMed

    Gayda, Susan; Longenecker, Kenton L; Manoj, Sharmila; Judge, Russell A; Saldana, Sylvia C; Ruan, Qiaoqiao; Swift, Kerry M; Tetin, Sergey Y

    2014-06-17

    In the present study, we report the structure of the free and drug-bound Fab fragment of a high affinity anti-methotrexate antibody and perform a thermodynamic analysis of the binding process. The anti-methotrexate Fab fragment features a remarkably rigid tunnel-like binding site that extends into a water channel serving as a specialized route to move solvent out and into the site upon ligand binding and dissociation. This new finding in antibody structure-function relationships directly relates to the fast association (1 × 10⁷ M⁻¹ s⁻¹) and slow dissociation (4 × 10⁻⁵ s⁻¹) rates determined for mAb ADD056, resulting in a very strong binding with a K(D) ~ 3.6 pM at 20 °C. As follows from the X-ray data analysis, the methotrexate-antibody complex is stabilized by an extended network of hydrogen bonds and stacking interactions. The analysis also shows structural involvement of the CDR H3 in formation of the water channel revealing another important role of this hypervariable region. This suggests a new direction in natural affinity maturation and opens a new possibility in antibody engineering. Methotrexate is a widely used therapeutic agent for many malignant diseases and inflammatory disorders. Unfortunately, it may also interfere with central aspects of metabolism and thereby cause inevitable side effects. Therefore, methotrexate therapy requires careful monitoring of drug blood levels, which is traditionally done by immunoassays. An understanding of the structure-function properties of antibodies selected for drug monitoring substantiates the performance and robustness of such tests.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Michael, Alicia K.; Fribourgh, Jennifer L.; Chelliah, Yogarany

    The basic helix-loop-helix PAS domain (bHLH-PAS) transcription factor CLOCK:BMAL1 (brain and muscle Arnt-like protein 1) sits at the core of the mammalian circadian transcription/translation feedback loop. Precise control of CLOCK:BMAL1 activity by coactivators and repressors establishes the ~24-h periodicity of gene expression. Formation of a repressive complex, defined by the core clock proteins cryptochrome 1 (CRY1):CLOCK:BMAL1, plays an important role controlling the switch from repression to activation each day. Here in this paper, we show that CRY1 binds directly to the PAS domain core of CLOCK: BMAL1, driven primarily by interaction with the CLOCK PAS-B domain. Integrative modeling and solutionmore » X-ray scattering studies unambiguously position a key loop of the CLOCK PAS-B domain in the secondary pocket of CRY1, analogous to the antenna chromophore-binding pocket of photolyase. CRY1 docks onto the transcription factor alongside the PAS domains, extending above the DNA-binding bHLH domain. Single point mutations at the interface on either CRY1 or CLOCK disrupt formation of the ternary complex, highlighting the importance of this interface for direct regulation of CLOCK:BMAL1 activity by CRY1.« less

  1. An experimental investigation of fractionation by sputter deposition. [application to solar wind irradiation of lunar soil

    NASA Technical Reports Server (NTRS)

    Paruso, D. M.; Cassidy, W. A.; Hapke, B. W.

    1978-01-01

    Artificial glass targets composed of elements varying widely in atomic weight were irradiated at an angle of incidence of 45 deg by 2-keV hydrogen ions at a current density of .33 mA/sq cm, and sputtered atoms were caught on a molybdenum film. Analyses of the sputter-deposited films and unsputtered target glasses were carried out by electron microprobe. The backward-sputtered component was found to be enriched in elements of low atomic weight, while the forward-sputtered component was enriched in heavy atoms. These results indicate that at the lunar surface lighter elements and isotopes would tend to be ejected in backward directions, escaping directly through the openings which admit bombarding ions without first striking an adjacent grain surface; heavy elements and isotopes would be forward-sputtered deeper into the soil and be preferentially retained, contributing to the reported enrichments of heavy elements and isotopes. Additional results show that the binding energy of an element in its oxide form influences the sticking coefficient of a sputtered atom; elements of low binding energy are likely to desorb, while elements of high binding energy tend to stick to the first bounce surface.

  2. Dead end1 is an essential partner of NANOS2 for selective binding of target RNAs in male germ cell development.

    PubMed

    Suzuki, Atsushi; Niimi, Yuki; Shinmyozu, Kaori; Zhou, Zhi; Kiso, Makoto; Saga, Yumiko

    2016-01-01

    RNA-binding proteins (RBPs) play important roles for generating various cell types in many developmental processes, including eggs and sperms. Nanos is widely known as an evolutionarily conserved RNA-binding protein implicated in germ cell development. Mouse NANOS2 interacts directly with the CCR4-NOT (CNOT) deadenylase complex, resulting in the suppression of specific RNAs. However, the mechanisms involved in target specificity remain elusive. We show that another RBP, Dead end1 (DND1), directly interacts with NANOS2 to load unique RNAs into the CNOT complex. This interaction is mediated by the zinc finger domain of NANOS2, which is essential for its association with target RNAs. In addition, the conditional deletion of DND1 causes the disruption of male germ cell differentiation similar to that observed in Nanos2-KO mice. Thus, DND1 is an essential partner for NANOS2 that leads to the degradation of specific RNAs. We also present the first evidence that the zinc finger domain of Nanos acts as a protein-interacting domain for another RBP, providing a novel insight into Nanos-mediated germ cell development. © 2015 The Authors.

  3. BAG3 Directly Interacts with Mutated alphaB-Crystallin to Suppress Its Aggregation and Toxicity

    PubMed Central

    Hishiya, Akinori; Salman, Mortada Najem; Carra, Serena; Kampinga, Harm H.; Takayama, Shinichi

    2011-01-01

    A homozygous disruption or genetic mutation of the bag3 gene causes progressive myofibrillar myopathy in mouse and human skeletal and cardiac muscle disorder while mutations in the small heat shock protein αB-crystallin gene (CRYAB) are reported to be responsible for myofibrillar myopathy. Here, we demonstrate that BAG3 directly binds to wild-type αB-crystallin and the αB-crystallin mutant R120G, via the intermediate domain of BAG3. Peptides that inhibit this interaction in an in vitro binding assay indicate that two conserved Ile-Pro-Val regions of BAG3 are involved in the interaction with αB-crystallin, which is similar to results showing BAG3 binding to HspB8 and HspB6. BAG3 overexpression increased αB-crystallin R120G solubility and inhibited its intracellular aggregation in HEK293 cells. BAG3 suppressed cell death induced by αB-crystallin R120G overexpression in differentiating C2C12 mouse myoblast cells. Our findings indicate a novel function for BAG3 in inhibiting protein aggregation caused by the genetic mutation of CRYAB responsible for human myofibrillar myopathy. PMID:21423662

  4. ComEA Is Essential for the Transfer of External DNA into the Periplasm in Naturally Transformable Vibrio cholerae Cells

    PubMed Central

    Seitz, Patrick; Pezeshgi Modarres, Hassan; Borgeaud, Sandrine; Bulushev, Roman D.; Steinbock, Lorenz J.; Radenovic, Aleksandra; Dal Peraro, Matteo; Blokesch, Melanie

    2014-01-01

    The DNA uptake of naturally competent bacteria has been attributed to the action of DNA uptake machineries resembling type IV pilus complexes. However, the protein(s) for pulling the DNA across the outer membrane of Gram-negative bacteria remain speculative. Here we show that the competence protein ComEA binds incoming DNA in the periplasm of naturally competent Vibrio cholerae cells thereby promoting DNA uptake, possibly through ratcheting and entropic forces associated with ComEA binding. Using comparative modeling and molecular simulations, we projected the 3D structure and DNA-binding site of ComEA. These in silico predictions, combined with in vivo and in vitro validations of wild-type and site-directed modified variants of ComEA, suggested that ComEA is not solely a DNA receptor protein but plays a direct role in the DNA uptake process. Furthermore, we uncovered that ComEA homologs of other bacteria (both Gram-positive and Gram-negative) efficiently compensated for the absence of ComEA in V. cholerae, suggesting that the contribution of ComEA in the DNA uptake process might be conserved among naturally competent bacteria. PMID:24391524

  5. Diffusion Monte Carlo method for evaluating Hamaker constants

    NASA Astrophysics Data System (ADS)

    Maezono, Ryo; Hongo, Kenta

    We evaluated Hamaker's constants for Si6H12 (CHS) to investigate its wettability, which is industrially useful but no references available. The constant is fundamental for wettability, but not directly accessible by experiments. Ab initio estimations are therefore in demand, and surely give an impact for broader fields such as tribology where the wettability plays an important role. The evaluation of binding curves itself could be a big challenge if it is applied to a practical molecule such as CHS, because highly accurate descriptions of electron correlations in vdW bindings get tough for such larger sizes with anisotropy. We applied DMC to overcome this difficulty, showing a new direction for wettability issues. Since ab intio estimations rely on simple assumptions such as additivity (and hence we denote it as Aadd), it would include biases. Taking a benzene as a benchmark, we compared Aadd evaluated from several available binding curves with other reported AL (estimations based on Lifshitz theory). By the comparison, we get trends of biases in Aa dd due to non-additivity and anisotropy because AL is expected to capture these effects to some extent in macroscopic manner. The expected trends here surprisingly well explain the series of results for CHS.

  6. Differential interactions of the formins INF2, mDia1, and mDia2 with microtubules

    PubMed Central

    Gaillard, Jeremie; Ramabhadran, Vinay; Neumanne, Emmanuelle; Gurel, Pinar; Blanchoin, Laurent; Vantard, Marylin; Higgs, Henry N.

    2011-01-01

    A number of cellular processes use both microtubules and actin filaments, but the molecular machinery linking these two cytoskeletal elements remains to be elucidated in detail. Formins are actin-binding proteins that have multiple effects on actin dynamics, and one formin, mDia2, has been shown to bind and stabilize microtubules through its formin homology 2 (FH2) domain. Here we show that three formins, INF2, mDia1, and mDia2, display important differences in their interactions with microtubules and actin. Constructs containing FH1, FH2, and C-terminal domains of all three formins bind microtubules with high affinity (Kd < 100 nM). However, only mDia2 binds microtubules at 1:1 stoichiometry, with INF2 and mDia1 showing saturating binding at approximately 1:3 (formin dimer:tubulin dimer). INF2-FH1FH2C is a potent microtubule-bundling protein, an effect that results in a large reduction in catastrophe rate. In contrast, neither mDia1 nor mDia2 is a potent microtubule bundler. The C-termini of mDia2 and INF2 have different functions in microtubule interaction, with mDia2's C-terminus required for high-affinity binding and INF2's C-terminus required for bundling. mDia2's C-terminus directly binds microtubules with submicromolar affinity. These formins also differ in their abilities to bind actin and microtubules simultaneously. Microtubules strongly inhibit actin polymerization by mDia2, whereas they moderately inhibit mDia1 and have no effect on INF2. Conversely, actin monomers inhibit microtubule binding/bundling by INF2 but do not affect mDia1 or mDia2. These differences in interactions with microtubules and actin suggest differential function in cellular processes requiring both cytoskeletal elements. PMID:21998204

  7. Various Bee Pheromones Binding Affinity, Exclusive Chemosensillar Localization, and Key Amino Acid Sites Reveal the Distinctive Characteristics of Odorant-Binding Protein 11 in the Eastern Honey Bee, Apis cerana.

    PubMed

    Song, Xin-Mi; Zhang, Lin-Ya; Fu, Xiao-Bin; Wu, Fan; Tan, Jing; Li, Hong-Liang

    2018-01-01

    Odorant-binding proteins (OBPs) are the critical elements responsible for binding and transporting odors and pheromones in the sensitive olfactory system in insects. Honey bees are representative social insects that have complex odorants and pheromone communication systems relative to solitary insects. Here, we first cloned and characterized OBP11 ( AcerOBP11 ), from the worker bees antennae of Eastern honey bee, Apis cerana . Based on sequence and phylogenetic analysis, most sequences homologous to AcerOBP11 belong to the typical OBPs family. The transcriptional expression profiles showed that AcerOBP11 was expressed throughout the developmental stages and highly specifically expressed in adult antennae. Using immunofluorescence localization, AcerOBP11 in worker bee's antennae was only localized in the sensilla basiconica (SB) near the fringe of each segment. Fluorescence ligand-binding assay showed that AcerOBP11 protein had strong binding affinity with the tested various bee pheromones components, including the main queen mandibular pheromones (QMPs), methyl p-hydroxybenzoate (HOB), and ( E )-9-oxo-2-decanoic acid (9-ODA), alarm pheromone (n-hexanol), and worker pheromone components. AcerOBP11 also had strong binding affinity to plant volatiles, such as 4-Allylveratrole. Based on the docking and site-directed mutagenesis, two key amino acid residues (Ile97 and Ile140) were involved in the binding of AcerOBP11 to various bee pheromones. Taken together, we identified that AcerOBP11 was localized in a single type of antennal chemosensilla and had complex ligand-binding properties, which confer the dual-role with the primary characteristics of sensing various bee pheromones and secondary characteristics of sensing general odorants. This study not only prompts the theoretical basis of OBPs-mediated bee pheromones recognition of honey bee, but also extends the understanding of differences in pheromone communication between social and solitary insects.

  8. Role of Altered Sialylation of the I-Like Domain of β1 Integrin in the Binding of Fibronectin to β1 Integrin: Thermodynamics and Conformational Analyses

    PubMed Central

    Pan, Di; Song, Yuhua

    2010-01-01

    Abstract N-glycosylation of the I-like domain of β1 integrin plays an essential role in integrin structure and function, and the altered sialylation of β1 integrin regulates β1 integrin binding to fibronectin. However, the structural basis underlying the effect of altered sialylation of the β1 I-like domain on β1 integrin binding to fibronectin remains largely unknown. In this study, we used a combination of molecular dynamics simulations and binding free energy analyses to investigate changes in binding thermodynamics and in conformation of the glycosylated β1 I-like domain-FN-III9-10 complex caused by altered sialylation of the β1 I-like domain. Binding free energy analyses showed that desialylation of β1 I-like domain increased β1 integrin binding to fibronectin, consistent with experimental results. Interaction analyses showed that altered sialylation of the β1 I-like domain resulted in significant changes in the interaction of the N-glycans of the I-like domain with both the I-like domain and fibronectin, and these changes could directly affect the allosteric regulation of the interaction between the I-like domain and fibronectin. Altered sialylation of the β1 I-like domain caused significant conformational changes in key functional sites of both the β1 I-like domain and fibronectin. In addition, altered sialylation of the β1 I-like domain resulted in changes in the degree of correlated motions between residues in the I-like domain and residues in fibronectin, and in the degree of motion changes in fibronectin, which could affect β1 integrin binding to fibronectin. We believe results from this study provide thermodynamic and structural evidence for a role of altered sialylation of β1 integrin in regulating β1 integrin binding to fibronectin and it's induced cellular activities. PMID:20655849

  9. The structure of the Myo4p globular tail and its function in ASH1 mRNA localization.

    PubMed

    Heuck, Alexander; Fetka, Ingrid; Brewer, Daniel N; Hüls, Daniela; Munson, Mary; Jansen, Ralf-Peter; Niessing, Dierk

    2010-05-03

    Type V myosin (MyoV)-dependent transport of cargo is an essential process in eukaryotes. Studies on yeast and vertebrate MyoV showed that their globular tails mediate binding to the cargo complexes. In Saccharomyces cerevisiae, the MyoV motor Myo4p interacts with She3p to localize asymmetric synthesis of HO 1 (ASH1) mRNA into the bud of dividing cells. A recent study showed that localization of GFP-MS2-tethered ASH1 particles does not require the Myo4p globular tail, challenging the supposed role of this domain. We assessed ASH1 mRNA and Myo4p distribution more directly and found that their localization is impaired in cells expressing globular tail-lacking Myo4p. In vitro studies further show that the globular tail together with a more N-terminal linker region is required for efficient She3p binding. We also determined the x-ray structure of the Myo4p globular tail and identify a conserved surface patch important for She3p binding. The structure shows pronounced similarities to membrane-tethering complexes and indicates that Myo4p may not undergo auto-inhibition of its motor domain.

  10. Biological role and structural mechanism of twinfilin–capping protein interaction

    PubMed Central

    Falck, Sandra; Paavilainen, Ville O; Wear, Martin A; Grossmann, J Günter; Cooper, John A; Lappalainen, Pekka

    2004-01-01

    Twinfilin and capping protein (CP) are highly conserved actin-binding proteins that regulate cytoskeletal dynamics in organisms from yeast to mammals. Twinfilin binds actin monomer, while CP binds the barbed end of the actin filament. Remarkably, twinfilin and CP also bind directly to each other, but the mechanism and role of this interaction in actin dynamics are not defined. Here, we found that the binding of twinfilin to CP does not affect the binding of either protein to actin. Furthermore, site-directed mutagenesis studies revealed that the CP-binding site resides in the conserved C-terminal tail region of twinfilin. The solution structure of the twinfilin–CP complex supports these conclusions. In vivo, twinfilin's binding to both CP and actin monomer was found to be necessary for twinfilin's role in actin assembly dynamics, based on genetic studies with mutants that have defined biochemical functions. Our results support a novel model for how sequential interactions between actin monomers, twinfilin, CP, and actin filaments promote cytoskeletal dynamics. PMID:15282541

  11. Promoter Engineering Reveals the Importance of Heptameric Direct Repeats for DNA Binding by Streptomyces Antibiotic Regulatory Protein-Large ATP-Binding Regulator of the LuxR Family (SARP-LAL) Regulators in Streptomyces natalensis.

    PubMed

    Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F

    2018-05-15

    The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is controlled by the Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator PimR, which binds a series of heptameric direct repeats in its promoter region. The structure and importance of such repeats in protein binding, transcriptional activation, and polyene production have been investigated. These findings should provide important clues to understand the regulatory machinery that modulates antibiotic biosynthesis in Streptomyces and open new possibilities for the manipulation of metabolite production. The presence of PimR orthologues encoded by gene clusters for different secondary metabolites and the conservation of their operators suggest that the improvements observed in the activation of pimaricin biosynthesis by Streptomyces natalensis could be extrapolated to the production of different compounds by other species. Copyright © 2018 Barreales et al.

  12. Yeast hexokinase: substrate-induced association--dissociation reactions in the binding of glucose to hexokinase P-II.

    PubMed

    Hoggett, J G; Kellett, G L

    1976-06-15

    A method is described for the purification of native hexokinases P-I and P-II from yeast using preparative isoelectric focussing to separate the isozymes. The binding of glucose to hexokinase P-II, and the effect of this on the monomer--dimer association--dissociation reaction have been investigated quantitatively by a combination of titrations of intrinsic protein fluorescence and equilibrium ultracentrifugation. Association constants for the monomer-dimer reaction decreased with increasing pH, ionic strength and concentration of glucose. Saturating concentrations of glucose did not bring about complete dissociation of the enzyme showing that both sites were occupired in the dimer. At pH 8.0 and high ionic strength, where the enzyme existed as monomer, the dissociation constant of the enzyme-glucose complex was 3 X 10(-4) mol 1(-1) and was independent of the concentration of enzyme. Binding to the dimeric form at low pH and ionic strength (I=0.02 mol 1(-1), pH less than 7.5) was also independent of enzyme concentration (in the range 10-1000 mug ml-1) but was much weaker. The process could be described by a single dissociation constant, showing that the two available sites on the dimer were equivalent and non-cooperative; values of the intrinsic dissociation constant varied from 2.5 X 10(-3) mol 1(-1) at pH 7.0 to 6 X 10(-3) at pH 6.5. Under intermediate conditions (pH 7.0, ionic strength=0.15 mol 1(-1)), where monomer and dimer coexisted, the binding of glucose showed weak positive cooperatively (Hill coefficient 1.2); in addition, the binding was dependent upon the concentration of enzyme in the direction of stronger binding at lower concentrations. The results show that the phenomenon of half-sites reactivity observed in the binding of glucose to crystalline hexokinase P-II does not occur in solution; the simplest explanation of our finding the two sites to be equivalent is that the dimer results from the homologous association of two identical subunits.

  13. Identification and Functional Characterization of a Novel Acetylcholine-binding Protein from the Marine Annelid Capitella teleta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCormack, T.; Petrovich,; Mercier, K

    2010-01-01

    We identified a homologue of the molluscan acetylcholine-binding protein (AChBP) in the marine polychaete Capitella teleta, from the annelid phylum. The amino acid sequence of C. teleta AChBP (ct-AChBP) is 21-30% identical with those of known molluscan AChBPs. Sequence alignments indicate that ct-AChBP has a shortened Cys loop compared to other Cys loop receptors, and a variation on a conserved Cys loop triad, which is associated with ligand binding in other AChBPs and nicotinic ACh receptor (nAChR) {alpha} subunits. Within the D loop of ct-AChBP, a conserved aromatic residue (Tyr or Trp) in nAChRs and molluscan AChBPs, which has beenmore » implicated directly in ligand binding, is substituted with an isoleucine. Mass spectrometry results indicate that Asn122 and Asn216 of ct-AChBP are glycosylated when expressed using HEK293 cells. Small-angle X-ray scattering data suggest that the overall shape of ct-AChBP in the apo or unliganded state is similar to that of homologues with known pentameric crystal structures. NMR experiments show that acetylcholine, nicotine, and {alpha}-bungarotoxin bind to ct-AChBP with high affinity, with KD values of 28.7 {micro}M, 209 nM, and 110 nM, respectively. Choline bound with a lower affinity (K{sub D} = 163 {micro}M). Our finding of a functional AChBP in a marine annelid demonstrates that AChBPs may exhibit variations in hallmark motifs such as ligand-binding residues and Cys loop length and shows conclusively that this neurotransmitter binding protein is not limited to the phylum Mollusca.« less

  14. Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site

    PubMed Central

    Song, Lingyun; Caguiat, Jonathan; Li, Zhongrui; Shokes, Jacob; Scott, Robert A.; Olliff, Lynda; Summers, Anne O.

    2004-01-01

    The repressor-activator MerR that controls transcription of the mercury resistance (mer) operon is unusual for its high sensitivity and specificity for Hg(II) in in vivo and in vitro transcriptional assays. The metal-recognition domain of MerR resides at the homodimer interface in a novel antiparallel arrangement of α-helix 5 that forms a coiled-coil motif. To facilitate the study of this novel metal binding motif, we assembled this antiparallel coiled coil into a single chain by directly fusing two copies of the 48-residue α-helix 5 of MerR. The resulting 107-residue polypeptide, called the metal binding domain (MBD), and wild-type MerR were overproduced and purified, and their metal-binding properties were determined in vivo and in vitro. In vitro MBD bound ca. 1.0 equivalent of Hg(II) per pair of binding sites, just as MerR does, and it showed only a slightly lower affinity for Hg(II) than did MerR. Extended X-ray absorption fine structure data showed that MBD has essentially the same Hg(II) coordination environment as MerR. In vivo, cells overexpressing MBD accumulated 70 to 100% more 203Hg(II) than cells bearing the vector alone, without deleterious effects on cell growth. Both MerR and MBD variously bound other thiophilic metal ions, including Cd(II), Zn(II), Pb(II), and As(III), in vitro and in vivo. We conclude that (i) it is possible to simulate in a single polypeptide chain the in vitro and in vivo metal-binding ability of dimeric, full-length MerR and (ii) MerR's specificity in transcriptional activation does not reside solely in the metal-binding step. PMID:14996817

  15. Natural product (-)-gossypol inhibits colon cancer cell growth by targeting RNA-binding protein Musashi-1.

    PubMed

    Lan, Lan; Appelman, Carl; Smith, Amber R; Yu, Jia; Larsen, Sarah; Marquez, Rebecca T; Liu, Hao; Wu, Xiaoqing; Gao, Philip; Roy, Anuradha; Anbanandam, Asokan; Gowthaman, Ragul; Karanicolas, John; De Guzman, Roberto N; Rogers, Steven; Aubé, Jeffrey; Ji, Min; Cohen, Robert S; Neufeld, Kristi L; Xu, Liang

    2015-08-01

    Musashi-1 (MSI1) is an RNA-binding protein that acts as a translation activator or repressor of target mRNAs. The best-characterized MSI1 target is Numb mRNA, whose encoded protein negatively regulates Notch signaling. Additional MSI1 targets include the mRNAs for the tumor suppressor protein APC that regulates Wnt signaling and the cyclin-dependent kinase inhibitor P21(WAF-1). We hypothesized that increased expression of NUMB, P21 and APC, through inhibition of MSI1 RNA-binding activity might be an effective way to simultaneously downregulate Wnt and Notch signaling, thus blocking the growth of a broad range of cancer cells. We used a fluorescence polarization assay to screen for small molecules that disrupt the binding of MSI1 to its consensus RNA binding site. One of the top hits was (-)-gossypol (Ki = 476 ± 273 nM), a natural product from cottonseed, known to have potent anti-tumor activity and which has recently completed Phase IIb clinical trials for prostate cancer. Surface plasmon resonance and nuclear magnetic resonance studies demonstrate a direct interaction of (-)-gossypol with the RNA binding pocket of MSI1. We further showed that (-)-gossypol reduces Notch/Wnt signaling in several colon cancer cell lines having high levels of MSI1, with reduced SURVIVIN expression and increased apoptosis/autophagy. Finally, we showed that orally administered (-)-gossypol inhibits colon cancer growth in a mouse xenograft model. Our study identifies (-)-gossypol as a potential small molecule inhibitor of MSI1-RNA interaction, and suggests that inhibition of MSI1's RNA binding activity may be an effective anti-cancer strategy. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  16. Binding of an antibody mimetic of the human low density lipoprotein receptor to apolipoprotein E is governed through electrostatic forces. Studies using site-directed mutagenesis and molecular modeling.

    PubMed

    Raffaï, R; Weisgraber, K H; MacKenzie, R; Rupp, B; Rassart, E; Hirama, T; Innerarity, T L; Milne, R

    2000-03-10

    Monoclonal antibody 2E8 is specific for an epitope that coincides with the binding site of the low density lipoprotein receptor (LDLR) on human apoE. Its reactivity with apoE variants resembles that of the LDLR: it binds well with apoE3 and poorly with apoE2. The heavy chain complementarity-determining region (CDRH) 2 of 2E8 shows homology to the ligand-binding domain of the LDLR. To define better the structural basis of the 2E8/apoE interaction and particularly the role of electrostatic interactions, we generated and characterized a panel of 2E8 variants. Replacement of acidic residues in the 2E8 CDRHs showed that Asp(52), Glu(53), and Asp(56) are essential for high-affinity binding. Although Asp(31) (CDRH1), Glu(58) (CDRH2), and Asp(97) (CDRH3) did not appear to be critical, the Asp(97) --> Ala variant acquired reactivity with apoE2. A Thr(57) --> Glu substitution increased affinity for both apoE3 and apoE2. The affinities of wild-type 2E8 and variants for apoE varied inversely with ionic strength, suggesting that electrostatic forces contribute to both antigen binding and isoform specificity. We propose a model of the 2E8.apoE immune complex that is based on the 2E8 and apoE crystal structures and that is consistent with the apoE-binding properties of wild-type 2E8 and its variants. Given the similarity between the LDLR and 2E8 in terms of specificity, the LDLR/ligand interaction may also have an important electrostatic component.

  17. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

    PubMed

    Lenzmeier, B A; Giebler, H A; Nyborg, J K

    1998-02-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

  18. Cationic Peptides and Peptidomimetics Bind Glycosaminoglycans as Potential Sema3A Pathway Inhibitors

    PubMed Central

    Corredor, Miriam; Bonet, Roman; Moure, Alejandra; Domingo, Cecilia; Bujons, Jordi; Alfonso, Ignacio; Pérez, Yolanda; Messeguer, Àngel

    2016-01-01

    Semaphorin3A (Sema3A) is a vertebrate-secreted protein that was initially characterized as a repulsive-guidance cue. Semaphorins have crucial roles in several diseases; therefore, the development of Sema3A inhibitors is of therapeutic interest. Sema3A interacts with glycosaminoglycans (GAGs), presumably through its C-terminal basic region. We used different biophysical techniques (i.e., NMR, surface plasmon resonance, isothermal titration calorimetry, fluorescence, and UV-visible spectroscopy) to characterize the binding of two Sema3A C-terminus-derived basic peptides (FS2 and NFS3) to heparin and chondroitin sulfate A. We found that these peptides bind to both GAGs with affinities in the low-micromolar range. On the other hand, a peptoid named SICHI (semaphorin-induced chemorepulsion inhibitor), which is positively charged at physiological pH, was first identified by our group as being able to block Sema3A chemorepulsion and growth-cone collapse in axons at the extracellular level. To elucidate the direct target for the reported SICHI inhibitory effect in the Sema3A signaling pathway, we looked first to the protein-protein interaction between secreted Sema3A and the Nrp1 receptor. However, our results show that SICHI does not bind directly to the Sema3A sema domain or to Nrp1 extracellular domains. We evaluated a new, to our knowledge, hypothesis, according to which SICHI binds to GAGs, thereby perturbing the Sema3A-GAG interaction. By using the above-mentioned techniques, we observed that SICHI binds to GAGs and competes with Sema3A C-terminus-derived basic peptides for binding to GAGs. These data support the ability of SICHI to block the biologically relevant interaction between Sema3A and GAGs, thus revealing SICHI as a new, to our knowledge, class of inhibitors that target the GAG-protein interaction. PMID:27028639

  19. Effects of ligand binding on the dynamics of rice nonspecific lipid transfer protein 1: a model from molecular simulations.

    PubMed

    Lai, Yen-Ting; Cheng, Chao-Sheng; Liu, Yu-Nan; Liu, Yaw-Jen; Lyu, Ping-Chiang

    2008-09-01

    Plant nonspecific lipid transfer proteins (nsLTPs) are small, basic proteins constituted mainly of alpha-helices and stabilized by four conserved disulfide bridges. They are characterized by the presence of a tunnel-like hydrophobic cavity, capable of transferring various lipid molecules between lipid bilayers in vitro. In this study, molecular dynamics (MD) simulations were performed at room temperature to investigate the effects of lipid binding on the dynamic properties of rice nsLTP1. Rice nsLTP1, either in the free form or complexed with one or two lipids was subjected to MD simulations. The C-terminal loop was very flexible both before and after lipid binding, as revealed by calculating the root-mean-square fluctuation. After lipid binding, the flexibility of some residues that were not in direct contact with lipid molecules increased significantly, indicating an increase of entropy in the region distal from the binding site. Essential dynamics analysis revealed clear differences in motion between unliganded and liganded rice nsLTP1s. In the free form of rice nsLTP1, loop1 exhibited the largest directional motion. This specific essential motion mode diminished after binding one or two lipid molecules. To verify the origin of the essential motion observed in the free form of rice nsLTP1, we performed multiple sequence alignments to probe the intrinsic motion encoded in the primary sequence. We found that the amino acid sequence of loop1 is highly conserved among plant nsLTP1s, thus revealing its functional importance during evolution. Furthermore, the sequence of loop1 is composed mainly of amino acids with short side chains. In this study, we show that MD simulations, together with essential dynamics analysis, can be used to determine structural and dynamic differences of rice nsLTP1 upon lipid binding. 2008 Wiley-Liss, Inc.

  20. Maximizing in vivo target clearance by design of pH-dependent target binding antibodies with altered affinity to FcRn.

    PubMed

    Yang, Danlin; Giragossian, Craig; Castellano, Steven; Lasaro, Marcio; Xiao, Haiguang; Saraf, Himanshu; Hess Kenny, Cynthia; Rybina, Irina; Huang, Zhong-Fu; Ahlberg, Jennifer; Bigwarfe, Tammy; Myzithras, Maria; Waltz, Erica; Roberts, Simon; Kroe-Barrett, Rachel; Singh, Sanjaya

    2017-10-01

    Antibodies with pH-dependent binding to both target antigens and neonatal Fc receptor (FcRn) provide an alternative tool to conventional neutralizing antibodies, particularly for therapies where reduction in antigen level is challenging due to high target burden. However, the requirements for optimal binding kinetic framework and extent of pH dependence for these antibodies to maximize target clearance from circulation are not well understood. We have identified a series of naturally-occurring high affinity antibodies with pH-dependent target binding properties. By in vivo studies in cynomolgus monkeys, we show that pH-dependent binding to the target alone is not sufficient for effective target removal from circulation, but requires Fc mutations that increase antibody binding to FcRn. Affinity-enhanced pH-dependent FcRn binding that is double-digit nM at pH 7.4 and single-digit nM at pH 6 achieved maximal target reduction when combined with similar target binding affinities in reverse pH directions. Sustained target clearance below the baseline level was achieved 3 weeks after single-dose administration at 1.5 mg/kg. Using the experimentally derived mechanistic model, we demonstrate the essential kinetic interplay between target turnover and antibody pH-dependent binding during the FcRn recycling, and identify the key components for achieving maximal target clearance. These results bridge the demand for improved patient dosing convenience with the "know-how" of therapeutic modality by design.

  1. PRISM offers a comprehensive genomic approach to transcription factor function prediction

    PubMed Central

    Wenger, Aaron M.; Clarke, Shoa L.; Guturu, Harendra; Chen, Jenny; Schaar, Bruce T.; McLean, Cory Y.; Bejerano, Gill

    2013-01-01

    The human genome encodes 1500–2000 different transcription factors (TFs). ChIP-seq is revealing the global binding profiles of a fraction of TFs in a fraction of their biological contexts. These data show that the majority of TFs bind directly next to a large number of context-relevant target genes, that most binding is distal, and that binding is context specific. Because of the effort and cost involved, ChIP-seq is seldom used in search of novel TF function. Such exploration is instead done using expression perturbation and genetic screens. Here we propose a comprehensive computational framework for transcription factor function prediction. We curate 332 high-quality nonredundant TF binding motifs that represent all major DNA binding domains, and improve cross-species conserved binding site prediction to obtain 3.3 million conserved, mostly distal, binding site predictions. We combine these with 2.4 million facts about all human and mouse gene functions, in a novel statistical framework, in search of enrichments of particular motifs next to groups of target genes of particular functions. Rigorous parameter tuning and a harsh null are used to minimize false positives. Our novel PRISM (predicting regulatory information from single motifs) approach obtains 2543 TF function predictions in a large variety of contexts, at a false discovery rate of 16%. The predictions are highly enriched for validated TF roles, and 45 of 67 (67%) tested binding site regions in five different contexts act as enhancers in functionally matched cells. PMID:23382538

  2. Substrate Binding Drives Active-Site Closing of Human Blood Group B Galactosyltransferase as Revealed by Hot-Spot Labeling and NMR Spectroscopy Experiments.

    PubMed

    Weissbach, Sophie; Flügge, Friedemann; Peters, Thomas

    2018-05-04

    Crystallography has shown that human blood group A (GTA) and B (GTB) glycosyltransferases undergo transitions between "open", "semiclosed", and "closed" conformations upon substrate binding. However, the timescales of the corresponding conformational reorientations are unknown. Crystal structures show that the Trp and Met residues are located at "conformational hot spots" of the enzymes. Therefore, we utilized 15 N side-chain labeling of Trp residues and 13 C-methyl labeling of Met residues to study substrate-induced conformational transitions of GTB. Chemical-shift perturbations (CSPs) of Met and Trp residues in direct contact with substrate ligands reflect binding kinetics, whereas the CSPs of Met and Trp residues at remote sites reflect conformational changes of the enzyme upon substrate binding. Acceptor binding is fast on the chemical-shift timescale with rather small CSPs in the range of less than approximately 20 Hz. Donor binding matches the intermediate exchange regime to yield an estimate for exchange rate constants of approximately 200-300 Hz. Donor or acceptor binding to GTB saturated with acceptor or donor substrate, respectively, is slow (<10 Hz), as are coupled protein motions, reflecting mutual allosteric control of donor and acceptor binding. Remote CSPs suggest that substrate binding drives the enzyme into the closed state required for catalysis. These findings should contribute to better understanding of the mechanism of glycosyl transfer of GTA and GTB. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Enhanced toxicity of Bacillus thuringiensis Cry3A 8-endotoxin in coleopterans by mutagenesis in recetor binding loop

    Treesearch

    Sheng-Jiun Wu; Noah C. Koller; Deborah L. Miller; Leah S. Bauer; Donald H. Dean

    2000-01-01

    We used site-directed mutagenesis to modify the Bacillus cry3A gene in amino acid residues 350-354. Two mutant toxins, A1 (R345A, Y350F, Y351F) and A2 (R345A,DeltaY350, DeltaY351, showed significantly improved...

  4. Identification of the Doublesex protein binding sites that activate expression of lozenge in the female genital disc in Drosophila melanogaster.

    PubMed

    Wagamitsu, Shunsuke; Takase, Dan; Aoki, Fugaku; Suzuki, Masataka G

    2017-02-01

    Normal sexual differentiation in the genital organs is essential for the animal species that use sexual reproduction. Although it is known that doublesex (dsx) is required for the sexual development of the genitalia in various insect species, the direct target genes responsible for the sexual differentiation of the genitalia have not been identified. The lozenge (lz) gene is expressed in the female genital disc and is essential for developments of spermathecae and accessory glands in Drosophila melanogaster. The female-specific isoform of DSX (DSXF) is required for activating lz expression in the female genital disc. However, it still remains unclear whether the DSXF directly activates the transcription of lz in the female genital disc. In this study, we found two sequences (lz-DBS1 and lz-DBS2) within lz locus that showed high homoloty to the DSX binding motif identified previously. Competition assays using recombinant DSX DNA-binding domain (DSX-DBD) protein verified that the DSX-DBD protein bound to lz-DBS1 and lz-DBS2 in a sequence-specific manner with lower affinity than to the known DSX binding site in the bric-à-brac 1 (bab1) gene. Reporter gene analyses revealed that a 2.5-kbp lz genomic fragment containing lz-DBS1 and lz-DBS2 drove reporter gene (EGFP) expression in a manner similar to endogenous lz expression in the female genital disc. Mutations in lz-DBS1 alone significantly reduced the area of EGFP-expressing region, while EGFP expression in the female genital disc was abolished when both sites were mutated. These results demonstrated that DSX directly activates female-specific lz expression in the genital disc through lz-DBS1 and lz-DBS2. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Structural Basis for Certain Naturally Occurring Bioflavonoids to Function as Reducing Co-Substrates of Cyclooxygenase I and II

    PubMed Central

    Zhu, Bao Ting

    2010-01-01

    Background Recent studies showed that some of the dietary bioflavonoids can strongly stimulate the catalytic activity of cyclooxygenase (COX) I and II in vitro and in vivo, presumably by facilitating enzyme re-activation. In this study, we sought to understand the structural basis of COX activation by these dietary compounds. Methodology/Principal Findings A combination of molecular modeling studies, biochemical analysis and site-directed mutagenesis assay was used as research tools. Three-dimensional quantitative structure-activity relationship analysis (QSAR/CoMFA) predicted that the ability of bioflavonoids to activate COX I and II depends heavily on their B-ring structure, a moiety known to be associated with strong antioxidant ability. Using the homology modeling and docking approaches, we identified the peroxidase active site of COX I and II as the binding site for bioflavonoids. Upon binding to this site, bioflavonoid can directly interact with hematin of the COX enzyme and facilitate the electron transfer from bioflavonoid to hematin. The docking results were verified by biochemical analysis, which reveals that when the cyclooxygenase activity of COXs is inhibited by covalent modification, myricetin can still stimulate the conversion of PGG2 to PGE2, a reaction selectively catalyzed by the peroxidase activity. Using the site-directed mutagenesis analysis, we confirmed that Q189 at the peroxidase site of COX II is essential for bioflavonoids to bind and re-activate its catalytic activity. Conclusions/Significance These findings provide the structural basis for bioflavonoids to function as high-affinity reducing co-substrates of COXs through binding to the peroxidase active site, facilitating electron transfer and enzyme re-activation. PMID:20808785

  6. Direct interplay between two candidate genes in FSHD muscular dystrophy

    PubMed Central

    Ferri, Giulia; Huichalaf, Claudia H.; Caccia, Roberta; Gabellini, Davide

    2015-01-01

    Facioscapulohumeral muscular dystrophy (FSHD) is one of the most common neuromuscular disorders. The major form of the disease (FSHD1) is linked to decrease in copy number of a 3.3-kb tandem repeated macrosatellite (D4Z4), located on chromosome 4q35. D4Z4 deletion alters chromatin structure of the locus leading to aberrant expression of nearby 4q35 genes. Given the high variability in disease onset and progression, multiple factors could contribute to the pathogenesis of FSHD. Among the FSHD candidate genes are double homeobox 4 (DUX4), encoded by the most telomeric D4Z4 unit, and FSHD region gene 1 (FRG1). DUX4 is a sequence-specific transcription factor. Here, we located putative DUX4 binding sites in the human FRG1 genomic area and we show specific DUX4 association to these regions. We found also that ectopically expressed DUX4 up-regulates the endogenous human FRG1 gene in healthy muscle cells, while DUX4 knockdown leads to a decrease in FRG1 expression in FSHD muscle cells. Moreover, DUX4 binds directly and specifically to its binding site located in the human FRG1 gene and transactivates constructs containing FRG1 genomic regions. Intriguingly, the mouse Frg1 genomic area lacks DUX4 binding sites and DUX4 is unable to activate the endogenous mouse Frg1 gene providing a possible explanation for the lack of muscle phenotype in DUX4 transgenic mice. Altogether, our results demonstrate that FRG1 is a direct DUX4 transcriptional target uncovering a novel regulatory circuit contributing to FSHD. PMID:25326393

  7. Direct multiplex imaging and optogenetics of Rho GTPases enabled by near-infrared FRET.

    PubMed

    Shcherbakova, Daria M; Cox Cammer, Natasha; Huisman, Tsipora M; Verkhusha, Vladislav V; Hodgson, Louis

    2018-06-01

    Direct visualization and light control of several cellular processes is a challenge, owing to the spectral overlap of available genetically encoded probes. Here we report the most red-shifted monomeric near-infrared (NIR) fluorescent protein, miRFP720, and the fully NIR Förster resonance energy transfer (FRET) pair miRFP670-miRFP720, which together enabled design of biosensors compatible with CFP-YFP imaging and blue-green optogenetic tools. We developed a NIR biosensor for Rac1 GTPase and demonstrated its use in multiplexed imaging and light control of Rho GTPase signaling pathways. Specifically, we combined the Rac1 biosensor with CFP-YFP FRET biosensors for RhoA and for Rac1-GDI binding, and concurrently used the LOV-TRAP tool for upstream Rac1 activation. We directly observed and quantified antagonism between RhoA and Rac1 dependent on the RhoA-downstream effector ROCK; showed that Rac1 activity and GDI binding closely depend on the spatiotemporal coordination between these two molecules; and simultaneously observed Rac1 activity during optogenetic manipulation of Rac1.

  8. PHD Domain-Mediated E3 Ligase Activity Directs Intramolecular Sumoylation of an Adjacent Bromodomain which is Required for Gene Silencing

    PubMed Central

    Ivanov, Alexey V.; Peng, Hongzhuang; Yurchenko, Vyacheslav; Yap, Kyoko L.; Negorev, Dmitri G.; Schultz, David C.; Psulkowski, Elyse; Fredericks, William J.; White, David E.; Maul, Gerd G.; Sadofsky, Moshe J.; Zhou, Ming-Ming; Rauscher, Frank J.

    2015-01-01

    SUMMARY Tandem PHD and bromodomains are often found in chromatin-associated proteins and have been shown to cooperate in gene silencing. Each domain can bind specifically modified histones: the mechanisms of cooperation between these domains are unknown. We show that the PHD domain of the KAP1 corepressor functions as an intramolecular E3 ligase for sumoylation of the adjacent bromodomain. The RING finger-like structure of the PHD domain is required for both Ubc9 binding and sumoylation and directs modification to specific lysine residues in the bromodomain. Sumoylation is required for KAP1-mediated gene silencing and functions by directly recruiting the SETDB1 histone methyltransferase and the CHD3/Mi2 component of the NuRD complex via SUMO interacting motifs. Sumoylated KAP1 stimulates the histone methyltransferase activity of SETDB1. These data provide a mechanistic explanation for the cooperation of PHD and bromodomains in gene regulation and describe a new function of the PHD domain as an intramolecular E3 SUMO ligase. PMID:18082607

  9. Progranulin Directly Binds to the CRD 2 and CRD3 of TNFR Extracellular Domains

    PubMed Central

    Jian, Jinlong; Zhao, Shuai; Tian, Qingyun; Gonzalez-Gugel, Elena; Mundra, Jyoti Joshi; Uddin, Sardar MZ; Liu, Ben; Richbourgh, Brendon; Brunetti, Ryan; Liu, Chuan-ju

    2013-01-01

    We previously reported that PGRN directly bound to TNF receptors (TNFR) in vitro and in chondrocytes (Tang, et al, Science, 2011). Here we report that PGRN also associated with TNFR in splenocytes, and inhibited the binding of TNFα to immune cells. Proper folding of PGRN is essential for its binding to TNFR, as DTT treatment abolished its binding to TNFR. In contrast, the binding of PGRN to Sortilin was enhanced by DTT. Protein interaction assays with mutants of the TNFR extracellular domain demonstrated that CRD2 and CRD3 of TNFR are important for the interaction with PGRN, similar to the binding to TNFα. Taken together, these findings provide the molecular basis underlying PGRN/TNFR interaction and PGRN-mediated anti-inflammatory activity in various autoimmune diseases and conditions. PMID:24070898

  10. Nucleotide-dependent assembly of the peroxisomal receptor export complex

    PubMed Central

    Grimm, Immanuel; Saffian, Delia; Girzalsky, Wolfgang; Erdmann, Ralf

    2016-01-01

    Pex1p and Pex6p are two AAA-ATPases required for biogenesis of peroxisomes. Both proteins form a hetero-hexameric complex in an ATP-dependent manner, which has a dual localization in the cytosol and at the peroxisomal membrane. At the peroxisomal membrane, the complex is responsible for the release of the import receptor Pex5p at the end of the matrix protein import cycle. In this study, we analyzed the recruitment of the AAA-complex to its anchor protein Pex15p at the peroxisomal membrane. We show that the AAA-complex is properly assembled even under ADP-conditions and is able to bind efficiently to Pex15p in vivo. We reconstituted binding of the Pex1/6p-complex to Pex15p in vitro and show that Pex6p mediates binding to the cytosolic part of Pex15p via a direct interaction. Analysis of the isolated complex revealed a stoichiometry of Pex1p/Pex6p/Pex15p of 3:3:3, indicating that each Pex6p molecule of the AAA-complex binds Pex15p. Binding of the AAA-complex to Pex15p in particular and to the import machinery in general is stabilized when ATP is bound to the second AAA-domain of Pex6p and its hydrolysis is prevented. The data indicate that receptor release in peroxisomal protein import is associated with a nucleotide-depending Pex1/6p-cycle of Pex15p-binding and release. PMID:26842748

  11. Structural dynamics and energetics underlying allosteric inactivation of the cannabinoid receptor CB1

    PubMed Central

    Fay, Jonathan F.; Farrens, David L.

    2015-01-01

    G protein-coupled receptors (GPCRs) are surprisingly flexible molecules that can do much more than simply turn on G proteins. Some even exhibit biased signaling, wherein the same receptor preferentially activates different G-protein or arrestin signaling pathways depending on the type of ligand bound. Why this behavior occurs is still unclear, but it can happen with both traditional ligands and ligands that bind allosterically outside the orthosteric receptor binding pocket. Here, we looked for structural mechanisms underlying these phenomena in the marijuana receptor CB1. Our work focused on the allosteric ligand Org 27569, which has an unusual effect on CB1—it simultaneously increases agonist binding, decreases G-protein activation, and induces biased signaling. Using classical pharmacological binding studies, we find that Org 27569 binds to a unique allosteric site on CB1 and show that it can act alone (without need for agonist cobinding). Through mutagenesis studies, we find that the ability of Org 27569 to bind is related to how much receptor is in an active conformation that can couple with G protein. Using these data, we estimated the energy differences between the inactive and active states. Finally, site-directed fluorescence labeling studies show the CB1 structure stabilized by Org 27569 is different and unique from that stabilized by antagonist or agonist. Specifically, transmembrane helix 6 (TM6) movements associated with G-protein activation are blocked, but at the same time, helix 8/TM7 movements are enhanced, suggesting a possible mechanism for the ability of Org 27569 to induce biased signaling. PMID:26100912

  12. Selective Inhibition of Mutant Isocitrate Dehydrogenase 1 (IDH1) via Disruption of a Metal Binding Network by an Allosteric Small Molecule

    PubMed Central

    Deng, Gejing; Shen, Junqing; Yin, Ming; McManus, Jessica; Mathieu, Magali; Gee, Patricia; He, Timothy; Shi, Chaomei; Bedel, Olivier; McLean, Larry R.; Le-Strat, Frank; Zhang, Ying; Marquette, Jean-Pierre; Gao, Qiang; Zhang, Bailin; Rak, Alexey; Hoffmann, Dietmar; Rooney, Eamonn; Vassort, Aurelie; Englaro, Walter; Li, Yi; Patel, Vinod; Adrian, Francisco; Gross, Stefan; Wiederschain, Dmitri; Cheng, Hong; Licht, Stuart

    2015-01-01

    Cancer-associated point mutations in isocitrate dehydrogenase 1 and 2 (IDH1 and IDH2) confer a neomorphic enzymatic activity: the reduction of α-ketoglutarate to d-2-hydroxyglutaric acid, which is proposed to act as an oncogenic metabolite by inducing hypermethylation of histones and DNA. Although selective inhibitors of mutant IDH1 and IDH2 have been identified and are currently under investigation as potential cancer therapeutics, the mechanistic basis for their selectivity is not yet well understood. A high throughput screen for selective inhibitors of IDH1 bearing the oncogenic mutation R132H identified compound 1, a bis-imidazole phenol that inhibits d-2-hydroxyglutaric acid production in cells. We investigated the mode of inhibition of compound 1 and a previously published IDH1 mutant inhibitor with a different chemical scaffold. Steady-state kinetics and biophysical studies show that both of these compounds selectively inhibit mutant IDH1 by binding to an allosteric site and that inhibition is competitive with respect to Mg2+. A crystal structure of compound 1 complexed with R132H IDH1 indicates that the inhibitor binds at the dimer interface and makes direct contact with a residue involved in binding of the catalytically essential divalent cation. These results show that targeting a divalent cation binding residue can enable selective inhibition of mutant IDH1 and suggest that differences in magnesium binding between wild-type and mutant enzymes may contribute to the inhibitors' selectivity for the mutant enzyme. PMID:25391653

  13. Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

    PubMed Central

    Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.

    2015-01-01

    Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

  14. Measuring Positive Cooperativity Using the Direct ESI-MS Assay. Cholera Toxin B Subunit Homopentamer Binding to GM1 Pentasaccharide

    NASA Astrophysics Data System (ADS)

    Lin, Hong; Kitova, Elena N.; Klassen, John S.

    2014-01-01

    Direct electrospray ionization mass spectrometry (ESI-MS) assay was used to investigate the stepwise binding of the GM1 pentasaccharide β- D-Gal p-(1→3)-β-D-Gal pNAc-(1→4)[α-D-Neu5Ac-(2→3)]-β- D-Gal p-(1→4)-β-D-Glc p (GM1os) to the cholera toxin B subunit homopentamer (CTB5) and to establish conclusively whether GM1os binding is cooperative. Apparent association constants were measured for the stepwise addition of one to five GM1os to CTB5 at pH 6.9 and 22 °C. The intrinsic association constant, which was established from the apparent association constant for the addition of a single GM1os to CTB5, was found to be (3.2 ± 0.2) × 106 M-1. This is in reasonable agreement with the reported value of (6.4 ± 0.3) × 106 M-1, which was measured at pH 7.4 and 25 °C using isothermal titration calorimetry (ITC). Analysis of the apparent association constants provides direct and unambiguous evidence that GM1os binding exhibits small positive cooperativity. Binding was found to be sensitive to the number of ligand-bound nearest neighbor subunits, with the affinities enhanced by a factor of 1.7 and 2.9 when binding occurs next to one or two ligand-bound subunits, respectively. These findings, which provide quantitative support for the binding model proposed by Homans and coworkers [14], highlight the unique strengths of the direct ESI-MS assay for measuring cooperative ligand binding.

  15. Small Molecule Interactome Mapping by Photoaffinity Labeling Reveals Binding Site Hotspots for the NSAIDs.

    PubMed

    Gao, Jinxu; Mfuh, Adelphe; Amako, Yuka; Woo, Christina M

    2018-03-28

    Many therapeutics elicit cell-type specific polypharmacology that is executed by a network of molecular recognition events between a small molecule and the whole proteome. However, measurement of the structures that underpin the molecular associations between the proteome and even common therapeutics, such as the nonsteroidal anti-inflammatory drugs (NSAIDs), is limited by the inability to map the small molecule interactome. To address this gap, we developed a platform termed small molecule interactome mapping by photoaffinity labeling (SIM-PAL) and applied it to the in cellulo direct characterization of specific NSAID binding sites. SIM-PAL uses (1) photochemical conjugation of NSAID derivatives in the whole proteome and (2) enrichment and isotope-recoding of the conjugated peptides for (3) targeted mass spectrometry-based assignment. Using SIM-PAL, we identified the NSAID interactome consisting of over 1000 significantly enriched proteins and directly characterized nearly 200 conjugated peptides representing direct binding sites of the photo-NSAIDs with proteins from Jurkat and K562 cells. The enriched proteins were often identified as parts of complexes, including known targets of NSAID activity (e.g., NF-κB) and novel interactions (e.g., AP-2, proteasome). The conjugated peptides revealed direct NSAID binding sites from the cell surface to the nucleus and a specific binding site hotspot for the three photo-NSAIDs on histones H2A and H2B. NSAID binding stabilized COX-2 and histone H2A by cellular thermal shift assay. Since small molecule stabilization of protein complexes is a gain of function regulatory mechanism, it is conceivable that NSAIDs affect biological processes through these broader proteomic interactions. SIM-PAL enabled characterization of NSAID binding site hotspots and is amenable to map global binding sites for virtually any molecule of interest.

  16. Analysis of the Binding Moiety Mediating the Interaction between Monocarboxylate Transporters and Carbonic Anhydrase II*

    PubMed Central

    Noor, Sina Ibne; Dietz, Steffen; Heidtmann, Hella; Boone, Christopher D.; McKenna, Robert; Deitmer, Joachim W.; Becker, Holger M.

    2015-01-01

    Proton-coupled monocarboxylate transporters (MCTs) mediate the exchange of high energy metabolites like lactate between different cells and tissues. We have reported previously that carbonic anhydrase II augments transport activity of MCT1 and MCT4 by a noncatalytic mechanism, while leaving transport activity of MCT2 unaltered. In the present study, we combined electrophysiological measurements in Xenopus oocytes and pulldown experiments to analyze the direct interaction between carbonic anhydrase II (CAII) and MCT1, MCT2, and MCT4, respectively. Transport activity of MCT2-WT, which lacks a putative CAII-binding site, is not augmented by CAII. However, introduction of a CAII-binding site into the C terminus of MCT2 resulted in CAII-mediated facilitation of MCT2 transport activity. Interestingly, introduction of three glutamic acid residues alone was not sufficient to establish a direct interaction between MCT2 and CAII, but the cluster had to be arranged in a fashion that allowed access to the binding moiety in CAII. We further demonstrate that functional interaction between MCT4 and CAII requires direct binding of the enzyme to the acidic cluster 431EEE in the C terminus of MCT4 in a similar fashion as previously shown for binding of CAII to the cluster 489EEE in the C terminus of MCT1. In CAII, binding to MCT1 and MCT4 is mediated by a histidine residue at position 64. Taken together, our results suggest that facilitation of MCT transport activity by CAII requires direct binding between histidine 64 in CAII and a cluster of glutamic acid residues in the C terminus of the transporter that has to be positioned in surroundings that allow access to CAII. PMID:25561737

  17. Idas, a Novel Phylogenetically Conserved Geminin-related Protein, Binds to Geminin and Is Required for Cell Cycle Progression*

    PubMed Central

    Pefani, Dafni-Eleutheria; Dimaki, Maria; Spella, Magda; Karantzelis, Nickolas; Mitsiki, Eirini; Kyrousi, Christina; Symeonidou, Ioanna-Eleni; Perrakis, Anastassis; Taraviras, Stavros; Lygerou, Zoi

    2011-01-01

    Development and homeostasis of multicellular organisms relies on an intricate balance between cell proliferation and differentiation. Geminin regulates the cell cycle by directly binding and inhibiting the DNA replication licensing factor Cdt1. Geminin also interacts with transcriptional regulators of differentiation and chromatin remodelling factors, and its balanced interactions are implicated in proliferation-differentiation decisions during development. Here, we describe Idas (Idas being a cousin of the Gemini in Ancient Greek Mythology), a previously uncharacterised coiled-coil protein related to Geminin. We show that human Idas localizes to the nucleus, forms a complex with Geminin both in cells and in vitro through coiled-coil mediated interactions, and can change Geminin subcellular localization. Idas does not associate with Cdt1 and prevents Geminin from binding to Cdt1 in vitro. Idas depletion from cells affects cell cycle progression; cells accumulate in S phase and are unable to efficiently progress to mitosis. Idas protein levels decrease in anaphase, whereas its overexpression causes mitotic defects. During development, we show that Idas exhibits high level expression in the choroid plexus and the cortical hem of the mouse telencephalon. Our data highlight Idas as a novel Geminin binding partner, implicated in cell cycle progression, and a putative regulator of proliferation-differentiation decisions during development. PMID:21543332

  18. Idas, a novel phylogenetically conserved geminin-related protein, binds to geminin and is required for cell cycle progression.

    PubMed

    Pefani, Dafni-Eleutheria; Dimaki, Maria; Spella, Magda; Karantzelis, Nickolas; Mitsiki, Eirini; Kyrousi, Christina; Symeonidou, Ioanna-Eleni; Perrakis, Anastassis; Taraviras, Stavros; Lygerou, Zoi

    2011-07-01

    Development and homeostasis of multicellular organisms relies on an intricate balance between cell proliferation and differentiation. Geminin regulates the cell cycle by directly binding and inhibiting the DNA replication licensing factor Cdt1. Geminin also interacts with transcriptional regulators of differentiation and chromatin remodelling factors, and its balanced interactions are implicated in proliferation-differentiation decisions during development. Here, we describe Idas (Idas being a cousin of the Gemini in Ancient Greek Mythology), a previously uncharacterised coiled-coil protein related to Geminin. We show that human Idas localizes to the nucleus, forms a complex with Geminin both in cells and in vitro through coiled-coil mediated interactions, and can change Geminin subcellular localization. Idas does not associate with Cdt1 and prevents Geminin from binding to Cdt1 in vitro. Idas depletion from cells affects cell cycle progression; cells accumulate in S phase and are unable to efficiently progress to mitosis. Idas protein levels decrease in anaphase, whereas its overexpression causes mitotic defects. During development, we show that Idas exhibits high level expression in the choroid plexus and the cortical hem of the mouse telencephalon. Our data highlight Idas as a novel Geminin binding partner, implicated in cell cycle progression, and a putative regulator of proliferation-differentiation decisions during development.

  19. Modulating supramolecular binding of carbon dioxide in a redox-active porous metal-organic framework

    DOE PAGES

    Lu, Zhenzhong; Godfrey, Harry G. W.; da Silva, Ivan; ...

    2017-02-13

    Hydrogen bonds dominate many chemical and biological processes, and chemical modification enables control and modulation of host–guest systems. Here in this paper we report a targeted modification of hydrogen bonding and its effect on guest binding in redox-active materials. MFM-300(V III) {[V III 2(OH) 2(L)], LH 4=biphenyl-3,3',5,5'-tetracarboxylic acid} can be oxidized to isostructural MFM-300(V IV), [V IV 2O 2(L)], in which deprotonation of the bridging hydroxyl groups occurs. MFM-300(V III) shows the second highest CO 2 uptake capacity in metal-organic framework materials at 298 K and 1 bar (6.0 mmol g -1) and involves hydrogen bonding between the OH group of the host and the O-donor of CO 2, which binds in an end-on manner, OH∙∙∙ =1.863(1) Å. In contrast, CO 2-loaded MFM-300(V IV) shows CO 2 bound side-on to the oxy group and sandwiched between two phenyl groups involving a unique O COmore » $$_2$$···c.g.phenyl interaction [3.069(2), 3.146(3) Å]. Lastly, the macroscopic packing of CO 2 in the pores is directly influenced by these primary binding sites.« less

  20. Endo-β-D-1,4-mannanase from Chrysonilia sitophila displays a novel loop arrangement for substrate selectivity.

    PubMed

    Gonçalves, Ana Maria D; Silva, Catarina S; Madeira, Tânia I; Coelho, Ricardo; de Sanctis, Daniele; San Romão, Maria Vitória; Bento, Isabel

    2012-11-01

    The crystal structure of wild-type endo-β-D-1,4-mannanase (EC 3.2.1.78) from the ascomycete Chrysonilia sitophila (CsMan5) has been solved at 1.40 Å resolution. The enzyme isolated directly from the source shows mixed activity as both an endo-glucanase and an endo-mannanase. CsMan5 adopts the (β/α)(8)-barrel fold that is well conserved within the GH5 family and has highest sequence and structural homology to the GH5 endo-mannanases. Superimposition with proteins of this family shows a unique structural arrangement of three surface loops of CsMan5 that stretch over the active centre, promoting an altered topography of the binding cleft. The most relevant feature results from the repositioning of a long loop at the extremity of the binding cleft, resulting in a shortened glycone-binding region with two subsites. The other two extended loops flanking the binding groove produce a narrower cleft compared with the wide architecture observed in GH5 homologues. Two aglycone subsites (+1 and +2) are identified and a nonconserved tryptophan (Trp271) at the +1 subsite may offer steric hindrance. Taken together, these findings suggest that the discrimination of mannan substrates is achieved through modified loop length and structure.

Top